Sunteți pe pagina 1din 3

Tez simestrial la biologie n clasa a X-a (profil real)

Sesiunea de iarn 2011


1.Definii noiunile:
Reproducere____________________________________________________________________________
______________________________________________________________________________________.
Eucariot_______________________________________________________________________________
______________________________________________________________________________________.
Nucleol________________________________________________________________________________
_____________________________________________________________________________________.
Ontogenez_____________________________________________________________________________
____________________________________________________________________________________4 p.
2. Numii tipurile de organite celulare reprezentate n imagini i scrie cte o funcie corespunztoare
fiecrui tip de organit celular numit.
Organitele
celulare

Denumirea
Funcii
4p.
3. Elaborai o schem n care s indicai grupele principale de organite ale celulei eucariote,
prezentnd cte dou exemple

10p.

4. Completai schema structurii nucleotidului de ARN:


a)________________
1.________________
2.________________
3.________________
4.________________

c)_____________

b)
1.____________

9 p.
5.Completai legenda enumernd 5 organite celulare: 5p.

6.Scriei n faa literelor din coloana A cifrele corespunztoare din coloana B:


Coloana A conine tipuri de acizi nucleici, iar coloana B-constituenii posibili a unui nucleotid..
A
B
________a)ADN
1.adenina
5.timina
________b)ARN
2.guanina
6.restul fosforic
3.citozina
7.riboza
4.uracilul
8.dezoxiriboza
12 p.
7.Numii tipurile de reproducere la
Hidr______________________________
Parameciul__________________________
Mamifere __________________________
Plante_____________________________
8 p.
8. Alctuii structura linear la a doua caten de ADN, dac I caten are urmtoarea consecutivitate
de nucleotide:
AAACAGAAGTAAGACAACATCTTT
________________________________________________________
8 p.
9. Completeaz tabelul cu cu cel puin trei deosebiri
Metabolismul plastic
Criterii

Metabolismul energetic

9 p.
10. Incercuiete cuvintele, care nu se incadreaz n grupul tematic i explic de ce le-ai selectat
Nucleu
Plastide
Proteine
Ribozomi
Perete celular
Lipide
Plastide
Centrul celular
Sruri minerale
Mitocondrii_
Vacuom
Glucide
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
____________________________________________________________________________________9 p.
11. Analizeaz imaginea

a) ncercuiete cifra care indic membrana celular


b) Explic ntr-un text, n baza structurii membranei celulare, funciile acesteia
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
________________________________________________________________________________10 p.