Sunteți pe pagina 1din 1495

BIOLOGA MOLECULAR DE

LA CLULA
TERCERA EDICION

Bruce Alberts Dennis Bray Julian Lewis Martin Raff Keith Roberts James D. Watson
Traducido por

Merc Durfort i Coll


Catedrtica de Biologa Celular Animal y Vegetal de la Facultad de Biologa de la Universidad de Barcelona

Miquel Llobera i Sande


Catedrtico de Bioqumica y Biologa Molecular de la Facultad de Biologa de la Universidad de Barcelona

EDICIONES OMEGA

Bruce Alberts es Doctor (Ph.D.) por la Universidad de Harvard y


actualmente es Presidente de la National Academy of Sciences y Profesor de Bioqumica y Biofsica en la Universidad de California, San Francisco. Dermis Bray es Doctor (Ph.D.) por el Massachusetts Institute of Technology y actualmente est becado por el Medical Research Council en el Departamento de Zoologa de la Universidad de Cambridge. Julian Lewis es Doctor (D.Phil.) por la Universidad de Oxford y actualmente es Senior Scientist en el Imperial Cancer Research Fund Developmental Biology Unit, de la Universidad de Oxford. Martin Raff es Doctor (M.D.) por la Universidad de McGill y actualmente es Profesor del MRC Laboratory for Molecular Cell Biology y del Biology Department University College de Londres. Keith Roberts es Doctor (Ph.D.) por la Universidad de Cambridge y actualmente es Director del Department of Cell Biology del John Innes Institute de Norwich. James D. Watson es Doctor (Ph.D.) por la Universidad de Indiana y actualmente es Director del Cold Spring Harbor Laboratory. Es autor de Molecular Biology o f the Gene y, con Francis Crick y Maurice Wilkins, recibi el Premio Nobel de Medicina y Fisiologa en 1962.

En la traduccin han colaborado: Dra. M. Grcia Bozzo, Dra. Roser Pagan, Dra. Montserrat Poquet, Dr. Manuel Reina, Dr. Josep Valero y Dr. Senn Vilar.

Reimpresin: Enero 2002


Quedan rigurosamente prohibidas, sin la autorizacin escrita de los titulares del Copyright, bajo las sanciones establecidas en las leyes, la reproduccin total o parcial de esta obra por cualquier medio o procedimiento, comprendidos la reprografa y el tratamiento informtico, y la distribucin de ejemplares de ella mediante alquiler o prstamo pblicos, as como la exportacin e importacin de estos ejemplares para su distribucin en venta, fuera del mbito de la Unin Europea. Authorized translation from English language edition published by Garland Publishing, Inc.

MOLECULAR BIOLOGY OF THE CELL 1993,1989,1994 by Bruce Alberts, Dennis Bray, Julian Lewis,
Martin Raff, Keith Roberts and James D. Watson y para la edicin espaola 1996,2002 Ediciones Omega, S.A. Plat, 26 - 08006 Barcelona www.ediciones-omega.es ISBN 84-282-1011-X Depsito legal B. 39.082-2001 Printed in Spain Ind. Grf. Ferr Olsina, SA. - Viladomat, 158-160 int. - 08015 Bai

Cubierta anterior: la fotografa muestra una bra nerviosa de rata en cultivo. Est marcada con un fluorocromo asociado a un anticuerpo que reconoce el soma celular y las prolongaciones dendrticas de la clula (am arillo ). Los terminales nerviosos (verde) de otras neuronas (no visibles) que han establecido sinapsis con la clula estn marcados con un anticuerpo diferente. (Por cortesa de Olaf Mundigl y Pietro de Camilli.) Cubierta posterior: los autores, en orden alfabtico, atravesando Abbey Eoad en Londres, yendo a comer. La mayor parte de esta tercera edicin se ha escrito en una casa situada en el ngulo de la imagen. (Fotografa de Richard Olivier.) Dedicatoria; Gavin Borden, ltimo presidente de Garland Publishing, curtido durante la ascensin cerca del Mount McKinley, a mediados de 1980, con Bruce Alberts, autor de Biologa Molecular de la Clula" y el famoso gula de montaa Mugs Stump (1940-1992).

Gavin Borden 1 de mayo de 1939 - 20 de diciembre de 1991

Prefacio a la tercera edicin


La investigacin biolgica se encuentra en una fase explosiva impulsada por los nuevos conocim ientos de las unidades bsicas de todas las formas de vida. Ac tualmente, la clave de un problema sobre neuronas, clulas vegetales o cncer puede encontrarse investigando en levaduras, ranas o moscas. Ahora ms que nunca, la gentica molecular nos ensea cmo reconocer y aprovechar estas co nexiones y nos obliga a reflexionar sobre los antiguos orgenes de los com po nentes a partir de los cuales estamos construidos. Al sobrevolar la biologa celu lar uno no sabe si maravillarse ms con la variedad sin fin de sistemas vivos o con las similitudes fundamentales de los mecanismos a travs de los que estos sistemas actan. El desafo que supone escribir un libro de texto consiste en escoger los con ceptos ms importantes de todo lo que conocem os. El problema de revisarlo consiste en descubrir qu conceptos han cambiado o cules han aparecido de nuevo. Se trata de algo muy diferente a hacer un resumen de hechos aparecidos recientemente: una gran cantidad de nuevos conceptos pueden cambiar muy poco nuestra visin de las clulas, mientras que algunos pueden transformar la visin global de la cuestin. Reconociendo que es imposible ser exhaustivos, nos hemos esforzado en intentar asegurar que nuestro libro pueda proporcionar una visin de la biologa celular que los estudiantes puedan leer y digerir. Por ello nos hemos dedicado a reflexionar tanto sobre el problema de qu haba que eli minar como sobre el problema de qu haba que aadir. En esta tercera edicin, grandes partes del texto se han reescrito totalmente de acuerdo con los nuevos avances. Dos captulos -e l de los vegetales y el de neurobiologa- se han fragmentado y sus componentes se han integrado en otros captulos, poniendo de relieve que estos temas no son elementos colatera les propios de especialistas sino que pertenecen al ncleo de la biologa celular. Algunos de los captulos centrales del libro se han subdividido en partes ms manejables y se ha aadido un captulo sobre la tecnologa del DNA recombinante. Tam bin hemos insertado otro captulo sobre los principios de la funcin de las protenas, que muestra que las protenas trabajan como molculas con partes mviles, constituyendo los artilugios dinmicos de la clula viva -u n a cuestin fundamental que est empezando a cobrar la importancia que se m ere ce gracias al rpido incremento de conocimientos que se est produciendo so bre la estructura de las protenas. Al final del libro hemos aadido un glosario de trminos tcnicos esenciales. Para estudiar las molculas de la vida, hemos seleccionado una antologa de ellas y las hemos incluido en un disquete de ordenador junto con el programa Kinemage, que nos permite ver las estructuras moleculares en tres dimensiones, rotarlas y manipularlas sobre la pantalla del ordenador, as como observar cmo sufren cambios conformacionales. Tim Hunt y John Wilson han actualizado y ampliado su libro de problemas que acompaa lo ms importante del texto y que ayuda a los estudiantes a apreciar los experimentos y a razonar sobre las ba ses de nuestro conocim iento de las clulas. Tanto el disquete de las estructuras moleculares como el libro de problemas puede conseguirse a travs de la edito rial americana: Garland Publishing, Inc. 717 Fifth Avenue, New York, NY 10022. Estados Unidos. Queremos agradecer especialmente a nuestros colaboradores (todos ellos de la Universidad de California, San Francisco) que han contribuido de forma importante en la redaccin de determinados captulos: Sandy Johnson (Captu los 8 y 9), Peter Walter (Captulos 12 y 13), Andrew Murray (Captulo 17) y Tim Mitchison (Captulos 16 y 18); tambin a Michael Klymkowsky (Universidad de Colorado, Boulder) por su contribucin en el Captulo 16. Una vez ms tenemos

una deuda con los expertos que, generosamente, nos han hecho sugerencias, comentarios y correcciones; estn mencionados individualmente en las pginas xxxix-xli. Como editora, Miranda Robertson, ha jugado, como siempre, un papel crucial en conseguir que el texto resulte claro, coherente y accesible a los estu diantes. En esta edicin, nos hemos aventurado con las imgenes a todo color. Nigel Orme ha transformado los dibujos en imgenes en color, con un acierto y efecti vidad mgicos. Carol Winter de nuevo ha escrito al ordenador todo el libro con esmero y ha preparado los disquetes finales. John M-Roblin ha compaginado el texto con las figuras y se ha encargado de la transicin desde el ordenador hasta el libro impreso final. Brian Rubin ha colaborado en las referencias, Fran Dependahl en la tipografa y Emily Preece nos ha asesorado en cuanto a estilo mientras escribamos. Les hacemos llegar nuestro agradecimiento a todos ellos y a m u chos otros, especialmente al grupo de Garland Publishing, quienes han contri buido de formas demasiado numerosas para poder ser citados. Debemos un agradecimiento especial a Ruth Adams quien, una vez ms, ha supervisado la produccin del libro con una eficiencia infatigable y buen humor, y a Elizabeth Borden, ahora directora de Garland Publishing, cuya clida hospitalidad, senti do comn y estimulante amistad nos ha acompaado hasta el final de una em presa intimidante, por tercera vez. Gracias, sobre todo, a nuestras sufridas fami lias, nuestros estudiantes y nuestros colegas, que pacientemente han cargado con nuestras ausencias y preocupaciones. Por ltimo, en una nota triste, recordamos nuestra deuda a Gavin Borden, nuestro editor y gran amigo, que muri de cncer en diciembre de 1991. Sin l este libro no habra existido. Nosotros, y el propio libro, le debemos ms de lo que podemos expresar a su espritu de aventura, su generosidad, su amor a la vida y su amistad. Dedicamos esta edicin a su recuerdo.

viii

Prefacio a la tercera edicin

Prefacio a la segunda edicin


Hace ms de 50 aos, E.B. Wilson escribi: La clave de cualquier problema bio lgico tiene que buscarse finalmente en la clula. Hasta hace muy poco, la bio loga celular se aprenda nicamente como un curso de especializacin para bilogos basado fundamentalmente en la microscopa electrnica. En la mayo ra de las facultades de medicina muchas de las cuestiones de la biologa celular, como los mecanismos de la endocitosis, de la quimiotaxis, del movimiento celu lar y de la adhesin celular, se trataban superficialmente, ya que eran considera dos demasiado celulares para la bioqumica y demasiado moleculares para la histologa. Sin embargo, con los extraordinarios avances recientes sobre el co nocim iento de las clulas, la biologa celular empieza a ocupar el lugar que le co rresponde en el centro de las enseanzas de la biologa y de la medicina. En Es tados Unidos la biologa celular constituye cada vez ms un curso completo imprescindible de cualquier graduado en biologa y bioqumica, y se est convir tiendo en la base sobre la que se organiza el primer ao de la mayora de los currculos de medicina. La primera edicin de Biologa Molecular de la Clula se escribi antes de que se produjeran todas estas necesarias reformas del currculo, con la esperanza de catalizarlas. Estaremos satisfechos si esta segunda edi cin ayuda a acelerar y difundir estas reformas. Al revisar el libro hemos encontrado algunos casos en los que recientes des cubrimientos han invalidado antiguas conclusiones. Pero en los seis aos trans curridos desde que apareci la primera edicin, ha surgido una cantidad fants tica de nueva informacin sobre las clulas que ha puesto al descubierto nuevas conexiones y en muchos casos ha obligado a un cambio radical del nfasis del apartado correspondiente. La presente revisin, por lo tanto, se ha hecho en profundidad: cada captulo ha sufrido cambios sustanciales, muchos de ellos prcticam ente han sido reescritos completamente y se han aadido otros dos captulos completamente nuevos, los relativos al control de la expresin gnica y al cncer. Algunos comentaristas, especialmente profesores, echaron en falta en la pri mera edicin discusiones ms detalladas de las evidencias experimentales sobre las que se basan los diferentes conceptos discutidos. Nosotros pretendemos no romper el hilo conceptual ni alargar un libro ya de por s muy voluminoso, pero estamos de acuerdo en que resulta crucial proporcionar a los alumnos una sen sacin de cm o se han producido los diferentes avances de la ciencia. La segunda edicin, como la primera, ha supuesto una larga dedicacin. Como en aqulla, cada Captulo ha pasado varias veces del autor que ha escrito la primera versin a los otros autores, para su crtica y profunda revisin, de for ma que cada una de las secciones del libro representa una verdadera com posi cin; a menudo, Tim Hunt y John Wilson han participado en este proceso. Ade ms, se han invitado a diversos expertos en cada tema para que realizaran sugerencias para su revisin y, en algunos casos, para que contribuyeran con material para el texto, que los autores integraron en el libro. Estamos especial mente agradecidos a James Rothman (Princeton University) por su contribucin al Captulo 8 y a Jeremy Hyams (University College London), Tim Mitchison (University of California, San Francisco) y Paul Nurse (University of Oxford) por sus contribuciones al Captulo 13. Todas las secciones del texto revisado han sido ledas por expertos, cuyos comentarios y sugerencias han resultado extraor dinariamente valiosas. A todos ellos nuestro agradecimiento. Miranda Robertson ha desempeado un papel importante para que el libro resultara legible, insistiendo en que cada pgina fuera coherente y reescribiendo muchas que no lo eran. Tambin estamos en deuda con el equipo de Garland Publishing y en particular con Ruth Adams, Alison Walker y Gavin Borden por su

amabilidad, eficiencia e incansable apoyo durante los cuatro aos de prepara cin de esta edicin. Agradecimientos especiales para Carol Winter por su esme rado cuidado en la mecanografa de todo el libro y por la preparacin de los disquetes para la impresora. Finalmente, tambin ofrecemos nuestra gratitud a nuestras esposas, familias, colegas y estudiantes, solicitando de ellos excusas por varios aos de imposiciones y negligencias; sin su ayuda y tolerancia, este libro no podra haber sido escrito.

Prefacio a la segunda edicin

Prefacio a la primera edicin


Existe una paradoja en el desarrollo de los conocimientos cientficos. A medida que la informacin se va acumulando en cantidades cada vez mayores, los h e chos inconexos y los misterios impenetrables pueden sustituirse por explicacio nes racionales, y del caos surge la simplicidad. Gradualmente se ponen de m ani fiesto los principios esenciales de un tema. Esto es lo que sucede actualmente en la biologa celular. Las nuevas tcnicas de anlisis a nivel molecular estn reve lando la existencia de una asombrosa elegancia y econom a en la clula viva, y de una satisfactoria unidad en cuanto a los principios por los que funcionan las clulas. Este libro trata de estos principios. No es una enciclopedia sino una gua para el conocim iento. Debemos admitir que existen an amplias reas de igno rancia en la biologa celular y numerosos hechos que an no pueden ser explica dos. Pero estos problemas todava no resueltos constituyen un gran estmulo, y hemos intentado subrayarlos para estimular a los lectores a que se animen a la tarea de su descubrimiento. As, en lugar de presentar simplemente hechos in conexos en las reas que estn an mal comprendidas, hemos aventurado a m e nudo hiptesis para que el lector las estudie y, esperamos, las critique. Biologa Molecular de la Clula se ocupa principalmente de las clulas eucariticas, estudindolas de forma contrapuesta con las bacterias, reflejando su t tulo la importancia capital de los conocimientos que se han adquirido a travs del enfoque molecular. Las partes I y II del libro analizan las clulas desde esta perspectiva y cubren los temas tradicionales de los cursos de biologa celular. Pero la biologa molecular por s sola no es suficiente. Las clulas eucariticas que forman los animales y plantas pluricelulares son organismos sociales hasta un grado extremo: viven gracias a la cooperacin y a la especializacin. Para com prender cmo funcionan, las clulas se deben estudiar en las comunidades pluri celulares, adems de efectuar investigaciones sobre el funcionamiento interno de las clulas aisladas. Se trata de dos niveles de investigacin muy diferentes, pero cada uno de ellos depende del otro en cuanto a enfoque y direccin. Por ello he mos dedicado la parte III del libro al comportamiento de las clulas en los anim a les y plantas pluricelulares. As, la biologa del desarrollo, la histologa, la inmu nologa y la neurobiologa se estudian aqu con mucho ms detalle que en otros libros de biologa celular. Aunque estos temas pueden ser omitidos en un curso de biologa celular bsica y tratados en cursos optativos o suplementarios, repre sentan una parte esencial de nuestro conocimiento sobre las clulas y resultan especialmente tiles a quienes deciden proseguir estudios biolgicos o mdicos. La amplitud del tema refleja nuestra conviccin de que la biologa celular debera constituir el centro de una educacin biolgica moderna. Este libro est dedicado principalmente a quienes empiezan el primer curso de biologa celular, ya sean estudiantes, graduados o estudiantes de doctorado. Aunque presuponemos que la mayor parte de los lectores habrn recibido por lo menos un curso de introduccin a la biologa, hemos intentado escribir el libro de forma que incluso un profano de la biologa pueda seguirlo si empieza por el principio. Por otro lado, esperamos que resulte tambin de utilidad para los cientficos que buscan una gua que les ayude a encontrar un camino a travs de este amplio campo de conocimientos. Por esta razn hemos incluido una lista de referencias mucho ms extensa de lo que necesitara un estudiante universi tario no graduado, procurando al mismo tiempo que la seleccin de obras pre sentadas pueda encontrarse en la mayora de bibliotecas. Es ste un libro extenso, que ha tenido un largo perodo de gestacin -tres veces ms que un elefante y cinco veces ms que una ballena. Muchas personas han contribuido. Cada captulo ha pasado varias veces desde el autor que escri bi el primer borrador a los otros autores, que lo criticaron y revisaron, por lo

que cada captulo representa una obra de conjunto. Adems, varios expertos han aportado material escrito, que los autores han revisado para adaptarlo al resto del libro, y todos los captulos han sido ledos por expertos, cuyos comen tarios y correcciones han sido de gran valor. Hemos incluido la lista completa de agradecimientos a estos colaboradores y lectores, por su ayuda en la confeccin de captulos especficos. Paul R. Burton (University of Kansas), Douglas Chandler (Arizon State University), Ursula Goodenough (Washington University), Robert E. Pollack (Columbia University), Robert E. Savage (Swarthmore College) y Charles F. Yocum (University of Michigan) leyeron todo o parte del manuscrito y aportaron muchas sugerencias tiles. El manuscrito fue ledo tambin por estu diantes no graduados, quienes nos ayudaron a identificar los pasajes que queda ban oscuros o resultaban difciles de comprender. La mayor parte de los consejos obtenidos de los estudiantes y de los exper tos ajenos a la obra fueron filtrados y digeridos por Miranda Robertson. Insis tiendo en que cada pgina deba ser lcida y coherente, y escribiendo de nuevo muchas de las que no lo eran, Miranda Robertson ha desempeado un impor tante papel en la creacin de un libro de texto que los estudiantes leern con fa cilidad. Lydia Malim dibuj muchas de las ilustraciones de los Captulos 15 y 16, y numerosos cientficos nos proporcionaron fotografas con gran generosidad: sus nombres se encuentran en el texto que acompaa las ilustraciones. A nues tras familias, nuestros colegas y estudiantes manifestamos nuestro agradeci miento por su paciencia, y pedimos disculpas por varios aos de abuso y negli gencia. Finalmente, tenemos una deuda especial de gratitud con nuestros editores. Tony Adams desempe un importante papel en la mejora de la clari dad de exposicin y Ruth Adams, con un grado de jovial eficacia que avergonz a los autores, organiz toda la produccin del libro. Gavin Borden se ocup de la publicacin, y su generosidad y su hospitalidad convirtieron el trabajo de escri bir en un placer y en una leccin para nosotros.

xii

Prefacio a la primera edicin

Indice general
Caractersticas especiales ndice de m aterias Agradecimien tos Nota al lector Nota de los traductores

XV
x vii xxx ix xliii xlv PARTE 3 43 93 147

Introduccin a la clula
1. La evolucin de la clula 2. Pequeas molculas, energa y biosntesis 3. Macromolculas: estructura, forma e informacin 4. Cmo se estudian las clulas

Gentica molecular
5. Funcin de las protenas 6. Mecanismos genticos bsicos 7. Tecnologa del DNA recombinante 8. El ncleo celular 9. El control de la expresin gnica 207 237 313 359 429

PARTE

II

Organizacin interna de la clula


10. Estructura de la membrana 11. Transporte de molculas pequeas a travs de la membrana y base inica de la excitabilidad de la membrana 12. Compartimientos intracelulares y clasificacin de protenas 13. Trfico vesicular mediante las rutas secretora y endoctica 14. Conversin energtica: mitocondrias y cloroplastos 15. Transmisin de seales entre clulas 16. El citoesqueleto 17. El ciclo de divisin celular 18. Los mecanismos de la divisin celular 509 541 589 641 697 771 843 925 977

PARTE

III

Las clulas en su contexto social


19. Adhesin celular, uniones celulares y matriz extracelular 20. Clulas germinales y fecundacin 21. Mecanismos celulares del desarrollo 22 . Clulas diferenciadas y conservacin de los tejidos 23. El sistema inmunitario 24. Cncer Glosario ndice alfabtico 1017 1083 1111 1219 1279 1345 G-l

IV

PARTE

1-1

Caractersticas especiales
Panel 1-1 Panel 1-2 Panel 1-3 Tabla 2-1 Panel 2-1 Panel 2-2 Panel 2-3 Panel 2 -4 Panel 2-5 Panel 2-6 Tabla 3-1 Tabla 3-2 Panel 3-1 Tabla 3-3 Panel 3-2 Tabla 11-1 Panel 11-1 Panel 11-2 Panel 11-3 Tabla 12-1 Tabla 12-2 Panel 12-1 Panel 13-1 Panel 14-1 Panel 16-1 Panel 18-1 Panel 21-1 Panel 21-2 Clulas eucariotas: esquema de sus principales orgnulos Modelos celulares y tejidos con los que estn construidas las plantas superiores Algunos de los diferentes tipos de clulas existentes en el cuerpo de un vertebrado Composicin qumica aproximada de una clula bacteriana Propiedades qumicas del agua y su influencia sobre el comportamiento de las molculas biolgicas Enlaces y grupos qumicos frecuentes en las molculas biolgicas Algunos de los tipos de azcares encontrados habitualmente en las clulas Algunos de los tipos de cidos grasos encontrados habitualmente en las clulas y las estructuras que forman Los 20 aminocidos que intervienen en la sntesis de las protenas Resumen de los principales tipos de nucletidos y sus derivados existentes en las clulas Composicin qumica aproximada de una bacteria tpica y de una clula de mamfero tpica Enlaces qumicos covalentes y no covalentes Principales tipos de fuerzas no covalentes dbiles que unen las molculas entre s La relacin entre las diferencias de energa libre y las constantes de equilibrio Estructuras del DNA y del RNA Comparacin de las concentraciones inicas en el interior y el exterior de una clula de mamfero Equilibrio del agua intracelular: el problema y su solucin Deduccin de la ecuacin de Nernst Algunos experimentos clsicos realizados en el axn gigante del calamar Volmenes relativos ocupados por los principales compartimientos intracelulares en una clula heptica tpica (hepatocito) Cantidades relativas de tipos de membrana en dos clulas eucariotas Estudio de las secuencias seal y de la translocacin de protenas a travs de membranas Estrategias utilizadas para estudiar los mecanismos moleculares implicados en el transporte vesicular Energa libre y reacciones biolgicas Polimerizacin de la actina y la tubulina Los seis estadios de la divisin celular Revisin de gentica clsica Caractersticas generales del desarrollo temprano de las plantas con flores 18-19 30-31 38-39 45 50-51 52-53 54-55 56-57 58-59 60-61 94 95 96-97 101 104-105 542 552 562 568 591 591 598 682-683 714-715 882-883 982-983 1148-1149 1189 1271-1274

Captulo 22 Apndice Catlogo de las clulas del cuerpo humano adulto

xv

ndice de materias
Introduccin a la clula
La evolucin de la clula
Desde las molculas hasta la primera clula En condiciones prebiticas se pueden formar molculas biolgicas Pueden desarrollarse sistemas qumicos complejos en un entorno alejado de su equilibrio qumico Los polinucletidos son capaces de dirigir su propia sntesis Las molculas autorreplicantes estn sometidas a la seleccin natural Algunas molculas especializadas de RNA pueden catalizar reacciones bioqumicas La informacin fluye desde los polinucletidos a los polipptidos Las membranas definieron la primera clula Todas las clulas actuales utilizan el DNA como material hereditario Resumen De los procariotas a los eucariotas Las clulas procariotas son estructuralmente simples pero bioqumicamente diversas Las reacciones metablicas evolucionan Comparando secuencias de DNA se pueden deducir relaciones evolutivas Las cianobacterias pueden fijar C 02 y N2 Las bacterias pueden realizar la oxidacin aerbica de las molculas nutritivas Las clulas eucariotas poseen varios orgnulos caractersticos Las clulas eucariotas dependen de las mitocondrias para su metabolismo oxidativo Los cloroplastos son descendientes de una clula procariota incorporada 4 4 4 6 7 8 8 10 11 12 12 12 14 15 16 17 20 21 22 Las clulas eucariotas contienen una rica dotacin de membranas internas Las clulas eucariotas tienen un citoesqueleto Entre los protozoos se encuentran las clulas ms complejas conocidas En las clulas eucariotas el material gentico est empaquetado de forma compleja Resumen De las clulas simples a los organismos pluricelulares Las clulas se pueden asociar formando colonias Las clulas de un organismo superior se especializan y cooperan La organizacin pluricelular depende de la cohesin entre las clulas Las capas de clulas epiteliales envuelven un medio interno protegido La comunicacin clula-clula controla es esquema espacial de los organismos pluricelulares La memoria celular permite el desarrollo de patrones complejos Los programas bsicos de desarrollo tienden a ser conservados en la evolucin Las clulas somticas del cuerpo de los vertebrados muestran ms de 200 tipos diferentes de especializacin Los genes pueden ser activados y desactivados Comparaciones entre secuencias revelan centenares de familias de genes homlogos Resumen Bibliografa P arte

i
Captulo

23 25 25 26 27 27 28 29 32 32 33 34 34 36 37 37 41 41

Pequeas molculas, energa y sntesis


Los componentes qumicos de una clula La qumica celular se basa en los compuestos de carbono Las clulas utilizan cuatro tipos bsicos de molculas pequeas Los azcares son las molculas alimenticias de la clula Los cidos grasos son componentes de las membranas celulares Los aminocidos son las subunidades de las protenas Los nucletidos son las subunidades del DNA y del RNA Resumen Orden biolgico y energa El orden biolgico resulta posible gracias a la liberacin de energa calorfica por parte de las clulas Los organismos fotosintetizadores utilizan la luz solar para sintetizar compuestos orgnicos La energa qumica pasa de las plantas a los animales 43 43 45 46 47 48 49 62 62 63 63 64 Las clulas obtienen energa mediante la oxidacin de molculas biolgicas La degradacin de una molcula orgnica se realiza a travs de una secuencia de reacciones catalizadas enzimticamente Parte de la energa liberada en las reacciones de oxidacin se acopla a la reaccin de formacin de ATP La hidrlisis del ATP genera orden en las clulas Resumen

Captulo

65

66 66 67 69 69 69 70 73

El alimento y la obtencin de la energa celular Las molculas alimenticias son degradadas en tres etapas para producir ATP La glucolisis puede producir ATP incluso en ausencia de oxgeno El NADH es el intermediario central en el catabolismo oxidativo

xvii

El metabolismo est dominado por el ciclo del cido ctrico En la fosforilacin oxidativa, la transferencia de electrones al oxgeno impulsa la formacin de ATP Los aminocidos y los nucletidos forman parte del ciclo del N Resumen La biosfntesis y la creacin de orden El cambio de energa libre de una reaccin determina si sta puede producirse o no A menudo las reacciones de biosntesis estn acopladas directamente a la hidrlisis del ATP Las coenzimas intervienen en la transferencia de determinados grupos qumicos La estructura de las coenzimas sugiere que se formaron en un mundo de RNA La biosntesis necesita poder reductor

74 75 76 77 77 77 78 80 81 82

Los polmeros biolgicos se sintetizan mediante la repeticin de reacciones elementales de deshidratacin Resumen Coordinacin entre catabolismo y biosfntesis El metabolismo est organizado y regulado Las vas metablicas estn reguladas a travs de cambios de la actividad enzimtica Las reacciones catablicas pueden revertirse mediante un aporte de energa Las enzimas pueden activarse e inhibirse mediante modificaciones covalentes Las reacciones estn comprtimentadas, tanto dentro de las clulas como dentro de los organismos Resumen Bibliografa

84 84 86 86 86 87 89 89 91 91

Macromolculas: estructura, forma e informacin


Procesos de reconocimiento molecular Las interacciones especficas de una macromolcula dependen de enlaces dbiles no covalentes Una hlice es un motivo estructural comn en las estructuras biolgicas generadas a partir de subunidades repetidas La difusin es el primer paso hacia el reconocimiento molecular Los movimientos trmicos unen a las molculas y luego las separan La constante de equilibrio constituye una medida de la fuerza de interaccin entre dos molculas Los tomos y las molculas se mueven rpidamente Los procesos de reconocimiento molecular nunca pueden ser perfectos Resumen cidos nucleicos Los genes estn formados por DNA Las molculas de DNA consisten en dos largas cadenas unidas por pares de bases complementarias La estructura del DNA proporciona una explicacin del proceso de la herencia Los errores en el proceso de replicacin del DNA generan mutaciones La secuencia de nucletidos de un gen determina la secuencia de aminocidos de una protena Porciones de la secuencia de DNA se copian en molculas de RNA para guiar la sntesis de protenas Las molculas de RNA de eucariotas son cortadas y recombinadas, eliminndose secuencias intrn Las secuencias de nucletidos del mRNA son ledas en grupos de tres y traducidas a aminocidos Las molculas de tRNA emparejan los aminocidos con los grupos de nucletidos El mensaje de RNA se lee de un extremo al otro por un ribosoma Algunas molculas de RNA actan como catalizadores Resumen Estructura de las protenas La forma de una molcula proteica est determinada por la secuencia de sus aminocidos Diferentes cadenas proteicas presentan esquemas de plegamiento iguales Las protenas son molculas asombrosamente verstiles Las protenas presentan diferentes niveles de organizacin estructural 93 94 99 99 99 Los dominios estn formados por cadenas polipeptdicas que se pliegan adelante y atrs, generando delgadas circunvoluciones en la superficie de la protena De entre la gran cantidad de cadenas polipeptdicas posibles, nicamente un nmero relativamente pequeo de ellas llegara a ser til Normalmente las nuevas protenas se desarrollan por alteraciones menores de protenas antiguas Las nuevas protenas pueden desarrollarse por recombinacin de dominios polipeptdicos preexistentes Las homologas estructurales pueden contribuir en la asignacin de funciones a las protenas descubiertas recientemente Las subunidades proteicas pueden ensamblarse formando grandes estructuras Un solo tipo de subunidad proteica puede interaccionar consigo misma formando agregados geomtricos regulares A menudo las protenas superenrolladas colaboran en la construccin de grandes estructuras en las clulas Las protenas pueden ensamblarse formando lminas, tubos o esferas Muchas estructuras celulares son capaces de autoensamblarse No todas las estructuras biolgicas se forman por autoensamblaje Resumen Las protenas como catalizadores La conformacin de una protena determina sus propiedades qumicas El primer paso de la catlisis enzimtica es la unin del substrato Las enzimas aceleran las reacciones estabilizando determinados estados de transicin Las enzimas pueden facilitar la formacin y la rotura de enlaces covalentes a travs de una catlisis cida y bsica simultnea Adems, las enzimas pueden incrementar las velocidades de reaccin formando enlaces covalentes intermedios con sus substratos Las enzimas aceleran las reacciones qumicas pero no pueden hacerlas energticamente ms favorables Las enzimas pueden determinar el sentido de una va acoplando determinadas reacciones a la hidrlisis del ATP Los complejos multienzimticos ayudan a incrementar la velocidad del metabolismo celular Resumen Bibliografa

124

125 125 127

100 101

129 130 130 131 132 132 134 135 135 135 137 138

101 102
102

102

103 106 108 108 109


110

111
111 112

139

113 116 116 116 119

140 140 141 141 142 143

120
122

xviii

ndice de materias

Cmo se estudian las clulas


Observacin de la estructura de las clulas con el microscopio El microscopio ptico puede resolver detalles situados a 0,2 nm de distancia Para la observacin microscpica, normalmente los tejidos son fijados y seccionados Los diferentes componentes de la clula pueden ser teidos selectivamente Mediante la microscopa de fluorescencia se pueden localizar molculas en las clulas de forma especfica Las clulas vivas se pueden observar con nitidez en un microscopio de contraste de fases o de contraste de fases interferencial Mediante tcnicas electrnicas las imgenes pueden ser amplificadas y analizadas Gracias al microscopio de barrido confocal es posible obtener imgenes de complejos objetos tridimensionales El microscopio electrnico resuelve la estructura fina de la clula Para poder ser estudiadas al microscopio electrnico, las muestras biolgicas requieren una preparacin especial Mediante la microscopa electrnica de barrido se pueden obtener imgenes tridimensionales El sombreado metlico permite el examen a alta resolucin de detalles superficiales, mediante el microscopio electrnico de transmisin La microscopa electrnica de criofractura y la de grabado por congelacin proporcionan una nueva visin del interior celular La tincin negativa y la microscopa crioelectrnica permiten observar macromolculas a alta resolucin Resumen Aislamento y crecimiento de clulas en cultivo Las clulas de un tejido pueden ser aisladas y separadas en diversos tipos celulares Las clulas pueden cultivarse en una placa de cultivo Los medios definidos qumicamente, libres de suero, permiten la identificacin de factores de crecimiento especficos Las lneas celulares eucariotas constituyen una fuente ampliamente utilizada para la obtencin de clulas homogneas Las clulas pueden fusionarse formando clulas hbridas Resumen 147 149 150 151 152

Captulo

4
Fraccionamiento de las clulas y anlisis de sus molculas Los orgnulos y las macromolculas pueden separarse por ultracentrifugacin Los detalles moleculares de los procesos celulares complejos nicamente se pueden descifrar en sistemas libres de clulas Las protenas pueden separase mediante cromatografa Mediante electroforesis en gel de poliacrilamida con SDS pueden determinarse el tamao y la composicin de subunidades de una protena Mediante electroforesis bidimensional sobre gel de poliacrilamida, se pueden resolver ms de 1000 protenas sobre un mismo gel La hidrlisis selectiva de una protena genera un conjunto caracterstico de fragmentos peptdicos Mediante mquinas automatizadas pueden analizarse secuencias cortas de aminocidos La difraccin de rayos X por cristales de protena puede revelar la estructura exacta de una protena Tambin se puede determinar la estructura molecular utilizando espectroscopia de resonancia magntica nuclear (NMR) Resumen Siguiendo el rastro y cuantiflcando las molculas del interior de las clulas Los tomos radiactivos pueden ser detectados con una gran sensibilidad Los radioistopos se utilizan para marcar las molculas en las clulas y en los organismos y seguirles la pista Las concentraciones de los iones se pueden medir mediante electrodos intracelulares Los cambios rpidos en las concentraciones inicas intracelulares se pueden medir mediante indicadores emisores de luz Existen diferentes sistemas que permiten introducir molculas en una clula para las que la membrana celular sea impermeable La activacin inducida por la luz de molculas precursoras empaquetadas facilita el estudio de la dinmica intracelular Se pueden utilizar anticuerpos para detectar y aislar molculas determinadas Las lneas celulares de hibridomas constituyen una fuente permanente de anticuerpos monoclonales Resumen Bibliografa 172 172

174 176

179

153 154

181 183 184 185

155 157

159 161

186 187 189 189 190 191

162

162 163 165 166 166 167

193

194

197 197 199 201 201

168

169 170 172

Gentica molecular
Funcin de las protenas
Las protenas como mquinas La unin de un ligando puede cambiar la conformacin de una protena A menudo cuando dos ligandos se unen a la misma protena, cada uno de ellos afecta la unin del otro Dos ligandos cuyos lugares de unin estn acoplados pueden afectar recprocamente uno la unin del otro 207 208 209 210 Las transiciones alostricas colaboran en la regulacin del metabolismo A menudo las protenas forman agregados simtricos que sufren transiciones alostricas cooperativas La transicin alostrica de la aspartato transcarbamilasa se conoce a nivel atmico

Parte

II

Captulo

5
210

212 212

ndice de materias

xix

La fosforilacin de protenas es un mecanismo para dirigir transiciones alostricas en las clulas eucariotas Una clula eucariota contiene muchas protena quinasas y fosfatasas La estructura de la protena quinasa Cdk muestra de qu forma una protena puede actuar como un microchip Las protenas que unen e hidrolizan GTP son reguladores celulares ubicuos Otras protenas controlan la actividad de las protenas que unen GTP, determinando si se une GDP o GTP La transicin alostrica de la protena EF-Tu muestra de qu manera pequeas molculas pueden generar grandes movimientos Protenas que hidrolizan ATP realizan trabajo mecnico en las clulas La estructura de la miosina revela de qu forma los msculos generan fuerza Protenas alostricas unidas a membrana y dirigidas por ATP pueden actuar como bombas inicas o trabajar en sentido inverso, sintetizando ATP Las transiciones alostricas acopladas energticamente permiten a las protenas actuar como motores, como relojes, como factores de ensamblaje o como transductores de informacin

214 215 216 218

A menudo las protenas forman grandes complejos que actan como mquinas proteicas Resumen Nacimiento, ensamblaje y muerte de las protenas Se cree que las protenas se pliegan a travs de un intermediario globular fundido Las chaperonas moleculares facilitan el plegamiento de las protenas Muchas protenas contienen series de molculas plegadas de forma independiente Los mdulos confieren versatilidad y a menudo median las interacciones protena-protena Las protenas pueden unirse unas a otras a travs de diferentes tipos de interfases La conexin y la proteolisis selectiva aseguran los ensamblajes del tipo todo o nada La proteolisis dependiente de ubiquitina es la responsable principal del recambio proteico selectivo en los eucariotas La vida media de una protena puede ser determinada por enzimas que alteran su extremo N Resumen Bibliografa

225 225 226 226 227 229 230 231 231 232 234 235 235

219 219
221

222
223

224

Mecanismos genticos bsicos


Sntesis de RNA y de protenas La RNA polimerasa copia el DNA a RNA: el proceso de la transcripcin del DNA Slo se utilizan zonas seleccionadas de un cromosoma para producir molculas de RNA Las molculas de RNA de transferencia actan como adaptadores que traducen secuencias de nucletidos a secuencias de protena Unas determinadas enzimas acoplan cada aminocido con su molcula apropiada de tRNA Los aminocidos se van aadiendo al extremo carboxilo terminal de una cadena polipeptdica en crecimiento El cdigo gentico es degenerado Los acontecimientos de la sntesis proteica estn catalizados sobre el ribosoma El ribosoma se desplaza, paso a paso, a lo largo de la cadena de mRNA Cuando se alcanza uno de los tres tipos de codn de terminacin, la cadena proteica se libera del ribosoma El proceso de iniciacin establece la pauta de lectura para la sntesis proteica En clulas eucariotas, normalmente slo se sintetiza un tipo de cadena polipeptdica sobre cada molcula de mRNA La unin de varios ribosomas a una misma molcula de mRNA genera polirribosomas En los eucariotas, la velocidad general de sntesis de protenas est controlada por factores de iniciacin La fidelidad de la sntesis de protenas est incrementada gracias a dos procesos independientes de correccin de galeradas Muchos inhibidores de la sntesis de protenas en procariotas resultan tiles como antibiticos Cmo evolucion el proceso de la sntesis de protenas? Resumen 237 238 241

Captulo

6
La mayora de mutaciones de las protenas resultan perjudiciales y son eliminadas por seleccin natural Para que exista la vida tal como la conocemos, es necesario que se den estas bajas frecuencias de mutacin El hecho de que las frecuencias de mutacin sean bajas significa que los organismos relacionados han de estar formados esencialmente por las mismas protenas Si no fueran corregidas, las alteraciones espontneas del DNA podran cambiar rpidamente las secuencias del DNA La estabilidad de los genes depende de la reparacin del DNA Las alteraciones del DNA pueden ser eliminadas por ms de una va Las clulas pueden producir enzimas de reparacin de DNA en respuesta a las alteraciones del DNA La estructura y las propiedades qumicas de la doble hlice del DNA hacen que sea fcil de reparar Resumen Mecanismos de repllcacin del DNA Tal como ocurre para el proceso de reparacin del DNA, el fundamento del proceso de replicacin es el apareamiento de bases La horquilla de replicacin del DNA es asimtrica El elevado grado de fidelidad del mecanismo de replicacin del DNA requiere la existencia de una mecanismo de correccin de galeradas" Slo la replicacin del DNA en direccin 5 a 3 permite la existencia de un eficiente procesos de correccin de errores Una enzima especial que polimeriza nucletidos sintetiza cortas molculas cebadoras de RNA sobre la cadena retrasada Unas protenas especiales ayudan a abrir la doble hlice del DNA por delante de la horquilla de replicacin Una molcula de DNA polimerasa mvil se mantiene unida al DNA mediante un anillo deslizante En la horquilla de replicacin, una serie de protenas cooperan entre s formando una mquina de replicacin Un sistema de correccin de galeradas que elimina los errores de replicacin producidos por la mquina de replicacin 259 260

260 261 263 263 266 266 268 268

242 243 244 245 246 247 249 249 252 253 254

268 269

270

271

254 255 257 257

272 273 273 275 276

Mecanismos de reparacin del DNA 258 Las secuencias de DNA se mantienen con un elevado grado de fidelidad 258 Las frecuencias de mutacin observadas en clulas proliferativas son consistentes con los valores evolutivos estimados 259

xx

ndice de materias

Las horquillas de replicacin se inician en el origen Las DNA topoisomerasas evitan que el DNA se enrede durante la replicacin La replicacin del DNA en los eucariotas es bsicamente similar a la de los procariotas Resumen

277 278 280 280

Recombinacin gentica 281 La recombinacin general est guiada por interacciones de apareamiento de bases entre cadenas complementarias de dos molculas homologas de DNA 282 La recombinacin general puede iniciarse en una muesca de una cadena de la doble hlice de DNA 283 Las reacciones de hibridacin del DNA proporcionan un modelo sencillo para la fase de apareamiento de bases en la recombinacin general 284 La protena RecA permite a una molcula de una sola cadena de DNA aparearse con una regin homologa de una doble hlice en E. coli 285 La recombinacin gentica general habitualmente supone un intercambio cruzado de cadenas o entrecruzamiento 287 La conversin gnica se produce combinando procesos de recombinacin general y de sntesis limitada de DNA 287 Los mecanismos de correccin de errores pueden evitar la recombinacin gentica promiscua entre dos secuencias de DNA mal apareadas 288 Enzimas de recombinacin especfica de lugar ponen y quitan del genoma secuencias especiales de DNA 289 La recombinacin transposicional puede insertar un elemento gentico mvil en cualquier secuencia de DNA 291 Resumen 292

Virus, plsmidos y elementos genticos transponibles Los virus son elementos genticos mviles La cubierta exterior de un virus puede ser una cpside proteica o una envoltura membranosa Los genomas vricos se presentan en una gran variedad de formas vricas y pueden ser tanto de DNA como de RNA Los cromosomas vricos codifican enzimas implicadas en la replicacin de su cido nucleico Tanto los virus RNA como los virus DNA se replican mediante la formacin de cadenas complementarias Los virus utilizan la maquinaria de trfico intracelular de sus clulas husped Diferentes virus recubiertos geman a partir de diferentes membranas celulares Los cromosomas vricos pueden integrarse en los cromosomas del husped La sntesis continuada de algunas protenas vricas puede transformar a las clulas en cancerosas Los virus tumorales RNA son retrovirus El virus del SIDA es un retrovirus Algunos elementos transponibles estn estrechamente relacionados con los retrovirus Otros elementos transponibles se transfieren directamente a s mismos desde un lugar a otro del genoma Probablemente la mayora de los virus evolucionaron a partir de plsmidos Resumen Bibliografa

293 293 294

294 296 297 298 300 301 301 302 304 305 305 306 307 308

Tecnologa del DNA recombinante


Fragmentacin, separacin y secuenciacin de molculas de DNA Las endonucleasas de restriccin cortan las molculas de DNA en secuencias nucleotdicas especficas Los mapas de restriccin muestran la distribucin de pequeas secuencias nucleotdicas a lo largo del cromosoma Las molculas de DNA de diferentes tamaos pueden separarse mediante la electroforesis en gel Las molculas purificadas de DNA pueden ser marcadas in vitro con radioistopos o con marcadores qumicos Los fragmentos aislados de DNA pueden ser rpidamente secuenciados Las huellas del DNA revelan los lugares donde las protenas se unen a la molcula de DNA Resumen Hibridacin de cidos nucleicos La hibridacin de cidos nucleicos proporciona un mtodo sensible para la deteccin de secuencias determinadas de nucletidos Las transferencias Northern y Southern facilitan la hibridacin con molculas de cidos nucleicos separadas electroforticamente El anlisis de los polimorfismos de longitud de los fragmentos de restriccin (RFLP) facilita el anlisis gentico de los grandes genomas Las molculas sintticas de DNA facilitan el diagnstico prenatal de enfermedades genticas La hibridacin poco rigurosa permite identificar genes relacionados de forma indirecta Las tcnicas de hibridacin in situ permiten localizar secuencias especficas de cidos nucleicos en los cromosomas y en las clulas Resumen 314 315 315 317 318 319 320 322 322

Captulo

7
ClonajedeDNA Se puede construir una librera de DNA utilizando vectores vricos o vectores plasmdicos Dos tipos de libreras de DNA cubren diferentes propsitos Los clones cDNA contienen secuencias codificantes continuas Pueden preparse libreras cDNA a partir de poblaciones seleccionadas de molculas de mRNA Para identificar los clones de inters en una librera de DNA puede utilizarse tanto una sonda DNA como un ensayo para la protena expresada La traduccin in vitro facilita la identificacin del clon de DNA correcto La seleccin de clones DNA solapados permite caminar sobre el cromosoma hasta un gen vecino de inters Se estn construyendo libreras genmicas de clones ordenados para organismos seleccionados El clonaje posicional de DNA revela la presencia de genes de funciones imprevistas Mediante una reaccin de polimerizacin en cadena se pueden clonar segmentos de DNA en un tubo de ensayo Resumen Ingeniera de DNA Se pueden construir molculas de DNA de cualquier secuencia uniendo fragmentos de DNA Es posible producir grandes cantidades de molculas de RNA homogneas mediante transcripcin de DNA in vitro Utilizando vectores de expresin es posible producir grandes cantidades de protenas celulares minoritarias Los genes marcadores permiten analizar la funcin de las secuencias de DNA reguladoras Los organismos mutantes revelan mejor la funcin de un gen 331 332 333 334 335

335 337 337 339 340 340 341 342 343 343 344 345 345

323

324

326 327 329

330 331

ndice de materias

xxi

Pueden fabricarse a medida clulas y organismos que contengan genes alterados Los genes se pueden redisear para que produzcan protenas de cualquier secuencia que se desee Habitualmente las protenas de fusin son de gran utilidad para analizar la funcin proteica Los genes normales son fcilmente reemplazables por imitantes, tanto en bacterias como en algunos eucariotas inferiores Genes desarrollados por ingeniera gentica pueden crear mutaciones dominantes especficas en los organismos diploides

347 347 348

349

Genes sometidos a ingeniera gentica se pueden insertar de forma permanente en la lnea germinal de un ratn o de la mosca del vinagre, produciendo animales trangnicos El direccionamiento gnico hace posible obtener ratones transgnicos que carecen de determinados genes Las plantas transgnicas son importantes tanto para la biologa celular como para la agricultura Resumen

351

353 355 356 356

350

Bibliografa

El ncleo celular
El DNA cromosmico y su empaquetamiento Cada molcula de DNA que forma un cromosoma ha de contener un centrmero, dos telmeros y varios orgenes de replicacin La mayor parte del DNA cromosmico no codifica protenas esenciales ni RNA Cada gen produce una molcula de RNA La comparacin entre secuencias de DNA de organismos relacionados permite diferenciar entre regiones de DNA de secuencia conservada y no conservada Las histonas son las principales protenas estructurales en los cromosomas eucariotas La asociacin de las histonas con el DNA conduce a la formacin de los nucleosomas, las partculas unitarias de la cromatina La posicin de los nucleosomas en el DNA viene determinada por la tendencia del DNA a formar bucles estrechos y por la presencia de otras protenas de unin al DNA Habitualmente los nucleosomas se empaquetan con la histona H1 formando estructuras regulares de orden superior Resumen La estructura global de los cromosomas Los cromosomas plumulados contienen bucles de cromatina descondensada Tambin se pueden apreciar dominios estructurales organizados en la cromatina interfsica en los cromosomas politnicos Los diferentes dominios de la cromatina de los cromosomas politnicos pueden empaquetarse y desempaquetarse como una unidad Es probable que tanto las bandas como las interbandas de los cromosomas politnicos contengan genes La cromatina est menos condensada en las regiones que son transcripcionalmente activas La cromatina activa es bioqumicamente diferente La heterocromatina est muy condensada y es transcripcionalmente inactiva Los cromosomas mitticos estn formados por cromatina en su forma ms condensada Cada uno de los cromosomas mitticos presenta un patrn caracterstico de grandes dominios estructurales Resumen Replicacin del cromosoma Secuencias especficas de DNA actan como orgenes de replicacin Un sistema eucariota libre de clulas replica el cromosoma de un virus de simio Los orgenes de replicacin de los cromosomas eucariotas se activan en grupos 361

Captulo

361 363 364

366 366

367

Regiones distintas del mismo cromosoma se replican en diferente momento La cromatina muy condensada se replica tardamente en la fase S, mientras que la cromatina activa se replica temprano Las unidades de replicacin tardas coinciden con las bandas ricas en A-T en los cromosomas metafsicos El patrn ordenado de activacin de los orgenes de replicacin puede contribuir a la memoria de la clula Factores unidos a la cromatina aseguran que cada regin del DNA slo se replique una vez A medida que el DNA se replica, se van ensamblando nuevas histonas en la cromatina Los telmeros son secuencias cortas, repetidas, ricas en G, que se aaden al extremo de los cromosomas por accin de la telomerasa Resumen Sntesis y procesamiento del RNA Las RNA polimerasas intercambian subunidades cuando inician cada cadena de RNA En las clulas eucariotas, el RNA sintetiza por tres RNA polimerasas diferentes La RNA polimerasa II transcribe algunas secuencias de DNA mucho ms frecuentemente que otras Los precursores de los RNA mensajeros son modificados covalentemente en sus dos extremos El procesamiento del RNA elimina largas secuencias nucleotdicas del interior de las molculas de RNA Los transcritos hnRNA son inmediatamente recubiertos por protena y snRNP Las secuencias intrnicas se eliminan de las molculas de RNA en forma de lazo Habitualmente de cada transcrito de RNA se eliminan muchas secuencias intrnicas El estudio de la talasemia revela de qu forma la maduracin del RNA puede permitir que las protenas evolucionen Probablemente la maduracin del RNA catalizada por el espliceosoma evolucion a partir de mecanismos de automaduracin El transporte de los mRNA al citoplasma se retrasa hasta que la maduracin se ha completado Los RNA ribosmicos y los RNA de transferencia se sintetizan sobre conjuntos de genes idnticos dispuestos en tndem El nuclolo es una mquina productora de ribosomas El nuclolo es un subcompartimiento nuclear muy organizado Despus de cada mitosis, el nuclolo se ensambla de nuevo en determinados cromosomas Los cromosomas ocupan territorios discretos en el ncleo interfsico Est muy ordenado el ncleo? Resumen

385 386 386 387 388 389

389 390 391 392 393 393 395 397 398 400 401 402

368

369 370 371 371

373

374 375 376 377 378 378 380 381 382 382 383 384

403 404 405 407 408 409 410 411 412

xxii

ndice de materias

Organizacin y evolucin del genoma nuclear Los genomas se van ajustando de forma precisa por mutaciones puntuales y se remodelan radicalmente o aumentan de tamao por recombinacin gentica Las secuencias repetidas en tndem de DNA tienden a permanecer inalteradas La evolucin de la familia de los genes de la globina muestra que las duplicaciones al azar contribuyen a la evolucin de los organismos Los genes que codifican nuevas protenas se pueden crear mediante la recombinacin de exones La mayora de las protenas se han originado probablemente a partir de genes altamente fragmentados Una fraccin mayoritaria del DNA de los eucariotas superiores est formada por secuencias de nucletidos repetidas y no codificantes

413

413 414

415 417 417

Las secuencias de DNA satlite no tienen ninguna funcin conocida La evolucin de los genomas se ha acelerado mediante al menos tres tipos de elementos transponibles Los elementos transponibles afectan frecuentemente a la regulacin gnica Las explosiones de transposicin provocan cambios catastrficos en los genomas e incrementan la diversidad biolgica Aproximadamente un diez por ciento del genoma humano consiste en dos familias de elementos transponibles Resumen Bibliografa

420

421 422

423

423 424 424

419

El control de la expresin gnica


Introduccin al control gnico 429 Los distintos tipos celulares de un organismo pluricelular contienen el mismo DNA 429 Distintos tipos celulares sintetizan distintos conjuntos de protenas 430 Un clula puede cambiar la expresin de sus genes como respuesta a seales externas 431 La expresin gnica se puede regular en muchas de las etapas de la va que conduce desde el DNA al RNA y a las protenas 431 Resumen 432 Motivos estructurales de unin a DNA en las protenas de regulacin gnica Las protenas de regulacin gnica se descubrieron utilizando tcnicas de gentica bacteriana El exterior de la hlice de DNA puede ser ledo por protenas La geometra de la doble hlice de DNA depende de la secuencia de nucletidos Secuencias cortas de DNA son componentes fundamentales de los interruptores genticos Las protenas de regulacin gnica contienen motivos estructurales que pueden leer secuencias de DNA El motivo hlice-giro-hlice es uno de los motivos de unin a DNA ms simples y comunes Las protenas de homeodominios son una clase especial de protenas hlice-giro-hlice Existen diferentes tipos de motivos de unin a DNA en forma de dedos de zinc Las lminas P tambin pueden reconocer el DNA El motivo cremallera de leucina est implicado tanto en el reconocimiento del DNA como en la dimerizacin El motivo hlice-bucle-hlice tambin est implicado en la dimerizacin y la unin al DNA An no es posible predecir la secuencia de DNA que es reconocida por una protena reguladora Un ensayo de movilidad en gel permite detectar con gran facilidad protenas que se unen a una secuencia especfica de DNA La cromatografa de afinidad de DNA facilita la purificacin de protenas de unin a secuencias especficas de DNA Resumen Cmo funcionan los interruptores genticos El represor de triptfano es un interruptor simple que activa y desactiva genes en bacterias Los activadores transcripcionales activan los genes Un activador transcripcional y un represor transcripcional controlan el opern lac 432 432 433 433 435 435 437 438 439 440 440 442 442

Captulo
B La regulacin de la transcripcin en las clulas eucariotas es compleja Las RNA polimerasas eucariotas requieren factores de transcripcin generales Los incrementadores o activadores controlan los genes a distancia Una regin de control eucariota est formada por un promotor y por las secuencias de DNA reguladoras Muchas protenas activadoras aceleran el ensamblaje de los factores generales de transcripcin Las protenas represoras pueden inhibir la transcripcin de diferentes formas Las protenas reguladoras de genes de clulas eucariotas frecuentemente se ensamblan formando pequeos complejos sobre el DNA Los complejos interruptores genticos que regulan el desarrollo de D rosophila estn formados por mdulos menores El gen eve de Drosophila est regulado por controles combinatorios En mamferos las regiones de control tambin estn formadas a partir de mdulos reguladores sencillos A su vez, la actividad de una protena de regulacin gnica puede estar regulada Las bacterias utilizan subunidades intercambiables de la RNA polimerasa para colaborar en el control de la transcripcin gnica Los interruptores genticos han evolucionado gradualmente Resumen Estructura de la cromatina y el control de la expresin gnica La transcripcin del DNA que est empaquetado en nucleosomas se puede activar Algunas formas de la cromatina impiden la transcripcin Antes de que los genes de globina de mamfero puedan transcribirse, puede ser necesaria una etapa de descondensacin No se conocen los mecanismos que forman la cromatina activa La tensin superhelicoidal del DNA permite la accin a distancia Resumen Mecanismos genticos que originan tipos celulares especializados Los cambios de fase de las bacterias son provocados por reorganizaciones del DNA

449 450 451 452 453 454

454

456 457 458 459

460 461 461 462 463 463 465 466 467 469 469 469

443 444 445 445 446 447 448

ndice de materias

xxiii

En levaduras, algunas protenas reguladoras determinan la identidad del tipo celular Dos protenas fgicas que se reprimen mutuamente su sntesis determinan el estado del bacterifago lambda La expresin de una protena reguladora crtica puede disparar la expresin de una batera de genes situados por debajo (en direccin 3) El control gnico combinatorio es la norma en los eucariotas Se hereda un cromosoma X inactivo Los genes de Drosophila y de levadura tambin pueden inactivarse por caractersticas hereditarias de su estructura cromatnica Cuando las clulas de vertebrados se dividen, pueden heredar el patrn de metilacin del DNA En las clulas de los vertebrados la metilacin del DNA refuerza las decisiones del desarrollo La actividad genmica heredable requiere metilacin del DNA En los mamferos, las islas ricas en CG estn asociadas con alrededor de 40 000 genes Resumen Controles post-transcripcionales La atenuacin de la transcripcin causa una terminacin temprana de algunas molculas de RNA La maduracin alternativa del RNA puede producir diferentes formas de proteina a partir de un mismo gen La determinacin del sexo en D rosophila depende de una serie de procesos de maduracin alternativa regulada del RNA

470 472

474 475 476

478 479 480 481 482 483 484 484 484

Un cambio en el punto de rotura del transcrito de RNA y la adicin de poli-A puede cambiar el extremo carboxilo terminal de una protena La definicin de gen se ha de modificar debido al descubrimiento de la maduracin alternativa del RNA El transporte de RNA desde el ncleo puede ser regulado Algunos RNA estn localizados en regiones especficas del citoplasma La edicin del RNA puede cambiar el sentido del mensaje del RNA Las clulas eucariotas y procariotas utilizan estrategias diferentes para especificar el lugar de inicio de la traduccin en una molcula de mRNA La fosforilacin de un factor de iniciacin regula la sntesis de protenas Las protenas que se unen a la regin 5 lder de los mRNA intervienen en el control traduccional negativo La expresin gnica puede estar controlada por variaciones de la estabilidad del mRNA La degradacin selectiva del mRNA est acoplada a la traduccin El control citoplasmtico de la longitud de las cadenas de poli-A pueden afectar tanto la traduccin como la estabilidad del mRNA Algunos mRNA contienen seales d reconocimiento que interrumpen el proceso normal de la traduccin Es muy probable que las reacciones catalizadas por RNA tengan un origen muy antiguo Resumen Bibliografa

486 487 488 489 490

492 493 494 495 496

497 498 499 499 500

485

Organizacin interna de la clula


Estructura de la membrana
La bicapa lipidica Los lpidos de las membranas son molculas antipticas que espontneamente forman bicapas La bicapa lipidica es un fluido bidimensional La fluidez de una bicapa lipidica depende de su composicin La bicapa lipidica es asimtrica En la superficie de todas las membranas plasmticas hay glucolpidos Resumen Protenas de membrana Las protenas de membrana pueden estar asociadas a la bicapa lipidica de varias maneras Se considera que, en la mayora de protenas transmembrana, las regiones de la cadena polipeptdica que cruzan la bicapa lipidica presentan una conformacin en hlice a Las protenas de membrana pueden solubilizarse y purificarse mediante detergentes El lado citoplasmtico de las protenas de membrana se puede estudiar en fantasmas de eritrocito La espectrina es una proteina del citoesqueleto asociada no covalentemente a la cara citoplasmtica de la membrana del eritrocito 510 510 511 513 514 516 517 517 518 La glucoforina atraviesa la bicapa lipdica del glbulo rojo, formando una hlice a sencilla La banda 3 de la membrana celular del eritrocito es una protena de membrana multipaso que cataliza el cotransporte aninico La bacteriorrodopsina es una bomba de protones que atraviesa la bicapa en forma de siete hlices a Las porinas son protenas transmembrana formadoras de canales que cruzan la membrana en forma de un barril (3 Las protenas de membrana actan a menudo como grandes complejos Muchas protenas de membrana difunden en el plano de la membrana Las clulas pueden confinar a lpidos y a protenas en dominios especficos de la membrana La superficie celular est recubierta con residuos de azcar Las selectinas son protenas de membrana que se unen a carbohidratos de la superficie celular y que median adhesiones celulares transitorias en el torrente sanguneo Resumen Bibliografa 526

527

528

530 531 531 534 535

519 521 522

536 538 538

524

xxiv

ndice de materias

Transporte de molculas pequeas a travs de la membrana y base inica de la excitabilidad de la membrana


Principios de transporte a travs de membrana Las bicapas lipdicas libres de protena son altamente impermeables a los iones Existen dos clases principales de protenas de transporte a travs de membrana: protenas transportadoras y protenas de canal El transporte activo est mediado por protenas transportadoras acopladas a una fuente energtica La tecnologa del DNA recombinante ha revolucionado el estudio de las protenas de transporte a travs de membrana Se pueden utilizar ionforos como herramientas para incrementar la permeabilidad de las membranas a determinados iones Resumen Protenas transportadoras y transporte activo a travs de membrana La bombas Na+ -K+de la membrana plasmtica es una ATPasa La ATPasa de Na+ -K+es necesaria para mantener el equilibrio osmtico y estabilizar el volumen celular Algunas bombas de Ca2 +tambin son ATPasas unidas a membrana Algunas enzimas ligadas a membrana que sintetizan ATP son ATPasas de transporte que actan en sentido opuesto El transporte activo puede ser impulsado por gradientes inicos Las protenas de transporte impulsado por Na+de la membrana plasmtica regulan el pH citoslico En las clulas epiteliales, la distribucin asimtrica de protenas transportadoras permite el transporte transcelular de solutos Algunas ATPasas transportadoras de membrana son homlogas a las ATPasas transportadoras de eucariotas, que participan en la resistencia a drogas y en la fibrosis qustica: la superfamilia de transportadores ABC Resumen Canales inicos y propiedades elctricas de las membranas Los canilles inicos son selectivos para el ion y fluctan entre estados abiertos y cerrados 542 542

Captulo

11

543 543

544

545 546 547 548 550 551 553 553 554

555

555 558 558 559

El potencial de membrana de las clulas animales depende principalmente de los canales de fuga de K+y del gradiente de K+a travs de la membrana plasmtica Cuando se para la bomba de Na+ -K+ , el potencial de reposos slo decae lentamente La funcin de una clula nerviosa depende de su estructura alargada Los canales inicos regulados por voltaje son los responsables de la generacin de potenciales de accin en clulas excitables elctricamente La mielinizacin incrementa la velocidad y la eficiencia de la propagacin de los potenciales de accin en las clulas nerviosas El registro de zona indica que cada uno de los canales de Na+se abre siguiendo la ley del todo o nada Los canales catinicos regulados por voltaje estn relacionados evolutiva y estructuralmente En las sinapsis qumicas los canales inicos regulados por transmisor transforman seales qumicas en seales elctricas Las sinapsis qumicas pueden ser excitadoras o inhibidoras Los receptores de acetilcolina de las uniones neuromusculares son canales catinicos regulados por transmisor Los canales inicos regulados por transmisor son las dianas principales de la accin de drogas psicoactivas La transmisin neuromuscular implica la activacin secuencial de al menos cuatro grupos de canales inicos regulados El potencial postinptico principal de una neurona representa la suma espacial y temporal de muchos pequeos potenciales postsinpticos La integracin neuronal requiere la combinacin de al menos tres tipos de canales de K+diferentes La potenciacin a largo plazo en el hipocampo de los mamferos depende de la entrada de Ca2 + a travs de canales receptores NMDA Resumen Bibliografa

560 561 563

565

567 567 570

572 573

574

575

577

578 580

582 584 585

Compartimientos intracelulares y clasificacin de protenas


La compartimentacin de las clulas superiores Todas las clulas eucariotas tienen la misma coleccin bsica de orgnulos rodeados de membrana La relacin topolgica de los orgnulos rodeados de membrana puede ser interpretada en trminos de sus orgenes evolutivos Las protenas pueden desplazarse entre compartimientos de diferentes maneras Los pptidos seal y la regin seal determinan el destino celular correcto de las protenas Las clulas no pueden construir d e novo sus orgnulos rodeados de membrana: necesitan informacin del propio orgnulo Resumen El transporte de molculas hacia dentro y hacia fuera del ncleo Los poros nucleares atraviesan la envoltura nuclear 589 589 Unas seales de localizacin nuclear dirigen las protenas nucleares hacia el ncleo Las macromolculas son transportadas activamente hacia dentro y hacia fuera del ncleo a travs de los poros nucleares La envoltura nuclear se desorganiza durante la mitosis El transporte entre el ncleo y el citosol puede ser regulado evitando el acceso a la maquinaria transportadora Resumen El transporte de protenas al interior de mitocondrias y de cloroplastos La translocacin hacia la matriz mitocondrial depende de una seal tpica de la matriz La translocacin hacia la matriz mitocondrial depende del gradiente electroqumico a travs de la membrana interna y de la hidrlisis de ATP

Captulo

12
601

592 594 596

603 604

605 606 607 607

597 599 599 600

608

ndice de materias

XXV

Las protenas mitocondriales son importadas hacia la matriz mediante un proceso de dos etapas, a travs de lugares de contacto que unen las membranas externa e interna Las protenas son importadas hacia el interior de la matriz mitocondrial, en un estado desplegado La unin secuencial de las protenas importadas a las protenas mitondriales hsp70 y hsp60 impulsa su translocacin y ayuda al plegamiento proteico El transporte de protenas al espacio intermembrana mitocondrial requiere dos seales Para dirigir el transporte de protenas a la membrana tilacoidal de los cloroplastos se necesita la participacin de dos pptidos seal Resumen Peroxisomas Los peroxisomas utilizan el oxgeno molecular y el perxido de hidrgeno para realizar reacciones oxidativas Una corta secuencia seal dirige la importacin de protenas hacia los peroxisomas Resumen El retculo endoplasmtico Los ribosomas adheridos a las membranas definen el ER rugoso El ER liso es abundante en algunas clulas especializadas Las regiones lisas del ER pueden separarse de las rugosas mediante centrifugacin Los pptidos seal fueron descubiertos por primera vez en protenas importadas al ER

609 610

611 611

612 613 614

614 616 616 617 617 618 620 622

Una partcula de reconocimiento de seal (SRP) dirige los pptidos seal para el ER a un receptor especfico de la membrana del ER La translocacin a travs de la membrana del ER no siempre requiere que se est produciendo el crecimiento de la cadena polipeptdica La cadena polipeptdica pasa a travs de un poro acuoso en el aparato de translocacin El pptido seal del ER es eliminado de la mayora de protenas solubles despus de la translocacin En las protenas transmembrana de un solo paso, un pptido seal interno permanece en la bicapa lipdica como una hlice a que atraviesa la membrana Combinaciones de seales de inicio y de paro de transferencia determinan la topologa de las protenas transmembrana de multipaso Las cadenas polipeptdicas translocadas se pliegan y se ensamblan en el lumen del ER rugoso La mayora de protenas sintetizadas en el ER rugoso son glucosiladas por la adicin de un AT-oligosacrido comn Algunas protenas de membrana, poco despus de entrar en el ER, intercambian un cola transmembrana carboxilo terminal por un glucosilfosfatidilinositol (GPI) unido de forma covalente La mayora de las bicapas lipdicas de membrana son ensambladas en el ER Las protenas de intercambio de fosfolpidos pueden transportar fosfolpidos desde el ER a las mitocondrias y a los peroxisomas Resumen Bibliografa

623

623 624 625

626

627 629 630

632 633

634 635 636

Trfico vesicular mediante las rutas secretora y endoctica


Transporte desde el ER al complejo de Golgi El complejo de Golgi est formado por una serie de compartimientos ordenados Las protenas residentes en el ER son selectivamente recuperadas de la red del cis Golgi Las protenas del Golgi vuelven al ER cuando las clulas se tratan con la droga brefeldina A En el complejo de Golgi se procesan las cadenas de oligosacrido Las cisternas del Golgi estn organizadas en forma de series secuenciales de compartimientos de procesamiento Los proteoglucanos son ensamblados en el complejo de Golgi Los carbohidratos de las membranas celulares se encuentran en la cara de la membrana que es topolgicamente equivalente al exterior de la clulas Cul es el propsito de la glucosilacin? Resumen Transporte desde la red del trans Golgi a los lisosomas Los lisosomas son el lugar principal de digestin intracelular Los lisosomas son heterogneos Las vacuolas de las plantas y de los hongos son lisosomas muy verstiles Los materiales son transportados hasta los lisosomas a travs de varias rutas Algunas protenas citoslicas son transportadas directamente a los lisosomas para ser degradadas Las enzimas lisosomales son clasificadas en la red del trans Golgi por un receptor proteico unido a membrana que reconoce la maosa 6-fosfato El receptor de maosa 6-fosfato viaja como una lanzadera, adelante y atrs, entre determinadas membranas 642 643 644 645 646 647 649

Captulo

13

Una regin seal en la cadena polipeptdica proporciona la clave para marcar una enzima lisosomal con la maosa 6-fosfato Los defectos en la GlcNAc-fosfotransferasa causan una enfermedad de acmulo lisosomal en humanos Resumen Transporte desde la membrana plasmtica va endosomas: endocitosis Clulas fagocticas especializadas pueden ingerir grandes partculas Las vesculas de pinocitosis se forman en la membrana plasmtica a partir de depresiones revestidas Las depresiones revestidas de clatrina pueden actuar como un mecanismo concentrador internalizando macromolculas extracelulares especficas Las clulas importan colesterol por endocitosis mediada por receptor El material endocitado termina frecuentemente en los lisosomas Determinadas protenas son recuperadas de los endosomas tempranos y devueltas a la membrana plasmtica La relacin entre endosomas tempranos y tardos es incierta Las macromolculas pueden ser transferidas a travs de las lminas de clulas epiteliales mediante transcitosis Las clulas epiteliales tienen dos compartimientos endosomales tempranos distintos pero un solo compartimiento endosomal tardo comn Resumen Transporte desde la red del trans Golgi hasta la superficie celular: exocitosis Parece que muchas protenas y lpidos son transportados automticamente desde el ER y el complejo de Golgi a la superficie celular

659 659 660 661 661 662

650 650 652 652 652 654 654 656 656

663 664 665 666 668 668

669 669 670

657 658

670

xxvi

ndice de materias

Las vesculas de secrecin emergen por gemacin desde la red del trans Golgi A menudo las protenas son procesadas proteolticamente durante la formacin de las vesculas de secrecin Las vesculas de secrecin permanecen cerca de la membrana plasmtica hasta que una seal les hace liberar su contenido La exocitosis regulada es una respuesta localizada de la membrana plasmtica y del citoplasma subyacente Los componentes de la membrana de las vesculas de secrecin se reciclan Las vesculas sinpticas se forman a partir de los endosomas Las clulas polarizadas dirigen las protenas desde la red del trans Golgi hasta el dominio apropiado de la membrana plasmtica Resumen Mecanismos moleculares del transporte vesicular y mantenimiento de la diversidad de compartimientos El mantenimiento de las diferencias entre compartimientos requiere un aporte de energa libre Existe ms de un tipo de vesculas revestidas

671 672

673 674 674 675

675 677 678 678 679

El ensamblaje del revestimiento de clatrina conduce a la formacin de la vescula Las adaptinas reconocen protenas transmembrana especficas y las unen al revestimiento de clatrina Las vesculas revestidas de coatmero median el transporte vesicular no selectivo El transporte vesicular depende de protenas reguladoras que unen GTP Parece que ARF sealiza el ensamblaje y el desensamblaje del revestimiento de coatmero Marcadores proteicos de orgnulo, llamados SNARE, colaboran en la direccin del transporte de vesculas Se cree que las protenas Rab aseguran la especificidad de la unin de las vesculas La fusin de vesculas est catalizada por una maquinaria de fusin de membrana La protena de fusin de membrana mejor caracterizada est sintetizada por un virus Resumen Bibliografa

680 684 685 686 686

687 688 689 690 691 692

Conversin energtica: mitocondrias y cloroplastos


La mitocondria La mitocondria presenta una membrana externa y una membrana interna que define dos compartimientos internos La oxidacin mitocondrial empieza cuando se generan grandes cantidades de acetil CoA a partir de piruvato y de cidos grasos en el espacio de la matriz El ciclo del cido ctrico oxida el grupo acetilo del acetil CoA, generando NADH y FADH2 para la cadena respiratoria En la membrana mitocondrial interna, un proceso quimiosmtico convierte la energa de oxidacin en ATP Los electrones son transferidos desde el NADH hasta el oxgeno, a travs de tres grandes complejos enzimticos respiratorios La energa liberada por el paso de los electrones a lo largo de la cadena respiratoria se almacena en forma de gradiente electroqumico de protones a travs de la membrana mitocondrial interna La energa almacenada en el gradiente electroqumico de protones se utiliza para producir ATP y para transportar metabolitos e iones inorgnicos hacia el espacio de la matriz La rpida conversin de ADP en ATP en las mitocondrias mantiene una elevada relacin ATP-ADP en las clulas La diferencia entre AG y AG: para que la hidrlisis de ATP sea til para la clula es necesario que tenga un valor muy negativo de AG La respiracin celular es notablemente eficiente Resumen La cadena respiratoria y la ATP sintasa A partir de las mitocondrias se pueden aislar partculas invertidas funcionales La ATP sintasa puede ser purificada y de nuevo incorporada a las membranas La ATP sintasa puede funcionar de manera reversible, hidrolizando ATP y bombeando H+ La cadena respiratoria bombea H+a travs de la membrana mitocondrial interna Se han utilizado mtodos espectroscpicos para identificar muchos transportadores de electrones de la cadena respiratoria La cadena respiratoria contiene tres grandes complejos enzimticos incluidos en la membrana 699 700

Captulo

14
723

702 705 706

708

710

710 711

En la citocromo oxidasa, un centro de hierro-cobre cataliza de forma eficiente la reduccin del 0 2 Las transferencias de electrones estn mediadas por colisiones aleatorias que se producen entre los dadores y los aceptores que difunden en la membrana mitocondrial interna Una gran cada de potencial redox a travs de cada uno de los tres complejos enzimticos respiratorios aporta energa para el bombeo de H+ El mecanismo del bombeo de H+se conoce mejor en bacteriorrodopsina Los ionforos de H+disipan el gradiente de H+ , desacoplando as el transporte de electrones de la sntesis de ATP Normalmente el control respiratorio restringe el flujo de electrones a travs de la cadena Existen desacoplantes naturales que transforman las mitocondrias del tejido adiposo marrn en mquinas generadoras de calor Todas las bacterias utilizan mecanismos quimiosmticos para ahorrar energa Resumen Cloroplastos y fotosntesis El cloroplasto es un miembro de una familia de orgnulos exclusivos de las plantas -los plastidios Los cloroplastos se parecen a las mitocondrias, pero tienen un compartimiento adicional Dos reacciones caractersticas de los cloroplastos: la produccin de ATP y de NADPH, impulsada por la luz, y la conversin de C 02 en carbohidratos La fijacin del carbono est catalizada por la ribulosa bisfosfato carboxilasa En el ciclo de fijacin del carbono se consumen tres molculas de ATP y dos molculas de NADPH por cada molcula de C 0 2 fijada En algunas plantas, la fijacin del carbono est compartimentada para facilitar el crecimiento a concentraciones bajas de C 0 2 La fotosntesis depende de la fotoqumica de las molculas de clorofila Un fotosistema contiene un centro de reaccin y un complejo antena

725

725 726

727 728

728 729 730 730 731 733

712 716 716 717 717 717 719 720

733 734

735

736 737 738

720 721

ndice de materias

xxvii

En un centro de reaccin, la energa capturada por la clorofila genera un dador fuerte de electrones a partir de uno dbil En plantas y en cianobacterias, la fotofosforilacin no cclica produce NADPH y ATP Los cloroplastos pueden producir ATP por fotofosforilacin cclica sin generar NADPH El gradiente electroqumico de protones es similar en las mitocondrias y los cloroplastos Como la membrana mitocondrial interna, la membrana interna del cloroplasto contiene protenas transportadoras que facilitan el intercambio de metabolitos con el citosol Los cloroplastos llevan a cabo otros procesos biosintticos Resumen Evolucin de las cadenas de transporte de electrones Probablemente las clulas ms primitivas producan ATP mediante fermentacin La evolucin de la cadena de transporte electrnico conservadora de energa capacit a las bacterias anaerbicas para utilizar compuestos orgnicos no fermentadles como fuente de energa Las bacterias fotosintticas, suministrando una fuente inagotable de poder reductor, superaron el mayor obstculo de la evolucin de las clulas Las cadenas de transporte electrnico de los complejos fotosintticos de las cianobacterias produjeron oxgeno atmosfrico y permitieron nuevas formas de vida Resumen Los genomas de las mitocondrias y de los cloroplastos La biosntesis de las mitocondrias y de los cloroplastos supone la contribucin de dos sistemas genticos diferentes

739 740 742 742

743 743 743 744 744

744

746

748 750 751

El crecimiento y la divisin de los orgnulos mantiene el nmero de mitocondrias y de cloroplastos en la clula Generalmente los genomas de los cloroplastos y de las mitocondrias son molculas de DNA circulares Las mitocondrias y los cloroplastos contienen sistemas genticos completos El genoma del cloroplasto de las plantas superiores contiene aproximadamente 120 genes Los genomas mitocondriales presentan varias caractersticas sorprendentes Las mitocondrias de animales contienen el sistema gentico ms simple de los conocidos Por qu los genomas mitocondriales en las plantas son tan grandes? Algunos genes de orgnulos contienen intrones Los genes mitocondriales se pueden distinguir de los genes nucleares gracias a su herencia no mendeliana (citoplasmtica) En muchos organismos, los genes de los orgnulos se heredan de la madre Los mutantes diminutos en levadura demuestran la extraordinaria importancia del ncleo celular en la biognesis mitocondrial Las mitocondrias y los cloroplastos contienen protenas especficas de tejido Las mitocondrias importan la mayor parte de sus lpidos mientras que los cloroplastos producen la mayor parte de ellos Probablemente, tanto las mitocondrias como los cloroplastos han evolucionado a partir de bacterias endosimbiticas Por qu los cloroplastos y las mitocondrias tienen sus propios sistemas genticos? Resumen Bibliografa

752 753 754 755 756 757 758 758

759 760

761 762

762 762 764 765 766

751

Transmisin de seales entre clulas


Principios generales de la sealizacin celular 771 Las molculas seal extracelulares son reconocidas por receptores especficos de la superficie o del interior de las clulas diana 772 Las molculas secretadas median tres formas de sealizacin: la paracrina, la sinptica y la endocrina 773 La sealizacin autocrina puede coordinar decisiones de grupos de clulas idnticas 774 Las uniones comunicantes permiten que la informacin de sealizacin sea compartida por las clulas vecinas 776 Cada clula est programada para responder a combinaciones especficas de molculas seal 776 Diferentes clulas pueden responder de forma diferente a la misma seal qumica 777 La concentracin de una molcula puede ajustarse rpidamente slo si la vida media de la molcula es corta 777 El gas xido ntrico acta como una seal, unindose directamente a una enzima en el interior de la clula diana 779 Las hormonas esteroideas, las hormonas tiroideas, los retinoides y la vitamina D se unen a receptores intracelulares que son protenas reguladoras de genes activadas por ligando 779 Se conocen tres clases de protenas receptoras de superficie celular: las asociadas a canales inicos, las asociadas a protenas G y las asociadas a enzimas 782 Los receptores de superficie celular, una vez activados, desencadenan la adicin de grupos fosfato a una red de protenas intracelulares 783 Resumen 784

iptulo

15
Sealizacin va receptores de superficie celular asociados a protenas G Las protenas G trimricas transmiten la seal intracelular desde los receptores asociados a protenas G Algunos receptores incrementan los niveles intracelulares de AMP cclico activando la adenil ciclasa a travs de una protena G estimuladora (Gs) Se cree que las protenas G trimricas se desensamblan cuando son activadas Algunos receptores disminuyen los niveles de AMP cclico inhibiendo la adenil ciclasa va una protena G trimrica inhibidora (G,) La protena quinasa dependiente de AMP cclico (quinasa A) media los efectos del AMP cclico Diversas protena serina/treonina fosfatasas revierten rpidamente los efectos de la quinasa A Para utilizar el Ca2 +como seal intracelular, las clulas han de mantener los niveles basales de Ca2 + muy bajos El Ca2 + acta como un mensajero intracelular ubicuo Algunos receptores relacionados con protenas G activan el proceso de sealizacin de fosfolpidos de inositol activando la fosfolipasa C-0 El inositol trisfosfato (IP3) acopla la activacin del receptor con la liberacin de Ca2 + del ER A menudo las oscilaciones de Ca2 + prolongan la respuesta inicial de Ca2 + inducida por IP3 El diacilglicerol activa la protena quinasa C (quinasa C) La calmodulina es un receptor intracelular de Ca2 +ubicuo 786 786

787 788

791 791 793

794 795

796 797 798 799 801

xxviii

ndice de materias

En las clulas animales la mayora de acciones del Ca2t se producen a travs de protena quinasas dependientes de Ca2+ -calmodulina (quinasas CaM) Los procesos de Ca2 +y de AMP cclico interaccionan entre s Algunas protenas G trimricas regulan directamente canales inicos La olfaccin y la visin dependen de receptores asociados a protenas G y de canales inicos regulados por nucletidos cclicos Las seales extracelulares son notablemente amplificadas mediante la utilizacin de mensajeros intracelulares y de cascadas enzimticas Las clulas pueden responder de forma sbita a incrementos graduales de la concentracin de una seal extracelular El efecto de algunas seales puede ser recordado por la clula Resumen Sealizacin va receptores de superficie celular asociados a enzimas Los receptores guanilato ciclasa generan GMP cclico directamente Los receptores para la mayora de los factores de crecimiento son protenas transmembrana que presentan actividad protena tirosina quinasa especfica Los residuos tirosina fosforilados son reconocidos por protenas con dominios SH2 Las protenas Ras constituyen un eslabn crucial en la cascada intracelular de sealizacin activada por receptores protena quinasa Una protena SH adapatadora acopla los receptores tirosina quinasa con Ras: evidencias que provienen del desarrollo del ojo de Drosophila Ras activa una cascada de fosforilaciones serina/treonina que activa la MAP- quinasa La actividad de los receptores asociados a tirosina quinasa depende de tirosina quinasas que no son receptores Algunos receptores son protena tirosina fosfatasas

802 803 804

La utilizacin de oncogenes que provocan cncer ha permitido identificar muchos componentes del proceso de sealizacin de los receptores tirosina quinasa Las protenas de la superfamilia TGF-P activan receptores que son protena serina/treonina quinasas El receptor transmembrana Notch media la inhibicin lateral mediante un mecanismo desconocido Resumen Adaptacin de las clulas diana La adaptacin lenta depende de la regulacin por disminucin del nmero de receptores A menudo la adaptacin rpida se produce por fosforilacin de los receptores Algunas formas de adaptacin son debidas a cambios en el proceso de sealizacin La adaptacin desempea un papel crucial en la quimiotaxis bacteriana La quimiotaxis bacteriana est mediada por una familia de cuatro receptores transmembrana homlogos y por un sistema de fosforilacin que transmite la seal En la quimiotaxis bacteriana, la metilacin del receptor es responsable de la adaptacin Resumen La lgica de la sealizacin intracelular: lecciones de redes neuronales basadas en los ordenadores Las redes neuronales basadas en el ordenador pueden ser entrenadas Las redes de sealizacin celular pueden observarse como redes neuronales entrenadas por la evolucin Las redes de sealizacin capacitan a las clulas para responder a complejos patrones de seales extracelulares Las redes seal son robustas Resumen Bibliografa

822 823 823 824 825 825 826 827 827

805

807 808 811 811 812 812

830 831 833 833 834 835 836 837 837 838

813 815

816

817 818 820 821

El citoesqueleto
La naturaleza del citoesqueleto El citoplasma de una clula eucariota est organizado espacialmente por los filamentos de actina, los microtbulos y los filamentos intermedios La dinmica de los microtbulos emana del centrosoma La red microtubular puede encontrar el centro de la clula Determinadas protenas motoras utilizan la red microtubular como gua para posicionar los orgnulos rodeados de membrana El crtex de actina puede generar y mantener la polaridad celular Normalmente los filamentos de actina y los microtbulos actan juntos polarizando la clula Las funciones del citoesqueleto son difciles de estudiar Resumen Filamentos intermedios Los filamentos intermedios son polmeros de protenas fibrosas Las clulas epiteliales presentan una familia muy diversa de filamentos de queratina Muchas clulas no epiteliales presentan sus propios filamentos intermedios citoplasmticos diferenciales La lmina nuclear est constituida por un tipo especial de protenas de filamentos intermedios: las lamininas Los filamentos intermedios proporcionan estabilidad mecnica a las clulas animales Resumen 844

Captulo

16
Microtbulos Los microtbulos son cilindros huecos formados por tubulina Los microtbulos son estructuras muy lbiles, sensibles a drogas antimitticas especficas El alargamiento de un microtbulo es un proceso rpido, mientras que la nucleacin de un nuevo microtbulo es un proceso lento Los dos extremos de un microtbulo son diferentes y crecen a velocidades diferentes Los centrosomas son el lugar primario de nucleacin de los microtbulos en las clulas animales En las clulas animales los microtbulos se despolimerizan y repolimerizan continuamente La hidrlisis de GTP puede explicar la inestabilidad dinmica de los microtbulos individuales La inestabilidad dinmica de los microtbulos proporciona un principio organizador para la morfognesis celular Los microtbulos sufren una lenta maduracin como resultado de modificaciones post-traduccionales de sus subunidades de tubulina Las protenas asociadas a microtbulos (MAP) se unen a los microtbulos y modifican sus propiedades Las MAP colaboran en la generacin de regiones citoplasmticas funcionalmente distintas La quinesina y la dinena dirigen el movimiento de los orgnulos a lo largo de los microtbulos 860 860 861

844 844 846

862 863 864 866 867

848 849 850 851 852 852 853 854 856 857 858 860

868

869 870 870 871

ndice de materias

xxix

La velocidad y la direccin de desplazamiento a lo largo de los microtbulos son especficas del dominio globular de las protenas motoras Resumen Cilios y centrolos Los cilios se mueven por el batido de un axonema -un complejo haz de microtbulos La dinena dirige el movimiento de los cilios y de los flagelos Cilios y flagelos crecen a partir de corpsculos basales que estn muy ntimamente relacionados con los centrolos Los centrolos suelen aparecer por duplicacin de los centrolos preexistentes Resumen Filamentos de actina Los filamentos de actina son delgados y flexibles La actina y la tubulina polimerizan por mecanismos parecidos El comportamiento dinmico de los filamentos de actina requiere la hidrlisis del ATP Las funciones de los filamentos de actina son inhibidas por drogas estabilizadoras y desestabilizadoras del polmero La molcula de actina se une a pequeas protenas que ayudan a controlar su polimerizacin Muchas clulas emiten, desde su borde frontal de avance, microespinas y lamelipodios dinmicos que contienen actina El borde frontal de avance de las clulas mviles nuclea la polimerizacin de la actina Algunas bacterias patgenas utilizan la actina para moverse dentro y entre las clulas La polimerizacin de la actina en el crtex celular est controlada por receptores de la superficie celular Protenas G heterotrimricas y pequeas GTPasas transmiten seales desde la superficie celular al crtex de actina Los mecanismos de polarizacin celular pueden ser analizados en las clulas de levadura Resumen Protenas de unin a la actina Un citoesqueleto unido de manera sencilla a la membrana proporciona soporte mecnico a la membrana plasmtica de los eritrocitos

872 873 874 874 876 877 878 879 880 880 880 884 885 885

Protenas de entrecruzamiento con diferentes propiedades organizan ensamblajes particulares de actina Las protenas de unin a la actina con propiedades diferentes estn construidas a partir de mdulos semejantes La gelsolina, cuando se activa por Ca2+ , fragmenta los filamentos de actina En las clulas eucariotas se han encontrado mltiples tipos de miosina En clulas no musculares pueden formarse transitoriamente ensamblajes semejantes a los musculares Los contactos focales permiten que los filamentos de actina se extiendan hacia el substrato Los microvilli ilustran de qu forma los haces de filamentos entrecruzados de actina pueden estabilizar zonas locales de la membrana plasmtica El comportamiento de la corteza celular depende de un equilibrio de interacciones cooperativas y competitivas entre una gran coleccin de protenas de unin a la actina La migracin de las clulas animales comporta tres subprocesos distintos dependientes de actina El mecanismo de la locomocin celular puede ser diseccionado genticamente Resumen El msculo Las miofibirillas estn formadas por ensamblajes repetitivos de filamentos gruesos y delgados La contraccin se produce por el deslizamiento de los filamentos de miosina y de actina entre s Las cabezas de miosina caminan hacia el extremo menos de los filamentos de actina La contraccin muscular se inicia por un aumento repentino de la concentracin de Ca2 + citoslico La troponina y la tropomiosina median la regulacin de la contraccin del msculo esqueltico por el Ca2 + Otras protenas accesorias mantienen la arquitectura de la miofibrilla y le proporcionan su elasticidad La misma maquinaria contrctil, en una forma modificada, se encuentra en el msculo cardaco y en el msculo liso En muchas clulas, la activacin de la miosina depende de la fosforilacin de la cadena ligera de la miosina Resumen Bibliografa

895 897 897 898 900 902

902

904 906 907 908 908 910 910 913 915 916 916 917 918 920 920

887 888 889 890 892 893 894 894

894

El ciclo de la divisin celular


La estrategia general del ciclo celular La replicacin del DNA nuclear ocurre durante una fase especfica de la interfase: la fase S Paralelamente al crecimiento continuo de la clula, durante el ciclo celular se producen una serie de procesos discretos Un sistema de control central desencadena los procesos esenciales del ciclo celular El control del ciclo celular es un mecanismo basado en una protena quinasa Resumen El ciclo celular de los embriones tempranos y la funcin del MPF El crecimiento del oocito de Xenopus est equilibrado por la divisin del huevo Un regulador citoplasmtico, el MPF, controla la entrada en la mitosis Las oscilaciones de la actividad MPF controlan el ciclo de divisin celular 926 927 La acumulacin y la destruccin de ciclina controla la activacin y la inactivacin de MPF La degradacin de la ciclina desencadena la salida de la mitosis El MPF puede actuar como autocataltico, estimulando su propia activacin El MPF activo induce los procesos subordinados de la mitosis El sistema de control del ciclo celular permite tiempo suficiente para que se produzca una ronda de replicacin del DNA en cada interfase Un bloqueo de la re-replicacin asegura que ningn segmento de DNA se replique ms de una vez en cada ciclo celular El paso por la mitosis hace desaparecer el bloqueo a las re-replicaciones Resumen Las levaduras y la gentica molecular del sistema de control del ciclo celular El crecimiento celular requiere una interfase prolongada con puntos de control del ciclo celular 937 939 939 939

929 929 931 933 933 934 935 936

940 941 941 943 943 944

xx x

ndice de materias

Las levaduras de fisin y de gemacin cambian de forma a medida que van progresando a lo largo del ciclo celular Las mutaciones del ciclo de divisin celular detienen el ciclo en puntos especficos; las mutaciones wee permiten al ciclo saltarse un punto de control de tamao Las subunidades del MPF en las levaduras son homologas a las del MPF en animales La actividad del MPF est regulada por fosforilacin y desfosforilacin El mecapismo de activacin del MPF controla el tamao de las levaduras de fisin Para la mayora de las clulas el punto de control principal del ciclo celular se encuentra en el Inicio de G, La protena Cdc2 se asocia con la ciclina G, para conducir a la clula ms all del Inicio Las ciclinas G, median muchos de los controles que actan en el Inicio La quinasa de Inicio pone en marcha la fabricacin de los componentes necesarios para la replicacin del DNA Los controles por retroalimentacin aseguran que las clulas completen un proceso de ciclo celular antes de comenzar el siguiente El DNA daado genera una seal que retrasa la mitosis Generalmente los controles por retroalimentacin en el ciclo celular dependen de seales inhibidoras Resumen Controles de la divisin celular en los animales pluricelulares El sistema de control del ciclo celular es ms elaborado que el de las levaduras

945

945 947 948 948 949 949 951 952

952 953 954 955 955 956

La regulacin del crecimiento y de la proliferacin de las clulas de mamfero se estudia normalmente en lneas celulares cultivadas Los factores de crecimiento estimulan la proliferacin de clulas de mamfero El crecimiento celular y la divisin celular pueden ser regulados independientemente Las clulas pueden retrasar su divisin entrando en un estado especializado de no-crecimiento La ausencia de suero evita el paso por el punto de control G, El sistema de control del ciclo celular puede desensamblarse rpidamente pero slo puede ensamblarse de nuevo, lentamente Las clulas vecinas compiten por los factores de crecimiento Las clulas animales normales en cultivo necesitan anclarse para superar el Inicio Estudios en clulas cancerosas revelan la existencia de genes implicados en el control de la proliferacin celular Los factores de crecimiento desencadenan cascadas de seales intracelulares Las ciclinas y la Cdk son inducidas por factores de crecimiento tras un largo retraso La protena retinoblastoma acta manteniendo la proliferacin bajo control La probabilidad de entrar en G0 aumenta con el nmero de divisiones celulares: la senescencia celular El cuerpo se genera y se mantiene mediante complicados patrones reguladores de la divisin celular Resumen Bibliografa

957 957 959 960 961

962 963 964 966 967 968 968 969 971 972 973

Los mecanismos de la divisin celular


Visin de conjunto de la fase M Tres caractersticas son exclusivas de la fase M: la condensacin cromosmica, el huso mittico y el anillo contrctil La divisin celular depende de la duplicacin del centrosoma Tradicionalmente la fase M se divide en seis estadios Los orgnulos citoplasmticos grandes se fragmentan durante la fase M asegurando que se heredan correctamente Resumen 977 Las cromtidas hermanas se separan repentinamente en la anafase La anafase se retrasa hasta que todos los cromosomas se posicionan en la placa metafsica Dos procesos diferentes separan las cromtidas en la anafase El desensamblaje de los microtbulos cinetocricos se produce durante la anafase A Dos fuerzas distintas podran contribuir a la anafase B En la telofase se recompone la envoltura nuclear alrededor de los grupos de cromosomas Resumen Citocinesis El huso mittico determina el lugar de la segmentacin del citoplasma durante la citocinesis El huso se reposiciona especficamente creando divisiones celulares asimtricas La actina y la miosina generan las fuerzas necesarias para la segmentacin En casos especiales, determinados componentes celulares se pueden segregar a una sola clula hija En las clulas de las plantas superiores, la citocinesis ocurre mediante un mecanismo especial Una red de citoesqueleto determina el plano de divisin de las clulas vegetales La elaborada fase M de los organismos superiores evolucion gradualmente a partir de organismos procariotas de fisin Resumen Bibliografa 995 996 996 996 998 999 1000 1001 1001 1002 1003 1005 1006 1007

977 978 980 984 985

Mitosis 985 La formacin del huso mittico en una clula en fase M se acompaa de cambios sorprendentes en las propiedades dinmicas de los microtbulos 986 Las interacciones entre microtbulos orientados en direcciones opuestas conducen el ensamblaje del huso 986 Los cromosomas replicados se unen a los microtbulos por sus cinetocoros 988 En los cromosomas de la levadura los complejos proteicos cinetocricos se ensamblan siguiendo secuencias especficas de DNA centromrico 989 Los cinetocoros capturan los microtbulos nucleados en los polos del huso 990 Los extremos ms de los microtbulos cinetocricos pueden aadir y perder subunidades de tubulina mientras estn adheridos al cinetocoro 991 Los polos del huso repelen los cromosomas 991 Las cromtidas hijas se unen a polos opuestos del huso mediante sus cinetocoros 992 Fuerzas bipolares equilibradas mantienen a los cromosomas en la placa metafsica 992 Los microtbulos son dinmicos en el huso metafsico 993

1009 1011 1011

ndice de materias

xxxi

Las clulas en su contexto social


Adhesin celular, uniones celulares y matriz extracelular
Uniones celulares Las uniones estancas forman una barrera de permeabilidad selectiva a travs de los epitelios Las uniones de anclaje conectan el citoesqueleto entre clulas o entre la clula y la matriz extracelular Las uniones adherentes conectan haces de fibras de actina entre clulas o entre la clula y la matriz extracelular Los desmosomas conectan filamentos intermedios entre clulas; los hemidesmosomas los unen a la lmina basal Las uniones de tipo gap permiten el paso directo de pequeas molculas entre clulas Los conexones de las uniones de tipo gap estn compuestos por seis subunidades La mayor parte de las clulas embrionarias estn acopladas entre s durante las primeras etapas del desarrollo mediante uniones de tipo gap La permeabilidad de las uniones de tipo gap est regulada En los vegetales, los plasmodesmos realizan muchas de las funciones de las uniones de tipo gap Resumen 1018 1019 1021 Los proteoglucanos de superficie celular actan como correceptores Las colgenas son las protenas ms abundantes de la matriz extracelular Las molculas de colgena son secretadas con unas extensiones no helicoidales en cada una de las regiones terminales Despus de su secrecin, las molculas fibrilares de procolgena son degradadas hasta molculas de colgena, las cuales se organizan en fibrillas Las colgenas asociadas a fibrillas organizan estas fibrillas Las clulas participan de la organizacin de las fibras de colgena que secretan ejerciendo tensiones mecnicas sobre la matriz La elastina confiere a los tejidos su elasticidad La fibronectina es un protena extracelular adhesiva que contribuye a la adhesin de la clula a la matriz Las diversas formas de fibronectina son producto de una maduracin alternativa del RNA Las glucoprotenas de la matriz ayudan a determinar las vas de migracin celular Las molculas de colgena de tipo IV se ensamblan formando una red laminar que facilita la formacin de la lmina basal La lmina basal est compuesta fundamentalmente por colgena de tipo IV, proteoglucanos del tipo heparn sulfato, laminina y entactina Las lminas basales realizan diversas y complejas funciones La degradacin de los componentes de la matriz extracelular est estrechamente controlada Resumen Receptores de la matriz extracelular en clulas animales: las integrinas Las integrinas son heterodmeros transmembrana Las integrinas pueden interaccionar con el citoesqueleto para unir las clulas a la matriz extracelular Las integrinas permiten al citoesqueleto y a la matriz extracelular comunicarse a travs de la membrana plasmtica Las clulas pueden regular la actividad de sus integrinas Las integrinas pueden activar cascadas de sealizacin intracelular Resumen La pared celular de los vegetales La composicin de la pared celular depende del tipo celular Las fuerzas de tensin de las paredes celulares permiten a las clulas vegetales desarrollar una presin de turgencia La pared celular est constituida por microfibrillas de celulosa entretejidas con una red de polisacridos y protenas Los microtbulos orientan la deposicin de la pared celular Resumen Bibliografa 1048 1048

1051

1022

1024 1026 1027

1052 1053

1054 1055 1057 1058 1059

1028 1029 1030 1031

Adhesin intercelular 1032 Existen dos vas fundamentales mediante las cuales las clulas animales se unen para formar tejidos 1032 Las clulas de vertebrados disociadas pueden reagregarse en tejidos organizados mediante mecanismos de adhesin selectiva clula-clula 1033 Las cadherinas median la unin clula-clula dependiente de Ca2 +en los vertebrados 1035 Las cadherinas median la adhesin clula-clula a travs de un mecanismo homoflico 1036 La adhesin intercelular independiente de Ca2 +est mediada principalmente por unas protenas pertenecientes a la 1037 superfamilia de las inmunoglobulinas Muchos tipos de molculas de superficie celular actan paralelamente mediando la adhesin selectiva clula-clula y clula-matriz 1038 Los contactos no adhesivos pueden ser los iniciadores de fenmenos de adhesin intercelular especficos de tejido que posteriormente son orientados y estabilizados por contactos de unin 1040 Resumen 1041 La matriz extracelular de los animales La matriz extracelular est producida y orientada por las clulas que engloba Las cadenas de glucosaminoglucano (GAG) ocupan grandes volmenes, formando geles hidratados Parece que el cido hialurnico facilita la migracin celular durante la morfognesis y la reparacin de los tejidos Los proteoglucanos estn compuestos por cadenas de GAG unidas covalentemente a una protena central Las cadenas de proteoglucanos pueden regular las actividades de molculas secretadas de sealizacin Las cadenas de GAG pueden estar altamente organizadas en la matriz extracelular 1041 1042 1043

1059

1060 1062 1065 1066 1067 1068 1069

1069 1070 1071 1072 1073 1073

1074

1044 1045 1046 1047

1074 1076 1078 1079

xxxii

ndice de materias

Clulas germinales y fecundacin


Las ventaj as del sexo En los animales pluricelulares, la fase diploide es compleja y larga mientras que la haploide es sencilla y corta La reproduccin sexual confiere una ventaja competitiva a los organismos que se encuentran en un ambiente que cambia de forma imprevisible Resumen Meiosis La meiosis implica dos divisiones nucleares en lugar de una sola La redistribucin gnica aumenta debido al entrecruzamiento entre las cromtidas homologas no hermanas El apareamiento meitico cromosmico culmina con la formacin del complejo sinaptonmico Se cree que los nodulos de recombinacin median los intercambios de cromtidas Los quiasmas desempean un importante papel en la segregacin cromosmica durante la meiosis El apareamiento de los cromosomas sexuales asegura que tambin ellos se segreguen La divisin meitica II es semejante a la mitosis Resumen Oocitos El oocito es la nica clula de un animal superior que es capaz de desarrollarse produciendo un nuevo individuo 1083 1084

Captulo
^.11

1085 1086 1086 1086

Un oocito est altamente especializado para su desarrollo independiente, presentando grandes reservas nutritivas y una compleja cubierta protectora Los oocitos se desarrollan por etapas Los oocitos crecen hasta alcanzar su gran tamao por medio de mecanismos especiales Resumen Espermatozoides Los espermatozoides estn altamente adaptados para depositar su DNA en un oocito En muchas especies de mamferos los espermatozoides se producen de manera continua Resumen Fecundacin El contacto con la cubierta pelcida estimula al espermatozoide a sufrir la reaccin acrosmica La reaccin cortical del oocito contribuye a asegurar que sea fecundado por un solo espermatozoide Una protena de fusin transmembrana de la membrana plasmtica del espermatozoide cataliza la fusin espermatozoide-oocito El espermatoide proporciona un centriolo al zigoto Resumen Bibliografa

1094 1095 1097 1099 1099 1099 1100 1103 1103 1104

1088 1089 1090 1091 1093 1093 1094 1094 1094

1105

1106 1107 1108 1108

Mecanismos celulares del desarrollo


Movimientos morfognicos y la forma del mapa corporal La polaridad del embrin de anfibio depende de la polaridad del huevo La segmentacin produce muchas clulas a partir de una clula inicial La blstula es una cavidad rodeada por un epitelio La gastrulacin transforma una esfera hueca de clulas en una estructura triestratificada con un intestino primitivo Los movimientos de gastrulacin se organizan alrededor del labio dorsal del blastoporo Cambios activos del empaquetamiento celular suministran una fuerza conductora para la gastrulacin Las tres capas germinales formadas por la gastrulacin tienen destinos distintos El mesodermo situado a cada lado del eje del cuerpo se fragmenta en somitos, de los que derivan las clulas musculares Los patrones cambiantes de molculas de adhesin celular regulan los movimientos morfognicos Clulas migratorias invaden los tejidos del embrin de forma estrictamente controlada El plano estructural del cuerpo de los vertebrados se forma primero en miniatura y despus se mantiene a medida que el embrin crece Resumen 1111 1112 1113 1114 Interacciones inductivas generan nuevos tipos de clulas en un patrn cada vez ms detallado Un sencillo gradiente de morfgeno puede organizar un complejo patrn de respuestas celulares Las clulas pueden reaccionar de forma distinta a una seal segn el momento en que la reciban: funcin de un reloj intracelular En los mamferos, el protegido entorno uterino permite un tipo extraordinario de desarrollo temprano Todas las clulas del embrin animal temprano tienen el mismo potencial de desarrollo Las clulas madre embrionarias de los mamferos muestran cmo seales procedentes del entorno pueden controlar el ritmo y la va de desarrollo Resumen

Captulo

21
1127 1129

1131 1131 1133

1114 1116 1117 1118

1133 1135 1135

1120 1121 1122

1124 1124

Diversificacin celular en el embrin animal temprano 1125 Las diferencias iniciales entre los blastmeros de Xenopus surgen a partir de la segregacin espacial de determinantes en el huevo 1126

Memoria celular, determinacin celular y el concepto de valores posicionales A menudo las clulas quedan determinadas para su futuro papel especializado mucho antes de que se diferencien manifiestamente El momento de la determinacin celular puede ponerse de manifiestojior medio de experimentos de trasplante La determinacin y la diferenciacin celulares reflejan la expresin de genes reguladores El estado de determinacin puede estar controlado por el citoplasma o puede ser intrnseco a los cromosomas Las clulas de los tejidos en desarrollo recuerdan sus valores posicionales El patrn de valores posicionales controla la proliferacin celular y se regula a travs de intercalacin Resumen

1135 1136 1137 1138 1139 1140 1142

ndice de materias

xxxiii

El gusano nemtodo: los genes controladores del desarrollo y las leyes del comportamiento celular C aenorhabditis elegans es anatmica y genticamente sencillo El desarrollo del nemtodo es prcticamnte invariable Los genes de control del desarrollo definen las leyes del comportamiento celular que generan el mapa corporal La induccin de la vulva depende de un amplio conjunto de genes controladores del desarrollo Pruebas genticas microquirrgicas revelan la lgica del control del desarrollo; el clonaje y la secuenciacin de genes nos ayudan a descubrir su bioqumica Mutaciones heterocrnicas identifican los genes que especifican cambios en las leyes del comportamiento celular a medida que transcurre el tiempo El tempo del desarrollo no est controlado mediante el ciclo de divisin celular Las clulas mueren ordenadamente como parte del programa de desarrollo Resumen

1143 1143 1144 1145 1146

1147

1151 1152 1152 1153 1154 1155 1156 1158 1159

Los genes selectores hometicos son esenciales para la memoria de la informacin posicional de las clulas de los discos imagnales Los genes selectores hometicos y los genes de polaridad del segmento definen los compartimientos del cuerpo La expresin localizada de protenas especficas antecede la produccin de quetas sensitivas La inhibicin lateral regula el patrn detallado de tipos celulares diferenciados Los genes de control de desarrollo de D rosophila tienen homlogos en los vertebrados Los mamferos tienen cuatro complejos HOM homlogos Los genes Hox definen los valores posicionales en los vertebrados tal como ocurre en los insectos Subconjuntos de los genes Hox se expresan distribuidos a lo largo de los dos ejes ortogonales de las yemas de las extremidades de los vertebrados Resumen El desarrollo vegetal El desarrollo embrionario empieza con el establecimiento del eje raz-brote y se detiene en el interior de la semilla Los mdulos repetitivos de una planta son generados secuencialmente por los meristemos La forma de cada nueva estructura depende de la orientacin de la divisin celular y de la expansin Cada mdulo de la planta crece a partir de un conjunto microscpico de primordios de un meristemo Seales hormonales de largo alcance coordinan los procesos del desarrollo en partes distantes de la planta Arabidopsis se utiliza como organismo modelo para la gentica molecular de las plantas Los genes selectores hometicos definen las partes de una flor Resumen El desarrollo neural Las reservas de neuronas generadas en el inicio del desarrollo neural no se reemplazarn posteriormente El momento y el lugar de nacimiento de una neurona determinarn sus conexiones Cada axn o dendrita se extiende gracias a un cono de crecimiento situado en su extremo El cono de crecimiento conduce in vivo a la neurita en desarrollo a travs de una va definida con precisin Los tejidos diana liberan factores neurotrficos que controlan el crecimiento y la supervivencia de las clulas nerviosas Los valores posicionales de las neuronas guan la formacin de mapas neuronales ordenados: doctrina de la especificidad neuronal Los axones de lados opuestos de la retina responden de forma distinta al gradiente de las molculas repelentes del tectum Los patrones difusos de las conexiones sinpticas se definen mediante la eliminacin de la sinapsis dependiente de actividad La experiencia moldea el patrn de conexiones sinpticas del cerebro Resumen Bibliografa

1176 1178 1179 1180 1182 1183 1184

1185 1186 1187

Drosophila y la gentica molecular del patrn


de formacin. I. Gnesis del mapa corporal El cuerpo del insecto se construye mediante la modulacin de un patrn fundamental de unidades de repeticin D rosophila inicia su desarrollo como un sincitio Dos sistemas ortogonales definen el mapa geomtrico del embrin Influencias procedentes de las clulas que envuelven el huevo marcan el inicio del modelaje del embrin El eje dorsoventral se define en el interior del embrin mediante una protena reguladora de genes con un gradiente de concentracin intranuclear El sistema posterior define las clulas germinales y tambin los segmentos corporales posteriores El mRNA localizado en el polo anterior codifica una protena reguladora de genes que constituye el gradiente morfognico anterior Tres clases de genes de segmentacin subdividen el embrin La expresin localizada de los genes de segmentacin est regulada por una jerarqua de seales de posicin El producto de un gen de segmentacin controla la expresin de otro gen generando un patrn detallado Los genes de polaridad del huevo gap y de regla par generan un patrn transitorio que es recordado por otros genes Los genes de la polaridad de segmento marcan las subdivisiones bsicas de cada parasegmento Resumen

1188 1190 1190 1192

1193 1194 1195 1198 1199 1200 1201 1203 1205

1160 1162

1163 1165 1166 1168 1169 1169 1170

1205

Drosophila y la gentica molecular del patrn


de formacin. II. Genes selectores hometicos y modelaje de las partes del cuerpo Los genes selectores hometicos del complejo bithorax y del complejo Antennapedia definen las diferencias entre parasegmentos Los genes selectores hometicos codifican un sistema de marcadores moleculares de direccin Las regiones de control de los genes selectores hometicos actan como chips de memoria de informacin posicional La mosca adulta se desarrolla a partir de un conjunto de discos imagnales que contienen informacin posicional 1171

1207

1171 1172

1207

1209 1210 1211 1212

1172

1174

xxxiv

ndice de materias

Clulas diferenciadas y conservacin de los tejidos


Mantenimiento del estado diferenciado La mayora de las clulas diferenciadas recuerdan su carcter esencial incluso en un nuevo entorno El estado diferenciado se puede modular por el entorno celular Resumen Tejidos con clulas permanentes Las clulas del centro del cristalino del ojo de un adulto son residuos del embrin La mayora de las clulas permanentes renuevan sus componentes: las clulas fotorreceptoras de la retina Resumen Renovacin por biparticin simple Las funciones del hgado como interfase entre el tracto digestivo y la sangre La prdida de clulas hepticas estimula la proliferacin de clulas hepticas La regeneracin requiere el crecimiento coordinado de los constituyentes de los tejidos Las clulas endoteliales revisten todos los vasos sanguneos Las nuevas clulas endoteliales se generan por biparticin simple de clulas endoteliales ya existentes Los capilares se forman mediante proliferacin La angiognesis est controlada por factores de crecimiento liberados por los tejidos prximos Resumen Renovacin por medio de clulas madre: la epidermis Las clulas madre pueden dividirse sin lmite y dar lugar a una progenie diferenciada Las clulas madre epidrmicas se encuentran en la capa basal Las clulas epidrmicas en diferenciacin sintetizan una secuencia de queratinas diferentes a medida que maduran Las clulas madre epidrmicas son un subconjunto de las clulas basales La proliferacin de las clulas basales se regula en funcin del grosor de la epidermis Las clulas secretoras de la piel estn agrupadas en glndulas que tienen su propia cintica de poblacin Resumen Renovacin por medio de clulas madre pluripotenciales: formacin de las clulas sanguneas Existen tres tipos principales de glbulos blancos: los granulocitos, los monocitos y los linfocitos La produccin de los distintos tipos de clulas sanguneas en la mdula sea se halla controlada individualmente 1219 1221 1221 1222 1222 1223 1224 1226 1227 1227 1230 1231 1231 1232 1233 1234 1235 1236 1237 1238 La mdula sea contiene las clulas madre hematopoyticas Las clulas madre pluripotenciales dan lugar a todos los tipos de clulas sanguneas El nmero de clulas sanguneas especializadas se amplifica por divisiones de clulas progenitoras determinadas Los factores que regulan la hematopoyesis pueden analizarse en cultivo La eritropoyesis depende de la hormona eritropoyetina En la produccin de los neutrfilos y de los macrfagos influyen mltiples CSF Las clulas madre hematopoyticas dependen del contacto con clulas que expresan el factor Steel El comportamiento de una clula hematopoytica depende parcialmente del azar La regulacin de la supervivencia celular es tan importante como la regulacin de la proliferacin celular Resumen Gnesis, modulacin y regeneracin del msculo esqueltico Las nuevas clulas del msculo esqueltico se forman por fusin de los mioblastos Las fibras musculares pueden modular sus propiedades mediante cambios de las protenas isoformas que poseen En el adulto persisten algunos mioblastos como clulas madre quiescentes Resumen Los fibroblastos y sus transformaciones: la familia de las clulas del tejido conjuntivo Los fibroblastos cambian sus caractersticas en respuesta a seales de la matriz extracelular La matriz extracelular puede influir en la diferenciacin de las clulas del tejido conjuntivo, afectando a su adhesin y a su forma Distintas molculas seal actan de forma secuencial regulando la produccin de adipocitos El hueso se remodela continuamente por medio de las clulas que lo constituyen Los osteoblastos segregan matriz sea, mientras que los osteoclastos la erosionan Durante el desarrollo, los osteoclastos erosionan el cartlago y se abren paso en el hueso La estructura del cuerpo est estabilizada mediante su armazn de tejido conjuntivo y mediante la cohesin selectiva de las clulas Resumen Apndice Catlogo de las clulas del cuerpo humano adulto Bibliografa 1247 1249 1250 1251 1252 1253 1255 1255 1256 1258 1258 1260

1261 1261 1262 1262 1263

1264 1265 1265 1266 1269

1239 1240 1241 1242 1243 1243 1244 1246

1269 1271 1271 1274

El sistema inmunitario
Base celular de la inmunidad El sistema inmunitario humano est compuesto por billones de linfocitos Los linfocitos B producen las repuestas humorales con anticuerpos; los linfocitos T producen las respuesta mediadas por clulas Los linfocitos se desarrollan en los rganos linfoides primarios y reaccionan con los antgenos extraos en los rganos linfoides secundarios 1280 1280 Los marcadores de superficie celular permiten distinguir y separar las clulas T de las clulas B El sistema inmunitario acta mediante la seleccin clonal La mayora de antgenos estimulan muchos clones diferentes de linfocitos La mayora de los linfocitos recirculan continuamente La memoria inmunolgica se debe a la expansin clonal y a la maduracin de los linfocitos 1283 1284 1286 1286 1288

1281

1282

ndice de materias

XXXV

La falta de respuesta ante los antgenos propios es debida a una tolerancia inmunolgica adquirida Resumen Propiedades funcionales de los anticuerpos Los receptores de las clulas B especficos para los antgenos son molculas de anticuerpo Las clulas B pueden ser estimuladas a segregar anticuerpos en una placa de cultivo Los anticuerpos tienen dos lugares idnticos de unin al antgeno Una molcula de anticuerpo est compuesta por dos cadenas ligeras idnticas y dos cadenas pesadas idnticas Existen cinco clases diferentes de cadenas pesadas, cada una de las cuales tiene propiedades biolgicas distintas Los anticuerpos pueden tener cadenas ligeras k o A ,, pero no de ambos tipos La intensidad de una interaccin antgeno-anticuerpo depende tanto del nmero de lugares de unin ocupados como de la afinidad de cada lugar de unin La utilizacin del complemento por los anticuerpos contribuye a la lucha contra las infecciones bacterianas Resumen La estructura fina de los anticuerpos Las cadenas ligeras y las cadenas pesadas presentan regiones constantes y regiones variables Las cadenas ligeras y las cadenas pesadas contienen tres regiones hipervariables cada una, que en conjunto forman el lugar de unin al antgeno Las cadenas ligeras y las cadenas pesadas estn plegadas en dominios repetitivos similares Estudios por difraccin de rayos X han revelado la estructura tridimensional de los dominios de las Ig y de sus lugares de unin al antgeno Resumen La generacin de la diversidad de los anticuerpos Durante el desarrollo de las clulas B, los genes de los anticuerpos se ensamblan a partir de segmentos gnicos aislados Cada regin V est codificada por ms de un segmento gnico La unin imprecisa de los segmentos gnicos aumenta la diversidad de las regiones V La hipermutacin somtica dirigida por el antgeno acaba de afinar las respuestas de anticuerpos La unin de los segmentos gnicos de los anticuerpos est regulada asegurando que las clulas B sean monoespecficas Cuando las clulas B son estimuladas por un antgeno, pasan de la produccin de anticuerpo ligado a la membrana a la produccin de la forma segregada del mismo anticuerpo Las clulas B pueden cambiar la clase de anticuerpo que producen Resumen Los receptores de las clulas T y sus subclases Los receptores de la clula T son heterodmeros similares a los anticuerpos Las diferentes respuestas de las clulas T estn mediadas por distintas clases de clulas T Resumen

1289 1291 1291 1291 1292 1292

Las molculas MHC y la presentacin del antgeno a las clulas T Existen dos clases principales de molculas MHC Estudios por difraccin de rayos X revelan el lugar de unin al antgeno de las protenas MHC as como el pptido de unin Las molculas MHC de clase I y de clase II tienen funciones distintas Las protenas CD4 y CD8 actan como correceptores de unin a MHC en las clulas T colaboradoras y citotxicas, respectivamente Resumen Las clulas T citotxicas Las clulas T citotxicas reconocen fragmentos de protenas vricas en la superficie de clulas infectadas por virus Los transportadores ABC codificados por MHC transfieren fragmentos peptdicos desde el citosol hasta la luz del ER Las clulas T citotxicas inducen a las clulas diana infectadas a destruirse a s mismas Resumen Clulas T colaboradoras y activacin de las clulas T Las clulas T colaboradoras reconocen fragmentos de protenas antignicas endocitadas, asociadas con protenas MHC de clase II Las clulas T colaboradoras se activan por las clulas presentadoras de antgeno El receptor de una clula T forma parte de un gran complejo de sealizacin en la membrana plasmtica Para activar la clula T colaboradora se requieren dos seales simultneas Las clulas T colaboradoras, una vez activadas, se estimulan a s mismas y a otras clulas T para proliferar mediante la secrecin de interleuquina-2 Para responder ante un antgeno, la mayora de las clulas B necesitan la participacin de las clulas T colaboradoras La activacin de las clulas B por clulas T colaboradoras se produce tanto por seales unidas a la membrana como por seales segregadas Algunas clulas T colaboradoras activan las clulas T citotxicas y los macrfagos mediante la secrecin de interleuquinas Resumen Seleccin del repertorio de clulas T Las clulas T que reconocen pptidos asociados a las molculas MHC propias son seleccionadas positivamente durante su desarrollo en el timo Las clulas T en desarrollo que reaccionan fuertemente con los pptidos propios unidos a molculas MHC propias son eliminadas en el timo Algunas formas allicas de molculas MHC no son efectivas en la presentacin de antgenos especficos a las clulas T: genes de la respuesta inmunitaria {Ir) El papel de las protenas MHC en la presentacin del antgeno a las clulas T proporciona una explicacin de las reacciones de trasplante y del polimorfismo MHC Las molculas de reconocimiento inmunitario pertenecen a una antigua superfamilia Resumen Bibliografa

1317 1317

1319 1321

1322 1322 1323

1293

1293 1296

1323

1324 1325 1326 1326

1297 1298 1301 1302 1302

1327 1328 1329 1329

1303 1303

1304 1307 1307

1331

1331

1307 1308 1310 1310

1332

1333 1334 1335

1311

1335

1312 1313 1314 1315 1315 1316 1316

1336

1338

1338 1339 1340 1341

xxxvi

ndice de materias

Cncer
El cncer como un proceso de microevolucin Los cnceres difieren en funcin del tipo celular del que derivan La mayora de cnceres derivan de una sola clula anormal Probablemente la mayora de cnceres se inician por un cambio en la secuencia de DNA de una clula Una sola mutacin no es suficiente para causar cncer Los cnceres evolucionan mediante etapas lentas a partir de clulas alteradas benignas La progresin de los tumores implica rondas sucesivas de mutacin y seleccin natural El desarrollo de un cncer puede estar estimulado por factores que no alteran la secuencia de DNA de las clulas La mayora de cnceres se producen por combinaciones evitables de causas ambientales La bsqueda de curaciones para el cncer es dura pero no imposible El crecimiento canceroso depende a menudo de desrdenes de la diferenciacin celular Para formar metstasis, las clulas cancerosas han de ser capaces de cruzar la lmina basal Las mutaciones que aumentan la frecuencia de mutacin aceleran el desarrollo del cncer El incremento de la capacidad de mutar de las clulas cancerosas confiere a estas clulas una cierta capacidad de evadirse de la destruccin producida por drogas anticancerosas Resumen Gentica molecular del cncer Los retrovirus pueden actuar como vectores para los oncogenes que modifican el comportamiento celular Los retrovirus recogen oncogenes por accidente Un retrovirus puede transformar una clula husped insertando su DNA en un lugar prximo a un proto-oncogn del husped 1345 1346 1348 1349 1350 1352 1354

Captulo

Qy|

1355 1356 1358 1359 1360 1361

1363 1364 1365 1365 1367

Diferentes investigaciones sobre la base gentica del cncer convergen sobre disfunciones de un mismo pequeo grupo de proto-oncogenes Un proto-oncogn puede ser convertido en oncognico de muchas maneras Las acciones de los oncogenes puede ensayarse individualmente o combinadas entre s en ratones transgnicos La prdida de una copia de un gen supresor de tumores puede generar predisposicin hereditaria al cncer La prdida del gen supresor de tumores de retinoblastoma interviene en muchos cnceres distintos Los virus de DNA tumorales activan la maquinaria de replicacin del DNA de la clula como parte de su estrategia para sobrevivir Los virus de DNA tumorales activan la maquinaria de replicacin de la clula bloqueando la accin de los genes clave supresores de tumores Mutaciones en el gen p53 inhabilitan el freno de emergencia de la proliferacin celular y conducen a una inestabilidad gentica Los cnceres colon-rectales se desarrollan lentamente, a travs de una sucesin de cambios estructurales visibles Las mutaciones que conducen al cncer colon-rectal pueden ser identificadas examinando las clulas cancerosas y estudiando las familias propensas a desarrollar cncer Deleciones genticas en las clulas cancerosas colon-rectales revelan lugares de prdida de genes supresores de tumores Las etapas de la progresin tumoral puede correlacionarse con determinadas mutaciones Cada caso de cncer se caracteriza por su propia sucesin de lesiones genticas Resumen Bibliografa

1369 1370

1372

1373 1375

1376

1377

1378

1379

1381

1382 1382 1383 1384 1385

1369

ndice de materias

xxxvii

Agradecimientos
Al escribir este libro, nos hemos beneficiado enormemente de las opiniones de muchos bilogos y bioqumicos. Adems de los que nos han aconsejado por te lfono, queremos agradecer a las personas que se citan a continuacin sus con sejos por escrito, as como a todos los que nos ayudaron a preparar la primera y la segunda edicin. (Los que nos han ayudado en esta edicin aparecen primero y los que lo hicieron en las ediciones primera y segunda, despus.)
Captulo 1 Alan Grafen (University of Oxford), David Haig (Harvard University), Laurence Hurst (University of Cambridge), Jack Szostak (Massachusetts General Hospital, Boston). Captulo 2 Carl Branden (European Synchrotron Facility, Grenoble, France), Greg Petsko (Brandis University). Captulo 3 David Agard (University of California, San Francisco), Greg Petsko (Brandis University), Richard Wolfenden (University of North Carolina). Captulo 4 Tim Mitchison (University of California, San Francisco). Captulo 5 Henry Bourne (University of California, San Francisco), Steven Harrison (Harvard University), David Morgan (University of California, San Francisco), Greg Petsko (Brandis University), Martin Rechsteiner (University of Utah, Salt Lake City), Howard Schachman (University of California, Berkeley), Mathias Sprinzl (University of Bayreuth), Alex Varshavsky (California Institute of Technology, Pasadena). Captulo 6 Nancy Craig (Johns Hopkins University), Sandy Johnson (University of California, San Francisco), Kelly Komachi (University of California, San Francisco), Tomas Lindahl (IRCF Clare Hall Laboratories), Harry Noller (University of California, Santa Cruz), John Wilson (Baylor University), Rick Wood (ICRF Clare Hall Laboratories). Captulo 7 Martha Arnaud (University of California, San Francisco), Mario Capecchi (University of Utah), Walter Gehring (Biozentrum, University of Basel), Tim Hunt (ICRF Clare Hall Laboratories), Barbara Meyer (University of California, Berkeley), Richard Myers (Stanford University), John Wilson (Baylor University). Captulo 8 Sandy Johnson [colaboracin principal] (University of California, San Francisco), Larry Gerace (Scripps Clinic, La Jolla, CA), Christine Guthrie (University of California, San Francisco), Martha Stark (University of California, San Francisco), Peter Walter (University of California, San Francisco), Keith Yamamoto (University of California, San Francisco). Captulo 9 Sandy Johnson [colaboracin principal] (University of California, San Francisco), Tanya Awabdy (University of California, San Francisco), Steve Burley (The Rockefeller University), Beverly Emerson (The Salk Institute), Frank Grosveld (Erasmus Universiteit, Rotterdam), Alan Hinnebusch (National Institutes of Health, Bethesda), Nancy Hollingsworth (University of California, San Francisco), Mike Levine (University of California, San Diego), Richard Losick (Harvard University), Stuart Orkin (Childrens Hospital, Boston), Roy Parker (University of Arizona, Tucson), Alan Sachs (University of California, Berkeley), Madhu Wahi (University of California, San Francisco), Peter Walter (University of California, San Francisco), Harold Weintraub (Fred Hutchinson Cancer Research Center), Sandra Wolin (Yale University), Keith Yamamoto (University of California, San Francisco). Captulo 10 Mark Bretscher (MRC Labortory of Molecular Biology, Cambridge, UK), Richard Henderson (MRC Laboratory of Molecular Biology, Cambridge, UK), Kai Simons (EMBL, Heidelberg, Germany), Tim Springer (Center for Blood Research, Boston). Captulo 11 Barbara Barres (Stanford University), Bertil Hille (University of Washington, Seattle), Ron Kaback (University of California, Los Angeles), Chuck Stevens (The Salk Institute, La Jolla, CA), Roger Thomas (University of Bristol, Bristol, UK). Captulo 12 Peter Walter [colaboracin principal] (University of California, San Francisco), Larry Gerace (Scripps Clinic, La Jolla, CA), Reid Gilmore (University of Massachusetts), Walter Neupert (University of Mnchen, Germany), George Palade (University of California, San Diego), Gottfried Schatz (Biozentrum, University of Basel). Captulo 13 Peter Walter [colaboracin principal] (University of California, San Francisco), Ari Helenius (Yale University), Ira Mellman (Yale University), Keith Mostov (University of California, San Francisco), Jim Rothman (Memorial Sloan-Kettering Cancer Center), Randy Schekman (University of California, Berkeley). Captulo 14 Martin Brand (University of Cambridge), Richard Henderson (MRC Laboratory of Molecular Biology, Cambridge, UK), William W. Parson (University of Washington, Seattle), Gottfried Schatz (University of Basel), Alison Smith (John Innes Institute, Norfolk, UK). Captulo 15 Michael J. Berridge (University of Cambridge), Henry Bourne (University of California, San Francisco), Ernst Hafen (Universitt Zurich), Robert J. Lefkowitz (Duke University, Durham, NC), Mark E. Nelson (University of Illinois, Urbana), Melvin I. Simon (California Institute of Technology, Pasadena), Lewis T. Williams (University of California, San Francisco). Captulo 16 Tim Mitchison [colaboracin principal] (University of California, San Francisco), Mike Klymkowsky [colaboracin importante] (University of Colorado, Boulder), Douglas Kellogg (University of California, San Francisco), Michelle Mortiz (University of California, San Francisco), Jordan Raff (University of California, San Francisco), Murray Stewart (MRC Laboratory of Molecular Biology, Cambridge, UK).

xxxix

Captulo 17

AndrewM urray [colaboracin principal] (University

France), Paul Wassarman (Roche Institute o f Molecular Biology, Nutley, NJ), Keith Willison (Chester Beatty Laboratories, London). Capitulo 21 Michel Akam (University o f Cambridge), Enrico Coen

of California, San Francisco), Gerard Evan (Imperial Cncer Research Fund, London), Tim Hunt (Imperial Cncer Research Fund, Clare Hall Laboratories), Paul Nurse (Imperial Cncer Research Fund, London). Captulo 18 Tim M itchison [colaboracin principal] (University of

(John Innes Institute, Norwich, UK), David Ish-Horowicz (Imperial Cancer Research Fund, Oxford), Roger Keynes (University of Cambridge), Jonathan Slack (Imperial Cancer Research Fund, Oxford), Paul Sternberg (California Institute ofTechnology, Pasadena). Capitulo 22 Capitulo 23 John Harris (University o f Otago, New Zealand). N.A. Mitchison (Deutsches Rheuma-

California, San Francisco). Captulo 19 David Birk (UMDNJ-Robert Wood Johnson Medical

School), Robert Cohn (University of California, San Francisco), Benny Geiger (Weizmann Institute of Science, Rehovot, Israel), Dan Goodenough (Harvard University), Barry Gumbiner (Memorial Sloan-Kettering Cncer Center), Richard Hynes (Massachusetts Institute o f Technology), Louis Reichardt (University of California, San Francisco), Erkki Ruoslahti (La Jolla Cncer Research Foundation), Robert Trelstad (UMDNJ-Robert Wood Johnson Medical School), Frank Walsh (Guys Hospital, London), Peter Yurchenco (UMDNJ-Robert Wood Johnson Medical School). Captulo 20 Nancy Kleckner (Harvard University), Daniel Szollosi

Forschungszentrum Berlin), Klaus Rajewsky (Institut fr Genetik der Universitt, Cologne, Germany), Ronald Schwartz (National Institutes of Health, Bethesda), Alain Townsend (Institute of M olecular Medicine, John Radcliffe Hospital, Oxford, UK). Capitulo 24 M ichael Bishop (University of California, San

Francisco), Julian Downward (Imperial Cancer Research Fund, London), David Lane (University of Dundee), Andrew Murray (University of California, San Francisco), Bruce Ponder (University of Cambridge), Harold Varmus (National Institutes of Health).

(Institu National de la Recherche Agronomique, Jouy-en-Josas,

Prim era y segunda ediciones Fred Alt (Columbia University), Michael Ashburner (University of Cambridge), Jonathan Ashmore (University o f Sussex, UK), Peter Baker (Kings College London), M ichael Banda (University of California, San Francisco), Michael Bennett (Albert Einstein College o f Medicine), Darwin Berg (University of California, San Diego), Tim Bliss (National Institute for Medical Research, London), Hans Bode (University of California, Irvine), Piet Borst (Jan Swammerdam Institute, University of Amsterdam), Alan Boyde (University College London), Marianne Bronner-Fraser (University of California, Irvine), Robert Brooks (Kings College London), Barry Brown (Kings College London), Michael Brown (University of Oxford), Stephen Burden (Harvard Medical School), Steven Burden (Massachusetts Institute of Technology), Max Burger (University of Basel), John Cairns (Harvard School o f Public Health), Zacheus Cande (University of California, Berkeley), Lewis Cantley (Harvard University), Charles Cantor (Columbia University), Roderick Capaldi (University of Oregon), Adelaide Carpenter (University o f California, San Diego), Tom Cavalier-Smith (Kings College London), Pierre Chambon (University of Strasbourg), Philip Cohen (University of Dundee, Scotland), Roger Cooke (University o f California, San Francisco), Jam es Crow (University o f Wisconsin, Madison), Stuart Cull-Candy (University College London), M ichael Dexter (Paterson Institute for Cancer Reserch, M anchester, UK), Russell Doolittle (University of California, San Diego), Graham Dunn (MRC Cell Biophysics Unit, London), Jim Dunwell (John Innes Institute, Norwich, UK), Sarah Elgin (Washington University, St. Louis), Ruth Ellman (Institute of Cancer Research, Sutton, UK), Charles Emerson (University of Virginia), David Epel (Stanford University), Ray Evert (University of Wisconsin, Madison), Gary Felsenfeld (National Institutes of Health, Bethesda), Gary Firestone (University of California, Berkeley), Gerald Fischbach (Washington University, St. Louis), Robert Fletterick (University of California, San Francisco), Judah Folkman (Harvard Medical School), Larry Fowke (University of Saskatchewan, Saskatoon), Daniel Friend (University of California, San Francisco), Joseph Gall (Yale University), Anthony GardnerMedwin (University College London), Peter Garland (University of

Dundee, Scotland), John Gerhart (University o f California, Berkeley), Gunther Gerisch (Max Planck Institute for Biochemistry, Martinsried), Bernie Gilula (Baylor University), Charles Gilvarg (Princeton University), Bastien Gomperts (University College Hospital Medical School, London), Peter Gould (Middlesex Hospital Medical School, London), Walter Gratzer (Kings College London), Howard Green (Harvard University), Leslie Grivell (University of Amsterdam), Brian Gunning (Australian National University, Canberra), Jeffrey Hall (Brandeis University), John Hall (University of Southampton, UK), Zach Hall (University of California, San Francisco), David Hanke (University of Cambridge, UK), Graham Hardie (University o f Dundee, Scotland), Leland Hartwell (University of Washington, Seattle), John Heath (University of Oxford), Glenn Herrick (University of Utah), Ira Herskowitz (University of California, San Francisco), Leroy Hood (California Institute ofTechnology), Robert Horvitz (Massachusetts Institute of Technology), David Housman (Massachusetts Institute of Technology), James Hudspeth (University of California, San Francisco), Jeremy Hyams (University College London), Philip Ingham (Imperial Cancer Research Fund, Oxford), Norman Iscove (Ontario Cancer Institute, Toronto), Tom Jessell (Columbia University), Andy Johnston (John Innes Institute, Norwich, UK), E.G. Jordan (Queen Elizabeth College, London), Ray Keller (University of California, Berkeley), Regis Kelly (University of California, San Francisco), John Kendrick-Jones (MRC Laboratory of M olecular Biology, Cambridge, UK), Cynthia Kenyon (University of California, San Francisco), Judith Kimble (University of Wisconsin, Madison), Marc Kirschner (University of California, San Francisco), Juan Korenbrot (University of California, San Francisco), Tom Kornberg (University of California, San Francisco), Stuart Kornfeld (Washington University, St. Louis), Daniel Koshland (University of California, Berkeley), Marilyn Kozak (University of Pittsburgh), Mark Krasnow (Stanford University), Peter Lachmann (MRC Center; Cambridge, UK), Trevor Lamb (University of Cambridge), Hartmut Land (Imperial Cancer Research Fund, London), Jay Lash (University of Pennsylvania), Peter Lawrence (MRC Laboratory of Molecular Biology, Cambridge, UK), Alex Levitzki (Hebrew

xl

Agradecimientos

University), Vishu Lingappa (University of California, San Francisco), Clive Lloyd (John Innes Institute, Norwich, UK), Brian McCarthy (University of California, Irvine), Richard McCarty (Cornell University), Anne McLaren (University College London), Jam es Mailer (University of Colorado Medical School), Colin Manoil (Harvard Medical School), Mark Marsh (Institute of Cancer Research, London), Gail Martin (University of California, San Francisco), Freiderick Meins (Freiderich Miescher Institut, Basel), Robert Mishell (University of Birmingham, UK), Avrion Mitchison (University College London), J. Murdoch Mitchison (University of Edinburgh), Mark Mooseker (Yale University), Montrose Moses (Duke University), Anne Mudge (University College London), Hans Miiller-Eberhard (Scripps Clinic and Research Institute), Alan Munro (University of Cambridge), David Nicholls (University of Dundee, Scotland), Duncan ODell (University College London), Patrick OFarrell (University of California, San Francisco), John Owen (University of Birmingham, UK), Dale Oxender (University of Michigan), Wiliam Paul (National Institutes of Health, Bethesda), Robert Perry (Institute of Cancer Research, Philadelphia), David Phillips (Rockefeller University), Jeremy Pickett-Heaps (University of Colorado), Tom Pollard (Johns Hopkins University), Darwin Prockop (Rutgers Medical School), Dale Purves (Washington University, St. Louis), Efraim Racker (Cornell University), George Ratcliffe (University of Oxford), David Rees (National Institute for Medical Research, Mill Hill, London), Fred Richards (Yale University), Phillips Robbins (Massachusetts Institute of Technology), Elaine Robson (University of Reading, UK), Robert Roeder (Rockefeller University), Joel Rosenbaum (Yale University), Jesse Roth (National Institutes of Health, Bethesda), David Sabatini (Rockefeller University), Michael Schramm (Hebrew University), Robert Schreiber (Scripps Clinic and Research Institute), James Schwartz (Columbia University), John Scott (University of

M anchester), John Sedat (University of California, San Francisco), Zvi Sellinger (Hebrew University), Philippe Sengel (University of Grenoble), Peter Shaw (John Innes Institute, Norwich, UK), Samuel Silverstein (Columbia University), John Maynard Smith (University of Sussex), Michael Solursh (University of Iowa), Scott Stachel (University of California, Berkeley), Andrew Staehelin (University of Colorado, Boulder), David Standring (University of California, San Francisco), Wilfred Stein (Hebrew University), Malcolm Steinberg (Princeton University), Monroe Strickberger (University o f Missouri, St. Louis), Michael Stryker (University o f California, San Francisco), Masatoshi Takeichi (Kyoto University), Vernon Thornton (Kings College London), Cheryll Tickle (Middlesex Hospital Medical School, London), Jim Till (Ontario Cancer Institute, Toronto), Lewis Tilney (University of Pennsylvania), Anthony Trewavas (Edinburgh University), Victor Vacquier (University of California, San Diego), Tom Vanaman (University o f Kentucky), Harry van der Westen (Wageningen, The Netherlands), Virginia Walbot (Stanford University), Trevor Wang (John Innes Institute, Norwich, UK), Anne Warner (University College London), Fiona Watt (Imperial Cancer Research Fund, London), John Watts (John Innes Institute, Norwich, UK), Klaus Weber (Max Planck Institute of Biophysical hemistry, Gottingen), Martin Weigert (Institute o f Cancer Research, Philadelphia), Norman Wessells (Stanford University), Judy White (University of California, San Francisco), William Wickner (University of California, Los ngeles), Michael Wilcox (MRC Laboratory of Molecular Biology, Cambridge, UK), Richard Wolfenden (University of North Carolina), Lewis Wolpert (Middlesex Hospital Medical School, London), Abraham Worcel (University o f Rochester), John Wyke (Imperial Cancer Research Fund, London), Charles Yocum (University of Michigan), Rosalind Zalin (University College London), Patricia Zambryski (University of California, Berkeley).

Agradecimientos

xli

Nota al lector
A pesar de que los captulos de este libro pueden leerse de forma independiente uno de otro, estn ordenados siguiendo una secuencia lgica en cuatro partes. Los tres primeros captulos de la Parte I tratan de principios elementales y bsi cos de bioqumica. Pueden ser tiles a modo de introduccin para aquellos que no han estudiado bioqumica y tambin como un sistema para refrescar la m e moria para los que ya estudiaron estas materias. El Captulo 4, que concluye la Parte I, trata de las bases de los principales mtodos experimentales de que dis ponemos para estudiar las clulas. No es necesario leer este captulo para poder entender los captulos siguientes, sino que puede ser til como referencia. Las Partes II y III representan el ncleo central de la biologa celular y prin cipalmente tratan de los procesos que son comunes a la mayora de las clulas eucariotas. La Parte II estudia la expresin y la transmisin de la informacin ge ntica mientras que la Parte III discute la organizacin interna de la clula. La Parte IV sigue el comportamiento de las clulas en los organismos pluri celulares, empezando con las uniones clula-clula y con la matriz extracelular y acabando con la alteracin de la organizacin pluricelular que se presenta en el cncer. El Captulo 4 incluye varias tablas que contienen datos sobre el desarrollo de hechos cruciales con los nombres de los cientficos que participaron en ellos. A lo largo de todo el libro hemos seguido el criterio de omitir el nombre de los cientficos. Sin embargo, los autores de los principales descubrimientos pueden identificarse consultando la bibliografa al final de cada captulo. Frecuente mente esta bibliografa incluye los trabajos originales en los que estos descubri mientos importantes se describieron por primera vez. Los superndices que acompaan a los ttulos de los prrafos corresponden a las citas de la bibliogra fa que contienen informacin adecuada para seguir el prrafo en cuestin. A lo largo de todo el texto se ha utilizado la negrita para destacar los trmi nos clave en los lugares del captulo en que se discuten con mayor profundidad, pudiendo coincidir o no con el lugar en que el trmino aparece por primera vez. Las cursivas se utilizan para resaltar trminos importantes pero con un nfasis menor. Tambin hemos adoptado el convenio de que los nombres de los genes se indican en cursiva (por ejemplo ras, Notch) mientras que los nombres de las protenas correspondientes se indican en tipo normal con la primera letra en mayscula (por ejemplo Ras, Notch). Al final del libro hemos aadido un glosario que recoge los trminos tcni cos de uso comn en la biologa celular actual; puede utilizarse como primera solucin para el lector que encuentre un trmino que no le es familiar utilizado sin ninguna explicacin correspondiente. El Libro de problem as (The Problems Book) est diseado como un volu men acom paante que puede ayudar al lector a apreciar la elegancia, el ingenio y las sorpresas de la investigacin. Proporciona problemas que acompaan la porcin central de este libro (Captulos 5-19). Cada captulo de problemas est dividido en secciones que se corresponden con las secciones de libro de texto, y el principal enfoque de cada seccin consiste en una coleccin de problemas orientados a la investigacin derivados de la literatura cientfica. La mayora de los problemas de investigacin ilustran puntos del texto principal. Adems, cada seccin empieza con un conjunto de preguntas de verdadero-falso y de llenarel-hueco que intentan ayudar al lector a revisar el vocabulario y los conceptos principales del tema de que se trate. El libro est publicado en ingls y puede so licitarse a Garland Publishing, Inc. 717 Fifth Avenue, New York, NY 10022. Esta dos Unidos.

xliii

Nota de los traductores


La traduccin de cualquier texto es una obra compleja. La de un texto cientfico no debe entraar en principio la misma dificultad que la traduccin de una obra literaria respecto a la falta de correspondiente entre las expresiones y matices propios de cada idioma. Sin embargo, tambin tiene sus escollos. En primer lugar, la inexistencia de numerosos trminos cientficos hace que la presencia de anglicismos sea la nota predominante en la mayora de traduc ciones, no slo al castellano sino tambin al francs y a otras lenguas. Por otra parte, la falta de uniformidad terminolgica que existe en muchos campos de la ciencia, a pesar de repetidos esfuerzos por parte de muchos autores y divulgado res de la ciencia, es otro agravante aadido. A estos problemas terminolgicos hay que aadir el de la velocidad de enve jecim iento de los conceptos que se recogen en el texto que se traduce: resulta impensable dedicar dos o tres aos a la traduccin de una obra como Biologa Molecular de la Clula ya que continuam ente se producen nuevos hallazgos y cada tres o cuatro aparece una nueva edicin ampliada y modificada. Por ello, hay que recurrir a la colaboracin de diferentes especialistas que traduzcan los captulos de su competencia. El inevitable cambio de estilo se puede minimizar mediante un corrector nico que realice una revisin general de todo el texto. A todo ello hay que aadir la enorme responsabilidad que supone el tradu cir, ya que uno se hace el vehculo de las ideas del autor. En algunas ocasiones puede ocurrir que exista una cierta disconformidad entre lo expuesto por los au tores de la obra y las ideas de los traductores. En estos casos hay que hacer un esfuerzo considerable para no introducir modificaciones en el texto original. Por otro lado, la fidelidad al texto original tiene que ir acompaada de la adecuacin a las estructuras gramaticales de la lengua a la que se traduce. No es nada senci llo. Sin duda, lo ideal es que cada uno pueda entender el texto original. An ms, si nos referimos a un texto cientfico escrito en ingls y a alumnos de carreras universitarias, parece casi obligado y debera favorecerse. A pesar de ello, no resistimos la tentacin de aceptar la traduccin de Mole cular Biology o f the Cell porque consideramos que se trata de una obra magnfi ca, actualizada, de gran rigor cientfico y a la vez muy didctica y con un enfoque integrado y moderno de la biologa celular y molecular. Esta tercera edicin est sensiblemente ampliada respecto a la segunda, in corporando muchos conceptos y una reestructuracin de algunos temas, as como la edicin de nuevos captulos. Al igual que en la revisin que realizamos de la primera edicin, en la traduccin de las posteriores nos encontramos nue vamente con graves dificultades terminolgicas del castellano, tanto por el hecho de que todava no se ha aceptado la denominacin de una serie de nue vos conceptos (capping, splicing, enhancer, etc.), como porque tradicional mente se han utilizado com o castellanas las palabras inglesas originales (blott, cluster, symport, etc.). Cuando ha sido posible, hemos mantenido las recom en daciones de la Real Academia de la Lengua y de la Real Academia de las Ciencias Exactas, Fsicas y Naturales, aunque ello supusiera en ocasiones ir en contra de trminos utilizados muy frecuentemente (las enzimas y no los enzimas, DNA y no ADN, cAMP y no AMPc, acervo y no pool, etc.). Con todo, despus de consul tar a especialistas sobre cada uno de los temas, hemos tenido que adaptar al gunos trminos, los ms importantes de los cuales se citan a continuacin en un intento de uniformizar nuestro lxico en el campo de la biologa y molecular. Esperamos que este esfuerzo sea til en alguna medida. Cualquier crtica o consejo ser bien acogido para posteriores revisiones. Los traductores

xlv

Lxico de trminos utilizados en esta edicin


allolactose = alolactosa annealing = unin, enlace antiport = transporte de intercambio antisense = antisentido, sin sentido backstitching = punto hacia atrs beads on a string = cuentas ensartadas blott = transferencia branch migration = migracin de la cadena boundary = lmite budding yeast = levadura de gemacin bulk lesion = gran lesin cap = capucha, caperuza capping = formacin de la capucha o caperuza catabolite activator protein = protena activadora de los catabolitos chromosome walking = caminar por el cromosoma cleavage = fragmentacin cloth of tissue fluid = cogulo de plasma cloverleaf = estructura en hoja de trbol cluster = grupo, agregacin coated pits = depresiones revestidas (o recubiertas) coated vesicles = vesculas revestidas (o recubiertas) cohesive ends = extremos cohesivos coiled coil = hlice sobreenrollada combinatorial gene regulation = regulacin gnica por combinacin core = ncleo, zona central cosmids = csmidos (clones de C. elegans en vectores del fago lambda) counterpart = complementario crossing-over = entrecruzamiento cross-strand exchange = intercambio cruzado de cadenas; entrecruzamiento decondensation = desespiralizacin deep-etch = sublimacin depurination = despurinacin derepressed = desreprimido (opern inducible) directs = gua DNA-looping model for enhancer action = modelo de accin de los activadores mediante de DNA domain shuffling = barajado de los dominios donor junction acceptor = enlace entre la regin dadora y la aceptora donor splice junction = regin dadora en la maduracin double minute chromosomes = pares de cromosomas diminutos down-stream = en direcci 3 down regulation = regulacin por disminucin ear vesicle = vescula auditiva engineered = construido in vitro enhancer element = elemento activador (enhancer, aumentador, activador) expression vectors = vectores de expresin feedback = retroalimentacin fingerprint = anlisis de huellas dactilares fisin yeast = levadura de fisin footprinting = anlisis de huellas frameshifting = modificacin de la pauta de lectura freeze-drying = liofilizacin freeze-etch = grabado por congelacin fruit fly = mosca del vinagre gap junctions = uniones comunicantes, uniones de tipo gap gel-mobility shift studies = experimentos de retencin en geles gene cassettes = casettes gnicas gene regulatory protein = protena reguladora de genes, protena reguladora general transcription machinery = maquinaria general para la transcripcin genetic linkage = ligamiento gentico hairpin = horquilla helix-turn-helix = hlice-vuelta-hlice helper virus = virus auxiliar heteroduplex joint = unin heterodplex Holliday junction = intermedio de Holliday housekeeping = constitutivo

xlvi

Nota de los traductores

hybride selection = seleccin de hbridos hybride ion = ion hidruro (H) input = aporte insertional m utagenesis = mutagnesis por insercin interspersed repeated DNAs = secuencias repetidas intercaladas de DNA lactose repressor protein = proteina represora de la lactosa lagging strand = hebra retardada, hebra retrasada lampbrush = plumulados (cromosomas) large T-antigen = antgeno T grande leader = gua leading strand = hebra conductora leak = fuga (del K+ ) left-handed = levgira ligand = ligando mapp (to) = hacer un mapa master gene = gen patrn mating-type = tipo de apareamiento m em brane zippering m echanism = cierre de la mem brana por cremallera midbrain = mesencfalo mismatch = error de apareamiento natural killer = clulas agresoras naturales nick = muesca NMR = resonancia magntica nuclear notochord = notocorda nuclear run on = run on nuclear nuclease-hipersensitive site = zona hipersensible a las nucleasas nucleosom e phasing = distribucin de los nucleosomas en fase off = inactivado on = activado output = salida patch = mancha, porcin, zona patch clamp recording = registro de zona patching = parcheam iento pattern = patron pellet = precipitado phase variation = cam bio de fase photobleaching = fotoblanqueamiento playing head = aparato reproductor polimerase chain reaction = reaccin en cadena de la polimerasa pool = acervo primase = primasa primer = cebador primosome = primosoma probe = sonda probe (to) = sondar processing = maduracin proofreading m echanism = verificacin de lectura puff = asa, protuberancia, lazo pulse-field gel electrophoresis = electroforesis en gel de campo pulsante rate = proporcin, relacin reading frame = pauta de lectura recording patch = registro de zona replication bubble = burbuja de replicacin replication fore = horquilla de replicacin reporter gene = gen informativo restrictrion fragment length polymorphism = polimorfismo de longitud de fragmentos de restriccin reverse genetics = gentica reversa, gentica inversa right-handed = dextrgira scanning = barrido sea squirt = ascidia self assembly = autoensamblado self splicing = automaduracin selfish = egosta, interesado SEM = microscopia electrnica de barrido Semliki forest virus = virus Semliki forest sequence-specific DNA-binding protein = proteina que se une a secuencias especficas del DNA shadowing = sombreado shotgun = perdigonada shuffling = mezclado, barajado

Nota de los traductores

xlvii

sinaptonemal = sinaptonm ico single-strand DNA-binding protein = protena de unin al DNA de una sola hebra site specific recom bination = recom binacin de sitio especfico size = centro, lugar slot = muesca snRNP = RPNsn solid bead = superficie de cuentas space-filling model = modelo tridimensional spliceosom e = espliceosoma splicing = maduracin por corte y empalm e stable transcription com plex = com pleto transcripcional estable staggered = escalonados, protuberantes staggered joint = unin solapada, enlace o unin de extremos protuberantes start site = lugar de iniciacin start site for RNA synthesis = punto de inicio de la sntesis de RNA step = etapa stepwise = gradualmente stop codons = codones de terminacin strand = hebra, cadena stringency = rigor, grado, exigencia substractive hybridization = hibridacin substractiva subvert = destruir, trastornar supercoil = sobreenrollado swivel = desenrollamiento alrededor de la cadena intacta symport = cotransporte unidireccional target = diana TATA box = caja TATA template = patrn, molde tight junction = unin herm tica, unin fuerte, unin estable time-lapse m icrocinem a = microcinematografa a intervalos tomato bushy stunt virus = virus achaparrado peludo del tomate transcripts = transcritos transposable = transponible transposases = transposasas trigger = poner en marcha, disparar trimming = ajuste turn off a gene = desactivar un gen turn on a gene = activar un gen two-dimensional polyacrylamide-gel electrophoresis = electroforesis bidimensional en gel de poliacrilamida underfocus = desenfocado uniport = transporte sencillo unwing = desenrollar upstream = en direccin 5 upstream prom otor elem ent = elem ento prom otor en direccin 5 , elem ento promotor video-enhanced contrast light microscopy = microscopa de contraste vdeo-amplificada western blotting = transferencia de protenas desde un gel de poliacrilamida a un filtro de nailon o nitrocelulosa, transferencia de tipo western whisker = pelo, fleco wind = enrollar, empaquetar wing bud = yema de ala wobble (tercera base) = balanceo zinc finger = dedos de cinc

xlviii

Nota de los traductores

Introduccin a la clula

m m m
i La evolucin de la clula Z Pequeas molculas, energa y biosntesis 3 Macromolculas: estructura, forma e informacin 4 Cmo se estudian las clulas

El sentido de la escala: estas electronm icrografas tom ad as a am p liaciones cad a vez m ayores m uestran clu las b acterian as sobre la punta de un alfiler d om stico. (Por cortesa de T ony Brain y de Scien ce Photo Library.)

E lectronm icrografa de barrid o de clu las de levadura en desarrollo. Estos eucariotas unicelulares generan por gem acin p equ e as clu las hijas cu and o se m u ltiplican. (Por cortesa de Iva Herskowitz y Eric Sch abatach.)

La evolucin de la clula
Desde las molculas hasta la primera clula De los procariotas a los eucariotas De las clulas simples a los organismos pluricelulares

Todas las criaturas vivas estn formadas por clulas -pequeos compartim ien tos rodeados de membrana y llenos de una solucin acuosa concentrada de compuestos qumicos. Las formas ms simples de vida son clulas solitarias que se propagan dividindose en dos. Los organismos superiores, como nosotros mismos, son como ciudades celulares en las que grupos de clulas realizan fun ciones especializadas y estn unidos por intrincados sistemas de comunicacin. Las clulas ocupan un punto intermedio en la escala de la complejidad biolgi ca. Las estudiamos para aprender, por un lado, cmo estn formadas a partir de las molculas y, por otro, cmo cooperan para constituir un organismo tan com plejo como un ser humano. Se cree que todos los organismos, y todas las clulas que los constituyen, descienden por evolucin mediante seleccin natural de una clula ancestral co mn. La evolucin im plica dos procesos esenciales: (1) la aparicin de una variacin al azar en la informacin gentica transmitida de un individuo a sus descendientes, y (2) la seleccin de la informacin gentica que ayuda a su porta dor a sobrevivir y multiplicarse. La evolucin es el principio central de la biolo ga, ya que nos ayuda a comprender la asombrosa diversidad del mundo vivo. Este captulo, al igual que todo el libro, se ocupa de la progresin desde las molculas hasta los organismos pluricelulares. Estudia la evolucin de la clula, primero como unidad viva constituida por partes menores, y luego como bloque constitutivo de estructuras mayores. A travs de la evolucin presentamos los componentes y actividades celulares que se tratarn con mayor detalle en los cap tulos siguientes, y en una secuencia ms o menos igual. Empezando con los orge nes de la primera clula en la Tierra, estudiamos cmo las propiedades de ciertos tipos de grandes molculas permiten que se transmita y exprese la informacin he reditaria y permiten que se produzca la evolucin. Rodeadas por una membrana, estas molculas constituyen la parte esencial de una clula que se replica a s mis ma. Luego describimos la transmisin principal que se produjo en el transcurso de la evolucin, desde unas pequeas clulas parecidas a bacterias hasta unas clulas mucho mayores y complejas, tales como las que se encuentran en los animales y plantas actuales. Finalmente, sugerimos la manera en que las clulas aisladas, de vida libre, dieron lugar quizs a los grandes organismos pluricelulares, especiali zndose y cooperando en la formacin de rganos tan complejos como el cerebro. Es evidente que presentar la clula a travs de su evolucin tiene sus riesgos: las grandes lagunas de nuestro conocim iento slo pueden superarse por medio de especulaciones quizs errneas en muchos detalles. No podemos retroceder en el tiempo para conocer los fenmenos moleculares que tuvieron lugar hace

miles de millones de aos. Pero algunos sucesos antiguos han dejado muchas huellas para nuestro anlisis. Plantas ancestrales, animales y tambin bacterias estn preservadas como fsiles. An ms importante, todos los organismos ac tuales proporcionan evidencias de las caractersticas de los seres vivos del pasa do. Concretamente, las molculas biolgicas actuales son una fuente rica de in formacin sobre el curso de la evolucin, ya que ponen en evidencia semejanzas fundamentales entre los ms dispares organismos vivos y nos permiten organi zar las diferencias que existen entre ellos construyendo una escala objetiva uni versal. Estas diferencias y similitudes moleculares representan para nosotros un problema sem ejante al que se enfrenta un literato que intenta establecer cul es el texto original de un autor antiguo, comparando varios manuscritos diferentes que han sido variados por repetidas copias y ediciones. La tarea es dura y la evi dencia es incompleta, pero al menos es posible proponer conjeturas inteligentes acerca de las principales fases de la evolucin de las clulas vivas.

descarga elctrica
O

Desde las molculas hasta la primera clula1


En condiciones prebiticas se pueden formar molculas biolgicas12
Las condiciones que reinaban en la Tierra durante los primeros mil millones de aos son an tem a de discusin. Estaba inicialm ente fundida la superficie terrestre? Contena la atmsfera amonaco, o metano? Sin embargo, todo el mundo parece estar de acuerdo en que la Tierra era un lugar violento, con erup ciones volcnicas, relmpagos y lluvias torrenciales. Exista muy poca, o ningu na, cantidad de oxgeno libre, y no exista una capa de ozono que absorbiera la radiacin ultravioleta del sol. La radiacin, mediante su accin fotoqumica, pudo haber contribuido a que la atmsfera fuese rica en molculas reactivas y alejadas de su equilibrio qumico. Es probable que bajo estas condiciones se produjeran molculas orgnicas (es decir, molculas que contienen carbono) simples. La prueba ms clara de ello procede de experimentos de laboratorio. Si se toman mezclas de gases como C 0 2, CH4, NHt y H2, se calientan con agua y se activan mediante descargas elc tricas o radiacin ultravioleta, se observa cmo los gases reaccionan formando pequeas molculas orgnicas -p or lo general, un pequeo nmero de molcu las diferentes, cada una de ellas producida en grandes cantidades (Figura 1-1). Entre estos productos se cuentan diversos compuestos, tales como el cianuro de hidrgeno (HCN) y el formaldehdo (HCHO), que en solucin acuosa sufren r pidamente reacciones posteriores (Figura 1-2). Y lo que es ms importante, se generan molculas representativas de la mayora de las principales clases de molculas orgnicas encontradas en las clulas como aminocidos, azcares y las purinas y pirimidinas necesarias para sintetizar nucletidos. Aunque estos experimentos no pueden reproducir con toda exactitud las condiciones primitivas de la Tierra, ponen de manifiesto el hecho de que la for macin de molculas orgnicas es sorprendentemente fcil. Y la Tierra en for macin tena inmensas ventajas sobre cualquier experimentador humano; era muy grande y poda producir una amplia gama de condiciones. Pero, sobre todo, dispona de mucho ms tiempo -cientos de millones de aos. En tales cir cunstancias, parece muy posible que, en algn lugar y en algn momento deter minados, muchas de las molculas orgnicas simples que se encuentran en las clulas actuales se acumularan en concentraciones elevadas.

calor
Figura 1-1 Tpico experimento que simula las condiciones en la Tierra primitiva. Se calienta agua en un
aparato cerrado que contiene CH4, NHy I\ 2, y se hace pasar una descarga elctrica a travs de la mezcla gaseosa. En el tubo en IJ se acumulan compuestos orgnicos.

HCHO HCOOH HCN CH:iCOOH NH2CH2COOH CH-jCHCOOH OH NH2CHCOOH I CH:, NH CHzCOOH CH3
nh2 C

form aldehdo cido frm ico cianuro de hidrgeno cido actico glicina cido lctico alanina

I I O

NH2 cido asprtico

n h 2c h c o o h I ch2 cooh

Pueden desarrollarse sistemas qumicos complejos en un entorno alejado de su equilibrio qumico


Las molculas orgnicas simples como los aminocidos y los nucletidos se pueden asociar formando grandes polmeros. Un aminocido puede unirse a

Figura 1-2 Algunos de los compuestos que se pueden formar en el experimento descrito en la Figura 1-1.
Los compuestos indicados en color son componentes importantes de las clulas vivas actuales.

Captulo 1 : La evolucin de la clula

otro formando un enlace peptdico, mientras que dos nucletidos se pueden unir entre ellos mediante un enlace fosfodister. La repeticin de estas reaccio nes da lugar a polmeros lineales conocidos como polipptidos y polinucletidos, respectivamente. En los organismos vivos actuales, los polipptidos -c o n o cidos como protenas- y los polinucletidos -e n forma de cidos ribonucleicos (RNA) y cidos desoxirribonucleicos (DNA)- son considerados habitualmente los constituyentes ms importantes. Un restringido conjunto de 20 aminocidos forman los bloques constitutivos universales de las protenas, mientras que las molculas de RNA y DNA estn construidas a partir de cuatro tipos de nucleti dos cada una. Aunque no sabemos por qu se seleccionaron estos conjuntos de monmeros en particular para biosntesis en lugar de otros qumicamente simi lares, veremos que las propiedades qumicas de los polmeros correspondientes los hacen especialmente adecuados para desempear sus funciones especficas en la clula. Los primeros polmeros pudieron formarse de varias maneras -p or ejemplo, mediante el calentamiento de compuestos orgnicos secos o gracias a la activi dad cataltica de las elevadas concentraciones de polifosfatos inorgnicos u otros catalizadores inorgnicos crudos. Los productos obtenidos de reacciones similares en el laboratorio son polmeros de longitud variable y de secuencia aleatoria, en los que la adicin de un aminocido o de un nucletido en un m o mento dado depende principalmente del azar (Figura 1-3). Sin embargo, una vez formado, un polmero puede influir sobre reacciones qumicas posteriores ac tuando como un catalizador. El origen de la vida requiri que en un conjunto de molculas de este tipo hubiera algunas que tuvieran, al menos en parte, una propiedad crucial: la capa cidad de catalizar reacciones que generaran, directa o indirectamente, la pro duccin de ms molculas del propio catalizador. La produccin de catalizado res con esta propiedad autogenerativa especial estuvo favorecida y las molculas ms eficientes en generar su propia produccin captaron los materiales crudos eliminndolos de los procesos de produccin de otras substancias. De esta ma nera puede concebirse el desarrollo gradual de un sistema qumico complejo de monmeros orgnicos y de polmeros que actuaban juntos generando ms m o lculas de los mismos tipos, alimentadas por materiales crudos simples del en torno. Un sistema autocataltico como ste tendra las mismas propiedades que creemos que son las caractersticas de la materia viva: estara formado por una gran cantidad de molculas interactivas seleccionadas al azar; tendera a autorreproducirse; competira con otros sistemas dependientes de la misma materia prima; y si se eliminara esta materia prima o si se mantuviera a temperaturas errneas que alteraran el balance de las velocidades de reaccin progresara ha cia el equilibrio qumico y morira. Pero, qu tipo de molculas pudo haber tenido propiedades autocatalticas como stas? En las clulas actuales los catalizadores mas verstiles son dos poli pptidos, compuestos de muchos aminocidos diferentes con cadenas laterales qumicamente diversas y por tanto capaces de adoptar diferentes formas tridi-

I imilla i i Form acin de polinucletidos y de polipptidos. Cuatro tipos de nucletidos (aqu representados con las letras A, U, G y C) pueden sufrir una polimerizacin espontnea con prdida de agua. El producto es una mezcla de polinucletidos de longitud y secuencia aleatorias. De forma similar, aminocidos de diferentes tipos, simbolizados aqu mediante nombres abreviados de tres letras, pueden polimerizar entre ellos formando polipptidos. Las protenas actuales estn formadas a partir de un conjunto estndar de 20 tipos de aminocidos.

Desde las molculas hasta la primera clula

------- B B i l B M

S i 1* * -- I w H

/g 7

T0 iSafi r^ f\
'''

mensionales erizadas de lugares reactivos. Sin embargo aunque los polipptidos son verstiles com o catalizadores no conocem os sistemas por los que una de es tas molculas pueda autorreproducirse especificando directamente la formacin de otra de la m isma secuencia.

Figura 1-4 Polinucletidos como patrn. Se produce el enlace preferencial entre pares de nucletidos (C con G y A con U) mediante enlaces qumicos relativamente dbiles {arriba). Este apareamiento permite que un polinucletido acte como patrn para la sntesis de otro polinucletido ( izq u ierd a ).

Los polinucletidos son capaces de dirigir su propia sntesis3


Los polinucletidos tienen propiedades que contrastan con las de los polippti dos. Su capacidad como catalizadores es ms limitada pero pueden dirigir direc tamente la formacin de copias exactas de su propia secuencia. Esta capacidad depende del apaream iento com plem entario de subunidades de nucletidos, el cual permite a un polinucletido actuar como patrn en la formacin de otro. En el caso ms simple un polmero compuesto por un nucletido (por ejemplo, cido policitidlico o poli C) puede alinear en su superficie las subunidades n e cesarias para generar otro polinucletido, (en este ejemplo el cido poliguanlico o poli G) favoreciendo as su polimerizacin formando poli G (Figura 1-4). Debi do a que las subunidades C se unen preferentemente a las subunidades G, y vi ceversa, a su vez la m olcula de poli G favorecer la sntesis de ms poli C. Consideremos ahora un polinucletido con una secuencia de subunidades ms compleja, concretam ente una molcula de RNA formada por cuatro tipos de nucletidos con las bases uracilo (U), adenina (A), citosina (C) y guanina (G) dispuestas siguiendo una secuencia particular. Debido al apareamiento com ple mentario entre las bases A y U, y entre las bases G y C, cuando esta molcula se aade a una mezcla de nucletidos activados y bajo condiciones adecuadas, di rigir la polimerizacin de una secuencia complementaria a la suya. La nueva molcula de RNA resultante ser una especie de molde del original, de manera que cada A del original corresponder con una U en la copia, y as sucesivamen te. La secuencia de nucletidos de la cadena original de RNA contiene una infor m acin que esencialm ente se conserva en las cadenas complementarias recin formadas: una segunda operacin de copia, tomando la cadena complementaria como patrn, da lugar a la secuencia original (Figura 1-5). Estos mecanism os de molde o patrn complementario son elegantemente sencillos y se hallan en la base de los procesos de transferencia de informacin de los sistemas biolgicos. La informacin gentica contenida en cada clula

paso 1 LA SECUENCIA ORIGINAL FORMA LA SECUENCIA COMPLEMENTARIA

paso 2 LA SECUENCIA COMPLEMENTARIA FORMA LA SECUENCIA ORIGINAL

[|H ppgHgH|KJ
6 Captulo 1 : La evolucin de la clula

Figura 1-5 Replicacin de una secuencia de polinucletido (en este caso una molcula de RNA). En el paso 1, la molcula original de RNA acta como patrn en la formacin de una molcula de RNA de secuencia complementaria. En el paso 2, esta molcula com plementaria de RNA acta a su vez como patrn, formando molculas de RNA de secuencia igual a la original. Puesto que cada molcula patrn puede producir numerosas copias de la hebra complementaria, estas reacciones pueden dar lugar a la multiplicacin de la secuencia original.

est codificada en las secuencias de nucletidos de sus molculas de polinucletidos, y esta informacin se transmite (hereda) de generacin en generacin m e diante las interacciones entre los pares de bases complementarios. Sin embargo, para que se produzcan estos mecanismos de molde se necesi ta la participacin de catalizadores: sin una catlisis especfica, la polimeriza cin sobre un patrn es lenta e ineficaz y adems la formacin de rplicas co rrectas est claramente dificultada por la existencia de reacciones competitivas. En la actualidad las funciones catalticas que replican polinucletidos estn pro porcionadas por protenas altamente especializadas, llamadas enzimas. En el caldo prebitico quiz hubiera polipptidos primitivos que colaboraron en al guna tarea cataltica. Sin embargo la existencia de molculas con especificidad cataltica adecuada debi ser escasa a no ser que el propio RNA fuese capaz, de alguna manera, de favorecer su propia produccin. Volveremos a estudiar las re laciones recprocas entre las sntesis de RNA y las sntesis de protenas, de cru cial importancia en todas las clulas vivas. Pero primero consideraremos qu puede ocurrir con el RNA, ya que las molculas de RNA pueden presentar varias propiedades catalticas adems de actuar como patrones de su propia replicacin. Concretamente, una molcula de RNA con una secuencia de nucletidos adecuada puede actuar como catalizador en la replicacin apropiada de otra molcula de RNA -e l patrn- cuya secuencia puede ser arbitraria. Se cree que la especial versatilidad de las molculas de RNA ha jugado un papel central en los procesos del origen de la vida.

Las molculas autorreplicantes estn sometidas a la seleccin natural3,4


Las molculas de RNA no son nicamente cadenas de smbolos que contienen in formacin de una manera abstracta. Tambin tienen personalidades qumicas concretas que afectan a su comportamiento. Concretamente, la secuencia de nu cletidos determina el modo en que la cadena se pliega en solucin. Del mismo modo que los nucletidos de un polinucletido se pueden aparear con nucletidos complementarios libres de su entorno formando un nuevo polmero, tambin se pueden aparear con residuos complementarios de nucletidos del propio polme ro. Una secuencia GGGG de una regin de una cadena polinucleotdica puede for mar una asociacin relativamente fuerte con una secuencia CCCC de otra regin de la misma molcula. Dichas asociaciones producen diversos pliegues tridimen sionales, y el conjunto de la molcula adopta una forma tpica que depende com pletamente de la secuencia de sus nucletidos (Figura 1-6). La estructura plegada tridimensional de un polinucletido afecta a su esta bilidad, a su accin sobre otras molculas y a su capacidad de replicacin, de modo que no todas las formas de polinucletidos tendrn igual xito en una mezcla de replicacin. Adems resulta inevitable que en cualquier proceso de copia se produzcan errores y las copias imperfectas del original se irn propa gando. Por lo tanto tras repetidas replicaciones se generarn continuamente nuevas secuencias variantes de nucletidos. En estudios de laboratorio se ha de mostrado que los sistemas replicantes de molculas de RNA sufren una especie de seleccin natural a travs de la cual predominan diferentes secuencias favo rables, segn cules sean las condiciones experimentales utilizadas. Lo que es ms importante, las molculas de RNA pueden ser seleccionadas por su capaci dad de unir especficamente casi cualquier otro tipo de molculas. Esto tambin se ha demostrado en experimentos in vitro que se inician con una preparacin de cortas molculas de RNA de secuencias de nucletidos al azar sintetizadas ar tificialmente. Esta mezcla se hace pasar a travs de una columna llena de una re sina a la que se ha unido alguna substancia determinada. Las molculas de RNA que no se unen a esta substancia pasan a travs de la columna y son eliminadas; el pequeo nmero de molculas que se unen a ella es retenido y utilizado como patrn para dirigir la produccin de mltiples copias de su propia secuencia. Esta nueva preparacin de RNA, enriquecida en secuencias que se unen a la

Figura 1 -6 Conformacin de una molcula de RNA. El apareamiento de nucletidos entre diferentes regiones de la propia cadena de polinucletido (RNA) hace que la molcula adopte una forma particular.

Desde las molculas hasta la primera clula

substancia escogida, se utiliza entonces como material de partida para repetir de nuevo el proceso. Tras varios de estos ciclos de seleccin y reproduccin la mez cla de RNA consiste en mltiples copias de un relativamente pequeo nmero de secuencias, cada una de las cuales se une a la substancia de ensayo casi espe cficamente. Por consiguiente, una molcula de RNA tiene dos caractersticas especiales: transporta informacin codificada en su secuencia de nucletidos que puede transmitir mediante el proceso de replicacin, y tiene una estructura plegada nica que determina la manera en que interactuar con otras molculas y res ponder a las condiciones ambientales. Estos dos rasgos -uno de informacin y el otro de funcin- son las dos propiedades esenciales que se necesitan para la evolucin. La secuencia de nucletidos de una molcula de RNA es anloga al genotipo -la informacin hereditaria- de un organismo. La estructura tridimen sional plegada es anloga al fenotipo -la expresin de la informacin gentica en la que acta la seleccin natural.

Algunas molculas especializadas de RNA pueden catalizar reacciones bioqumicas5


La seleccin natural depende del entorno, y para una molcula de RNA que se replica, un com ponente crtico del entorno es el conjunto de las otras molculas de RNA de la mezcla. Adems de actuar como patrn para su propia replicacin, estas molculas de RNA pueden catalizar la rotura y la formacin de enlaces covalentes, incluyendo uniones entre nucletidos. Por ejemplo, algunas molculas de RNA especializadas pueden catalizar cambios en otras molculas de RNA cor tando la secuencia de nucletidos en un punto determinado; otros tipos de m o lculas de RNA eliminan espontneam ente una porcin de su propia secuencia y renen los extremos cortados (un proceso conocido como automaduracin por corte y em palm e, self-splicing). Cada reaccin catalizada por una molcula de RNA depende de una ordenacin especfica de los tomos que forman la su perficie de esta molcula de RNA cataltica (la ribozima ), la cual hace que algu nos grupos qumicos de uno o ms de sus nucletidos sean altamente reactivos. Ciertas actividades catalticas pudieron tener una importancia capital en el caldo primordial. Consideremos una molcula de RNA que catalice el proceso de polimerizacin utilizando cualquier molcula de RNA como patrn. (Esta ac tividad ribozima se ha demostrado directamente in vitro al menos de una forma rudimentaria.) Esta molcula cataltica puede actuar sobre copias de s misma, replicndose con elevada velocidad y eficiencia (Figura 1-7A). Al mismo tiempo, puede promover la replicacin de otras molculas de RNA vecinas (Figura 1-7B). Algunas de estas molculas pueden desarrollar acciones catalticas que ayuden o dificulten la supervivencia o la replicacin del RNA en otras vas. Si los efectos beneficiosos son recprocos, diferentes tipos de molculas de RNA, especializa das en diferentes actividades, pueden desarrollar un sistema cooperativo que se replique con una eficiencia extraordinaria.

La informacin fluye desde los polinucletidos a los polipptidos6


Todo lo expuesto sugiere que hace entre 3,5 y 4 mil millones de aos, unos siste mas autorreplicantes de molculas de RNA, mezcladas con otras molculas or gnicas como algunos polipptidos simples, iniciaron, en algn lugar de la Tie rra, el proceso de la evolucin. Sistemas con diferentes dotaciones de polmeros compitieron por los materiales precursores disponibles para construir copias de ellos mismos, tal y como compiten los organismos actualmente; el xito depen di de la exactitud y de la rapidez con que se producan las copias, y de la estabi lidad de las mismas. Sin embargo, como destacamos anteriormente, aunque la estructura de los polinucletidos est bien adaptada al almacenamiento y replicacin de la infor-

Captulo 1 : La evolucin de la clula

(A) catlisis

replicacin

(B)

Figura 1-7 D iag ram a d e tre s p asos su cesiv o s en la ev olu ci n d el siste m a a u to rre p lic a n te d e m o l cu la s de RNA q u e s o n c a p a ce s de d irig ir la s n te sis p ro te ica .

M olcula de RNA cataltico que une nucletidos para reproducir su m ism a secuencia de nucletidos y por lo tanto su m isma form a.

(C) Familia de m olculas de RNA catalticas que se mantienen m utuam ente, catalizando una de eilas la reproduccin de las otras.

RNA codificante (m olde para la sntesis proteica)

_ RNA adaptadores Evolucin de nuevas m olculas de RNA catalticos, algunas de las cuales unen por s solas am inocidos activados. Por apaream iento de bases a una m olcula de RNA codificante, estas m olculas de RNA perm iten que una secuencia de RNA acte com o m olde o patrn para la sntesis de polm eros de am inocidos, generando as la aparicin de las prim eras secuencias proteicas determ inadas genticam ente. De esta form a, estas m olculas actan com o los prim eros adaptadores entre una secuencia de nucletidos y una secuencia de am inocidos.

macin, sus capacidades catalticas son limitadas respecto a las de los polipptidos, y en las clulas modernas la replicacin eficiente de los polinucletidos es absolutam ente dependiente de las protenas. En el origen de la vida cualquier polinucletido que dirigi la sntesis de un polipptido til debi tener en el am biente competitivo de la evolucin una gran ventaja para sobrevivir. Sin embargo, de qu manera poda la informacin codificada en sus se cuencias determinar las secuencias de otro tipo de polmeros? Sin duda, los poli nucletidos debieron actuar como catalizadores uniendo determinados am ino cidos entre s. En los organismos actuales, un sistema de colaboracin de molculas de RNA juega un papel central en la direccin de la sntesis de polipptidos -la sntesis proteica- pero en el proceso tambin colaboran otras protenas previamente sintetizadas. La maquinaria bioqumica para la sntesis proteica est notablem ente elaborada. Una molcula de RNA contiene la informacin ge ntica de un polipptido determinado, en forma de cdigo, mientras que otras molculas de RNA actan como adaptadores, uniendo cada una de ellas un am i nocido especfico. Estos dos tipos de molculas de RNA forman pares de bases complementarias entre s, permitiendo que las secuencias de nucletidos del RNA codificante dirijan la incorporacin de aminocidos especficos, transpor tados por el RNA adaptador, a la cadena polipeptdica en crecimiento. Probable mente los precursores de estos dos tipos de molculas de RNA dirigieron la pri mera sntesis proteica sin la ayuda de protenas (Figura 1-7C).

Desde las molculas hasta la primera clula

En la actualidad, estos procesos de ensamblaje de nuevas protenas tienen lugar en la superficie de los ribosomas -partculas complejas compuestas por va rias grandes molculas de RNA de otro tipo, y por ms de 50 tipos diferentes de protenas. En el Captulo 5 veremos que este RNA ribosmico juega un papel ca taltico central en el proceso de la sntesis proteica y constituye ms del 60 % de la masa ribosomal. Al menos en trminos evolutivos, este RNA es el componente fundamental del ribosoma. As pues, parece que el RNA dirigi la sntesis primordial de protenas, qui zs de una forma torpe y primitiva. De esta manera el RNA fue capaz de crear herramientas -e n forma de protenas- que permitieron conseguir una biosntesis ms eficiente. Algunas de estas protenas pudieron ser utilizadas en la replicacin del RNA y en el propio proceso de produccin de herramientas. La sntesis de protenas especficas bajo la direccin del RNA requiere la evolucin de un cdigo a travs del cual una secuencia de polinucletidos espe cifique la secuencia de aminocidos que formar la protena. Este cdigo -e l c digo gentico- se deletrea en forma de un diccionario de palabras de tres le tras: diferentes tripletes de nucletidos codifican aminocidos determinados. El cdigo parece haber sido seleccionado arbitrariamente (tal vez sometido a algu nos condicionantes), y todava hoy es prcticamente el mismo en todos los orga nismos vivos* Esto sugiere claram ente que todas las clulas actuales descienden de una lnea celular primitiva que desarroll el m ecanismo de sntesis proteica.

Las membranas definieron la primera clula7


Uno de los acontecim ientos cruciales que condujeron a la formacin de la pri mera clula debi de ser el desarrollo de una membrana externa. Por ejemplo, las protenas sintetizadas bajo el control de un determinado tipo de RNA no faci litaran la reproduccin de este tipo de RNA a menos que permanecieran en sus proximidades; adems, mientras estas protenas tuvieran libertad para difundir entre la poblacin de molculas de RNA en replicacin, podra beneficiar por igual a cualquier especie competidora de RNA que estuviera presente. Si surga una variante de RNA que produca un tipo superior de enzima, la nueva enzima no poda contribuir selectivamente a la supervivencia del RNA variante en la com petencia de ste con los otros RNA. La seleccin de las molculas de RNA de acuerdo con la calidad de las protenas que generaban no pudo empezar hasta que apareci alguna forma de compartimiento que retuviera las protenas pro ducidas por cada molcula de RNA y que por lo tanto hiciera que estas protenas quedaran disponibles slo para el RNA que las produjo (Figura 1-8). Esta necesidad de contener es ejecutada fcilmente por otro tipo de mol culas que poseen la sencilla propiedad fisicoqumica de ser anfipticas, lo cual consiste en que una zona de la molcula es hidrofbica (insoluble en agua) y

SIN COMPARTIMIENTOS

CON COMPARTIMIENTOS

e
10 Captulo 1 : La evolucin de la clula

Figura 1-8 Dibujo esquem tico que m uestra la ventaja evolutiva que suponen los com partim ientos semejantes a una clula. En una mezcla de molculas de RNA autorreplicantes capaces de realizar la sntesis proteica (tal com o se ilustra en la Figura 1-7), cualquier forma de RNA mejorada que sea capaz de producir una protena ms til debe compartir esta protena con todas sus competidoras. Sin embargo, si el RNA est encerrado en un compartimiento, com o por ejemplo una membrana lipdica, cualquier protena que produzca quedar confinada para su uso exclusivo; entonces, el RNA puede ser seleccionado en base a su capacidad de sintetizar una protena mejor.

otra hidroflica (soluble en agua). Cuando tales molculas se encuentran en un medio acuoso se agregan poniendo en ntimo contacto sus zonas hidrofbicas y estableciendo contacto con el agua por sus zonas hidroflicas. Molculas anfipticas de forma adecuada se agregan espontneamente formando bicapas, que generan pequeas vesculas cerradas cuyo contenido acuoso se halla aislado del medio externo (Figura 1-9). Este fenmeno se puede reproducir en el tubo de ensayo simplemente mezclando fosfolpidos y agua: en condiciones apropiadas, se formarn pequeas vesculas. Todas las clulas actuales estn delimitadas por una m em brana plasm tica formada por molculas anfpticas -mayoritariamente fosfolpidos- en esta configuracin; en las membranas celulares la bicapa lipdica tambin contiene protenas anfpticas. Al microscopio electrnico es tas membranas aparecen com o lminas de aproximadamente 5 nm de grosor, con un aspecto triestratifcado caracterstico, debido al empaquetamiento colacon-cola de las molculas de fosfolpidos. Probablemente, las primeras clulas rodeadas de membrana se formaron por ensam blaje espontneo de molculas de fosfolpidos del caldo prebitico, incluyendo una mezcla de molculas autorreplicantes de RNA y otras molculas. No est claro en qu punto de la evolucin de la catlisis biolgica y sntesis pro teica se formaron las primeras clulas. En cualquier caso, cuando las molculas de RNA fueron confinadas con una membrana cerrada pudieron empezar a evo lucionar eficazmente como transportadores de instrucciones genticas: pudie ron ser seleccionadas no solamente en base a su propia estructura, sino tambin por el efecto que ejercieron sobre otras molculas de su mismo compartimiento. Las secuencias de nucletidos de las molculas de RNA pudieron ser expresadas en el carcter de la clula como un todo.

i ACEITE ; \

monocapa de fosfolpidos AGUA

: :

\ : * :

V :

bicapa de fosfolpidos

v ................./

..................

Todas las clulas actuales utilizan el DNA como material hereditario3,6,8


Evidentemente, el cuadro que acabamos de presentar es especulativo: no exis ten datos fsiles que registren los orgenes de la primera clula. Sin embargo, los organismos actuales y los experimentos realizados proporcionan pruebas bas tante convincentes de que los rasgos principales de esta historia evolutiva son correctos. La sntesis prebitica de pequeas molculas, la autorreplicacin de las molculas de RNA cataltico, la traduccin de las secuencias de RNA a se cuencias de aminocidos y el ensamblaje de las molculas lipdicas formando compartimientos rodeados de membrana: todo esto debi de ocurrir durante la gnesis de la clula primitiva hace unos 3,5 o 4 mil millones de aos. Resulta til comparar estas clulas primitivas con las clulas actuales ms sencillas, los micoplasmas. Son pequeas bacterias de un tipo degenerado que normalmente llevan una vida parasitaria en estrecha asociacin con clulas ve getales o animales (Figura 1-10). Algunos tienen un dimetro de aproximada mente 0,3 fim y slo contienen el cido nucleico suficiente para codificar la sn tesis de unas 400 protenas diferentes. Algunas de estas protenas son enzimas, otras son protenas estructurales; otras se hallan en el interior de la clula; otras estn incluidas en su membrana. En conjunto los micoplasmas sintetizan las pe queas molculas esenciales que no se encuentran accesibles en el entorno, re distribuyen la energa necesaria para conducir las reacciones biosintticas y mantienen las condiciones apropiadas en el interior de la clula. Probablemente, las primeras clulas de la Tierra fueron menos sofisticadas y se dividan ms lentamente y con menor eficiencia. Pero exista una diferencia ms fundamental entre las clulas primitivas y un micoplasma o cualquier otra clula actual: la informacin hereditaria en todas las clulas vivas actuales est almacenada en el DNA y no en el RNA, que es como se supone que las clulas primitivas almacenaban la informacin hereditaria. Ambos tipos de polinucletidos se encuentran en las clulas actuales, pero actan de una manera coopera tiva, ya que cada uno ha evolucionado en el sentido de desempear tareas espe cializadas. Pequeas diferencias qumicas hacen que cada uno de los dos tipos

Figura 1 -9 Form acin de m em branas por fosfolpidos. Dado que estas molculas tienen una cabeza hidroflica y unas colas lipoflicas, en una interfase aceite-agua se alinean espontneam ente con la cabeza hacia el agua y las colas en el aceite. En agua se asocian formando bicapas vesiculares cerradas, en las cuales las colas lipoflicas estn en contacto con otras colas y las cabezas hidroflicas estn expuestas al agua.

i__________ i

5 (jm

Figura 1-10 Spiroplasma citrii, un m icoplasm a que crece en clulas vegetales. (Por cortesa de J. Burgess.)

Desde las molculas hasta la primera clula

11

de molculas sean adecuadas para funciones diferentes. El DNA acta como de positario permanente de la informacin gentica y a diferencia del RNA se halla en las clulas principalmente en forma de doble hebra, compuesta por un par de molculas complementarias de polinucletidos. Esta estructura de doble hebra hace al DNA celular ms robusto y estable que el RNA; tambin determina que el DNA sea relativamente fcil de replicar (vase el Captulo 3) y permite que acte un mecanismo de reparacin que utiliza la hebra intacta como patrn para la correccin o reparacin de la hebra lesionada asociada. El DNA dirige la sntesis de molculas especficas de RNA, de nuevo por el principio de apareamiento de pares de bases complementarias, aunque el apareamiento se produce aqu entre tipos de nucletidos ligeramente diferentes. Luego, las molculas de RNA resul tantes, de una sola hebra, realizan otras dos funciones primordiales: dirigen la sntesis proteica tanto com o molculas de RNA codificantes (RNA ) como de RNA catalticos (RNA y otros no mensajeros). Brevemente, se sugiere que el RNA apareci antes que el DNA en el proceso evolutivo, presentando las propiedades gentica y cataltica; posteriormente, el DNA tom el relevo de la funci gentica primaria y las protenas se constituye ron en los principales catalizadores, mientras que el RNA qued relegado a prin cipal intermediario entre ambos (Figura 1-11). Con el advenimiento del DNA, las clulas pudieron ser cada vez ms complejas, ya que pudieron contener y trans mitir una cantidad de informacin gentica mayor de la que poda almacenarse de forma estable en las molculas de RNA.

EVOLUCIN DE RNA ADAPTADORES

sistemas basados en el RNA y en las protenas


------- protn*

ribosmicos

mensajeros

EVOLUCIN DE NUEVAS ENZIMAS QUE GENERAN DNA Y LO COPIAN EN MOLCULAS DE RNA

Resumen

Las clulas vivas surgieron probablemente en la Tierra gracias a la agregacin es pontnea de molculas, hace aproximadamente 3,5 mil millones de aos. Sobre la base de nuestros conocimientos acerca de los organismos actuales y de las molculas que contienen, parece probable que el desarrollo de los mecanismos autocatalticos fundamentales para los sistemas vivientes empezara con la evolucin de familias de molculas de RNA que podan catalizar su propia replicacin. Con el tiempo, una de estas familias de RNA catalticos cooperativos debi de desarrollar la habili dad de dirigir la sntesis de polipptidos. Finalmente, debido a que la acumulacin de catalizadores proteicos permiti la evolucin de clulas ms complejas y eficientes, el DNA de doble hebra substituy al RNA como molcula ms estable para el almacenaje de las cantidades crecientes de informacin gentica requerida por estas clulas. De los procariotas a los eucariotas9
Se cree que todos los organismos que viven actualmente sobre la Tierra derivan de una nica clula primitiva nacida hace ms de tres mil millones de aos. Esta clula, superando a sus competidoras, tom la delantera en el proceso de divi sin celular y evolucin y, con el tiempo, cubri de verde la Tierra y cambi la composicin de su atmsfera, convirtindola en el hogar de la vida inteligente. Los parecidos familiares entre todos los organismos son demasiado acusados para ser explicados de otra manera. Un hito importante a lo largo de este cam i no evolutivo se produjo hace 1,5 mil millones de aos, cuando ocurri la transi cin desde las clulas pequeas con una estructura interna relativamente senci lla -las denominadas clulas procariotas, que incluyen los diversos tipos de bacterias- hasta las clulas mayores y radicalmente ms complejas, tal como las encontram os hoy en los animales y plantas superiores.

l isura 1-11 Estadios propuestos para la evolucin desde sencillos sistemas autorreplicantes de molculas de RNA hasta las clulas actuales. Actualmente el DNA es el depositario de la informacin gentica y el RNA acta mayoritariamente como intermediario de la sntesis proteica.

eucariotas,

Las clulas procariotas son estructuralmente simples pero bioqumicamente diversas1 0


Las bacterias son los organismos ms sencillos que se encuentran en la mayora de hbitats naturales. Se trata de clulas esfricas o alargadas, generalmente de

12

Captulo 1 : La evolucin de la clula

S pirillum

Figura 1-12 Estructuras y tamaos de procariotas. (A) Algunas clulas


procariotas dibujadas a escala. (B) Mlcrograffa electrnica de una seccin longitudinal de una bacteria {Escherichia coty; el DNA celular est concentrado en la regln plida de la figura. (Por cortesa de E. Kellenberger.)

Bacillus grande

o
(A)

Escherichia coli 3 especies de M ycoplasm a (B)


1

Staphylococcus

un dimetro de varios micrmetros (Figura 1-12). A menudo poseen una envol tura protectora resistente, denominada pared celular, por debajo de la cual una membrana plasmtica rodea a un nico compartimiento citoplasmtico que contiene DNA, RNA, protenas y pequeas molculas. Al microscopio electrni co, este interior celular aparece como una matriz de textura variable y sin ningu na estructura interna organizada evidente (vase la Figura 1-12B). Las bacterias son pequeas y se pueden replicar a gran velocidad, simple mente dividindose en dos mediante fisin binaria. Cuando el alimento es abundante, "la supervivencia del ms apto significa generalmente la supervi vencia de los que pueden reproducirse con mayor rapidez. En condiciones pti mas, una misma clula procariota se puede dividir cada 20 minutos, y por lo tan to dar lugar a 5 mil millones de clulas (aproximadamente el mismo nmero de la poblacin humana mundial actual) en menos de 11 horas. La capacidad de di vidirse con rapidez permite que las poblaciones de bacterias se adapten rpida mente a los cambios de su ambiente. Por ejemplo, en condiciones de laboratorio una poblacin de bacterias mantenida en un gran recipiente evoluciona en unas cuantas semanas, mediante mutacin espontnea y seleccin natural, y consi gue utilizar como fuente de carbono nuevos tipos de molculas de azcar. En la Naturaleza las bacterias viven en una gran variedad de nichos ecolgi cos y muestran la riqueza correspondiente a su composicin bioqumica. Se
bacterias anaerbicas que viven en condiciones cidas calientes (por ejemplo, bacterias del azufre) bacterias que viven en condiciones salinas extremas (halfilas extremas) bacterias anaerbicas que reducen el CO2 a metano (metangenas) bacterias gram positivas bacterias verdes fotosintetizadoras (anaerbicas) EUBACTERIAS
(procariotas)

ARQUEBACTERIAS (procariotas)
PROCARIOTA ANCESTRAL

cianbacterias (algas verde-azules) bacterias prpuras fotosintetizadoras bacterias gram negativas no fotosintetizadoras espiroquetas

Figura 1-13 Relaciones familiares entre las bacterias actuales. Las


flechas Indican posibles vas de evolucin. El origen de las clulas eucariotas se discute ms adelante en el texto.

De los procariotas a los eucariotas

13

pueden reconocer dos grupos distintos: las eubacterias, que son las formas ms habituales y viven en el suelo, el agua y los organismos vivos; y las arquebacterias, que se encuentran en ambientes tan incmodos como cinagas, profundi dades marinas, aguas salobres y fuentes cidas calientes (Figura 1-13). Existen especies de bacterias que pueden utilizar como alimento prctica mente cualquier tipo de molcula orgnica, incluidos azcares, aminocidos, grasas, hidratos de carbono, polipptidos y polisacridos. Algunas son capaces incluso de obtener los tomos de carbono del CO;, y los tomos de nitrgeno del N2. A pesar de su simplicidad relativa, las bacterias han sobrevivido durante ms tiempo que cualquier otro organismo y todava constituyen el tipo de clulas ms abundante de la Tierra.

Las reacciones metablicas evolucionan10,1 1


Una bacteria que crezca en una solucin salina que contenga un nico tipo de fuente de carbono, como por ejemplo la glucosa, debe realizar un elevado n mero de reacciones qumicas. No slo debe obtener de la glucosa la energa qu mica necesaria para muchos procesos vitales, sino que tambin debe utilizar los tomos de carbono de la glucosa para sintetizar todos los tipos de molculas or gnicas que la clula necesita. Estas reacciones estn catalizadas por cientos de enzimas que trabajan en cadenas de reacciones, de forma que el producto de una reaccin es el sustrato de la siguiente; estas cadenas enzimticas, deno minadas vas metablicas, se estudiarn en el captulo siguiente. Probablemente cuando empez la vida sobre la Tierra estas elaboradas re acciones m etablicas eran poco necesarias. Las clulas podan sobrevivir y cre cer gracias a las molculas de su entorno. Pero a medida que se agotaron estos recursos naturales, la com petencia por estas limitadas fuentes de recursos fue

m etabolitos asequibles en el m edio externo clula

m etabolito asequible en el m edio externo


Figura 1-14 Dos m aneras posibles a travs de las cuales pudieron evolucionar las vas metablicas. (A) La clula de la izquierda tiene a su disposicin una serie de substancias afines (A, B, C, D) producidas por sntesis prebitica. Una de ellas, la substancia D, es m etablicam ente til. Cuando la clula agota la reserva disponible de D, obtiene una ventaja selectiva con la evolucin de una nueva enzima que puede producir D a partir de la substancia afn C. Mediante una serie de pasos similares pueden haber surgido vas metablicas fundamentalmente importantes. (B) A la derecha, un compuesto A m etablicam ente til se halla disponible en abundancia. En el transcurso de la evolucin aparece una enzima que, por casualidad, tiene la capacidad de convertir la substancia A en la substancia B. Luego se producen otros cambios dentro de la clula, que le permiten utilizar la nueva substancia. La aparicin de otras enzimas puede dar lugar a una larga cadena de reacciones.

nueva enzima

nueva enzima

nueva enzima

nueva enzima

nueva enzima

(A)
14 Captulo 1 : La evolucin de la clula

(B)

h 2o

Figura 1-15 El enlace tioster.

SH + H O C
h2 o

S C

tiol

cido carboxlico

tioster

cada vez ms intensa. Los organismos que haban desarrollado enzimas para fa bricar molculas orgnicas posean una gran ventaja selectiva. De esta manera, se cree que la dotacin de enzimas de las clulas aument gradualmente, gene rando las vas metablicas de los organismos actuales. La Figura 1-14 muestra dos maneras plausibles por las que podra haber surgido una va metablica du rante la evolucin. Si las vas metablicas evolucionaron por adicin secuencial de nuevas reac ciones enzimticas a las ya existentes, las reacciones ms antiguas, al igual que los anillos ms viejos del tronco de un rbol, deben de hallarse ms prximas al centro del rbol m etablico, donde se sintetizan los bloques constitutivos m o leculares bsicos ms esenciales. Esta posicin central del metabolismo est cla ramente ocupada por los procesos qumicos en los que intervienen los azcares fosfato. Entre estos procesos el ms central probablemente es la secuencia de re acciones conocida com o glucolisis mediante la cual la glucosa puede ser degra dada en ausencia de oxgeno (es decir, de forma anaerbica ). Las vas m etabli cas ms antiguas debieron ser anaerbicas ya que no exista oxgeno libre en la atmsfera de la Tierra primitiva. La glucolisis se produce prcticam ente en todas las clulas vivas e impulsa la formacin del compuesto adenosn trifosfato o ATP, que es utilizado por todas las clulas como una verstil fuente de energa qumi ca. Algunos compuestos tioster desempean un papel fundamental en las reac ciones de transferencia de energa de la glucolisis y en un gran nmero de otros procesos bioqumicos bsicos en los que dos molculas orgnicas (un grupo tiol y un cido carboxlico) se unen mediante un enlace rico en energa en el que in terviene el azufre (Figura 1-15). Se ha argumentado que esta simple pero pode rosa estrategia es una reliquia de procesos prebiticos, que refleja las reacciones que tuvieron lugar en el ambiente sulfuroso volcnico de la tierra primitiva, an tes incluso de que el RNA hubiera empezado a evolucionar. Conectados a estas reacciones centrales de la glucolisis se encuentran cien tos de procesos qumicos distintos. Algunos de ellos son responsables de la sn tesis de pequeas molculas, muchas de las cuales son utilizadas en reacciones posteriores para producir los grandes polmeros especficos del organismo. Otras reacciones se utilizan para degradar a unidades qumicas ms simples molculas complejas ingeridas como alimento. Uno de los rasgos ms notables de estas re acciones m etablicas consiste en que se producen en todos los tipos de organis mos, lo cual sugiere que su origen es extremadamente antiguo.

Comparando secuencias de DNA se pueden deducir relaciones evolutivas1 2


Las enzimas que catalizan las reacciones m etablicas fundamentales, sin dejar de desarrollar las mismas funciones esenciales, sufrieron modificaciones pro gresivas a medida que los organismos evolucionaron hacia formas divergentes. Por esta razn la secuencia de aminocidos del mismo tipo de enzima de dife rentes especies actuales proporciona un ndice extremadamente valioso de la re lacin evolutiva existente entre estas especies. Los resultados obtenidos mues tran un estrecho paralelismo entre este ndice y los proporcionados por otros mtodos, como por ejemplo el registro fsil. Una fuente de informacin an ms rica se halla presente en la clula viva en las secuencias de nucletidos del DNA. Mtodos modernos de anlisis permiten determinar estas secuencias de DNA en un gran nmero de especies y compararlas entre s. Las comparaciones de se cuencias altamente conservadas, que tienen un papel central y por consiguiente

De los procariotas a los eucariotas

15

hom bre 1 sapo ------------ hongo i------maz --------- Volvox ---------------------------------------protozoos ciliados ----------------------------- D ictyostelium -------------------------------------------------Euglena ----------------------------------------------------tripanosom a ------------------------------------------------------------------------------------------------------ m icrosporidios ----------------------------------------------------------------------------- Giardia Halobacterium E. coli

Figura 1*10 Relaciones evolutivas entre los organismos, deducidas a partir de las secuencias de nudedtldos de los genes de la subunldad ribosdmica pequea. Estos
genes presentan secuencias altamente conservadas, que han cambiado tan lentamente que pueden ser utilizadas para medir las relaciones fliogenticas abarcando el conjunto entero de ios organismos vivos. Los datos sugieren que los linajes de las plantas, animales y hongos divergieron de un ancestro comn relativamente tarde en la historia de las clulas eucariotas. Halobacterium y E. coli son procartotas; el resto son eucariotas. Giardia, los microsporidios, los tripanosomas, Euglena, y los protozoos ciliados son protistas (eucariotas unicelulares). (Adaptado de M.L. Sogn, J.H. Gunderson, HJ. Elwood, R.A. Alonso and D.A. Peattle, Science 243:75-77,1989. < >1989 the AAAS.)

durante la evolucin slo cambian lentamente, pueden poner de manifiesto pa rentescos entre organismos que divergieron hace tiempo (Figura 1-16), mientras que secuencias que evolucionan rpidamente pueden utilizarse para determinar cmo evolucionan especies ntimamente relacionadas. Es de esperar que la con tinua aplicacin de estos mtodos permitir seguir el curso de la evolucin con una exactitud sin precedentes hasta el momento.

Las cianobacterias pueden fijar C02y N21 3


A medida que se intensific la competencia por los materiales crudos necesarios para sntesis orgnica, los organismos capaces de utilizar directamente de la at msfera tomos de carbono y de nitrgeno (en forma de C02 y de N2) tuvieron ms ventaja. Sin embargo, aunque el C02 y el N2 eran muy abundantes, tambin resultaban muy estables, por lo que era necesaria una gran cantidad de energa y un elevado nmero de reacciones qumicas complicadas para transformarlos en formas utillzables -es decir, en molculas orgnicas como los azcares simples. En el caso del C02, el mecanismo principal que apareci para conseguir esta transformacin fue la fotosntesis, en la que la energa radiante obtenida del sol se utiliza para facilitar la conversin de C02 en compuestos orgnicos. La inter accin de la luz solar con una molcula de pigmento, la clorofila, excita un elec trn que pasa a un estado de mayor energa. Cuando el electrn cae de nuevo a un nivel de menor energa, la energa que se desprende impulsa unas reacciones qumicas, facilitadas y dirigidas por molculas proteicas. Probablemente una de las primeras reacciones impulsadas por la luz solar fue la generacin de poder reductor. Los tomos de carbono y de nitrgeno del C02 y del N2 atmosfricos se hallan en un estado oxidado e inerte. Una manera de con seguir que sean ms reactivos para que participen en las reacciones de biosntesis consiste en reducirlos -es decir, en proporcionarles una mayor cantidad de elec trones. Ello se consigue en varias etapas. En la primera, se liberan electrones de dadores dbiles de electrones, y se transfieren a un dador fuerte de electrones, por medio de la clorofila, a travs de una reaccin en la que interviene la luz; en el pro ceso de reduccin el dador fuerte de electrones se utiliza para reducir el C02 o el N2. El estudio de los mecanismos de fotosntesis en diversas bacterias actuales su giere que una de las primeras fuentes de electrones fue el H2S, siendo el producto residual primario el azufre elemental. Ms tarde se llev a cabo el proceso mucho ms difcil, pero en ltimo trmino ms rentable, de obtener electrones del H20 y el 0 2 fue liberado en grandes cantidades como producto residual. Actualmente las cianobacterias (conocidas tambin como algas azules) son una va principal a travs de la cual el carbono y el nitrgeno son transformados
16 Captulo 1 : La evolucin de la clula

en molculas orgnicas, penetrando as en la biosfera. Constituyen los organis^ mos ms autosuficientes de los que viven en la actualidad. Al ser capaces de "fi ja r el C 0 2 y el N2 en molculas orgnicas estn capacitadas, en una primera aproximacin, para vivir nicamente del agua, del aire y de la luz solar; es probable que los mecanismos mediante los cuales lo consiguen hayan permanecido esencialm ente constantes durante varios miles de millones de aos. Conjunta* mente con otras bacterias que tienen algunas de estas capacidades, crearon las condiciones adecuadas para la evolucin de otros tipos de organismos ms complejos: en cuanto algn tipo de organismos fue capaz de sintetizar a partir de material inorgnico crudo la gama completa de componentes orgnicos celulares, otros organismos pudieron subsistir alimentndose de los sintetizadores primarios y de sus productos.

Las bacterias pueden realizar la oxidacin aerbica de las molculas nutritivas1 3


Actualmente mucha gente est preocupada, y con razn, por las consecuencias ambientales de las actividades humanas. Sin embargo, en el pasado otros orga nismos provocaron tam bin (aunque mucho ms lentamente) cambios revolu cionarlos en el medio ambiente de la Tierra. Este cambio resulta especialmente evidente en cuanto a la composicin de la atmsfera terrestre, que a travs de la fotosntesis (proceso que liber oxgeno) fue transformndose desde una mezcla prcticam ente carente de oxgeno hasta una mezcla en la que el oxgeno consti tuye un 21% del total (Figura 1-17). Puesto que el oxgeno es un elemento qumico extremadamente reactivo, que puede interaccionar con la mayora de los constituyentes citoplasmtlcos, debi de ser txico para muchos organismos primitivos, al igual que lo es para muchas bacterias anaerbicas actuales. Sin embargo, esta reactividad tambin proporciona una fuente de energa qumica, y por tanto no es sorprendente que haya sido utilizada por los organismos en el transcurso de la evolucin. Utilizan do oxgeno, los organismos pueden oxidar de manera ms completa las m olcu las que ingieren. Por ejemplo, en ausencia de oxgeno, la glucosa nicamente puede ser degradada hasta cido lctico o etanol, los productos finales de la glucolisis anaerbica. Pero en presencia de oxgeno, la glucosa puede ser degradada completamente a C 0 2 y H20 . De esta manera se puede obtener mucha ms energa por cada gramo de glucosa. La energa liberada en la respiracin -la oxi dacin aerbica de las molculas alim enticias- se utiliza para impulsar la snte sis de ATP, de una manera muy parecida a la que los organismos fotosintticos

Figura 1*17 El oxgeno atmosfrico y el curso de la evolucin. Relacin entre los cambios en los niveles de oxgeno atmosfrico y algunas de las principales etapas que ai parecer ocurrieron durante la evolucin de los organismos vivos sobre la Tierra. Como se indica, las evidencias geolgicas sugieren que pasaron ms de mil millones de aos entre la aparicin de las clanobacterlas (probablemente el primer organismo que liber oxgeno) y el momento en que los niveles de oxgeno empezaron a acumularse en la atmsfera. Se cree que este intervalo fue debido fundamentalmente al rico aporte de hierro ferroso disuelto en los ocanos, que reaccion con el oxgeno liberado formando enormes depsitos de xido de hierro.

20 NIVELES DE OXGENO EN LA ATMSFERA

(% )

10

inicio del acum ulo rpido de O j (el Fe2* de los ocanos lo utilizan)

TIEMPO (MILES DE MILLONES DE AOS)

formacin de los ocanos y Ir los continental formacin da la Tier i n

'

JL
primaras primara liberacin callas tie oxigeno por vivas fotosntesis primeras clulas fotoslnttlcas

actualmente origen de las clulas primeros fotosinttlcas vertebrados eucar iotas la respiracin aerbica primeros animales su geneiall/a y plantas pluricelulares

De los procariotas a los eucariotas

17

EL SISTEMA DE MEMBRANAS DE LA CELULA


MEMBRANA PLASMATICA
El lm it e e x t e r n o d e la c lu la e s la m e m b r a n a p la s m tic a , u n a c a p a c o n tin u a d e m o l c u la s lip d ic a s d e u n o s 4 -5 n m d e g r o s o r , e n la q u e e s t n in c lu id a s v a r ia s p r o t e n a s ,

RETICULO ENDOPLASMATICO
P o r t o d o el c ito p la s m a d e las c lu la s e u c a ri tic a s se e x tie n d e un s is te m a d e m e m b r a n a f o r m a n d o c is te rn a s , s c u lo s y tu b o s a p la n a d o s , o c u p a n d o r o d e a n d o un a m p lio e s p a c io n tr a c e lu la r . La m e m b r a n a d e l RE se h a lla e n c o n tin u id a d e s tr u c tu r a l c o n la m e m b r a n a e x te r n a d e la e n v o ltu r a n u c le a r y e s t e s p e c ia liz a d a e n la s n te s is y e n el t r a n s p o r te d e lp id o s y p r o te n a s d e m e m b r a n a . El re tc u lo e n d o p la s m tic o r u g o s o (ER ru g o s o ) se s u e le p r e s e n ta r c o m o s c u lo s a p la n a d o s y e x t e r io r m e n t e e s t r e c u b ie r to p o r r ib o s o m a s , d e d ic a d o s a la s n te s is p r o te ic a .

ESPACIO EXTRACELULAR

bom ba proteica

o
proteina

I bicapa J lipidica

iflii*

CITOPLASMA

canal proteico x- ' ;

ribosom as

A lg u n a s de estas p ro te n a s a c t a n c o m o b o m b a s y c a n a le s p a ra el tra n s p o rte d e m o l c u la s e sp e c fic a s hacia fu e ra y d e n tro de la c lu la .

COMPLEJO DE GOLGI
U n s is t e m a d e s c u lo s a p ila d o s , lim it a d o s p o r m e m b r a n a y a p la n a d o s , im p lic a d o s e n la m o d ific a c i n , s e le c c i n y e m p a q u e t a m i e n t o d e m a c r o m o l c u la s p a r a la s e c r e c i n o p a ra la e x p o r ta c i n a o tr o s r g a n u lo s .

nucleo El re tc u lo e n d o p la s m tic o liso (ER liso ) s u e le s e r m s t u b u la r y c a re c e d e r ib o s o m a s . S u p r in c ip a l fu n c i n se c e n tra e n el m e ta b o lis m o lip d ic o . .

Jlil L )

i-

C r -- ' /s . ^ "s-

3 e~\
LISOSOMAS

M iH i

lili

PEROXISOMAS 0,2-0,5 |um


0,2-0,5 ju m
v e s c u la s lim it a d a s p o r m e m b r a n a q u e c o n t ie n e n e n z im a s o x id a t iv a s q u e g e n e r a n y d e s t r u y e n el p e r x id o d e h id r g e n o

A lr e d e d o r d e l c o m p le jo d e G o lg i se e n c u e n tr a n n u m e r o s a s v e s c u la s p e q u e a s r o d e a d a s d e m e m b r a n a (d e m s d e 5 0 n m ) S e c re e q u e t r a n s p o r t a n m a t e r ia l d e s d e el c o m p le jo d e G o lg i a lo s d if e r e n t e s c o m p a r t im e n t o s d e la c lu la . v e s c u la s lim it a d a s p o r m e m b r a n a q u e c o n tie n e n e n z im a s h id r o ltic a s d e s tin a d a s a la s d ig e s tio n e s in t r a c e lu la r e s

18

Panel 1-1 Clulas eucariotas: esquema de sus principales orgnulos.

NCLEO
El n c le o es el o r g n u lo m s a p a r e n te d e la c lu la . E s t s e p a r a d o d e l c it o p la s m a p o r u n a e n v o lt u r a f o r m a d a p o r d o s m e m b r a n a s T o d o el D N A c r o m o s m ic o se e n c u e n tr a e n el n c le o , e m p a q u e t a d o e n fib r a s d e c r o m a t in a g r a c ia s a su a s o c ia c i n c o n u n a c a n t id a d ig u a l d e p r o te n a s h is to n a s . El c o n te n id o n u c le a r , el n u c le o p la s m a , s e c o m u n ic a c o n el c ito s o l p o r m e d io d e u n a s a b e r tu r a s d e la e n v o ltu r a n u c le a r d e n o m in a d a s p o ro s n u c le a r e s .

3-10 pm

poros nucleares

nuclolo: una fbrica dentro del ncleo, donde se ensamblan los ribosom as de la clula envoltura nuclear m em brana interna mem brana externa

crom atina

CITOESQUELETO
E n el c ito s o l, u n a s a g r u p a c io n e s d e fila m e n t o s p r o te ic o s f o r m a n r e d e s q u e le c o n fie r e n a la c lu la su f o r m a y q u e c o n s tit u y e n la b a s e d e s u s m o v im ie n t o s . Lo s tr e s p r in c ip a le s tip o s d e e le m e n t o s d e l c it o e s q u e le to s o n :

MITOCONDRIAS
A p r o x im a d a m e n t e d e l t a m a o d e la s b a c te r ia s , la s m it o c o n d r ia s s o n la s c e n tr a le s e n e r g tic a s d e t o d a s las c lu la s e u c a r io t a s ; u tiliz a n la e n e r g a o b t e n id a c o m b in a n d o o x g e n o c o n m o l c u la s n u t r it iv a s p a ra p r o d u c ir A T P . ----------- j

1. m ic r o t b u lo s 25 nm d i m e t r o 2. f ila m e n t o s d e a c tin a 8 nm d i m e t r o

m em brana externa m em brana interna plegada form ando crestas ..

// /[

3. f ila m e n t o s in t e r m e d io s 10 n m d i m e t r o

las fases term inales de la oxidacin tienen lugar en la m em brana interna

el espacio de la m atriz contiene una solucin concentrada de muchas enzimas diferentes

ORGANULOS ESPECIALES DE LA CELULA VEGETAL


V a c u o la ; U n a v e s c u la m u y g r a n d e , C lo r o p la s to s : E s to s p la s to s , q u e c o n tie n e n c lo r o f ila , s o n o r g n u lo s r o d e a d o s p o r u n a d o b le m e m b r a n a , y se e n c u e n tr a n e n t o d a s las p la n ta s s u p e r io r e s . U n e la b o r a d o s is te m a d e m e m b r a n a s e n el in te r io r d e l c lo r o p la s to c o n t ie n e el a p a r a to f o t o s in t e tiz a d o r . lim it a d a p o r u n a m e m b r a n a u n it a r ia , q u e o c u p a h a s ta el 9 0 % d e l v o lu m e n c e lu la r ; la v a c u o la a c t a e n la

vacuola

r e g u la c i n d e la p r e s i n o s m tic a y t a m b i n e n la d ig e s ti n in t r a c e lu la r .

m em brana externa m em brana interna

tilacoide grana estrema


P a re d c e lu la r : Las c lu la s v e g e ta le s e s t n r o d e a d a s p o r u n a p a r e d r g id a f o r m a d a p o r fib r illa s d e c e lu lo s a d e p o s it a d a s e n u n a m a tr iz f o r m a d a p o r o tr o s p o lis a c r id o s .

m em brana plasm tica m em brana de la vacuola (tonoplasto)

m em brana plasmtica

19

producen ATP a partir de la energa de la luz solar. En ambos procesos existe una serie de reacciones de transferencia electrnica que genera un gradiente de H+ entre el exterior y el interior de un compartimiento rodeado por una membrana; el gradiente de H+se utiliza luego para impulsar la sntesis del ATP. Actualmente, la respiracin es utilizada por la gran mayora de organismos, incluidos la mayor parte de los procariotas.

Las clulas eucariotas poseen varios orgnulos caractersticos1 4


Qu sucedi con los organismos anaerbicos, con los que haba empezado la vida, en cuanto se fue acumulando oxgeno molecular en la atmsfera? En un mundo rico en oxgeno, que no podan utilizar, se hallaban en franca desventaja. Es indudable que algunos se extinguieron. Otros desarrollaron la capacidad de respirar o encontraron nichos en los que escaseaba el oxgeno y en los que pu dieron continuar un tipo de vida anaerbica. Otros, se transformaron en predadores o parsitos de las clulas aerbicas. Y algunos parece que descubrieron una estrategia de supervivencia ms astuta y ms rica de implicaciones para el futuro: se cree que formaron una asociacin ntima con un tipo aerbico de c lula, viviendo en simbiosis con l. sta es la explicacin ms plausible del origen de las clulas actuales de tipo eucariota (Panel 1-1, pgs. 18-19), que constitu yen el tem a principal de este libro. Por definicin, y a diferencia de las clulas procariotas, las clulas eucario tas tienen un ncleo (caryon en griego), que contiene la mayor parte del DNA celular y que est rodeado por una doble membrana (Figura 1-18). Por consi guiente, el DNA se mantiene en un compartimiento, separado del resto del con tenido celular, el citoplasma, que es donde se producen la mayora de las reac ciones metablicas de la clula. Adems, en el citoplasma se pueden distinguir muchos orgnulos caractersticos. Entre ellos destacan dos pequeos tipos de corpsculos, las mitocondrias y los cloroplastos (Figuras 1-19 y 1-20). Cada uno de ellos est rodeado por su propia doble membrana, que es qumicamente dife rente de la m em brana que envuelve al ncleo. La presencia de mitocondrias

5 pm
Figura I IB El ncleo celular. El ncleo contiene la mayor parte del DNA de la clula eucariota. La figura lo muestra en un corte ultrafino de una clula de mamfero, observada al microscopio electrnico. No sabemos cmo y cundo se gener el ncleo; en la Figura 12-5 se presentan algunas especulaciones sobre este origen. (Por cortesa de Daniel S. Friend.)

grana

1 (Jm
Figura 1-10 Un cloroplasto. Micrografia electrnica de un cloroplasto de una clula de musgo, mostrando su extenso sistema de membranas internas. Los sacos membranosos aplanados contienen clorofila y estn dispuestos en pilas, o gran a. Este cloroplasto contiene tambin grandes acmulos de almidn. (Por cortesa de J. Burgess.)

1 |jm

Figura 1-20 Una m itocondria. En casi


todas las clulas eucariotas, las mitocondrias realizan la degradacin oxidativa de las molculas nutrientes. Tal como se observa en esta micrografa electrnica, presentan una membrana externa lisa y una membrana interna altamente replegada. (Por cortesa de Daniel S. Friend.)

20

Captulo 1 : La evolucin de la clula

constituye un rasgo casi universal de las clulas eucariotas*, mientras que los cloroplastos se encuentran nicamente en aquellas clulas eucariotas que pue den realizar fotosntesis -e s decir, en las plantas, pero no en los animales ni en los hongos. Se cree que ambos orgnulos tienen un origen simbitico.

Las clulas eucariotas dependen de las mitocondrias para su metabolismo oxidativo1 5


Las mitocondrias muestran muchas similitudes con los organismos procariotas de vida libre: por ejemplo, se parecen a menudo a las bacterias en cuanto a tamao y forma, contienen DNA, fabrican protenas y se reproducen dividindose en dos. Rompiendo las clulas eucariotas y separando los elementos que las constituyen, es posible demostrar que las mitocondrias son responsables de la respiracin y que este proceso no se produce en ninguna otra parte de la clula eucariota. Sin las mitocondrias, las clulas de los animales y de los hongos seran organismos anaerbicos que para obtener su energa dependeran del proceso relativamente poco eficaz y antiguo de la glucolisis. Muchas bacterias actuales respiran igual que las mitocondrias, y parece probable que las clulas eucariotas sean descendientes de organismos anaerbicos primitivos que sobrevivieron en un mundo que haba pa sado a ser rico en oxgeno incorporando bacterias anaerbicas -mantenindolas en simbiosis, debido a su capacidad de consumir el oxgeno atmosfrico y produ cir energa. Ciertos microorganismos actuales muestran claras evidencias de la via bilidad de esta secuencia evolutiva. Existen varios cientos de especies unicelulares de organismos eucariotas que se parecen a la hipottica clula eucariota ancestral en que viven en condiciones pobres de oxgeno (por ejemplo, en el intestino de los animales) y no presentan mitocondrias. Recientemente, anlisis comparativos de secuencias nucleotdicas han sugerido que al menos dos grupos de estos organis mos, los diplomonados y los microsporidios, pudieron divergir muy temprana mente del linaje principal de las otras clulas eucariotas (Figura 1-21). Existe otro eucariota, la ameba Pelomyxa palustris que a pesar de que carece de mitocondrias, realiza un metabolismo oxidativo hospedando bacterias aerbicas en su citoplas ma, manteniendo con ellas una relacin simbitica permanente. Por consiguiente, los diplomonados y los microsporidios por una parte y Pelomyxa por otra, parecen dos de los estadios propuestos en la evolucin de los eucariotas.
* (T V . del T.) nicamente los microsporidios, protozoos endoparsitos, carecen de mitocondrias.

Hgiira l-'l El diplomonado Giardia. (A) Dibujo, tal com o se ve al microscopio ptico. (B) Micrografa electrnica de una seccin a travs del aplanado cuerpo de la clula. Se cree que G iardia es uno de los tipos celulares ms primitivos de clula eucariota. Es nucleado (de hecho tiene dos ncleos Idnticos), presenta citoesqueleto con actina y tubulina y se desplaza mediante flagelos tpicos que contienen microtbulos; sin embargo no tiene ni mitocondrias ni cloroplastos ni un retculo endoplasm tico normal ni com plejo de Golgi. Estudios de secuencias de nucletidos indican que est al menos tan relacionado con las bacterias como con otros eucariotas, de los que debi de diverger en etapas tempranas de la evolucin. G iardia vive como un parsito en el intestino y en humanos puede causar enfermedades. (A, segn G.D. Schmidt y L.S. Roberts, Foundations of parasitology, 4th Ed. St. Louis: Times Mirror/Mosby, 1989; B, por cortesa de Dennis Feely.)

De los procariotas a los eucariotas

21

La adquisicin de mitocondrias debi de tener muchas repercusiones. La membrana plasmtica, por ejemplo, est fuertemente comprometida en el meta bolismo energtico en las clulas procariotas pero no en las eucariotas, en las que esta funcin crucial ha sido relegada a la mitocondria. Parece probable que la sepa racin de funciones dej libre a la membrana plasmtica eucariota para desarrollar otras caractersticas importantes. Concretamente, dado que las clulas eucariotas no necesitan mantener un marcado gradiente de H+a travs de su membrana plas mtica, tal como requieren las procariotas para la produccin de ATP, fue posible utilizar cambios controlados de la permeabilidad inica de la membrana plasmti ca con finalidad de seales celulares. As, aproximadamente al mismo tiempo en que surgieron las clulas eucariotas, aparecieron en la membrana plasmtica va rios tipos de canales inicos. En la actualidad, en organismos superiores estos ca nales median elaborados procesos de seales elctricas -especialmente en el siste ma nervioso- y controlan gran parte del comportamiento de organismos eucariotas unicelulares de vida libre como los protozoos (ver ms adelante).

clula

surco de segm entacin

Los cloroplastos son descendientes de una clula procariota incorporada 16


Los cloroplastos realizan la fotosntesis de una manera muy parecida a como lo hacen las cianobacterias procariotas, captando la luz solar en la clorofila que est unida a sus membranas. Algunos cloroplastos guardan una estrecha seme janza ultraestructural con las cianobacterias, siendo similares en tamao y en la m anera en que sus m em branas portadoras de clorofila estn apiladas (vase Figura 1-20). Adems, los cloroplastos se reproducen por divisin y contienen DNA, con una secuencia de nucletidos casi idntica a la de fragmentos del cro mosoma bacteriano. Todo ello sugiere claramente que los cloroplastos com par ten un ancestro com n con las cianobacterias y que evolucionaron a partir de procariotas que pasaron a vivir dentro de clulas eucariotas. Estos procariotas realizaron fotosntesis para sus huspedes como contraprestacin por la protec cin y por el am biente nutritivo que estos ltimos les suministraban. De hecho, la simbiosis de clulas fotosintetizadoras con otros tipos celulares es un fenm e no comn, y se pueden encontrar algunas clulas eucariotas actuales que con tienen autnticas cianobacterias (Figura 1-22).

Figura 1-22 Un pariente prxim o de las cianobacterias actuales, que vive en una relacin simbitica perm anente dentro de otra clula. Los dos organismos reciben el nombre conjunto de C y an op h ora p arad ox a. La cianobacteria est en el proceso de divisin. (Por cortesa de Jeremy D. Pickett-Heaps.)

arquebacterias

otras eubacterias

bacterias fotosintetizadoras prpuras no del azufre y sus parientes no fotosintetizadoras

cianobacterias

plantas

'IMK

cloroplastos

eucariota ancestral desconocido ancestro procariota anaerbico de los eucariotas


Figura 1-23 Hipottico origen de los eucariotas actuales, por simbiosis de procariotas aerbicos y anaerbicos. No se conoce la relacin entre el momento en que se origin el ncleo de los eucariotas y el momento en que la lnea de los eucariotas se separaron de las arquebacterias y de las eubacterias.

procariota ancestral

22

Captulo 1 : La evolucin de la clula

Tabla 1-1 C o m p araci n e n tre organ ism os p ro ca rio ta s y eu cario tas


P ro ca rio ta s E u cario tas

Organismos bacterias y cianobacterias Tamao celular generalmente de 1 a 10 |xm en dimensin lineal Metabolismo anaerbico o aerbico Orgnulos pocos o ninguno DNA DNA circular en el citoplasma

RNA y protena sintetizados en el mismo compartimiento Citoplasma sin citoesqueleto: corrientes citoplasmticas, endocitosis y exocitosis ausentes Divisin celular separacin de cromosomas por unin a la membrana plasmtica Organizacin principalmente unicelular celular

RNA y protena

protistas, hongos, plantas y animales generalmente de 5 a 100 (j.m en dimensin lineal aerbico ncleo, mitocondrias, cloroplastos, retculo endoplasmtico, etc. molculas lineales de DNA muy largas que contienen muchas regiones no codificantes; organizado en cromosomas y rodeado por la envoltura nuclear RNA sintetizado y procesado en el ncleo; protenas sintetizadas en el citoplasma citoesqueleto compuesto por filamentos proteicos; corrientes citoplasmticas, endocitosis y exocitosis separacin de cromosomas mediante un aparato: el huso mittico principalmente pluricelular, con diferenciacin de muchos tipos celulares

La Figura 1-23 muestra los orgenes evolutivos de los eucariotas, de acuerdo con la teora simbitica. Sin embargo, debemos subrayar que las mitocondrias y los cloroplastos muestran, adems de similitudes, importantes diferencias con respecto a las bacterias aerbicas y a las cianobacterias actuales respectivamen te. Por ejemplo, su cantidad de DNA es muy reducida, de forma que la mayor parte de las molculas a partir de las cuales estn constituidos, son sintetizadas en algn otro lugar de la clula eucariota e importadas al orgnulo. Si bien pare ce que se originaron como bacterias simbiticas, han sufrido importantes cam bios evolutivos y han pasado a ser altamente dependientes de sus huspedes y sujetos a su control. La mayora de los eucariotas actuales tienen en comn las mitocondrias y toda una constelacin de rasgos que los distinguen de los procariotas (Tabla 11). Todos estos rasgos actan conjuntam ente proporcionando a las clulas euca riotas un gran nmero de capacidades diferentes de forma que tan slo es posi ble especular sobre cul de ellos surgi primero. Sin embargo, la adquisicin de mitocondrias por una clula eucariota anaerbica debe de haber sido un paso crucial en el xito de los eucariotas al proporcionarles el medio de utilizar una abundante fuente de energa para la direccin de sus complejas actividades.

Las clulas eucariotas contienen una rica dotacin de m em branas internas


Las clulas eucariotas suelen tener un volumen mucho mayor que las procario tas (por lo general, ms de mil veces superior) y contienen una cantidad propor cionalmente superior de la mayora de materiales celulares; una clula humana, por ejemplo, contiene 1000 veces ms DNA que una bacteria tpica. Este gran ta mao plantea problemas. Puesto que todas las materias primas para las reaccio nes de biosntesis que se producen en el interior de una clula deben entrar y sa lir pasando a travs de la membrana plasmtica que recubre su superficie, y puesto que en la membrana tambin se producen importantes reacciones, un aumento en el volumen celular exige un aumento en la superficie celular. Pero la geometra nos ensea que un aumento simple de la escala de una estructura in crementa el volumen al cubo de la dimensin lineal, mientras que el rea super ficial queda aumentada slo al cuadrado. Por consiguiente, si la gran clula euca riota ha de conservar la misma proporcin de superficie respecto al volumen que presenta la clula procariota, deber suplementar su rea superficial m e diante circunvoluciones, pliegues y otras transformaciones de su membrana.

De los procariotas a los eucariotas

23

ER rugoso

ribosomas

m itocondria

Es probable que esto explique en parte la compleja profusin de m em bra nas internas, que es una caracterstica bsica de todas las clulas eucariotas. Las membranas rodean al ncleo, a las mitocondrias y (en las clulas vegetales) a los cloroplastos. Forman un compartimiento laberntico denominado retculo endoplasmtico (Figura 1-24), donde son sintetizados los lpidos y las protenas de las m embranas celulares, as como el material destinado a ser exportado por la clula. Tambin forman agrupaciones de sculos aplanados, que constituyen el complejo de Golgi (Figura 1-25), que participa en la modificacin y en el trans porte de las molculas fabricadas en el retculo endoplasmtico. Las membranas rodean a los lisosomas, los cuales contienen reservas de las enzimas necesarias para la digestin intracelular, enzimas que de este modo no pueden atacar a las protenas y cidos nucleicos de la propia clula. De la misma manera, las mem branas rodean a los peroxisomas, donde se generan y degradan perxidos peli grosamente reactivos durante la oxidacin por el oxgeno de varios tipos de m o lculas. Las m embranas tambin forman pequeas vesculas y, en las plantas, una gran vacuola llena de lquido. Todas estas estructuras rodeadas de m embra na corresponden a distintos compartimientos intracitoplasmticos. En una c lula animal tpica, estos compartimientos (u orgnulos) ocupan casi la mitad del volumen celular total. El restante compartimiento del citoplasma, que incluye todos los elem entos celulares salvo los orgnulos delimitados por una membra na, suele recibir el nombre de citosol. Todas las estructuras membranosas que acabamos de citar se encuentran dentro de la clula. Por consiguiente, cmo pueden ayudar a solucionar el pro blema mencionado al principio y suministrar a la clula un rea superficial que sea suficiente para su gran volumen? La respuesta es que hay un intercambio con tinuo entre los compartimientos internos delimitados por membrana y el exterior de la clula. Esto se consigue mediante la endocitosis y la exocitosis, procesos que se presentan nicamente en las clulas eucariotas. En la endocitosis, porciones de la membrana superficial externa se invaginan y separan por estrangulacin, for mando unas vesculas citoplasmticas, rodeadas de membrana y que contienen sustancias que se hallaban presentes en el medio externo o que fueron adsorbidas en la superficie celular. Partculas muy grandes o incluso clulas extraas enteras son capturadas por fagocitosis -un a forma especial de endocitosis. La exocitosis es el proceso inverso, por el cual unas vesculas rodeadas de membrana, presentes en el interior de la clula, se fusionan con la membrana plasmtica y liberan su contenido al medio externo. De esta manera, las membranas que limitan a los compartimientos situados dentro de la clula incrementan el rea superficial efectiva de la clula para los intercambios de materia con el medio exterior. Como veremos en captulos posteriores, las diversas membranas y com par timientos rodeados por membrana de las clulas eucariotas han llegado a ser al tamente especializados, algunos para la secrecin, otros para la absorcin, otros para procesos especficos de biosntesis, etc.

Figura ) 24 Retculo endoplasmtico. Micrografa electrnica de un corte ultrafino de una clula de mamfero, mostrando zonas lisas y zonas rugosas del retculo endoplasmtico (ER). Las regiones lisas estn implicadas en el metabolismo lipdico mientras que las regiones rugosas, tapizadas de ribosomas, son lugares de sntesis de protenas destinadas a abandonar el citosol y entrar en otros compartimientos de la clula. (Por cortesa de George Palade.)
c o m p le jo do G olgi

1 |m
El complejo de Golgi. Micrografa electrnica de un corte ultrafino de una clula de mamfero, mostrando el aparato o com plejo de Golgi, que est compuesto por sculos membranosos aplanados dispuestos en mltiples filas (vase tambin el Panel 1-1, pgs. 18-19). El com plejo de Golgi interviene en la sntesis y empaquetamiento de molculas destinadas a ser segregadas por la clula, as como en el transporte de protenas recin sintetizadas hacia el compartimiento celular adecuado. (Por cortesa de Daniel S. Friend.)
Figura I

24

Captulo 1 : La evolucin de la clula

Figura 1-26 Actina. En esta micrografia electrnica, preparada por la tcnica de sublimacin, se observa una red de filamentos de actina subyacente a la m embrana plasmtica de una clula animal. (Cortesa de John Heuser.)

I _______ 1
100 nm

Las clulas eucariotas tienen un citoesqueleto


Cuanto mayor es una clula, y cuanto ms complejas y especializadas son sus es tructuras internas, tanto mayor es la necesidad de mantener estas estructuras en sus lugares apropiados y de controlar sus movimientos. Todas las clulas eucario tas tienen un esqueleto interno, el cito esq u eleto , que confiere a la clula su forma, su capacidad de moverse y su habilidad para distribuir sus orgnulos y transportar los de una parte a otra de la clula. El citoesqueleto est compuesto por una red de filamentos proteicos, de los cuales dos de los ms importantes son los filamentos de actina (Figura 1-26) y los microtbulos. Los dos debieron aparecer en una poca muy temprana de la evolucin, ya que se presentan en todos los eucariotas de ma nera casi idntica. Ambos intervienen en la generacin de los movimientos celula res; los filamentos de actina, por ejemplo, permiten a las clulas eucariotas reptar, y participan en la contraccin muscular en los animales; mientras que los microt bulos son los principales elementos estructurales y generadores de fuerza de los ci lios y los flagelos -las largas proyecciones que existen en la superficie de algunas c lulas, que se mueven como ltigos y que sirven de instrumentos de propulsin. Los filamentos de actina y los microtbulos tambin son imprescindibles para los movimientos internos que tienen lugar en el citoplasma de todas las clu las eucariotas. As, los microtbulos del huso mittico son una parte esencial de la maquinaria utilizada habitualmente para distribuir el DNA en dos partes iguales entre las dos clulas hijas, cuando una clula eucariota se divide. Por consiguien te, la clula eucariota no se podra reproducir sin los microtbulos. En este y en otros casos, el movimiento mediante difusin libre sera demasiado lento o dema siado aleatorio para resultar eficaz. De hecho, a menudo los orgnulos de una c lula eucariota parecen estar adheridos de manera directa o indirecta al citoesque leto y cuando se mueven, ser propulsados a lo largo de las vas citoesquelticas.

Entre los protozoos se encuentran las clulas ms com plejas conocidas 17


La complejidad que puede alcanzar una clula eucariota se pone de manifiesto sobre todo en los protistas (Figura 1-27). Se trata de eucariotas unicelulares, de vida generalmente libre, que son evolutivamente diversos (vase Figura 1-16) y que muestran una asombrosa variedad de formas y comportamientos distintos: pueden ser fotosintetizadores o carnvoros, mviles o sedentarios. A menudo su anatoma celular es compleja e incluye estructuras tales como cirros sensoriales, fotorreceptores, flagelos, apndices a modo de patas, piezas bucales, flechas ur ticantes y haces contrctiles parecidos a msculos. Aunque son clulas aisladas, pueden ser tan complicadas y verstiles como muchos organismos pluricelula res. Esto es vlido sobre todo para el grupo de protistas conocido como p ro to z o o s, y est particularmente bien ilustrado en el grupo conocido como ciliad os.

De los procariotas a los eucariotas

25

Didinium es un protozoo carnvoro. Tiene un cuerpo globular, de aproxima damente 150 Jim de dimetro rodeado por dos hileras de cilios; su extremo frontal es aplanado salvo una protrusin parecida a un hocico (Figura 1-28). Didinium se desplaza en el agua nadando a gran velocidad mediante el batido sincrnico de sus cilios. Cuando encuentra una presa apropiada, por lo general Paramecium, otro tipo de protozoo, despide desde la regin de su hocico un gran nmero de pequeos dardos paralizantes. Luego Didinium se fija a Paramecium y lo devora, invirtindose como una pelota hueca y rodeando a la otra clula, que es tan gran de como l mismo. La mayor parte de este complejo comportamiento -natacin, paralizacin y captura de la presa- se genera por estructuras citoesquelticas si tuadas inmediatamente por debajo de la membrana plasmtica. En este crtex celular se encuentran, por ejemplo, los haces paralelos de microtbulos que for man la parte central de cada cilio y que le permiten su movimiento de remar. Comportamientos depredadores de este tipo y el conjunto de caractersticas de las que depende -tam ao grande, capacidad de fagocitosis y habilidad para moverse en persecucin de la presa- son tpicas de los eucariotas. De hecho es probable que estas caractersticas aparecieran en un estadio temprano de la evolucin, haciendo posible la captura de bacterias para su domesticacin como mitocondrias y cloroplastos.

Figura 1-27 Grupo de protistas, ilustrando algunas de las enorm es variedades que pueden hallarse entre esta clase de organismos unicelulares. Estos dibujos estn realizados a diferente escala, pero en cada caso la barra representa 10 |im. Los organismos en (A), (B), (E), (F) e (I) son ciliados; (C) es un euglenoide; (D) es una ameba; (G) es un dinoflagelado; (H) es un heliozoo. (De M.A. Sleigh, The Biology of Protozoa. London: Edward Arnold, 1973.)

En las clulas eucariotas el m aterial gentico est empaquetado de form a com pleja
Las clulas eucariotas contienen una gran cantidad de DNA. Como hemos dicho anteriormente, las clulas humanas contienen unas mil veces ms DNA que una bacteria tpica. La longitud del DNA de las clulas eucariotas es tan grande que

26

Captulo 1 : La evolucin de la clula

el peligro de enmaraamiento y rotura resulta muy elevado. Probablemente por esta razn, aparecieron unas protenas que slo se encuentran en los eucariotas, las historias, que se unen al DNA y lo enrollan formando cromosomas, compactos y manejables (Figura 1-29). El denso empaquetamiento del DNA en los cromosomas es una parte esencial de los preparativos para la divisin celular en los eucariotas (Figura 1-30). Todos los eucariotas (salvo una pequea excepcin) tienen histonas unidas a su DNA, y la importancia de estas protenas se refleja en su notable con servacin a lo largo de la evolucin: varias de las histonas de una planta de guisante son casi exactamente iguales, aminocido a aminocido, a las de una vaca. Las m embranas que envuelven el ncleo de las clulas eucariotas protegen la estructura del DNA y la delicada maquinaria de control asociada, previenen que se embrollen con el citoesqueleto mvil y las resguardan de muchos de los cam bios qumicos que se producen en el citoplasma. Tambin permiten separar e independizar dos pasos cruciales de la expresin gnica: (1) el copiado de las secuencias de DNA a secuencias de RNA (transcripcin del DNA) y (2) la utiliza cin de estas secuencias de RNA para dirigir la sntesis de protenas especficas (traduccin del RNA). En las clulas procariotas no existe la divisin de estos procesos en compartimientos -la traduccin de las secuencias de RNA a prote nas empieza en cuanto estas secuencias se transcriben, incluso antes de que su sntesis haya terminado. Pero en los eucariotas (salvo en las mitocondrias y en los cloroplastos que en este aspecto, como en otros, se parecen ms a las bacte rias), los dos pasos que conducen desde el gen hasta la protena estn estricta mente separados: la transcripcin ocurre en el ncleo, la traduccin en el cito plasma. El RNA ha de abandonar el ncleo antes de poder ser utilizado para guiar la sntesis proteica. Mientras se halla en el ncleo sufre una serie de com plicadas transformaciones, durante las cuales se eliminan unas zonas determi nadas de la molcula de RNA y otras se modifican (procesamiento del RNA). Debido a estas complejidades, el material gentico de una clula eucariota ofrece muchas ms oportunidades de control que las existentes en las bacterias.

_______________________ ( I
100 iim

Resumen

Las clulas vivas actuales se clasifican en procariotas (bacterias y organismos afi nes) y eucariotas. Aunque presentan estructuras relativamente sencillas, las clulas procariotas pueden ser bioqumicamente verstiles y muy diferentes: por ejemplo, en las bacterias pueden encontrarse todas las vas metablicas principales, incluidos los tres procesos energticos fundamentales, o sea la glucolisis, la respiracin y la fo tosntesis. Las clulas eucariotas son mayores y ms complejas que las clulas proca riotas, y contienen ms DNA, adems de otros componentes que permiten que este DNA sea modificado de manera compleja. El DNA de la clula eucariota est situado en un ncleo rodeado por una doble membrana, mientras que el citoplasma contie ne muchos otros orgnulos tambin delimitados por una doble membrana, entre los que se cuentan las mitocondrias, que realizan la oxidacin de las molculas del ali mento, y en las clulas vegetales, los cloroplastos, que realizan la fotosntesis. Diver sos tipos de pruebas sugieren que las mitocondrias y los cloroplastos son descendien tes de clulas procariotas primitivas que se establecieron como simbiontes dentro de una gran clula anaerbica. Las clulas eucariotas presentan tambin la caracters tica de poseer un citoesqueleto de filamentos proteicos que ayuda a organizar el cito plasma y proporciona la maquinaria para el movimiento. De las clulas simples a los organismos pluricelulares1 8
Los organismos unicelulares, tales como las bacterias y los protozoos, han teni do tanto xito al adaptarse a una gran variedad de ambientes distintos, que constituyen ms de la mitad de la biomasa total de la Tierra. A diferencia de los

Figura 1 -28 Un protozoo devorando a otro. Los ciliados son animales unicelulares que presentan una inmensa diversidad de formas y comportamientos. La fotografa superior muestra D idinium , un protozoo ciliado con posee dos bandas de cilios mviles y una protuberancia a modo de hocico en su extremo anterior, con la que captura sus presas. En la micrografa inferior D idinium est devorando otro protozoo, P aram eciu m . (Por cortesa de D. Barlow.)

De las clulas simples a los organismos pluricelulares

27

organismos superiores, muchos de estos organismos unicelulares pueden sinte tizar a partir de unos cuantos nutrientes simples todas las sustancias que necesi tan y algunos de ellos se dividen ms de una vez cada hora. Cul fue entonces la ventaja selectiva que condujo a la evolucin de los organism os pluricelulares? La respuesta ms sencilla es que los organismos pluricelulares pueden ex plotar recursos que ninguna clula aislada podra utilizar tan bien. Este princi pio, aplicado por primera vez a una simple asociacin de clulas, ha llegado al l mite en los organismos pluricelulares que conocem os. La pluricelularidad, por ejemplo, permite que una planta llegue a ser fsicamente grande; que tenga ra ces en el suelo, donde un grupo de clulas pueden absorber agua y nutrientes; y que tenga hojas en el aire, donde otro grupo de clulas puede captar eficazmen te energa radiante del sol. En el tronco de la planta existen clulas especializa das que forman conductos para el transporte del agua y de los nutrientes entre las races y las hojas. Otro grupo de clulas especializadas forma una capa de corteza que impide la prdida de agua y hace posible un ambiente interno pro tegido (vase el Panel 1-2, pgs. 30-31). La planta en conjunto no compite direc tam ente con los organismos unicelulares por su nicho ecolgico; ha encontrado una m anera radicalmente diferente de sobrevivir y multiplicarse. A medida que aparecieron los diferentes tipos de animales y plantas, alte raron el medio am biente en el que se produjo la evolucin posterior. La super vivencia en una jungla exige caractersticas diferentes a las requeridas para so brevivir en mar abierto. Las innovaciones en el movimiento, la percepcin sensorial, la com unicacin, la organizacin social -todo ello permiti a los orga nismos eucariotas competir, propagarse y sobrevivir de manera cada vez ms compleja.

DNA

Figura 1-29 Dibujo esquem tico que ilustra com o las protenas denominadas histonas, de carga positiva, favorecen el plegado del DNA en los crom osom as.

Las clulas se pueden asociar formando colonias


Parece probable que uno de los primeros pasos en la evolucin de los organis mos pluricelulares fuera la asociacin de organismos unicelulares formando co lonias. La manera ms sencilla de conseguirlo consiste en que las clulas hijas permanezcan asociadas despus de cada divisin celular. Algunas clulas proca riotas muestran incluso un comportamiento social semejante, aunque de una manera primitiva. Las mixobacterias, por ejemplo, viven en el suelo y se alimen tan de molculas orgnicas insolubles que degradan mediante las enzimas de gradantes que segregan. Se mantienen unidas en colonias laxas, en las que las enzimas digestivas segregadas por las distintas clulas se ponen en comn, con lo que aumenta la eficiencia de la alimentacin (el efecto flotilla). Estas clulas representan de hecho una sofisticacin mxima entre los procariotas, ya que cuando el alimento disponible se agota, las clulas forman agregados ms den sos y constituyen un cuerpo fructfero pluricelular (Figura 1-31), dentro del cual las bacterias se diferencian a esporas que pueden sobrevivir incluso en condicio nes extremadamente hostiles. Cuando las condiciones vuelven a ser ms favora bles, las esporas del cuerpo fructfero germinan y producen un nuevo enjam bre de bacterias. Las algas verdes (que no deben ser confundidas con las algas azules proca riotas o cianobacterias) son eucariotas que existen en formas unicelulares, for mas coloniales y formas pluricelulares (Figura 1-32). Las diferentes especies de algas verdes se pueden estudiar en orden de complejidad, ilustrndose as el tipo de progresin que ocurri probablemente durante la evolucin de los ani males y plantas superiores. Las algas verdes unicelulares, como por ejemplo Chlamydomonas, se parecen a protozoos flagelados, salvo en que presentan cloroplastos que les permiten realizar la fotosntesis. En gneros estrechamente em parentados, grupos de clulas flageladas viven en colonias, unidas por una m a triz de molculas extracelulares segregadas por las propias clulas. Las especies ms sencillas (las del gnero Gonium ) presentan la forma de un disco cncavo formado por 4, 8, 16 o 32 clulas. Sus flagelos se mueven de manera indepen diente, pero puesto que todos estn orientados en la misma direccin pueden

crom osom a

Figura 1-30 Dibujo esquem tico de clulas eucariotas en mitosis. A la izquierda se muestra una clula animal y a la derecha una clula vegetal. La envoltura nuclear se ha roto, y el DNA, una vez replicado, se ha condensado en dos dotaciones completas de cromosom as. Cada una de las dos clulas en formacin recibe una dotacin de cromosomas, los cuales son desplazados por el huso mittico que est compuesto mayoritariamente por microtbulos.

28

Captulo 1 : La evolucin de la clula

Figura 1-31 Micrografa electrnica de barrido, de los cuerpos fructferos formados por un m yxobacterium Cada cuerpo fructfero, empaquetado con esporas, est formado por la agregacin y diferenciacin de aproximadamente un milln de mixobacterias. (De P.L. Grilione y J. Pangborn,/. B acteriol. 124:1558-1565, 1975.)

{Chondromyces crocatus).

0,1 m m

propulsar a la colonia por el agua. Todas las clulas son equivalentes entre s, y cada una de ellas se puede dividir dando lugar a una nueva colonia. En otros g neros se encuentran colonias mayores, siendo las ms espectaculares las del g nero Volvox, algunas de cuyas especies viven en colonias de 50 000 o ms clulas unidas formando una esfera hueca. En Volvox, las distintas clulas que forman una colonia estn conectadas mediante finos puentes citoplasmticos, de modo que el batido de sus flagelos est coordinado para propulsar a toda la colonia como una pelota (Figura 1-32). Dentro de la colonia de Volvox existe un cierto reparto del trabajo entre las clulas; un reducido nmero de ellas se ha especiali zado en la reproduccin, sirviendo de precursoras de nuevas colonias. Las otras clulas son tan dependientes unas de otras que no pueden vivir aisladas, y el or ganismo muere si se destruye la colonia.

Las clulas de un organismo superior se especializan y cooperan


En algunos aspectos, Volvox es ms parecido a un organismo pluricelular que a una simple colonia. Todos sus flagelos se mueven sincrnicam ente cuando la colonia se desplaza en el agua, de forma que la colonia est estructural y funcio nalmente polarizada y puede nadar hacia una fuente lejana de luz. Las clulas reproductoras suelen estar confinadas en un extremo de la colonia, donde se di viden formando nuevas colonias en miniatura que inicialmente permanecen dentro de la esfera madre. As, y aunque de una manera primitiva, Volvox m ues tra los dos rasgos esenciales de todos los organismos pluricelulares: sus clulas se especializan y cooperan. Mediante la especializacin y la cooperacin las clu las se com binan formando un nico organismo coordinado, con capacidades mayores que las de cualquiera de las partes que lo componen. Los esquemas organizados de diferenciacin celular se presentan incluso en algunos procariotas. Por ejemplo, muchos tipos de cianobacterias permanecen agrupados despus de la divisin celular, formando cadenas filamentosas que pueden alcanzar hasta un metro de longitud. A lo largo del filamento, y a inter valos regulares, las distintas clulas adquieren un carcter distintivo y se vuelven capaces de incorporar nitrgeno atmosfrico en molculas orgnicas. Estas es casas clulas especializadas realizan la fijacin del nitrgeno para las clulas ve cinas y comparten con ellas los productos. Pero las clulas eucariotas han llega do mucho ms lejos en este tipo de distribucin organizada del trabajo; ellas, a diferencia de las clulas procariotas, son las unidades vivas a partir de las cuales estn construidos todos los organismos pluricelulares ms complejos.

La llave equivale en cada caso a 50 moi Figura 1 -32 Cuatro gneros de algas verdes, estrecham ente emparentados, mostrando una progresin desde una organizacin unicelular hasta una organizacin colonial y multicelular. (Por cortesa de David Kirk.)

De las clulas simples a los organismos pluricelulares

29

LA PLANTA m eristem o apical del brote


HOJA

epiderm is superior nervio principal (del haz) _____ ___/ nervio de la hoja r m esfilo estomas (parnquima) de la epiderm is inferior (del envs) colnquim a

La p la n ta jo v e n c o n flo re s q u e se p r e s e n ta a la izq u ie rd a e s t c o n s titu id a p o r tre s tip o s d e rg a n o s : h o ja s , ta llo s y ra c e s . A su v e z , c a d a r g a n o v e g e ta l e s t f o r m a d o p o r tr e s s is te m a s h is to l g ic o s : el b s ic o , el d r m ic o y el v a s c u la r . En ltim o t r m in o , los tr e s s is te m a s h is to l g ic o s d e r iv a n d e la a c tiv id a d p r o life r a tiv a d e u n a c lu la d e los m e r is t e m o s a p ic a le s d e l b r o te y d e la ra z , y c a d a u n o d e e llo s c o n tie n e un n m e r o r e la tiv a m e n t e r e d u c id o d e tip o s c e lu la r e s e s p e c ia liz a d o s . En e ste P an e l se d e s c rib e n e sto s tre s s is te m a s h is to l g ic o s c o m u n e s , y las c lu la s q u e los f o r m a n .

internudo LOS TRES SISTEMAS HISTOLOGICOS


La d iv is i n c e lu la r, el c re c im ie n to y la d ife re n c ia c i n d an lu g a r a s is te m a s h is to l g ic o s c o n fu n c io n e s e sp e c ia liz a d a s . T E J ID O E P ID R M IC O ( ^ H ) : S e tr a ta del re c u b rim ie n to I""

TALLO

planta joven con flores (dicotilednea)

e x te rn o p ro te c to r d e la p la n ta q u e est en c o n ta c to con | _ el m e d io . Fac ilita la c a p ta c i n d e a g u a y de io n e s en las

haz vascular

races y re g u la el in te rc a m b io g a s e o s o en las h o ja s y en los ta llo s . T E J ID O V A S C U L A R : El flo e m a

(ESI) y el x ile m a

(I

I)

fo r m a n c o n ju n ta m e n te un s is te m a v a s c u la r c o n tin u o a / tra v s de la p la n ta . Este te jid o c o n d u c e a g u a y s o lu to s e n tre los rg a n o s y ta m b i n p ro p o rc io n a s o p o rte

RAZ

m e c n ic o . T E J ID O B S IC O (tZ H I): Este te jid o de e m p a q u e ta m ie n to y de s o p o rte o c u p a la m a y o r p a rte del v o lu m e n d e la p la n ta

endoderm is periciclo m eristem os apicales de la raz

jo v e n . T a m b i n in te rv ie n e en la fa b ric a c i n y a lm a c e n a m ie n to de a lim e n to . _ _

TEJIDO BASICO

El s is te m a h is to l g ic o bs ic o c o n tie n e tre s tip o s c e lu la re s p rin c ip a le s lla m a d o s p a r n q u im a , c o l n q u im a y e s c le r n q u im a .

El c o l n q u im a e st fo r m a d o p o r c lu la s v iv a s s im ila re s a las c lu la s p a r e n q u im tic a s e x c e p to en q u e tie n e n p a re d e s c e lu la re s m u y g ru e s a s y en q u e h a b itu a lm e n te son a la rg a d a s y e st n e m p a q u e ta d a s en fib ra s a m o d o d e c u e rd a s .

Las c lu la s p a r e n q u m tic a s se e n c u e n tra n en to d o s los s is te m a s h is to l g ic o s . S o n c lu la s v iv a s , g e n e r a lm e n te c a p a c e s d e d iv id irs e p o s te r io r m e n te , y q u e p re s e n ta n un a p a re d c e lu la r p r im a ria d e lg a d a . E stas c lu la s tie n e n v a ria s fu n c io n e s . Las c lu la s m e ris te m tic a s a p ic a l y la te ra l d e los b ro te s y d e las rac es s u m in is tra n n u e v a s c lu la s n e c e s a ria s p a ra el c re c im ie n to . La p ro d u c c i n de a lim e n to y de a lm a c n tie n e lu g a r en las c lu la s fo to s in t tic a s d e la h o ja (d e n o m in a d a s c lu la s del m e s filo ) y del ta llo ; el p a r n q u im a de re s e rv a fo r m a el v o lu m e n d e m u c h o s fru to s y v e rd u ra s . A c au s a d e su c a p a c id a d p r o life ra tiv a , las c lu la s p a r e n q u im tic a s a c t a n c o m o c lu la s m a d re c ic a triz a n d o las h e rid a s e in te r v in ie n d o en la re g e n e ra c i n .

rS {
....... Y'" / /

S o n c a p a c e s d e a la rg a rs e y de p ro p o rc io n a r s o p o rte m e c n ic o al s is te m a h is to l g ic o b s ic o de las re g io n e s de la p la n ta en c re c im ie n to . Las c lu la s c o le n q u im a to s a s son e s p e c ia lm e n te a b u n d a n te s en las re g io n e s s u b e p id rm ic a s d e los ta llo s .

^ vacuola cloroplasto

localizaciones tpicas de grupos de soporte de clulas en un tallo fibras esclerenqu imticas haz vascular colnquim a "
El e s c le r n q u im a c o m o el c o l n q u im a , tie n e fu n c io n e s de re fu e rz o y d e s o p o rte . S in e m b a r g o , haz de fibras n o rm a lm e n te e st f o r m a d o p o r c lu la s m u e rta s , con g ru e s a s p a re d e s c e lu la re s s e c u n d a ria s lig n ific a d a s in c a p a c e s de a la rg a rs e c u a n d o la p la n ta cre c e . Los do s tip o s c o m u n e s son las fib ra s , q u e a m e n u d o fo r m a n la rg o s ha c e s, y las e s c le re id a s , q u e son c lu la s m s c o rta s y ra m ific a d a s e x is te n te s en las c u b ie rta s d e la s e m illa y en el fru to .

ncleos clulas del m esfilo de la hoja

clulas m eristem ticas de la raz

/ U n a c lu la d e tra n s fe re n c ia , un a fo rm a e s p e c ia liz a d a de c lu la p a re n q u im tic a , se id e n tific a f c ilm e n te g ra cia s a un as c o m p le ja s in v a g in a c io n e s de la p a re d c e lu la r p r im a ria . El in c re m e n to del re a de la m e m b r a n a p la s m tic a b a jo estas p a re d e s fa c ilita el r p id o tr a n s p o r te de s o lu to s hacia y d e s d e las c lu la s del s is te m a v a s c u la r. I /\ / /

vaso xilem tico clula de transferencia

esclereida

30

Panel 1-2 Modelos celulares y tejidos con los que estn construidas las plantas superiores.

TEJIDO DERMICO
La e p id e r m is e s la c u b ie r ta p r im a r ia p r o te c to r a e x t e r n a d e l c u e r p o d e la p la n ta . Las c lu la s d e la e p id e r m is t a m b i n e s t n m o d if ic a d a s f o r m a n d o lo s e s to m a s y v a r io s tip o s d e p e lo s .

Lo s p e lo s (o t r ic o m a s ) s o n a p n d ic e s d e r iv a d o s d e las c lu la s e p id r m ic a s . E x is te u n a g r a n v a r ie d a d d e f o r m a s ; n o r m a lm e n t e se e n c u e n t r a n e n t o d a s la s p a r te s d e la p la n ta . Lo s p e lo s in t e r v ie n e n e n la p r o t e c c i n , a b s o r c i n y s e c r e c i n ; e je m p lo s :

espacio areo
^ 5| a m
Lo s e s t o m a s s o n a b e r t u r a s d e la e p id e r m is , p r in c ip a lm e n t e e n la c a ra in f e r io r d e la h o ja (e n v s ), q u e r e g u la n el in t e r c a m b io g a s e o s o e n la p la n ta . E s t n f o r m a d o s p o r d o s c lu la s e p id r m ic a s e s p e c ia liz a d a s lla m a d a s clu la s g u a rd a , las c u a le s r e g u la n el d i m e t r o d e l p o ro . En c a d a e p id e r m is , lo s e s t o m a s e s t n d is t r ib u id o s s ig u ie n d o d if e r e n t e s o r d e n a c io n e s e s p e c fic a s d e la e s p e c ie .

epiderm is

p e lo s u n ic e lu la r e s j v e n e s d e la e p id e r m is d e la s e m illa d e l a lg o d n . C u a n d o s to s c re c e n , la s p a r e d e s se e n g r u e s a n s e c u n d a r ia m e n t e c o n c e lu lo s a f o r m a n d o la s f ib r a s d e a lg o d n

La e p id e r m is ( n o r m a lm e n t e d e u n a s o la c a p a d e c lu la s d e g r o s o r ) c u b r e c o m p le t a m e n t e el t a llo , la h o ja y la ra z d e la p la n ta jo v e n . Las c lu la s e s t n v iv a s , t ie n e n g r u e s a s p a r e d e s c e lu la r e s p r im a r ia s , y e s t n r e c u b ie r t a s a p ic a lm e n t e p o r u n a c u tc u la e s p e c ia l c o n u n a c a p a e x te r n a d e c e r a . Las c lu la s e s t n n t im a m e n t e u n id a s s ig u ie n d o d ife r e n te s o r d e n a c io n e s .

Haces vasculares
N o r m a lm e n t e e n las ra c e s h a y un s o lo h a z v a s c u la r , p e r o e n lo s ta llo s h a y v a r io s h a c e s . En las d ic o t ile d n e a s e s to s h a c e s e s t n o r d e n a d o s s ig u ie n d o u n a e s tr ic ta s im e tr a r a d ia l, p e r o en las m o n o c o t ile d n e a s e s t n d is p e r s o s d e f o r m a m s ir r e g u la r .

epiderm is

vaina de esclernquima epiderm is del haz de una hoja epiderm is de un tallo floem a

los pelos radiculares desem pean una im portante funcin en la captacin de agua e iones

parenquima TEJIDO VASCULAR


El f lo e m a y el x ile m a f o r m a n c o n ju n t a m e n t e u n s is te m a v a s c u la r c o n tin u o p o r to d a la p la n t a . E n p la n ta s j v e n e s n o r m a lm e n t e j| e s t n a s o c ia d a s a v a r io s t ip o s c e lu la r e s d is tin to s e n los haces vasculares. El f lo e m a y e l x ile m a s o n t e jid o s c o m p le jo s . S u s e le m e n t o s c o n d u c t o r e s e s t n a s o c ia d o s c o n c lu la s

X ilem a

un haz vascular tpico de un tallo joven de un rannculo.

El x ile m a t r a n s p o r t a p o r la p la n ta a g u a e io n e s d is u e lto s . Las p r in c ip a le s c lu la s c o n d u c t o r a s s o n lo s e le m e n t o s d e l v a s o m o s t r a d a s a q u , q u e e n la m a d u r e z s o n c lu la s m u e r t a s q u e h a n p e r d id o la m e m b r a n a p la s m t ic a . La p a r e d c e lu la r se h a e n g r o s a d o s e c u n d a r ia m e n t e y s e h a lig n if ic a d o r V fu e r te m e n te . C o m o se v e e n la f ig u r a , g r a n p a r te d e

p a r e n q u im t ic a s q u e m a n t ie n e n e in t e r c a m b ia n m a te r ia le s c o n e llo s . A d e m s , v a r io s g r u p o s d e c lu la s c o le n q u im t ic a s y e s c le r e n q u im t ic a s p r o p o r c io n a n s o p o r te m e c n ic o .

Floem a

placa cribosa m em brana plasmtica

pequeo elem ento de vaso en el extrem o radicular

p
p

la s p a r e d e s t e r m in h a n e lim in a d o , lo c u a l p e r m it e la f o r m a c i n d e t u b o s c o n t in u o s m u y la r g o s .

f ^ r =====:~ z ^ ? J J C

clula acompaante area cribosa visin externa de un elem ento de tubo criboso

elem ento de tubo criboso en seccin

gran elem ento de vaso m aduro


Lo s e le m e n t o s d e l v a s o e s t n n t im a m e n t e a s o c ia d o s s c o n c lu la s p a r e n q u im t ic a s d e l x ile m a q u e tr a n s p o r t a n a c t iv a m e n t e s o lu to s s e le c c io n a d o s h a c ia d e n t r o y h a c ia fu e r a d e lo s e le m e n t o s a t r a v s d e s u m e m b r a n a p la s m t ic a .

d e lo s tu b o s c rib o s o s m a d u r o s s o n c lu la s v iv a s , in te rc o n e c ta d a s p o r p e r fo r a c io n e s e n s u s p a r e d e s te r m in a le s q u e so n p ia s m o d e s m o s a m p lia d o s y m o d ific a d o s (p la c a s c rib o s a s ). E s ta s c l u l a s m a n tie n e n su m e m b r a n a p la s m tic a p e r o h a n p e r d id o s u s n c le o s y g r a n p a r te d e su c ito p la s m a ; p o r lo t a n t o , p a ra su m a n t e n im ie n t o n e ce sita n el c o n c u r s o d e c lu la s a c o m p a a n te s a s o c ia d a s . E s ta s c lu la s a c o m p a a n te s t ie n e n la fu n c i n a d ic io n a l d e a c tiv a r el t r a n s p o r t e de

El f lo e m a p a r tic ip a e n el t r a n s p o r t e d e lo s s o lu to s o r g n ic o s d e la p la n ta . L as c lu la s c o n d u c t o r a s p r in c ip a le s ( e le m e n to s ) e s t n a lin e a d a s f o r m a n d o tu b o s lla m a d o s tu b o s crib oso s, Los e le m e n to s

clulas parenquim ticas del xilem a elem ento del vaso

'olenlas a lim e n tic ia s

s o lu b le s h a c ia d e n t r o y h a c ia fu e ra d e lo s iicm eriros d e l tu b o c rib o s o a t r a v s d e las r e a s c rib o s a s de la pa red.

La organizacin pluricelular depende de la cohesin entre las clulas


Para formar un organismo pluricelular las clulas han de estar unidas entre s de alguna m anera y los eucariotas han desarrollado diversos sistemas para satisfa cer esta necesidad. Como ya hemos dicho las clulas de Volvox no se separan por com pleto despus de la divisin celular sino que permanecen conectadas mediante puentes citoplasmticos. En las plantas superiores, las clulas no slo perm anecen conectadas por puentes citoplasmticos (denominados plasmodesmos), sino que adems quedan encerradas en un rgido conjunto de cmaras con paredes celulsicas que han segregado las propias clulas (paredes celula

res).
Las clulas de la mayora de los animales carecen de paredes rgidas y los puentes citoplasmticos son poco frecuentes. En lugar de ello, las clulas se ha llan unidas por una red relativamente laxa de grandes molculas orgnicas extracelulares (denominada matriz extracelular ) y por las adherencias entre sus membranas plasmticas. Muy a menudo las uniones lado-a-lado entre clulas las m antienen unidas formando una capa pluricelular o epitelio.

Las capas de clulas epiteliales envuelven un medio interno protegido


De todos los sistemas a travs de los que las clulas animales estn relacionadas formando los tejidos pluricelulares, quizs la disposicin epitelial es la que tiene una importancia ms fundamental. La capa epitelial tiene para la evolucin de los organismos pluricelulares complejos un significado muy parecido al que la mem brana celular tiene para la evolucin de las clulas aisladas complejas. La im portancia de las capas epiteliales est bien ilustrada en otro grupo in ferior de animales, el de los celentreos. Este grupo incluye las anmonas de mar, las medusas y los corales, as como el pequeo organismo de agua dulce Hydra. Los celentreos estn constituidos por dos capas de epitelio, una capa externa, o ectodermo, y una capa interna o endodermo. La capa endodrmica rodea una ca vidad, el celentern, en donde se digiere el alimento (Figura 1-33). Entre las clu las endodrmicas existen algunas que segregan enzimas digestivas al celentern,

Figura 1-33 Organizacin corporal de Hydra. (A) H ydra oligactis en su entorno natural; en estas especies de Hydra los tentculos se retraen para capturar las presas. Las proyecciones que se producen por gemacin del cuerpo son hijos que se separarn del padre. (B) Diagrama de la arquitectura celular del cuerpo de una H ydra tpica. La capa externa de clulas (ectodermo) es esencialm ente protectora, predadora y sensorial, mientras que las clulas de la capa interna (endodermo) desempean fundamentalmente funciones digestivas. Ambas capas epiteliales tienen tambin una funcin contrctil o muscular que permite al animal moverse. Los movimientos estn coordinados por clulas nerviosas que ocupan una posicin protejida en el interior de cada epitelio, formando una malla interconectada. (A, por cortesa de Richard Manuel.)

ENDODERMO

ECTODERMO

clula glandular

clula sensorial clula intersticial clula nerviosa clula epiteliom uscular clula urticante

celentern endoderm o ectoderm o

clula digestiva

capa m uscular transversal (A) (B)

capa m uscular longitudinal

m atriz extracelular (mesoglea)

32

Captulo 1 : La evolucin de la clula

Figura 1-34 Hydra alimentndose. Hydra puede realizar una amplia gama de actividades bastante complejas. Aqu se ha fotografiado un organismo solitario capturando con sus tentculos pequeas pulgas de agua; en el ltimo panel se halla introduciendo estas presas en su celentern para su digestin. (Cortesa de Amata Hornbruch.)

mientras que otras absorben, continuando la digestin de las molculas de nu trientes que aquellas enzimas haban transformado. Al formar una capa epitelial densa y coherente que impide que todas estas molculas se pierdan hacia el ex terior, las clulas endodrmicas crean por s mismas un medio ambiente en el celentern que es apropiado para sus propias tareas digestivas. Las clulas ectodrmicas, orientadas hacia el exterior permanecen especializadas para el con tacto con el mundo exterior. En el ectodermo, por ejemplo, se hallan clulas que contienen una cpsula venenosa con un dardo enrollado que puede ser dispara do para matar los pequeos animales de los que se alimenta Hydra. La mayora de las dems clulas ectodrmicas o endodrmicas tienen propiedades pareci das a las musculares, permitiendo el movimiento de Hydra, tal como debe ha cerlo un predador. Entre la doble capa de ectodermo y endodermo, se encuentra otro com par timiento separado tanto del celentern como del medio exterior. Aqu, se hallan las clulas nerviosas, ocupando estrechos espacios entre las clulas epiteliales, por debajo de la superficie externa donde las uniones celulares ("cell junctions') especializadas entre las clulas epiteliales forman una barrera impermeable. El animal puede cambiar su forma y moverse por medio de contracciones de clu las del epitelio semejantes a las de las clulas musculares, y las clulas nerviosas transmiten seales elctricas controlando y coordinando estas contracciones (Figuras 1-33, 1-34 y 1-35). Como veremos ms adelante, las concentraciones de iones orgnicos simples en el medio que rodea a una clula nerviosa son crucia les para su funcionamiento. La mayora de clulas nerviosas -incluidas las nues tras- estn diseadas para trabajar cuando se hallan en un medio que tenga una composicin inica similar a la del agua de mar. Este hecho probablemente re fleja las condiciones en las que evolucionaron las primeras clulas nerviosas. La mayora de celentreos, aunque no todos, todava viven en el mar. Hydra, con cretamente, vive en el agua dulce. Es evidente que ha sido capaz de colonizar este nuevo hbitat, sobre todo, gracias a que sus clulas nerviosas se hallan con tenidas en un espacio aislado del exterior mediante capas de clulas epiteliales que m antienen el ambiente interno necesario para el funcionamiento de las c lulas nerviosas.

La com unicacin clula-clula controla el esquema espacial de los organismos pluricelulares 19


Las clulas de Hydra no estn nicamente agrupadas m ecnicam ente y conecta das mediante uniones que aslan el interior del ambiente exterior; tambin estn comunicadas entre s a lo largo de todo el cuerpo. Si se secciona un extremo de una Hydra, las clulas restantes reaccionan ante la ausencia de la parte amputaFigura 1-35 Hydra nadando. H ydra puede nadar, deslizarse sobre su base o, como muestra el dibujo, desplazarse dando volteretas.

De las clulas simples a los organismos pluricelulares

33

da adaptando sus caractersticas y reordenndose regenerando un animal com pleto. Es evidente que ciertas seales pasan de una parte del organismo a otra, gobernando el desarrollo de su esquema corporal -q u e presenta tentculos y una boca en un extremo y un pie en el otro. Adems, estas seales son indepen dientes del sistem a nervioso. Si una Hydra en desarrollo se trata con una droga que impide la formacin de clulas nerviosas, el animal resulta incapaz de m o verse, de atrapar las presas o de alimentarse. Sin embargo, su sistema digestivo funciona an con normalidad por lo que el animal puede ser mantenido vivo por cualquiera que tenga la paciencia de introducirle su alimento normal en la boca. En estos animales alimentados artificialmente se mantiene el patrn cor poral normal de modo que las zonas perdidas son regeneradas, tal como ocurre en los animales que tienen el sistema nervioso intacto. Los animales superiores ms complejos han evolucionado a partir de unos humildes antepasados parecidos a los celentreos. Estos animales superiores deben su complejidad a un aprovechamiento ms sofisticado de los mismos principios bsicos de cooperacin celular en los que se basa la construccin de Hydra. Las capas de clulas epiteliales, revisten todas las superficies externas e internas del cuerpo, creando compartimientos resguardados y ambientes inter nos controlados en los que las clulas diferenciadas realizan funciones especiali zadas. Las clulas especializadas interaccionan y se comunican entre s estable ciendo seales que determinan el carcter de cada clula de acuerdo con su situacin en el conjunto de la estructura. Pero para mostrar cmo es posible ge nerar organismos pluricelulares con un tamao, una complejidad y una preci sin como las existentes en un rbol, una mosca o un mamfero, es necesario estudiar con mayor detalle la secuencia de procesos que tienen lugar durante el desarrollo.

La m em oria celular perm ite el desarrollo de patrones complejos


Las clulas de casi todos los organismos pluricelulares proceden de la divisin repetida de una nica clula precursora; estas clulas constituyen un clon. A m e dida que contina la proliferacin y el clon crece, algunas de las clulas, como ya hemos visto, se diferencian de las otras en respuesta a los datos que les pro porcionan las clulas vecinas, adoptando normalmente una estructura diferen te, unas caractersticas qumicas diferentes y una funcin diferente. Es notable que las clulas eucariotas y su progenie persistan en sus estados especializados incluso despus de que las influencias que dirigieron originariamente su dife renciacin hayan desaparecido -e n otras palabras, estas clulas tienen una m e moria. Por consiguiente, su Carcter final no est determinado simplemente por su ambiente final, sino ms bien por toda la secuencia de influencias a las que han estado sometidas en el transcurso del desarrollo. As, a medida que el cuer po crece y madura quedan especificados detalles progresivamente ms finos del esquema corporal adulto, creando un organismo de complejidad creciente cuya forma ltima es la expresin de una larga historia de desarrollo que es recordada por las clulas.

Los programas bsicos de desarrollo tienden a ser conservados en la evolucin 20


La estructura final de un animal refleja su historia evolutiva la cual, como el de sarrollo, presenta una crnica de progreso desde lo simple hasta lo complejo. Cul es entonces la conexin entre estas dos perspectivas, la de la evolucin por un lado y la del desarrollo por otro? Durante la evolucin m uchos de los dispositivos de desarrollo que surgieron en los organismos pluricelulares ms sencillos se han conservado como princi pios bsicos para la construccin de sus descendientes ms complejos. Ya he mos mencionado, por ejemplo, la organizacin de las clulas en epitelios. Algu nos de los tipos celulares especializados, como por ejemplo las clulas nerviosas,

34

Captulo 1: La evolucin de la clula

F.Fiscli.

A. Salamander. T.Schildkrto.

H.Hului

Kaninchen

M..Mensch

se encuentran a nivel de casi todo el reino animal, desde Hydra hasta el hombre. Estudios moleculares, que discutiremos ms adelante en este libro, revelan un sorprendentemente elevado nmero de parecidos de desarrollo a un nivel gen tico fundamental, incluso entre especies tan remotamente relacionadas como los mamferos y los insectos. Adems, en trminos anatmicos las primeras fases del desarrollo de animales cuyas formas adultas son radicalmente diferentes son a menudo sorprendentemente similares; se necesita experiencia para distinguir, por ejemplo, un embrin temprano de pollo de un embrin temprano humano (Figura 1-36). Observaciones de este tipo no son difciles de comprender. Consideremos el proceso mediante el cual, en el transcurso de la evolucin, aparece un nuevo rasgo anatmico -p or ejemplo, un pico alargado. Se produce una mutacin ale atoria que modifica la secuencia de aminocidos de una protena y, por lo tanto, su actividad biolgica. Esta alteracin puede afectar por casualidad a las clulas responsables de la formacin del pico, de tal manera que produzcan un pico ms largo. Pero la mutacin ha de ser tambin compatible con el desarrollo del resto del organismo: slo entonces ser propagada por la seleccin natural. La formacin de un pico ms largo tendra poca ventaja selectiva si, en el proceso, se perdiera la lengua o no llegaran a desarrollarse los odos. Una catstrofe de este tipo es mucho ms probable si la mutacin afecta a acontecimientos que se producen en las primeras fases del desarrollo que si afecta a los que ocurren cer ca del final. Las primeras clulas de un embrin son como los naipes de la base de un castillo de naipes -casi todo depende de ellas: una pequea alteracin de sus propiedades, probablemente dar como resultado un desastre. Los pasos

Figura 1-36 Com paracin del desarrollo em brionario de un pez, de un anfibio, de un reptil, de un pjaro y de una seleccin de mamferos. Los estadios tempranos (a rr ib a ) son muy similares pero los ltimos estadios {abajo) son ms divergentes. Los estadios tempranos estn dibujados ms o menos a escala y los ltimos estadios no. (De E. Haeckel, Anthropogenie, oder Entwickelungsgeschichte des Menschen. Leipzig: Engelmann, 1874. Por cortesa de the Bodleian Library, Oxford.)

De las clulas simples a los organismos pluricelulares

35

fundamentales han sido congelados en procesos de desarrollo, del mismo modo que el cdigo gentico o los mecanismos de sntesis proteica han quedado congelados en la organizacin bioqumica bsica de la clula. En cambio, las c lulas producidas hacia el final del desarrollo (o producidas tempranamente pero que forman estructuras accesorias como la placenta, que no se incorporan al cuerpo adulto) tienen ms libertad para cambiar. Probablemente sta es la ra zn de que los embriones de las diferentes especies se parezcan a menudo entre s en las primeras fases y de que, a medida que se desarrollan, repitan los pasos de la evolucin.

Las clulas som ticas del cuerpo de los vertebrados muestran ms de 200 tipos diferentes de especializacin
La riqueza de especializaciones diferentes que se encuentra en las clulas de un animal superior es incom parablem ente mayor a la que puede presentar cual quier procariota. En un vertebrado se pueden distinguir fcilmente ms de 200 tipos celulares diferentes y es probable que muchos de estos tipos de clulas in cluyan, bajo un mismo nombre, a un elevado nmero de variedades con dife rencias sutiles. El Panel 1-3 (pgs. 38-39) muestra una pequea seleccin de ellos. En esta profusin de comportamientos especializados se puede observar, en un mismo organismo, la asombrosa versatilidad de la clula eucariota. Gran parte de los conocim ientos actuales sobre las propiedades generales de las clu las eucariotas procede del estudio de estos tipos especializados de clulas que muestran individualmente, hasta un grado excepcional, aspectos que son bsi cos para todas las clulas. Cada rasgo y cada orgnulo de cada prototipo celular que hem os esbozado en el Panel 1-1 (pgs. 18-19) est desarrollado hasta un grado extraordinario o revelado con especial claridad en algn tipo celular. Para tomar un ejemplo arbitrario, consideremos la unin neuromuscular, en la que intervienen slo tres tipos de clulas: una clula muscular, una clula nerviosa y una clula de Schwann. Cada una de ellas desempea un papel muy distinto (Fi gura 1-37). 1. La clula muscular se ha especializado en la contraccin. Su citoplasma est lleno de filamentos proteicos, incluido un elevado nmero de fila m entos de actina, dispuestos organizadamente. Existen tambin num e rosas mitocondrias distribuidas entre los filamentos proteicos, que sumi nistran ATP como combustible para el aparato contrctil. 2. La clula nerviosa estimula al msculo a contraerse; transmite al mscu lo una seal excitadora procedente del cerebro o de la mdula espinal. Por consiguiente, la clula nerviosa es extraordinariamente alargada: su cuerpo principal, que contiene el ncleo, puede hallarse a ms de un m e tro de la unin con el msculo. El citoesqueleto est desarrollado de for ma correspondiente manteniendo esta forma poco habitual de la clula y transportando eficazmente los materiales desde un extremo al otro de la misma. Pero la especializacin ms crucial de la clula nerviosa radica en su m em brana plasmtica, la cual contiene protenas que actan como bom bas de iones y como canales inicos, provocando un movimiento de iones que equivale a un flujo de electricidad. Aunque todas las clulas contienen estos canales y bom bas en sus membranas plasmticas, la c lula nerviosa los ha aprovechado de tal manera que un pulso de electrici dad se puede propagar en una fraccin de segundo desde un extremo al otro de la clula, transmitiendo as una seal. 3. Finalmente, las clulas de Schwann estn especializadas en la produc cin masiva de mem brana plasmtica, que disponen alrededor de la por cin alargada de la clula nerviosa, depositando una tras otra sucesivas capas de membrana, como si fuera un rollo de cinta, formando una vaina de mielina que acta de aislante.

soma de la clula nerviosa

prolongacin de la clula nerviosa (axn) clula de Schwann generando la vaina de m ielina 100 |jm

clula de Schwann term inal de a clula

clula m uscular
Figura 1-37 Esquema de una clula nerviosa, con sus clulas de Schwann asociadas, entrando en contacto con una clula m uscular a travs de una unin neurom uscular. Diagrama esquemtico.

36

Captulo 1 : La evolucin de la clula

Los genes pueden ser activados y desactivados


Diversos tipos celulares especializados de un mismo animal o planta superior a menudo aparecen tan radicalmente distintos como pueden serlo dos clulas. Esto puede parecer paradjico ya que todas las clulas de un organismo plurice lular estn estrechamente relacionadas al haberse formado recientemente a par tir de una misma clula precursora -e l vulo fecundado. Un linaje comn impli ca genes similares; cmo aparecen entonces las diferencias? En algunos casos la especializacin celular implica la prdida de material gentico. Un ejemplo extremo lo constituyen los eritrocitos de los mamferos, que en el transcurso de la diferenciacin pierden por completo el ncleo. Pero la inmensa mayora de las clulas de la mayor parte de especies animales y vegetales conservan toda la in formacin gentica contenida en el vulo fecundado. La especializacin depen de de alteraciones de la expresin gnica y no de la prdida o adquisicin de ge nes. Incluso las bacterias no producen simultneamente todos sus tipos de pro tenas, sino que son capaces de ajustar el nivel de sntesis a las condiciones ex ternas. Las protenas especficamente necesarias para el metabolismo de la lac tosa, por ejemplo, son producidas por algunas bacterias slo cuando pueden disponer de este azcar. Otras bacterias detienen la mayor parte de los procesos metablicos normales; cuando las condiciones son desfavorables para la prolife racin celular, algunas bacterias detienen la mayor parte de los procesos m eta blicos normales y forman esporas que presentan una pared externa, resistente, impermeable y un citoplasma de composicin alterada. Las clulas eucariotas han desarrollado mecanismos mucho ms complejos para controlar la expresin gnica, y estos mecanismos afectan a sistemas ente ros de productos gnicos interactivos. Los grupos de genes son activados o inhi bidos en respuesta a seales tanto externas como internas. La composicin de las membranas, el citoesqueleto, los productos secretores, incluso el m etabolis mo y otros muchos rasgos, deben variar de manera coordinada cuando las clu las se diferencian. Los controles que hacen posible estos cambios han evolucio nado en los eucariotas hasta un grado no alcanzado por los procariotas, definiendo las complejas reglas del comportamiento celular que pueden generar un organismo pluricelular organizado a partir de un simple huevo.

Comparaciones entre secuencias revelan centenares de familias de genes homlogos 12,21


A parte de las apariencias, la evolucin ha transformado el universo de las cosas vivientes hasta un grado que no tiene parangn. Un ser humano, una mosca, una margarita, un hongo, una bacteria... parecen tan diferentes entre s que dif cilmente tiene sentido compararlos. Todos ellos son descendientes de un ances tro comn y a medida que vamos estudiando su interior, encontramos ms y ms evidencias de sus orgenes comunes. Ahora conocemos que la maquinaria molecular bsica de la vida se ha conservado hasta un grado tal que probable mente habra sorprendido a los padres de la teora de la evolucin. Como hemos visto, todas las formas de vida tienen esencialmente la misma qumica, basada en aminocidos, azcares, cidos grasos y nucletidos; todas sintetizan estos costituyentes qumicos de una manera esencialmente similar; todas almacenan la informacin gentica en el DNA y la expresan a travs del RNA y de las prote nas. El grado de conservacin de la evolucin es todava ms sorprendente cuando examinamos en detalle las secuencias de nucletidos de determinados genes y de aminocidos en determinadas protenas. La suerte es que las enzimas bacterianas que catalizan cualquier reaccin en particular, como la rotura de un azcar de seis carbonos en dos azcares de tres carbonos a travs de la glucolisis, tienen una secuencia de aminocidos (y una estructura tridimensional) in equvocamente similar a la de las enzimas que catalizan la misma reaccin en los seres humanos. Ambas enzimas -y de forma equivalente los genes que las es-

De las clulas simples a los organismos pluricelulares

TIPOS CELULARES
E x is te n m s d e 2 0 0 t ip o s d if e r e n t e s d e c lu la s e n el c u e r p o h u m a n o . S e h a lla n f o r m a n d o d iv e r s o s tip o s d e t e jid o s com o

EPITELIOS
L a s c lu la s e p ite lia le s f o r m a n c a p a s c e lu la r e s c o h e r e n te s d e n o m in a d a s e p ite lio s , q u e r e v is te n las c a r a s in te r n a s y e x te r n a s d e l c u e r p o . E x is te n m u c h o s tip o s e s p e c ia liz a d o s d e e p ite lio s . L a s c lu la s a b s o r b e n t e s (e n te r o c ito s ) t ie n e n m u c h o s m ic r o v illi q u e se p r o y e c ta n a la s u p e r fic ie lib r e a u m e n t a n d o el re a d e a b s o r c i n . C lu la s c ilia d a s : tie n e n c ilio s e n su s u p e r fic ie lib re q u e b a te n s in c r n ic a m e n t e p a r a d e s p la z a r s u s ta n c ia s e n c im a d e la c a p a e p it e lia l. C lu la s s e c r e to r a s : s e h a lla n e n la m a y o r a d e la s c a p a s e p it e lia le s . E s ta s c lu la s e s p e c ia liz a d a s s e g r e g a n s u s ta n c ia s h a c ia la s u p e r fic ie d e la c a p a c e lu la r .

e p ite lio s te jid o c o n ju n tiv o m s c u lo te jid o n e rv io s o


La m a y o r a d e t e jid o s e s t n f o r m a d o s p o r c o m b in a c io n e s d e v a r io s t ip o s c e lu la r e s .

lllllllllDlllDlllllll
------}x----- 'I------a------A----- ------- Jt------

------------ m icrovilli

contacto lmina basal cilios

L as c lu la s e p ite lia le s a d y a c e n te s e s t n u n id a s m e d ia n t e u n io n e s q u e c o n fie r e n a la c a p a c e lu la r su fu e r z a m e c n ic a y q u e la h a c e n t a m b i n im p e r m e a b le a las m o l c u la s p e q u e a s . La c a p a d e s c a n s a s o b r e u n a l m in a b a s a l.

ncleo

TEJIDO CONJUNTIVO
Los e s p a c io s e n tr e r g a n o s y t e jid o s d e l c u e rp o e s t n o c u p a d o s p o r t e jid o c o n ju n tiv o , f o r m a d o p r in c ip a lm e n t e p o r u n a re d d e fib r a s p ro te ic a s r e s is te n te s in m e r s a s e n un g e l p o lis a c r id o . E s ta m a tr iz e x t r a c e lu la r e s t s e g r e g a d a p r in c ip a lm e n t e p o r lo s fib r o b la s to s . El h u e s o e s t p r o d u c id o p o r c lu la s d e n o m in a d a s o s te o b la s to s , q u e s e g re g a n u n a m a tr iz e x tr a c e lu la r e n la q u e m s ta r d e se d e p o s ita r n c ris ta le s d e fo s fa to c lc ic o .

Las sales de calcio se depositan en la m atriz extracelular.

D o s tip o s fu n d a m e n t a le s d e f ib r a p r o te ic a e x t r a c e lu la r s o n la c o l g e n a y la e la s tin a . \

osteoblastos unidos por prolongaciones celulares

matriz extracelular

Las c lu la s a d ip o s a s s o n u n a s d e las m a y o r e s d e l c u e rp o . E s tas c lu la s s o n r e s p o n s a b le s d e la p r o d u c c i n y a lm a c e n a m ie n t o d e g r a s a . El n c le o y el c ito p la s m a e s t n

fibroblastos en tejido conjuntivo laxo

d e s p la z a d o s h a c ia la p e r ife ria d e la c lu la p o r u n a g ra n g o ta d e lp id o .

TEJIDO NERVIOSO dendritas


SALIDAS

axon
El a x n c o n d u c e las s e a le s e l c tric a s p r o c e d e n te s d e l s o m a c e lu la r . E s tas s e a le s s o n p r o d u c id a s p o r un flu jo d e io n e s a t r a v s d e la m e m b r a n a d e la c lu la n e r v io s a

LLEGADAS

cuerpo o soma celular


La s in a p s is es el lu g a r e n el q u e L as c lu la s n e r v io s a s , o n e u r o n a s , e s t n e s p e c ia liz a d a s e n la c o m u n ic a c i n . El c e r e b r o y la m d u la e s p in a l, p o r e je m p lo , e s t n c o m p u e s to s d e u n a re d d e n e u r o n a s c o n c lu la s g lia le s d e s o s t n . la n e u r o n a f o r m a u n a u n i n e s p e c ia liz a d a c o n o tra n e u r o n a (o c o n u n a c lu la m u s c u la r ). En la s in a p s is , las s e a le s p a s a n d e u n a n e u r o n a a o tr a (o d e u n a n e u r o n a a u n a c lu la m u s c u la r ).

U n a s c lu la s e s p e c ia liz a d a s , d e n o m in a d a s c lu la s d e S c h w a n n u o lig o d e n d r o c ito s , se d is p o n e n a lr e d e d o r d e l a x n f o r m a n d o u n a v a in a m u lt ila m in a r .

38

Panel 1-3 Algunos de los diferentes tipos de clulas existentes en el cuerpo de un vertebrado.

A m e n u d o la s c lu la s e p ite lia le s s e c r e to r a s e s t n a g r u p a d a s f o r m a n d o u n a g l n d u la q u e se e s p e c ia liz a e n la s e c r e c i n d e u n a s u s ta n c ia p a r tic u la r . T a l c o m o s e ilu s tra , la s g l n d u la s e x o c r in a s s e g r e g a n d e t e r m in a d o s p r o d u c to s ( c o m o l g r im a s , m u c o s id a d e s y ju g o s g s tric o s ) al in te r io r d e c o n d u c to s . Las g l n d u la s e n d o c r in a s s e g r e g a n h o r m o n a s a la sa n g re . conducto _ de ,a

material segregado

MUSCULO
M e d ia n t e su c o n t r a c c i n , la s c lu la s m u s c u la r e s g e n e r a n fu e r z a m e c n ic a . En lo s v e r t e b r a d o s e x is te n t r e s t ip o s p r in c ip a le s :

m s c u lo e s q u e l tic o : m u e v e la s a r t ic u la c io n e s p o r m e d io d e su c o n tr a c c i n p o t e n t e y r p id a . C a d a m s c u lo e s t f o r m a d o p o r u n h a z d e f ib r a s m u s c u la r e s , c a d a u n a d e las c u a le s e s u n a e n o r m e c lu la p lu r in u c le a d a .

glndula

m sculo

ncleo clula m scular con estriaciones transversales

tendn clulas secretoras de la glndula

m s c u lo liso : s e h a lla e n la s p a r e d e s d e l t r a c to

SANGRE
L o s e r itr o c ito s ( g l b u lo s r o jo s ) s o n c lu la s m u y p e q u e a s , n o r m a lm e n t e s in n c le o ni m e m b r a n a s in te r n a s , y c o n t ie n e n h e m o g lo b in a , p r o t e n a q u e s e u n e al o x g e n o .

d ig e s t iv o , la v e jig a , las a r t e r ia s y la s v e n a s ; e s t c o m p u e s t o p o r f in a s c lu la s a la r g a d a s (n o e s t r ia d a s ) , c a d a u n a c o n u n s o lo n c le o .

m s c u lo c a r d a c o : d e c a r c t e r in t e r m e d io e n tr e el m s c u lo e s q u e l t ic o y el m s c u lo lis o .

1 cm de sangre contiene 5000 m illones de eritrocitos

su form a norm al es la de un disco bicncavo

P r o d u c e el la tid o c a r d a c o . Las c lu la s a d y a c e n t e s e s t n a s o c ia d a s p o r u n io n e s e l c t r ic a m e n t e c o n d u c t o r a s , q u e h a c e n q u e las c lu la s se c o n t r a ig a n s in c r n ic a m e n t e

Lo s g l b u lo s b la n c o s (le u c o c ito s ) p r o te g e n d e las in fe c c io n e s . La s a n g r e c o n tie n e a p r o x im a d a m e n t e u n le u c o c ito p o r c a d a 1 0 0 g l b u lo s r o jo s . A u n q u e v ia ja n p o r s a n g r e , p u e d e n p a s a r a t r a v s d e la s p a r e d e s d e lo s v a s o s s a n g u n e o s p a r a r e a liz a r su fu n c i n e n lo s t e jid o s v e c in o s . E x is te n v a r io s tip o s d is t in t o s , e n tr e e llo s : lin fo c ito s : r e s p o n s a b le s d e la s r e s p u e s ta s in m u n it a r ia s , t a le s c o m o la p r o d u c c i n d e a n tic u e r p o s . m a c r fa g o s y n e u tr filo s : s e d e s p la z a n h a c ia lo s fo c o s d e in fe c c i n , d o n d e in g ie r e n b a c te r ia s y r e s id u o s .

CELULAS SENSORIALES
E n tr e las c lu la s m s c o m p le ja s d e l c u e r p o d e lo s v e r t e b r a d o s s e e n c u e n t r a n las q u e d e te c ta n lo s e s t m u lo s e x t e r n o s . Las c lu la s c ilia d a s d e l o d o in t e r n o s o n las d e t e c t o r a s p r im a r ia s d e l s o n id o . S e t r a t a d e c lu la s e p it e lia le s m o d ific a d a s , c o n m ic r o v illi e s p e c ia le s (e s te r e o c ilio s ) e n su s u p e r fic ie . El m o v im ie n t o d e e s to s e s t e r e o c ilio s e n r e s p u e s ta a las v ib r a c io n e s s o n o r a s p r o v o c a u n a s e a l e l c tric a q u e p a s a al c ere b ro . =

los estereocilios son m uy rgidos porque estn em paquetados con filam entos de actina

pared de un pequeo vaso sanguneo infeccin bacteriana en el tejido conjuntivo

clula ciliada

CELULAS GERMINALES
T a n t o los e s p e r m a to z o id e s c o m o lo s v u lo s s o n h a p lo id e s, e s d e c ir , q u e c o n t ie n e n u n a s o la d o t a c i n d e c r o m o s o m a s . U n e s p e r m a to z o id e d e l m a c h o s e u n e a u n v u lo d e la h e m b r a , f o r m a n d o , p o r s u c e s iv a s d iv is io n e s , u n n u e v o o r g a n is m o d ip lo id e .

vulo con un esperm atozoide dibujado a escala

L o s b a s to n e s d e la r e tin a d e l o jo s o n c lu la s e s p e c ia liz a d a s e n la r e s p u e s ta a la lu z. La r e g i n fo t o s e n s ib le c o n t ie n e u n a g r a n c a n t id a d d e d is c o s m e m b r a n o s o s (e n rojo) e n c u y a s m e m b r a n a s s e e n c u e n t r a el p ig m e n t o s e n s ib le a la lu z , la r o d o p s in a . La lu z a c t a c o m o u n a s e a l e l c tric a (fle c h a verde), q u e s e t r a n s m it e a c lu la s n e r v io s a s d e l o jo , las c u a le s c a n a liz a n la s e a l h a s ta el c e r e b r o .

r ffT )

esperm atozoide

Figura 1-38 Relaciones evolutivas entre algunos de los organismos mencionados en este libro. Las ramas del rbol muestran vas de descendencia comn, pero su longitud no indica el paso del tiempo. (Tngase en cuenta as mismo que el eje vertical del diagrama muestra categoras principales de organismos, pero no tiempo.)

40

pecifcan- no slo tienen una funcin similar sino tambin casi con seguridad un origen evolutivo comn. Se pueden utilizar estas relaciones para dibujar los caminos evolutivos ms antiguos; comparando secuencias de genes y recono ciendo homologas se descubren paralelismos ocultos y similitudes entre orga nismos diferentes. A menudo tambin se encuentran parecidos familiares entre genes que co difican protenas que realizan funciones relacionadas en un mismo organismo. Estos genes tambin estn relacionados evolutivamente y su existencia revela una estrategia bsica a travs de la cual se ha originado la complejidad creciente de los organismos: los genes y zonas de genes se duplican y las nuevas copias di vergen de la original mediante mutacin y recombinacin, para realizar nuevas funciones adicionales. De esta manera, partiendo de un nmero relativamente pequeo de genes en las clulas primitivas, la forma de vida ms com pleja ha llegado a desarrollar ms de 50 000 genes, como se cree que presenta un animal o una planta superiores. A partir del estudio de un gen o de una protena, avan zamos en el conocim iento de toda una familia de genes o protenas homlogos a ella. As la biologa molecular subraya la unidad del mundo viviente y nos pro porciona herramientas para descubrir los mecanismos generales que estn en la base de su infinita variedad de invenciones. En el prximo captulo empezaremos la discusin de estos mecanismos con el estudio del com ponente mas bsico del kit de construccin biolgica -las m o lculas pequeas a partir de las que se sintetizan todos los com ponentes mayo res de las clulas vivas.

Resumen
La evolucin de los grandes organismos pluricelulares dependi de la capacidad de las clulas eucariotas para expresar su informacin hereditaria de muchas maneras diferentes y para actuar deform a cooperativa como un colectivo nico. En los ani males uno de los primeros desarrollos fu e probablemente la formacin de capas de clulas epiteliales que separaron del ambiente exterior el espacio interior del cuerpo. Adems de estas clulas epiteliales tambin se desarrollaron clullas nerviosas, clu las musculares y clulas del tejido conjuntivo, todas las cuales se hallan actualmen te en los animales ms sencillos. La evolucin de los animales y de las plantas supe riores (Figura 1 -38) dependi de la produccin de un nmero cada vez mayor de tipos celulares especializados y de mtodos mas sofisticados de coordinacin entre ellos, reflejando un nmero cada vez mayor de elaborados sistemas de control de la expresin de los genes en los distintos tipos celulares.

Bibliografia
General
Bendall, D.S., ed. Evolution from Molecules to Men. Cam bridge, UK: Cambridge University Press, 1983. Evolution of Catalytic Function. Cold Spring Harbor Symp. Quant. Biol. 52, 1987. Curtis, H.; Barnes, N.S. Biology, 5th ed. New York: Worth, 1989. Darnell, J.E.; Lodish, H.F.; Baltimore, D. Biologia Celular y Molecular, 2.a ed., Capitulo 26. Barcelona: Ediciones Omega, S.A., 1993. Darwin, C. On the Origin of Species. London: Murray, 1859. Reprinted, New York: Penguin, 1984. Dawkins, R. The Blind Watchmaker. New York: Viking Pen guin, 1988. Margulis, L.M.; Schwartz, K.V. Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth, 2nd ed. New York: W.H. Freeman, 1988.

Watson, J.D.; Hopkins, N.H.; Roberts, J.W.; Steitz, J.A.; Wei ner, A.M. Molecular Biology of the Gene, 4th ed., Chap ter 28. Menlo Park, CA: Benjamin-Cummings, 1987.

Citas
1. Lazcano, A.; Fox, G.E.; Oro, J.F. Life before DNA: the ori gin and evolution of early archaean cells. In The Evo lution of Metabolic Function (R.P. Mortlock, ed.), pp. 237-295. Boca Raton, FL: CRC Press, 1992. Schopf, J.W.; Hayes, J.M.; Walter, M.R. Evolution of earths earliest ecosystems: recent progress and un solved problems. In Earths Earliest Biosphere: Its Origin and Evolution (J.W. Schopf, ed.), pp. 361-384. Princeton, NJ: Princeton University Press, 1983. 2. Miller, S.L. Which organic compounds could have oc curred on the prebiotic earth? Cold Spring Harbor Symp. Quant. Biol. 52:17-27, 1987. 3. Orgel, L.E. Molecular replication. Nature 358:203-209, 1992.

Bibliografa

41

4. Ellington, A.D.; Szostak, J..W. In vitro selection of RNA molecules that bind specific ligands. Nature 346:818822, 1990. Joyce, G.F. Directed molecular evolution. Sci. Am. 267(6) :90-97, 1992. 5. Bartel, D.P.; Szostak, J.W. Isolation of new ribozymes from a large pool of random sequences. Science 261:1411-1418,1993. Cech, T.R. RNA as an enzyme. Sci. Am. 255(5):64-75, 1986. 6. Alberts, B.M. The function of the hereditary materials: biological catalyses reflect the cells evolutionary history. Am. Zool. 26:781-796, 1986. Maizels, N.; Weiner, A.M. Peptide-specific ribosomes, genomic tags, and the origin of the genetic code. Cold Spring Harbor Symp. Quant. Biol. 52:743-749, 1987. 7. Cavalier-Smith, T. The origin of cells: a symbiosis be tween genes, catalysts, and membranes. Cold Spring Harbor Symp. Quant. Biol. 52:805-824, 1987. 8. Muto, A., Andachi, Y.; Yuzawa, H.; Yamao, F.; Osawa, S. The organization and evolution of transfer RNA genes in Mycoplasma capricolum. Nucl. Acid Res. 18:5037-5043, 1990. 9. Sogin, M.L. Early evolution and the origin of eukaryotes. Curr. Opin. Genet. Devel. 1:457-463, 1991. Vidal, G. The oldest eukaryotic cells. Sci. Am. 250(2):4857, 1984. 10. Woese, C.R. Bacterial evolution. Microbiol. Rev. 51:221271, 1987. Zillig, W. Comparative biochemistry of Archaea and Bacteria. Carr. Opin. Genet. Devel. 1:544-551, 1991. 11. Clarke, P.H. Enzyme in bacterial populations. In Bio chemical Evolution (H. Gutfreund, ed.), pp. 116-149. Cambridge, UK: Cambridge University Press, 1981. De Duve, C. Blueprint for a Cell: The Nature and Origin of Life. Burlington, NC: Neil Patterson Publishers, 1991. 12. Li, W.-H.; Graur, D. Fundamentals of Molecular Evolu tion. Sunderland, MA: Sinauer Associates, 1991. Sidow, A.; Bowman, B.H. Molecular phylogeny. Curr. Opin. Genet. Devel. 1:451-456, 1991. 13. Dickerson, R.E. Cytochrome c and the evolution of en ergy metabolism. Sci. Am. 242(3): 136-153,1980. 14. Cavalier-Smith, T. The origin of eukaryote and archaebacterial cells. Ann. N.Y. Acad. Sci. 503:17-54,1987.

15.

16. 17. 18.

19.

20.

21.

Gray, M.W. The evolutionary origins of organelles, Trends Genet. 5:294-299, 1989. Margulis, L. Symbiosis in Cell Evolution. New York: W.H. Freeman, 1981. Gray, M.W. Origin and evolution of mitochondrial DNA. Annu. Rev. Cell Biol. 5:25-50, 1989. Sogin, M.L.; Gunderson, J.H.; Elwood, H.J.; Alonso, R.A.; Peattie, D.A. Phylogenetic meaning of the kingdom concept: an unusual ribosomal RNA from Giardia lamblia. Science 243:75-77, 1989. Vossbrinck, C.R.; Maddox, J.V.; Friedman, S.; Debrunner-Vossbrinck, B.A.; Woese, C.R. Ribosomal RNA se quence suggest microsporidia are extremely ancient eukaryotes. Nature 326:411-414,1987. Bryant, D.A. Puzzles of chloroplast ancestry. Curr. Biol. 2:240-242, 1992. Sleigh, M.A. Protozoa and Other Protists. London: Ed ward Arnold, 1989. Buchsbaum, R., et al. Animals Without Backbones, 3rd ed. Chicago: University of Chicago Press, 1987. Field, K.G., et al. Molecular phylogeny of the animal kingdom. Science 239:748-753, 1988. Knoll, A.H. The end of the proterozoic eon. Sci. Am. 265(4):64-73, 1991. Levinton, J.S. The big bang of animal evolution. Sci. Am. 267(5):84-91, 1992. Shapiro, J.A. Bacteria as multicellular organisms. Sci. Am. 258(6):82-89, 1988. Valentine, J.W. The evolution of multicellular plants and animals. Sci. Am. 239(3):140-158, 1978. Bode, P.M.; Bode, H.R. Patterning in Hydra. In Pattern Formation (G.M. Malacinski, S.V. Bryant, eds.), pp. 213-244. New York: Mcmillan, 1984. Raff, R.A.; Kaufman, T.C. Embryos, Genes, and Evolu tion. New York: Macmillan, 1983. Slack, J.M.W.; Holland, P.W.H.; Graham, C.F. The zootype and the phylotypic stage. Nature 361:490-492, 1993. Chothia, C. One thousand families for the molecular biologist. Nature 357:543-544, 1992. Miklos, G.L.; Campbell, H.D. The evolution of protein domains and the organizational complexities of metazoans. Curr. Opin. Genet. Devel. 2:902-906,1992.

42

Captulo 1: La evolucin de la clula

Pequeas molculas, energa y biosntesis


Los componentes qumicos de una clula Orden biolgico y energa K 1 alimento y la obtencin de la energa celular La biosntesis y la creacin de orden Coordinacin entre catabolismo y biosntesis

Debo anunciarles que puedo preparar urea sin necesidad de ningn rin ni de ningn animal, ya sea un hombre o un perro. Esta frase, escrita hace 165 aos por el joven qumico alemn Whler, signific el final de la creencia en una fuer za vital especial existente en los organismos vivos que da lugar a sus propieda des y productos caractersticos. Pero lo que en la poca de Whler fue una reve lacin, actualmente es de comn conocim iento -las criaturas vivas estn hechas de compuestos qumicos. En la visin contem pornea de la vida no hay lugar para el vitalismo -o para cualquier cosa que quede fuera de las leyes de la qumi ca y de la fsica. Esto no quiere decir que en biologa ya no existan misterios: existen muchas reas de ignorancia, tal como se pondr de manifiesto en cap tulos posteriores. Pero deberamos empezar a subrayar la gran cantidad de fen menos que se conocen. Actualmente, disponemos de informacin detallada sobre las molculas esenciales de la clula -n o slo de un reducido nmero de molculas, sino de miles de ellas. En m uchos casos conocem os sus estructuras qumicas exactas y sabem os con exactitud cmo son producidas y degradadas. En trm inos gene rales, conocem os cmo la energa qumica impulsa las reacciones biosintticas de la clula, cm o actan en las clulas los principios de la term odinm ica ge nerando un orden molecular, y tam bin cm o son controladas y coordinadas las miradas de cambios qumicos que se producen continuamente dentro de las clulas. En este captulo y en el siguiente resumimos brevemente la qumica de la clula viva. Aqu nos ocuparemos de los procesos en los que intervienen las m o lculas pequeas: de aquellos mecanismos a travs de los cuales la clula sinteti za sus com ponentes qumicos fundamentales y obtiene su energa. El Captulo 3 describe las molculas gigantes de la clula, que son polmeros de las molculas pequeas y cuyas propiedades son las responsables de la especificidad de los procesos biolgicos y de la transferencia de la informacin biolgica.

Los componentes qumicos de una clula


La qumica celular se basa en los compuestos de carbono 1
Una clula viva est compuesta por un restringido conjunto de elementos, cua tro de los cuales (C, H, N y O) constituyen aproximadamente el 99 % de su peso. Esta composicin difiere notablem ente de la de la corteza terrestre y pone de re

43

50

Figura 2-1 Abundancia relativa de los elementos qumicos encontrados en la corteza terrestre (el mundo inanimado), comparada con la encontrada en los tejidos blandos de los organismos vivos. La abundancia
relativa se expresa com o el porcentaje del n m ero total de tomos presentes. As, por ejemplo, aproximadamente cerca del 50 % de los tomos de los organismos vivos son tomos de hidrgeno.

Ca y Mg

Na y K

Si

Otros

lieve un tipo caracterstico de qumica (Figura 2-1). Cul es esta qumica espe cial y cmo surgi? La substancia ms abundante de la clula viva es el agua. Constituye aproxi madamente el 70 % del peso de las clulas. La mayora de reacciones intracelulares ocurren en un medio acuoso. La vida en este planeta empez en el mar, y las condiciones que reinaban en aquel ambiente primitivo imprimieron un sello per manente en la qumica de la materia viva. Todos los organismos han sido disea dos en base a las propiedades caractersticas del agua, tales como su carcter po lar, su habilidad para formar enlaces de hidrgeno y su alta tensin superficial. Por ejemplo, el agua rodea completamente a las molculas polares mientras que tiende a reunir las molculas no polares, formando grandes agregados. En el Pa nel 2-1 (pgs. 50-51) se resumen algunas propiedades importantes del agua. Aparte del agua, la gran mayora de las otras molculas de una clula son compuestos de carbono, centro de atencin de la qum ica orgnica. El carbono destaca entre todos los elementos de la Tierra por su capacidad de formar gran des molculas; en este aspecto le sigue el silicio, muy por debajo de l. Debido a su reducido tamao y a los cuatro electrones de la capa externa el tomo de car bono puede formar cuatro enlaces covalentes fuertes con otros tomos. Y, lo que es ms importante, se puede unir a otros tomos de carbono formando cadenas y anillos, generando as molculas grandes y complejas cuyo tamao no tiene un lmite superior obvio. Los otros tomos abundantes en la clula (H, N y O) tam bin son pequeos y capaces de formar enlaces covalentes muy fuertes (Panel 22, pgs. 52-53). Un enlace covalente tpico de una molcula biolgica tiene una energa de entre 15 y 170 kcal/mol, en funcin de los tomos que estn implicados. Como por trmino medio la energa trmica a la temperatura corporal solamente es de 0,6 kcal/mol, incluso una colisin energtica con otra molcula, muy poco pro bable, no ser capaz de romper un enlace covalente. Sin embargo, catalizadores especficos pueden romper o reorganizar rpidamente los enlaces covalentes. La Biologa es posible gracias a la com binacin de estabilidad de los enlaces cova lentes en condiciones fisiolgicas y la capacidad de los catalizadores biolgicos (denominados enzimas ) de romper y reorganizar estos enlaces de una manera controlada y en determinadas molculas. En principio, las simples reglas del enlace covalente entre el carbono y otros elementos permiten un nmero infinitamente elevado de compuestos. Aunque el nmero de compuestos diferentes de carbono de una clula es muy grande, nica

44

Captulo 2 : Pequeas molculas, energa y biosnlesis

mente representa una diminuta fraccin de los que son tericamente posibles. En algunos casos podemos encontrar una buena razn para explicar que este o aquel compuesto realiza una funcin biolgica determinada; pero con mayor frecuencia parece que el compuesto elegido fue una alternativa entre otras muchas razona bles, algo as como un accidente (Figura 2-2). Ciertos patrones y elementos de reac cin, una vez establecidos en las clulas ms antiguas, fueron preservados con al gunas variaciones a lo largo de la evolucin. Aparentemente, el desarrollo de nuevas clases de compuestos fue necesario o til en muy contadas ocasiones.

Las clulas utilizan cuatro tipos bsicos de molculas pequeas 2


Ciertas com binaciones simples de tomos -tales como los grupos metilo (-CH3), hidroxilo (-OH), carboxilo (-COOH) y amino (-NH2) - se presentan repetidamen te en las molculas biolgicas. Cada uno de estos grupos tiene propiedades qu micas y fsicas distintas que influyen sobre el comportamiento de cualquier m o lcula en que se presente el grupo. El Panel 2-2 (pgs. 52-53) resume los tipos principales de grupos qumicos y algunas de sus propiedades sobresalientes. Los pesos atmicos de H, C, N y O son 1, 12, 14 y 16 respectivamente. Las molculas orgnicas pequeas de la clula tienen pesos moleculares que osci lan entre 100 y 1000 y contienen hasta unos 30 tomos de carbono. Normalmen te se hallan libres en solucin, donde algunas de ellas forman un acervo de inter mediarios a partir de los cuales se construyen largos polmeros, denominados m acrom olculas. Tambin existen intermediarios esenciales en las reacciones qumicas que transforman la energa derivada de los alimentos en formas tiles de energa (lo cual se discute ms adelante). Las molculas pequeas representan una dcima parte del total de materia orgnica de una clula y (a grandes rasgos) slo existen del orden de un millar de tipos diferentes de ellas (Tabla 2-1). Todas las molculas biolgicas se sintetizan a partir de los mismos compuestos simples y se degradan a estos mismos com puestos, ocurriendo la sntesis y la degradacin a travs de secuencias de cambios qumicos de alcance limitado y siguiendo reglas precisas. Por consiguiente, los compuestos de una clula pueden ser clasificados en un reducido nmero de fa milias distintas. Dado que las macromolculas de una clula, que constituyen el tema del Captulo 3 de este libro, estn formadas a partir de estas mismas m ol culas pequeas, pertenecen a sus mismas familias. A grandes rasgos, podemos decir que las clulas poseen cuatro grandes fami lias de molculas orgnicas pequeas: los azcares simples, los cidos grasos, los aminocidos y los nucletidos. Cada una de estas familias contiene muchos miembros diferentes, que presentan rasgos qumicos comunes. Aunque algunos compuestos celulares no pueden clasificarse en estas categoras, las cuatro fami lias, junto con las macromolculas formadas a partir de ellas, constituyen un por centaje sorprendentemente elevado de la masa celular total (Tabla 2-1). Tabla 2-1 Composicin qumica aproximada de una clula bacteriana Porcentaje del peso celular total Agua Iones inorgnicos Azcares y precursores Aminocidos y precusores Nucletidos y precursores cidos grasos y precursores Otras molculas pequeas Macromolculas (protenas, cidos nucleicos y polisacridos) 70 1 1 0,4 0,4 1 0,2 26,0 Nmero de tipos de cada molcula 1 20 250 100 100 50 -300 -3000

Figura 2-2 Los organism os vivos nicam ente sintetizan un reducido nm ero de las molculas orgnicas, que en principio podran producir. De los seis aminocidos que se muestran en la figura, nicam ente el de la parte superior (el triptfano) es sintetizado por las clulas.

Los componentes qumicos de una clula

45

c h 2o h

'i

C ---- OH H/

CN

Figura 2-3 La estructura del monosacrido glucosa, una hexosa simple. (A) Forma de cadena abierta del azcar, que est en equilibrio con la forma cclica o de anillo, ms estable, que se muestra en (B). (C) y (D) son modelos de espacio lleno y de bolas y varillas, respectivamente, de esta forma cclica (|}-D-glucosa). La forma de silla (E) es una representacin alternativa que se utiliza frecuentem ente debido a que refleja de una forma ms exacta la estructura del azcar. En (A), (B) y (E) las O de color rojo indican el tomo de oxgeno del grupo aldehido. Para una revisin de las estructuras y de las propiedades qumicas de los azcares, vase el Panel 2-3, pgs. 54-55.

Los azcares son las m olculas alim enticias de la clula 3


Los azcares ms sencillos -los m onosacridos- presentan la frmula general (CH20), donde n es un nmero entero comprendido entre 3 y 7. La glucosa, por ejemplo, tiene la frmula C6H1 2 0 6 (Figura 2-3). Como se muestra en la Figura 2-3, los azcares pueden presentarse tanto en forma de anillo como en forma de ca dena abierta. En esta forma de cadena abierta, los azcares presentan un nm e ro variable de grupos hidroxilo y un grupo aldehido ( jj/ C = 0 ) o un grupo cetona (/ C = 0 ) . El grupo aldehido o cetona desempea un papel especial. En primer lugar, pueden reaccionar con un grupo hidroxilo de la misma molcula convir tiendo la molcula en un anillo; en esta forma de anillo, puede reconocerse el carbono del aldehido o de la cetona originales ya que es el nico que est unido a dos tom os de oxgeno. En segundo lugar, una vez formado el anillo, este car bono puede unirse a uno de los carbonos con un grupo hidroxilo de otro azcar, generando un disacrido (Panel 2-3, pgs. 54-55). De esta misma forma la adi cin de ms monosacridos da lugar a oligosacridos de longitud creciente (trisacridos, tetrasacridos, y as sucesivamente), hasta llegar a las grandes m ol culas de polisacridos con miles de unidades de monosacridos. Puesto que cada monosacrido tiene varios grupos hidroxilo libres que pueden formar un enlace con otro monosacrido (o con algn otro compuesto), el nmero de es tructuras posibles de polisacridos es enorm em ente elevado. Incluso un disac rido simple, formado por dos residuos de glucosa, puede existir en 11 variedades diferentes (Figura 2-4), mientras que tres hexosas diferentes (C6Hl20 6) se pueden unir formando varios miles de trisacridos diferentes. Por esta razn resulta muy difcil determinar la estructura de un polisacrido determinado, ya que es nece sario conocer los lugares de unin de cada azcar a sus vecinos. Con los m to dos actuales, por ejemplo, se tarda ms tiempo en determinar la disposicin de media docena de azcares unidos (por ejemplo, los de una glucoprotena), que en determinar la secuencia de nucletidos de una molcula de DNA que conten ga muchos miles de nucletidos en la que cada unidad se une a la siguiente exactam ente de la misma forma). La glucosa es el principal compuesto alimenticio de muchas clulas. Una se rie de reacciones oxidativas (vase pg. 65) conducen desde esta hexosa hasta varios derivados ms pequeos y, finalmente, hasta C 0 2 y H20 . El resultado neto se puede indicar as: CB H l20 6 + 6 0 2 6 C 0 2 + 6H20 + energa

En el transcurso de la degradacin de la glucosa se genera energa y poder re ductor", ambos esenciales para las reacciones de biosntesis, que son captados y 46 Captulo 2 : Pequeas molculas, energa y biosntesis

CH,OH

CH7

CH,OH

iT "

J o

'

(31-6

a1 o c1

a1 2

(31-3
CH2OH
c h 2o h

a1 3
CH tOH

x() .

I ggO

...........
CH tOH vr O CH tOH

(31-2
CH tOH
ch,

a l 4

Figura 2-4 Once disacridos formados por dos unidades de D-glucosa. Aunque se diferencian nicam ente en el tipo de enlace entre las dos unidades de glucosa, son qum icam ente diferentes. Puesto que los oligosacridos asociados a las protenas y a los lpidos pueden tener ms de seis tipos diferentes de azcares unidos, a travs de enlaces com o los ilustrados aqu, en disposiciones lineales y ramificadas, el nmero de tipos distintos posibles de oligosacridos de que puede disponer la clula es extrem adamente elevado.

D_

(31-(31

a1 6

(31 a1

transportados fundamentalmente por dos molculas cruciales, denominadas ATP y NADH, respectivamente. Ms adelante, en este mismo captulo discuti mos la estructura y las funciones de estas dos molculas cruciales. Los polisacridos simples, compuestos slo por residuos de glucosa -p rinci palmente el glucgeno en las clulas animales y el almidn en las clulas vegeta le s- son utilizados para almacenar energa que se utilizar en el futuro. Pero los azcares no se utilizan exclusivamente para la produccin y el almacenamiento de energa. Importantes compuestos estructurales extracelulares (tales como la celulosa) estn formados por polisacridos sencillos, y a menudo secuencias no repetitivas de cadenas de molculas de azcares, ms pequeas pero ms com plejas, estn unidas covalentemente a protenas, formando glucoprotenas, o a lpidos, formando glucolpidos.

O O" % /

ch2

Los cidos grasos son componentes de las m em branas celulares 4


Una molcula de cido graso, como por ejemplo el cido palmtico (Figura 2-5) presenta dos regiones caractersticas: una larga cadena hidrocarbonada hidrofbica (insoluble en agua) y qumicamente no muy reactiva, y un grupo de cido carboxlico, ionizado en solucin (COO~), extremadamente hidroflico (soluble en agua) y que fcilmente reacciona con un grupo hidroxilo o un grupo amino de otra molcula formando steres y amidas. De hecho casi todas las molculas de cido graso de una clula estn unidas covalentemente a otras molculas, mediante su grupo cido carboxlico. El gran nmero de cidos grasos distintos que se encuentran en las clulas difieren en caractersticas qumicas tales como la longitud de la cadena hidrocarbonada y en el nmero y la posicin de los do bles enlaces carbono-carbono que contienen (Panel 2-4, pgs. 56-57). Los cidos grasos son una importante fuente de alimento ya que pueden ser degradados produciendo por unidad de peso ms del doble de energa til que produce la glucosa. Se almacenan en el citoplasma en forma de triacilglicridos, compuestos de tres cadenas de cidos grasos unidas a una molcula de glicerol (Panel 2-4, pgs. 56-57); Estas molculas constituyen las grasas animales que nos Los componentes qumicos de una clula

I 2 I 2 CH, I 2 ch2 I 2
ch2 ch2 ch2

I 2 I 2 CH, I 2
ch2 ch,

I 2 I 2 CH, I 2 CH2 I 2 ch2 I 2


ch2 ch,

CH,

I 2

Figura 2-5 cido palmtico. El grupo cido carboxlico (en rojo) est representado en forma ionizada. En el centro se presenta un modelo de bolas y varillas y a la d erech a un modelo tridimensional de espacio lleno.

47

grupo am ino

grupo carboxilo

H2N C COOH CH>

pH 7

H ,N C CH

-COO

form a no ionizada

form a ionizada

Figura 2-6 1 aminocido alanina. En la clula, en la que el pH es cercano a 7, el aminocido se halla en forma ionizada. Sin embargo, al ser incorporado a una cadena polipeptdica las cargas de los grupos amino y carboxilo del aminocido libre desaparecen. A la derecha de las frmulas estructurales se muestran modelos de bolas y varillas y de espacio lleno. En el caso de la alanina, la cadena lateral es un grupo -C H 3.

son familiares en nuestra experiencia diaria. Cuando es necesario obtener ener ga, las cadenas de cido graso pueden ser liberadas de los triacilglicridos y ser degradadas hasta unidades de dos carbonos. A continuacin, estas unidades de dos carbonos, que constituyen el grupo acetilo de una molcula hidrosoluble denominada acetil CoA, son degradadas a travs de varias reacciones que liberan energa y que describiremos ms adelante. Pero la funcin ms importante de los cidos grasos reside en la construc cin de las mem branas de la clula. Estas finas capas semipermeables que limi tan a todas las clulas y envuelven sus orgnulos internos estn compuestas fun damentalmente de fosfolfpidos, pequeas molculas que se parecen a los triaciglicridos en que estn construidas en su mayor parte a partir de cidos grasos y glicerol. En los fosfolfpidos, sin embargo, el glicerol est unido a dos ca denas de cido graso y no a tres. El lugar restante del glicerol est acoplado a un grupo fosfato, que a su vez est unido a otro pequeo compuesto hidrofflico como la etanolam ina , la colina o la serina. Cada molcula de fosfolpido tiene una cola hidrofbica -com puesta por las dos cadenas de cido graso- y una cabeza polar hidroflica en la que se encuen tra el fosfato. Si se coloca una pequea cantidad de fosfolpido en agua, se exten der sobre la superficie formando una monocapa de molculas de fosfolpido; en esta lmina las colas de las molculas quedan densamente empaquetadas unas con otras y dirigidas hacia el aire y las cabezas se hallan en contacto con el agua (Panel 2-4, pgs. 56-57). Dos de estas lminas se pueden combinar, cola contra cola, formando un sandwich de fosfolfpidos, o bicapa lipdica, una es tructura extraordinariamente importante que es la base estructural de todas las membranas celulares (como se discute en el Captulo 10).

extremo amino de iacadena i----- i"-----1 N -H Phe H - C -C H

o=c
Ser

N -H H C CH7OH

o=c I
Glu

N -H

H - C CH2-C H 2-C

Los am inocidos son las subunidades de las protenas 5


Los aminocidos com unes son qumicamente variados, pero todos ellos contie nen un grupo de cido carboxlico y un grupo amino, ambos unidos al mismo tomo de carbono (Figura 2-6). Se utilizan como subunidades en la sntesis de las protenas, que son largos polmeros lineales de aminocidos unidos cabezacola mediante un enlace peptdico entre el grupo carboxlico de un aminocido y el grupo amino del aminocido siguiente (Figura 2-7). Aunque existen muchos aminocidos posibles, en las protenas slo hay 20 aminocidos comunes, cada uno de ellos con una cadena lateral diferente unida al tomo de carbono a (Pa nel 2-5, pgs. 58-59). Estos mismos 20 aminocidos se presentan una y otra vez en todas las protenas, incluidas las producidas por las bacterias, las plantas y los animales. Aunque la seleccin de estos 20 aminocidos probablemente sea un ejemplo de un accidente evolutivo, la versatilidad qumica que proporcionan es de una importancia vital. Por ejemplo, 5 de los 20 aminocidos presentan cade nas laterales que pueden transportar una carga (Figura 2-8) mientras que los otros no estn cargados pero son reactivos de formas diferentes (Panel 2-5, pgs. 58-59). Como veremos, las propiedades de las cadenas laterales de los am inoci dos determinan las propiedades de las protenas y constituyen la base de las dis tintas y sofisticadas funciones desempeadas por ellas.
Lys

0=C
N -H

o=c

H - C - C H 2-C H 2-C H 2 -CH- -N -H 4 XH

extremo carboxilo de ia cadena

Figura 2-7 Pequea parte de una m olcula proteica, mostrando cuatro aminocidos. Cada aminocido est unido al siguiente mediante un enlace covalente que recibe el nombre de en lace p ep td ico. Uno de estos enlaces peptdicos se destaca sombreado de am arillo. Por lo tanto, las protenas se denominan a veces p olip p tid os. Las ca d en as laterales de los aminocidos se representan en rojo y los tomos de un aminocido (el cido glutmico) se destacan mediante el so m b rea d o gris.

48

Captulo 2 : Pequeas molculas, energa y biosntesis

h 2n

\ / c
NH

nh

13
nh2

(ch2)3

(CH2)4
11

HO HN

:N
\ / C I CHi
CH
nh3 +

H.-N

\ ^ C
NH

\H

(CH2)4

(CH2)3

PH

COOch2

CO O II ch2
ch2

t I t

I I
cooh ch2

I I
COOH
ch2 ch2

HC HN \ C

KH '

CH

ch2

Figura 2-8 La carga de las cadenas laterales de los aminocidos depende del pH. En solucin acuosa los cidos carboxlicos pierden fcilm ente un H+ , formando un ion de carga negativa que se nom bra m ediante el sufijo -a to , com o por ejemplo aspartafo o glutamafo. Con las aminas se produce una situacin parecida ya que en solucin acuosa toman H+formando un ion de carga positiva (que no recibe ningn nombre especial). Estas reacciones son rpidamente reversibles, y la cantidad presente de las dos formas, con carga y sin carga, depende del pH de la solucin. A un pH elevado, los cidos carboxlicos tienden a estar cargados y las aminas sin carga; a un pH bajo sucede lo contrario -lo s cidos carboxlicos carecen de carga y las aminas estn cargadas. El pH en el que estn cargados exactam ente la m itad de los residuos de cido carboxlico o amina, recibe el nom bre de pK del aminocido en cuestin. En la clula, el pH es prximo a 7, y casi todos los cidos carboxlicos y las aminas se encuentran en forma cargada.

cido asprtico pK~4,7

cido glutm ico pK~4,7

histidina pK~6,5

lisina pK~10,2

arginina pK~12

Los nucletidos son las subunidades del DNA y del RNA6


En los nucletidos, uno de los diversos compuestos cclicos que contienen nitr geno (denominados a menudo bases porque en soluciones cidas pueden com binarse con H+ ) est unido a un azcar de cinco carbonos (ribosa o desoxirribosa) que tambin contiene un grupo fosfato. Existe un claro parecido entre los dife rentes anillos nitrogenados de los nucletidos. La citosina (C), la timina (T) y el uracilo (U) reciben el nombre de pirimidinas puesto que todos ellos derivan de un anillo de pirimidina hexagonal; la guanina (G) y la adenina (A) son purinas, compuestas por un segundo anillo pentamrico unido al anillo hexamrico.
Figura 2-9 Estructura qum ica del adenosn trifosfato (ATP). Se muestra un modelo de espacios llenos (A), un modelo de bolas y varillas (B) y la frmula estructural (C). Ntese la presencia de cargas negativas en cada uno de los tres fosfatos.

^ P0

nO n\ /O
<| i H

Hv A r /NH, ii i N^ C Cx ; N
P H OH OH H

,
(C)

trifosfato

M ribosa_______ adenina adenosina

Los componentes qumicos de una clula

49

ENLACES DE HIDROGENO
D e b id o a q u e e s t n p o la r iz a d a s , d o s m o l c u la s d e a g u a a d y a c e n te ^ p u e d e n f o r m a r u n a u n i n c o n o c id a c o m o e n la c e d e h id r g e n o . Lo s e n la c e s d e h id r g e n o t ie n e n u n a fu e r z a d e a lr e d e d o r d e 1 /2 0 la d e u n e n la c e c o v a le n te . 0 ,1 0 4 n m e n la c e d e h id r g e n o 0 ,2 8 n m lo n g itu d e s d e e n la c e

enlace de hidrgeno
L o s e n la c e s d e h id r g e n o s o n m s f u e r te s c u a n d o lo s 3 t o m o s se e n c u e n tr a n e n ln e a re c ta .

e n la c e c o v a le n t e

ELAG UA
D o s t o m o s , c o n e c ta d o s p o r u n e n la c e c o v a le n te , p u e d e n e je r c e r a tra c c io n e s d if e r e n t e s s o b r e lo s e le c tr o n e s d e l e n la c e . En e s to s c a s o s el e n la c e e s d ip o la r , c o n u n e x t r e m o c a r g a d o lig e r a m e n t e n e g a t iv o (8~) y o tr o c a r g a d o lig e r a m e n t e p o s itiv o (5 + ). Lo s e n la c e s e n lo s q u e lo s d o s to m o s s o n ig u a le s o e je r c e n a tr a c c io n e s ig u a le s s o b r e lo s e le c tr o n e s s e d e n o m in a n n o p o la re s .

ESTRUCTURA DEL AGUA


Las m o l c u la s d e a g u a se u n e n e n tr e s t r a n s it o r ia m e n t e f o r m a n d o u n a re d a tr a v s d e e n la c e s d e h id r g e n o . In c lu s o a 3 7 C , un 1 5 % d e las m o l c u la s d e a g u a e s t n u n id a s c a d a u n a a a o tra s 4 , e n un e n s a m b la je d e v id a c o rta c o n o c id o c o m o " a g r u p a c i n o s c ila n te " .

region electropositiva

region electronegativa

A u n q u e u n a m o l c u la d e a g u a tie n e u n a c a rg a n e ta to ta l n e u tr a (p o r t e n e r el m is m o n m e r o d e p r o to n e s q u e d e e le c tro n e s ), s us e le c tro n e s e s t n d is tr ib u id o s d e f o r m a a s im tr ic a , lo c u a l h a c e q u e la m o l c u la s ea p o la r. El n c le o d e o x g e n o d e s p la z a a lo s e le c tro n e s d e lo s n c le o s d e h id r g e n o , d e j n d o lo a e s to s n c le o s c o n u n a p e q u e a c a rg a n e ta p o s itiv a . El e x c e s o d e d e n s id a d e le c tr n ic a s o b re el t o m o d e o x g e n o g e n e r a r e g io n e s d b ilm e n t e n e g a tiv a s c e rc a d e l t o m o d e o x g e n o e n lo s o tr o s d o s v r tic e s d e un t e tr a e d r o im a g in a r io .

La n a tu r a le z a c o h e s iv a d e l a g u a e s r e s p o n s a b le d e m u c h a s d e s u s p r o p ie d a d e s e x t r a o r d in a r ia s , ta le s c o m o la e le v a d a t e n s i n s u p e r f ic ia l, el a lto c a lo r e s p e c fic o y el e le v a d o c a lo r d e v a p o r iz a c i n

MOLECULAS HIDROFILICAS E HIDROFOBICAS


D e b id o a su n a t u r a le z a p o la r , la s m o l c u la s d e a g u a se a g r u p a n a lr e d e d o r d e lo s io n e s y d e o tr a s m o l c u la s p o la re s .

Las m o l c u la s n o p o la re s in t e r r u m p e n la e s tr u c tu r a d e l a g u a f o r m a d a p o r e n la c e s d e H , s in f o r m a r in te r a c c io n e s fa v o r a b le s c o n m o l c u la s d e a g u a . P o r lo t a n t o s o n h id r o f b ic a s y c a s i in s o lu b le s en ag u a.

Las m o l c u la s q u e p u e d e n a c o m o d a r s e e n e s tr u c tu r a s d e e s te t ip o , f o r m a d a s p o r m o l c u la s d e a g u a u n id a s p o r e n la c e s d e h id r g e n o , s o n h id r o f lic a s y r e la tiv a m e n t e s o lu b le s e n a g u a .

50

Panel 2-1 Propiedades qumicas del agua y su influencia sobre el comportamiento de las molculas biolgicas.

MOLCULAS HIDROFBICAS Y ESTRUCTURAS ACUOSAS

Las m o l c u la s q u e s o n n o p o la re s y n o p u e d e n f o r m a r e n la c e s d e h id r g e n o - c o m o los h i d r o c a r b o n o s - s lo t ie n e n u n a s o lu b ilid a d e n a g u a lim it a d a , y se d e n o m in a n h id r o f b ic a s . C u a n d o e s ta s m o l c u la s s e e n c u e n tr a n e n a g u a , se f o r m a n a su a lr e d e d o r e s tr u c tu r a s o r d e n a d a s d e m o l c u la s d e a g u a . E s ta s c a ja s s e m e ja n t e s a h ie lo s o n r e la tiv a m e n t e m s o r d e n a d a s q u e el a g u a lib r e y g e n e r a n u n a d is m in u c i n d e e n tr o p a d e l m e d io . En la f ig u r a se m u e s tr a p a r te d e u n a d e e s ta s e s tr u c tu r a s (e n rojo) a lr e d e d o r d e u n h id r o c a r b o n o (e n negro). E n la e s tr u c tu r a in ta c ta c a d a t o m o d e o x g e n o

(c rc u lo s rojos) p u e d e e s ta r c o o r d in a d o
t e t r a d r ic a m e n t e c o n o tr o s c u a tro .

___________

E s te m o v im ie n t o d e l a g u a d e s d e u n a s o lu c i n h ip o t n ic a a u n a s o lu c i n h ip e r t n ic a , p u e d e p r o v o c a r u n a u m e n t o d e la p r e s i n h id r o s t tic a e n el c o m p a r t i m i e n t o h ip e r t n ic o . D o s s o lu c io n e s q u e t e n g a n c o n c e n t r a c io n e s id n tic a s d e s o lu to s , es d e c ir , q u e s e a n o s m t ic a m e n t e e q u ilib r a d a s , s e d ic e q u e s o n is o t n ic a s .

51

ESQUELETOS CARBONADOS
El p a p e l c a r a c te r s tic o d e l c a r b o n o e n la c lu la s e d e b e a su c a p a c id a d d e f o r m a r e n la c e s c o v a le n te s c o n o tr o s t o m o s d e c a r b o n o . A s , lo s to m o s d e c a r b o n o se p u e d e n u n ir f o r m a n d o c a d e n a s . o e s tr u c tu r a s r a m if ic a d a s

C\

c C / \ c c

/ C

representado tambin como

representado tambin como

representado tambin como

ENLACES COVALENTES
U n e n la c e c o v a le n te s e f o r m a c u a n d o d o s to m o s se a c e rc a n s u fic ie n te m e n te y c o m p a r te n u n o o m s d e sus e le c tro n e s . En un e n la c e s e n c illo se c o m p a r te un e le c tr n d e c a d a u n o d e los d o s to m o s ; e n un e n la c e d o b le se c o m p a r t e n un to ta l d e c u a tro e le c tro n e s . C a d a to m o f o r m a un n m e r o d e te r m in a d o d e e n la c e s c o v a le n te s , s ig u ie n d o u n a d is tr ib u c i n e s p a c ia l d e fin id a . P o r e je m p lo , el c a r b o n o f o r m a c u a tro e n la c e s s e n c illo s d is tr ib u id o s h a c ia los v r tic e s d e un t e t r a e d r o m ie n t r a s q u e el n itr g e n o f o r m a tr e s e n la c e s s e n c illo s y el o x g e n o f o r m a d o s e n la c e s s e n c illo s , d is tr ib u id o s c o m o se m u e s tr a e n e s te p a n e l. D o s to m o s u n id o s p o r d o s o m s e n la c e s c o v a le n te s n o p u e d e n ro ta r lib r e m e n te a lr e d e d o r d e l e je d e l e n la c e E sta re s tric c i n c o n s titu y e el fa c to r lim ita n te p rin c ip a l s o b re la d is tr ib u c i n t r id im e n s io n a l d e m u c h a s m a c r o m o l c u la s .

HIDROCARBUROS

El c a r b o n o y el h id r g e n o f o r m a n ju n to s u n o s c o m p u e s to s e s ta b le s d e n o m in a d o s h id r o c a r b u ro s . S o n n o p o la re s , n o f o r m a n e n la c e s d e h id r g e n o y , p o r lo g e n e r a l, s o n in s o lu b le s e n a g u a .

H H C H H C H

Los d o b le s e n la c e s t ie n e n u n a d is tr ib u c i n e s p a c ia l d ife r e n te .

metano

grupo metilo

RESONANCIA Y AROMATICIDAD
La c a d e n a d e c a r b o n o s p u e d e n in c lu ir d o b le s e n la c e s . S i s to s s e e n c u e n tr a n e n t o m o s d e c a r b o n o s a lte r n o s , lo s e le c tr o n e s d e e n la c e s e m u e v e n d e n tr o d e la m o l c u la , e s t a b iliz a n d o la e s tr u c tu r a e n un f e n m e n o c o n o c id o c o m o r e s o n a n c ia . C u a n d o se p r o d u c e r e s o n a n c ia en un c o m p u e s t o c c lic o , se g e n e r a un a n illo a r o m t ic o .

C=

C=C

c= c

la e s tr u c tu r a v e r d a d e r a se h a lla e n tr e e s ta s d o s

\ / cc

representado a menudo como

parte de la cadena de un cido graso

52

Pane! 2-2 Enlaces y grupos qumicos frecuentes en las molculas biolgicas.

COMPUESTOS C O
M u c h o s c o m p u e s to s b io l g ic o s c o n tie n e n un c a r b o n o u n id o a u n o x g e n o . P o r e je m p lo : a lc o h o l

COMPUESTOS C N
Las a m in a s y a m id a s s o n d o s im p o r t a n t e s e je m p lo s d e c o m p u e s t o s q u e c o n t ie n e n u n c a r b o n o u n id o a u n n it r g e n o . En a g u a , la s a m in a s se c o m b in a n c o n un io n H + y q u e d a n El O H re c ib e el n o m b r e d e g r u p o h id r o x ilo . c a r g a d a s p o s it iv a m e n t e .

H -C OH H

----- C N

a ld e h id o

II \ H

+ H+ ;

-C N H1

I \H

P o r c o n s ig u ie n t e , s o n b s ic a s . El C = 0 r e c ib e el n o m b r e c e to n a d e g r u p o c a r b o n ilo . Las a m id a s se f o r m a n p o r la c o m b in a c i n d e u n c id o y u n a a m in a . S o n m s e s ta b le s q u e lo s s te r e s . A d if e r e n c ia d e las a m in a s , e n s o lu c i n a c u o s a n o p o s e e n c a r g a . U n e je m p lo lo c o n s t it u y e el e n la c e p e p td ic o .

c=o
./
cid o c a r b o x lic o

O
OH

O
El C O O H r e c ib e el n o m b r e d e g r u p o c a r b o x ilo . E n el a g u a p ie r d e un i n H + y se c o n v ie r te e n C O C T .

/
OH
h 7n

0
c

H, 0

"n c 1 I
H 1

L o s s te r e s e s t n f o r m a d o s p o r la c o m b in a c i n d e u n c id o y u n a lc o h o l:

El n it r g e n o s e p r e s e n ta t a m b i n e n d iv e r s o s c o m p u e s t o s c c lic o s : p u r in a s y p ir im id in a s

I '-<

o + !
OH HO C-

-C C

O
+ H, 0

NH, ,H
c ito s in a (u n a p ir im id in a )

o C O
s te r

'H

c id o

a lc o h o l

FOSFATOS
El fo s fa to in o r g n ic o e s u n io n e s ta b le f o r m a d o a p a r t ir d e l c id o fo s f r ic o , H 3 P 0 4. A m e n u d o se r e p r e s e n ta c o m o P. S e p u e d e n f o r m a r s te r e s fo s f a t o e n t r e un fo s f a t o y u n g r u p o h id r o x ilo lib re .

O P O OH

O"

La c o m b in a c i n d e u n fo s f a to y u n g r u p o c a r b o x ilo , o d e d o s o m s g r u p o s fo s f a t o , d a lu g a r a u n a n h d r id o c id o .

tambin representado como

n1 O

C OH +

H ,0

53

O I I

H O pO "

| - C o PO 1 1
i

tambin representado como

HEXOSAS n = 6
Las h e x o s a s m s c o m u n e s son

MONOSACARIDOS
L o s m o n o s a c r id o s s o n a ld e h id o s o c e to n a s

PENTOSAS n = 5
U n a p e n to s a f r e c u e n t e es

glucosa H C H C OH HO C H H C OH H C OH H C OH H

.O
-C' H

c=o

H
\ ^

O C

q u e t ie n e n t a m b i n d o s o m s g r u p o s d e

h id r o x ilo . S u f r m u la g e n e r a l e s (C H 20 ) n - Los m s s im p le s s o n las tr io s a s (n = 3 ) t a le s c o m o

H C OH
I

\
C

O
-

H C OH H C OH
I

H C OH H C -OH
I

I I

H CH2OH
g lic e r a ld e h d o (u n a a ld o s a ) rib o s a

CH2OH

c= o
D-glucosa (form a de cadena abierta)
(> c h 2o h d ih id r o x ia c e t o n a (u n a c e to s a )

D-ribosa (forma de cadena abierta)

CH2OH H 4C

5c -

-OH
1 /

> CH2OH H .OH

1// H \OH c'3


H
-C 2

FORMACIN DEL ANILLO


O El g r u p o a ld e h id o o c e to n a d e u n a z c a r p u e d e r e a c c io n a r c o n u n g r u p o h id r o x ilo .

4 H ]COH

1/

\?

OH

-c 1 2

V /c \

H +

OH

// / / c -------- 0 H / \ OH 1/ H \ 1 \ \? 1 H HO 1 H
1

\ ;\?h r
1 1 H

HO C -------- - C OOH CH tOH

O -O

CH ,OH I z

?1/ / 'H 1 OH

H-

En los a z c a re s m a y o r e s (n > 4 ) , e s to p u e d e o c u r r ir d e n t r o d e la m is m a

/
H C* V H OH OH

\
CH2OH
J -

vi C
OH OH

m o l c u la , f o r m n d o s e un a n illo d e 5 o 6 m ie m b r o s .

SISTEMA DE NUMERACIN
L o s t o m o s d e c a r b o n o d e un a z c a r se n u m e r a n a p a r t ir d e l e x t r e m o m s c e r c a n o al a ld e h id o o la c e to n a .

f\!?

C |_i \> u -

s. \

H i I 0 0 -

OH

OH

P-D-glucosa

a -D -c

|3- D-ribosa

cx-D-ribosa

E S T E R E O IS O M E R O S

E S T E R E O IS M E R O S

ISMEROS
Lo s m o n o s a c r id o s t ie n e n m u c h o s is m e r o s q u e n ic a m e n t e se d if e r e n c ia n e n la o r ie n ta c i n d e s u s g r u p o s h id r o x ilo - p o r e je m p lo , la g lu c o s a , la g a la c to s a y la m a o s a s o n is m e r o s e n tr e s.

FO RM AS d

D o s is m e r o s q u e s e a n im g e n e s e s p e c u la r e s u n o d e l o tr o t ie n e n las m is m a s p r o p ie d a d e s q u m ic a s y p o r e llo r e c ib e n el m is m o n o m b r e , d is t in g u i n d o lo s m e d ia n t e e l p r e f ijo d o l .

CH tOH CH,OH HO OH OH HO CH,OH

-o

OH

D-glucosa

.17

Ir
;

:: : .

glucosa

OH ,-H O OH

plano especular
HO OH HO OH OH
a

m
III

L-glucosa

54

Panel 2-3 Algunos de los tipos de azcares encontrados habitualmente en las clulas.

ENLACES a Y (3
El g r u p o h id r o x ilo d e l c a r b o n o q u e p r e s e n te el a ld e h id o o la c e to n a p u e d e p a s a r r p id a m e n t e d e u n a p o s ic i n a o tr a . E s ta s d o s p o s ic io n e s r e c ib e n el n o m b r e d e a y (3.

DERIVADOS DE LOS AZCARES


Lo s g r u p o s h id r o x ilo d e u n m o n o s a c r id o s im p le p u e d e n s e r s u s titu id o s p o r o tr o s g r u p o s . P o r e je m p lo :

CH ,OH COOH

-O
OH.

hidroxilo (3

hidroxilo a
OH
E n c u a n t o u n a z c a r se u n e a o tr o , se c o n g e la la f o r m a a o [3.

DISACARIDOS
El c a r b o n o q u e lle v a el g r u p o a ld e h id o o c e to n a p u e d e r e a c c io n a r c o n c u a lq u ie r g r u p o h id r o x ilo d e o tr a m o l c u la , f o r m a n d o u n e n la c e g lu c o s d ic o . T r e s d is a c r id o s fr e c u e n t e s s o n la m a lto s a (g lu c o s a a 1 , 4 g lu c o s a ), la la c to s a (g a la c to s a p 1 ,4 g lu c o s a ) y la s a c a ro s a (g lu c o s a 1 ,2 fr u c to s a ). La s a c a r o s a se m u e s tr a e n la fig u r a .

a-D-glucosa

CH )OH

sacarosa (glucosa a1,2 fructosa)

OH

OH

OLIGOSACARIDOS Y POLISACRIDOS
C o n u n id a d e s s im p le s r e p e t it iv a s s e p u e d e n f o r m a r g r a n d e s m o l c u la s lin e a le s y r a m ific a d a s . Las c a d e n a s c o r ta s re c ib e n el n o m b r e d e o lig o s a c r id o s , m ie n t r a s q u e las c a d e n a s la r g a s se d e n o m in a n p o lis a c r id o s . El g lu c g e n o , p o r e je m p lo , es un p o lis a c r id o f o r m a d o e n t e r a m e n t e p o r u n id a d e s d e g lu c o s a .

se producen enlaces a1,6 en los puntos de ram ificacin

OLIGOSACRIDOS COMPLEJOS
H C
En m u c h o s c a s o s , u n a s e c u e n c ia d e a z c a re s es n o r e p e titiv a . S o n p o s ib le s m u c h a s m o l c u la s d if e r e n te s . T a le s o lig o s a c r id o s c o m p le jo s s u e le n e s ta r u n id o s a p r o t e n a s o a lp id o s .

CH )OH CHtOH CH,OH

un oligosacrido de grupo sanguneo


OH

55

ACIDOS GRASOS FRECUENTES


S e t r a t a d e c id o s c a r b o x lic o s c o n u n a la r g a c o la h id r o c a r b o n a d a .

E x is te n c e n t e n a r e s d e tip o s d is tin to s d e c id o s g r a s o s . A lg u n o s t ie n e n u n o o m s d o b le s e n la c e s y se d ic e q u e s o n in s a tu r a d o s .

COOH

COOH

COOH

E s te d o b le e n la c e o r ig in a u n a in c lin a c i n e n la c a d e n a h id r o c a r b o n a d a . El re s to d e la c a d e n a p u e d e g ir a r lib r e m e n t e a tr a v s d e lo s o tr o s e n la c e s

cido oleico

cido esterico

m odelo espacial de espacio lleno

esqueleto carbonado

TRIGLICERIDOS

Lo s c id o s g r a s o s s e a lm a c e n a n c o m o r e s e r v a e n e r g tic a (g r a s a ) m e d ia n t e su u n i n al g lic e r o l f o r m a n d o tr ig lic r id o s .

cido palm tico


(Ce)

cido esterico
(Ca)

cido oleico
(C 18)

glicerol

GRUPO CARBOXILO

FOSFOLIPIDOS

Lo s f o s f o lp id o s s o n lo s c o n s t it u y e n t e s p r in c ip a le s d e las m e m b r a n a s c e lu la r e s .

S i e s t lib r e , el g r u p o c a r b o x ilo d e u n c id o g r a s o s e io n iz a .

un fosfolpido

P e ro c o n m a y o r fr e c u e n c ia e s t u n id o a o tr o s g r u p o s f o r m a n d o s te r e s

m odelo de espacio lleno de la fosfatidilcolina


En los fo s fo lp id o s , d o s d e los g ru p o s - O H del g lic e ro l e st n u n id o s a c id o s g ra s o s , m ie n tr a s q u e

"colas" hidrofbicas de cido graso

el te rc e r g ru p o - O H e st u n id o al c id o fo s f ric o . El fo s fa to e st u n id o a d e m s a un p e q u e o g ru p o p o la r (a lc o h o le s ) d e e n tre v a rio s p o s ib le s .

56

Panel 2-4 Algunos de los tipos de cidos grasos encontrados habitualmente en las clulas y las estructuras que forman.

AGREGADOS LIPIDIOOS
Lo s c id o s g r a s o s t ie n e n u n a c a b e z a h id r o flic a y u n a c o la h id r o f b ic a .

POLI ISOPRE NOI DES


la r g o s p o lm e r o s lin e a le s d e is o p r e n o

En el a g u a p u e d e n f o r m a r u n a p e lc u la s u p e r fic ia l o p e q u e a s m ic e la s .

S u s d e r iv a d o s p u e d e n f o r m a r g r a n d e s a g r e g a d o s u n id o s p o r fu e r z a s h id r o f b ic a s : L o s t r ia c ilg lic r id o s f o r m a n g r a n d e s g o ta s e s f r ic a s e n el c ito p la s m a c e lu la r . Lo s fo s fo lp id o s y g lu c o lp id o s f o r m a n b ic a p a s lip d ic a s q u e se c ie r ra n s o b r e s m is m a s y c o n s t it u y e n la b a s e d e to d a s las m e m b r a n a s c e lu la r e s .

o mas

OTROS LIPIDOS

Lo s lp id o s se d e f in e n c o m o c o m p u e s t o s s o lu b le s e n d is o lv e n te s o r g n ic o s . O tr o s d o s tip o s fr e c u e n te s d e lp id o s s o n lo s e s te r o id e s y lo s p o liis o p r e n o id e s . A m b o s e s t n f o r m a d o s p o r u n id a d e s d e is o p r e n o . is o p r e n o

L o s e s t e r o id e s tie n e n u n a e s tr u c tu r a c o m n f o r m a d a p o r m ltip le s a n illo s .

c o le s t e r o l p r e s e n te e n m u c h a s m e m b r a n a s

te s t o s t e r o n a h o r m o n a e s t e r o id e m a s c u lin a

GLUCOLIPIDOS
A l ig u a l q u e lo s f o s f o lp id o s , e s to s c o m p u e s to s e s t n f o r m a d o s p o r u n a r e g i n h id r o f b ic a , q u e c o n tie n e d o s la r g a s c o la s h id r o c a r b o n a d a s , y u n a r e g i n p o la r , q u e c o n tie n e e n e s te c a s o u n o o m s r e s id u o s d e a z c a r, p e r o n o fo s fa to . galactosa

OH
azcar d o lc o l f o s f a t o u t iliz a d o p a ra t r a n s p o r t a r lo s a z c a re s a c tiv a d o s d u r a n t e la s n te s is a s o c ia d a a m e m b r a n a d e las g lu c o p r o t e n a s y d e a lg u n o s p o lis a c r id o s .

I H H

C-NH
r e g i n h id r o f b ic a

u n g lu c o lp id o s im p le

57

EL AMINOACIDO
La f r m u la g e n e r a l d e un a m in o c id o es

ISOMEROS OPTICOS tom o de carbono a

El t o m o d e c a r b o n o a e s a s im t r ic o , p o r lo q u e e x is te n d o s is m e r o s e s p e c u la r e s (o e s t e r e o is m e r o s ) , d y l .

grupo am ino

..... grupo carboxilo grupo de cadena lateral

H a b it u a lm e n t e R e s u n a c a d e n a la te r a l d e e n tr e 2 0 p o s ib le s . A p H 7 el g r u p o a m in o y el g r u p o c a r b o x ilo e s t n io n iz a d o s .

Las p r o te n a s c o n s ta n e x c lu s iv a m e n t e d e a m in o c id o s l.

ENLACES PEPTIDICOS
H a b it u a lm e n t e , lo s a m in o c id o s e s t n u n id o s p o r u n e n la c e a m id a d e n o m i n a d o e n la c e p e p td ic o . e n la c e p e p td ic o : lo s c u a tr o t o m o s d e c a d a re c u a d ro g ris f o r m a n u n a u n id a d p la n a r g id a . N o e x is te lib e r t a d d e r o ta c i n a lr e d e d o r d e l e n la c e C N .

L a s p r o te n a s s o n la r g o s p o lm e r o s d e a m in o c id o s u n id o s p o r e n la c e s p e p td ic o s y s ie m p r e s e e s c r ib e n c o n el e x t e m o /V -te r m in a l h a c ia la iz q u ie r d a . La s e c u e n c ia d e e s te t r ip p t id o e s H is C y s V a l.

extrem o am ino o A/-terminal


\

extrem o carboxilo o C-terminal

E s to s d o s e n la c e s s e n c illo s , a c a d a la d o d e la u n id a d p e p td ic a r g id a , t ie n e n u n a lto g r a d o d e lib e r t a d d e r o ta c i n .

FAMILIAS DE AMINOCIDOS

CADENAS LATERALES BASICAS


lis in a a r g m in a

histidina

Lo s a m in o c id o s c o m u n e s s e c la s ific a n s e g n si s u s c a d e n a s la t e r a le s s o n c id a s b s ic a s p o la re s n o c a r g a d a s n o p o la re s E s te g r u p o e s m u y E s to s 2 0 a m in o c id o s se p u e d e n a b r e v ia r d e d o s f o r m a s : p o r m e d io d e t r e s le tr a s y p o r m e d io d e u n a s o la le tra . A s : a la n in a = A la = A b s ic o , y a q u e su c a r g a p o s itiv a e s t e s ta b iliz a d a po r r e s o n a n c ia .^ E s to s n itr g e n o s tie n e n u n a a fin id a d r e la t iv a m e n t e d b il p o r e l H + y s lo s o n p a r c ia lm e n t e p o s itiv o s a p H n e u tr o .

58

Panel 2-5 Los 20 aminocidos que intervienen en la sntesis de las protenas.

m Km iaim^lfim-

CADENAS LATERALES CIDAS


c id o a s p r tic o (A s p o D ) c id o g lu t m ic o (G lu o E)

CADENAS LATERALES NO POLARES


H O

N C C
H

I I

g lic in a (G ly o G )

H
1

O
II

H
1

O n
1 II

-n

-z

N C C H
CH2

a la n in a (A la o A )

v a lin a (V a l o V )

CH,
CH, 1

C
\

O O

C
\

I I I N C C
O
H CH ;

N C C H

I I

CH ,

/ \

CH

CH,

Los a m in o c id o s c u y a s c a d e n a s la te ra le s n o p o la re s no c a r g a d a s s o n r e la tiv a m e n te h id r o flic o s y n o r m a lm e n te se s it a n e n el e x t e r io r d e las p r o te n a s , m ie n tr a s q u e las c a d e n a s la te ra le s d e a m in o c id o s n o p o la re s tie n d e n a a g r e g a r s e e n el in te r io r d e las p r o te n a s . Los a m in o c id o s c o n c a d e n a s la te ra le s c id a s s o n m u y p o la re s y casi s ie m p r e se h a lla n e n la s u p e r fic ie d e las m o l c u la s p ro te ic a s . El c d ig o d e u n a le tra , e n o r d e n a lfa b tic o :

le u c in a (L e u o L)

is o le u c in a (lle u o I)

N C C H
CH2

N C C H

A = A la C = C ys D= A sp E = G lu F = Phe

G= H= K= L=

G ly H is Lys L eu

1 = lle u

M= M et N = A sn P = P ro Q = G ln
R = A rg

S= T=

Ser Thr

CH3

/ \

CH

CH, CH,

/ \

CH

CH, CH,

V = Val

W = T rp Y = Tyr

p r o lin a (P ro o P)

CADENAS LATERALES POLARES NO CARGADAS


a sp a ra g m a (A s n o N )

N C C
CH,

I I

\
CH,

CH,

(en realidad es un im inocido)

m e t io n in a (M e t o M )

I I I N C C I I
II CH , CH,
A u n q u e la a m id a N n o e s t c a r g a d a a u n p H n e u tr o , es p o la r. s e r in a ( S e r o S)

s ch3

N C C

I I

c is te n a (C y s o C)

CH2 SH

Las c is te rn a s a p a r e a d a s p e r m it e n q u e se f o r m e n e n la c e s d is u lf u r o e n las p r o te n a s .

----- CH2 S S CH2-----

* mSM SSm

i* S

- ' !
59

u r a c lo Las b a s e s s o n c o m p u e s t o s c c lic o s c o n N y a s e a n p u rin a s o p ir im id in a s .

c ito s in a

g u a n in a t im in a P IR IM ID IN A

PURINA

FOSFATOS
N o r m a lm e n t e lo s fo s fa to s e s t n u n id o s al h id r o x ilo C 5 d e la rib o s a o d e la d e s o x ir r ib o s a . S o n fr e c u e n t e s los m o n o f o s f a t o s , d ifo s fa to s y t r ifo s fa to s .

NUCLEOTIDOS
U n n u c le t id o c o n s is te e n u n a b a s e n itr o g e n a d a , un a z c a r d e 5 c a r b o n o s y u n o o v a r io s g r u p o s fo s fa to .

ENLACE BASE-AZCAR

e n la c e BASE A /-g lu c o s d ic o

c o m o en el A M P FO SFATO

c o m o en el A D P

AZCAR

com o en el S o n las s u b u n id a d e s d e lo s cidos n u c le ic o s . El f o s f a t o h a c e q u e un n u c le tid o e s t c a r g a d o n e g a t iv a m e n t e . La b a s e e s t u n id a al m is m o c a r b o n o (C 1 ) u tiliz a d o e n lo s e n la c e s a z c a r-a z c a r. ATP

AZCAR

AZUCARES
HOCH

p -D -R IB O S A u tiliz a d a e n el c id o r ib o n u c le ic o

un a z c a r de 5 c a rb o n o s

HOCH
-D -2 -D E S O X IR R IB O S A C a d a u n o d e lo s c a r b o n o s n u m e r a d o s d e u n a z c a r se e s c r ib e c o n u n a " p r im a " ; a s h a b la m o s d e " c a r b o n o 5 - p r im a " , e tc. u tiliz a d a e n el c id o d e s o x ir r ib o n u c le ic o

60

Panel 2-6 Resumen de los principales tipos de nucletidos y sus derivados existentes en las clulas.

NOMENCLATURA

Lo s n o m b r e s p u e d e n in d u c ir a c o n fu s i n , p e r o las a b r e v ia t u r a s s o n c la ra s .

BASE a d e n in a g u a n in a c ito s in a u r a c ilo tim in a

N U C L E O S ID O a d e n o s in a g u a n o s in a c itid in a u r id in a tim id in a

ABREV. A G C U T

Lo s n u c le tid o s se a b r e v ia n c o n tr e s le tr a s m a y s c u la s , d e la s ig u ie n t e m a n e r a : BASE + A Z C A R = AMP UDP ATP = a d e n o s in a m o n o f o s f a t o = u r id in a d ifo s fa to = a d e n o s in a tr if o s f a t o

NUCLEOSIDO

d A M P = d e s o x ia d e n o s in a m o n o f o s f a t o

BASE + A Z C A R + FO SFA TO =

NUCLEOTIDO

ACIDOS NUCLEICOS
L o s n u c le t id o s e s t n u n id o s m e d ia n te u n e n la c e fo s f o d i s t e r e n tr e lo s c a r b o n o s 5' y 3 ', f o r m a n d o c id o s n u c le ic o s . La s e c u e n c ia lin e a l d e lo s n u c le tid o s d e u n a c a d e n a d e c id o n u c le ic o s e s u e le a b r e v ia r m e d ia n t e u n c d ig o d e u n a le tr a , A G C T T A C A , c o n el e x t r e m o 5 ' d e la c a d e n a a la iz q u ie r d a .

LOS NUCLETIDOS TIENEN OTRAS MUCHAS FUNCIONES

T r a n s p o r t a n e n e r g a e n s u s e n la c e s c id o - a n h d r id o , q u e s o n f c ilm e n t e h id r o liz a b le s .

NH ;

e je m p o : A T P (o Q Q )

OH

OH

OH

+ O
"O P o c h 2

S e c o m b in a n c o n o tr o s g r u p o s f o r m a n d o c o e n z im a s .

N H

o-

,o.

H ( II, H

H S -C - C - N - C - C - C - N - C - C - C C - O P ~ 0 P O CH2 OH H H H H H IH HO CH, H O O

extem o 5' O la cadena

e je m p lo : c o e n z im a A (C o A )

base
3

OH

OH

E n la c lu la s o n u tiliz a d o s c o m o m o l c u la s s e a liz a d o r a s e s p e c fic a s .

NH,
e n la c e f o s f o d i s t e r e je m p lo : A M P c c lic o ( c A M P )

O ------- CH

e je m p lo : D N A

o=pexterno 3' de la cadena


3' OH O"

OH

61

Cada nucletido se nom bra en referencia a la nica base que contiene (Panel 26, pgs. 60-61). Los nucletidos pueden actuar como transportadores de energa qumica. Destaca el ster trifosfato de adenina, ATP (Figura 2-9}, que participa en la trans ferencia de energa en cientos de reacciones celulares distintas. Su fosfato termi nal se aade utilizando la energa de la oxidacin de los alimentos, y puede ser fcilmente separado por hidrlisis liberando energa, la cual es utilizada en cual quier lugar de la clula en reacciones biosintticas energticamente desfavora bles. Como discutiremos ms adelante, otros derivados de nucletidos actan de transportadores de grupos qumicos particulares como tomos de hidrgeno o residuos de azcar, desde una molcula a otra. Adems, un derivado cclico de la adenina que contiene fosfato, el se utiliza como molcula univer sal de sealizacin dentro de las clulas y controla la velocidad de numerosas re acciones intracelulares diferentes. La importancia especial de los nucletidos estriba en el almacenamiento de la informacin biolgica. Los nucletidos constituyen los elementos de cons truccin de los cidos nucleicos, largos polmeros en los que las subunidades de nucletidos estn unidas covalentemente gracias a la formacin de un ster fos fato entre el grupo hidroxilo 3' del residuo de azcar de un nucletido y el grupo fosfato 5 del nucletido siguiente (Figura 2-10). Existen dos tipos principales de cidos nucleicos que se diferencian en el tipo de azcar de su esqueleto polim rico. Los que se basan en el azcar reciben el nombre de cidos ribonu cleicos, o RNA, y contienen las bases A, U, G y C. Los que se basan en la (en la que el hidroxilo de la posicin 2 de la ribosa est sustituido por un hidrgeno) se denominan cidos desoxfrribonucleicos, o DNA y contienen las bases A, T, G y C. La secuencia de las bases de un polmero de DNA o RNA repre senta la informacin gentica de la clula viva. La capacidad de las bases de dife rentes molculas de cido nucleico para reconocerse unas a otras mediante in teracciones no covalentes (denominadas apareamiento de bases) -G con C y A con T (en el DNA) o con U (en el RNA)- constituye, tal como se explicar en el Captulo 3, la base de toda la herencia y la evolucin.

extrem o b' de la cadena


O

AMP cclico,

O PO

ribosa

rribosa

desoxi-

o
O P = o

Resumen

Los organismos vivos son sistemas qumicos autnomos, que se autopropagan. Es tn formados por un conjunto caracterstico pero limitado de pequeas molculas basadas en el carbono que esencialmente son las mismas en todas las especies vi vientes. Las principales categoras son: azcares, cidos grasos, aminocidos y nu cletidos. Los azcares constituyen una fuente primaria de energa qumica para las clulas y son incorporados a polisacridos para el almacenamiento de energa. Los cidos grasos son tambin importantes para el almacenamiento de energa, pero su Juncin ms significativa estriba en la formacin de las membranas de la clula. Los polmeros formados por aminocidos constituyen macromolculas notablemente diversas y verstiles conocidas como protenas. Los nucletidos desempean un pa pel central en la transferencia de energa y tambin son las subunidades a partir de las cuales se construyen las macromolculas de informacin, RNA y DNA. Orden biolgico y energa7
Las clulas han de obedecer las leyes de la fsica y de la qumica. Las reglas de la mecnica y de la transformacin de una forma de energa en otra se aplican a una clula igual que a una mquina de vapor. Sin embargo, es necesario admitir que una clula tiene unos rasgos asombrosos que, a primera vista, parecen colo carla en una categora especial. Es bien conocido que con el tiempo las cosas abandonadas a su suerte pasan a quedar desordenadas: los edificios se derrum ban, los organismos muertos se descomponen, etc. Esta tendencia general se 62 Captulo 2 : Pequeas molculas, energa y biosntesis

extrem o 3' de la cadena


Figura 2-10 Un breve fragmento de cido desoxirribonuclelco (DNA) de cuatro nucletidos. Uno de tos

enlaces fosfodister, que une nucletidos adyacentes, se destaca en amarillo y uno de los nucletidos se destaca sombreado en gris. El DNA y su pariente prximo el RNA son los cidos nucleicos de la clula.

halla expresada en la segunda ley de la termodinmica, que afirma que el grado de desorden del universo (o de cualquier sistema aislado) slo puede aumentar. Lo asombroso es que los organismos vivos mantienen, a todos los niveles, un alto grado de orden; y como se alimentan, se desarrollan y crecen, parece que crean este orden a partir de materiales alimenticios que carecen de l. El orden resulta claramente aparente en grandes estructuras como el ala de una mariposa o el ojo de un pulpo, en estructuras intracitoplasmticas como una mitocondria o un cilio, o en la forma y disposicin de las molculas a partir de las que estn construidas estas estructuras. Los tomos que las constituyen han sido captura dos, en ltimo trmino, desde su estado relativamente desorganizado del medio ambiente y unidos formando una estructura determinada. Incluso una clula que no crezca, requiere para sobrevivir unos procesos constantes de ordena cin, puesto que todas sus estructuras organizadas estn sujetas a alteraciones y deben ser reparadas continuamente. Cmo es esto posible desde el punto de vista termodinmico? Veremos que la respuesta se halla en el hecho de que la clula emite constantem ente calor a su ambiente y, por consiguiente, no es un sistema aislado en el sentido termodinmico del trmino.

entorno

clula
/

El orden biolgico resulta posible gracias a la liberacin de energa calorfica por parte de las clulas 8
Como acabamos de ver, la segunda ley de la termodinmica afirma que la canti dad de orden del universo (es decir, de la clula ms su entorno) siempre debe disminuir. Por consiguiente, el aumento de orden dentro de la clula viva ha de ir acompaado de un aumento an mayor de desorden en el ambiente de la clula. El calor es energa en su forma ms desordenada -e l choque al azar de las m o lculas- y la clula cede calor al medio m ediante reacciones que ordenan las molculas que la clula contiene. El increm ento del movimiento al azar, inclui das las distorsiones de los enlaces, de las molculas del resto de universo genera un desorden que com pensa con creces el incremento de orden en la clula, tal com o requieren las leyes de la termodinmica para los procesos espontneos. De esta forma, la liberacin de calor de una clula al medio le permite ordenarse internamente al mismo tiempo que el universo en su conjunto se vuelve ms des ordenado (Figura 2-11). Es importante precisar que la clula no consigue nada produciendo calor a menos que las reacciones productoras de calor estn asociadas con los procesos que generan orden molecular en la clula. Se dice que las reacciones asociadas de esta forma estn acopladas, tal como explicaremos ms adelante. Lo que dis tingue el metabolismo de una clula de la combustin ruinosa de un fuego es el estrecho acoplamiento que existe entre la produccin de calor y el increm en to de orden. La generacin de orden en el interior de las clulas se produce a expensas de la degradacin de combustible energtico. Para las plantas la energa deriva ini cialmente de la radiacin electromagntica del sol; para los animales deriva de la energa almacenada en los enlaces covalentes de las molculas orgnicas que ingieren. Sin embargo, com o estos nutrientes han sido producidos, a su vez, por organismos fotosintetizadores como las plantas verdes, de hecho el sol es la fuente ltima de energa para ambos tipos de organismos.

/ *

'

P *~m

. 1

X f iV i i 1 ^ z1 W

v /

/ *

<

% IIIc a lo r ) m
p f^V V 1
.

Los organismos fotosintetizadores utilizan la luz solar para sintetizar compuestos orgnicos 9
La energa solar entra en el mundo vivo (la biosfera ) gracias a la fotosntesis que realizan los organismos fotosintetizadores -plantas o bacterias. En la fotosnte sis, la energa electromagntica se transforma en energa de enlace qumico. Al mismo tiempo, una parte de la energa de la luz solar se transforma en energa calorfica, y la liberacin de este calor al entorno increm enta el desorden del universo y, por consiguiente, impulsa el proceso fotosinttico. Orden biolgico y energa

Figura 2-11 Anlisis term odinm ico simple de una clula viva. En el esquema superior las molculas de la clula y del resto del universo (su entorno) se han representado en un estado relativamente desordenado. En el esquema inferior, la clula (gris) ha liberado calor por medio de una reaccin que ordena las molculas de su interior {verde). El calor incrementa el desorden en el entorno de la clula, de forma que aunque la clula crezca y se divida se cumple el segundo principio de la termodinmica.

63

Las reacciones de la fotosntesis se describen con detalle en el Captulo 14. En trminos generales, podemos decir que se pueden distinguir dos etapas distintas. En la primera etapa (la de las reacciones activadas por la luz o fase luminosa), la ra diacin visible captada por una molcula de pigmento impulsa la transferencia de electrones desde el agua hasta el NADPH, y al mismo tiempo proporciona la ener ga necesaria para la sntesis de ATP. En la segunda (la fase oscura), el ATP y el NADPH se utilizan para impulsar una serie de reacciones de fijacin de carbono', en las que el C 0 2 del aire se utiliza para formar molculas de azcar (Figura 2-12), El resultado neto de la fotosntesis, en lo que se refiere a la planta verde, se puede resumir en la siguiente ecuacin: energa + C 0 2 + H20 azcar + 0 2 Esta ecuacin simple esconde la com pleja naturaleza de las reacciones de la fase oscura, que abarcan numerosas reacciones consecutivas. Adems, y aunque la fijacin inicial del C 0 2 da lugar a azcares, las reacciones metablicas subsi guientes los convierten rpidamente en otras molculas, grandes y pequeas, esenciales para la clula vegetal.

SOL

reacciones activadas por la luz

E SI

La energa qum ica pasa de las plantas a los animales


Los animales y otros organismos no fotosintetizadores no pueden capturar di rectam ente la energa de la luz solar y, por ello, han de sobrevivir gracias a la energa de segunda m ano" que obtienen al ingerir plantas o a la de tercera m ano", obtenida al com er otros animales. Las molculas orgnicas producidas por las clulas vegetales suministran a los organismos que se alimentan de ellas tanto elementos estructurales para la construccin como combustible. Todos los tipos de molculas vegetales pueden servir para este propsito -azcares, protenas, polisacridos, lpidos y otros muchos compuestos. No todas las transacciones entre plantas y animales son unidireccionales. Las plantas, los animales y los microorganismos han existido juntos en este pla neta durante tanto tiempo que muchos se han convertido en una parte esencial del medio am biente de los otros. Por ejemplo, el oxgeno liberado durante la fo tosntesis se consum e en la com bustin de las molculas orgnicas realizada por casi todos los organismos, y algunas de las molculas de C 0 2 que hoy se fijan en molculas orgnicas mayores en una hoja verde mediante la fotosntesis, an teayer fueron liberadas a la atmsfera por la respiracin de un animal. As, la uti lizacin del carbono es un proceso cclico que abarca el conjunto de la biosfera y cruza los lmites de los organismos individuales (Figura 2-13). Anlogamente, los

reacciones ce la fase oscura

C02

A Z CA R

Figura 2-12 La fotosntesis. Las dos fases de la fotosntesis en una planta verde.

C 0 2 en la A TM S F E R A y en el A G U A

Figura 2-13 El ciclo del carbono. Los

RESPIRACIN POR MICROORGANISMOS

COMBUSTIN Y EROSIN

tomos de carbono se incorporan a las molculas orgnicas del mundo vivo gracias a la actividad foto sintetizado de las plantas, las bacterias y las algas marinas. Pasan luego a los animales, a los microorganismos y al material orgnico del suelo y de los ocanos, a travs de vas cclicas. El C02vuelve a la atmsfera cuando las molculas orgnicas son oxidadas por las clulas o quemadas por el hombre en forma de combustibles fsiles.

Y COMBUSTIBLES FSILES

64

Captulo 2 : Pequeas molculas, energa y biosntesis

(A)

ATOMO 2

FORMACION DE UN ENLACE COVALENTE

ATOMO 1

este extrem o tiene una carga parcial positiva

MOLECULA

H C H

este extrem o tiene una carga parcial negativa debido a un exceso de electrones

m etano

H H C OH H

Figura 2-14 Oxidacin y reduccin. (A) Cuando dos tomos forman un enlace covalente, uno de los tomos tiene una mayor cantidad de electrones de forma que adquiere una carga negativa parcial: se dice que se ha redu cido, mientras que el otro adquiere una carga positiva parcial y se dice que se ha o x id ad o . (B) El tomo de carbono del metano puede ser convertido en el del dixido de carbono mediante la eliminacin sucesiva de sus tomos de hidrgeno. En cada paso los electrones son alejados del tomo de carbono, y el tomo de carbono se va oxidando progresivamente. Cada una de estas etapas es energticamente favorable dentro de la clula.

m etanol
H

form aldehdo
H

c= o

tomos de nitrgeno, de fsforo y de azufre pueden seguirse, en principio, desde una molcula biolgica a otra, a travs de unos ciclos similares al del carbono.

HO

c= o

cido frm ico

Las clulas obtienen energa mediante la oxidacin de molculas biolgicas 10


Los tomos de carbono y de hidrgeno de las molculas que las clulas toman como alimento pueden utilizarse como combustible porque no se encuentran en su forma ms estable. La atmsfera terrestre contiene una gran cantidad de oxgeno, y en presencia de oxgeno la forma energticamente ms estable del carbono es el C 0 2, y la del hidrgeno es el H20 . Por consiguiente, una clula puede obtener energa de las molculas de glucosa o de las de protena, permi tiendo que sus tomos de carbono e hidrgeno se com binen con oxgeno produ ciendo C 0 2 y H20 , respectivamente. Sin embargo, la clula no oxida las m olcu las en un solo paso, como ocurre en la combustin. A travs de la accin de catlisis especfica mediante enzimas especficas, hace pasar las molculas a tra vs de un gran nmero de reacciones que slo rara vez implican la adicin direc ta de oxgeno. Antes de estudiar estas reacciones y de poder comprender la fuer za impulsora que las mueve, debemos aclarar qu entendemos por un proceso de oxidacin. En el sentido que antes hemos utilizado, la oxidacin no significa nica mente la adicin de tomos de oxgeno: el trmino se aplica de manera ms ge neral a cualquier reaccin en la que se transfieran electrones de un tomo a otro. Oxidacin, en este sentido, hace referencia a la eliminacin de electrones, y re duccin -lo contrario de oxidacin- significa la adicin de electrones. As, el Fe2 + se oxida si pierde un electrn convitindose en Fe3+, y un tomo de cloro se re duce si acepta un electrn convirtindose en CL. Tambin se utilizan estos mis mos trminos cuando slo se produce un desplazamiento parcial de electrones entre tomos unidos por un enlace covalente (Figura 2-14A). Por ejemplo, cando un tomo de carbono forma un enlace covalente con un tomo con una gran afinidad por los electrones, como el oxgeno, el cloro o el azufre, cede ms que su parte correspondiente de electrones, adquiriendo una carga positiva parcial y entonces se dice que se ha oxidado. Contrariamente un tomo de carbono en un enlace C-H tiene una carga de electrones mayor que la que le corresponde y por ello se dice que est reducido (Figura 2-14B). A menudo, cuando una molcula capta un electrn (e ) tambin capta un protn (H+ ) (en solucin acuosa hay una gran cantidad de protones libremente

dixido de carbono

o= c= o

Orden biolgico y energa

asequibles). En este caso el efecto neto es la adicin de un tomo de hidrgeno a la molcula A + e + H+^ AH A pesar de que en esta reaccin participa un protn y un electrn, (en lugar de solamente un electrn), las hidrogenacianes de este tipo son reducciones y las reacciones contrarias , las deshidrogenaciones son oxidaciones. La combustin de los materiales alimenticios en una clula convierte los tomos de C y de H de las molculas orgnicas (en las que se hallan en un estado relativamente rico en electrones, o sea, reducido) en C 0 2 y H20 , compuestos en los que el C y el H han cedido electrones y, por consiguiente, estn altamente oxidados. El paso de electrones desde el carbono y el hidrgeno hasta el oxgeno permite a todos estos tomos alcanzar un estado ms estable, y por ello la trans formacin es energticam ente favorable.
O

energa de activacin

.5

D )

C D C

< D

proceso de la re accin---------
Figura 2-15 El principio de la energa de activacin. El compuesto X se halla en un estado m etaestable ya que si se transforma en el compuesto Y se liberar energa. Sin embargo, esta transicin no ocurrir a menos que X pueda adquirir la en erga d e activacin suficiente de su entorno {mediante colisiones poco habituales con otras molculas) para sufrir la reaccin.

La degradacin de una m olcula orgnica se realiza a travs de una secuencia de reacciones catalizadas enzim ticam ente 11
Aunque la forma energticam ente ms favorable del carbono es el C 0 2 y la del hidrgeno es el H20 , un organismo vivo no desaparece transformndose en humo por la misma razn que este libro no empieza a arder en cualquier m o mento: en ambos casos las molculas existen en niveles energticos metaestables y necesitan una energa de activacin (Figura 2-15) para poder transfor marse en configuraciones ms estables. En el caso del libro, la energa de activacin puede ser suministrada por una cerilla encendida. Para una clula viva, la com bustin se puede obtener de una manera ms controlada. El papel de la cerilla lo realiza una colisin energtica poco habitual de una molcula con otra. Adems, las nicas molculas que reaccionan son las que se hallan unidas a la superficie de las enzimas. Como se explica en el Captulo 3, las enzim as son catalizadores proteicos al tam ente especializados. Como todos los dems tipos de catalizadores, aceleran las reacciones reduciendo la energa de activacin de un cambio qumico deter minado, Las enzimas se unen fuertemente a las molculas de su substrato y las mantienen de tal forma que reducen notablem ente la energa de activacin de una determinada reaccin que reordena algunos enlaces covalentes. Al reducir selectivamente la energa de activacin de una determinada reaccin de las que puede sufrir la molcula unida, las enzimas determinan cul de las diferentes vas alternativas de rotura o formacin de enlaces covalentes se producir (Figu ra 2-16). El producto liberado por la enzima tras la reaccin enzimtica podr unirse a una segunda enzima que catalice otra reaccin. De esta manera, cada pna de las muchas molculas de una clula pasan de una a otra enzima siguien do vas especficas de reacciones, determinando as la qumica celular. Ms ade lante discutiremos algunas vas centrales del metabolismo energtico. El xito de los organismos vivos se puede atribuir a la habilidad de las clu las para producir muchos tipos diferentes de enzimas, cada uno con propieda des especficas. Cada enzima tiene una forma nica y une un conjunto determi nado de molculas (llamadas substratos), de tal manera que la enzima acelera una reaccin determinada normalmente unas 101 4 veces. Como otros cataliza dores, las molculas de la enzima no cambian despus de participar en una re accin y por lo tanto pueden actuar una y otra vez.

Parte de la energa liberada en las reacciones de oxidacin se acopla a la reaccin de form acin de ATP12
Las clulas obtienen energa til a partir de la ''combustin de la glucosa, nicamente porque la queman de una manera muy compleja y controlada. Mediante vas de reaccin dirigidas por enzimas, las reacciones qumicas de snte sis, o reacciones anablicas, que generan el orden biolgico, estn estrechamente

66

Captulo 2 : Pequeas molculas, energa y biosntesis

i n

(A)

no catalizada m olculas con una energa media

catlisis enzimtica de la reaccin 1

muchas m olculas tienen una cantidad de energa suficiente para seguir la reaccin catalizada enzim ticam ente casi no hay molculas que tengan la cantidad de energa tan elevada necesaria para seguir la reaccin en ausencia de enzima

(B)

energa por molcula

acopladas a las reacciones de degradacin, o catablicas, que proporcionan la energa. La diferencia crucial entre una reaccin acoplada y una reaccin no acoplada se ilustra mediante una analoga m ecnica en la Figura 2-17, en la que una reaccin qum ica energticam ente favorable se representa por las ro cas que caen desde un acantilado. Normalmente la energa cintica de las rocas que caen se desperdiciara com pletam ente en forma del calor generado cuan do chocan contra el suelo (seccin A). Pero m ediante un cuidadoso dispositivo parte de la energa cintica podra ser utilizada para accionar una rueda de pa las que eleva un cubo de agua (seccin B). Puesto que en la seccin B las rocas slo pueden llegar al suelo accionando la rueda de palas, decimos que la reac cin espontnea de la cada de las rocas ha sido acoplada directamente a la reac cin no espontnea de elevacin del cubo de agua. Dado que ahora parte de la energa se utiliza para realizar un trabajo, las rocas llegan al suelo con una velo cidad menor que en la seccin A y se pierde menos energa en forma de calor. En las clulas las enzimas desempean el papel de la rueda de palas de nuestra analoga, y acoplan la combustin espontnea de los alimentos a reac ciones que generan el nuclesido trifosfato, ATP. De la misma forma que la energa acumulada en el cubo de agua elevado de la Figura 2-17 se puede utilizar poco a poco para impulsar diversas mquinas hidrulicas (seccin C), el ATP ac ta como dador conveniente y verstil de energa, impulsando muchas reaccio nes qumicas diferentes necesarias para la clula (Figura 2-18).

Figura 2-1 6 Catlisis enzim tica. (A) Un modelo de caja que ilustra de qu forma las enzimas dirigen a las molculas a travs de vas determinadas. En este modelo, la p elo ta verde representa el substrato potencial de una enzima, (compuesto X) el cual se desplaza arriba y abajo de niveles energticos a causa del constante bombardeo de las molculas de agua que colisionan con ella. Las cuatro paredes de la caja representan las barreras de energa de activacin para cuatro reacciones qumicas diferentes energticam ente favorables. En la caja de la izquierda no se produce ninguna de estas reacciones, ya que la energa disponible gracias a las colisiones es insuficiente para superar ninguna de las barreras energticas. En la caja de la derecha, la catlisis enzimtica reduce la energa de activacin nicam ente para la reaccin nmero 1. As permite que, con la energa disponible, se produzca esta reaccin de forma que el com puesto X se transforma en el com puesto Y. Entonces, el com puesto Y se puede unir a otra enzima que lo transforme en el com puesto Z, y as sucesivamente. (B) Distribucin de energas en una poblacin de molculas idnticas. Para que se produzca una reaccin qumica determinada, la energa de la molcula (en forma de movimientos de traslacin, vibracin y rotacin) ha de exceder la energa de activacin; en la mayora de los casos esto nunca ocurre si no se produce una catlisis enzimtica.

La hidrlisis del ATP genera orden en las clulas 13


De qu forma acta el ATP como transportador de energa qumica? En las con diciones existentes en el citoplasma, la hidrlisis del ATP liberando fosfato inor gnico (Pj), se produce gracias a la catlisis de una enzima, y libera una gran can tidad de energa utilizable. Un grupo qumico que se halle unido mediante un Orden biolgico y energa

67

TRABAJO TIL

la energa cintica se transform a nicam ente en energa calorfica

parte de la energia cintica se utiliza elevando un cubo de agua, por lo que se libera menos energia en form a de calor

la energa potencial almacenada en el cubo de agua elevado se puede utilizar para im pulsar diversas m quinas hidrulicas.

enlace reactivo de este tipo ser transferido a otra molcula; por ello se puede considerar que el fosfato terminal del ATP se halla en un estado activado. El enla ce que se rompe en esta reaccin de hidrlisis recibe, a veces, el nombre de en lace de alta energa. Sin embargo, este enlace no tiene nada de especial. Sim plem ente ocurre que en solucin acuosa la hidrlisis del ATP genera dos m o lculas (ADP y P) de energa mucho menor. Muchas de las reacciones qumicas de la clula son energticamente desfa vorables. Estas reacciones son impulsadas por la energa liberada en la hidrlisis del ATP a travs de enzimas que acoplan directamente la reaccin determinada desfavorable con la reaccin favorable de la hidrlisis del ATP. Entre estas reac ciones se encuentran las que intervienen en la sntesis de las molculas biolgi cas, en el transporte activo de las molculas a travs de las membranas celulares y en la generacin de fuerza y de movimiento. Estos procesos desempean un papel vital en el establecim iento del orden biolgico. Por ejemplo, las macromolculas formadas en las reacciones de biosntesis transportan informacin, cata lizan reacciones especficas y son ensambladas en estructuras altamente orde nadas. Unas bom bas situadas en las m embranas mantienen la composicin interna especial de las clulas y permiten que las seales pasen al interior de las

Figura 2-17 Esquema de un modelo mecnico que ilustra el principio de acopiamiento de las reacciones qumicas. La reaccin espontnea mostrada en (A) puede servir como analoga de la oxidacin directa de la glucosa a C 0 2 y H20 , que nicamente produce calor. En (B), la misma reaccin est acoplada a una segunda reaccin; esta segunda reaccin puede servir como analoga de la sntesis de ATP. La energa producida en una forma ms verstil, en (B) puede ser utilizada para impulsar otros procesos celulares, como se ve en (C). El ATP es la forma de energa ms verstil de las clulas.

energa asequible para trabajo celular y para sntesis qumica

Figura 2-18 La molcula de ATP sirve com o transportador de energa en las clulas. Como se indica, la formacin de ATP desde ADP y fosfato inorgnico, energticamente desfavorable, est acoplada a la oxidacin de molculas alimenticias, energticamente favorable (vase la Figura 2-17B). La hidrlisis de este ATP hasta ADP y fosfato inorgnico proporciona la energa necesaria para impulsar muchas reacciones celulares importantes.

68

Captulo 2 : Pequeas molculas, energa y biosntesis

clulas y entre ellas. Finalmente, la produccin de fuerza y de movimiento per mite que el contenido citoplasmtico de la clula sea organizado y que las pro pias clulas se desplacen y se ensamblen formando tejidos.

Resumen
Las clulas vivas estn altamente ordenadas y, por consiguiente, han de generar or den dentro de ellas mismas para sobrevivir y crecer. Desde el punto de vista termodinmico esto slo es posible gracias a una entrada continua de energa, parte de la cual las clulas ceden a su entorno en form a de calor. La energa procede en ltimo trmino de la radiacin electromagntica del sol, que impulsa la formacin de mo lculas orgnicas en los organismos fotosintetizadores como las plantas verdes. Los animales obtienen su energa ingiriendo estas molculas orgnicas y oxidndolas en una serie de reacciones catalizadas enzimticamente y acopladas a la formacin de ATP. En todas las clulas el ATP es un dador general de energa y su hidrlisis, energticamente favorable, est acoplada a otras reacciones, impulsamlo diversos procesos energticamente desfavorables que generan el elevado grado de orden esencial para la vida.

El alimento y la obtencin de la energa celular1 4


Las molculas alim enticias son degradadas en tres etapas, para producir ATP
Las protenas, los lpidos y los polisacridos, que constituyen la mayor parte de los alimentos que comemos, han de ser degradados a molculas menores antes de que nuestras clulas puedan utilizarlos. Se puede considerar que la degrada cin enzimtica, o catabolismo, de estas molculas ocurre en tres etapas (Figura 2-19). Haremos un breve esbozo de estas etapas antes de estudiar con mayor de talle dos de ellas. La fase 1, llamada digestin, ocurre principalmente en el intestino. Las grandes molculas polimricas se escinden en sus subunidades monomricas -las protenas en aminocidos, los polisacridos en azcares y las grasas en ci dos grasos y glicerol- mediante la accin de enzimas segregadas. La fase 2 ocu rre en el citoplasma despus de que las pequeas molculas resultantes de la fase 1 penetren en las clulas, donde sufren una degradacin posterior. La m a yora de los tomos de carbono e hidrgeno de los azcares se transforman en piruvato, que penetra luego en las mitocondrias, donde se transforma en los grupos acetilo del com ponente qumicamente reactivo acetil coenzima A (acetil CoA) (Figura 2-20). Tam bin se producen grandes cantidades de acetil CoA m e diante la oxidacin de los cidos grasos. En la fase 3, el grupo acetilo del acetil CoA se degrada completamente hasta C 0 2 y H20 en la mitocondria. En esta fase final se genera la mayor parte del ATP. Mediante una serie de reacciones qumi cas acopladas, alrededor de la mitad de la energa que tericamente se puede obtener de la combustin de los carbohidratos y de las grasas hasta H20 y C 0 2 se canaliza para impulsar la reaccin energticamente desfavorable P + ADP - ATP. Puesto que el resto de la energa de combustin se cede por la clula en for ma de calor, esta sntesis de ATP crea un desorden neto en el universo, de acuer do con la segunda ley de la termodinmica. A travs de la formacin de ATP, la energa derivada originariamente de la combustin de los carbohidratos y de las grasas se redistribuye en una forma de energa qumica convenientemente empaquetada. Aproximadamente unas 109 molculas de ATP se encuentran en solucin por todo el espacio intracelular de una clula tpica, donde su hidrlisis a ADP y fosfato es energticamente favora ble y proporciona la energa que impulsar un gran nmero de diferentes reac ciones acopladas que, en s mismas, son energticamente desfavorables por lo que de lo contrario no se produciran.

El alimento y la obtencin de la energa celular

alim ento ETAPA 1: transform acin de las grandes m olculas en subunidades sim ples

protenas

polisa ;ndos

gra sas

am ino cidos

azcares sim ples, com o la glucosa

cidos grasos y gii ;erol

Figura 2-19 Diagrama simplificado de las tres etapas del catabolism o que conducen desde el alimento hasta los productos residuales. Esta serie de reacciones produce ATP, que luego es utilizado para impulsar reacciones de biosntesis y otros procesos celulares que requieren energa.

ETAPA 2: degradacin de las subunidades sim ples hasta acetil CoA, acompaada de la produccin de una cantidad lim itada de ATP y de NADH

ETAPA 3: oxidacin com pleta del acetil CoA hasta H2 O y CO 2 , acompaada de la produccin de una gran cantidad de ATP y de NADH

nh3

h 2o

C 02

; residual

La glucolisis puede producir ATP incluso en ausencia de oxgeno


La parte ms importante de la fase 2 del catabolismo es una secuencia de reac ciones conocida como glucolisis -la lisis (rotura) de la glucosa. La glucolisis pue de producir ATP en ausencia de oxgeno, y probablemente apareci pronto en la historia de la vida, antes de que las actividades de los organismos fotosintticos introdujeran oxgeno en la atmsfera. En la glucolisis una molcula de glucosa, de seis tomos de carbono, se transforma en dos molculas de piruvato, de tres tomos de carbono cada una. Esta conversin se produce a travs de una se cuencia de nueve etapas enzimticas que generan intermediarios que contienen fosfato (Figura 2-21). La clula hidroliza dos molculas de ATP para impulsar las primeras etapas, pero produce cuatro molculas de ATP en las etapas finales, de forma que se produce una ganancia neta de ATP. Desde un punto de vista lgico, la secuencia de reacciones se puede dividir en tres partes: (1) en las etapas 1 a 4, la glucosa se transforma en dos molculas de tres tomos de carbono cada una, el gliceraldehdo 3-fosfato, transformacin

70

Captulo 2 : Pequeas molculas, energa y biosntesis

grupo acetilo

coenzima A

ADENINA
H H
H 3 C - C - S - C - C - N - C - C - C - N - C - C c C - O - P - O - P - O - C H t O

Il

O H H

I I I

OH

I I I I
I I I

CH, H

Figura 2-20 El acetil coenzim a A (acetil CoA). Este intermediario m etablico crucial se genera cuando los grupos acetilo producidos en la fase 2 del catabolismo se unen covalentemente al coenzima A (CoA).

H H H

I I I

H H H

I I I

O H C H 3H

O-

O-

aceti I Co A
HtO

H H

H - S - C - C - N - C - C - C - N - C - C C C - O - P - O - P - O - C H , H H H

II

O H H

I I I I

OH

III

CH, H

I 3 I

I I I

I I

I I I

H H H

I I I

OH CH , H

I I I

O"

O"

CoA

que requiere un aporte de energa en forma de hidrlisis de ATP para suminis trar dos fosfatos; (2) en las reacciones 5 y 6, el grupo aldehido del gliceraldehdo 3 -fosfato se oxida a cido carboxlico y la energa de esta reaccin se acopla a la sntesis de ATP a partir de ADP y fosfato inorgnico; y (3), en las reacciones 7, 8 y 9, las mismas molculas de fosfato que fueron aadidas a los azcares en la pri mera secuencia de reacciones son transferidas de nuevo al ADP formando ATP, recuperndose as la inversin original de dos molculas de ATP hidrolizadas en la primera secuencia de reacciones (vase Figura 2-21). Al final de la glucolisis, el balance energtico (por molcula de glucosa) es un beneficio neto de las dos molculas de ATP que fueron producidas en las re acciones 5 y 6. Puesto que estas dos reacciones son las nicas reacciones de la secuencia en las que se forma un enlace fosfato rico en energa a partir de fosfa to inorgnico, constituyen el corazn de la glucolisis. Por otra parte, estas reac ciones constituyen un excelente ejemplo de cmo las reacciones de la clula se pueden acoplar para aprovechar la energa liberada en las oxidaciones (Figura 2-22). El resultado total es que un grupo aldehido de un azcar se oxida a cido carboxlico, que un grupo fosfato inorgnico se transfiere a un enlace de alta energa del ATP y que una molcula de NAD+ se reduce a NADH, una molcula que desempea un papel central en el metabolismo energtico, como discutire mos ms adelante. Este elegante conjunto de reacciones acopladas fue proba blemente una de las primeras etapas metablicas que aparecieron en la clula durante su evolucin. Para la mayora de las clulas animales la glucolisis nicamente es un prelu dio de la fase 3 del catabolismo, ya que el cido pirvico que se forma penetra rpidamente en las mitocondrias donde ser oxidado completamente a C 0 2 y H20 . Sin embargo, en el caso de los organismos anaerbicos (los que no utilizan oxgeno molecular) y para algunos tejidos como el msculo esqueltico que pueden verse sometidos a condiciones anaerbicas, la glucolisis por s sola se puede convertir en la fuente principal de ATP de la clula. Las reacciones pro ductoras de energa y anaerbicas de este tipo, reciben el nombre de ferm enta ciones. En estos casos las molculas de piruvato no son degradadas en la mitocondria sino que permanecen en el citosol y, segn el organismo de que se trate, pueden ser transformadas en etanol y C 0 2 (en las levaduras) o en lactato (en el msculo), compuestos que luego son excretados. Estas reacciones posteriores del piruvato utilizan el potencial reductor producido en la reaccin 5 de la glu colisis, regenerando as el NAD+ que se requiere para que contine la glucolisis, como discutiremos en el Captulo 14.

El alimento y la obtencin de energa celular

71

glucosa

g
glucosa 6-fosfato

fructosa 6*fosfato

jjj-

3
fructosa 1,6-bisfosfato

Figura 2-21 Glucolisis. Cada una de las reacciones mostradas aqu est catalizada por una enzima diferente. En la serie de reacciones designadas como paso 4, un azcar de seis carbonos es transformado en dos azcares de tres carbonos, de modo que a partir de este paso el nmero de molculas es el doble. Las reacciones 5 y 6 (en la zona amarilla) son las responsables de la sntesis neta de molculas de ATP y de NADH (vase Figura 2-22).

dihidroxiacetona fosfato

2x 2x ( P

gliceraldehdo 3-fosfato

O 1,3-bisfosfoglicerato 6 3-fosfoglicerato

gliceraldehdo 3-fosfato

CHOH C H 20

- HS "v
7 2-fosfoglicerato 8 x fosfoeno lpiru vato CHOH
c h

enzima

2o

2 sa
2x piruvato O S "v

NAD+

+ H+
enzim a

REACCIN 5

\ /
C CHOH
c h

2o

Figura 2-22 Reacciones 5 y 6 de la glucolisis. En estas reacciones la oxidacin de un aldehido a un cido carboxlico est acoplada a la formacin de ATP y de NADH (vase tambin Figura 2-21), Como se indica aqu, la reaccin 5 empieza cuando la enzima gliceraldehdo 3-fosfato deshidrogenasa (vase Figura 3-42) forma un enlace covalente con el carbono del grupo aldehido del gliceraldehdo 3-fosfato. Despus, el hidrgeno (como ion hidruro -un protn con dos electrones) es eliminado del grupo aldehido del gliceraldehdo 3-fosfato y se transfiere al importante transportador de hidrgeno NAD+(vase Figura 2-24). Este paso de oxidacin genera un grupo carbonilo de un azcar unido a la enzima mediante un enlace de alta energa (mostrado en rojo). Entonces, un ion fosfato (P) de la solucin rompe este enlace generando en su lugar un enlace azcar-fosfato de alta energa {enlace rojo). En estas dos ltimas reacciones la enzima ha acoplado el proceso energticamente favorable de oxidacin de un aldehido con la formacin energticamente desfavorable de un enlace fosfato de alta energa, permitiendo que la segunda reaccin sea dirigida por la primera. Finalmente, en el paso 6 de la glucolisis el grupo fosfato reactivo recientemente.creado es transferido al ADP para formar ATP, dejando un grupo carboxlico libre en el azcar oxidado.

HS "v

enzima

\C /
I
CHOH C H ,0 1,3-bisfosfoglicerato

[A D Pj

REACCIN
6

OH

% /
C CHOH
c h

3-fosfoglcerato

2o

72

Captulo 2 : Pequeas molculas, energa y biosntesis

El NADH es el intermediario central en el catabolismo oxidativo


La generacin anaerbica de ATP a partir de glucosa y a travs de las reacciones de la glucolisis es relativamente ineficiente. Los productos finales de la glucolisis anaerbica contienen an una gran cantidad de energa qumica que puede ser liberada mediante su oxidacin posterior. La evolucin del catabolismo oxidati vo (respiracin celular) slo result posible despus de que el oxgeno molecular se hubiera acumulado en la atmsfera terrestre, como resultado de la fotosnte sis realizada por las cianobacterias. Antes de ello, los procesos catablicos anaerbicos haban dominado la vida sobre la Tierra. La adicin al proceso catabli co de una fase dependiente de oxgeno (fase 3 de la Figura 2-19) proporcion a las clulas un mtodo mucho ms potente y eficaz de extraer energa de las m o lculas alimenticias. Esta tercera fase empieza con el ciclo del cido ctrico (de nominado tambin ciclo de los cidos tricarboxlicos o tambin, ciclo de Krebs) y termina con la fosforilacin oxidativa, procesos que se producen tanto en las bacterias aerbicas como en las mitocondrias de las clulas eucariotas. En la Figura 2-23 se presenta una versin simplificada de los dos procesos centrales del catabolismo oxidativo. En primer lugar, en el ciclo del cido ctrico los grupos acetilo de las molculas de acetil CoA son oxidados hasta C 0 2 y NADH. A continuacin, en el proceso de fosforilacin oxidativa el NADH genera do reacciona con el oxgeno molecular ( 0 2) produciendo ATP y H20 , a travs de una complicada serie de etapas que implican un transporte de electrones a tra vs de una membrana.
(A)

Figura 2-2 3 Esquema simplificado de la etapa 3 del catabolism o. El proceso produce primariamente grandes cantidades de ATP a partir de ADP y de fosfato inorgnico (P). El ciclo del cido ctrico produce NADH, que luego es utilizado para dirigir la produccin de ATP a travs de la fosforilacin oxidativa. As pues, el NADH acta com o intermediario central en la oxidacin de grupos acetilo hasta C 0 2 y H20 (tambin juega un papel similar, aunque en menor cantidad, el FADH2).

NAD
O

NADH
l~ k ^i c
NH,

//

o
NH:

anillo de nicotinam ida

Pj-O
RIBOSA V

p)-oRIBOSA

PhO

P h -O

(B)

H -C -O H

; + NAD+ ------ C= 0 + NADH + H+

Figura 2 -24 El NAD+y el NADH. Estas dos molculas son los transportadores de electrones ms importantes en las reacciones catablicas. Sus estructuras se muestran en (A). NAD+es la abre viatura de n icotin am id a ad en in a d in u cletid o, reflejando el hecho de que la mitad derecha de la molcula, tal como se indica en el dibujo, es el monofosfato de adenosina (AMP). La parte de la molcula del NAD+conocida como el anillo de nicotinamida (som breada en gris) es capaz de aceptar dos electrones y un protn (en total un ion hidruro, H ), formando NADH. En esta forma reducida, el anillo de nicotinamida tiene una estabilidad reducida debido a que ya no est estabilizada por resonancia. Como consecuencia de ello, el ion hidruro incorporado est a ctiv a d o en el sentido de que es fcilm ente transferido a otras molculas. (B) Ejemplo de una reaccin en la que participan el NAD+y el NADH. En la oxidacin biolgica de una molcula de substrato, com o un alcohol, el substrato pierde dos tomos de hidrgeno. Uno de ellos se aade como ion hidruro al NAD+ , produciendo NADH, mientras que el otro se libera a la solucin como un protn (H+ ).

El alimento y la obtencin de energa celular

73

El NADH, intermediario central en estos procesos, tambin lo encontramos como un producto de la glucolisis (vase Figura 2-22). Es un imporante trans portador de poder reductor en las clulas. Como se ilustra en la Figura 2-24, est formado por la adicin de un ncleo de hidrgeno y dos electrones (un ion hidruro H ) a la adenina nicotinamida dinucletido (NAD+ ). Debido a que esta adi cin tiene lugar de una forma tal que el ion hidruro queda asociado a travs de una unin rica en energa, el NADH acta en la clula como una fuente adecua da de electrones fcilmente transferibles, de una forma semejante a como el ATP acta com o una fuente adecuada de grupos fosfato fcilmente transferibles.

El metabolism o est dominado por el ciclo del cido ctrico 15


La funcin primaria del ciclo del cido ctrico consiste en oxidar los grupos acetilo que entran en el ciclo en forma de molculas de acetil CoA. Las reacciones forman un ciclo porque el grupo acetilo no se oxida directamente, sino despus de haberse unido covalentemente a una molcula mayor, el oxalacetato, que se regenera al final de cada vuelta del ciclo. Tal como se ilustra en la Figura 2-25, el ciclo empieza con la reaccin que tiene lugar entre el acetil CoA y el oxalacetato, formando una molcula de un cido tricarboxlico denominada cido ctrico (o citrato). Luego se producen una serie de reacciones en las que dos de los seis tomos de carbono del citrato se oxidan a C 0 2, formando otra molcula de oxa lacetato, que inicia de nuevo el ciclo. (Puesto que los carbonos que entran en cada ciclo se incorporan en lugares del citrato diferentes a los que se oxidan a C 0 2, no sern oxidados hasta despus de varias vueltas del ciclo.) El C 0 2 produ cido en estas reacciones sale de la mitocondria (o de la bacteria) por difusin y abandona de la clula. La energa que se libera cuando se oxidan los enlaces C-H y C-C del citrato puede ser capturada de varias maneras diferentes en el transcurso del ciclo del

piruvato
NAD+

3C C 02 2C

4 H' ,

> > acetil CoA

NADH l + H+ -------------------- y
1 7

citrato
....................V

6C
Figura 2-25 El ciclo del cido ctrico. En las mitocondrias y en las bacterias aerbicas los grupos acetiio producidos a partir del piruvato se oxidan posteriormente. Los tomos de carbono de los grupos acetilo se transforman en C 0 2, mientras que los tomos de hidrgeno se transfieren a las molculas transportadoras NAD+y FAD. tomos adicionales de oxgeno e hidrgeno entran en el ciclo en forma de agua en los pasos indicados con un asterisco (*). El nmero de carbonos de cada molcula se indica en el recuadro blan co. Para ms detalles vase Figura 14-14.

isocitrato s
L

6C i NAO+i . i + h4

74

Captulo 2 : Pequeas molculas, energa y biosntesis

cido ctrico. En un paso del ciclo (de succinil CoA a succinato) se genera un en lace fosfato rico en energa mediante un mecanismo parecido al que se ha des crito antes para la glucolisis. El resto de la energa de oxidacin que se captura en el ciclo se canaliza hacia la conversin de molculas transportadoras de hi drgeno -o iones hidruro- en sus formas reducidas; en cada vuelta del ciclo, tres molculas de NAD+ se convierten en NADH y un (FAD) se convierte en FADH2. La energa transportada por el hidrgeno activado de estas molculas transportadoras se utiliza en las reacciones de la (que ser considerada con ms detalle ms adelante), las nicas reac ciones descritas aqu que requieren oxgeno molecular de la atmsfera. Los tomos de oxgeno adicionales necesarios para producir C 0 2 a partir de los grupos acetilo que entran en el ciclo del cido ctrico no son suministrados por el oxgeno molecular, sino por el agua. En cada vuelta del ciclo, tres m olcu las de agua se rompen y sus tomos de oxgeno se utilizan produciendo C 0 2. Al gunos de sus tomos de hidrgeno entran a formar parte de molculas del sus trato y, como los tomos de hidrgeno de los grupos acetilo, finalmente sern transferidos a molculas transportadoras como el NADH. En la clula eucariota, las mitocondrias son el centro donde confluyen todos los procesos catablicos, tanto si empiezan desde azcares, desde grasas o des de protenas. En efecto, adems del piruvato, los cidos grasos y algunos am ino cidos tambin pasan desde el citosol a las mitocondrias, y all son transforma dos a acetil CoA o a alguno de los otros intermediarios del ciclo del cido ctrico. La mitocondria tambin acta como punto de partida de reacciones de biosntesis, al producir unos compuestos de carbono vitales, tales como el y el Estas sustancias pueden ser transferidas de nuevo desde la mitocondria al citosol donde actan como precursoras para la sntesis de m ol culas esenciales, com o por ejemplo algunos aminocidos.

flavn adenn dinucletido

oxidativa

fosforilacin

a-cetoglutarato.

oxalacetato

En la fosforilacin oxidativa, la transferencia de electrones al oxgeno impulsa la formacin de ATP1 0 -1 6


La fosforilacin oxidativa es el ltimo paso del catabolismo y el proceso en que se libera la mayor parte de la energa metablica. En este proceso, las molculas de NADH y de FADH2 transfieren al oxgeno molecular ( 0 2) los electrones que han obtenido de la oxidacin de las molculas alimenticias. La reaccin, que for malmente es equivalente a la combustin del hidrgeno en el aire formando agua, libera una gran cantidad de energa qumica. Parte de esta energa se utili za para producir la mayor parte del ATP de la clula; el resto se libera en forma de calor. Aunque el proceso qumico general de la oxidacin del NADH y del FADH2 implica una transferencia de hidrgeno hasta el oxgeno, cada tomo de hidr y un protn (el ncleo de hidrgeno, H+ ). geno se transfiere como un Esto es posible debido a que el tomo de hidrgeno puede ser fcilmente diso ciado en el electrn y el protn (H+ ) que lo constituyen. Entonces, el electrn puede ser transferido por separado a una molcula que nicamente acepta elec trones, mientras que el protn permanece en la solucin acuosa. Por el mismo razonamiento, si se transfiere un electrn a una molcula que tenga una fuerte afinidad por el hidrgeno, automticamente se reconstituir un tomo de hidr geno tomando un protn de la solucin. En el transcurso de la fosforilacin oxi dativa los electrones del NADH y del FADH2 descienden a lo largo de una cadena de molculas transportadoras, conocida como cadena de transporte electrni co. La presencia o ausencia de tomos de hidrgeno intactos depende de la na turaleza del transportador. En una clula eucariota, esta serie de transferencias electrnicas a lo largo de la cadena de transporte electrnico ocurre en la membrana mitocondrial in terna, en la que se hallan todas las molculas transportadoras. En cada paso de la transferencia, los electrones caen a un nivel energtico ms bajo, hasta que al final son transferidos a las molculas de oxgeno. Cada molcula de oxgeno ( 0 2)

electrn

El alimento y la obtencin de energa celular

toma cuatro electrones de la cadena de transporte de electrones y cuatro proto nes de la solucin acuosa formando dos molculas de agua. Las molculas de oxgeno tienen una gran afinidad por los electrones, por lo que los electrones unidos al oxgeno se encuentran en su estado energtico ms bajo. La cadena de transporte de electrones es importante para la clula porque la energa que se libera cuando estos electrones caen a estados energticos ms bajos se aprovecha de una manera remarcable. Como describimos en el Captu lo 14, transferencias particulares de electrones hacen que se bom been protones a travs de la membrana, desde el compartimiento mitocondrial interno hacia el exterior (Figura 2-26). As, se genera un gradiente electroqumico de protones a travs de la membrana mitocondrial interna. A su vez, este gradiente impulsa un flujo de protones a travs de un com plejo enzimtico especial de la misma membrana mitocondrial haciendo que la enzima (ATP sintasa ) aada un grupo fosfato al ADP, generando por consiguiente ATP dentro de la mitocondria. Final mente, el ATP recin sintetizado se transfiere desde la mitocondria al resto de la clula.

electrn de alta energa

Los aminocidos y los nucletidos forman parte del ciclo del nitrgeno
Hasta aqu hem os centrado nuestra discusin fundamentalmente en el m etabo lismo de los carbohidratos. No hemos hablado an del metabolismo del nitrge no o del azufre. Estos dos elementos son constituyentes de las protenas y de los cidos nucleicos, los cuales son las dos clases de macromolculas ms impor tantes en la clula y constituyen aproximadamente las dos terceras partes de su peso seco. Los tomos de nitrgeno y de azufre pasan desde un compuesto has ta otro y entre los organismos y su ambiente a travs de una serie de ciclos rever sibles. Aunque el nitrgeno molecular es abundante en la atmsfera terrestre, en forma de gas es no reactivo qumicamente. nicam ente algunas especies vivien tes son capaces de incorporarlo a molculas orgnicas, proceso denominado fi jacin del nitrgeno. La fijacin del nitrgeno ocurre en ciertos microorganis mos y en algunos procesos geofsicos, com o por ejemplo en la descarga de un rayo. Es esencial para toda la biosfera, pues sin esta fijacin no existira la vida en este planeta. Pero nicamente una pequea parte de los compuestos nitroge nados de los organismos actuales representa productos frescos de fijacin del nitrgeno atmosfrico. La mayor parte del nitrgeno orgnico ha estado en cir culacin durante m ucho tiempo, pasando de un organismo vivo a otro. Por con siguiente, se puede decir que las reacciones de fijacin del nitrgeno realizan la funcin de mantener llena al mximo la reserva total de nitrgeno. Los vertebrados reciben prcticamente todo su nitrgeno a travs de la in gesta de protenas y de cidos nucleicos. En el cuerpo estas macromolculas se descom ponen en sus com ponentes, aminocidos y nucletidos, los cuales luego son repolimerizados generando nuevas protenas y cidos nucleicos o son utili zados para sintetizar otras molculas. Aproximadamente la mitad de los 20 ami nocidos existentes en las protenas son aminocidos esenciales (Figura 2-27) para los vertebrados: no pueden ser sintetizados a partir de otros ingredientes de la dieta. Los otros aminocidos s que pueden ser sintetizados, utilizando una enorme diversidad de materiales, incluyendo intermediarios del ciclo del cido ctrico. Los aminocidos esenciales son producidos en otros organismos, gene ralmente a travs de rutas largas y energticamente costosas que en el transcur so de la evolucin de los vertebrados se han ido perdiendo. Los nucletidos necesarios para producir RNA y DNA pueden ser sintetiza dos utilizando vas biosintticas especializadas: no existen "nucletidos esencia les"' que deban ser proporcionados por la dieta. Todos los nitrgenos de las b a ses puncas i pirimidnicas (y tam bin algunos de los carbonos) derivan de los abundantes am inocidos glutamina, cido asprtico y glicina, mientras que los azcares ribosa y desoxirribosa derivan de la glucosa. 76 Captulo 2 : Pequeas molculas, energa y biosntesis

H+

electrn de baja energa

Figura 2-26 Generacin de un gradiente de H+a travs de una m em brana, m ediante reacciones de transporte electrnico. Un electrn de alta energa (por ejem plo, derivado de la oxidacin de un metabolito) recorre secuencialm ente los transportadores A, B y C hasta un estado energtico inferior. En este esquema el transportador B est dispuesto en la membrana de tal manera que mientras pasa el electrn toma el H1 de un lado de la membrana y lo libera al otro lado. El gradiente resultante de H+corresponde a una forma de energa almacenada, utilizada por otras protenas de membrana de la mitocondria para favorecer la formacin de ATP, com o se discute en el Captulo 14 .

Los aminocidos que no son utilizados en procesos de biosntesis pueden ser oxidados generando energa metablica. Muchos de sus tomos de carbono y de hidrgeno formarn C 0 2 o H20 mientras que sus tomos de hidrgeno se rn transportados a travs de varias formas y aparecern como urea, que es ex cretada. Cada aminocido es procesado de forma diferente y existe una conste lacin entera de reacciones enzimticas para su catabolismo.

LOS AMINOACIDOS ESENCIALES TREONINA METIONINA ^ USINA VALINA LEUCINA ISOLEUCINA HISTIDINA FENILALANINA TRIPTFANO
i

Resumen

Las clulas animales obtienen la energa a partir del alimento, siguiendo tres fases. En la fase 1 las protenas, los polisacridos y las grasas son transformados a mol culas pequeas mediante reacciones extracelulares. En la fase 2, estas molculas pequeas son degradadas dentro de las clulas, produciendo acetil CoA y una pe quea cantidad de ATP y de NADH. stas son las nicas reacciones que pueden pro porcionar energa en ausencia de oxgeno. En la fase 3, las molculas de acetil CoA son degradadas en las mitocondrias, produciendo COz y tomos de hidrgeno que se unen a molculas transportadoras, como por ejemplo el NADH. Los electrones de los tomos de hidrgeno pasan a travs de una compleja cadena de transportado res, que conduce finalmente a la reduccin del oxgeno molecular formando agua. Impulsados por la energa liberada en estos pasos de transferencia de electrones, los protones (H+ ) son transportados al exterior de la mitocondria. El gradiente elec troqumico de protones resultante a travs de la membrana mitocondrial interna se utiliza para impulsar la sntesis de la mayor parte del ATP celular. La biosntesis y la creacin de orden1 7
En un momento cualquiera en una clula se producen miles de reacciones qumi cas diferentes. Las reacciones estn asociadas formando cadenas y redes, en las que el producto de una reaccin se convierte en el substrato de la reaccin siguien te. La mayora de las reacciones qumicas celulares pueden clasificarse de manera aproximada, segn pertenezcan al catabolismo o a la biosntesis (anabolismo). Ya hemos discutido las reacciones catablicas, por lo que ahora vamos a estudiar las reacciones de biosntesis. Estos procesos empiezan en los compuestos intermedia rios de la glucolisis y del ciclo del cido ctrico (y en otros compuestos relacionados con stos) y generan las mayores y ms complejas molculas de la clula.

Figura 2-2 7 Los nueve aminocidos esenciales. Estos aminocidos no pueden ser sintetizados por las clulas humanas y por lo tanto deben ser suministrados en la dieta.

El cambio de energa libre de una reaccin determina si sta puede producirse o no1 8
A pesar de que las enzimas aceleran las reacciones energticamente favorables, no pueden forzar que las reacciones energticamente desfavorables tengan lu gar. En una analoga con el agua, las enzimas por s solas no pueden hacer que el agua fluya cuesta arriba. Sin embargo las clulas han de hacerlo para poder cre cer y dividirse; han de formar molculas altamente ordenadas y ricas en energa a partir de molculas pequeas y sencillas. Hemos visto que, de una manera ge neral, esto se realiza mediante enzimas que acoplan reacciones energticamente favorables que consumen energa (derivada fundamentalmente del sol) y que producen calor, a reacciones energticamente desfavorables que producen or den. Vamos a examinar en detalle cmo se realiza este acoplamiento. En primer lugar debemos considerar ms cuidadosamente el trmino ener gticamente favorable, que hemos estado utilizando con bastante ligereza sin definirlo. Como se explica al principio, para que una reaccin qumica tenga lu gar espontneam ente nicamente ha de producir un incremento neto de desor den en el universo. El desorden se incrementa cuando la energa til (enega que puede ser derivada para producir trabajo) se disipa en forma de calor; el criterio de incremento de desorden puede expresarse de forma cuantitativa con la ener ga libre, G. sta se define de manera que los cambios de su valor, indicados por La biosntesis y la creacin de orden

77

AG, miden la cantidad de desorden creado en el universo cuando tienen lugar una reaccin. Las reacciones energticamente favorables son, por definicin, aquellas que liberan una gran cantidad de energa libre, o en otras palabras, las que tienen un valor negativo de AG elevado y por tanto crean mucho desorden. Un ejemplo familiar a escala macroscpica puede ser la reaccin por la que un muelle comprimido se relaja hasta su estado expandido, liberando al medio en forma de calor la energa elstica que almacenaba. Las reacciones energtica mente favorables, con un AG < 0, presentan una elevada tendencia a ocurrir es pontneamente, aunque su velocidad depender de otros factores, tales como la existencia de enzimas especficas (vase ms adelante). En cambio, las reacciones energticamente desfavorables, con un valor positivo de AG, como aquellas en las que dos aminocidos se unen entre s formando un enlace peptdico, generan or den en el universo y por lo tanto no se pueden producir espontneamente. Reac ciones energticamente desfavorables como stas slo se producirn si estn acopladas a una segunda reaccin que tenga un valor de AG suficientemente ne gativo como para que el AG del proceso completo tambin resulte negativo. El curso de la mayora de las reacciones puede predecirse cuantitativamen te. Se han recogido una gran cantidad de datos termodinmicos que hacen posi ble calcular los cam bios de energa libre para la mayora de las reacciones ms importantes de la clula. Entonces, el cambio global de energa libre para una va es la simple suma de los cambios de energa libre de cada una de las reaccio nes que la com ponen. Consideremos por ejemplo dos reacciones: X Y y C h >D con valores de AG de +1 y -1 3 kcal/mol respectivamente. (Hay que recordar que un mol son 6 x 1023 molculas de la substancia.) Si estas dos reacciones pueden ser acopladas, el AG de la reaccin acoplada ser de -1 2 kcal/mol. As, la reac cin desfavorable X Y, que no ocurrir espontneamente, puede ser impulsa da por la reaccin favorable C D, siempre que exista un mecanismo mediante el cual las dos reacciones puedan ser acopladas.

A menudo las reacciones de biosntesis estn acopladas directamente a la hidrlisis del ATP
Consideremos una reaccin tpica de biosntesis en la que dos monmeros, A y B, han de unirse a travs de una reaccin de deshidratacin (denominada tam bin de condensacin) en la que se libera agua:
a -h

+ b - o h ^ a - b + h 2o

De forma casi invariable, la reaccin inversa (denominada hidrlisis), en la que el agua rompe el compuesto formado por el enlace covalente A-B, ser la reac cin energticam ente favorable. Por ejemplo, ste es el caso de la hidrlisis a sus subunidades de las protenas, los cidos nucleicos y los polisacridos. La estrategia general que permite a la clula producir A-B a partir de A-H y BOH, implica una secuencia de reacciones a travs de las cuales la sntesis energti camente desfavorable del compuesto deseado se acopla a una reaccin energtica mente ms favorable (vase Figura 2-17). Como se explica en la Figura 2-28 la hidrlisis del ATP tiene un AG muy negativo y es la fuente habitual de energa libre que se utiliza para impulsar las reacciones biosintticas de la clula. En la va aco plada desde A-H y B-OH hasta A-B, la energa de hidrlisis del ATP transforma pri mero B-OH en un compuesto intermedio de mayor energa, que luego reacciona directamente con A-H dando A-B. El mecanismo ms simple consiste en la transfe rencia de un fosfato desde el ATP hasta B-OH formando B-OPOs (o sea, B -O - ), en cuyo caso la va de reacciones nicamente estar formada por dos pasos: 1. B-OH + ATP B - 0 - + ADP

2. A-H + B -0-(P) >A-B + P

78

Captulo 2 : Pequeas molculas, energa y biosntesis

adenosina trifosfato

0
m

- O - P-o - P-o - P-o -c H ,

O
I I I O

o~
I I O

I O

H ,0

O -P -O H

0 1

H ,0

I O

fosfato

Figura 2-28 Hidrlisis del ATP. La hidrlisis del fosfato terminal del ATP libera, dependiendo de las condiciones intracelulares, entre 11 y 13 kcal/mol de energa utilizable. Esta reaccin tiene un AG muy negativo debido a varios factores. La liberacin del grupo fosfato terminal elimina una repulsin desfavorable entre cargas negativas adyacentes. Adems, el ion fosfato inorgnico (P) liberado est estabilizado por resonancia y por la formacin favorable de un enlace de hidrgeno con el agua.

ADP

o
Puesto que el intermediario B -O - se forma slo transitoriamente, las reaccio nes globales que se producen son: A-H + B-OH -> A-B y ATP -> ADP + P La primera reaccin, de por s energticamente desfavorable, es impulsada a producirse acoplndola directamente a la segunda reaccin energticamente fa vorable (la hidrlisis del ATP). Un ejemplo de reaccin biosinttica acoplada de este tipo es la sntesis del aminocido glutamina, mostrada en la Figura 2-29. El AG de la hidrlisis del ATP a ADP y fosfato inorgnico (P) depende de las concentraciones de los tres reactantes, y en las condiciones habituales de una clula es entre -11 y -1 3 kcal/mol. En principio, esta reaccin de hidrlisis pue de utilizarse para impulsar una reaccin desfavorable con un AG de, quizs, +10 kcal/mol, siempre que exista una va de reacciones adecuada. Para algunas reacciones de biosntesis, sin embargo, -1 3 kcal/mol puede ser insuficiente. En estos casos, la reaccin de hidrlisis del ATP puede ser alterada de manera que inicialmente produzca AMP y pirofosfato (PP). El pirofosfato ser hidrolizado en segundo paso (Figura 2-30). En su conjunto el proceso produce un cambio de energa libre total disponible de aproximadamente -2 6 kcal/mol. Cmo se acopla la energa de hidrlisis del pirofosfato a una reaccin bio sinttica? Se puede ilustrar una de las vas considerando de nuevo la sntesis del compuesto A-B a partir de A-H y B-OH. Mediante una enzima apropiada, B-OH puede ser convertido a travs de su reaccin con el ATP en un intermediario de alta energa B - O - - . La reaccin completa consta ahora de tres pasos: 1. B-OH + ATP - B - O - - + AMP 2. A-H + B - O - - 3. PP + H20 -> 2P Y las reacciones globales son A-H + B-OH -> A-B y ATP + H20 AMP + 2P A-B + PP

% /

o p )~
Vp

ch2 ch2 H7N CH COOH

CH ch2 H2N CH COOH

NH,

ch2 ch2 H9N CH COOH

cido glutm ico

glutam ina
Figura 2-29 Ejemplo de reaccin biosinttica de deshidratacin impulsada por la hidrlisis del ATP. En primer lugar, el cido glutmico es transformado en un intermediario fosforilado de alta energa (que corresponde al com puesto B - O - descrito en el texto), el cual reacciona con el amonio formando glutamina. En este ejemplo, ambos pasos tienen lugar en la superficie de la misma enzima, la g lu ta m in a sintasa. Obsrvese que, para mayor claridad, estas molculas se muestran en sus formas no cargadas.

Dado que una enzima acelera por igual las direcciones hacia adelante y hacia atrs de la reaccin que cataliza, el compuesto A-B puede ser destruido por re com binacin con pirofosfato (el inverso del paso 2). Pero la reaccin energtica mente favorable de la hidrlisis del pirofosfato (paso 3) estabiliza el compuesto

La biosntesis y la creacin de orden

79

BB

0 1 -p-p-o -P-0II iil II O o o


Or i Cr 1
adenosina trifo s fa to

\R1B0SA / x

Figura 2-30 Una ruta alternativa para la hidrlisis del ATP, en la que prim ero se form a pirofosfato y luego sehidroliza. Esta ruta p roporciona
aproxim adam ente el doble de energa utilizable que la reaccin de la Figura 2-28. D espus de la hidrlisis, los tom os de hidrgeno p roced en tes del agua ap arecen unidos a los grupos fosfato. Sin em bargo, al pH del citoplasm a celular, la m ayora de ellos se hallan disociad os form ando iones hidrgeno H+libres.

HtO
H ,0 -

AMP

oo I I -O -P -O -P -O

il

pirofosfato

h7 o-

adenosina m onofosfato

h7o 0 1

.P i) + (PO

o-p-o I o
fosfato

I HC-P-O O
fosfato

cr

A-B, m anteniendo la concentracin de pirofosfato muy baja, evitando as la in versin del paso 2. De esta manera, la energa de hidrlisis del pirofosfato se uti liza para impulsar esta reaccin en la direccin hacia adelante. Un ejemplo de una reaccin biosinttica importante de este tipo es la sntesis de polinucletidos, que se muestra en la Figura 2-31.

Las coenzimas intervienen en la transferencia de determinados grupos qumicos


Puesto que la unin del fosfato terminal del ATP puede romperse fcilmente li berando energa libre, el ATP acta como un eficiente dador de fosfatos en un gran nmero de diferentes reacciones de fosforilacin. Tambin actan de esta forma una amplia variedad de tipos de enlaces qumicamente lbiles y a m enu do las molculas que los contienen se unen fuertemente a la superficie de las en zimas de forma que puedan ser utilizadas de forma eficiente como dadoras de su grupo reactivo en las reacciones catalizadas enzimticamente. Estas m olcu las se denominan coenzim as porque son esenciales para la actividad de la enzi ma; la misma coenzima puede participar en muchas reacciones biosintticas di ferentes en las que se necesite su grupo reactivo. En la Tabla 2-2 se presentan algunos ejemplos de coenzimas. Entre ellas la que encontram os primero es el acetil coenzima A (acetil CoA). Consta de un gru po acetilo unido al CoA m ediante un enlace tioster reactivo (vase la Figura 220). Este grupo acetilo se puede transferir fcilmente a otra molcula, como por ejemplo una molcula de cido graso en formacin. Otros importantes ejemplos los constituyen el NADH, que transporta un ion hidruro (Figura 2-24), y la biotina, que transfiere un grupo carboxilo en numerosas reacciones de biosntesis (Figura 2-32) Muchas coenzimas no pueden ser sintetizadas por los animales y deben ser obtenidas de plantas y microorganismos de la dieta. A menudo las vitaminas -factores nutricionales esenciales que los animales necesitan en cantidades tra z a - son precursores de coenzimas necesarias.

80

Captulo 2 : Pequeas molculas, energa y biosntesis

- /M pB Q i ^ i \v i \ ' Kazucaw T - 71
OH

Figura 2-31 La sntesis de un polinucletido, DNA o RNA, es un proceso de mltiples pasos que se halla impulsado por la hidrlisis del ATP. En el p rim er p aso un n u cletid o

2[DP[

nuclesido trifosfato interm ediario de aita energia

PO
\azucapj [basel
p )o

2 BEky
base Kazucar,
N j
OH pp) - j ^ H 20
Y

Y -i Kazucaw

y -/
OH [base T Kazca'rJ ' l l l r

2Pj)

i 1 I o-

cadena de polinucletido que contiene dos nucletidos

nuclesido m onofosfato

1 base

L2 I

m o n ofo sfato es activado por la tran sferen cia secu en cial de grupos fosfato term inales de dos m o lcu las de ATP. El interm ed iario de alta energa form ado - u n nu clesid o trifo sfa to p erm an ece libre en solu cin hasta que reaccion a, co n lib eracin de pirofosfato, con el extrem o en crecim ien to de la cad en a de RNA o de DNA. La hidrlisis del pirofosfato hasta fosfato inorgnico es altam en te favorable y ayuda a im pulsar la reacci n global en d ireccin a la sntesis del p o lin ucletido.

(p ) n ^

cadena de polinucletic que contiene tres nucletidos ('p 'w

M \zcaw ry i

3 J kazcaM

base

!\ p / l
OH

La estructura de las coenzimas sugiere que se formaron en un mundo de RNA


Como se discute en el Captulo 1, los recientes descubrimientos de que las m ol culas de RNA pueden plegarse formando superficies altamente catalticas han llevado a la visin de que los RNA (o compuestos estrechamente relacionados con ellos) probablemente fueron los principales catalizadores en la formas primi tivas de la vida y que las protenas evolucionaron posteriormente. Para desarro llar catlisis eficientes sobre reacciones necesarias en las clulas, parece lgico que estos RNA necesitaran la presencia de una gran variedad de coenzimas que compensaran su propia m onotona qumica (ya que estn construidos nica mente por cuatro subunidades nucleotdicas diferentes). Algunos RNA actuales contienen lugares de unin altamente especficos para nucletidos, que utilizan contactos de enlaces de hidrgeno base-base no de Watson y Crick (vase Figura 3-21). Es posible que las coenzimas se unieran a los RNA iniciales mediante el mismo tipo de asa que se halla presente en la espalda de muchas de las coen-

T abla 2 -2 Algunas de las coen zim as que intervienen en reaccio n es de tran sferen cia de grupos C oenzim a*
A TP NADH, NADPH C o e n z im a A B io tin a S -A d e n o s ilm e tio n in a

Grupo transferido
fo sfato h id r g e n o y e le c tr n (ion h id ru ro) a c e tilo c a rb o x ilo m etilo

*Las coenzimas son pequeas molculas que estn asociadas a algunas enzimas y que son esenciales para la actividad de stas. Cada una de las coenzimas enumeradas aqu es una mol cula transportadora de un pequeo grupo qumico y participa en diversas reacciones en las que este grupo se transfiere a otra molcula. Algunas enzimas estn unidas covalentemente a su en zima; otras se unen mediante un enlace menos fuerte.

La biosntesis y la creacin de orden

81

biotina carboxilada

CH;

c= o c o
#

piruvato

o-

Figura 2-32 Transferencia de un grupo carboxilo mediante la coenzima biotina. La biotina (mostrada en verde) acta como molcula transportadora del grupo carboxilo (en rojo). En la secuencia de reacciones mostradas aqu, la biotina est unida covalentemente a la enzima piruvato carboxilasa. Un grupo carboxilo activado, derivado de un ion bicarbonato (HCOj) se acopla a la biotina a travs de una reaccin que requiere un aporte de energa procedente de la hidrlisis de una molcula de ATP. A continuacin este grupo carboxilo se transfiere al grupo metilo del piruvato formando oxalacetato.

C= o

oxalacetato piruvato carboxilasa

zimas actuales, como el ATP, el acetil CoA y el NADH. De acuerdo con este pun to de vista, estas molculas debieron evolucionar con un nucletido unido covalentem ente debido a la utilidad que supona este nucletido para la unin de la coenzima en un mundo de RNA.

7-DEHIDROCOLESTEROL

La biosntesis necesita poder reductor


Hemos visto como en las clulas se producen continuam ente reacciones de oxi dacin y de reduccin. La energa qumica de las molculas alimenticias se libe ra mediante reacciones de oxidacin, mientras que para producir molculas biolgicas la clula necesita -en tre otras cosas- llevar a cabo una serie de reac ciones de reduccin que requieren un aporte de energa qumica. Aplicando el principio de las reacciones acopladas que hemos descrito en pginas anteriores, las clulas canalizan directamente la energa qumica derivada del catabolismo hacia la sntesis del NADH (por ejemplo, vase Figura 2-22). El enlace de alta energa que se forma entre el hidrgeno y el anillo de nicotinamida, dando lugar al NADH proporciona energa para reacciones enzimticas desfavorables, trans firiendo el hidrgeno (como ion hidruro) a otra molcula. Por ello se dice que el NADH, y tam bin el NADPH (estrechamente relacionado con l y en el que se puede convertir con facilidad) son transportadores de "poder reductor. Ambos se utilizan como coenzimas en numerosos tipos de reacciones de reduccin. Para saber cm o ocurre la transferencia de hidrgeno en la prctica, consi deremos un solo paso de biosntesis: la ltima reaccin de la va de sntesis de la molcula lipdica colesterol. En esta reaccin, dos tomos de hidrgeno se aa den al anillo esteroide policclico, reduciendo un doble enlace carbono-carbono. Como en la mayora de reacciones de biosntesis, los constituyentes de los dos tomos de hidrgeno que son necesarios en esta reaccin son suministrados en forma de ion hidruro del NADPH ms un protn (H+ ) de la solucin (H~ + H+ = 2H) (Figura 2-33). Como en el NADH, el ion hidruro del NADPH que debe ser transferido forma parte de un anillo de nicotinam ida y se separa fcilm ente debido a que el anillo puede adoptar un estado arom tico ms estable si pierde el ion hidruro (vase Figura 2-24). Por consiguiente, tanto el NADH como el NADPH m antienen este ion hidruro a travs de un enlace de alta energa y, a

Figura 2-33 Fase final de una de las rutas de biosntesis que conducen a la formacin del colesterol. La reduccin del enlace C=C se consigue mediante la transferencia de un ion hidruro procedente de la molcula transportadora NADPH, ms un protn (H+ ) de la solucin.

82

Captulo 2 : Pequeas molculas, energa y biosntesis

Figura 2-34 La estructura del NADPH. Se diferencia de ia del NADH (vase Figura 2-24) nicamente por la presencia de un grupo fosfato adicional, el cual permite que el NADPH sea reconocido selectivamente por enzimas implicadas en la biosntesis.

Fk
anillo de nicotinam ida N

//
< "

O
NH,

partir de l, pueden transferirlo a otra molcula siempre que exista la enzima adecuada para catalizar la transferencia. La diferencia entre el NADH y el NADPH es trivial desde el punto de vista qumico: el NADPH tiene un grupo fosfato ms, en una zona de la molcula ale jada de la regin activa (Figura 2-34). Este grupo fosfato extra carece de impor tancia para la reaccin de transferencia del ion hidruro, pero sirve de asa para unir el NADPH como coenzima. Por regla general, el NADH se une a enzimas que catalizan reacciones catablicas, mientras que el NADPH acta con enzimas que catalizan reacciones de biosntesis. Al tener las dos cocnzimas que actan en pro cesos diferentes, la clula puede mantener la relacin NADPH:NADP* alta para aportar el poder reductor necesario para los procesos de biosntesis mientras que, simultneamente, puede mantener la relacin NADH:NAD+ baja para tener NAD+disponible para aceptar electrones durante el catabolismo.

POLISACARIDOS

CIDO S NUCLEICO S

glucosa
CHoOH

glucgeno
C H 2O H c h 7o h

-o
OH HO OH OH

O
CHn .O .

O
CH2

o
OH

-o0 OH

h 2o

energa de la hidrlisis del nuclesido trifosfato

0 1 0 1
CH,

OH

o = poRNA

o = p -O

1 O

C H tO H

C H ?O H

C H ,O H

o
OH HC

CH,

OH

.O .

o
OH

o-

OH
- O -

OH

OH

H20 energa de la hidrlisis del nuclesido trifosfato

OH

- 0 = P - -O

PROTENAS

HO

protena
H O

am inocido
Y
\
OH

o = p- -o o
OH RNA

o
CH,

I I
R

I I I
H

H N C C

---------C C N -

y
\

o
nucletido
CH, .O . OH

O.

OH

H20
H O R

energa de la hidrlisis del nuclesido trifosfato


O H

OH

OH

---------- C C N -

-c c N cH H R

II

I
R

I
H

protena

Figura 2-35 Sntesis de macrom olculas. Esbozo de las reacciones de polimerizacin mediante las cuales se sintetizan tres clases de polmeros biolgicos, mostrando que en cada caso la sntesis implica la prdida de agua (deshidratacin). En la figura no se muestra el consumo de nuclesidos trifosfato altamente energticos, necesaria para OH activar cada monmero antes de su adicin. Por el contrario, la reaccin inversa -la degradacin de los tres tipos de polm eros- se produce mediante la simple adicin de agua (hidrlisis).

La biosntesis y la creacin de orden

83

POLIMERIZACIN POR LA CABEZA (p. ej PROTENAS, CIDOS GRASOS)


' ' ! + n i >

POLIMERIZACIN POR LA COLA (p. ej DNA, RNA, POLISACRIDOS)

mm

' ................................ i

cada m onm ero transporta un enlace rico en energa que ser utilizado para la adicin del m onm ero siguiente

cada m onm ero transporta un enlace rico en energa para su propia adicin

vi
Figura 2-36 Intermediarios activados en reacciones de polimerizacin. Se compara el crecimiento de polmeros por la cabeza y por la cola.

Los polmeros biolgicos se sintetizan mediante la repeticin de reacciones elem entales de deshidratacin
Las principales macromolculas sintetizadas por las clulas son los polinucletidos (DNA y RNA), los polisacridos y las protenas. Son extraordinariamente di versos en cuanto a estructura, e incluyen las molculas ms complejas conoci das. A pesar de ello, se sintetizan a partir de un nmero relativamente reducido de pequeas molculas (denominadas o a travs de una restringida gama de reacciones qumicas. En la Figura 2-35 se muestra un esbozo sobresimplificado del mecanismo de adicin de m onmeros a las protenas, a los polinucletidos y a los polisacri dos. A pesar de que en las reacciones de sntesis de cada polmero participan di ferentes tipos de enlaces covalentes, diferentes enzimas y diferentes coenzimas, existen similitudes bsicas entre ellas. Como se indica por el sombreado en rojo, en cada caso la adicin de subunidades se produce por una reaccin de deshi dratacin que supone la elim inacin de una molcula de agua de las dos m ol culas que reaccionan. Como en el caso general que hem os estudiado en la pgina 79, la formacin de estos polmeros requiere el aporte de energa qumica, la cual se consigue mediante la estrategia estndar de acoplar la reaccin de biosntesis a la hidrli sis energticam ente favorable de un nuclesido trifosfato. En los tres tipos de macromolculas se degrada por lo m enos un nuclesido trifosfato generando pirofosfato, que se hidroliza inm ediatamente aumentando la fuerza impulsora de la reaccin. En la Figura 2-31 ilustramos el m ecanism o utilizado para la sntesis de polinucletidos. Los intermediarios activos de las reacciones de polimerizacin pueden origi narse de dos maneras distintas, producindose la polimerizacin por la cabeza o el enlace activo por la cola de los monmeros. En la est presente en el extremo del polmero en crecimiento, y por lo tanto debe ser regenerado cada vez que se aade un monmero. En este caso, cada monmero contiene el grupo activo que ser utilizado para reaccionar con el siguiente m o nmero de la serie (Figura 2-36). En la el enlace activo transportado por cada monmero se utiliza para la adicin del propio monm e ro. Para la sntesis de macromolculas biolgicas se utilizan ambos tipos de poli merizacin. La sntesis de polinucletidos y de algunos polisacridos simples, por ejemplo, se produce mediante la polimerizacin por la cola, mientras que la sn tesis de las protenas ocurre por el sistema de polimerizacin por la cabeza.

monmeros suburtidades),

polimerizacin por la cabeza, polimerizacin por la cola,

Resumen

Normalmente la hidrlisis del ATP se acopla a reacciones energticamente desfavora bles, como la biosntesis de macromolculas, mediante la transferencia de gruposfosfato formando intermediarios fosforilados reactivos. Como ahora la reaccin energtica mente desfavorable se ha vuelto energticamentefavorable, se dice que el ATP impulsa la reaccin. Las molculas polimricas como las protenas, los cidos nucleicos y los polisa cridos, se ensamblan a partir de pequeas molculas precursoras activadas mediante reacciones repetidas de deshidratacin impulsadas de esta forma. Otras molculas reac84 Captulo 2 : Pequeas molculas, energa y biosntesis

Figura 2-37 (pgina opuesta) Algunas de las reacciones qumicas que se producen en la clula. (A) El esquema muestra unas 500 reacciones metablicas comunes, representando cada especie qumica con un crculo. En rojo se presentan las reacciones centrales de la glucolisis y del ciclo del cido ctrico. Una clula de mamfero tpica sintetiza ms de 10 000 protenas diferentes, la mayor parte de las cuales son enzimas. En el segmento escogido de forma arbitraria en este laberinto metablico (sombreado en amarillo), se sintetiza colesterol a partir del acetil CoA. A la derecha y por debajo del laberinto, este segmento escogido se muestra con mayor detalle (B).

tres m olculas de acetil CoA


2 CoASH

CH2c o c r n i //J c h 3- c - c h 2c x
H S C oA

hidroxim e tilgluta ril CoA


2 NADPH 2 CoASH 2c ~
c h

2 NADP+
c h o o

c h

,-

c h

7-

2o

OH

m evalonato
-2 n u
2 [PP] C H 2C O O

CH 3- C - C H 2 CH 2 O - ( p ) - 0
OH

pirofosfom evalonato
CO
|a d p + Pi

c h

3-

c h

2c

2o - -

isopentenil pirofosfato ISOMERIZACINv


c h

CH 3 -C = C H C H 2 O - 0 - 0

d im etilalil pirofosfato
CHj
c h

CH3
h c h

3-

=c

2c

2-

=c

h c h

2o - 0 - 0

geran'il pirofosfato sopenteml pirofosfato PP

farnesil pirofosfato NADPH -- NADP+ ^ DOS MOLCULAS CONDENSADAS

colesterol

NADP+ NADPH + H+

7-dehidrocolesterol

lanosterol

escualeno

85

tivas, denominadas coenzimas, transfieren otros grupos qumicos en el transcurso de la biosntesis: el NADPH por ejemplo, transfiere hidrgeno en forma de un protn y dos electrones (ion hidruro), mientras que el acetil CoA transfiere grupos acetilo. Coordinacin entre catabolismo y biosntesis1 9
El m etabolism o est organizado y regulado
La Figura 2-37 nos da una idea de lo complicada que resulta una clula cuando se considera como una mquina qumica; la figura es un esquema que tan slo muestra algunas de las etapas enzimticas de una clula. Todas estas reacciones tienen lugar en una clula que tiene menos de 0,1 mm de dimetro, y cada una de ellas requiere la participacin de una enzima, la cual, a su vez, es el producto de una serie de reacciones de transferencia de informacin y de sntesis protei ca. Para una molcula pequea tpica -p o r ejemplo, el aminocido serina- po demos encontrar ms de media docena de enzimas que pueden modificarlo de diferentes maneras: unindolo al AMP (adenilarlo) preparndolo para la sntesis de protenas, degradarlo a glicina, transformarlo en piruvato preparndolo para su oxidacin, acetilarlo mediante acetil CoA o transferirlo a un cido graso pro duciendo fosfatidilserina. Todas estas diferentes vas compiten por la misma molcula de serina. Al mismo tiempo se est produciendo una lucha similar a sta, para miles de pequeas molculas. Se podra pensar que todo el sistema debe estar equilibrado tan finamente que cualquier trastorno menor, tal como un cam bio temporal de la dieta, podra tener resultados desastrosos. De hecho, la clula es asombrosam ente estable. Siempre que es perturbada, reacciona hasta recuperar su estado inicial. Puede adaptarse y continuar su fun cin de una manera coherente durante perodos de ayuno o de enfermedad. Mutaciones de m uchos tipos pueden eliminar una reaccin de una determinada va, y a pesar de ello -siem pre que se cumplan ciertos requisitos m nim os- la c lula sobrevive. Esto es as porque en las clulas existe una elaborada red de m e canismos de control que regulan y coordinan la velocidad de sus reacciones. Al gunos de los niveles superiores de control se estudiarn en captulos posteriores. Aqu nos limitaremos a describir los m ecanismos ms simples que regulan el flujo de pequeas molculas a travs de las diferentes vas metablicas.

Las vas m etablicas estn reguladas a travs de cambios de la actividad enzim tica 20
Las concentraciones de las diversas molculas pequeas de una clula estn amortiguadas frente a cambios importantes, mediante un proceso conocido como regulacin por retroalimentacin (feedback) que adapta el flujo de metabolitos a travs de una va determinada mediante un aumento o una disminucin tempo ral de la actividad de enzimas cruciales. Por ejemplo, la enzima inicial de una se rie de reacciones suele estar inhibida por retroalimentacin negativa del producto final de esta va: si se acumulan grandes cantidades del producto final, automti camente queda inhibida la entrada de ms precursores a la va (Figura 2-38). Cuando las vas se ramifican o se cruzan, cosa que sucede a menudo, general mente existen varios puntos de control mediante diferentes productos finales. La complejidad de estos procesos de control por retroalimentacin queda ilustrada en la Figura 2-39, que muestra el esquema de regulacin enzimtica observado en un grupo de vas metablicas de aminocidos relacionados. La regulacin por retroalim entacin puede actuar casi instantneamente y es reversible; adems, un producto final dado puede activar enzimas conducto ras de otras vas e inhibir enzimas que producen su propia sntesis. Se conoce bien la base molecular de este tipo de control pero debido a que su estudio re quiere unos conocim ientos determinados sobre la estructura de las protenas, no entrarem os en l hasta el Captulo 5.

86

Captulo 2 : Pequeas molculas, energa y biosntesis

Las reacciones catablicas pueden revertirse mediante un aporte de energa 21


Regulando unas cuantas enzimas de puntos clave de la red metabolica pueden conseguirse cambios a gran escala que afecten el metabolismo de toda la clula. Por ejemplo, un patrn especial de regulacin por retroalimentacin permite que una clula pase de la degradacin de glucosa a la biosntesis de glucosa (de nominada gluconeognesis). La necesidad de la gluconeognesis es especialm en te aguda en los perodos de ejercicio violento, cuando la glucosa necesaria para la contraccin muscular debe ser generada por las clulas hepticas, y tambin en perodos de ayuno, en los que, para sobrevivir, la glucosa debe ser sintetizada a partir del glicerol de las grasas y de los aminocidos. La degradacin normal de la glucosa hasta piruvato, por la glucolisis, est catalizada por varias enzimas que actan en serie. La mayora de las reacciones catalizadas por estas enzimas son fcilmente reversibles, pero tres de estas reac ciones (los nmeros 1, 3 y 9 en la secuencia de la Figura 2-21) son claramente irreversibles. De hecho, el importante cambio de energa libre que se produce en estas reacciones es lo que normalmente impulsa la secuencia de reacciones en la direccin de la degradacin de la glucosa. Para que las reacciones se produz can en direccin opuesta y se pueda formar glucosa a partir de piruvato, es ne cesario superar cada una de estas tres reacciones. Ello se consigue mediante tres reacciones alternativas, catalizadas enzimticamente, que son impulsadas cuesta arriba gracias a un aporte de energa qumica (Figura 2-40). As, cuando una molcula de glucosa se degrada a dos molculas de piruvato, se generan dos

Figura 2 -38 Inhibicin por retroalim entacin de una va de biosntesis. Cada letra representa una pequea molcula diferente, y cada fle c h a negra simboliza una reaccin catalizada por una enzima diferente. El producto final Z inhibe la primera enzima que es la nica que lo sintetiza, de forma que Z controla su propio nivel en la clula. Se trata de un ejemplo de retroalim en tacin negativa (feed b a c k negativo).

Figura 2-39 Inhibicin por retroalim entacin en la sntesis de los am inocidos lisina, metionina, treonina e isoleucina, en las bacterias. En este diagrama cada reaccin catalizada por una enzima est representada por una fle c h a negra, mientras que las flechas rojas indican las posiciones en las que los productos retroalim entan inhibiendo las enzimas. Obsrvese que tres enzimas diferentes (denominadas isoen zim as ) catalizan la reaccin inicial, y que cada una de ellas est inhibida por un producto distinto.

Coordinacin entre catabolismo y biosntesis

87

Figura 2-40 Com paracin entre las reacciones que producen glucosa durante la gluconeognesis y las reacciones que degradan la glucosa durante la glucolisis. Las reacciones de degradacin (glucolfticas) son energticamente favorables (el cambio de energa libre es inferior a cero), mientras que las reacciones de sntesis requieren un aporte de energa. Para sintetizar glucosa se necesitan diferentes enzimas de derivacin necesarias para saltar" las reacciones 1,3 y 9 de la glucolisis. El flujo total de compuestos entre la glucosa y el piruvato est determinado por m ecanismos de control por retroalimentacin que actan controlando el metabolismo de las molculas que participan en estos tres pasos.

molculas de ATP pero la reaccin inversa de la gluconeognesis requiere cuatro molculas de ATP y dos molculas de GTP, lo cual, en total, es equivalente a la hidrlisis de seis molculas de ATP por cada molcula de glucosa sintetizada. Las reacciones de desvo de la Figura 2-40 deben estar controladas, de ma nera que se degrade glucosa rpidamente cuando se necesite energa y se sinte tice glucosa cuando la clula est repleta de energa. Si las reacciones pudieran producirse en ambos sentidos sin restricciones, enviaran grandes cantidades de

88

Captulo 2 : Pequeas molculas, energa y biosntesis

metabolitos hacia adelante y hacia atrs, siguiendo unos ciclos ftiles que con sumiran grandes cantidades de ATP sin ningn objetivo concreto. La elegancia de estos mecanismos de control puede ilustrarse con un ejem plo clave. El paso 3 de la glucolisis es una de las reacciones que debe ser supera da durante la formacin de glucosa (vase Figura 2-40). Normalmente el paso implica la adicin a la fructosa 6-fosfato de un grupo fosfato procedente del ATP, y est catalizado por la enzima fosfofructoquinasa. Esta enzima es activada por AMP, ADP y fosfato inorgnico e inhibida por ATP, citrato y cidos grasos. As pues, la enzima se activa por la acumulacin de los productos de la hidrlisis del ATP cuando el aporte de energa es bajo y se inactiva cuando la cantidad de energa (en forma de ATP) o el aporte de alimentos, como pueden ser cidos gra sos o citrato (derivado de los aminocidos) son abundantes. La fructosa bisfosfatasa es la enzima que cataliza la reaccin inversa (la hidrlisis de fructosa 1,6 bisfosfato a fructosa 6-fosfato, que conduce hacia la formacin de glucosa); esta enzima est regulada de manera opuesta por el mismo sistema de retroinhibicin, de forma que se estimula cuando la fosfofructoquinasa se inhibe.

Las enzimas pueden activarse e inhibirse mediante m odificaciones covalentes 22


Los sistemas de control por retroalimentacin que acabamos de describir per miten que las velocidades de las secuencias de reacciones estn reguladas de manera continua y automtica, segundo a segundo, en respuesta a fluctuacio nes del metabolismo. Las clulas disponen de varios dispositivos para regular las enzimas cuando los cambios de su actividad han de ser ms prolongados, del orden de minutos u horas. Estos sistemas implican la modificacin covalen te reversible de las enzimas. Casi siempre estas modificaciones se consiguen mediante la adicin de un grupo fosfato a un residuo determinado de serina, de treonina o de tirosina de la enzima. El fosfato procede del ATP y su transferencia est catalizada por una familia de enzimas conocidas como protena quinasas. En el Captulo 5 describiremos como la fosforilacin puede alterar la forma de una enzima, aumentando o inhibiendo su actividad. La eliminacin posterior del grupo fosfato, que revierte el efecto de la fosforilacin, se consigue mediante una segunda enzima denominada proteina fosfatasa. La modificacin covalente de las enzimas aade otra dimensin al control metabolico, ya que permite que las vas de reaccin especficas sean reguladas por seales (como las hormonas y factores de crecimiento) que no estn relacionadas con los propios intermediarios metablicos.

Las reacciones estn compartimentadas, tanto dentro de las clulas como dentro de los organismos 23
No todas las reacciones m etablicas de una clula se producen dentro del mis mo compartimiento citoplasmtico. Puesto que diferentes enzimas se hallan en diferentes compartimientos de la clula, el flujo de los componentes qumicos est canalizado, tanto fsica como qumicamente.

trm eros de lipoam ida reductasatransacetilasa


8

+ 1 2 m olculas de dihidrolipoil deshidrogenasa

+ 24 molculas de piruvato descarboxilasa

Figura 2-41 Estructura de la piruvato-deshidrogenasa. Este com plejo enzim tico cataliza la conversin de piruvato en acetil CoA. Se trata de un ejemplo de un gran com plejo multienzimtico en el que los intermediarios de la reaccin pasan directam ente de unas enzimas a otras.

Coordinacin entre catabolismo y biosntesis

89

La forma ms simple de esta segregacin espacial se produce cuando dos enzi mas que catalizan reacciones secuenciales forman un complejo enzimtico, y el producto de la primera enzima no ha de difundir a travs del citosol para encontrar la segunda enzima. En cuanto ha terminado la primera reaccin empieza la segun da. Algunos grandes agregados enzimticos realizan toda una serie de reacciones sin perder el contacto con el substrato. Por ejemplo, la transformacin del piruvato en acetil CoA ocurre en tres pasos qumicos que se producen sobre el mismo gran complejo enzimtico (Figura 2-41); en la sntesis de los cidos grasos, una secuen cia de reacciones an ms larga est catalizada por un nico conjunto de enzimas. No resulta sorprendente que algunos de los mayores complejos enzimticos estn destinados a la sntesis de macromolculas como las protenas y el DNA. El siguiente nivel de segregacin espacial en las clulas se refiere al confina miento de enzimas relacionadas funcionalmente dentro de la misma membrana o dentro de los compartimientos acuosos de un orgnulo que est rodeado por una membrana. El metabolismo oxidativo de la glucosa constituye un buen ejemplo de ello. Despus de la glucolisis, el piruvato se transporta activamente desde el citosol hasta el compartimiento interno de la mitocondria, el cual contiene todas las enzi mas y metabolitos que intervienen en el ciclo del cido ctrico (Figura 2-42). Adems la propia membrana mitocondrial interna contiene todas las enzimas que catalizan las reacciones siguientes de la fosforilacin oxidativa, incluidas las enzimas implica das en la transferencia de electrones desde el NADH al 0 2 y las implicadas en la sn tesis del ATP. Por consiguiente, la mitocondria puede ser considerada como una pe quea fbrica productora de ATP. Anlogamente, otros orgnulos celulares, como el ncleo, el complejo de Golgi y los lisosomas, pueden ser considerados como com partimientos especializados donde se encuentran confinadas enzimas relacionadas funcionalmente y que realizan tareas especficas. En cierto sentido, la clula viva es como una ciudad, con muchos servicios especializados concentrados en diferentes reas, intensamente interconectadas por diversas vas de comunicacin. La organizacin espacial de los organismos pluricelulares se extiende ms all de la clula individual. Los diferentes tejidos del cuerpo tienen diferentes grupos de enzimas y realizan contribuciones distintas a la qumica del organismo com pleto. Adems de las diferencias entre los diferentes tipos de clulas de un mismo organismo en cuanto a productos especializados como las hormonas o los anti cuerpos, tambin existen diferencias considerables en cuanto a las vas metablicas habituales. Aunque prcticamente todas las clulas contienen las enzimas de la glucolisis, del ciclo del cido ctrico, de la sntesis y de la degradacin de los lpidos y del m etabolismo de los aminocidos, los niveles de estos procesos en los diferentes tejidos estn regulados de forma diferente. Las clulas nerviosas, que probablemente son las clulas ms exigentes del cuerpo, carecen casi totalmente de reservas de glucgeno y de cidos grasos, dependiendo casi por completo del aporte de glucosa de la sangre. Las clulas hepticas proporcionan glucosa a las fi bras musculares que se contraen activamente, y reciclan de nuevo a glucosa el ci do lctico producido por estas clulas musculares (Figura 2-43). Todos los tipos de clulas tienen sus rasgos metablicos caractersticos y cooperan intensamente, tanto en el estado normal como en la respuesta al ejercicio, al estrs y al hambre.

membrana plasmtica

glucolisis el citosol

ciclo del cido ctrico V fosforilacin oxidativa en la mitocondria

Figura 2 -42 Segregacin de los diversos pasos de la degradacin de la glucosa en la clula eucariota. La glucolisis se produce en el citosol, mientras que las reacciones del ciclo del cido ctrico y de la fosforilacin oxidativa ocurren nicam ente en las mitocondrias.

G A D

Figura 2-43 Representacin esquem tica de la cooperacin m etablica entre las clulas hepticas y las fibras musculares. El principal combustible de las fibras musculares en activa contraccin es la glucosa, gran parte de la cual est suministrada por las clulas hepticas. El cido lctico, producto final de la degradacin anaerbica de la glucosa por glucolisis en el msculo, se transforma de nuevo en glucosa en el hgado mediante el proceso de gluconeognesis.

90

Captulo 2 : Pequeas molculas, energa y biosntesis

Resumen
Los muchos miles de reacciones qumicas distintas realizadas simultneamente por una clula estn estrechamente coordinadas. Diversos mecanismos de control regulan las actividades de las enzimas clave, en respuesta a las condiciones cam biantes de la clula. Una form a muy comn de regulacin estriba en la inhibicin por retroalimentacin, rpidamente reversible, ejercida por el producto final sobre la primera enzima de una va. Una form a ms prolongada de regulacin implica la modificacin qumica de una enzima por otra enzima, a menudo mediante fosfori lacin. Combinaciones de mecanismos reguladores pueden producir cambios im portantes y prolongados en el metabolismo de la clula. No todas las reacciones ce lulares se producen dentro del mismo compartimiento intracelular, de form a que la segregacin espacial, mediante membranas internas, permite que los orgnulos se especialicen en tareas bioqumicas.

Bibliografa
General
Becker, W.M.; Deamer, D.W. The World of the Cell, 2nd ed. Redwood City, CA: Benjamin-Cummings, 1991. Herriott, J.; Jacobson, G.; Marmur, J.; Parsom, W. Papers in Biochemistry. Reading. MA: Addison-Wesley, 1984. Lehninger, A.L.; Nelson, D.L.; Cox, M.M. Principios de Bio qumica, 2.a ed. Barcelona: Ediciones Omega, S.A., 1993 Mathews, C.K.; van Holde, K.E. Biochemistry. Menlo Park, CA: Benjamin-Cummings, 1990. Stryer, L. Biochemistry, 3rd ed. New York: W.H. Freeman, 1988.

Citas
1. Atkins, P.W. Molecules. New York: Scientific American Library, 1987. Henderson, L.J. The Fitness of the Environment. Boston: Beacon, 1927; reimpresin 1958. (Un anlisis clsico y de fcil lectura.) 2. Ingraham, J.L.; Maaloe, O.; Neidhardt, F.C. Growth of the Bacterial Cell. Sunderland, MA: Sinauer, 1983. 3. Sharon, N. Carbohydrates. Sei. Am. 243(5):90-116, 1980. 4. Robertson, R.N. The Lively Membranes. Cambridge, UK: Cambridge University Press, 1983. 5. Branden, C.; Tooze, J. Introduction to Protein Structure. New York: Garland, 1991. 6. Saenger, W. Principles of Nucleic Acid Structure. New York: Springer, 1984. 7. Hess, B.; Markus, M. Order and chaos in biochemistry. Trends Biochem. Sei. 12:45-48, 1987. Schrdinger, E. What Is Life? Mind and Matter. Cam bridge, UK: Cambridge University Press, 1969. 8. Atkins, P.W. The Second Law. New York: Scientific Ame rican Books, 1984. Dickerson, R.E. Molecular Thermodynamics. Menlo Park, CA: Benjamin, 1969. Klotz, I.M. Energy Changes in Biochemical Reactions. New York: Academic Press, 1967. 9. Youvan, D.C.; Marrs, B.L. Molecular mechanisms of photosynthesis. Sei. Am. 256(6):42-49, 1987. 10. Leehninger, A.L. Bioenergetics: The molecular Basis of Biological Energy Transformations, 2nd ed. Menlo Park, CA: Benjamin-Cummings, 1971. Racker, E. From Pasteur to Mitchell: a hundred years of bioenergetics. Fed. Proc. 39:210-215, 1980.

11. Fothergill-Gilmore, L.A. The evolution of the glycolytic pathway. Trends Biochem. Sci. 11:47-51, 1986. 12. Lipmann, F. Wanderings of a Biochemist. New York: Wiley, 1971. 13. Schlenk, F. The ancestry, birth and adolescence of ATP. Trends Biochem. Sci. 12:367-368, 1987. 14. Abeles, R.H.; Frey, P.A.; Jencks, W.P. Biochemistry. Bos ton: Jones and Bartlett, 1992. McGilvery, R.W. Biochemistry: A Functional Approach, 3rd ed. Philadelphia: Saunders, 1983. 15. Kornberg, H.L. Tricarboxylic acid cycles. Bioessays 7:236-238, 1987. Krebs, H.A. The history of the tricarboxylic acid cycle. Perspect. Biol. Med. 14:154-170, 1970. Krebs, H.A.; Martin, A. Reminiscences and Reflections. Oxford, UK: Clarendon Press; New York: Oxford Uni versity Press, 1981. 16. Pullman, M.E., et al. Partial resolution of the enzymes catalyzing oxidative phosporylation. /. Biol. Chem. 235:3322-3329, 1960. 17. Prigogine, I.; Stengers, I. Order out of Chaos: Mans New Dialogue with Nature. New York: Bantam Books, 1984. 18. Eisenberg, D.; Crothers, D. Physical Chemistry with Ap plications to the Life Sciences. Menlo Park, CA: Ben jamin-Cummings, 1979. Kauzmann, W. Thermodynamics and Statistics: With Applications to Gases. New York: Benjamin, 1967. 19. Martin, B.R. Metabolic Regulation: A Molecular Appro ach. Oxford, UK; Blackwell Scientific, 1987. Newsholme, E.A.; Start, C. Regulation in Metabolism. New York: Wiley, 1973. 20. Pardee, A.B. Molecular basis of biological regulation: origins of feedback inhibition and allostery. Bioessays 2:37-40, 1985. 21. Hess, B. Oscillating reactions. Trends Biochem. Sci. 2:193-195, 1977. 22. Cohen, P. Control of Enzyme Activity, 2nd ed. London: Chapman and Hall, 1983. Koshland, D.E., Jr. Switches thresholds and ultrasensiti vity. Trends Biochem. Sci. 12:225-229, 1987. 23. Banks, P.; Bartley, W.; Birt, M. The Biochemistry of the Tissues, 2nd ed. New York: Wiley, 1976. Sies, H. Metabolic Compartmentation. New York: Aca demic Press, 1982.

Bibliografa

91

Macromolculas: estructura, forma e informacin

3
Procesas de reconocimiento molecular Acidos nucleicos Estructura de las protenas Las protefnas como catalizadores

Al considerar la transicin desde las pequeas molculas de la clula hasta las ma cromolculas gigantes, asistimos a mucho ms que a un simple aumento de tama o. Aunque las protenas, los cidos nucleicos y los polisacridos estn construidos a partir de una coleccin restringida de aminocidos, nucletidos y azcares res pectivamente, pueden presentar propiedades nicas y realmente sorprendentes, que les confieren unas caractersticas muy lejanas a sus precursores qumicos. Las macromolculas biolgicas estn compuestas de varios cientos -a veces de millo n es- de tomos unidos entre ellos formando disposiciones espaciales definidas de forma muy precisa. Cada una de estas macromolculas contiene una informacin muy especfica. Incorporadas a su estructura, existen series de mensajes biolgicos que pueden ser ledos cuando estas macromolculas interaccionan con otras mol culas, permitindoles desarrollar una funcin determinada. En este captulo examinaremos las estructuras de las macromolculas, dedi cando un inters especial a las protenas y a los cidos nucleicos y explicando cmo, a lo largo de la evolucin, se han adaptado para desarrollar funciones determina das. Consideraremos los principios por los cuales estas macromolculas catalizan transformaciones qumicas, construyen complejas estructuras multimoleculares, generan movimiento y -m ucho ms fundamental que todo esto- almacenan y transmiten informacin hereditaria.

azcares, am inocidos y nucletidos -0,5-1 nm

v fe

protenas globulares ~ 2 - 1 0 nm

Procesos de reconocimiento molecular1


Las macromolculas tienen un peso molecular que normalmente oscila entre 10 000 y 1 milln, y un tamao intermedio entre las molculas orgnicas de la clula, tratadas en el Captulo 2, y los grandes agregados macromoleculares y orgnulos, que sern objeto de estudio de captulos posteriores (Figura 3-1). Una pequea molcula, la del agua, constituye el 70% de la masa total de la clula; casi todo el resto de la masa son macromolculas (Tabla 3-1). Tal com o se ha descrito en el Captulo 2, una macromolcula se ensambla a partir de subunidades de peso molecular menor, que se aaden una tras otra formando un largo polmero a modo de cadena (vase Figura 2-35). General mente, en la construccin de cada cadena participa nicamente una familia de subunidades: los aminocidos se unen a otros aminocidos formando las prote nas, los nucletidos se unen a otros nucletidos formando los cidos nucleicos; y los azcares se unen a otros azcares formando los polisacridos. Puesto que la secuencia exacta de las subunidades es crucial para la funcin de una molcu-

ribosom a -30 nm

Figura 3-1 Com paracin entre el tam ao de las molculas proteicas y el de otros com ponentes celulares. Los ribosomas son importantes agregados macromoleculares com puestos por unas 60 protenas y molculas de RNA.

93

Tabla 3-1 C om p osicin q u m ica ap ro xim ad a de u n a b a cte ria tpica y de u n a cel la de m am fero tpica P o rce n ta je del peso to tal de la clula
E. coli

C om ponente
Ho0 Io n e s in o rg n ic o s (N a+, K+, M g2+, C a2+, Cl~, e tc.) A lgun os m e ta b o lito s p e q u e o s P ro te n a s RNA DNA F o sfo lp id o s O tro s lp id o s P o lisa c rid o s V o lu m e n c e lu la r to tal: V o lu m e n c e lu la r relativ o :

Bacteria
70 1 3 15 6 1 2 2 2 x l0 ~ ,2 c m 3 1

Clula de mamfero
70 1 3 18 1,1 0 ,2 5 3 2 2 4 x 10 9 c m 3 2000

Las protenas, los polisacridos, el DNA y el RNA son macromolculas. Los lpidos generalm en te no se clasifican com o m acrom olculas, a pesar de que tienen algunas de sus caractersticas; por ejemplo, la mayora de ellos se sintetizan com o polmeros lineales de una molcula menor (el grupo acetil de acetil CoA) y se autoensam blan formando grandes estructuras (membranas). Ntese que el agua y las protenas com prenden la mayor parte de la masa tanto de las clulas de mamfero com o de las bacterias.

la, su biosntesis requiere mecanismos que aseguren que cada subunidad ade cuada se coloque en el polmero en la posicin exacta de la cadena.

Las interacciones especficas de una macromolcula dependen de enlaces dbiles no covalentes 2


Una cadena macromolecular se mantiene unida por medio de enlaces covalentes, que son suficientemente fuertes como para preservar la secuencia de subunidades durante largos perodos de tiempo. A pesar de que la secuencia de subunidades de termina la informacin contenida en una macromolcula, la utilizacin de esta in formacin depende en gran medida de otros enlaces mucho ms dbiles, los enlaces no covalentes. Estos enlaces dbiles se forman entre diferentes regiones de la misma macromolcula, y tambin entre diferentes macromolculas. Por ello, estos enlaces determinan en gran medida tanto la estructura tridimensional de las cadenas macromoleculares como la manera en que estas estructuras interaccionan entre s. Los enlaces no covalentes que se presentan en las molculas biolgicas, sue len clasificarse en tres tipos: enlaces Inicos, enlaces de hidrgeno y atraccio nes de van der Waals. Otra importante fuerza dbil se genera por la estructura tridimensional del agua, la cual tiende a unir los grupos hidrofbicos con el fin de minimizar su efecto destructor de la red de molculas de agua unidas por en laces de hidrgeno (vase Panel 2-1, pgs. 50-51). Esta expulsin de la solucin acuosa genera lo que algunas veces se considera como un cuarto tipo de enlace

m ovim iento trm ico m edio CONTENIDO ENERGTICO \Z (kcal/m ol) 0 ,1 enlace no covalente en el agua

hidrlisis de ATP en la clula

enlace C -C

Figura 3-2 Energas com parativas de algunos acontecim ientos moleculares im portantes de la clula. N tese que

10

100
luz verde

1000
oxidacin de la glucosa com pleta

los valores de energa se m u estran en una escala logartm ica.

94

Captulo 3 : Macromolculas: estructura forma e informacin

Tabla 3-2 Enlaces qumicos covalentes y no covalentes Fuerza (kcal/mol)* Tipo de enlace Longitud (nm)
0,15 0,25 0,30 0,35 En e l v a co 90 80 4 0,1 En el a g u a 90 3 1 0,1

Covalente Inico Hidrgeno A tracciones de van der W aals (por tom o)

*La fuerza de un enlace se puede medir como la energa necesaria para romperlo, que aqu se presenta en kaloras por mol (kcal/mol). (Una kilocalora es la cantidad de energa necesaria para incrementar en I o C la temperatura de 1000 g de agua. Una unidad alternativa de uso co mn es el kilojoule, kj, igual a 0,24 kcal.) La fuerza de cada enlace son los tomos que estn im plicados en su formacin, y del ambiente preciso en el que se halla el enlace; los valores de la tabla solamente son, por lo tanto, una gua aproximada. Ntese que el ambiente acuoso de una clula disminuye enormemente la fuerza de los enlaces inicos y de hidrgeno entre molculas diferentes a las de agua (Panel 3-1, pgs. 96-97). La longitud de enlace es la distancia entre los centros de los tomos diferentes al hidrgeno que participan en el enlace.

dbil no covalente. En el Panel 3-1, pginas 96-97, se exponen las caractersticas principales de estos cuatro tipos de enlaces dbiles. En un medio acuoso, los enlaces no covalentes son de 30 a 300 veces ms dbiles que los enlaces covalentes (Tabla 3-2) y slo ligeramente ms fuertes que la energa media de las colisiones trmicas a 37C (Figura 3-2). Por consiguiente, un nico enlace no covalente - a diferencia de lo que ocurre con un enlace cova len te- resulta demasiado dbil para resistir los movimientos trmicos que tien den a separar las molculas, por lo que son necesarios numerosos enlaces no covalentes para mantener unidas dos superficies moleculares. Entre dos superfi cies slo se pueden formar un elevado nmero de enlaces no covalentes si exis ten un elevado nmero de tomos de estas superficies que estn adaptados unos a los otros (Figura 3-3), lo cual determina la especificidad de reconocimiento biolgico, como ocurre entre una enzima y su substrato. Como se explica en la parte superior del Panel 3-1, los tomos se comportan casi como si fueran pesadas esferas de un radio determinado (su radio de van der Waals). El requerimiento de que dos tomos no pueden solaparse limita los ngulos de enlace posibles de una cadena polipeptdica (Figura 3-4). Estas y otras interacciones estricas reducen substancialmente el nmero de disposi ciones tridimensionales (o conform aciones) que son posibles. A pesar de ello, una larga cadena flexible como por ejemplo la de una protena, puede plegarse en un nmero enorme de diferentes posibilidades, teniendo cada conformacin

Figu ra 3 -3 Enlaces no covalentes.


Manera en que los enlaces dbiles median los procesos de reconocim iento entre las macromolculas.

( ^l
( ?,

),

las superficies de las m olculas A y B y A y C se adaptan mal y nicam ente son capaces de form ar unos cuantos enlaces dbiles; el m ovim iento trm ico las separa rpidam ente

la m olcula A encuentra a otras molculas (B, C y D)

las superficies de las m olculas A y D se adaptan bien, por lo que pueden form ar un nm ero suficiente de enlaces dbiles que perm ite resistir el m ovim iento trm ico, perm aneciendo unidas

Procesos de reconocimiento molecular

95

FUERZAS DE VAN DER WAALS


A u n a d is ta n c ia c o r ta , 2 t o m o s c u a le s q u ie r a m u e s t r a n u n a d b il in te r a c c i n d e e n la c e d e b id o a s u s c a r g a s e l c tric a s flu c t u a n t e s . E s ta f u e r z a r e c ib e e l n o m b r e d e a t r a c c i n d e v a n d e r W a a ls . S in e m b a r g o d o s t o m o s s e r e p e le n m u y e n e r g t ic a m e n t e si se lo s a c e r c a d e m a s ia d o . E s ta r e p u ls i n d e v a n d e r W a a ls d e s e m p e a u n p a p e l im p o r t a n t e lim it a n d o la s p o s ib le s c o n f o r m a c io n e s d e u n a m o l c u la . C a d a t ip o d e t o m o t ie n e u n r a d io , c o n o c id o c o m o r a d io d e v a n d e r W a a ls , e n el q u e la s fu e r z a s d e v a n d e r W a a ls e s t n e q u ilib r a d a s .

1,2 A (0 , 1 2 nm)

2,0 A (0 , 2 nm)

1,5 A (0,15 nm)

1,4 A (0,14 nm)

D o s t o m o s se a tr a e n e n t r e s p o r f u e r z a s d e v a n d e r W a a ls h a s ta q u e la d is ta n c ia e n tr e e llo s ig u a le la s u m a d e s u s r a d io s d e v a n d e r W a a ls . A p e s a r d e q u e e s ta s a t r a c c io n e s d e v a n d e r W a a ls s o n in d iv id u a lm e n t e m u y d b ile s , p u e d e n s e r im p o r t a n t e s c u a n d o d o s s u p e r fic ie s m a c r o m o le c u la r e s se a d a p t a n m u y b ie n u n a a o tr a .

ENLACES QUIMICOS DEBILES


Las m o l c u la s o r g n ic a s p u e d e n in t e r a c c io n a r c o n o tr a s m o l c u la s a t r a v s d e fu e r z a s n o c o v a le n t e s d e a lc a n c e r e d u c id o .

ENLACES DE HIDROGENO
U n t o m o d e h id r g e n o e s c o m p a r t id o p o r d o s to m o s ( a m b o s e le c t r o n e g a t iv o s , c o m o el O y el N ) fo r m n d o s e u n e n la c e d e h id r g e n o .

enlace covalente enlace de hidrgeno ~ 0 , 1 nm de largo ~ 0 , 2 nm de largo


L o s e n la c e s d e h id r g e n o s o n m s fu e r te s c u a n d o lo s tr e s t o m o s s e h a lla n e n ln e a re c ta :

T p ic a m e n t e , lo s e n la c e s q u m ic o s d b ile s t ie n e n u n a fu e r z a 2 0 v e c e s in f e r io r a la d e u n e n la c e c o v a le n t e . S lo s o n s u fic ie n te m e n te fu e r te s p a ra f ija r d o s m o l c u la s c u a n d o se f o r m a s im u lt n e a m e n t e u n n m e r o e le v a d o d e e llo s .

I N

n1 1 1 1 1 1 1 1 1 1O

ENLACES DE HIDROGENO EN EL AGUA


Las m o l c u la s q u e p u e d e n f o r m a r e n la c e s d e h id r g e n o c o n o tr a s t a m b i n p u e d e n , a lt e r n a t iv a m e n t e , f o r m a r e n la c e s d e h id r g e n o c o n m o l c u la s d e a g u a . D e b id o a e s ta c o m p e t e n c ia c o n las m o l c u la s d e a g u a lo s e n la c e s d e h id r g e n o f o r m a d o s e n tr e d o s m o l c u la s d is u e lta s e n a g u a s o n r e l a tiv a m e n t e d b ile s .

E je m p lo s e n m a c r o m o l c u la s : D o s c a d e n a s p o lip e p td ic a s d e a m in o c id o s u n id a s p o r e n la c e s d e h id r g e n o .

enlace peptdico
2 H .O

= 0 |||||||||| H N -H H C C

I I i
D o s b a s e s , G y C , u n id a s p o r e n la c e s d e h id r g e n o e n el D N A o e n el R N A . H

-N I LI

O "O I
H \ l 2H ,0

H
\

C // -C

) n- h iiiiiiio c c
n iiiiiiiiiiih N
/

N :C

-c-

O I I

-N H

\
N s

\
/ c N

C " Ns /

O II
-C

N c I
H

O IIIIIIIIH

96

Panel 3 1 Principales tipos de fuerzas no covalentes dbiles que unen las molculas entre s.

INTERACCIONES HIDROFBICAS
El a g u a u n e lo s g r u p o s h id r o f b ic o s c o n o b je t o d e m in im iz a r lo s e fe c to s d e s tr u c to r e s d e e s to s g r u p o s s o b r e la re d d e e n la c e s d e h id r g e n o d e l a g u a . A m e n u d o s e d ic e q u e lo s g r u p o s h id r o f b ic o s q u e s e m a n t ie n e n u n id o s d e e s ta m a n e r a e s t n u n id o s p o r " p u e n te s h id r o f b ic o s " , a p e s a r d e q u e la a t r a c c i n e s t g e n e r a d a e n r e a lid a d p o r u n a r e p u ls i n d e la s m o l c u la s de agua.

*
ENLACES INICOS EN SOLUCIONES ACUOSAS
Lo s g r u p o s c a r g a d o s e s t n p r o t e g id o s p o r s u s in t e r a c c io n e s c o n la s m o l c u la s d e a g u a . P o r e llo , lo s e n la c e s i n ic o s e n s o lu c i n a c u o s a s o n b a s t a n t e d b ile s .

% <
ENLACES IONICOS
Las in te r a c c io n e s i n ic a s s e p r o d u c e n e n tr e g r u p o s t o t a lm e n t e c a r g a d o s (e n la c e i n ic o ) o e n t r e g r u p o s p a r c ia lm e n t e c a r g a d o s .

r Xo H O IIIIIIIH O
\ H H H \

\
iI

O
O P O

,0
H'

O
HO

A d e m s , lo s e n la c e s i n ic o s se d e b ilit a n p o r la p r e s e n c ia d e s a le s , c u y o s t o m o s f o r m a n lo s c o n t r a io n e s q u e se d is t r ib u y e n a lr e d e d o r d e lo s io n e s d e c a r g a o p u e s ta .

La f u e r z a d e a tr a c c i n e n tr e las d o s c a r g a s 8 + y 8 es fu e r z a = -

5+5~
r D

( Le y d e C o u lo m b )

La m e d id a d e la in t e n s id a d d e la d e s e s t a b iliz a c i n d e la in te r a c c i n p o r s a le s s u p o n e u n a e s t im a c u a n t it a t iv a d e l n m e r o to t a l d e e n la c e s i n ic o s im p lic a d o s .

d o n d e D = c o n s ta n te d ie l c tr ic a (1 p a r a el v a c o , 8 0 p a r a el a g u a ) D e t o d o s m o d o s , lo s e n la c e s i n ic o s s o n m u y im p o r t a n t e s e n lo s s is te m a s b io l g ic o s . U n a e n z im a q u e s e u n a a u n s u b s tr a to c a r g a d o p o s it iv a m e n t e En a u s e n c ia d e a g u a , la s fu e r z a s i n ic a s s o n m u y in te n s a s . S o n r e s p o n s a b le s d e la d u r e z a d e m in e r a le s ta le s c o m o el m r m o l y el g a ta . a m e n u d o p r e s e n ta r e n el lu g a r a p r o p ia d o u n re s to d e a m in o c id o c a r g a d o n e g a t iv a m e n t e .

r = d is ta n c ia d e s e p a r a c i n

c ris ta l d e N aC I

97

Figura 3 -4 Limitaciones estricas de los ngulos de enlace en una cadena polipeptdica. (A) Cada aminocido contribuye con

tres enlaces (en rojo) a su cadena polipeptdica. El enlace peptdico es plano (sombreado en gris) y no permite rotacin. Por el contrario, se puede producir rotacin sobre del enlace Ca- C -a este ngulo de rotacin se le denomina psi (y)- y sobre el enlace N- C-a este ngulo de rotacin se le denomina phi ((p). El grupo R representa una cadena lateral de un aminocido. (B) La conformacin de los tomos principales de una cadena proteica viene determinada por un par de ngulos psi y phi para cada aminocido; debido a las colisiones estricas entre los aminocidos, la mayora de los pares de ngulos phi y psi no tienen lugar. En este grfico, llamado de Ramachandran, cada punto representa un par de ngulos observados en protenas. (B, de J. Richardson, Adv. Prot. Chem. 34:, 174-175,1981.)

-ISO"

1 8 0

(8 )

una coleccin diferente de interacciones dbiles dentro de la cadena, y es la fuer za total de estas interacciones lo que determina qu conformaciones se formarn. La mayora de protenas de una clula se pliegan de forma estable de una sola manera: durante el curso de la evolucin la secuencia de subunidades de aminoci dos ha sido seleccionada de forma que una determinada conformacin puede for mar muchas ms interacciones favorables en la propia cadena que cualquier otra.
Figura 3-5 Cuando varias subunidades se unen entre s de una forma regular, se genera una hlice.

En primer trmino se presenta la interaccin entre dos subunidades y detrs aparecen las hlices que resultan de esta interaccin. Las hlices que se presentan aqu son de (A) dos, (B) tres o (C) y (D) seis unidades por vuelta. En la parte superior de la figura se puede observar la disposicin de las subunidades desde la parte superior de cada hlice. Ntese que la hlice (D) tiene un paso de vuelta ms ancho que la hlice (C).

(A)

<B)

ICJ

(D>

98

Captulo 3 : Macromolculas: estructura, forma e informacin

Una hlice es un motivo estructural comn en las estructuras biolgicas generadas a partir de subunidades repetidas 3
A menudo, las estructuras biolgicas estn formadas por subunidades que son muy similares las unas a las otras -com o aminocidos o nucletidos-, formando una larga cadena repetitiva. Si todas las subunidades son idnticas, normalm en te ocurre que las adyacentes en la cadena se unen de una nica manera, ajustando sus posiciones relativas de forma que se minimice la energa libre de contacto entre ellas. En este caso, cada subunidad se colocar exactamente en la misma posicin en relacin a sus subunidades adyacentes, de modo que la subunidad 3 se unir a la subunidad 2 de la misma forma en la que la subunidad 2 se ha uni do a la subunidad 1, y as sucesivamente. Debido a que es muy raro que las sub unidades se unan formando una lnea recta, generalmente estas uniones origi nan una hlice -u n a estructura regular que se parece a una escalera de caracol, como se ilustra en la Figura 3-5. En funcin de la direccin de giro de la escalera de caracol, la hlice se denomina dextrgira o levgira (Figura 3-6). Esta caracte rstica no vara cuando la hlice se coloca cabeza abajo, pero es la inversa cuan do se refleja en un espejo. Las hlices son elementos habituales de las estructuras biolgicas, tanto si las subunidades son molculas pequeas que estn unidas entre s de forma covalente (como en el DNA), como si son grandes molculas proteicas unidas en tre s por fuerzas no covalentes (como en los filamentos de actina). Esto no es sorprendente. Una hlice es una estructura que en absoluto es excepcional, ge nerada simplemente por la unin, una contra otra, de muchas subunidades si milares, de forma que cada una adopta exactamente la misma relacin espacial con la subunidad anterior.

hlice levgira

hlice dextrgira

La difusin es el primer paso hacia el reconocim iento molecular 4


Para que dos molculas se unan entre s deben entrar en estrecho contacto. Esto se consigue gracias a los movimientos trmicos que hacen que las molculas se desplacen, o difundan, desde sus posiciones de partida. Puesto que las m olcu las de un lquido colisionan y se separan rpidamente unas de otras, una deter minada molcula se mueve primero en una direccin y luego en otra, en un movimiento al azar (Figura 3-7). La distancia media que recorre cada tipo de molcula desde su punto de partida es proporcional a la raz cuadrada del tiem po utilizado, es decir, si una molcula determinada necesita por trmino medio 1 segundo para desplazarse 1 |a.m , necesitar 4 segundos para desplazarse 2 (im, 100 segundos para desplazarse 10 |im, etc. Por lo tanto, la difusin es eficaz para que las molculas se desplacen a distancias limitadas, pero no es eficaz para dis tancias largas. Experimentos realizados inyectando a clulas colorantes fluorescentes y otras molculas marcadas demuestran que la difusin en el citoplasma de m ol culas pequeas es casi tan rpida como en el agua. Una molcula del tamao del ATP necesitar slo 0,2 segundos aproximadamente para difundir hasta una dis tancia media de 10 |j.m -e l dimetro de una clula animal pequea. Sin embargo, las grandes macromolculas se desplazan mucho ms lentamente. No slo pre sentan velocidades de difusin intrnsecamente ms lentas sino que adems su movimiento se ve retardado por frecuentes colisiones con otras muchas m acro molculas que se mantienen en su lugar mediante asociaciones moleculares en el citoplasma (Figura 3-8).

Figura 3-6 Com paracin entre una hlice levgira y otra dextrgira. Como referencia, es til recordar que los tornillos habituales, que avanzan cuando se les hace girar en el sentido de las agujas de un reloj, son dextrgiros. Ntese que cualquier hlice conserva el mismo sentido de giro (y por lo tanto su caracterstica de ser dextrgira o levgira) aunque se la coloque boca abajo.

Los movimientos trm icos unen a las molculas y luego las separan 4
Los encuentros entre dos macromolculas o entre una macromolcula y una molcula pequea, se producen al azar, por difusin simple. Un encuentro pue de conducir inmediatamente a la formacin de un complejo (en cuyo caso se

Figura 3-7 Un recorrido al azar. Las molculas de una solucin se desplazan al azar debido a continuas colisiones con otras molculas. Este movimiento permite a las pequeas molculas difundir de una zona a otra de la clula en perodos de tiempo sorprendentemente cortos: pueden difundir a travs de toda una clula tpica de mamfero en menos de un segundo.

Procesos de reconocimiento molecular

99

dice que la velocidad de formacin est limitada por la difusin). Alternativa mente, la velocidad de formacin del complejo puede ser ms lenta, por necesi tar que se produzca un reajuste de la estructura de una o de ambas molculas, antes de que las superficies interactivas puedan adaptarse una a la otra, de for ma que a menudo las dos molculas que colisionan se separarn una de la otra, sin llegar a unirse. En ambos casos, cuando las dos molculas interactivas se han acercado suficientemente una a la otra, forman entre ellas mltiples enlaces d biles, que persisten hasta que el movimiento trmico al azar hace que las mol culas se disocien de nuevo (Figura 3-3). Por regla general, cuanto ms fuerte es la unin de las molculas que forman el complejo, tanto ms baja es su velocidad de disociacin. En un caso extremo, la energa total de los enlaces formados puede ser insignificante en comparacin con la del movimiento trmico, por lo que las dos molculas se disociarn tan r pidamente como se han unido. En el otro caso extremo, la energa total de los en laces es tan alta que la disociacin se produce muy raramente. Las interacciones fuertes se producen en la clula cuando la funcin biolgica requiere que las dos macromolculas permanezcan estrechamente asociadas durante largo tiempo -por ejemplo, en el caso de una protena reguladora que debe permanecer unida al DNA para inhibir la expresin de un gen. Las interacciones dbiles se producen cuando la funcin requiere un cambio rpido de la estructura del complejo -por ejemplo, cuando las dos protenas que interaccionan han de cambiar de pareja, durante los movimientos de una mquina proteica.

100

nm

La constante de equilibrio constituye una medida de la fuerza de interaccin entre dos molculas 5
La fuerza exacta del enlace entre dos molculas es un ndice til de la especifici dad de su interacin. Para ilustrar cmo se mide la fuerza de enlace, considere-

Figura 3 -8 Macromolculas en el citoplasma celular. El dibujo est hecho aproximadamente a escala, e ilustra el abarrotamiento que existe en el citoplasma. nicamente se representan las macromolculas: los RNA se han dibujado en azul, los ribosomas en verde y las protenas en rojo. En el citoplasma las macromolculas difunden de una forma relativamente lenta debido a que interaccionan con muchas otras macromolculas; por el contrario, las molculas pequeas difunden casi tan rpidamente como lo hacen en el agua. (Adaptado a partir de D.S. Goodsell, Trends in Biochem. Sci. 16:203-206, 1991.)

A B

disociacin

velocidad de _ constante concentracin disociacin ~ ~ de disociacin de AB velocidad de disociacin = A r0ff [AB] asociacin
A B

EJEMPLO: La concentracin de una m olcula de la que hay una sola copia en una clula tpica de m am fero (de un volum en aproxim ado de 2000 |im 3) es aproxim adam ente de 10 12 M. Si esta clula contiene 104 copias de la proteina A y 106 copias de la proteina B, [A] = 10 8 M y [B] = 10~6 M concentracin de B Supongam os que la proteina A se une a la proteina B con una K = 107 M-1. La relacin entre el nm ero de molculas de A unidas y el de molculas de A libres ser [AB]/[A], y como [AB] = K[B] = (10/ M )(10 M) = 10 [A] podem os esperar que dentro de la clula de cada diez m olculas de A que se hallen unidas a B, una est libre. Repitiendo los clculos para K = 104 IVT1, observarem os que nicamente alrededor de una de cada cien m olculas de A deben de hallarse unidas a B.

velocidad de constante de concentracin asociacin asociacin de A velocidad de asociacin = kon [A] [B] EN EL EQUILIBRIO:

velocidad de asociacin = velocidad de disociacin kon [A] [B] = kQ f [AB] [AB] C on --------- = ----- = K = constante de equilibrio [A] [B] fcoff

Figura 3 -9 Principio del equilibrio. El equilibrio entre las molculas A y B y el com plejo AB se mantiene gracias al balance entre las dos reacciones opuestas indicadas en (1) y (2). Como se expresa en (3), la relacin entre la constante de asociacin y la de disociacin es igual a la constante de equilibrio (K) para la reaccin. Las molculas A y B han de chocar para poder reaccionar por lo que la velocidad de sntesis del com plejo AB es proporcional al producto de las concentraciones individuales de los reactantes A y B. Por eso en la expresin final de K aparece el producto [A] x [B], donde [ ] indica "concentracin de. Como se ha definido tradicionalm ente, en la ecuacin de un equilibrio qumico las concentraciones de los productos aparecen en el numerador y las de los com puestos que reaccionan, en el denominador. As, la constante de equilibrio en (3) es para la reaccin de asociacin A + B AB, mientras que la inversa de esta fraccin sera la constante de equilibrio para la reaccin de disociacin AB A + B. Sin embargo, al referirse a interacciones de unin sencilla, es menos confuso hablar de constante de afinidad o constante de asociacin (en litros por mol); cuanto mayor es el valor de la constante de asociacin [KJ, mayor es la fuerza de unin entre A y B. El recproco de Ka es la constante de disociacin (en moles por litro); cuanto menor es el valor de la constante de disociacin (Kd) mayor es la fuerza de unin entre A y B.

100

Captulo 3 : Macromolculas: estructura, forma e informacin

mos una reaccin en la que la molcula A se une a la molcula B. Esta reaccin continuar hasta alcanzar un punto de equilibrio, en el cual la velocidad de for macin y la de disociacin son iguales (Figura 3-9). Las concentraciones de A, de B y del complejo AB en este punto de equilibrio se pueden utilizar para determi nar una constante de equilibrio (K) para la reaccin, tal como se explica en la Figura 3-9. Esta constante recibe a veces el nombre de constante de afinidad, y habitualmente se utiliza como medida de la fuerza de enlace entre dos m olcu las; cuanto ms fuerte sea el enlace, tanto ms elevado ser el valor de la cons tante de afinidad. La constante de equilibrio de una reaccin en la que se enlazan dos m olcu las est directamente relacionada con el cambio de energa libre estndar del enlace (AG), mediante la ecuacin descrita en la Tabla 3-3. En esta tabla tam bin se indican los valores de AG correspondientes a varios valores de K. En sis temas biolgicos, las constantes de afinidad para interacciones de enlace senci llo normalmente oscilan entre IO3 y 101 2 litros/mol; esto corresponde a energas de enlace en el intervalo de 4 a 17 kcal/mol, que puede provenir de unos 4 a 17 enlaces de hidrgeno.

Tabla 3-3 La relacin entre las diferencias de energa libre y las constantes de equilibrio Constante de equilibrio
[AB]

Energa libre
de AB m enos energa libre de A + B (kcal/mol)

_K

[A] [B] (litros/mol)

Los tomos y las molculas se mueven rpidamente 6


Las reacciones qumicas de una clula tienen lugar a velocidades asombrosa mente elevadas. Una molcula de una enzima tpica, por ejemplo, cataliza unas 1000 reacciones por segundo y algunas enzimas como la catalasa pueden conse guir velocidades de ms de 106 reacciones por segundo. Cada reaccin requiere que una molcula de enzima se encuentre con otra de substrato, por lo que velo cidades como stas slo son posibles gracias a que las molculas se mueven a velocidades suficientemente rpidas. Los movimientos de las molculas pueden clasificarse de forma general en tres categoras: (1) el movimiento de una m ol cula de un lugar a otro (movimiento de translacin), (2) el rpido movimiento atrs y adelante de los tomos unidos de forma covalente respecto a otro (vibra cin), y (3) las rotaciones. Todos estos movimientos son importantes para unir entre s las superficies de molculas que interaccionan. Las velocidades de los movimientos moleculares pueden medirse por diver sas tcnicas espectroscpicas, que indican que una gran protena globular est girando constantem ente, rotando sobre su eje, alrededor de un milln de veces por segundo. Las velocidades de encuentros por difusin originados por movi mientos de traslacin son proporcionales a la concentracin de la molcula que difunde. Si el ATP, por ejemplo, se halla presente a su concentracin intracelular habitual de 1 mM, cada lugar de una molcula proteica ser bombardeado con molculas de ATP por unas 106 colisiones al azar cada segundo. Para una con centracin de ATP 10 veces menor, el nmero de colisiones descendera a 105, y as sucesivamente. De forma extremadamente rpida, en cuanto dos molculas han colisiona do y se hallan en una orientacin relativa adecuada, puede producirse entre ellas una reaccin qumica. Teniendo en cuenta lo rpidamente que se mueven y reaccionan las molculas, las velocidades de catlisis enzimtica observadas no parecen tan extraordinarias.

105 104 103 102 10 1 10-1 10-2 10-3 10-4 10-5

-7,1 -5,7 -4,3 -2,8 -1,4 0 1,4 2,8 4,3 5,7 7,1

Si se permite que la reaccin A + B ^ lle gue al equilibrio, las cantidades relativas de A, B y AB dependern de las diferen cias de energa libre, AG, entre ellos. Los valores de la tabla corresponden a 37C (310K), y estn calculados a partir de la ecuacin

AG =-RT ln [AB] [A ] [B]

[AB] [A] [B]

_ g-AG / RT _ e -AG/0,6138

Aqu, AG viene dado en kilocaloras por mol y representa la diferencia de energa libre en condiciones estndar (en las que todos los componentes se hallan a con centraciones de 1,0 moles/litro); T es la temperatura en grados Kelvin (K). Principios similares a stos se aplican in cluso al caso ms sencillo de una reac cin A ^ A*, segn el cual una molcula puede interconvertirse entre dos estados A y A* que se diferencian en un cierto va lor de AG. En el equilibrio, la relacin entre el nmero de molculas de ambos tipos es igual a la relacin
__ _ _ = g-AG/RT

[A*]

[A ]

Los procesos de reconocim iento molecular nunca pueden ser perfectos 7


Todas las molculas tienen energa -la energa cintica de sus movimientos de traslacin, de vibracin y de rotacin y la energa potencial almacenada en sus distribuciones electrnicas. A travs de las colisiones moleculares, esta energa se distribuye aleatoriamente a todos los tomos presentes, de forma que la m a yora de tomos tendrn niveles de energa cercanos al valor medio, y tan slo una pequea proporcin de ellos presentarn niveles energticos muy altos. A pesar de que las conformaciones o estados favorables que adopte una molcula Procesos de reconocimiento molecular

As, a partir de esta tabla podemos ver que, si la transicin A A* tiene un cambio de energa libre favorable de 4,3 kcal/mol, en el equilibrio habr ms de 1000 mol culas en el estado A* que en el estado A.

101

sern las que supongan menor energa libre (vanse pgs. 78-79), como conse cuencia de colisiones extraordinariamente violentas se producen estados de alta energa. Es posible calcular la probabilidad de que, a una temperatura dada un tomo o una m olcula est en un estado de una determinada energa (vase Ta bla 3-3). La probabilidad de un estado de alta energa disminuye respecto a la de uno de b aja energa a medida que la diferencia entre los valores de la energa li bre de am bos aumenta. Sin embrago, esta probabilidad nicamente es igual a cero cuando la diferencia de energa es infinita. Debido a que las colisiones moleculares son fortuitas, de vez en cuando ocurren pequeas reacciones secundarias. A consecuencia de ello, una clula com ete errores continuamente. Se producirn ocasionalmente incluso las reac ciones que son energticam ente muy desfavorables. Por ejemplo, dos tomos unidos uno al otro por un enlace covalente, pueden ocasionalm ente estar so metidos a una energa especial de colisin, y separarse. Anlogamente, la espe cificidad de una enzima por su substrato no puede ser absoluta ya que el reco nocimiento de una molcula com o diferente de otra nunca puede ser perfecto. nicamente se podran evitar por completo los errores si la clula desarrollara mecanism os que tuvieran diferencias de energa infinitas entre las alternativas. Puesto que esto no es posible, las clulas se ven forzadas a tolerar un cierto nivel de error, y han desarrollado una gran variedad de reacciones especiales de repa racin para corregir los errores ms perjudiciales. Por otro lado, los errores son esenciales para la vida. Si no fuera por las equi vocaciones ocasionales en el proceso de mantenimiento de las secuencias de DNA, probablem ente la evolucin no habra tenido lugar.

Resumen

La secuencia de subunidades de una macromolcula contiene una informacin que determina el perfil tridimensional de su superficie. Este perfil, a su vez, controla el reconocimiento entre una molcula y otra o entre distintas zonas de una misma molcula, mediante enlaces dbiles, no covalentes. Las fuerzas de atraccin son de cuatro tipos: enlaces inicos, atracciones de van der Waals, enlaces de hidrgeno e interacciones entre grupos no polares causadas por su expulsin hidrofbica del agua. Dos molculas se reconocern una a otra mediante un proceso en el que pri mero se encuentran por difusin al azar, se unen deforma transitoria y luego se di socian. Generalmente, la fuerza de esta interaccin se expresar en forma de una constante de equilibrio. Puesto que la nica manera de conseguir que el reconoci miento sea infalible consiste en hacer que la energa de enlace sea infinitamente grande, las clulas vivas constantemente cometen errores; los que son intolerables son corregidos mediante procesos especiales de reparacin. cidos nucleicos8
Los genes estn formados por DNA9
Desde que el hombre ha sembrado cosechas o criado animales, resulta obvio que cada semilla o cada vulo fecundado debe de contener escondido un plan o dise o para el desarrollo del organismo. En la poca moderna, la ciencia de la gentica se desarroll alrededor de la premisa de que existan unos elementos invisibles portadores de informacin, denominados genes, que son distribuidos a cada una de las clulas hijas cuando la clula madre se divide. Por consiguiente, antes de di vidirse una clula ha de hacer una copia de sus genes para poder ceder a sus clu las hijas una coleccin completa de ellos. Los genes de los espermatozoides y de los vulos transmiten la informacin gentica de una generacin a la siguiente. La herencia de los caracteres biolgicos debe implicar la existencia de es quemas de tom os que sigan las leyes de la fsica y de la qumica: en otras pala bras, los genes deben estar formados por molculas. Al principio, la naturaleza

102

Captulo 3 : Macromolculas: estructura, forma e informacin

de estas molculas resultaba difcil de imaginar. Qu tipo de molcula podra ser almacenada en una clula, dirigir las actividades de un organismo en desa rrollo y adems ser capaz de una replicacin exacta y casi ilimitada? Hacia finales del siglo xix, los bilogos haban reconocido ya que los trans portadores de la informacin hereditaria eran los cromosomas que resultan visi bles en el ncleo cuando una clula empieza a dividirse. Pero la evidencia de que es el cido desoxirribonucleico (DNA) de estos cromosomas la substancia de la que estn formados los genes se obtuvo mucho ms tarde a partir de unos estudios sobre bacterias. En 1944 se demostr que la adicin de DNA purificado de una cepa de bacteria a otra cepa ligeramente diferente, confera a esta segun da cepa propiedades hereditarias caractersticas de la primera. Como hasta en tonces se haba credo que tan slo las protenas presentaban una complejidad conformacional suficiente como para ser portadoras de la informacin gentica, este descubrimiento constituy una sorpresa y no fue aceptado de forma gene ral hasta principio de los aos 1950. Actualmente, la idea de que el DNA contie ne la informacin gentica -alm acenada en su larga cadena de nucletidos- es tan fundamental para el pensamiento biolgico que a veces resulta difcil darse cuenta del enorme abismo intelectual que llen este concepto.

Las m olculas de DNA consisten en dos largas cadenas unidas por pares de bases com plem entarias 10
Al considerar la simplicidad de la qumica del DNA resulta comprensible que los genetistas tuvieran dificultades en aceptar que el DNA es la esencia de los genes. Una cadena de DNA es un largo polmero no ramificado, compuesto nicamente por cuatro tipos de subunidades. Estas subunidades son los desoxirribonucletidos que contienen las bases adenina (A), citosina (C), guanina (G) y timina (T). Los nucletidos estn unidos por enlaces covalentes fosfodister entre el carbono 5 de un grupo desoxirribosa y el carbono 3 del siguiente (Panel 2-6, pgs. 60-61). Los cuatro tipos de bases estn fijados a esta cadena de azcar fosfato repetitiva, casi como cuatro tipos diferentes de cuentas ensartadas en un collar. Cmo una larga cadena de nucletidos puede codificar las instrucciones para todo un organismo, o incluso nicamente para una sola clula? Y, cmo pueden copiarse estos m ensajes de una generacin de clulas a la siguiente? Las respuestas se hallan en la estructura tridimensional de la molcula de DNA.
Figura 3-10 La doble hlice de DNA. (A) Una corta seccin de la doble hlice del DNA. Se presentan cuatro pares de bases complementarias. Las bases se representan en gris y los azcares desoxiribosa en azul. (B) La hlice vista desde uno de sus extremos. Ntese que las dos hebras del DNA avanzan en direcciones opuestas y que cada par de bases se m antiene unido por dos o tres enlaces de hidrgeno (vase tambin Panel 3-2, pgs. 104105).

final 5' de la cadena bases 5' abajo

extrem o 5' arriba

enlace de hidrgeno

3' arriba

extrem o 3' abajo

cidos nucleicos

103

DNA Y RNA
E n e s ta m it a d d e l p a n e l se p r e s e n ta la e s t r u c t u r a d e l R N A y e n la o tr a m ita d la d e l D N A . T a n t o el D N A c o m o el R N A s o n p o lm e r o s lin e a le s d e n u c le tid o s (v a s e P a n e l 2 -6 , p g s . 6 0 -6 1 ) . El R N A se d ife r e n c ia d e l D N A e n tr e s a s p e c to s : 1. la c o lu m n a v e r t e b r a l d e a z c a r fo s f a to p r e s e n ta rib o s a e n lu g a r d e d e s o x ir r ib o s a 2 . p r e s e n ta la b a s e d e u r a c ilo (U ) e n lu g a r d e t im in a (T ) 3 . e x is te e n f o r m a d e h e b r a s e n c illa e n lu g a r d e u n a h lic e d e d o b le h e b ra .

ESQUELETO DE AZUCAR FOSFATO DEL RNA


G

ribosa

^ O S

enlace fosfodister

't ;

extrem o 3

&

O
LAS CUATRO BASES DEL RNA guanina
O
\ N / \ C ^ N

citosina
NH2

uracilo
O X _
n z

adenina
NH

h, n/

C ^ / C - n'

//

O'

O'

esqueleto azcar fosfato

104

Estructuras del DNA y del RNA.

II ^
^

\\

CH

II

CH

ESQUELETO DE AZUCAR FOSFATO DEL DNA

LAS CUATRO BASES DEL DNA FORMANDO DOS PARES DE BASES

extrem o 5' desoxirribosa


tim in a

citosina

unin 5' enlace fosfodister

enlace de hidrgeno extrem o 3' adenina guanina

ELECTRON MICROGRAFIA DEL DNA esqueleto de azcar fosfato


|re3ra^cif(4
La f o r m a c i n e s p e c fic a d e e n la c e s d e h id r g e n o e n tr e G y C y e n tr e A y T (A y U e n el R N A ) g e n e r a lo s p a r e s d e b a s e s c o m p le m e n t a r ia s .

(Cortesa de Mei Lie W ong.)

DOBLE HELICE DEL DNA


E n u n a m o l c u la d e D N A , se e n c u e n tr a n a p a r e a d a s d o s c a d e n a s a n t ip a r a le ia s c u y a s s e c u e n c ia s d e n u c le t id o s s o n c o m p le m e n t a r ia s , g e n e r a n d o u n a d o b le h lic e d e x tr g ir a d e a p r o x im a d a m e n t e 10 p a r e s d e n u c le t id o s p o r v u e lt a d e la h lic e . E n la p a r te s u p e r io r d e e s ta f ig u r a s e p r e s e n ta u n a ilu s tr a c i n e s q u e m tic a y e n la in f e r io r u n m o d e lo lle n o d e la d o b le h lic e d e l D N A .

esqueleto de azcar fosfato

enlace de hidrgeno una vuelta de hlice = 3,4 nm

estra principal

estra secundaria

105

A principios de los aos 1950, anlisis por difraccin de rayos X de muestras de DNA estiradas hasta conseguir fibras, sugirieron que la molcula de DNA es un polmero helicoidal formado por dos hebras. No era sorprendente que el DNA tuviera una estructura helicoidal pues, como ya hemos visto, es muy fre cuente la form acin de una hlice si cada una de las subunidades vecinas de un polmero est orientada regularmente. Pero el hecho de que el DNA tenga dos hebras fue crucial. Constituy el dato que condujo, en 1953, a la construccin de un modelo que se adaptaba al esquema de difraccin de rayos X observado y, con ello, solucionaba el rompecabezas de la estructura y de la funcin del DNA. Un rasgo esencial del modelo consista en que todas las bases de la molcula de DNA se hallan en el interior de la doble hlice, mientras que los azcares fosfa to se disponen en el exterior. Esta distribucin supone que las bases de una de las hebras deben estar extraordinariamente cerca de las de la otra hebra, y el modelo propuesto requera un apareamiento complementario entre una base prica (A o G, cada una de las cuales presenta dos anillos) de una de las cadenas y una base pirimidnica (T o C, cada una de las cuales presenta un solo anillo, por lo que es de menor tamao que una base prica) de la otra cadena (Figura 3-10). Tanto la evidencia obtenida a partir de los primeros experimentos bioqu micos com o las conclusiones derivadas de los modelos moleculares sugirieron que el apaream iento de bases com plem entarias (tambin llamado pares de ba ses de Watson y Crick) se formaran entre A y T por un lado y entre G y C por otro. Los anlisis bioqum icos de preparaciones de DNA de diferentes especies han demostrado que, a pesar de que la com posicin de nucletidos del DNA vara notablem ente (por ejemplo, desde un 13% a un 36% de residuos de A en el DNA de diferentes tipos de bacterias), se cumple una regla general que dice que, cuantitativamente, [G] = [C] y [A] = [T]. La construccin de modelos moleculares revel que el nmero de enlaces de hidrgeno efectivos que pueden formarse entre G y C o entre A y T era mayor que para otra combinacin cualquiera de es tas bases. As pues, el modelo de doble hlice para el DNA explicaba de forma elegante la bioqumica cuantitativa.

La estructura del DNA proporciona una explicacin del proceso de la herencia 11


Un gen contiene informacin biolgica en una forma que ha de ser copiada exactam ente y transmitida desde cada clula a todas sus clulas hijas. Las impli caciones del descubrimiento de la doble hlice del DNA fueron importantes, ya que la estructura sugiri inmediatamente cmo se efectuaba la transferencia de informacin. Puesto que cada hebra contiene una secuencia de nucletidos que es exactamente complementaria de la secuencia de nucletidos de la otra hebra, en realidad am bas hebras contienen la misma informacin gentica. Si llama mos a las dos hebras A y A, la hebra A puede servir de molde o patrn para pro ducir una nueva hebra A, mientras que de la misma forma la hebra A puede uti lizarse para producir una nueva hebra A. As, la informacin gentica puede ser copiada m ediante un proceso en el cual la hebra A se separa de la hebra A per mitiendo que cada una de am bas hebras sirva de patrn para la produccin de una nueva hebra complementaria. Como consecuencia directa del m ecanismo de apareamiento de bases, re sulta evidente que el DNA contiene informacin gracias a la secuencia lineal de

Figura 3-11 Secuencia del DNA del gen humano que codifica la p-globina. El gen codifica una de las dos subunidades de la molcula de la hemoglobina, que en todos los individuos adultos transporta el oxgeno por la sangre. Solamente se presenta la secuencia de una de las dos hebras del DNA (la cadena codificante"), ya que la otra tiene la secuencia complementaria. La secuencia debe leerse de izquierda a derecha y en lneas sucesivas de arriba a abajo de la pgina, como si se tratara de un texto normal en espaol.

CCCTGTGGAGCCACACCCTAGGGTTGGCCA ATCTACTCCCAGGAGCAGGGAGGGCAGGAG CCAGGGCTGGGCATAAAAGTCAGGGCAGAG CCATCTATTGCTTACATTTGCTTCTGACAC AACTGTGTTCACTAGCAACTCAAACAGACA CCATGGTGCACCTGACTCCTGAGGAGAAGT CTGCCGTTACTGCCCTGTGGGGCAAGGTGA ACGTGGATGAAGTTGGTGGTGAGGCCCTGG GCAGGTTGGTATCAAGGTTACAAGACAGGT TTAAGGAGACCAATAGAAACTGGGCATGTG GAGACAGAGAAGACTCTTGGGTTTCTGATA GGCACTGACTCTCTCTGCCTATTGGTCTAT TTTCCCACCCTTAGGCTGCTGGTGGTCTAC CCTTGGACCCAGAGGTTCTTTGAGTCCTTT GGGGATCTGTCCACTCCTGATGCTGTTATG GGCAACCCTAAGGTGAAGGCTCATGGCAAG AAAGTGCTCGGTGCCTTTAGTGATGGCCTG GCTCACCTGGACAACCTCAAGGGCACCTTT GCCACACTGAGTGAGCTGCACTGTGACAAG CTGCACGTGGATCCTGAGAACTTCAGGGTG AGTCTATGGGACCCTTGATGTTTTCTTTCC CCTTCTTTTCTATGGTTAAGTTCATGTCAT AGGAAGGGGAGAAGTAACAGGGTACAGTTT AGAATGGGAAACAGACGAATGATTGCATCA GTGTGGAAGTCTCAGGATCGTTTTAGTTTC TTTTATTTGCTGTTCATAACAATTGTTTTC TTTTGTTTAATTCTTGCTTTCTTTTTTTTT CTTCTCCGCAATTTTTACTATTATACTTAA TGCCTTAACATTGTGTATAACAAAAGGAAA TATCTCTGAGATACATTAAGTAACTTAAAA AAAAACTTTACACAGTCTGCCTAGTACATT ACTATTTGGAATATATGTGTGCTTATTTGC ATATTCATAATCTCCCTACTTTATTTTCTT TTATTTTTAATTGATACATAATCATTATAC ATATTTATGGGTTAAAGTGTAATGTTTTAA TATGTGTACACATATTGACCAAATCAGGGT AATTTTGCATTTGTAATTTTAAAAAATGCT TTCTTCTTTTAATATACTTTTTTGTTTATC TTATTTCTAATACTTTCCCTAATCTCTTTC T T TCAGGGCAATAATGATACAATGT ATCAT GCCTCTTTGCACCATTCTAAAGAATAACAG TGATAATTTCTGGGTTAAGGCAATAGCAAT ATTTCTGCATATAAATATTTCTGCATATAA ATTGTAACTGATGTAAGAGGTTTCATATTG CTAATAGCAGCTACAATCCAGCTACCATTC TGCTTTTATTTTATGGTTGGGATAAGGCTG GATTATTCTGAGTCCAAGCTAGGCCCTTTT GCTAATCATGTTCATACCTCTTATCTTCCT CCCACAGCTCCTGGGCAACGTGCTGGTCTG TGTGCTGGCCCATCACTTTGGCAAAGAATT CACCCCACCAGTGCAGGCTGCCTATCAGAA AGTGGTGGCTGGTGTGGCTAATGCCCTGGC CCACAAGTATCACTAAGCTCGCTTTCTTGC TGTCCAATTTCTATTAAAGGTTCCTTTGTT CCCTAAGTCCAACTACTAAACTGGGGGATA TTATGAAGGGCCTTGAGCATCTGGATTCTG CCTAATAAAAAACATTTATTTTCATTGCAA TGATGTATTTAAATTATTTCTGAATATTTT ACTAAAAAGGGAATGTGGGAGGTCAGTGCA TTTAAAACATAAAGAAATGATGAGCTGTTC AAACCTTGGGAAAATACACTATATCTTAAA CTCCATGAAAGAAGGTGAGGCTGCAACCAG CTAATGCACATTGGCAACAGCCCCTGATGC CTATGCCTTATTCATCCCTCAGAAAAGGAT TCTTGTAGAGGCTTGATTTGCAGGTTAAAG TTTTGCTATGCTGTATTTTACATTACTTAT TGTTTTAGCTGTCCTCATGAATGTCTTTTC

106

Captulo 3 : Macromolculas: estructura, forma e informacin

cadena patrn
5

cadena recin ' sintetizada

~o-p= o 1 o
H?C ~ 0~ P=0 1
O
Hy C

I 0

BASE

BASE

\A,
BASE
O

O o = p- o ^ ()

BASE
n

H 2

o o=p-o~

Figura 3 -1 2 Sntesis de DNA. La adicin de un desoxirribonucletido al extremo 3 de una cadena polinucleotdica es la reaccin fundamental a travs de la cual se sintetiza el DNA. Como se muestra en la figura, es el apareamiento de bases entre el ribonucletido que se aade y una hebra ya existente de DNA (la hebra patrn ) lo que condiciona que la nueva hebra de DNA tenga una secuencia de nucletidos complementaria.

3
O O0 ( 0

OH
BASE BASE
O

O - P - O - P - O - P - 0 - C H ,

1 O 1 O 1 1/ N
OH
1 T

o= p-o~ I o >
BASE

ki
0

desoxirribonuclesido trifosfato que entra

\ 0^ H 2
o = P -O "

BASE

sus nucletidos. Cada nucletido -A, C ,T o G - puede ser considerado como una letra de un alfabeto sencillo de cuatro letras que es utilizado para escribir los m ensajes biolgicos en forma lineal en una cinta de teleimpresora. Los orga nismos se diferencias entre s porque sus respectivas molculas de DNA poseen diferentes secuencias de nucletidos, y por consiguiente, diferentes mensajes biolgicos. Puesto que el nmero de posibles secuencias diferentes en una cadena de DNA de n nucletidos de largo es de 4n, la variedad biolgica que se puede gene rar utilizando una modesta longitud de DNA es, en principio, enorme. Una clu la animal tpica contiene un metro de DNA (3 x 109 nucletidos). Utilizando un abecedario lineal de cuatro letras, un gen humano extraordinariamente peque o puede llenar una cuarta parte de una pgina de texto (Figura 3-11), mientras que la informacin gentica existente en una clula humana permitira llenar un libro de ms de 500 000 pginas. Aunque el principio en el que se basa la replicacin gnica es elegante y simple, la maquinaria real con la que se realiza esta copia en la clula es com pli cada y est compuesta por un complejo de protenas que forman una mquina de replicacin. La reaccin fundamental es la indicada en la Figura 3-12, en la que la enzima DNA polimerasa cataliza la adicin de un desoxirribonucletido al extremo 3 de una cadena de DNA. Cada nucletido aadido a la cadena es, en realidad, un desoxirribonuclesido trifosfato; la libercin del pirofosfato de este nucletido activado y su hidrlisis posterior proporcionan la energa para la re accin de replicacin del DNA, convirtindola de forma efectiva en una reac cin irreversible.

cidos nucleicos

107

La replicacin de una hlice de DNA empieza por la separacin local de sus dos hebras de DNA complementarias. Cada hebra acta luego como patrn para la formacin de una nueva molcula de DNA, mediante la adicin secuencial de desoxirribonuclesidos trifosfato. El nucletido que debe ser aadido en cada caso se selecciona mediante un proceso durante el cual se forma un par de bases complem entarias con el nucletido siguiente de la hebra patrn madre, gene rndose as una hebra hija de DNA que tiene una secuencia complementaria a la de la hebra patrn (Figura 3-12). La informacin gentica se duplica en su totali dad -e s decir, se llegan a formar dos dobles hlices completas de DNA, cada una de las cuales es idntica en cuanto a secuencia de nucletidos a la hlice de DNA madre que sirvi de patrn. Puesto que al acabar el proceso, cada molcula de DNA hija est formada por una cadena original y otra recin sintetizada, se dice que el mecanismo de replicacin es semiconservativo (Figura 3-13).

doble hlice parterna de DNA

A
i i
a

REPLICACION

i i

Los errores en el proceso de replicacin del DNA generan m utaciones 12


Una de las caractersticas ms impresionantes de la replicacin del DNA es su exactitud. Se utilizan diversos mecanismos correctores de galeradas para eli minar nucletidos situados incorrectamente; como consecuencia de ello, la se cuencia de nucletidos de una molcula de DNA se copia con menos de un error por cada 109 nucletidos aadidos. Sin embargo, de vez en cuando la maquina ria de la replicacin salta o aade algunos nucletidos, o coloca una T donde de bera existir una C, o una A en lugar de una G. Cada uno de los cambios de este tipo en la secuencia de DNA constituye un error gentico llamado m utacin, que ser copiado en todas las generaciones futuras de clulas, ya que las secuen cias de DNA equivocadas se copian tan fielmente como las correctas". La consecuencia de un error de este tipo puede ser muy importante, ya que un solo cambio de un nucletido puede tener grandes efectos sobre la clula, depen diendo del lugar donde haya ocurrido la mutacin. A principios de los aos 1940, los genetistas demostraron de forma conclu yente que los genes especifican la estructura de las protenas. Por eso, una muta cin en un gen causada por una alteracin en la secuencia de su DNA puede acarrear la inactivacin de una protena y no producir ningn efecto, por lo que se le llama mutacin silenciosa . Muy raramente, una mutacin origina un gen con una funcin til, mejorada o nueva. En este caso los organismos portadores de la m utacin tendrn una ventaja, y a travs de la seleccin natural el gen mutado puede llegar a substituir con el tiempo al gen original de la poblacin.

x1
'

REPLICACION

lili
^

REPLICACIN
rx

hlices de DNA hijas


Figura 3-13 La replicacin semiconservativa del DNA. En cada ciclo de replicacin, cada una de las dos hebras de DNA son utilizadas como patrn para la formacin de una hebra com plementaria de DNA. Por consiguiente, las hebras originales permanecen inalteradas a lo largo de muchas generaciones celulares.

La secuencia de nucletidos de un gen determ ina la secuencia de aminocidos de una protena 13


El DNA es relativamente inerte qumicamente. La informacin que contiene se expresa indirectamente a travs de otras molculas: el DNA dirige la sntesis de RNA especficos y de molculas de proteina que, a su vez, determinan las pro piedades fsicas y qumicas de la clula. Aproximadamente al mismo tiempo en que los biofsicos analizaban la es tructura tridimensional del DNA por difraccin de rayos X, los bioqumicos estu diaban intensam ente la estructura qumica de las protenas. Se saba ya que las protenas son cadenas de aminocidos unidos por enlaces peptdicos secuenciales, pero todava no se conoca con certeza que cada tipo de protenas consiste en una secuencia caracterstica de aminocidos; pero a principios de los aos 1950, cuando se lleg a conocer la secuencia de la pequea protena insulina (Figura 3-14), se descubri que cada tipo de protena consiste en una secuencia de aminocidos tpica. Al igual que el conocim iento de la estructura del DNA ejerci una influencia crucial sobre la com posicin de la base molecular de la gentica y de la herencia, la determinacin de la secuencia de la insulina consti tuy la clave para comprender la estructura y la funcin de las protenas. Si la in108 Captulo 3 : Macromolculas: estructura, forma e informacin

C adena A

g _______________

G - I -V-E - Q - C - C - A - S - V - C - S - L -Y-Q-L - E-N -Y -C -N

Cadena B S

P-V-N-Q -H-L-C-G -S-H-L-V-E-A-L-Y-L-V-C-G -E-R-G -F-F-Y-T-P-K-A

sulina tena una secuencia definida, genticamente determinada, lo ms proba ble era que tam bin la tuvieran las dems protenas. Adems, pareca razonable suponer que las propiedades de una protena dependeran del orden exacto en el que se hallaran dispuestos sus aminocidos constituyentes. Tanto el DNA como las protenas estn compuestos por una secuencia lineal de subunidades, y el anlisis bioqumico de las protenas producidas por genes mutantes demostr que las dos secuencias son co-lineales -e s decir, los nucletidos del DNA estn dispuestos en un orden que coresponde al orden de los ami nocidos en la protena que especifican. Result evidente que la secuencia del DNA contiene una especificacin codificada de la secuencia proteica. La pre gunta central de la biologa molecular pas a ser entonces cmo una clula tra duce una secuencia de nucletidos del DNA a una secuencia de aminocidos de una protena.

Figura 3-14 Secuencia de aminocidos de la insulina bovina. La insulina es una protena muy pequea formada por dos cadenas polipeptdicas, una de 21 y la otra de 30 residuos de aminocidos. Cada cadena presenta una secuencia de aminocidos caracterstica determinada genticamente. Los smbolos de una letra utilizados para nombrar los aminocidos son los que se indican en el Panel 2-5, pgs. 58-59; los enlaces S-S indicados en rojo son enlaces disulfuro entre residuos de cisterna. Inicialmente la protena se sintetiza como una nica larga cadena polipeptdica (codificada por un nico gen), la cual se divide posteriormente formando las dos cadenas.

Porciones de la secuencia de DNA se copian en molculas de RNA para guiar la sntesis de protenas 14
La sntesis de una protena implica copiar regiones especficas del DNA (los ge nes) en otro tipo de polinucletido qumica y funcionalmente diferente, conoci do com o cido ribonucleico o RNA. Al igual que el DNA, el RNA est compuesto por una secuencia lineal de nucletidos, pero presenta dos pequeas diferencias qumicas respecto al DNA: (1) el esqueleto de azcar fosfato del RNA contiene ribosa en lugar de desoxirribosa, y (2) la base timina (T) est substituida por uracilo (U), una base muy estrecham ente relacionada que tam bin se aparea con A (vase Panel 3-2, pgs. 104-105). El RNA contiene toda la informacin de la secuencia de DNA de la que ha sido copiado y mantiene las propiedades del DNA de apareamiento de bases. Las molculas de RNA se sintetizan a travs de un proceso conocido como transcripcin del DNA, que en muchos aspectos se parece al de la replicacin del DNA, ya que una de las dos hebras del DNA acta como patrn sobre el que se examinan las posibilidades de apareamiento de bases de los ribonucletidos. Cuando se consigue un buen ajuste con el DNA patrn, el ribonucletido es in corporado como una unidad ligada covalentemente. De esta forma, la cadena de RNA que est creciendo lo hace nucletido a nucletido. La transcripcin del DNA se diferencia de la replicacin el DNA en varios puntos importantes. Por ejemplo, el RNA producido no permanece asociado al DNA. Inmediatamente detrs de la regin en la que se aaden los ribonucleti dos, la hlice original del DNA se forma de nuevo y la molcula de RNA se sepa ra. Por consiguiente, las molculas de RNA tienen una sola hebra. Adems, las molculas de RNA son relativamente cortas en comparacin con las de DNA, ya que son copiadas a partir de una regin limitada del DNA -suficiente para pro ducir una o varias protenas (Figura 3-15). A los transcritos de RNA que dirigen la sntesis de molculas de protena, se les llama molculas de RNA mensajero (mRNA). Otros transcritos de RNA actan como RNA de transferencia (tRNA) o bien forman los componentes del RNA ribosmico (rRNA) o partculas ribonucleoproteicas ms pequeas. La cantidad de RNA sintetizado a partir de una regin determinada de DNA est controlada por protenas reguladoras de la actividad gnica, que se unen a lugares especficos del DNA cerca de las secuencias codificantes de un gen. En cualquier clula y en cualquier momento dado, algunos genes se estn Utilizan-

cidos nucleicos

109

PROCARIOTAS
citoplasm a

Figura 3-15 La transferencia de informacin desde el DNA hasta la protena. La transferencia tiene lugar a

intrn exn TRANSCRIPCIN

m aduracin p o r corte y em palm e del RNA

TRADUCCIN proteina

travs de un intermediario de RNA llamado RNA mensajero (mRNA). En las clulas procariotas el proceso es ms simple que en las clulas eucariotas. En eucariotas, las regiones codificantes del DNA (situadas en los exones, dibujados en color) estn separadas por regiones no codificantes (llamadas intrones}. Tal como se indica en la figura, estos intrones pueden eliminarse a travs de una reaccin, catalizada por enzimas, de maduracin por corte y empalme (spiicing) del RNA, formando as una molcula de mRNA.

do para sintetizar RNA en grandes cantidades mientras que otros genes no se transcriben en absoluto. En cada generacin celular, a partir de un gen activo pueden sintetizarse centenares de transcritos de RNA a partir del mismo seg mento de DNA. Cada molcula de mRNA puede ser traducida dando lugar a mu chos centenares de copias de una cadena polipeptdica, por lo que la informa cin contenida en una pequea regin del DNA puede dirigir la sntesis de millones de copias de una protena determinada. La protena fibroma, por ejem plo, es el com ponente mayoritario de la seda. En cada clula de la glndula de la seda, un solo gen de fibrona genera 104 copias de mRNA, cada una de las cuales dirige la sntesis de 105 molculas de fibrona -producindose un total de 109 molculas de fibrona en slo 4 das.

Las molculas de RNA de eucariotas son cortadas y recombinadas, elim inndose secuencias intrn 15
En las clulas bacterianas la mayora de las protenas estn codificadas por una nica secuencia de DNA, larga e ininterrumpida, que se copia sin ninguna alte racin o modificacin previa, produciendo una molcula de mRNA. En 1977, los bilogos moleculares quedaron asombrados ante el descubrimiento de que la mayora de los genes eucariotas presentan sus secuencias codificantes (llamadas exones) interrumpidas por secuencias no codificantes (llamadas intrones). Para producir una protena, primero se transcribe todo el gen, incluyendo tanto sus intrones como sus exones y generando una molcula de mRNA muy larga -e l transcrito primario. Antes de que esta molcula de RNA abandone el ncleo, un complejo de enzimas procesadoras de RNA elimina todas las secuencias de in trones produciendo as una molcula de RNA mucho ms corta. Despus de que esta maduracin del RNA, llamada m aduracin por corte y empalme del RNA (RNA spiicing) haya concluido, la molcula de RNA se desplaza hasta el citoplas ma constituyendo ahora una molcula de mRNA que dirige la sntesis de una molcula de una protena determinada (Figura 3-15). Este sistema de transferencia de informacin en eucariotas, aparentemente ruinoso, se ha desarrollado probablemente debido a que supone que la sntesis de protena es mucho ms verstil. El transcrito primario de RNA de algunos ge nes, por ejemplo, puede madurar por corte y empalme de diferentes formas, produciendo diferentes mRNA dependiendo del tipo de clula y del estadio de desarrollo. Esto permite sintetizar diferentes protenas a partir del mismo gen. Adems, como la presencia de numerosos intrones facilita los procesos de re-

110

Captulo 3 : Macromolculas: estructura, forma e informacin

.a posicin (extrem o 5')


1

iP i
i i i. J
m % m B Lm L

u
Phe Phe Leu Leu Leu Leu Leu Leu lie lie lie Met Val Val Val Val

c
2

.a posicin

A
Tyr Tyr STOP STOP His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu

G
Cys Cys STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly

3.a posicin (extrem o 3')

Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala

U C A G

U C A G

Figura 3-1 6 El cdigo gentico. En el transcurso de la sntesis proteica, los grupos de tres nucletidos (c od on es ) de una molcula de mRNA son traducidos a aminocidos de acuerdo con las reglas indicadas aqu. Los codones GUG y GAG, por ejemplo, se traducen a valina y a cido glutmico respectivamente. Obsrvese que los codones que presentan U o C como segundo nucletido tienden a codificar los aminocidos ms hidrofbicos (comprese con el Panel 2-5, pgs. 58-59).

U C A G

U C A G

com binacin gentica entre exones, probablemente este tipo de disposicin gnica ha sido extraordinariamente importante en los albores de la historia de la evolucin de los genes -acelerando los procesos por medio de los cuales los or ganismos desarrollaron nuevas protenas a partir de partes de otras ya existen tes, en lugar de tener que desarrollar completamente nuevas secuencias.

Las secuencias de nucletidos del mRNA son ledas en grupos de tres y traducidas a am inocidos 16
Las reglas a travs de las que se traduce la secuencia nucleotdica a secuencia de aminocidos de una protena, el denominado cdigo gentico, fueron descifra das a principios de los aos 1960. Se demostr que la secuencia de nucletidos de la molcula de mRNA que acta como intermediario, era leda en orden con secutivo, en grupos de tres. Cada triplete de nucletidos, denominado un codn, determina un aminocido. Puesto que el RNA es un polmero lineal de cuatro nucletidos diferentes, existen 43 = 64 tripletes de codn posibles (recurdese que lo importante es la secuencia de nucletidos de un triplete). Habitualmente en las protenas tan slo se encuentran 20 aminocidos diferentes de modo que la mayora de aminocidos deben ser especificados por varios codones; es decir, el cdigo gentico es degenerado. El cdigo (ilustrado en la Figura 3-16) ha sido altamente conservado a travs de la evolucin: con pocas excepciones, es igual en organismos tan diversos como las bacterias, las plantas y el hombre. En principio, cada secuencia de RNA puede ser leda siguiendo una de las tres posibles pautas de lectura diferentes que pueden darse segn el lugar en que empiece el proceso de decodificacin (Figura 3-17). En casi todos los casos ni cam ente una de estas pautas de lectura producir una protena funcional. Pues to que no existen signos de puntuacin salvo al principio y al final del mensaje de RNA, la pauta de lectura se establece en el inicio del proceso de traduccin y se mantiene a partir de entonces.

1C U C II A G C I I G U U II ACC i i A U -LeuSer-V al-T hr -

C J p vA y G C G : L U y . A,. . C C A
Ser-A la-LeuPro-

CU 1 1 CA G 1 1 C G U i i U AC i i C A U GlnA rg-T yrHis-

Las molculas de tRNA em parejan los aminocidos con los grupos de nucletidos 17
Los codones de una molcula de mRNA no reconocen directamente los am ino cidos que especifican, como hacen las enzimas con su substrato. La traduccin de un mRNA a protena depende de una molcula adaptadora que reconoce

Figura 3 -17 Las tres pautas de lectura posibles en la sntesis proteica. En el proceso de traduccin de una secuencia de nucletidos (azul) en una secuencia de aminocidos (verde), la secuencia de nucletidos de un mRNA es leda desde el extremo 5 hacia el extremo 3 , en grupos consecutivos de 3 nucletidos. Por consiguiente, segn cual sea la pauta de lectura utilizada, cada secuencia de RNA puede codificar, en principio, tres secuencias de aminocidos com pletam ente diferentes entre s.

cidos nucleicos

111

unin del am inocido 54-58 55-18 56-19

nucletido 1

nucletido 76 (extrem o 3' con un am inocido unido)

48-15 8-14 22-46 23-9 45-10 44-26

interacciones poco habituales entre bases (B) anticodn

un aminocido y un grupo de tres nucletidos. Estos adaptadores son un grupo de pequeas molculas de RNA conocidas com o RNA de transferencia (tRNA), cada una de las cuales tiene una longitud de unos 80 nucletidos. Una molcula de tRNA presenta una conformacin tridimensional plegada, que se mantiene en parte por interacciones no covalentes de apareamientos de bases como las que mantienen unidas las dos hebras de la hlice de DNA. Sin embargo, en la molcula de tRNA, que es de una sola hebra, los pares de bases complementarios se forman entre residuos de nucletidos de la misma cadena, la cual hace que la molcula de tRNA se pliegue de una forma caracterstica, que es importante para su funcin de adaptador. Cuatro cortos segmentos de la m o lcula presentan una estructura en doble hlice, dando lugar a una molcula que parece un cruce en trbol en dos dimensiones. Este cruce en trbol est ms plegado formando una conformacin en forma de L que se mantiene por interacciones de enlaces de hidrgeno ms complejas (Figura 3-18). En cada ex tremo de la "L existen dos grupos de residuos de nucletidos desapareados, que son especialmente importantes para la funcin de la molcula de tRNA en la sntesis de protenas: uno de los grupos forma el anticodn, cuyas bases pueden aparearse con las de un triplete complementario de una molcula de mRNA (el codn), mientras que la secuencia CCA del extremo 3' de la molcula de tRNA est unido de forma covalente a una secuencia de aminocidos (Figura 3-18A).

El m ensaje de RNA se lee de un extremo al otro por un ribosom a 18


El proceso de reconocim iento de los codones, que transfiere la informacin ge ntica del mRNA va tRNA a la protena, depende de interacciones entre pares de bases del mismo tipo de las que median la transferencia de informacin genti ca del DNA al DNA y del DNA al RNA (Figura 3-19). Sin embargo, la m ecnica de ordenacin de las molculas de tRNA sobre el mRNA es complicada y requiere de la presencia de un ribosoma, que es un com plejo de ms de 50 protenas di ferentes asociadas a varias molculas de RNA estructura] (rRNA). Cada ribosoma es una gran mquina sintetizadora de protenas en la que las molculas de tRNA se colocan por s mismas para leer el mensaje gentico codificado en la secuen cia de las molculas de mRNA. El ribosoma encuentra primero un punto espec fico de inicio en la molcula de mRNA, que establece la pauta de lectura y deter mina el extremo amino terminal de la protena. Luego, a medida que el ribosoma se desplaza a lo largo de la molcula de mRNA, va traduciendo, codn a codn, la secuencia de nucletidos a secuencia de aminocidos, utilizando

Figura 3 -18 tRNA p ara la fenilalanina en levadura. (A) La m olcula est dibujada adoptando una conform acin de cruce en trbol para destacar los pares de bases complementarios (ba rra s grises cortas ) que se forman en regiones helicoidales internas de la molcula. (B) Se muestra en forma de esquema la conform acin real de la molcula, basada en anlisis por difraccin de rayos X. Los pares de bases com plementarios se indican como b a rra s grises largas. Adems, en rojo se presentan los nucletidos que participan en interacciones no habituales de apareamiento de bases y que mantienen unidas diferentes zonas de la molcula. Estas parejas estn numeradas y conectadas por ln eas d e co lor rojo tanto en (A) como en (B). En (B) los pares de bases estn numerados. (C) Una de las interacciones de apareamiento de bases poco habituales. Aqu, una base interacciona a travs de enlaces de hidrgeno con otras dos; algunas de estas triples bases colaboran para mantener plegada esta molcula de tRNA.

112

Captulo 3 : Macromolculas: estructura, forma e informacin

iC lC lA uuuuuuuuuuuuuuu T C G C T A A A G C G T G G A

_____________________________________________ mRNA
U U U U U U U U U U U U LJ u u

CCAUCGCUAAAG_CG__UGGA

G G T A G

G C A C C T DNA

o'" m U U U m x ,

G A T T T C U A A A

v p JK

3'
cadena de mRNA en crecim iento

(A)

(B)

am ino

cadena polipeptdica en crecim iento

tRNA entrante, extrem , , ..o cargado ;arboxilo . , con un am inocido

molculas de tRNA para aadir aminocidos al extremo por el que la cadena polipeptdica est creciendo (Figura 3-20). Cuando un ribosoma llega ai final del mensaje, tanto l com o el extremo carboxilo terminal de la protena recin sinte tizada se liberan del extremo 3 de la molcula de mRNA y quedan libres en el ci toplasma. Los ribosomas actan con una eficiencia notable: en 1 segundo, un solo ri bosom a bacteriano aade aproximadamente unos 20 aminocidos a una cadena polipeptdica en formacin. En el Captulo 6 se ofrecen ms detalles sobre la es tructura de los ribosomas y sobre el mecanismo de la sntesis proteica.

Algunas m olculas de RNA actan como catalizadores 19


Tradicionalmente se ha considerado que las molculas de RNA son simples cade nas de nucletidos, con una qumica relativamente poco interesante. En 1981, esta concepcin qued destrozada por el descubrimiento de una molcula de RNA con actividad cataltica, con un tipo de reactividad qumica tan sofisticada como la que los bioqumicos haban asociado exclusivamente a las protenas. Las molculas de RNA ribosmico de los protozoos ciliados Tetrahymena se sinteti zan inicialmente como un largo precursor, a partir del cual se sintetiza uno de los rRNA por una reaccin de corte y empalme (splicing) del RNA. La sorpresa surgi ante el descubrimiento de que esta reaccin de corte y empalme poda desarro llarse in vitro en ausencia de protenas. Por consiguiente, se demostr que la se cuencia intrn presenta una actividad cataltica, semejante a la de una enzima que lleva a cabo la reaccin de dos etapas que se ilustra en la Figura 3-21. A conti nuacin, se sintetiz en un tubo de ensayo la secuencia de 400 nucletidos de

Figura 3-19 Flujo de informacin en la sntesis proteica. (A) Los nucletidos de la molcula de mRNA se unen formando una copia complementaria de un segmento de una hebra de DNA. (B) Luego, estos nucletidos, en grupos de tres, se unen a conjuntos complementarios de tres nucletidos de la regin anticodn de determinadas molculas de tRNA. En el otro extremo de cada tipo de las molculas de tRNA, un aminocido determinado se mantiene unido a travs de un enlace de alta energa, y cuando se produce el apareamiento, este aminocido es aadido al extremo en crecimiento de la cadena proteica. As, la traduccin de la secuencia de nucletidos del mRNA a una secuencia de aminocidos depende del aparamiento de bases complementarias entre un codn del mRNA y el anticodn correspondiente del tRNA. Por consiguiente, la base molecular de la transferencia de informacin en la traduccin es muy similar a la de la replicacin y a la de la transcripcin del DNA. Ntese que tanto la sntesis como la traduccin del mRNA se inician en el extremo 5 .

subunidades ribosm icas separadas ribosom a extrem o 5 mRNA extrem o 3' stop

p o iip ptid o en crecim iento

Figura 3 -20 Sntesis de una proteia por ribosomas unidos a una molcula de mRNA. Los ribosomas se unen a una seal de iniciacin que se halla cercana al extremo 5 de la molcula de mRNA y luego se desplazan hacia el extremo 3\ sintetizando la protena a medida que avanzan. A menudo varios ribosomas se desplazan simultneamente sobre un mismo mRNA, de forma que cada uno de ellos fabrica una cadena polipeptdica independiente pero idntica a las otras; toda esta estructura recibe el nombre de polirribosom a.

cidos nucleicos

113

5 ': = =

: : : 3'

m olcula de RNA precursora

PASO 1

5 ': : :

: i= 3

interm ediario transitorio

Figura 3-21 Una molcula de RNA automadurativa. El diagrama muestra la reaccin de automaduracin en la que una secuencia intrn cataliza su propia escisin de una molcula de RNA ribosomal en T etrahym ena. Como se muestra en la figura, el proceso se inicia cuando un nucletido G se aade a la secuencia del intrn, y en esta reaccin se rompe la cadena de RNA; entonces, el nuevo extremo 3 de la cadena de RNA ataca al otro extremo del intrn, completndose la reaccin.

PASO 2 5, ___ _ZJ UCUUAAI


+

::I3'

m olcula de RNA madura

secuencia del intrn elim inada

longitud del intrn y se comprob que era capaz de plegarse formando una com pleja superficie y poda actuar como una enzima en reacciones con otras molcu las de RNA. Puede, por ejemplo, juntar dos substratos determinados -u n nucle tido de guanina y una cadena de RNA- y catalizar su unin covalente cortando la cadena de RNA en un lugar especfico (Figura 3-22). En esta reaccin tipo, de la cual el primer paso se presenta simulado en la Figura 3-21, la propia secuencia intrn acta de forma repetitiva cortando nu merosas cadenas de RNA. A pesar de que la maduracin del RNA por corte y em palme se realiza habitualmente por sistemas que no son autocatalticos (vase Captulo 8), en diferentes tipos de clulas, incluyendo hongos y bacterias, se han descrito RNA automadurativos con secuencias intrn relacionadas con la de Te-

productos RNA

Figura 3 -22 Una reaccin catalizada por la secuencia intrnica purificada de T etra h y m en a . En esta reaccin, que corresponde al primer paso de la Figura 3-21, tanto el substrato especfico -u na molcula de RNA- como un nucletido G se mantienen estrechamente unidos a la superficie de la molcula cataltica de RNA. Entonces el nucletido se une covalentemente a la molcula de RNA substrato rompindola en un lugar determinado. La liberacin de las dos cadenas de RNA resultantes deja libre la secuencia del intrn para posteriores ciclos de reaccin.

114

Captulo 3 : Macro molculas: estructura, forma e informacin

OCH,

N -form il met
H2 1

OH OH

n ll H OH 5' m imetiza un tRNA (rojo) unido al C-terminal de un polipptido en crecim iento {azul)

ENLACE PEPTDICO RECIN FORMADO +

trahymena. Este hecho sugiere que estas secuencias de RNA podran haber apa recido antes de que las lneas evolutivas de las clulas procariotas divergieran, hace 1,5 mil millones de aos. Recientem ente se han descubierto algunas otras familias de RNA catalticos. Por ejemplo, la mayora de los tRNA se sintetizan inicialmente como un RNA precursor ms largo, y se ha descrito una molcula de RNA que juega el papel cataltico principal en un complejo RNA-protena que reconoce estos precurso res y los corta en lugares especficos. Se conoce tambin una secuencia cataltica de RNA que desempea una funcin importante en el ciclo vital de numerosos viroides de plantas. Todava es ms destacable que ahora se sospecha que los ribosomas ejercen su funcin principalmente por catlisis basada en molculas de RNA, de forma que las protenas del ribosoma jugaran un papel de apoyo de los RNA ribosmicos (rRNA), que constituyen ms de la mitad de la masa del ri bosoma. El rRNA largo, por ejemplo, tiene una actividad peptidil transferasa que puede catalizar la formacin de nuevos enlaces peptdicos (Figura 3-23). Cmo le es posible a una molcula de RNA actuar como una enzima? El ejemplo del tRNA indica que las molculas de RNA pueden plegarse de formas al tamente especficas. En la Figura 3-24 se presenta una estructura tridimensional propuesta para el ncleo de la secuencia intrn automadurativa de Tetrahymena. Interacciones entre diferentes zonas de esta molcula de tRNA (anlogas a los poco habituales enlaces de hidrgeno en molculas de tRNA -vase Figura 3-18) son responsables de plegados posteriores que generan una compleja superficie

Figura 3-23 Una reaccin peptidil transferasa catalizada por una molcula de RNA ribosmico desproteinizada. La molcula de puromicina mimetiza un tRNA cargado con el aminocido tirosina y en las clulas acta com o un potente inhibidor de la sntesis de protenas aadindose al extremo en crecim iento de una cadena polipeptdica. En este modelo de reaccin el extremo de la cadena polipeptdica en crecim iento est mimetizado por un hexanucletido (en rojo, representando un tRNA) que est unido covalentemente a la N-formil metionina (que representa el polipptido). Una gran molcula de rRNA altamente purificada cataliza la adicin de puromizina a la N-formil metionina, formando un nuevo enlace peptdico y liberando el hexanucletido.

Figura 3-24 Visin tridimensional del ncleo cataltico de la secuencia intrnica de RNA ilustrada en las Figuras 3-21 y 3-22. (A) La molcula plegada, con las interacciones de enlaces de hidrgeno en rojo. Esta molcula, de unos 240 nucletidos, se presenta inmediatamente despus del corte inical del extremo 5 del intrn {am arillo). (B) Dibujo esquemtico de la molcula presentada en (A), en su forma desplegada. (Adaptado de L. Jaeger, E. W esthoff y F. Michel, J. Mol. Biol. 221: 1153-1164, 1991.)

cidos nucleicos

115

tridimensional con actividad cataltica. Una yuxtaposicin de tomos poco fre cuente puede estirar enlaces covalentes y, por lo tanto, conseguir que determina dos tomos de la cadena plegada del RNA sean extraordinariamente reactivos. Como se explica en el Captulo 1, el descubrimiento de las molculas de RNA con actividad cataltica ha cambiado profundamente nuestra visin de cmo aparecieron las primeras clulas.

Resumen

La informacin gentica se halla en la secuencia lineal de nucletidos del DNA. Cada molcula de DNA consiste en una doble hlice formada a partir de dos hebras complementarias de nucletidos, emparejadas mediante enlaces de hidrgeno entre los pares de bases G-C y A-T. La duplicacin ele la informacin gentica se produce mediante la polimerizacin de una nueva hebra complementaria de cada una de las dos hebras primitivas de la doble hlice, durante el proceso de replicacin del DNA. La expresin de la informacin gentica almacenada en el DNA comprende la traduccin de una secuencia lineal de nucletidos del DNA a una secuencia co-lineal de aminocidos de una protena. Un segmento acotado de DNA se copia primero en una hebra complementaria de RNA. Este transcrito primario es cortado y reempalmado (spliced) eliminndose las secuencias de intrortes y generando una molcula de mRNA. Finalmente, el mRNA es traducido a protena a travs de un complejo conjunto de reacciones que tienen lugar en un ribosoma. Los aminocidos utiliza dos para la sntesis proteica son unidos primero a una familia de molculas de tRNA, cada una de las cuales reconoce, mediante interacciones de apareamiento de bases complementarias, grupos determinados de tres nucletidos del mRNA. A continuacin, la secuencia de nucletidos del mRNA es leda de un extremo al otro en grupos de tres, de acuerdo con un cdigo gentico universal. Otras molculas de RNA actan en las clulas como agentes catalticos seme jantes a las enzimas. Estas molculas de RNA se pliegan generando una superficie que contiene nucletidos que han adquirido una reactividad extraordinaria. Uno de estos catalizadores es el rRNA grande del ribosoma, que cataliza la formacin de enlaces peptdicos durante la sntesis proteica. Estructura de las protenas20
Las clulas estn formadas en gran parte por protenas, que constituyen ms de la mitad del peso seco de la clula (Tabla 3-1). Las protenas determinan la forma y la estructura de la clula y tambin actan como los principales instrumentos de re conocimiento molecular y como catalizadores. A pesar de que es cierto que el DNA almacena la informacin para generar una clula entera, tiene poca influencia di recta sobre los procesos celulares. El gen de la hemoglobina, por ejemplo, no puede transportar oxgeno: sta es una propiedad de la protena especificada por el gen. Las molculas de DNA y de RNA son cadenas de nucletidos, qumicamente muy sem ejantes entre s. En cambio, las protenas estn formadas por un con junto de 20 aminocidos muy diferentes, cada uno de los cuales presenta una personalidad qumica distinta (vase Panel 2-5, pgs. 58-59). Esta variedad hace posible la enorm e versatilidad de las propiedades qumicas observada en las dis tintas protenas, y posiblem ente explica por qu durante la evolucin se han se leccionado las protenas en lugar de las molculas de RNA para catalizar la ma yora de las reacciones celulares.

La forma de una molcula proteica est determinada por la secuencia de sus am inocidos 21
Muchos de los enlaces de una larga cadena polipeptdica permiten la libre rota cin de los tomos que unen, lo cual confiere al esqueleto de la protena una gran flexibilidad. Por lo tanto, cualquier molcula proteica puede, en principio,

116

Captulo 3 : Macromolculas: estructura, forma e informacin

adoptar un nmero ilimitado de formas diferentes (conformaciones ). Sin em bar go, la mayora de las cadenas polipeptdicas se pliegan adoptando una sola con formacin particular. Esto es debido a que los esqueletos de los diferentes am i nocidos, a modo de cadenas laterales de la cadena principal, se asocian entre s y con el agua formando varios enlaces no covalentes dbiles (vase Panel 3-1, pgs. 96-97). Siempre que las cadenas laterales apropiadas se encuentren en po siciones cruciales en la cadena, se desarrollarn importantes fuerzas que hacen que una conformacin particular sea especialmente estable. La mayora de las protenas pueden plegarse espontneamente en su forma correcta. Debido al tratamiento con algunos disolventes, puede conseguirse que una protena se despliegue, o desnaturalice, obtenindose una cadena polipeptdica flexible que ha perdido su conformacin nativa. Normalmente cuando se retira el solvente desnaturalizante, la protena se pliega espontneam ente adop tando su conformacin original, lo cual indica que toda la informacin necesaria para determinar el plegamiento se halla contenida exclusivamente la secuencia de aminocidos. Uno de los factores ms importantes que condicionan el plegamiento de una protena es la distribucin de sus cadenas laterales polares y no polares. Las cadenas laterales hidrofbicas, muy abundantes, tienden a agruparse en el inte rior de la molcula, lo cual les permite evitar el contacto con el entorno acuoso (como las gotas de aceite se vuelven a unir despus de haber sido dispersadas m ecnicam ente en el agua). Por el contrario, las cadenas laterales polares tien den a disponerse cerca de la parte externa de la molcula proteica, donde pue den interactuar con el agua y con otras molculas polares (Figura 3-25). Puesto que los enlaces peptdicos tam bin son polares, tienden a interactuar entre s y con las cadenas laterales polares, para formar enlaces de hidrgeno (Figura 3-26); casi todos los residuos polares enterrados dentro de la protena estn apa reados de esta forma (Figura 3-27). As pues, los enlaces de hidrgeno desempe an un papel importante en mantener unidas diferentes regiones de la cadena polipeptdica de una molcula proteica plegada, y son de una importancia cru cial para muchas de las interacciones de enlace observadas en las superficies de las protenas.

polipptido desplegado cadenas laterales polares cadenas laterales no polares

*.
s ,

- m , , ...f u

f - t - r v

la regin central hidrofbica contiene las cadenas laterales no polares

las cadenas laterales polares, situadas en la superficie exterior de la m olcula, pueden form ar enlaces de hidrgeno

conform acin plegada en un am biente acuoso


Figura 3-25 Plegado de una protena adoptando una conform acin globular. Las cadenas laterales de los aminocidos polares tienden a situarse en el exterior de la protena, donde pueden interaccionar con el agua; las cadenas laterales de los aminocidos no polares quedan enterradas en el interior, formando un ncleo hidrofbico escondido del agua.

cido glutam nico

I ------1 ----------1 H O I I
CH2 CH2

-C N C C

O II

O I

-C C N C H

-cc N ('
H

-C
O
H

I
O - c c N C
H

OO

nc c r
H O

r
H
serina

h O Figura 3-26 Enlaces de hidrgeno. Algunos de los enlaces de hidrgeno (indicados en color) que se pueden formar entre los aminocidos de una protena. Los enlaces peptdicos se presentan sombreados en gris.

N C C N -

_______________I
enlace de hidrgeno entre tom os de dos enlaces peptdicos enlace de hidrgeno entre tom os de un enlace peptdico y una cadena lateral de un am inocido enlace de hidrgeno entre dos cadenas laterales de am inocido

Estructura de las protenas

117

Figura 3-27 Detalles de enlaces de hidrgeno en una protena. En esta regin de la enzima lisozima, se forman enlaces de hidrgeno entre dos cadenas laterales {azul}, entre una cadena lateral y un tomo de un enlace peptdico (a m a r illo ) o entre tomos de dos enlaces peptdicos {rojo). Para referencia, vase Figura 3-26. (Segn C.K. Mathews y K.E. van Holde, Biochemistry. Redwood City, CA: Benjamin/Cummings, 1990.)

Las protenas secretadas o las protenas de la superficie celular a menudo forman enlaces covalentes adicionales intracatenarios. De forma ms notable, la formacin de enlaces disulfuro (tambin denominados enlaces S-S) entre los dos grupos -SH de dos cistenas cercanas de una cadena polipeptdica plegada (Figura 3-28) a menudo sirven para estabilizar la estructura tridimensional de protenas extracelulares. Estos enlaces no son necesarios para el plegamiento es pecfico de las protenas ya que el plegamiento de las protenas normalmente tiene lugar en presencia de agentes reductores que impiden la formacin de en laces S-S. De hecho, muy raramente se forman enlaces S-S (si es que se forman alguna vez) en molculas proteicas que se hallen en el citosol, ya que la elevada concentracin de agentes reductores -SH en el citosol rompe estos enlaces. El resultado neto de todas las interacciones individuales entre aminocidos consiste en que la mayora de las molculas proteicas se pliegan espontneamente adoptando conformaciones caractersticas y definidas de forma precisa. Las que sofi compactas y globulares tienen un ncleo interno compuesto de grupos de ca denas laterales hidrofbicas -dispuestas siguiendo una ordenacin densa, casi cris talina- mientras que la superficie exterior, muy compleja e irregular, est formada por las cadenas laterales ms polares. La localizacin y las caractersticas qumicas de los diferentes tomos de esta intrincada superficie, hacen que cada protena sea nica y permiten a la molcula fijarse a otras superficies macromoleculares y a cier tas molculas pequeas (vase ms adelante). Desde los puntos de vista qumico y estructural, las protenas son las molculas conocidas ms sofisticadas.
Figura 3-28 Form acin de un enlace disulfuro. El dibujo ilustra la formacin de un enlace disulfuro (covalente) entre las cadenas laterales de residuos de cisterna vecinos, en una protena.

. . \ / cisterna r / \ N CH2 / H *S H

O. i % /
C 1 oxidantes

H N

X
C \

O. i \ /
C CH2

--------reductores

1
< ^\ /
.C CH,

/ Cx # \ / CH, O C H \ / cisterna

/ /
/

vy

2 H /

i /
/

118

Captulo 3 : Macromolculas: estructura, forma e informacin

Diferentes cadenas proteicas presentan esquemas de plegamiento iguales 22


Aunque toda la informacin necesaria para el plegamiento de una cadena pro teica se halla contenida en su secuencia de aminocidos, an no hemos apren dido a leer esta informacin y as poder predecir la estructura tridimensional detallada de una protena a partir de su secuencia. Por consiguiente, la confor macin plegada slo puede ser determinada mediante un elaborado anlisis por difraccin de rayos X de cristales de la protena, o si la protena es muy pequea por tcnicas de resonancia magntica nuclear (vase Captulo 4). Hasta ahora con estas tcnicas se han analizado completamente ms de 100 tipos de prote nas. Cada una de estas protenas tiene una conformacin especfica tan irregular y complicada que necesitaramos un captulo entero de este libro para describir todos los detalles tridimensionales de cada una de ellas. Al comparar las estructuras tridimensionales de diferentes molculas protei cas, se pone de manifiesto que, aunque la conformacin completa de cada prote na es nica, en diferentes regiones de estas macromolculas aparecen repetidos varios esquemas de plegamiento. Dos de estos esquemas son particularmente fre cuentes, porque resultan de las interacciones regulares por enlaces de hidrgeno entre los propios enlaces peptdicos ms que entre las cadenas laterales de algunos aminocidos. Ambos patrones de plegamiento fueron predichos correctamente en 1951 al estudiar los modelos basados en los diferentes esquemas de difraccin de rayos X de la seda y del cabello. Los dos patrones regulares de plegamiento descu biertos entonces reciben hoy el nombre de lmina p, que se presenta en la fibrona de la seda, y de hlice a, que se presenta en la protena a-queratina de la piel y de sus formaciones tales como el cabello, las uas y las plumas. El ncleo de la mayora (aunque no de todas) de las protenas globulares pre senta extensas regiones de lm ina p. En el ejemplo de la Figura 3-29, que mues tra parte de una molcula de anticuerpo, se forma una lmina (3 antiparalela

HOOC

( : .
~|

.3

nhs

2,5 nm

'\ \ %

A.:: a#

i0

-;> ,y . .. , . >j| ti /

am

cadena lateral de un am inocido-

nitrgeno

carbono /
V i

T
R S R m 4 C :
1

Q -

rv

R
;Sb x

k) ^
O -
^ R

^
%

R
^ r I

enlace de H
v .

IP

Figura 3-29 La lm ina B es una estructura frecuente form ada por zonas de cadenas polipeptdicas en las protenas globulares. En la parte superior se muestra un dominio de 115 aminocidos de una molcula de inmunoglobulina; consiste en una estructura en forma de sandwich de dos lminas (3, una de las cuales se presenta en color. En la parte inferior se muestra en detalle una lmina (3 antiparalela perfecta, siendo R las cadenas laterales de los aminocidos. Obsrvese que cada enlace peptdico est unido a travs de un enlace de hidrgeno a un enlace peptdico vecino. Las estructuras laminares reales de las protenas globulares suelen ser algo menos regulares que la lmina (5 dibujada aqu, y adems la mayora de lminas se hallan ligeramente deformadas (vase Figura 3-31).

R enlace peptdico R

... . hidrogeno

oxigeno

*
R

U --------------------------------------------------- 1,39 nm ---------------------------------------------- !

Estructura de las protenas

119

(A)

(B)

cuando una cadena polipeptdica extendida se pliega sobre s misma hacia ade lante y hacia atrs, de forma que cada seccin de la cadena queda orientada en direccin opuesta a la de las secciones inmediatas. Esto da lugar a una estructu ra muy rgida que se mantiene por enlaces de hidrgeno entre los enlaces peptdicos de las cadenas vecinas. A menudo tanto las lminas (3 antiparalelas como las lminas (3 paralelas, estrechamente relacionadas con las anteriores (forma das por regiones de cadenas polipeptdicas que estn orientadas en la misma di reccin), actan como una trama sobre la que se estructura la pro tena globular. Se genera una hlice a cuando una misma cadena polipeptdica gira regular mente sobre s misma dando lugar a un cilindro rgido en el que cada enlace peptdico est unido regularmente por enlaces de hidrgeno a otros enlaces peptdicos vecinos de la cadena. Muchas protenas globulares contienen breves regiones de estas hlices a (Figura 3-30). Las porciones de las protenas transmembrana que atraviesan la bicapa lipdica casi siempre son hlices a debido a las constric ciones impuestas por el ambiente lipdico hidrofbico (vase Captulo 10). Normalmente, una hlice a aislada no es estable por s sola en ambientes acuosos. Sin embargo, dos hlices a idnticas que presenten una disposicin re petitiva de cadenas laterales no polares se enrollan progresivamente una alrede dor de la otra formando una estructura especialmente estable denominada hli ce superenrollada (vase pg. 132). En muchas protenas fibrosas se presentan largas zonas de hlices superenrolladas semejantes a varillas, como en las fibras intracelulares de a-queratina que refuerzan la piel y sus apndices. En la Figura 3-31 se presentan modelos de espacio lleno de una hlice a y de una lmina (3, con y sin sus cadenas laterales.

Figura 3-30 Una hlice a es otra estructura frecuente form ada por zonas de la cadena polipeptdica de una protena. (A) La molcula de mioglobina, cuya funcin es transportar oxgeno, tiene 153 aminocidos de longitud y presenta una hlice a (dibujada en color). (B) Detalle de una hlice a perfecta. (C) Como en el caso de la lmina p, cada enlace peptdico est unido a un enlace peptdico vecino a travs de un enlace de hidrgeno. Obsrvese que para mayor claridad en (B) se han omitido tanto las cadenas laterales [que sobresalen radialmente a todo lo largo de la hlice y que en (C) se sealan como R] como los tomos de hidrgeno en el carbono a de cada aminocido (vase tambin Figura 3-31).

Las protenas son m olculas asom brosam ente verstiles 23


Debido a la variedad de las cadenas laterales de sus aminocidos, las protenas son notablemente verstiles en cuanto al tipo de estructuras que pueden formar. Veamos, por ejemplo, dos abundantes protenas segregadas por las clulas del tejido conjuntivo -la colgena y la elastina- ambas presentes en la matriz extracelular. En las molculas de colgena, tres cadenas polipeptdicas distintas ricas en el aminocido prolina y con un aminocido glicina de cada tres residuos, es tn enrolladas entre s generando una triple hlice regular. Estas molculas de

120

Captulo 3 : Macromolculas: estructura, forma e informacin

Figura 3-31 Modelos espaciales com pactos de una hlice a y de una lm ina (i con (derecha ) y sin (izquierda) las cadenas laterales de sus am inocidos. (A) Una hlice a (parte de la estructura de la mioglobina). (B) Una regin de lmina (3 (parte de la estructura de un dominio de una inmunoglobulina). En las fotografas de la izquierda, cada cadena lateral est representada por un nico tomo sombreado en negro (los grupos R de las Figuras 3-29 y 3-30), mientras que a la derecha se muestra la cadena lateral entera. (Por cortesa de Richard J. Feldmann.)

colgena estn, a su vez, empaquetadas formando fibrillas en las que las m ol culas de colgena adyacentes estn unidas por enlaces covalentes cruzados en tre los residuos vecinos de lisina, dando a las fibrillas una enorme resistencia a la tensin (Figura 3-32).
fibra elstica

triple hlice de colgena

EXTENSION

RELAJACION
molcula de elastina

Figura 3-32 Contraste entre la colgena y la elastina. (A) La colgena es una triple hlice formada por tres cadenas proteicas extendidas que se enroscan entre s. En el espacio extracelular muchas molculas de colgena, en forma de varilla, estn entrelazadas mediante enlaces cruzados formando fibrillas de colgena inextensibles (arriba) con una resistencia a la atraccin semejante a la del acero. (B) Las cadenas polipeptdicas de elastina estn unidas entre s mediante enlaces cruzados, formando fibras elsticas. Cuando la fibra es estirada, cada molcula de elastina se desenrolla adoptando una conformacin ms extendida. El notable contraste entre las propiedades fsicas de la elastina y las de la colgena radica por completo en que sus secuencias de aminocidos son diferentes.

Estructura de las protenas

121

La elastina es un caso que se encuentra en el extremo opuesto. Sus cadenas polipeptdicas, relativamente libres y desestructuradas, estn unidas por enlaces covalentes cruzados, generando una trama elstica parecida al caucho que per mite que tejidos tales como los de las arterias y de los pulmones se deformen y dilaten sin sufrir ningn dao. Tal como se ilustra en la Figura 3-32, la elastici dad es debida a la capacidad de las distintas molculas proteicas para desenro llarse de manera reversible cada vez que se les aplique una fuerza de tensin. Hay que destacar que la misma estructura qumica bsica -u n a cadena de am inocidos- pueda formar tantas estructuras diferentes: una trama elstica se m ejante al caucho (elastina), un cable inextensible con una resistencia a la ten sin sem ejante a la del acero (colgena) o cualquier otra de entre la amplia va riedad de superficies catalticas de las protenas globulares que actan como enzimas. La Figura 3-33 ilustra y compara la gama de formas que en principio podra adoptar una cadena polipeptdica de 300 aminocidos de longitud. Como ya hemos dicho, la conform acin adoptada realmente por una protena deter minada depende de su secuencia de aminocidos.

triple hlice de colgena de 29 nm de longitud

hlice a de 45 nm de largo

Las protenas presentan diferentes niveles de organizacin estructural 24


Al describir la estructura de una protena, resulta til distinguir varios niveles de organizacin. La secuencia de aminocidos se denomina estructura primara de la protena. Las interacciones regulares de enlaces de hidrgeno entre fragmentos contiguos de la cadena polipeptdica dan lugar a hlices a y a lminas (3, lo cual constituye la estructura secundara de la protena. Adems, ciertas com binacio nes de hlices a y lminas | 3 se empaquetan formando unidades globulares enla zadas de forma compacta, cada una de las cuales se denominan dominio protei co. Normalmente los dominios estn construidos a partir de una zona de una cadena polipeptdica de entre 50 y 350 aminocidos, y parece que son las unida des bsicas a partir de las cuales se construyen las protenas (vase ms adelan te). Mientras que las protenas ms pequeas pueden presentar un solo dominio, las protenas mayores presentan varios de ellos, normalmente conectados por ca denas polipeptdicas de longitud relativamente variable. Finalmente, los polipptidos individuales a menudo se asocian constituyendo subunidades de molculas mayores, a veces denominadas agregados moleculares o complejos proteicos, en los cuales las subunidades estn unidas entre s por un elevado nmero de dbi les interacciones no covalentes; en el caso de protenas extracelulares, a menudo estas interacciones estn estabilizadas por enlaces disulfuro. La estructura tridimensional de una protena puede representarse de dife rentes maneras. Consideremos la extraordinariamente pequea protena inhibi dora de la tripsina pancretica bsica (BPTI, de Basic Pancreatic Trypsin Inhibitor), que contiene 58 residuos de aminocido plegados en un solo dominio. La BPTI puede representarse como una imagen estereoscpica mostrando todos sus tomos a excepcin de los de hidrgeno (Figura 3-34A) o como un modelo molecular espacial en el que la mayora de los detalles no puedan observarse de forma muy clara (Figura 3-34B). Tam bin puede representarse de una forma ms esquemtica, omitiendo todas las cadenas laterales de los residuos de am i nocidos y todos los tomos reales, de forma que sea fcil de seguir el curso de la cadena polipeptdica principal (Figuras 3-34C, D y E). Una protena de tamao medio tiene alrededor de seis veces ms residuos de aminocidos que la BPTI, y muchas protenas son de un tamao ms de 20 veces mayor. Dibujos esquem ticos com o stos son fundamentales para representar la estructura de protenas grandes com o stas. En este libro se utilizarn de forma habitual. La Figura 3-35 muestra cmo se puede resolver la estructura de una gran pro tena en diferentes niveles de organizacin, construyendo cada nivel sobre el ante rior de una forma jerrquica. Estos niveles de complejidad organizativa creciente pueden corresponder a las etapas a travs de las que una protena acabada de sin tetizar se va plegando hasta alcanzar su estructura nativa dentro de la clula.

lm ina p de 7 x 7 x 0,8 nm

esfera de 4,3 nm de dim etro cadena extendida de - 1 0 0 nm de longitud


Figura 3-33 Algunas formas y tam aos que puede presentar una m olcula proteica tpica de 300 residuos de aminocidos de longitud. La estructura adoptada est determinada por la secuencia de aminocidos. (Adaptado de D.E. Metzler, Bioqumica. Barcelona: Ediciones Omega S.A., 1981.)

122

Captulo 3 : Macromolculas: estructura, forma e informacin

Figura 3-34 Protena inhibidora de la tripsina pancretica bsica (BPTI, de Basic Pancreatic Trypsin Inhibitor). Conformacin tridimensional de esta pequea protena, vista en 5 representaciones utilizadas habitualmente. (A) Representacin estereoscpica que muestra la posicin de todos los tomos excepto los de hidrgeno. La cadena principal se presenta en lneas gruesas y las cadenas laterales en lneas finas. (B) Modelo molecular mostrando el radio de van der Waals de todos los tomos (vase Panel 3-1, pgs. 96-97). (C) Modelo de esqueleto de alambre compuesto por lneas que conectan los carbonos a a lo largo del esqueleto polipeptdico. (D) Modelo de cinta que representa todas las regiones de interacciones regulares por enlaces de hidrgeno, en forma de hlices (hlices a) o como grupos de flechas (lminas (3), las cuales apuntan hacia el extremo carboxilo terminal de la cadena. (E) Modelo de tubo que muestra el curso de la cadena polipeptdica omitiendo cualquier detalle de ella. En los tres paneles de la parte inferior de la figura el m otiv o en h o rq u illa b eta se ha dibujado en verde. Tngase en cuenta que el ncleo de todas las protenas globulares est densamente empaquetado de tomos. Por lo tanto, la impresin de una estructura abierta producida por la observacin de los modelos (C), (D) y (E) es engaosa. (B y C por cortesa de Richard J. Feldmann; A y D por cortesa de Jane Richardson.)

123

lmina (3 subunidad proteica (monmero) estructura secundaria estructura terciaria molcula proteica (dmero) estructura cuaternaria

Los dominios estn formados por cadenas polipeptdicas que se pliegan adelante y atrs, generando delgadas circunvoluciones en la superficie de la protena 24
Un dominio proteico puede concebirse como la unidad estructural bsica de una estructura proteica. El ncleo de cada dominio est compuesto fundamen talm ente por un conjunto interconectado de lminas p, hlices a o de ambas co sas. Estas estructuras secundarias regulares estn favorecidas debido a que per miten la formacin de una gran cantidad de enlaces de hidrgeno entre los tomos del esqueleto de la protena, lo cual es esencial para estabilizar el inte rior del dominio, donde el agua no es asequible para formar enlaces de hidrge no con el oxgeno polar del carbonilo o con el hidrgeno de la amida del enlace peptdico. Existe un nmero limitado de maneras de combinar hlices a con lminas p para formar una estructura globular, por lo que determinadas com binaciones de estos elementos, denominadas motivos, se presentan repetidamente en el n cleo de muchas protenas no relacionadas entre s. Un ejemplo de ello lo consti tuye el motivo en horquilla beta encontrado en la BPTI (coloreado en verde en la Figura 3-34D). Consiste en dos cadenas p antiparalelas unidas por una fina vuel ta formada por un asa de la cadena polipeptdica. Otro ejemplo es eL motivo beta-alfa-beta, en el que dos cadenas P paralelas estn conectadas por un tramo de hlice a (Figura 3-36). En el Captulo 9 se com entan otros motivos comunes, como los diferentes motivos asociados a DNA encontrados en diversas familias de protenas reguladoras de genes. Varias com binaciones de motivos forman el dominio proteico, en el cual la cadena polipeptdica tiende a curvarse arriba y abajo a lo largo de toda la estruc tura, a veces formando una lmina P o una hlice a, y cambiando de direccin sbitamente dando una vuelta cerrada cuando llega a la superficie del dominio. Como resultado de ello, un dominio tpico es una estructura compacta, la super ficie de la cual est recubierta de asas protuberantes de cadenas polipeptdicas (Figura 3-37). Las regiones en asa, de longitud variable y superficie irregular, a menudo forman los lugares de unin para otras molculas. Debido a que las re giones en asa estn expuestas al agua, son ricas en aminocidos hidrofflicos, por lo que frecuentemente se pueden predecir sus posiciones a partir de un estudio detallado de la secuencia de aminocidos de la protena. 124 Captulo 3 : Macromolculas: estructura, forma e informacin

Figura 3-35 Tres niveles de organizacin de un a protena. La estructura tridimensional de una protena puede describirse en trminos de diferentes niveles de plegamiento, cada uno de los cuales se construye sobre el nivel precedente de una forma jerrquica. Aqu, estos niveles se ilustran utilizando la protena activadora de catabolito (CAP, de Catabolite Activator Protein), una protena reguladora de genes bacterianos que presenta dos dominios. Cuando el dominio mayor se une a AMP cclico provoca un cam bio de conform acin de la protena que permite al dominio menor unirse a una secuencia especfica de DNA. La secuencia de aminocidos se denomina estructura p rim a ria y el primer nivel de plegamiento estructura secu n daria. Tal com o se indica sombreado en am arillo, la com binacin de los niveles de plegamiento segundo y tercero mostrados aqu, se denomina habitualm ente estructura terciaria y el cuarto nivel (la unin de subunidades) estructura cu atern aria de una protena. (Modificado de un dibujo de Jane Richardson.)

De entre la gran cantidad de cadenas polipeptdicas posibles, nicam ente un nmero relativamente pequeo de ellas llegara a ser til
Puesto que cada uno de los 20 aminocidos es qumicamente distinto y cada uno de ellos puede, en principio, presentarse en cualquier posicin de una cadena proteica, existen 20 x 20 x 20 x 20 =160 000 posibles cadenas polipeptdi cas diferentes de 4 aminocidos de longitud o, anlogamente, 20" posibles cade nas polipeptdicas diferentes de n aminocidos de longitud. As, se podran pro ducir ms de 10390 protenas diferentes de una longitud de 300 aminocidos, es decir, de un tamao normal. Sabemos sin embargo que nicamente un pequeo nmero de estas posi bles protenas adoptara una conformacin tridimensional estable. La gran m a yora de cadenas tendra un gran nmero de conform aciones diferentes de energa aproximadamente igual, cada una de ellas con propiedades qumicas distintas. Estas protenas con propiedades tan variables no seran tiles, y por consiguiente, seran eliminadas por la seleccin natural durante el transcurso de la evolucin. Las protenas actuales tienen una estructura y unas propiedades qumicas sorprendentemente sofisticadas debido a sus propiedades nicas de plegado. No slo sucede que la secuencia de aminocidos es tal que condiciona que slo resulte extremadamente estable una sola de las conformaciones posi bles, sino que adems esta conformacin tiene la forma y las propiedades qu micas adecuadas para permitir que la protena realice una funcin cataltica o estructural determinada en la clula. Las protenas estn construidas de una m a nera tan precisa que el cambio de tan slo unos cuantos tomos de un am ino cido puede trastornar toda la estructura y provocar una alteracin catastrfica de la funcin de la protena.

Figura 3 -36 Ejemplo de un motivo proteico habitual. En el motivo betaalfa-beta, dos cadenas paralelas adyacentes que forman una lmina P estn conectadas a travs de una hlice a. Como en el caso del motivo de horquilla beta, destacado en la Figura 3-34, este motivo se halla en muchas protenas diferentes.

Normalmente las nuevas protenas se desarrollan por alteraciones m enores de protenas antiguas 25
Las clulas disponen de mecanismos genticos que permiten que durante la evolucin los genes se dupliquen, se modifiquen y se recombinen. Por consi guiente, una vez se ha desarrollado una protena con propiedades de superficie tiles, su estructura bsica puede ser incorporada a muchas otras protenas. A menudo, las protenas de funcin relacionada aunque diferente, de organismos

fk

i ' -" '"

% j~ . ? '
C %

.> ~3 " :

'
-. >

m
^

(A)

(B)

Figura 3-37 Modelos de cinta de la estructura tridimensional de algunos dominios de protenas organizados de forma diferente. (A) Citocromo b ^ , una protena de dominio nico compuesto casi completamente por hlices a. (B) Dominio que une NAD+de la lctico deshidrogenasa, compuesto por una combinacin de hlices a y de lminas (3. (C) Dominio variable de una cadena ligera de una inmunoglobulina, compuesto por un sandwich de dos lminas p. En estos tres ejemplos las hlices a se presentan en verde mientras que las cadenas organizadas en lminas P se sealan como flech a s rojas. Ntese que generalmente la cadena polipeptdica cruza hacia adelante y hacia atrs a travs de todo el dominio, adoptando curvas cerradas solamente en la superficie de la protena. A menudo las regiones en asa (am arillo) constituyen los lugares de unin de otras molculas. (Dibujos por cortesa de Jane Richardson.)

Estructura de las protenas

125

(A)
QUIMOTRIPSINA --------------------E LASTASA ---------------------

149 186 - A N TP O R LQ Q A S LP LLS N TN C K K - -Y W G T K IK D A M I C A G A S -G Q LA Q TLQ Q A Y LP TV D Y A I C SSSSYW GSTVKNSM VC AG G D G

II II II

III

I III

G V S S C M G D S G G P LVC K KN G A W T L V G I V S W GSS -T C S T S -T P G V Y A R V T A L V N W V Q Q T LA A N V R S G C Q G D S G G P L H C L V N G Q Y A V H G V T S F V S R LG CNVTRKPT V FTR VSAY I S W I N N V I A S N 187 ^ 245 (B) A = C = D = E = F =


Aia Cys Asp Gi Phe = = = = alanina cisteina cido aspartico cido glutm ico feniialanina

I I III I III I I I

I I

II I

G H K L
i

=Giy = giicina = Hs = histidna = He = isoleucna = Lys = lisina = Leu = leucina

= = = = =

M et Asn Pro Gin Arg

= = = = =

m etionna asparagina proiina giutam ina arginina

= = V = W = Y =

S T

Ser Thr Val Trp Tyr

= serina = treoRna = vaiina = trip t fa n o = tirosina

actuales, tienen secuencias de aminocidos similares. Se ha credo que estas fa milias de protenas evolucionaron a partir de un gen ancestral nico que duran te el transcurso de la evolucin se duplic dando lugar a otros genes en los que gradualmente se fueron acumulando diferentes mutaciones, generndose as protenas con funciones nuevas. Consideremos la familia de las enzimas que degradan protenas (enzimas proteolticas) denominadas serina proteasas, que incluye a las enzimas digesti vas quimotripsina, tripsina y elastasa y algunas de las proteasas de la cascada enzimtica de la coagulacin de la sangre y de la fijacin del complemento. Al comparar dos de estas protenas se observa que alrededor de un 40% de las posi ciones de sus secuencias estn ocupadas por el mismo aminocido (vase Figu ra 3-38). La semejanza de sus conform aciones tridimensionales, determinadas mediante cristalografa de rayos X, es an ms notable: la mayor parte de los complicados giros y vueltas de sus cadenas polipeptdicas, de varios cientos de aminocidos, son idnticos (Figura 3-39). El caso de las serina proteasas se repite en centenares de otros casos de fa milias proteicas. En muchos casos, la secuencias de aminocidos han divergido mucho ms que en el caso de las serina proteasas, de forma que no podemos es tar seguros de la relacin familiar entre dos protenas sin determinar sus estruc turas tridimensionales. Por ejemplo, las protenas a 2 de levadura y la protena

Figura 3-38 (A) Comparacin de las secuencias de aminocidos de dos miembros de la familia de enzimas serina proteasas. Se muestran las zonas carboxilo terminales (aminocidos 149 a 245) de las dos protenas. Los aminocidos idnticos se presentan conectados por barras de color y se destaca el residuo de serina del lugar activo de la enzima (posicin 195). En las secciones de la cadena polipeptdica encerradas en cajas a m arillas, cada aminocido ocupa una posicin espacial altamente equivalente en la estructura tridimensional de las dos enzimas (vase Figura 3-39). (B) Los cdigos estndar de una letra y de tres letras que se utilizan para designar los aminocidos. (Modificado de J. Greer, Proc. N a ti Acad. Sci. USA 77:33933397, 1980.)

HOOC HOOC
' V --V / / . 4 '

iw - ;, NHL

m..

fi

NH 2

ELASTASA (A)

QUIMOTRIPSINA (B)

Figura 3-39 Comparacin entre las conform aciones de las dos serina proteasas presentadas en la Figura 3-38. La elastasa se presenta en (A) y la quimotripsina en (B). A pesar de que ambas protenas solamente tienen iguales los aminocidos que se sealan en verde, sus conform aciones son muy similares. El lugar activo, sealado con Un crculo rojo, presenta un residuo activo de serina (vase Figura 3-57). La quimotripsina presenta ms de dos extremos de cadenas polipeptdicas ya que se forma por la rotura proteoltica del quimotripsingeno, un precursor inactivo.

126

Captulo 3 : Macromolculas: estructura, forma e informacin

(A)

(C)
H2N

levadura GHRFTKENVR LE S W FA KN IE N P YL D T KG L E N LM KNT SLSR IQ I RTAFSSEOLARLKREFNEN - - - RYLTERRRQQLSSELGLNEAQI Drosophila

K N W V S N R R R K E K T I COOH K I W F Q N K R A K I K K( S

angrelada de Drosophila son dos protenas reguladoras de genes de la familia homeodominio. Solo son iguales en 17 de sus 60 residuos de aminocidos, de forma que slo resulta evidente la relacin que existe entre ambas cuando se comparan sus estructuras tridimensionales (Figura 3-40). A menudo, los diferentes miembros de una gran familia de protenas tienen funciones bastantes diferentes. Algunos de los cambios de aminocidos que di ferencian estas enzimas fueron seleccionados en el transcurso de la evolucin probablem ente porque daban lugar a cambios en la especificidad del substrato y en las propiedades reguladoras, confirindoles las distintas funciones que pre sentan en la actualidad. Otros cambios de aminocidos parecen ser neutros, no teniendo efectos ni beneficiosos ni perjudcales sobre la estructura y la fun cin bsicas de una protena. Puesto que la mutacin es un proceso aleatorio, tam bin debieron producirse muchos cambios perjudiciales que alteraron la es tructura tridimensional de estas protenas lo suficiente como que resultaran inactivas. Estas protenas inactivas debieron perderse en cuanto los organismos individuales que las producan se encontraron en una situacin de desventaja y fueron eliminados por la seleccin natural. Por consiguiente no debe sorpren dernos que las clulas contengan grupos enteros de cadenas polipeptdicas afi nes que tienen ancestros comunes pero funciones diferentes.

Figura 3 -40 Com paracin de homodominios de unin al DNA de dos organismos separados por m s de mil millones de aos de evolucin.

(A) Estructura esquemtica. (B) Localizacin de las posiciones de los carbonos a. Las estructuras tridimensionales mostradas fueron determinadas por cristalografa de rayos X de la protena oc2 de la levadura {verde) y de la protena angrelada de Drosophila (rojo). (C) Comparacin de las secuencias de aminocidos de la regin de las protenas mostradas en (A) y (B). Los puntos naranja sealan la posicin de un inserto de tres aminocidos de la protena a2. (Adaptado de C. Wolberger et al., Cell 67: 517-528, 1991.)

Las nuevas protenas pueden desarrollarse por recom binacin de dominios polipeptdicos preexistentes 26
Cuando una clula ha producido un cierto nmero de superficies proteicas esta bles, se pueden generar nuevas superficies con diferentes propiedades de unin, mediante la com binacin de dos o ms protenas a travs de interacciones no covalentes, produciendo un complejo proteico. Este proceso de unin de prote nas globulares que genera agregados proteicos mayores y funcionales es habi tual en las clulas. Muchos complejos proteicos tienen pesos moleculares de ms de un milln de daltons, a pesar de que un una cadena polipeptdica tpica tiene un peso molecular de alrededor de 40 000 daltons (entre 300 y 400 am ino cidos) y de que un nmero relativamente reducido de cadenas alcanza un ta mao tres veces superior a ste. Un camino alternativo de generar una nueva protena a partir de cadenas preexistentes consiste en unir las secuencias de DNA correspondientes, produ cindose un gen que codifica una larga cadena polipeptdica nica. Se cree que

Estructura de las protenas

127

las protenas en las que diferentes zonas se pliegan de forma independiente en dominios globulares distintos, han evolucionado de esta forma, quizs despus de existir durante prolongados perodos de tiempo como complejos proteicos formados a partir de polipptidos independientes. Muchas protenas tienen una estructura multidominio de este tipo, y tal como cabra esperar a raz de las consideraciones evolutivas mencionadas antes, a menudo ocurre que un punto importante de unin a otra molcula se encuentra en el lugar en el que se yuxta ponen dos dominios diferentes (Figura 3-41). As, en el caso de la protena multi dominio cuya estructura tridimensional se muestra en la Figura 3-42, la superfi cie proteica de un dominio que une NAD+ aparentemente se combina con la superficie de un segundo dominio que une un azcar, constituyendo parte de un proceso de evolucin de un lugar activo que utiliza NAD+ para catalizar la oxidacin de un azcar. Existe otra manera, especialmente frecuente en las largas protenas fibrosas como la colgena, de reutilizar una secuencia de aminocidos (vase Figura 3-32). En estos casos se forma una estructura a partir de mltiples repeticiones inter nas de una secuencia ancestral de aminocidos. Es evidente que la unin de se cuencias de aminocidos a travs de la unin de secuencias preexistentes de DNA codificante es una estrategia mucho ms eficaz para la clula que la alter nativa de obtener nuevas secuencias proteicas mediante mutacin aleatoria del

Figura 3-41 Evolucin de un nuevo lugar de unin a un ligando. El principio general por el cual la yuxtaposicin en el curso de la evolucin de superficies de protena separadas ha permitido incrementar el nmero de protenas que presentan nuevos lugares de unin para otras molculas (lig an d os , vase pg. 135). Como se indica aqu, a menudo los lugares que interaccionan con los ligandos se localizan en la interfase entre los dos dominios proteicos y estn formados por regiones en asa de la superficie de la protena (vase tambin Figura 3-42).

Figura 3-42 Estructura de la enzima glucoltica gliceraldehdo 3-fosfato deshidrogenasa. La protena est compuesta por dos dominios, que aqu se presentan en colores diferentes, con regiones de hlice a (representadas por cilindros) y zonas de lmina (3 (representadas como flechas). Los detalles de la reaccin que cataliza esta enzima se muestran en la Figura 2-22. Ntese que los tres substratos que intervienen en la reaccin se unen a la enzima en una regin intermedia entre los dos dominios. (Por cortesa de Alan J. Wonacott.)

-------- NADH

128

Captulo 3 : Macromolculas: estructura, forma e informacin

PROTEINA CAP H2N I h A -

COOH

H2N

REPRESOR LAC --------------------------------------------- COOH

REPRESOR CRO H2N - A PROTEINA QUINASA DEPENDIENTE DE cGMP -r I I I

H2N

COOH

SUBUNIDAD REGULADORA DE LA PROTEINA QUINASA DEPENDIENTE DE cAMP H2N I I I I COOH

H?N' (B)

EGF H2N ^ > COOH QUIMOTRIPSINA H2N -^ P -C O O H UROQUINASA H2N O - O - COOH FACTOR IX H2N - A ----- O -----P < a l- COOH PLASMINGENO E l H E i Ci ^ c o o H

(A)

100 am inocidos

Las homologas estructurales pueden contribuir en la asignacin de funciones a las protenas descubiertas recientem ente 27
El desarrollo de tcnicas de secuenciacin rpida del DNA ha permitido deter minar la secuencia de aminocidos de un gran nmero de protenas a partir de las secuencias de nucletidos de sus genes. As, el disponer de una siempre cre ciente base de datos sobre protenas hace posible realizar de forma rutinaria un estudio exhaustivo por ordenador para buscar posibles secuencias homologas entre la de una protena acabada de sintetizar y las de otras protenas estudiadas previamente. A pesar de que, por ahora, solamente se han secuenciado un pe queo porcentaje del total de protenas de los organismos eucariotas, resulta ha bitual ya encontrar que una protena que se acaba de secuenciar es homologa a alguna regin de otra protena conocida, lo cual indica que la mayora de las protenas pueden descender de un nmero de tipos de protenas ancestrales re lativamente reducido. Como era de esperar, a menudo las secuencias de muchas protenas grandes muestran signos de haber evolucionado a travs de la unin de dominios preexistentes generando nuevas com binaciones de ellos, un proce so conocido como barajado de dominios (domain shuffling) (Figura 3-43). Estos estudios comparativos entre protenas tambin son importantes debi do a que normalmente una relacin estructural supone una relacin funcional. As, el descubrir una homologa entre la secuencia de aminocidos de la prote na estudiada y la de una protena de funcin conocida puede suponer el ahorro de muchos aos de investigacin. Tales homologas entre secuencias indicaron, por ejemplo, que algunos genes reguladores del ciclo celular en clulas de leva dura y otros genes que inducen la transformacin de clulas de mamfero en c lulas cancerosas son protena quinasas. De esta forma se pudo reconocer que muchas de las protenas que controlan la gnesis de la forma de la m osca del vinagre Drosophila son protenas reguladoras de genes, mientras que otras pro tenas tam bin implicadas en este control se pudieron clasificar como serina proteasas. El descubrimiento de homologas entre dominios tambin puede ser til en otro sentido. Resulta mucho ms difcil determinar la estructura tridimensional de una protena que conocer su secuencia de aminocidos. Sin embargo, es po sible intuir la conformacin de un dominio de una protena que se acaba de se cuenciar si este dominio es homlogo a otro dominio de una protena cuya con formacin ha sido determinada anteriormente por difraccin de rayos X. Asumiendo que los giros y torcimientos de las cadenas polipeptdicas estn con servados en ambas protenas a pesar de las diferencias que existan en la secuen cia de aminocidos, a menudo se puede esbozar la estructura de una nueva pro tena con una exactitud razonable (Figura 3-40). Cada ao se aaden muchas nuevas secuencias de protenas a la base de datos, con lo que paulatinamente se incrementa la posibilidad de encontrar ho mologas tiles. La comparacin entre secuencias de protenas es una herra m ienta de la biologa celular cada da ms importante.

Figura 3-43 Barajado de dominios. Durante la evolucin de las protenas se produjo un extenso barajado de bloques de secuencias de protena (m d u los proteicos). En la figura, las zonas sealadas con marcas de la misma forma y color estn relacionadas evolutivamente pero no son idnticas. (A) La protena activadora de gen por catabolitos (CAP, de Catabolite Gen Activator Protein) presenta un dominio (tringulo azul) que se une especficam ente a una secuencia de DNA, y un segundo dominio (rectn gu lo rojo) que une AMP cclico (vase Figura 3-35). El dominio que se une a DNA est relacionado con el de muchas otras protenas reguladoras de genes, com o las protenas represoras lac y ero. Adems, se han encontrado dos copias del dominio que une AMP cclico en protena quinasas de eucariotas reguladas por la unin de nucletidos cclicos. (B) Las serina proteasas sem ejantes a quimotripsina estn formadas por dos dominios (m arrn). En algunas proteasas relacionadas que estn fuertemente reguladas y ms especializadas los dos dominios proteasa estn conectados a uno o ms dominios homlogos a dominios encontrados en el factor de crecim iento epidrmico (h ex g on o verde), a la protena que une calcio (tringulo a m a rillo) o al dominio kringle (c u a d ra d o azu l) que contienen tres enlaces disulfuro internos.

Estructura de las protenas

129

subunidad

dim ero

Figura 3 -44 Form acin de un dimero a partir de un solo tipo de subunidad proteica. Una proteina con un solo lugar de unin que reconozca una zona de s misma, a menudo genera dimeros simtricos. Normalmente, estos dimeros se asocian con otras subunidades formando tetrmeros y agregados mayores (no se muestra).

Las subunidades proteicas pueden ensamblarse formando grandes estructuras 28


Los mismos principios que permiten que varios dominios proteicos se asocien formando lugares de unin, tam bin permiten la formacin de estructuras mu cho mayores en la clula. Las estructuras supramoleculares tales como los com plejos enzimticos, los ribosomas, los filamentos proteicos, los virus y las m em branas no se sintetizan en forma de molculas gigantes unidas covalentemente; en lugar de ello se forman por agregados no covalentes de muchas molculas preformadas, que en la estructura final se denominan subunidades. El uso de subunidades pequeas para construir grandes estructuras presenta varias ventajas: (1) la construccin de una gran estructura a partir de una o algu nas subunidades menores repetidas reduce la cantidad de informacin gentica necesaria; (2) puesto que las subunidades se asocian a travs de mltiples enlaces de energa relativamente baja, tanto el ensamblaje como la disgregacin resultan fciles de controlar; y (3) el ensamblaje de subunidades minimiza los errores en la sntesis de la estructura ya que en el transcurso del ensamblaje pueden actuar mecanismos de correccin que excluyan las subunidades defectuosas.

Figura 3-45 Modelo de cinta de un dmero formado a partir de dos subunidades proteicas idnticas (m onm eros). La protena mostrada es la protena activadora de gen por catabolito (CAP) de bacteria ilustrada previamente en la Figura 3-35. (Por cortesa de Jane Richardson.)

Un solo tipo de subunidad proteica puede interaccionar consigo m ism a formando agregados geomtricos regulares 29
Si una protena tiene un lugar de unin que es complementario de una regin de su propia superficie, se ensamblar espontneamente formando una estructura mayor. En el caso ms sencillo, un centro de unin se reconoce a s mismo y for ma un dmero simtrico. Muchas enzimas y otras protenas forman dmeros de

subunidades libres

estructuras ensambladas

de unin hlice

Figura 3 -46 Cuando un solo tipo de subunidad proteica interacciona consigo m isma, se pueden generar anillos o hlices. En la Figura 3-5 se muestra cmo se forma una hlice; se genera un anillo en lugar de una hlice si las subunidades se unen entre ellas, detenindose el crecim iento de la cadena.

anillo de unin

130

Captulo 3 : Macromolculas: estructura, forma e informacin

hlice de actina

Figura 3-47 Un filamento de actina. En este importante filamento, que se discute en detalle en el Captulo 16, existen aproximadamente dos subunidades proteicas globulares por vuelta.

este tipo, que frecuentem ente actan como subunidades en la formacin de agregados mayores (Figuras 3-44 y 3-45). Si el lugar de unin de una protena es complementario de una regin de su superficie que no incluya al propio lugar de unin, se formar una cadena de sub unidades. Determinadas orientaciones de los dos lugares de unin harn que la cadena se cierre pronto sobre s misma formando un anillo de subunidades (Figura 3-46). Sin embargo es ms frecuente que se produzca un largo polmero de subunidades; cuando cada subunidad se una a la siguiente de forma idntica, las subunidades del polmero se dispondrn siguiendo una hlice prolongada indefinidamente (vase Figura 3-5). Un filam ento de actina, por ejemplo, es una estructura helicoidal formada a partir de una sola subunidad: una protena glo bular denominada actina; los filamentos de actina son componentes mayoritarios del citosol de la mayora de las clulas eucariotas (Figura 3-47). Como discu timos ms adelante las protenas globulares tambin pueden asociarse con molculas sem ejantes formando grandes lminas o tubos (vase Figura 3-49).

A menudo las protenas superenrolladas colaboran en la construccin de grandes estructuras en las clulas 30
Normalmente cuando la resistencia m ecnica es especialmente importante, los agregados supramoleculares se construyen a partir de subunidades fibrosas en lugar de subunidades globulares. Estos agregados pueden estabilizarse por un gran nmero de regiones de contactos protena-protena que se producen cuanFigura 3 -48 Estructura de una hlice superenrollada. En (A) se presenta una hlica a sencilla, con las cadenas laterales de los aminocidos sucesivos sealadas siguiendo la secuencia de siete elementos abcdefg (de abajo a arriba). En esta secuencia los aminocidos a y d coinciden sobre la superficie del cilindro formando una banda (sealada en rojo) que gira lentamente alrededor de la hlice a. Tpicamente, las protenas que forman hlices superenrolladas tienen aminocidos hidrofbicos en las posiciones a y d. Por lo tanto, como se muestra en (B), las dos hlices a pueden enroscarse una sobre la otra de forma que las cadenas laterales hidrofbicas de una hlice a interaccionen con las cadenas laterales hidrofbicas de la otra, mientras que las otras cadenas laterales, ms hidroficas, quedan expuestas libremente al entorno acuoso. (C) La estructura atmica de una hlice superenrollada, determinada por cristalografa de rayos X. Las cadenas laterales en rojo son hidrofbicas. (C, de T. Alber, Curr. Opin. Genet. Devel. 2:205-210,1992. Current Science.)

banda de am inocidos hidrofbicos "a"y"d"

HOOC

COOH

0,5 nm
(A)

Estructura de las protenas

131

lmina empaquetada de form a hexagonal subunidad tubo helicoidal

Figura 3 -49 Las subunidades proteicas globulares empaquetadas de forma hexagonal pueden generar tanto una lm ina plana com o un tubo.

do las subunidades se enrollan una respecto a la otra formando una hlice multihebra. Una unidad estructural particularmente estable utilizada repetidamente en este sentido, es la denominada hlice superenrollada (coiled-coil). Se forma por el apareamiento de dos subunidades de hlice a que tienen una distribu cin repetida de cadenas laterales no polares. Normalmente las dos subunida des de hlice a son idnticas y corren en paralelo (es decir, en la misma direc cin amino-carboxilo terminal). Se enrollan gradualmente una alrededor de la otra generando un filamento rgido de un dimetro de unos 2 nm (Figura 3-48). En algunas familias de protenas reguladoras de genes las hlices superenrolladas actan como dominios de dimerizacin. Ms frecuentemente, una hlice superenrollada puede extenderse ms de 100 nm y actuar como un bloque de construccin de una gran estructura fibrosa, como el filamento fino en la clula muscular.

Las protenas pueden ensam blarse formando lminas, tubos o esferas 31


Algunas subunidades proteicas se ensamblan formando lminas planas en las que las subunidades se disponen siguiendo un patrn de anillos hexagonales. A veces, las protenas especializadas en transporte a travs de membranas pre sentan una disposicin de este tipo en el interior de la bicapa lipdica. Un pe queo cambio de la geometra de las subunidades puede hacer que una lmina hexagonal se convierta en un tubo (Figura 3-49) o, si se producen ms cambios, en una esfera hueca. Molculas proteicas tubulares y esfricas que se unen espe cficam ente al RNA y al DNA forman la cubierta de los virus. La form acin de estructuras cerradas, com o anillos, tubos y esferas, propor ciona una estabilidad adicional al increm entar el nmero de enlaces que se pueden formar entre las subunidades proteicas. Adems, debido a que estructu ras como stas se forman por interaciones cooperativas mutuamente depen dientes entre subunidades, puede inducirse la formacin o la disgregacin del complejo a travs de cam bios relativamente pequeos que afecten a las subuni dades individuales. Estos principios quedan ilustrados de forma espectacular en las protenas cpsides de muchos virus simples que adoptan la forma de una es fera hueca. A menudo, estas cubiertas estn formadas por cientos de subunida des proteicas idnticas que envuelven y protegen el cido nucleico vrico (Figura 3-50). La protena de estas cpsides ha de tener une estructura particularmente adaptable, ya que ha de establecer muchos tipos diferentes de contactos y tam bin alterar su disposicin para permitir la salida del cido nucleico al iniciar la multiplicacin vrica cuando el virus ha entrado en la clula.

Muchas estructuras celulares son capaces de autoensam blarse 32


La informacin necesaria para el ensam blaje de muchos agregados macromoleculares celulares ha de hallarse en las propias subunidades, ya que en condicio-

132

Captulo 3 : Macromolculas: estructura, forma e informacin

tres dmeros dm eros libres dm ero vrico partcula incom pleta

t-

dom inio de proyeccin dom inio de corteza brazo de conexin , dom inio de unin al RNA d im eros libres

m onm ero (en m odelo de cinta)

partcula vrica intacta (90 dmeros)

Figura 3 -5 0 Estructura de un virus esfrico. En muchos virus se em paquetan subunidadades proteicas idnticas generando un caparazn esfrico (una cpside) que contiene el genoma vrico com puesto de RNA o de DNA (vase Figura 6-72). Por razones geomtricas, no se pueden empaquetar de una forma sim trica precisa ms de 60 subunidades idnticas. Sin embargo, cuando pueden existir pequeas irregularidades estructurales, se puede generar una cpside mayor utilizando ms subunidades. Por ejemplo, el virus del tomate achaparrado (TBSV, de Tom ato Bushy Stunt Virus) es esfrico, de unos 33 nm de dimetro, formado por 180 copias idnticas de una protena de la cpside de 386 aminocidos y un genoma de RNA de 4500 nucletidos. Para formar una cpside tan grande, la protena ha de poder colocarse en tres am bientes algo diferentes, cada uno de los cuales se presenta en color en la partcula de la figura. Tam bin se muestra una propuesta sobre el proceso de ensam blaje; la estructura tridimensional precisa se ha determinado por difraccin de rayos X. (Dibujos por cortesa de Steve Harrison.)

nes adecuadas las subunidades aisladas puedes ensamblarse espontneamente en el tubo de ensayo dando lugar a la estructura final. El primer agregado macromolecular del que se demostr que era capaz de autoensamblarse a partir de sus elem entos constituyentes fue el virus del mosaico del tabaco (TMV, de To bacco Mosaic Virus). Este virus es una larga varilla en la que un cilindro de pro tena se halla dispuesto alrededor de un ncleo helicoidal de RNA (Figura 3-51). Si se mezclan en solucin el RNA y las subunidades proteicas disociadas, se ob serva que se recom binan formando partculas vricas completamente activas. El proceso de ensam blaje es sorprendentemente complejo e incluye la formacin de anillos dobles de protena que actan como intermediarios que se aaden a la cubierta vrica en crecimiento. Otro agregado macromolecular complejo que se puede reensamblar a partir de sus elementos constituyentes es el ribosoma bacteriano. Estos ribosomas es tn compuestos por unas 55 molculas proteicas diferentes y 3 molculas dife rentes de rRNA. Si los 58 componentes se incuban en condiciones apropiadas, es pontneamente forman la estructura original. Lo que es ms importante, estos ribosomas reconstruidos son capaces de llevar a cabo sntesis proteica. Como ca ba esperar, el proceso de reensamblaje de los ribosomas sigue una va especfica: primero ciertas protenas se fijan al RNA; luego, este complejo es reconocido por otras protenas, y as sucesivamente hasta que la estructura est completa. Todava no est claro cmo se regulan algunos de los procesos ms compli cados de autoensamblaje. Por ejemplo, parece que muchas estructuras de la c lula tienen una longitud exactamente definida, que es muchas veces superior a

Estructura de las protenas

133

M m m

(A)

50 nm

la de las macromolculas que las componen. En muchos casos todava constitu ye un enigma cmo se consigue esta determinacin de la longitud. En la Figura 3-52 se ilustran tres posibles mecanismos de este proceso. En el caso ms senci llo, un ncleo proteico u otra macromolcula proporciona un soporte que deter mina el tamao final del ensamblaje. ste es el mecanismo que determina la longitud de la partcula TMV en la que el ncleo est constituido por la cadena de RNA. De forma similar se ha demostrado que es una protena de ncleo la que determina la longitud de los filamentos finos del msculo y de las largas co las de algunos virus bacterianos (Figura 3-53).

(B)

No todas las estructuras biolgicas se form an por autoensam blaje 33


Algunas estructuras celulares mantenidas por enlaces no covalentes no son ca paces de autoensamblarse. Una mitocondria, un cilio o una miofibrilla no pue den formarse espontneam ente a partir de una solucin de sus componentes macromoleculares porque parte de la informacin necesaria para el ensamblaje es suministrada por enzimas especiales y por otras protenas celulares que reali zan la funcin de plantilla o patrn y que no aparecen en la estructura final una vez ensamblada. Incluso algunas estructuras pequeas carecen de alguno de los ingredientes necesarios para su ensamblaje. Por ejemplo en la formacin de un pequeo virus bacteriano la estructura de la cabeza, compuesta por un solo tipo de subunidad proteica, se ensam bla sobre un armazn transitorio compuesto por una segunda protena. Puesto que esta segunda protena no aparece en la partcula vrica final, la estructura no puede reensamblarse espontneamente despus de haber sido disgregada. Se conocen otros ejemplos en los que la de gradacin proteoltica es un paso esencial e irreversible del proceso de ensam blaje. ste es el caso de las cpsides de ciertos virus bacterianos e incluso de al gunos agregados proteicos sencillos, como por ejemplo la protena estructural colgena y la horm ona insulina (Figura 3-54). Sobre la base de estos ejemplos re lativamente simples parece muy probable que el ensamblaje de una estructura tan com pleja com o una mitocondria o un cilio implique por un lado una orde nacin espacial y temporal suministrada por otros componentes celulares, y por otro procesos irreversibles catalizados por enzimas degradativas.

Figura 3-51 Estructura del virus del mosaico del tabaco. (A) Micrografa electrnica del virus del mosaico del tabaco (TMV, de Tobacco Mosaic Virus) formado por una nica larga molcula de RNA rodeada por una cubierta proteica cilindrica que est compuesta por una densa disposicin helicoidal de subunidades proteicas idnticas. (B) Modelo que muestra parte de la estructura del TMV. Una molcula de RNA de una sola hebra, de 6000 nucletidos, se empaqueta formando una cubierta helicoidal construida a partir de 2130 copias de una protena de cubierta de 158 residuos de aminocido de longitud. En el tubo de ensayo a partir de RNA purificado y de molculas de protena se pueden autoensamblar partculas del virus con plena capacidad de infeccin. (A por cortesa de Robley Williams; B por cortesa de Richard J. Feldmann.)

i +m

S B
(A) ENSAMBLAJE SOBRE UN NCLEO (B) TENSIN ACUM U LAD A (C) PIE DE REY

Figura 3 -52 Tres posibles sistemas a travs de los que se puede form ar un gran agregado proteico de una longitud determinada. (A) Coensamblaje a lo largo de un ncleo proteico alargado o de otra macromolcula, las cuales actan como dispositivo de medida de longitud. (B) El final del ensam blaje se produce debido a la tensin que se acumula en la estructura polimrica a medida que se van aadiendo ms subunidades, de forma que a partir de una cierta longitud, la energa necesaria para aadir otra subunidad a la cadena es excesiva. (C) Ensamblaje tipo pie de rey", en el cual dos tipos de molculas sem ejantes a un rodillo, de longitud diferente, forman un complejo escalonado que crece hasta que sus finales coinciden exactamente.

134

Captulo 3 : Macromolculas: estructura, forma e informacin

Resumen
La conformacin tridimensional de una molcula proteica est determinada por su secuencia de aminocidos. La estructura plegada est estabilizada por interacciones no covalentes entre diferentes zonas de la cadena polipeptdica. Los aminocidos cuyo residuo es hidrofbico tienden a agruparse en el interior de la molcula; las interaccio nes locales por enlaces de hidrgeno entre los enlaces peptdicos vecinos dan lugar a hlices a y lminas p. Muchas protenas se construyen a partir de unidades modulares que son regiones globulares conocidas como dominios; tpicamente las protenas pe queas presentan un nico dominio mientras que las protenas ms grandes tienen varios dominios unidos entre s a travs de cortas zonas de la cadena polipeptdica. A medida que las protenasfueron evolucionando, los dominios fueron modificndose y combinndose con otros dominios construyndose as nuevas protenas. Las protenas pueden unirse entre sformando grandes estructuras a travs de las mismas fuerzas no covalentes que determinan el plegado de las protenas. Las protenas que presentan lugares de unin para su propia superficie se pueden en samblarformando dmeros, anillos cerrados estructuras esfricas o polmeros heli coidales. Algunas mezclas de protenas y de cidos nucleicos se pueden ensamblar espontneamente en un tubo de ensayo produciendo estructuras complejas pero muchos procesos de ensamblaje presentan pasos irreversibles de modo que no todas las estructuras de la clula son capaces de reensamblarse espontneamente des pus de haber sido disociadas en sus elementos constituyentes.

100 nm

Las protenas como catalizadores34


Las propiedades qumicas de una molcula proteica dependen casi com pleta mente de los residuos de aminocidos que quedan expuestos en su superficie y que son capaces de formar enlaces dbiles no covalentes con otras molculas. Cuando una molcula proteica se une a otra molcula, a esta segunda molcula se la denomina ligando. Puesto que la interaccin eficaz entre una molcula pro teica y un ligando requiere que se formen simultneamente entre ambas molcu las varios enlaces dbiles, los nicos ligandos que se pueden fijar fuertemente a una protena determinada son los que se adaptan exactamente a su superficie. La regin de una protena que se asocia con un ligando recibe el nombre de lugar de unin de dicha protena y suele tener forma de cavidad, constituida por una disposicin especfica de aminocidos en la superficie de la protena. A m e nudo estos aminocidos pertenecen a zonas muy distantes de la cadena poli peptdica (Figura 3-55) y representan una pequea fraccin del nmero total de aminocidos presentes. El resto de la molcula proteica es necesario para m an tener la cadena polipeptdica en posicin correcta y para suministrar lugares de unin adicionales con finalidad reguladora; normalmente el interior de la prote na nicamente es importante en cuanto confiere a la superficie de la molcula una forma y una rigidez adecuadas.

Figura 3-53 Electronmicrografa del bacterifago lambda. La punta de la cola del virus se une especficamente a una protena determinada de la superficie de una clula bacteriana, y a continuacin un DNA densamente empaquetado, situado en la cabeza del virus, es inyectado a la clula a travs de la cola del virus. La cola tiene una longitud precisa, determinada por el mecanismo que se muestra en la Figura 3-52A.

proinsulina

plegam iento especfico estabilizado por enlaces disulfuro

La conform acin de una protena determina sus propiedades qumicas 20


A menudo los residuos superficiales de una protena interaccionan de tal m ane ra que alteran la reactividad qumica de algunos residuos determinados de am i nocidos. Estas interaciones son de diferentes tipos.
Figura 3 -54 La horm ona polipeptdica insulina no puede form arse de nuevo de form a espontnea si se rom pen sus puentes disulfuro. Se sintetiza com o una gran protena (proin su lin a ), la cual es dividida por una enzima despus de que la cadena polipeptdica se haya plegado adoptando una forma especfica. La escisin de parte de la cadena polipeptdica de la proinsulina supone una prdida irreparable de la informacin necesaria para que la protena se pliegue espontneamente adoptando su conform acin normal.

elim inacin del pptido de unin, quedando as una m olcula com pleta de insulina, de dos cadenas insulina

la reduccin separa irreversiblem ente las dos cadenas


SH SH

SH

SH

Las protenas como catalizadores

135

H\ / C\

Ser 83

V H\ /
c
J

O,

/ N

CH? \ 2

\H

enlace de hidrgeno

(CH2)3

XN H
Arg 82 XC = N H ^ 0 \ 2 NH, O-7 ^

SUBUNIDAD 1

Figura 3-55 Lugar de unin a ligando de la protena activadora de un gen por catabolito (CAP, de Catabolite Gene Activator Protein). La unin por enlaces de hidrgeno entre CAP y su ligando, el AMP cclico {verde) se determind por anlisis cristalogrfico de rayos X del com plejo. Como se indica, las dos subunidades idnticas del dmero cooperan formando este lugar de unin (vase tam bin Figura 3-45). (Por cortesa de Tom Steitz.)

SUBUNIDAD 2

En primer lugar, zonas vecinas de la cadena polipeptidica pueden interaccionar de manera que restrinjan el acceso de molculas de agua a otras zonas de la superficie proteica. Puesto que las molculas de agua tienden a forma enlaces de hidrgeno, compiten con los ligandos por ciertos residuos de aminocidos de la superficie proteica (Figura 3-56). Por consiguiente, la intensidad de los enla ces de hidrgeno (y de las interacciones inicas) entre las protenas y sus ligandos queda altamente increm entada cuando las molculas de agua son excluidas. A primera vista resulta difcil imaginar un m ecanismo que pueda excluir de la superficie de una protena una molcula tan pequea como la del agua sin afec tar el acceso del propio ligando. Sin embargo, y debido a su clara tendencia a formar enlaces de hidrgeno, las molculas de agua se hallan formando una am plia red mantenida por estos enlaces (vase Panel 2-1, pgs. 50-51) y a menudo el separarse de la red e introducirse en una grieta de la superficie proteica resul ta energticamente desfavorable para las distintas molculas individuales. En segundo lugar, la agrupacin de residuos de aminocidos polares veci nos puede alterar su reactividad. Por ejemplo, si debido al plegamiento de la protena varias cadenas laterales con carga negativa son inducidas a agruparse, en contra de su repulsin mutua, la afinidad de cada residuo de aminocido por un ion de carga positiva aumenta marcadamente. Determinadas cadenas latera les pueden tam bin interaccionar una con otra a travs de enlaces de hidrgeno, los cuales pueden activar grupos laterales normalmente no reactivos (como el -CH 2OH de la serina, que se muestra en la Figura 3-57) transformndolos en grupos altam ente reactivos capaces de intervenir en reacciones que generan o rompen enlaces covalentes determinados. Por consiguiente, la superficie de cada molcula proteica tiene una reactivi dad qumica caracterstica que depende no slo de las cadenas laterales de ami nocidos que quedan al descubierto, sino que depende tambin de la exacta orientacin de estas cadenas entre s. Por esta razn, dos conformaciones ligera mente diferentes de la misma molcula proteica pueden ser enormemente dife rentes en cuanto a sus propiedades qumicas. A menudo, cuando la reactividad de las cadenas laterales resulta insuficien te, las protenas utilizan la ayuda de determinadas molculas no polipeptdicas que fijan a su superficie. Estos ligandos actan de coenzimas en las reacciones catalizadas enzimticamente y pueden estar tan fuertemente unidas a la prote-

Figura 3 -56 Competencia por la formacin de enlaces de hidrgeno. La habilidad de las molculas de agua para favorecer la formacin de enlaces de hidrgeno con grupos de la superficie de la protena reduce notablem ente la tendencia de estos grupos a unirse unos con otros.

136

Captulo 3 : Macromolculas: estructura, forma e informacin

na que llegan a formar parte efectiva de la propia protena. Ejemplos de este caso los hallamos en los grupos hemo (que contienen hierro) de la hemoglobina y de los citocromos, en la tiamina pirofosfato de las enzimas implicadas en la transferencia de grupos aldehido y en la biotina de las enzimas que participan en la transferencia de grupos carboxilo. La mayora de coenzimas son molculas orgnicas muy complejas, seleccionadas en base a la reactividad qumica que adquieren cuando se unen a la superficie de una protena. Adems de su lugar reactivo, una coenzima tiene otros residuos que la fijan a su protena husped (Figura 3-58). La Figura 3-59A muestra un modelo espacial compacto de una en zima unida a su coenzima.

El primer paso de la catlisis enzim tica es la unin del substrato 35


Una de las funciones ms importantes de las protenas consiste en actuar como enzimas, catalizando reacciones qumicas determinadas. En este caso el ligando es la molcula de substrato y la unin del substrato a la enzima es un preludio esencial de la reaccin qumica (Figura 3-59B). Si denominamos a la enzima E, al substrato S y al producto P, la reaccin bsica es E + S ^ ES ^ EP ^ E + P. A partir de esta simple representacin de una reaccin catalizada por una enzima, podemos ver que existe un lmite a la cantidad de substrato que cada molcula de enzima puede procesar en un tiempo dado. Si se increm enta la concentra cin de substrato, la velocidad a la que se forma el producto tambin se incre menta, hasta alcanzar un valor mximo (Figura 3-60). En este punto la molcula de enzima se halla saturada de substrato y la velocidad de reaccin (denominada V'mJ depende nicamente de la velocidad a la que sea procesada la molcula de substrato. Esta velocidad dividida por la concentracin de la enzima constituye

Figura 3-57 Un aminocido extraordinariam ente reactivo en el lugar activo de una enzima. El ejemplo que se muestra es la trada cataltica que se presenta en la quimotripsina, en la elastasa y en otras serina proteasas (vase Figura 3-39). La cadena lateral del cido asprtico induce a la histidina a eliminar el protn de la serina 195, lo cual activa la serina para formar un enlace covalente con el substrato de la enzima hidrolizando un enlace peptdico com o se ilustra en la Figura 3-64.

coenzima

H ,C , t-N H 2

c/
H E N Z IM A

y *


centro reactivo

H .C -C

p) W / C r'\

-C H ,

-O'

C H ,

o "\

Figura 3 -58 Coenzimas. Las coenzimas, como la tiamina pirofosfato (TPP) mostrada aqu en gris, son pequeas molculas que se unen a la superficie de una enzima permitindole catalizar reacciones especficas. La reactividad del TPP depende de su* tomo de carbono acdico, que intercambia rpidamente su tomo de hidrgeno por un tomo de carbono de una molcula de substrato. Probablemente otras regiones de la molcula de TPP actan como asas mediante las cuales la enzima mantiene a la coenzima en posicin correcta. Probablemente las coenzimas evolucionaron primero en un mundo de RNA, donde se unan a molculas de RNA para colaborar con ellas en los procesos de catlisis (se discute en el Captulo 1).

Las protenas como catalizadores

137

Figura 3-59 Modelos de espacio lleno, generados por ordenador, de dos enzimas. En (A) se p resen ta el
citocro m o c unido a su coen zim a hem o. En (B) se p resenta la lisozim a de la clara de huevo, con un substrato oligosacrido unido. En am bo s casos el ligando unido se p resen ta en rojo. (Por cortesa de Richard J. Feldm ann.)

el nmero de recambio. A menudo el nmero de recambio es de aproximada mente 1000 molculas de substrato procesadas cada segundo por cada molcula de enzima pero puede llegar a alcanzar valores mayores en casos extremos. El otro parmetro cintico utilizado con frecuencia para catacterizar a una enzima es su Kw que es la concentracin de substato que permite alcanzar la mitad de la velocidad mxima de la reaccin (Figura 3-60). Una KMbaja significa que la enzima alcanza su mxima velocidad cataltica a una baja concentracin del substrato, y por lo general indica que la enzima se une a su substrato muy fuertemente.

Las enzimas aceleran las reacciones estabilizando determinados estados de transicin36


Las enzimas consiguen que las reacciones qumicas se produzcan a velocidades extremadamente altas -m ucho ms que a travs de cualquier catlisis sinttica. Esta eficiencia puede ser atribuida a varios factores. En primer lugar, la enzima acta aumentando la concentracin local de las molculas de substrato en el lu gar cataltico y manteniendo los tomos adecuados en una orientacin correcta para la reaccin que se producir a continuacin. Sin embargo, lo ms impor tante es que una parte de la energa de fijacin contribuye directamente a la ca tlisis. Antes de formar los productos finales de la reaccin, las molculas del substrato pasan a travs de una serie de formas intermedias de geometra y dis tribucin electrnica alteradas y son las energas libres de estas formas interm e dias y en especial las de los estados de transicin ms inestables, los principales determinantes de la velocidad de la reaccin. Las enzimas presentan mayor afi nidad por estos estados inestables de transicin de los substratos que por sus

Figura 3-60 Cintica enzimtica. La velocidad de un a reacci n enzim tica


(V) au m en ta cuand o au m en ta la co n ce n traci n del substrato, hasta alcanzar un valor m xim o (Vm ax). En este punto, todos los lugares de u n in al substrato de las m olcu las enzim ticas estn ocupados, y la velocidad de la reacci n est lim itada por la velocidad del p ro ceso de catlisis sobre la superficie de la enzim a. Para la m ayora de las enzim as la co n ce n traci n de substrato a la que la velocidad es igual a la m itad de la velocidad m xim a (KM ) con stituye una m edida de la fuerza co n que la enzim a se une al substrato; cu an to m ayor es el valor de la Kw m en or es la fuerza de unin.

/21 / m a x

/ /

Km concentracin de substrato-

138

Captulo 3 : Macromolculas: estructura, forma e informacin

formas estables, y estas interacciones disminuyen las energas de los estados de transicin acelerando as una reaccin determinada (Figura 3-61). Una clara demostracin de cmo al estabilizar un estado de transicin se pue de incrementar enormemente la velocidad de la reaccin la constituye la produc cin intencionada de anticuerpos que actan como enzimas. Consideremos por ejemplo la hidrlisis de un enlace amida, que es similar al enlace peptdico que une aminocidos adyacentes en las protenas. En una solucin acuosa un enlace amida se hidroliza muy lentamente mediante el mecanismo ilustrado en la Figura 3-62A. En el compuesto intermedio central, o estado de transicin, el carbono carbonilo se halla unido a cuatro tomos situados en los vrtices de un tetraedro. Se puede obtener un anticuerpo que acte como una enzima generando anticuerpos que se unan fuertemente a un anlogo estable de este compuesto intermedio tetra drico, muy inestable, tal como se ilustra en la Figura 3-62B. Este anticuerpo catal tico se une al compuesto intermedio tetradrico y lo estabiliza, incrementando as ms de 10 000 veces la velocidad de hidrlisis espontnea del enlace amida.

energa de activacin para una reaccin no catalizada

energa de activacin para una reaccin catalizada


Figura 3-61 Las enzimas aceleran las reacciones qumicas disminuyendo la energa de activacin. A m en ud o
tan to las re accio n e s no catalizadas (A) com o la catalizada por un a enzim a (B) se prod u cen a travs de diversos estad os de tran sicin . El estad o de tran sici n de m ayor energa (ST y EST) es el que d eterm in a la energa de activ acin y lim ita la velocidad de la re acci n (S=substrato; P=producto de la reacci n ).

Las enzimas pueden facilitar la formacin y la rotura de enlaces covalentes a travs de una catlisis cida y bsica simultnea3 7
Las enzimas son mejores catalizadores que los anticuerpos catalticos. Adems de unirse fuertemente al estado de transicin, el lugar activo de una enzima con tiene tomos situados en el espacio de forma precisa que aceleran la reaccin al terando la distribucin de los electrones de los tomos implicados en la form a cin y la rotura de los enlaces covalentes. Los enlaces peptdicos, por ejemplo, pueden ser hidrolizados en ausencia de una enzima exponiendo un polipptido a una base fuerte o a un cido fuerte, como se explica en la Figura 3-63B y C. Sin embargo, las enzimas son nicas en hacer posible la catlisis cida y bsica si multnea, ya que impiden que los residuos cidos y bsicos necesarios se com binen unos con otros (como ocurrira si estuvieran en solucin) al mantenerlos unidos a la rgida estructura de la protena (Figura 3-63D). Hay que precisar la adecuacin entre una enzima y su substrato. Un pequeo cambio introducido mediante ingeniera gentica en el lugar activo de una enzima puede tener consecuencias extraordinarias. Por ejemplo, al reemplazar un cido glutmico por un cido asprtico en una enzima se desplaza la posicin del ion carboxilato cataltico alrededor de 1 (aproximadamente el radio de un tomo de hidrge no), y ello es suficiente para reducir la actividad de la enzima ms de cien veces.

(A) HIDRLISIS DE UN ENLACE AM IDA


O ( H
c

Figura 3 -62 Anticuerpos catalticos.


La estab ilizacin de un estad o de tran sici n por u n an ticu erp o genera u n a enzim a. (A) La re a cci n de la hidrlisis de un en lace am id a se prod uce a travs de un intermedio tetradrico, que es el estad o de tran sicin de alta energa de la reacci n . (B) La m olcu la m ostrad a a la izquierda se un i co v alen tem en te a un a p ro ten a y se utiliz com o antgeno para gen erar u n anticu erp o que result un irse fu ertem en te a la regin de la m o lcu la se alad a en am arillo. Este anticu erp o tam b i n se une fu ertem en te al estad o de tran sici n en (A), por lo que act a com o u n a enzim a que cataliza e ficien tem en te la h idrlisis del en lace am id a de la m o lcu la que se m u estra a la derecha.

O )
h

HX XH agua

H+ H interm ediario tetradrico

( c) h N ^ P O l l () I I

(B) ANALOGO DEL ESTADO DE TRANSICIN PARA LA HIDRLISIS DE LA AM IDA


O

amida

Las protenas como catalizadores

139

LENTO

o II

RPIDO ----- N II /

/ C\H ----- N C -----H O H / \ H H

H O II

nN'

RPIDO
\
h

O II H C -----H H
O

MUY RPIDO \ H / H / \

( ' -----o II / \ H H

/ C\ ----- N II O / \ H
O

11 O II O

Figura 3 -6 3 Catlisis cida y catlisis bsica. (A) El inicio de la reaccin no


catalizada que se p resenta en la Figura 3-62A se h a dibujado aqu, utilizando el som bread o en azul com o un indicador esqu em tico de la distribucin electr n ica del agua y de los en laces carb onilo . (B) U n cido tiende a dar un p rotn (H+ ) a otros tom os. En co m b in aci n co n el oxgeno del carbonilo, un cido hace que los electrones tiendan a separarse del carb o n o carbonilo, h acien d o que este tom o atraiga m u ch o m s fu ertem ente el oxgeno electronegativo de la m olcu la de agua que ataca el en lace. (C) U na b ase tien d e a cap tar H +; en co m b in aci n co n un hidrgeno de la m olcu la de agua atacante, una base h a ce que los electron es se d esplacen h acia el oxgeno de la m olcu la de agua, h acien d o que constituya un grupo m s reactivo del carbo n o carbonilo. (D) Al p resentar una d isposicin ad ecu ada de tom os en su superficie, un a enzim a puede realizar una catlisis cida y bpsica sim u ltneam ente.

\ \
//

c H H
O

//

(A) no catlisis

(B) catlisis cida

(C)

catlisis bsica

(D)

catlisis cida y bsica

Adems, las enzimas pueden incrementar las velocidades de reaccin formando enlaces covalentes intermedios con sus substratos3 8
Adems de los mecanismos comentados antes, muchas enzimas aceleran la veloci dad de la reaccin que catalizan interactuando de manera covalente con uno de sus substratos, de modo que el substrato queda unido a un residuo de aminocido o a una molcula de coenzima. Generalmente cuando un substrato entra en el lugar de unin de la enzima, se une covalentemente a ella y entonces reacciona con un se gundo substrato sobre la superficie de la enzima que rompe el enlace covalente que se acaba de formar. Al final de cada ciclo de reacciones se regenera la enzima libre. Consideremos, por ejemplo, el mecanismo de accin de las serina proteasas. La reaccin que catalizan, la hidrlisis de un enlace peptdico, est enormemente acelerada debido a la afinidad de la enzima por el compusto intermediario tetradrico de la reaccin. Pero una serina proteasa hace mucho ms que lo que hace un tpico anticuerpo cataltico: en lugar de esperar a que una molcula de oxgeno del agua ataque el carbono carbonilo, hace que la reaccin transcurra mucho ms r pidamente utilizando en primer lugar para este fin una cadena lateral de un amino cido situada en el lugar adecuado (la serina activada de la Figura 3-57). Este paso rompe el enlace peptdico pero libera la enzima unida covalentemente al grupo carboxilo. Entonces, en un segundo paso muy rpido, este compuesto intermedio covalente se destruye por la adicin catalizada enzimticamente de una molcula de agua, lo cual completa la reaccin y regenera la enzima libre (Figura 3-64), A pe sar de que esta reaccin en dos etapas es menos directa que la reaccin en una eta pa (en la que el agua se aade directamente al enlace peptdico), es mucho ms r pida debido a que cada etapa tiene una energa de activacin relativamente baja.

Las enzimas aceleran las reacciones qumicas pero no pueden hacerlas energticamente ms favorables
Por muy sofisticada que sea una enzima, no puede hacer que la reaccin qumica que cataliza resulte ms o menos favorable desde el punto de vista energtico. La enzima no puede alterar la diferencia de energa libre que existe entre los subs tratos iniciales y los productos finales de la reaccin. Como ocurre en las simples interacciones de enlace antes mencionadas, cualquier reaccin qumica tiene un punto de equilibrio en el que los flujos de la reaccin en ambas direcciones son iguales; por consiguiente, en este punto ya no se produce ningn cambio neto de concentracin (vase Figura 3-9). Si una enzima acelera la velocidad de la reac cin en un sentido A + B - AB en un factor de 10, tambin debe acelerar en un factor de 10Bla velocidad de la reaccin contraria AB A + B. El cociente entre las velocidades de una y otra reacciones depende nicamente de las concentracio nes de A, de B y de AB. El punto de equilibrio es siempre exactamente el mismo, independientemente de si la reaccin est catalizada por una enzima o no.

140

Captulo 3 : Macromolculas: estructura, forma e informacin

Ser

CH2

O \/ /\ \ / /

Ser
NH,

interm ediario tetradrico


NH,

Ser
CH^

o- c
NH

H N. His

substrato polipeptdico
3

\ x\ V X C o c
HNH

NH

c -o o h

COOH

His

O COOH

prim er pptido liberado

(A)

(B)

(C)

Ser

\ \ / d > H Oc y \l/

Ser --------- C H ,

interm ediario tetradrico

Ser
NH,

o c /

\\ x C
'H

CH,
O O

/ N. His

H agua His

H N+

C D
C

NH,

His

/ OH

segundo pptido liberado

(D)

(E)

(F)
Figura 3-64 Algunas enzimas forman enlaces covalentes con sus substratos. En el ejemplo mostrado aqu, un grupo carbonilo de una cadena polipeptdica (en verde) forma un enlace covalente con un residuo de serina activado especficam ente (vase Figura 3-57) de una serina proteasa (en gris), el cual rompe la cadena polipeptdica. Cuando la porcin no unida de la cadena polipeptdica se ha alejado por difusin, se produce un segundo paso en el cual una molcula de agua hidroliza el nuevo enlace covalente formado, separando as la porcin de la cadena polipeptdica de la superficie de la enzima y liberando la serina para otro ciclo de reaccin. Ntese que en esta reaccin los intermediarios tetradricos inestables (en a m arillo) son los estados de transicin, y que ambos son estabilizados por la enzima.

Las enzimas pueden determ inar el sentido de una va acoplando determinadas reacciones a la hidrlisis del ATP39
La clula viva es un sistema qumico que se halla lejos del equilibrio. El producto de cada enzima suele actuar com o substrato de otra enzima de la va metabolica y es consumido rpidamente. Lo que es ms importante, por medio de las vas catalizadas enzim ticam ente descritas en el Captulo 2 , muchas reacciones son impulsadas en una direccin gracias a su acoplamiento a la hidrlisis energtica mente favorable del ATP a ADP y fosfato inorgnico. Para que esta estrategia sea efectiva, los niveles de ATP se m antienen en unos valores nada cercanos a los de equilibrio, con un cociente elevado entre ATP y sus productos de hidrlisis (va se Captulo 14). Por consiguiente, este acervo de ATP acta como una batera de reserva manteniendo un flujo continuo de tomos y de energa a travs de la clula a travs de vas determinadas por las enzimas presentes. Para un sistema vivo, la proximidad al equilibrio qumico significa degeneracin y muerte.

Los com plejos multienzimticos ayudan a increm entar la velocidad del m etabolism o celular 4 0
La eficiencia de las enzimas respecto a su funcin aceleradora de las reacciones qumicas es crucial para el m antenimiento de la vida. En efecto, las clulas han de luchar contra procesos inevitables de degeneracin que avanzan inexorable mente hacia el equilibrio qumico. Si las velocidades de las reacciones deseables no fueran superiores a las de las recciones opuestas, la clula pronto morira. Midiendo la velocidad de utilizacin del ATP podemos tener una idea aproxima da de la velocidad a la que se procude el metabolismo celular. Una clula tpica de mamfero recam bia (es decir, degrada por completo y substituye) todo su acervo de ATP, cada 1 o 2 minutos. Para cada clula esta renovacin representa la utilizacin de una 107 molculas de ATP por segundo (y para el cuerpo hum a no, aproximadamente un gramo de ATP cada minuto).

Las protenas como catalizadores

141

La velocidad de las reacciones celulares es elevada gracias a la eficiencia de los catalizadores enzimticos. De hecho, muchas enzimas importantes trabajan de una forma tan eficiente que es imposible mejorarla: en estos casos el factor li mitante de la velocidad de la reaccin no es la velocidad intrnseca de la accin enzimtica sino la frecuencia a la que la enzima interaciona con su substrato. De una reaccin como sta se dice que est limitada por la difusin. Si una reaccin est limitada por la difusin, su velocidad depende de las concentraciones de la enzima y del substrato. As, para que una secuencia de re acciones se produzca con gran rapidez ha de existir una elevada concentracin de cada uno de los intermediarios metablicos y de cada una de las enzimas que intervienen en ella. Dado el enorme nmero de reacciones diferentes que se de sarrollan en una clula, existen lmites a las concentraciones que se pueden al canzar de los substratos. De hecho, la mayora de metabolitos se hallan a con centraciones micromolares (IO-6 M) y las enzimas a concentraciones mucho menores. Cmo es posible m antener velocidades metablicas muy elevadas? La respuesta reside en la organizacin espacial de los componentes celulares. Las velocidades de reaccin pueden ser incrementadas sin aumentar la concentra cin de los substratos, reuniendo las diversas enzimas implicadas en una secuencia de reacciones y formando un gran complejo proteico denominado complejo multienzimtico. De esta manera, el producto de la enzima A es transferido directa mente a la enzima B, y as sucesivamente hasta el producto final, con lo que las ve locidades de difusin no limitan la velocidad de reaccin ni siquiera cuando la concentracin de substrato en toda la clula es muy baja. Estos complejos multienzimticos son muy frecuentes (en la Figura 2-41 se mostraba la estructura de uno de ellos, la piruvato deshidrogenasa) e intervienen en casi todos los aspectos del metabolismo, incluyendo los procesos genticos centrales del DNA y del RNA, y en la sntesis de protenas. De hecho es posible que muy pocas enzimas de las clulas eucariotas difundan libremente en solucin. Por el contrario, la mayora de las en zimas pueden haber desarrollado zonas de unin que les permitan concentrarse con otras protenas de funcin relacionada en determinadas regiones de la clula, incrementndose as la velocidad y la eficiencia de las reacciones que catalizan. Las clulas disponen adems de otro sistema de incrementar la velocidad de las reacciones metablicas. ste depende del enorme sistema de membranas intracelulares de las clulas eucariotas. Estas membranas pueden segregar ciertas substancias y las enzimas que actan sobre ellas, dentro del mismo com parti miento rodeado de membrana, com o el retculo endoplasmtico o el ncleo ce lular. Si, por ejemplo, el compartimiento ocupa un total de un 10% del volumen celular, la concentracin de los reactantes dentro del compartimiento sera 10 veces mayor que en una clula similar no compartimentada (Figura 3-65). Las reacciones que podran estar limitadas por la velocidad de difusin, pueden de esta manera increm entar su velocidad en este mismo factor. En el Captulo 5 se dan ms detalles de la estructura y funcin de las protenas. En l se discute de qu forma las clulas construyen diminutas mquinas proteicas.

Figura 3 -65 Com partim entacin. Se

puede conseguir un gran incremento en la concentracin de las molculas interactuantes al confinarlas en el mismo compartimiento rodeado de membrana, en una clula eucariota.

La Juncin biolgica de una protena depende de las propiedades qumicas detalla das de su superficie. Los lugares de unin para ligandos estn constituidos por cavi dades de la superficie en las cuales diversas cadenas laterales se localizan de una for ma precisa gracias al plegamiento de la protena. De esta forma, las cadenas laterales de aminocidos normalmente no reactivas puede hallarse activadas. Las enzimas aceleran enormemente las velocidades de las reacciones unindose a los estados de transicin de alta energa, de una form a especialmente intensa; tambin desarrollan catlisis deidas y bsicos simultneamente. A menudo, las velocidades de las reaccio nes enzimticas son tan rpidas que nicamente estn limitadas por la difusin; las velocidades pueden incrementarse an ms si las enzimas que actan deform a se cuencia! se halla unidas formando un mismo complejo multienzimdtico o si las enzi mas y sus substratos se hallan confinadas en el mismo compartimiento de la clula.
142 Captulo 3 : Macromolculas: estructura, forma e informacin

Resumen

Bibliografa General
Branden, C.; Tooze, J. Introduction to Protein Structure. New York: Garland, 1991. Gesteland, R.F.; Atkins, J.F., eds. The RNA World. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1993. Judson, H.F. The Eighth Day of Creation: Makers of the Re volution in Biology. New York: Simon & Schuster, 1979. Lehninger, A.L.; Nelson, D.L.; Cox, M.M. Principios de Bio qumica, 2.aed. Barcelona: Ediciones Omega, S.A., 1993. Mathews, C.K.; van Holde, K.E. Biochemistry. Menlo Park, CA: Benjamin/Cummings, 1990. Schulz, G.E.; Schirmer, R.H. Principles of Protein Structure. New York: Springer, 1979. Stryer, L. Biochemistry, 3rd ed. New York: W.H. Freeman, 1988. Voet, D.; Voet, J.G. Bioqumica. Barcelona: Ediciones Ome ga, S.A., 1992. Watson, J.D., et al. Molecular Biology of the Gene, 3rd ed. Menlo Park, CA: Benjamin-Cummings, 1987.

9.

10.

11.

Citas
1. Cantor, C.R.; Schimmel, P.R. Biophysical Chemistry, Part I and Part III. New York: W.H. Freeman, 1980. Eisenberg, D.; Crothers, D. Physical Chemistry with Ap plications to the Life Sciences. Menlo Park, CA: Ben jamin-Cummings, 1979. Pauling, L. The Nature of the Chemical Bond, 3rd ed. It haca, NY: Cornell University Press, 1960. Whitesides, G.M.; Mathias, J.P.; Seto, C.T. Molecular self-assembly and nanochemistry: a chemical strat egy for the synthesis of nanostructures. Science 254:1312-1319,1991. 2. Abeles, R.H., Frey, P.A.; Jencks, W.P. Biochemistry. Bos ton: Jones and Bartlett, 1992. Fersht, A.R. The hydrogen bond in molecular recogni tion. Trends Biochem. Sci. 12:301-304,1987. 3. Cohen, C.; Parry, D.A.D. a-helical coiled coils-a wide spread motif in proteins. Trends Biochem. Sci. 11:245-248,1986. Dickerson, R.E. The DNA helix and how it is read. Sci. Am. 249(6):94-lll, 1983. 4. Berg, H.C. Random Walks in Biology. Princeton, NJ: Princeton University Press, 1983. Einstein, A. Investigations on the Theory of Brownian Movement. New York: Dover, 1956. Lavenda, B.H. Brownian motion. Sci. Am. 252(2):70-85, 1985. 5. Lehninger, A.L. Bioenergetic: The Molecular Basis of Biological Energy Transformations, 2nd ed. Menlo Park, CA: Benjamin-Cummings, 1971. 6. Karplus, M.; McCammon, J.A. The dynamics of pro teins. Sci. Am. 254(4):42-51,1986. Karplus, M.; Petsko, G.A. Molecular dynamics simula tions in biology. Nature 347:631-639,1990. McCammon, J.A.; Harvey, S.C. Dynamics of Proteins and Nucleic Acids. Cambridge, UK: Cambridge Uni versity Press, 1987. 7. Kirkwood, T.B.; Rosenberger, R.F.; Galas, D.J.; eds. Accu racy in Molecular Processes: Its Control and Relevance to Living Systems. London: Chapman and Hall, 1986. 8. Berg, P.; Singer, M. Dealing with Genes. The Language of Heredity. Mill Valley, CA: University Science Books, 1992.

12.

13.

14.

15.

16.

17. 18.

19.

Rosenfield, I.; Ziff, E.; Van Loon, B. DNA for Beginners. London: Writers and Readers Publishing Cooperati ve. New York: Distribuido en EE UU por Norton, 1983. Saenger, W. Principles of Nucleic Acid Structure. Berlin: Springer, 1984. Moore, J. Heredity and Development, 2nd ed. New York: Oxford University Press, 1992. Olby, R. The Path to the Double Helix. Seattle: Univer sity of Washington Press, 1974. Stent, G.S.; Calendar, A.Z. Molecular Genetics: An Intro ductory Narrative, 2nd ed. San Francisco: W.H. Free man, 1978. Watson, J.D.; Crick, F.H.C. Molecular structure of nu cleic acids. A structure for deoxyribose nucleic acid. Nature 171:737-738, 1953. Felsenfeld, G. DNA. Sci. Am. 253(4):58-66, 1985. Meselson, M.; Stahl, F.W. The replication of DNA in E. coli. Proc. Natl. Acad. Sci. USA 44:671-682, 1958. Watson, J.D.; Crick, F.H.C. Genetic implications of the structure of deoxyribonucleic acid. Nature 171:964967, 1953. Drake, J.W. Spontaneous mutation. Annu. Rev. Genet. 25:125-1465,1991. Lindahl, T. Instability and decay of the primary structu re of DNA. Nature 362:709-715, 1993. Wilson, A.C. Molecular basis of evolution. Sci. Am. 253(4):164-173,1985. Sanger, F. Sequences, sequences, and sequences. Annu. Rev. Biochem. 57:1-28,1988. Thompson, E.O.P. The insulin molecule. Sci. Am. 192(5):36-41,1955. Yanofsky, C. Gene structure and protein structure. Sci. Am. 216(5):80-94,1967. Brenner, S.; Jacob, F.; Meselson, M. An unstable inter mediate carrying information from genes to riboso mes for protein synthesis. Nature 190:576-581,1961. Darnell, J.E., Jr. RNA. Sci. Am. 253(4):68-78, 1985. Chambon, P. Split genes. Sci. Am. 244(5):60-71,1981. Steitz, J.A. Snurps. Sci. Am. 258(6):58-63,1988. Witkowski, J.A. The discovery of split genes: a scienti fic revolution. Trends Biochem. Sci. 13:110-113, 1988. Crick, F.H.C. The genetic code: III. Sci. Am. 215(4):55-62, 1966. The Genetic Code. Cold Spring Harbor Symp. Quant. Biol. 31,1965. Rich, A.; Kim, S.H. The three-dimensional structure of transfer RNA. Sci. Am. 238(l):52-62,1978. Lake, J.A. The ribosome. Sci. Am. 245(2):84-97, 1981. Watson, J.D. Involvement of RNA in the synthesis of proteins. Science 140:17-26,1963. Zamecnik, P. The machinery of protein synthesis. Trends Biochem. Sci. 9:464-466,1984. Altman, S.; Baer, M.; Guerrier-Takada, C.; Viogue, A. Enzymatic cleavage of RNA by RNA. Trends Biochem. Sci. 11:515-518,1986. Cech, T. RNA as an enzyme. Sci. Am. 255(5):64-75, 1986. Cech, T. Fishing for fresh catalysts. Nature 365:204-205, 1993. Michel, F.; Westhof, E. Modelling of the three-dimensional architecture of group I catalytic introns based on comparative sequence analysis. /. Mol. Biol. 216:585-610,1990.

Bibliografa

143

20.

21.

22.

23. 24.

25.

26.

27.

Noller, H.F. Ribosomal RNA and translation. Anriu. Rev. Biochem. 60:191-227,1991. Noller, H.F.; Hoffarth, V.; Zimniak, L. Unusual resistan ce of peptidyl transferase to protein extraction proce dures. Science 256:1416-1419,1992. Branden, C.; Tooze, J. Introduction to Protein Structure. New York: Garland, 1991. Creighton, T.E. Proteins: Structure and Molecular Prop erties, 2nd ed. New York: W.H. Freeman, 1993. Dickerson, R.W.; Geis, I. The Structure and Action of Proteins. New York: Harper & Row, 1969. Schulz, G.E.; Schirmer, R.H. Principles of Protein Struc ture. New York: Springer, 1990. Anfinsen, C.B. Principles that govern the folding of pro tein chains. Science 181:223-230,1973. Baldwin, R.L. Seeding protein folding. Trends Biochem. Sci. 11:6-9, 1986. Creighton, T.E. Disulphide bonds and protein stability. Bioessays 8:57-63,1988. Richards, F.M. The protein folding problem. Sci. Amer. 264(l):54-63, 1991. Rupley, J.A.; Gratton, E.; Careri, G. Water and globular proteins. Trends Biochem Sci. 8:18-22,1983. Doolitde, R.F. Proteins. Sci. Am. 253(4):88-99,1985. Milner-White, E.J.; Proet, R. Loops, bulges, turns and hair pins in proteins. Trends Biochem Sci. 12:189-192,1987. Pauling, L.; Corey, R.B. Configurations of polypeptide chains with favored orientations around single bonds: two new pleated sheets. Proc. Natl. Acad. Sci. USA 37: 729-740, 1951. Pauling, L.; Corey, R.B.; Branson, H.R. The structure of proteins: two hydrogen-bonded helical configura tions of the polypeptide chain. Proc. Natl. Acad. Sci. USA 27:205-211,1951. Richardson, J.S. The anatomy and taxonomy of protein structure. Adv. Protein Chem. 34:167-339,1981. Scott, J.E. Molecules for strength and shape. Trends Bio chem. Sci. 12:318-321,1987. Branden, C.; Tooze, J. Introduction to Protein Structure. New York: Garland, 1991. Hardie, D.G.; Coggins, J.R. Multidomain Proteins-Structure and Evolution. Amsterdam: Elsevier, 1986. Doolitde, R.F. The genealogy of some recendy evolved ver tebrate proteins. Trends Biochem. Sci. 10:233-237,1985. Neurath, H. Evolution of proteolytic enzymes. Science 224:350-357, 1984. Blake, C. Exons and the evolution of proteins. Trends Biochem. Sci. 8:11-13,1983. Gilbert, W. Genes-in-pieces revisited. Science 228:823824, 1985. McCarthy, A.D.; Hardie, D.G. Fatty acid synthase: an example of protein evolution by gene fusion. Trends Biochem. Sci. 9:60-63,1984. Rossmann, M.G.; Argos, P. Protein folding. Annu. Rev. Biochem. 50:497-532,1981. Gehring, W.J. On the homeobox and its significance. Bioessays 5:3-4; 1986. Hanks, S.K.; Quinn, A.m.; Hunter, T. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241:42-52,1988. Shabb, J.B.; Corbin, J.D. Cyclic nucleotide-binding do mains in proteins having diverse function. J. Biol. Chem. 267:5723-5726,1992.

28.

29.

30. 31.

32.

33.

34.

35.

36.

37.

Thornton, J.M.; Gardner, S.P. Protein motifs and databa se searching. Trends Biochem. Sci. 14:300-304,1989. Bajaj, M.; Blundell, T. Evolution and the tertiary structure of proteins. Annu. Rev. Biophys. Bioeng. 13:453-492,1984. Klug, A. From macromolecules to biological assemblies. Biosci. Rep. 3:395-430,1983. Metzler, D.E. Bioqumica. Barcelona: Ediciones Omega, SA., 1981. (El Captulo 4 describe cmo las macromolculas se empaquetan formando grandes ensamblajes.) Caspar, D.L.D.; Klug, A. Physical principles in the con struction of regular viruses. Cold Spring Harbor Symp. Quant. Biol. 27:1-24,1962. Goodsell, D.S. Inside a living cell. Trends Biochem. Sci. 16:203-206, 1991. Cohen, C.; Parry, D.A.D. a-helical coiled coils-a wide spread motif in proteins. Trends Biochem. Sci. 11:245-248, 1986. Harrison, S.C. Multiple modes of subunit association in the structures of simple spherical viruses. Trends Bio chem. Sci. 9:345-351, 1984. Harrison, S.C. Viruses. Curr. Opin. Struc. Biol. 2:293299, 1992. Hogle, J.M.; Chow, M.; Filman, D.J. The structure of po lio virus. Sci. Am. 256(3) :42-49, 1987, Rossmann, M.G.; Johnson, J.E. Icosahedral RNA virus structure. Ann. Rev. Biochem. 58:533-573,1989. Fraenkel-Conrat, H.; Williams, R.C. Reconstitution of active tobacco mosaic virus from its inactive protein and nucleic acid components. Proc. Natl. Acad. Sci. USA 41:690-698,1955. Hendrix, R.W. Tail length determination in double stranded DNA bacteriophages. Curr. Top. Microbiol. Immunol. 136:21-29,1988. Namba, K.; Caspar, D.L.D.; Stubbs, GJ. Computer graphics representation of levels of organization in tobacco mo saic virus structure. Science 227:773-776,1985. Nomura, M. Assembly of bacterial ribosomes. Science 179:864-873, 1973. Trinick, J. Understanding the functions of titin and nebulin. FEBSLett. 307:44-48,1992. Mathews, C.K., Kutter, E.M.; Mosig, G.; Berget, P.B. Bacteriophage T4, Chaps. 1 and 4. Washington, DC: American Society of Microbiologists, 1983. Steiner, D.F.; Kemmler, W.; Tager, H.S.; Peterson, J.D. Proteolytic processinnn in the biosynthesis of insulin and other proteins. Fed. Proc. 33:2105-2115,1974. Dressier, D.; Potter, H. Discovering Enzymes. New York: Scientific American Library, 1991. Fersht, A. Enzyme Structure and Mechanism, 2nd ed. New York: W.H. Freeman, 1985. Fersht, A.R.; Leatherbarrow, R.J.; Wells, T.N.C. Binding energy and catalysis. Trends Biochem. Sci. 11:321325, 1986. Hansen, D.E.; Raines, R.T. Binding energy and enzyma tic catalysis./. Chem. Educ. 67:483-489, 1990. Lerner, R.A.; Benkovic, S.J.; Schultz, P.G. At te crossro ads of chemistry and immunology: catalytic antibo dies. Science 252:659-667,1991. Lerner, R.A.; Tramontano, A. Catalytic antibodies. Sci. Am. 258(3):58-70,1988. Wolfenden, R. Analog approaches to the structure of the transition state in enzyme reactions. Accounts Chem. Res. 5:10-18, 1972. Knowles, J.R. Tinkering with enzymes: what are we lear ning? Science 236:1252-1258, 1987.

\W

Capitulo 3 : Macromolculas: estructura, forma e informacin

Knowles, J.R. Enzyme catalysis; not different, just better. Nature 350:121-124,1991. 38. Stroud, R.M. A family of protein-cutting proteins. Sci. Am. 231(l):74-88,1974. 39. Wood, W.B.; Wilson, J.H.; Benbow, R.M.; Hood, L.E. Bio chemistry, a Problem Approach, 2nd ed. Menlo Park, CA: Benjamin-Cummings, 1981. (Captulos 9 y 15 y problemas anexos).

40. Barnes, S.J.; Weitzman, P.D.J. Organization of citric acid cycle enzymes into a multienzyme cluster. FEBS Lett, 201:267-270,1986. Berg, O.G.; von Hippel, P.H. Diffusion-controlled macromolecular interactions. Annu. Rev. Biophys. Biophys. Biochem. 14:131-160,1985. Reed, L.J.; Cox, D.J. Multienzyme complexes. In The Enzymes, 3rd ed. (P.D. Boyer, ed.), Vol. 1, pp. 213240. New York: Academic Press, 1970.

Bibliografa

145

Cmo se estudian las clulas

# h J H b
JU L

Observacin de la estructura de las clulas con el microscopio Aislamiento y crecimiento de clulas en cultivo Fraccionamiento de las clulas y anlisis de sus molculas Siguiendo el rastro y cuantificando las molculas

Las clulas son pequeas y complejas. Resulta difcil observar su estructura y descubrir su com posicin molecular, pero todava resulta ms difcil dilucidar cmo funcionan sus componentes. Lo que podemos aprender sobre las clulas depende de las herramientas que tengamos a nuestra disposicin; de hecho, los mayores avances de la ciencia son frecuentem ente fruto de la introduccin de nuevas tcnicas de estudio. Por consiguiente, para entender la biologa celular contem pornea es necesario conocer algo acerca de estos mtodos de estudio. En este captulo vamos a revisar brevemente algunos de los principales mto dos usados para estudiar las clulas. Empezaremos con las tcnicas utilizadas para examinar las clulas como un todo y despus continuaremos con las tcnicas utili zadas para analizar sus constituyentes macromoleculares. Nuestro punto de partida ser la microscopa; la biologa celular empez con la microscopa ptica, la cual to dava es una herramienta esencial, junto con los imaginativos inventos ms recien tes basados en haces de electrones y otras formas de radiacin. Desde la observa cin pasiva, nos desplazaremos hasta la intervencin activa: consideraremos cmo las clulas de diferentes tipos pueden ser separadas de los tejidos y crecer fuera del cuerpo, y cmo se pueden romper las clulas y aislar de forma pura sus orgnulos y constituyentes macromoleculares. Por ltimo, discutiremos cmo podemos detec tar, seguir y cuantificar los tipos individuales de molculas e iones en el interior de la clula. La tecnologa del DNA recombinante ha revolucionado nuestro conocimien to sobre la funcin celular, pero debido a que se trata de un apartado importante en s mismo y depende del conocimiento de los mecanismos genticos bsicos, este conjunto de poderosos mtodos se considera en detalle en el Captulo 7. A pesar de que los mtodos tienen una importancia bsica, lo que resulta real mente interesante es lo que nos permiten descubrir. Por lo tanto, proponemos que el presente captulo se utilice como referencia y se lea en conjuncin con los ltimos captulos del libro, ms que como una introduccin a ellos.

Observacin de la estructura de las clulas con el microscopio1


Una clula animal tpica mide entre 19 y 20 |xm de dimetro, es decir, unas cinco veces menos que la menor partcula visible a simple vista. Por ello, hasta que no se dispuso de buenos microscopios pticos, a principios del siglo xix, no se des cubri que todos los tejidos vegetales y animales son agregados de clulas. Este descubrimiento, propuesto por Schleiden y Schwann en 1838 como la teora ce lular, marca el nacimiento formal de la biologa celular.

147

Las clulas animales no slo son diminutas, sino que tambin son incoloras y traslcidas; por ello, el descubrimiento de las principales caractersticas inter nas de las clulas dependi del hallazgo, a finales del siglo xix, de diversos colo rantes que proporcionaron el contraste suficiente para hacerlas visibles. A prin cipios de los aos 1940 se desarroll el microscopio electrnico, mucho ms poderoso que el ptico. Sin embargo, antes de que su utilizacin permitiera el conocim iento detallado de las complejidades de la estructura interna de la clu la, se hizo necesario el desarrollo de nuevas tcnicas para la preservacin y colo racin de las clulas. Hasta ahora la microscopa depende tanto de las tcnicas para la preparacin del espcim en como del rendimiento del propio m icrosco pio. En las secciones que siguen, vamos a discutir tanto los instrumentos como la preparacin de las muestra, y empezaremos por el microscopio ptico. La Figura 4-1 muestra el grado de detalle que puede alcanzarse con la mi croscopa ptica moderna en comparacin con el de la microscopia electrnica. En la Tabla 4-1 se resumen algunos de los hitos histricos en el desarrollo de la microscopia ptica.

clula vegetal clula animal

bacteria

Tabla 4-1 Algunos descubrimientos en la historia de la microscopia ptica 1611 Kepler sugiri una manera de construir un microscopio compuesto. 1655 Hooke utiliz un microscopio compuesto para descubrir unas pequeas celdillas en cortes de corcho, a las que denomin clulas. 1674 Leeuwenhoek inform de su descubrimiento de los protozoos. Nueve aos ms tarde observ bacterias por primera vez. 1833 Brown public sus observaciones microscpicas de las orqudeas y describi claramente el ncleo celular. 1838 Schleiden y Schwann propusieron la teora celular, afirmando que la clula nucleada es la unidad estructural y funcional de las plantas y de los animales. 1857 Kolliker describi las mitocondrias de las clulas musculares. 1876 Abb analiz los efectos de la difraccin en la formacin de la imagen en el microscopio y mostr la manera de optimizar el diseo de los microscopios. 1879 Flemming describi con gran claridad el comportamiento de los cromosomas durante la mitosis de las clulas animales. 1881 Retzius describi muchos tejidos animales con una precisin que todava no ha sido superada por ningn especialista de microscopia ptica. En las dos dcadas siguientes, tanto l como Cajal y otros histlogos disearon mtodos de tincin y establecieron las bases de la anatoma microscpica. 1882 Koch utiliz colorantes de anilina para teir microorganismos e identific las bacterias que causan la tuberculosis y el clera. En las dos dcadas siguientes otros bacterilogos como KLebs y Pasteur identificaron los agentes causantes de otras muchas enfermedades, examinando al microscopio preparaciones teidas. 1886 Zeiss construy una serie de lentes, siguiendo las leyes de Abb, que permitieron a los especialistas en microscopia la resolucin de estructuras situadas en los lmites tericos de la resolucin de la luz visible. 1898 Golgi observ y descubri por primera vez el complejo de Golgi, impregnando las clulas con nitrato de plata. 1924 Lacassagne y colaboradores desarrollaron la primer tcnica autorradiogrfica para localizar el polonio radiactivo en muestras biolgicas, 1930 Lebedeff dise y construy el primer microscopio de contraste interferencial. En 1932 Zemicke invent el microscopio de contraste de fases. Estos adelantos permitieron observar por primera vez en detalle clulas vivas no teidas, 1941 Coons utiliz anticuerpos acoplados a colorantes fluorescentes para detectar antgenos celulares. 1952 Nomarski ide y patent el sistema de contraste interferencial para el microscopio ptico, que an lleva su nombre. 1981 Alien e Inou perfeccionaron la microscopia ptica de contraste vdeoamplificada. 1988 Se generaliza el uso de los microscopios de rastreo confocal.

virus ribosom a

protena globular m olcula pequea tom o


0 ,1

nm

(1 )

Figura 4 -1 Poder de resolucin. Tamaos de las clulas y de sus componentes, dibujados sobre una escala logartmica, indicando el intervalo de resolucin del ojo humano y de los microscopios ptico y electrnico. En microscopia se utilizan normalmente las siguientes unidades de longitud:
(im (micrmetro) = lO^m nm (nanmetro) = 10'M m (unidad Angstrom) = 10inm

148

Captulo 4 : Cmo se estudian las clulas

2 ONDAS EN FASE

< x x x x >
2 ONDAS DESFASADAS

Figura 4-2 Interferencia entre ondas luminosas. Cuando dos ondas de luz se combinan en fase, la amplitud de la onda resultante es mayor y la luminosidad queda incrementada. Dos ondas de luz desfasadas se anulan parcialmente una a otra, produciendo una onda de menor amplitud, y por consiguiente, de menor intensidad luminosa.

oscuridad

El microscopio ptico puede resolver detalles situados a 0,2 jxm de distancia 2


En general, un haz de una radiacin de una longitud de onda determinada no puede utilizarse para examinar detalles estructurales mucho ms pequeos que su propia longitud de onda: esto supone una limitacin fundamental de los m i croscopios. As pues, el lmite de resolucin de un microscopio ptico est de terminado por la longitud de onda de la luz visible, que abarca desde 0,4 p.m (para el violeta) hasta 0,7 Jim (para el rojo lejano). En la prctica, las bacterias y las mitocondrias, que tienen aproximadamente 500 nm (0,5 |a.m ) de dimetro, son las estructuras ms pequeas que se pueden observar ntidamente al m i croscopio ptico; los detalles ms pequeos que estas dimensiones quedan os curecidos por los efectos de la naturaleza ondulatoria de la luz. Para com pren der el porqu de este efecto, hemos de estudiar lo que le sucede a un haz de ondas luminosas cuando atraviesa las lentes de un microscopio. Dada su naturaleza ondulatoria, la luz no sigue exactamente la lnea recta idealizada de sus rayos predicha por la ptica geomtrica. Por el contrario, cuan do las ondas luminosas viajan a travs de un sistema ptico lo hacen por una di versidad de rutas ligeramente diferentes, de manera que se interfieren entre ellas generando efectos pticos de difraccin. Si dos trenes de ondas que alcan zan el mismo punto por diferentes caminos estn exactamente en fase, con coincidencia de las crestas y de los senos, se refuerzan el uno al otro aumentan do la luminosidad. Por el contrario, si los trenes de ondas estn desfasados, in terfieren uno con otro y se anulan total o parcialmente (Figura 4-2). La inciden cia de la luz sobre un objeto altera las relaciones de fase de las ondas luminosas, produciendo complejos efectos de interferencia. A gran aumento la sombra de un borde recto, por ejemplo, iluminado con una luz de longitud de onda unifor me, aparece como un conjunto de lneas paralelas, mientras que la de una m an cha circular aparece como un conjunto de anillos concntricos (Figura 4-3). Por la misma razn, observado a travs del microscopio un punto aparece como un disco borroso, mientras que dos objetos puntuales prximos entre s ofrecen imgenes superpuestas y pueden llegar a confundirse en una sola imagen. La perfeccin de las lentes, por alta que sea, no puede superar esta limitacin im puesta por la naturaleza ondulatoria de la luz. La separacin lmite a la que dos objetos pueden verse separados -conocida como lm ite de resolucin- depende tanto de la longitud de onda de la luz como de la apertura numrica de las lentes del sistema utilizado (Figura 4-4). En las m e jores condiciones posibles: con luz violeta (longitud de onda, X = 0,4 p.m) y una apertura numrica de 1,4, el lmite de resolucin terico que se puede obtener con el microscopio ptico es tan slo de 0,2 jxm. Esta resolucin ya fue alcanzada por los fabricantes de microscopios a finales del siglo xix y con los microscopios con temporneos producidos en serie, muy raramente se alcanza. Aunque es posible

Figura 4-3 Efectos de borde. Efectos de interferencia observados a gran aumento cuando la luz pasa por el borde de un objeto slido colocado entre la fuente de luz y el observador.

Observacin de la estructura de las clulas con el microscopio

149

LENTES IMAGEN

RESOLUCIN: el poder de resolucin de un m icroscopio depende de la am plitud del cono de ilum inacin y, por lo tanto, de las lentes objetivo y condensador. Se calcula con la frm ula la lente objetivo colecta un cono de luz generando una imagen la lente condensador enfoca un cono de rayos lum inosos en cada uno de los puntos de la m uestra resolucin en donde: 9= m itad de la anchura angular del cono de rayos colectados por la lente objetivo desde un punto tpico de la muestra (como la m axma anchura es de 180, el valor de seno 0 tiene un valor m xim o de 1 ) n = ndice de refraccin del m edio (norm alm ente aire o aceite) que separa la muestra de las lentes objetivo y condensador X = longitud de onda de la luz utilizada (para (uz blanca se utiliza norm alm ente el valor de 0,53 |im ) m ayor es la resolucin y la brillantez de la imagen (la brillantez es im portante en m icroscopa de fluorescencia). Sin em bargo, esta ventaja se obtiene a expensas de distancias de trabajo m uy cortas y de profundidades de cam po m uy pequeas. 0,61
X

Figura 4 -4 Apertura num rica. Paso de los rayos luminosos cuando atraviesan una muestra transparente en un microscopio, ilustrando el concepto de apertura numrica y su relacin con el lmite de resolucin.

muestra

V iW l
)
LUZ |

APERTURA NUMRICA: en la ecuacin anterior, el valor n sen B se denom ina apertura numrica de las lentes (AN) y es una funcin de su capacidad de colectar la luz. Para lentes secas este valor no puede ser m ayor de 1 pero para lentes sum ergidas en aceite puede llegar a ser de 1,4. Cuanto m ayor sea la apertura numrica

m ovim iento del brazo del m icrtom o m uestra incluida en cera o en resina cuchilla de acero

agrandar una imagen tanto como se desee -p . ej., proyectndola sobre una pan
talla- nunca resulta posible resolver al microscopio ptico dos objetos que estn separados menos de 0,2 jim : dichos objetos aparecern como uno solo. Ms adelante podremos ver cmo la interferencia y la difraccin pueden ser utilizadas para estudiar clulas vivas sin teir. En primer lugar vamos a estudiar cmo se pueden hacer preparaciones permanentes de clulas para su observa cin al microscopio y cm o se utilizan los colorantes qumicos en estas prepara ciones para increm entar la visibilidad de las estructuras celulares.

cinta de cortes finos cinta de cortes sobre el portaobjetos, teidos y m ontados con un cubreobjetos

Para la observacin microscpica, norm alm ente los tejidos son fijados y seccionados
Para hacer preparaciones perm anentes que despus puedan ser teidas y visua lizadas al m icroscopio, en primer lugar las clulas se han de tratar con un fijador que las inmovilice, las mate y las preserve. En trminos qumicos, la fijacin hace a las clulas permeables a los colorantes y establece puentes cruzados en tre sus molculas, de modo que stas queden estabilizadas y bloqueadas en su posicin original. Algunos de los primeros procedimientos de fijacin consistan en una breve inmersin en cidos o en disolventes orgnicos tales com o el alco hol. Los procedimientos actuales suelen comprender aldehidos activos, particu larmente el formaldehdo y el glutaraldehdo, que forman enlaces covalentes con los grupos amino libres de las protenas y por lo tanto forman puentes cru zados entre protenas adyacentes. La mayora de las muestras de tejidos son demasiado gruesas para que sus clulas sean examinadas directamente a alta resolucin. Por consiguiente, des pus de la fijacin, los tejidos suelen ser cortados en finas rebanadas (seccio nes), con un micrtomo, una mquina dotada de una cuchilla de metal muy afi lada que funciona de manera parecida a un cortafiambres (Figura 4-5). Las secciones que se utilizan para ser observadas al microscopio ptico, normal mente tienen entre 1 y 10 |j.m de grosor y son extendidas en la superficie de un portaobjetos. Por lo general los tejidos son muy blandos y frgiles, incluso despus de la fijacin, de forma que antes de la obtencin de los cortes, es necesario incluirlos

Figura 4 -5 Obtencin de secciones de un tejido. Un tejido incluido se corta con un micrtomo, como paso previo para su observacin al microscopio ptico.

150

Captulo 4 : Cmo se estudian las clulas

en un medio de soporte. Los medios ms utilizados son ceras o resinas. En esta do lquido, estos medios penetran y rodean todo el tejido; entonces, pueden ser endurecidos (por enfriamiento o por polimerizacin) para formar un bloque s lido que pueda ser cortado fcilmente con el m icrtomo. Existe el grave peligro de que cualquier tratamiento utilizado para la fijacin pueda alterar de manera no deseada la estructura de la clula o sus constituyen tes moleculares. La congelacin rpida proporciona un mtodo alternativo que, de alguna manera, evita este peligro eliminando la necesidad de fijacin y de in clusin. El tejido congelado puede ser cortado directamente con un criostato -u n m icrtomo especial que se mantiene en una cmara fra. Aunque, las sec ciones por congelacin conseguidas de esta manera tienen la ventaja de evitar algunos artefactos, pueden presentar otro tipo de complicaciones: la estructura nativa de algunas molculas com o las protenas est bien conservada pero nor malmente la estructura de las clulas se rompe por los cristales de hielo. Habitualmente, el paso siguiente al de obtencin de las secciones (por cual quier mtodo) es su tincin.

Los diferentes com ponentes de la clula pueden ser teidos selectivamente 3


El contenido de la mayora de las clulas (de las que el agua representa un 70% de su peso) no presenta demasiados elementos que impidan el paso de los rayos de luz. Por ello, casi todas las clulas en su estado natural, aunque estn fijadas y seccionadas, son casi invisibles al microscopio ptico convencional. Una m ane ra de hacerlas visibles es teirlas con colorantes orgnicos selectivos. A principios del siglo xix la demanda de colorantes para teir los productos de la industria textil condujo a un perodo frtil para la qumica orgnica. Se ob serv que algunos de los colorantes tean los tejidos biolgicos y que sorpren dentemente, a menudo m ostraban una preferencia por determinados com po nentes de la clula -e l ncleo o las membranas, por ejem plo- haciendo visibles estas estructuras internas. En la actualidad disponemos de una rica variedad de colorantes orgnicos, con nombres tan pintorescos como verde de malaquita, negro Sudn o azul de Coomassie, cada uno de los cuales presenta una afinidad especfica por ciertos com ponentes celulares. El colorante hematoxilina, por ejemplo, tiene afinidad por las molculas con carga negativa, y por ello revela la distribucin del DNA, del RNA y de las protenas cidas de la clula (Figura 4-6). No obstante, desconocem os la base qumica de la especificidad de muchos colo rantes.
Figura 4-6 Una seccin de tejido teida. Seccin de piel humana,

teida con una combinacin de colorantes, hematoxilina y eosina, que se utilizan habitualmente en histologa.

Observacin de la estructura de las clulas con el microscopio

151

FUENTE DE LUZ

3 segundo filtro de corte elim ina las seales de fluorescencia no deseadas y deja pasar la fluorescencia verde de em isin, de 520 a 560 nm espejo de ranuras ordenadas: refleja la luz de longitud de onda m enor de 510 nm pero transm ite la luz de longitud de onda superior a 510 nm
2

Figura 4-7 Sistema ptico de un moderno microscopio de fluorescencia. El juego de filtros consta de dos filtros de corte (1 y 3) y de un espejo dicroico (de ranuras ordenadas) (2). En este ejemplo se muestra un juego de filtros adecuado para la deteccin de la fluorescencia de la fluorescena. En este tipo de microscopios es especialmente importante que la lente objetivo tenga una elevada apertura numrica, ya que para una amplificacin dada la brillantez de la imagen fluorescente es proporcional a la cuarta potencia de la apertura numrica (vase tambin Figura 4-4).

1 prim er filtro de corte nicamente deja pasar la luz azul de una longitud de onda entre 450 y 490 nm

lente objetivo objecto

La relativa falta de especificidad de estos colorantes a nivel molecular ha esti mulado el diseo de procedimientos de tincin ms racionales y selectivos y ha permitido en particular el desarrollo de mtodos que revelan protenas especficas y otras macromolculas celulares. Existe, sin embargo, el problema de conseguir una sensibilidad adecuada para estos propsitos. Como una clula cualquiera pre senta pocas copias de cada una de la mayora de las macromolculas, a menudo una o dos molculas de colorante unidas a cada macromolcula resultan invisi bles. Una posibilidad de resolver este problema consiste en incrementar el nme ro de molculas de colorante asociadas a cada macromolcula individual. As, al gunas enzimas pueden ser localizadas en las clulas mediante su actividad cataltica: cuando son expuestas a un substrato molecular apropiado, cada mol cula de enzima genera muchas molculas visibles de producto, las cuales pueden ser localizadas. Un mtodo alternativo al problema de la sensibilidad consiste en la utilizacin de compuestos fluorescentes, como explicamos a continuacin.

fluorescena (verde)

Mediante la m icroscopa de fluorescencia se pueden localizar molculas en las clulas de form a especfica 4
Las molculas fluorescentes absorben la luz de una determinada longitud de onda y emiten luz de otra longitud de onda ms larga. Si un componente de este tipo es iluminado a su longitud de onda absorbente y visualizado a travs de un filtro que slo permita pasar la luz de longitud de onda igual a la de la luz emitida, el componente aparece brillante sobre un fondo oscuro. La intensidad y el color de la luz es una propiedad caracterstica de la molcula fluorescente utilizada. Los colorantes fluorescentes utilizados para la tincin celular son detecta dos con la ayuda del m icroscopio de fluorescencia. Este microscopio es similar al m icroscopio convencional, a excepcin de que la luz incidente, procedente de una potente fuente, atraviesa dos series de filtros -u n o para interceptar la luz antes de que llegue a la muestra y otro para filtrar la luz obtenida a partir de la muestra. El primer filtro se selecciona de manera que slo permita el paso de las longitudes de onda que excitan a un determinado colorante fluorescente, m ien tras que el segundo filtro bloquea esta luz y permite el paso de las longitudes de onda emitidas cuando el colorante emite fluorescencia (Figura 4-7). La microscopa de fluorescencia se utiliza habitualmente para detectar es pecficamente protenas u otras molculas en clulas y tejidos. Una tcnica muy

tetram etilrodam ina (roja)


Figura 4-8 Colorantes fluorescentes. Estructura de la fluorescena y de la tetrametilrodamina, dos colorantes utilizados habitualmente en microscopa de fluorescencia. La fluorescena emite luz amarillo-verdosa cuando se activa con luz de una longitud de onda adecuada, mientras que la rodamina emite luz roja. Las zonas de las molculas que se sealan en naran ja indican la posicin de un grupo qumicamente reactivo; normalmente, en esta posicin se forma un enlace covalente entre el colorante y una protena (u otra molcula). Diferentes versiones comerciales de estos colorantes con diferentes tipos de grupos reactivos permite utilizarlos como diana de grupos -SH o de grupos -NH 2 de protenas.

152

Captulo 4 : Cmo se estudian las clulas

t u b u lin a

aditila

DNA

50 (iin

utilizada y potente consiste en acoplar covalentemente un colorante fluorescen te a molculas de un anticuerpo, el cual se puede utilizar entonces como un re activo muy especfico y verstil que se une selectivamente a las macromolculas que reconoce en las clulas o en la matriz extracelular. Con esta finalidad, fre cuentem ente se utilizan dos colorantes fluorescentes: la fluorescena, que cuan do es excitada por luz azul emite una fluorescencia amarillo-verdosa intensa, y la rodamina, que cuando es excitada con una luz verde-amarilla emite una fluo rescencia de color rojo intenso (Figura 4-8). Acoplando una molcula a la fluores cena y otra a la rodamina, en la misma clula puede determinarse la distribu cin de dos molculas diferentes; ambas molculas son detectadas separadamente en el microscopio cambiando las dos series de filtros, uno especfico para cada colorante. Como se muestra en la Figura 4-9, de la misma forma se pueden utili zar tres colorantes fluorescentes para distinguir tres tipos de molculas en la misma clula. Actualmente se han desarrollado importantes mtodos, que explicaremos posteriormente, que capacitan a la microscopia de fluorescencia para seguir cambios en la concentracin y en la localizacin de molculas especficas en el interior de la clula viva (vase pg. 195).

Figura 4-9 M icroscopia de fluorescencia. Micrografas de una zona de la superficie de un embrin temprano de D rosophila, en el que se han marcado los microtbulos con un anticuerpo acoplado a fluorescena {p an el d e la izq u ierd a ) y los filamentos de actina con un anticuerpo acoplado a rodamina (p a n e l central). Adems, los cromosom as se han marcado con un tercer colorante que nicam ente emite fluorescencia cuando se une a DNA (p a n e l d e la d er ec h a ). En este estadio, todos los ncleos del embrin com parten un mismo citoplasma, y estn en el estadio de m etafase de la mitosis. Las tres micrografas fueron tomadas en la mism a regin de un embrin fijado, utilizando tres juegos de filtros diferentes en el microscopio de fluorescencia (vase tam bin Figura 4-7). (Por cortesa de Tim Karr.)

Las clulas vivas se pueden observar con nitidez en un microscopio de contraste de fases o de contraste de fases interferencial 2,5
La posibilidad de que algunos componentes de la clula puedan perderse o dis torsionase durante la preparacin de las muestras no ha dejado de preocupar a los especialistas en microscopia. La nica solucin a este problema es examinar

(A)

luz incidente

(B)

luz incidente

ondas en fase

ondas desfasadas

clula sin teir

Figura 4 -1 0 Dos sistem as para increm en tar el contraste en el m icroscopio ptico. En (A), las zonas teidas de la clula reducen la amplitud de las ondas luminosas de una longitud de onda determinada que pasan a travs de ellas. De esta forma se obtiene una imagen en color de la clula, visible mediante la observacin habitual. En (B), la luz que pasa a travs de la clula viva, no teida, no sufre ningn cambio importante de amplitud y, por consiguiente, muchos de sus detalles no se pueden observar directamente, aunque se amplifique enorm em ente la imagen; sin embargo, se producen cambios de fa s e en las ondas luminosas cuando stas pasan travs de la clula, y estas alteraciones pueden hacerse visibles aprovechando efectos de interferencia utilizando un microscopio de contraste de fases o de contraste de fases interferencial.

Observacin de la estructura de las clulas con el microscopio

153

50

|Jm

las clulas mientras an estn vivas, sin ningn tipo de fijacin ni de congelacin. Para este propsito son tiles microscopios con sistemas pticos especiales. Cuando la luz pasa a travs de una clula viva, la fase de la onda luminosa vara en relacin al ndice de refraccin de la clula: la luz que pasa a travs de una zona relativamente gruesa o densa de la clula, como por ejemplo el ncleo, se retrasa y su fase queda desplazada de forma correspondiente respecto a la de la luz que ha pasado a travs de una regin adyacente de citoplasma, ms fina. El m icroscopio de contraste de fases y el m icroscopio de contraste de fases interferencial aprovechan los efectos de interferencia que se producen cuando se com binan estos dos grupos de ondas, creando de esta forma una imagen de la estructura celular (Figura 4-10). Ambos tipos de microscopios pticos se utilizan habitualm ente para visualizar clulas vivas. Una manera ms sencilla de observar algunas de las caractersticas de una clula no teida consiste en utilizar luz dispersada por sus diversos com ponen tes. En el m icroscopio de cam po oscuro, los rayos luminosos del sistema de ilu minacin son dirigidos desde la parte lateral, por lo que slo penetra en las len tes del microscopio la luz dispersada. Por consiguiente, la clula aparece como un objeto iluminado sobre un fondo negro. La Figura 4-11 muestra imgenes de una misma clula obtenidas mediante cuatro tipos diferentes de microscopios pticos. Una de las grandes ventajas del microscopio de contraste de fases, del m i croscopio de contraste de fases interferencial y del microscopio de campo oscu ro estriba en que los tres permiten observar las clulas en accin y estudiar los movimientos implicados en procesos como la mitosis o la migracin celular. Puesto que muchos movimientos son demasiado lentos para ser observados a tiempo real, norm alm ente resulta til hacer pelculas o vdeos por el sistema de aceleracin de movimiento (microcinematografa ). En estos casos, se toman fo tografas sucesivas, separadas por breves perodos de tiempo, de modo que cuando la pelcula o el video registrados se proyectan a la velocidad normal los acontecim ientos aparecen muy acelerados.

Figura 4-11 Cuatro tipos de microscopio ptico. (A) Imagen de un fibroblasto en cultivo obtenida mediante la transmisin directa de luz a travs de la clula, tcnica conocida como m icroscop a d e ca m p o claro. Las otras imgenes fueron obtenidas utilizando las tcnicas descritas en el texto: (B) microscopa de contraste de fases; (C) microscopa de contraste de fases interferencial de Nomarski; y (D) microscopa de campo oscuro. Con los microscopios ms modernos se pueden obtener los cuatro tipos de imgenes, simplemente cambiando algunos de los sistemas pticos.

Mediante tcnicas electrnicas las imgenes pueden ser amplificadas y analizadas 6


Recientemente, los sistem as electrnicos de im genes y la tecnologa asociada de procesam iento de im genes han tenido un impacto importante en la mi croscopa ptica. No slo han permitido superar ciertas limitaciones prcticas de los microscopios (debidas a limitaciones en el sistema ptico), sino que tam bin han superado dos limitaciones fundamentales del ojo humano: el ojo no

154

Captulo 4 : Cmo se estudian las clulas

puede ver luz extremadamente dbil y no puede percibir pequeas diferencias en intensidad de luz sobre un fondo brillante. El primero de estos problemas puede solucionarse adaptando a un microscopio una cmara de vdeo altam en te sensible a la luz (del tipo de las que se utilizan para vigilancia nocturna). Con ello es posible observar clulas durante largos perodos de tiempo y con muy baja intensidad de luz, evitando de esta manera los efectos dainos de la luz in tensa (y caliente) prolongada. Estos sistemas de intensificacin de imgenes son especialmente importantes para visualizar molculas fluorescentes en las clu las vivas. Dado que las imgenes producidas por las cmaras de vdeo son de tipo electrnico, pueden ser digitalizadas, introducidas en un ordenador y procesa das de varios modos para extraer informacin latente en estas imgenes. Este procesamiento de la imagen hace posible la compensacin de los fallos pticos de los microscopios, pudiendo alcanzar el lmite terico de resolucin del m i croscopio ptico. Por otra parte, utilizando sistemas de vdeo acoplados a proce sadores de imgenes puede increm entarse el contraste, superndose las limita ciones del ojo en la deteccin de pequeas diferencias. A pesar de que este procesamiento tam bin increm enta los efectos aleatorios de las irregularidades del sistema ptico, este ruido puede eliminarse electrnicam ente restando una imagen de un rea en blanco del campo de observacin. De esta manera, pequeos objetos transparentes que antes eran imposibles de distinguir del fon do, pueden ser visibles. El alto contraste alcanzable en la microscopia de interferencia asistida por ordenador hace posible la visualizacin de pequeos objetos tales como microtbulos (Figura 4-12), los cuales tienen un dimetro de 0,025 |im, menor de una dcima parte de la longitud de onda de la luz. Los microtbulos individuales tam bin pueden ser vistos en un microscopio de fluorescencia si previamente han sido marcados con fluorescencia (vase Figura 4-62). En ambos casos, sin embargo, los inevitables efectos de difraccin dan una imagen altamente borrosa, de forma que estos microtbulos aparecen con un dimetro de al menos 0,2 Jim, lo cual hace imposible distinguir un microtbulo sencillo de un haz de varios microtbulos.

S pm Figura 4-12 Ampliando los lmites de deteccin. Imgenes al microscopio electrnico de microtbulos no teidos, visualizados por microscopia de contraste de fases interferencial seguida de un procesamiento electrnico de imgenes. (A) Imagen original no procesada. (B) Resultado final del proceso electrnico que incrementa marcadamente el contraste y reduce el ruido. A pesar de que los microtbulos nicamente tienen 0,025 nm de dimetro, aparecen como unos filamentos ms gruesos debido a efectos de difraccin. (Por cortesa de Bruce Schnapp.)

Gracias al microscopio de barrido confocal es posible obtener imgenes de com plejos objetos tridimensionales 7
Como hemos visto, para poder observar un tejido al microscopio ptico conven cional, se ha de cortar en finas secciones; cuanto ms finas sean las secciones ms definidas sern las imgenes. En el proceso de obtencin de las secciones, sin embargo, se pierde informacin respecto a la tercera dimensin. Cmo enton ces se puede obtener una imagen de la arquitectura tridimensional de una clula o de un tejido? Cmo se puede ver la estructura tridimensional de una muestra que por una u otra razn no puede haber sido previamente cortada en seccio nes? Si se observa una muestra fina con un microscopio ptico convencional, la imagen obtenida al enfocar un nivel determinado resulta degradada y borrosa por la informacin que queda fuera de foco de las zonas de la muestra situadas encim a y debajo del plano focal. A pesar de que este problema se puede superar mediante com plejos procesadores de imgenes aplicados a las imgenes de los diferentes planos focales, el mtodo resulta lento y costoso desde el punto de vista informtico. El microscopio de barrido confocal aporta otra solucin, ms directa, para conseguir el mismo resultado final: utiliza mtodos electrnicos de imagen que permiten enfocar un plano escogido de una muestra fina eliminan do la luz que proviene de las zonas fuera de foco superiores e inferiores a este plano. As se obtiene una imagen ntida de una fina seccin ptica. A partir de se ries de secciones pticas de este tipo obtenidas a diferentes profundidades, ar chivadas en un ordenador, resulta sencillo reconstruir una imagen tridimensio nal. El microscopio de barrido confocal es para los microscopistas lo que la TAC (tomografa axial computadorizada) de barrido fue (por diferentes razones) para

Observacin de la estructura de las clulas con el microscopio

155

Figura 4-13 El microscopio de barrido confocal de fluorescencia.

diafragm as confocales espejo dicroico

objectivo m uestra 3-D punto de foco una muestra fluorescente se ilum ina con un punto enfocado de luz procedente de un diafragm a la luz fluorescente em itida por el punto de la m uestra est en foco, se enfoca en el diafragm a y alcanza el detector la luz que procede del resto de puntos de la muestra estn fuera de foco del diafragm a, por lo que sern excluidos casi com pletam ente del detector

Este simple diagrama muestra que la disposicin bsica de los componentes pticos es similar a la del microscopio de fluorescencia estndar mostrado en la Figura 4-7, excepto en que en ste se utiliza un lser para iluminar una pequea mancha de luz cuya imagen se enfoca en un solo punto de la muestra (A). La fluorescencia emitida por este punto de la muestra se enfoca en un segundo (confocal) diafragma (B). La luz emitida por el resto de la muestra no se enfoca en este diafragma, por lo que no contribuir a formar la imagen final (C). Mediante un barrido de la mancha de luz por toda la muestra se obtiene una imagen bidimensional muy fina exactamente del plano de foco, la cual no est degradada significativamente por la luz procedente de otras regiones de la muestra.

los radilogos para estudiar el cuerpo humano: ambos sistemas proporcionan imgenes detalladas de secciones del interior de una estructura intacta. Los detalles pticos del microscopio de barrido confocal son complejos, pero la idea bsica es sencilla, como se ilustra en la Figura 4-13. Generalmente el mi croscopio utiliza una ptica fluorescente (vase Figura 4-7), pero en lugar de ilu minar toda la muestra a la vez, como se hace habitualmente, en cada instante el sistema ptico enfoca un pequeo punto luminoso en una profundidad determi nada de la muestra. Se necesita una fuente de luz que produzca puntos luminosos muy brillantes; habitualmente se utilizan fuentes lser cuya luz haya pasado a tra vs de un diafragma. La fluorescencia emitida por el material iluminado se recoge y produce una imagen a la entrada de un detector de luz adecuado. Se coloca un diafragma en el detector, en el lugar que es confocal con el punto luminoso -que es precisamente donde los rayos luminosos emitidos por el punto iluminado de la muestra estn enfocados. As, la luz de este punto de la muestra converge sobre esta apertura y entra en el detector. Contrariamente, la luz que proviene de las re giones fuera del plano focal del punto luminoso tambin estn fuera de foco en el diafragma, por lo que resulta en gran manera excluida del detector (Figura 4-14). Para obtener una imagen bidimensional se recoge secuencialmente la informa cin de cada punto luminoso del plano focal mediante un barrido por todo el campo a observar (como ocurre en una pantalla de televisin) y se presenta en
Figura 4-14 Com paracin entre la microscopa convencional y la confocal. Estas dos micrografas

proceden del mismo embrin intacto de Drosophila en estado de gstrula, teido con una sonda fluorescente para filamentos de actina. La imagen convencional no procesada (A) resulta borrosa debido a la presencia de estructuras fluorescentes situadas por encima y por debajo del plano focal. En la imagen confocal (B) esta informacin fuera de foco se ha eliminado, resultando una bien definida seccin ptica de la clula del embrin. (Por cortesa de Richard Warn y Peter Shaw.)

156

Captulo 4 : Cdmo se estudian las clulas

'>U

C L i.

uonkx. 4

J

&

v .

rv
20 pm

una pantalla de vdeo. A pesar de que no se presenta en la Figura 4-13, el barrido se obtiene por reflexin del haz luminoso en un espejo oscilante situado entre el espejo dicroico y las lentes del objetivo de tal forma que el punto luminoso y el diafragma confocal del detector permanezcan estrictamente en registro. El microscopio de barrido confocal se ha utilizado para resolver las estructu ras de numerosos objetos tridimensionales complejos (Figura 4-15), incluyendo las redes de fibras del citoesqueleto del citoplasma y la disposicin de los cro mosomas y de los genes en el ncleo.

Figura 4 -1 5 Reconstruccin tridimensional a p artir de Imgenes del m icroscopio de barrido confocal.

El microscopio electrnico resuelve la estructura fina de la clula 8


La relacin entre el lmite de resolucin y la longitud de onda de la luz que se utili za para iluminar la muestra (vase Figura 4-4) es cierta para cualquier forma de ra diacin, con independencia de que sea un haz de luz o un haz de electrones. Sin embargo, en el caso de los electrones el lmite de resolucin puede hacerse muy pequeo. La longitud de onda de un electrn disminuye a medida que aumenta su velocidad. En un microscopio electrnico que tenga un voltaje de aceleracin de 100 000 voltios, la longitud de onda de un electrn es de 0,004 nm, de forma que en teora, la resolucin de un microscopio de este tipo sera de aproximadamente 0,002 nm, lo cual es unas 10 000 veces mayor que la de un microscopio ptico. Sin embargo, debido a que las aberraciones de las lentes electrnicas son mucho ms difciles de corregir que las de las lentes de cristal, el poder de resolucin real de la mayora de los microscopios electrnicos actuales es, en el mejor de los casos, de 0,1 nm (1 ) (Figura 4-16). Adems, los problemas de preparacin de la muestra, de contrastado y de lesin por la radiacin, limitan claramente la resolucin nor mal para los objetos biolgicos a unos 2 nm (20 ), unas 100 veces mayor a la reso lucin de un microscopio ptico. En la Tabla 4-2 se resumen algunos de los hitos histricos en el desarrollo de la microscopia electrnica. El microscopio electrnico de transmisin (TEM, de Transmission Electron Microscope) es, en sus rasgos generales, parecido a un microscopio ptico, aun que es de mayor tamao e invertido (Figura 4-17). La fuente de iluminacin es un filamento o ctodo situado en la parte superior de una columna cilindrica de unos dos metros de altura, que emite electrones. Puesto que los electrones son dispersados al colisionar con las molculas del aire, se ha de extraer el aire de la columna, para producir el vaco en ella. A continuacin, los electrones son ace lerados desde el filamento mediante un nodo, que pueden atravesar a travs de un diminuto orificio, y forman un haz de electrones que se dirige hacia la parte inferior de la columna. Unas bobinas magnticas situadas a intervalos a lo largo de la columna enfocan el haz de electrones, como las lentes enfocan la luz en un microscopio ptico. La muestra se coloca en el vaco de la columna a travs de una antecmara de compresin, y se sita en el camino del haz de electrones. Como en el caso del microscopio ptico, normalmente la muestra se contrasta; en este caso mediante un material electrodenso, como veremos en la seccin si guiente. Algunos de los electrones que atraviesan la muestra son dispersados por estructuras contrastadas con el material electrodenso; el resto de electrones

Los granos de polen, en este caso de una pasionaria, tienen una pared celular estructurada de forma muy compleja, que contiene compuestos fluorescentes. Las imgenes obtenidas a diferentes profundidades del grano utilizando un microscopio de barrido confocal se pueden combinar obtenindose una imagen tridimensional del grano de polen completo, como se muestra a la derecha. A la izquierda se presentan algunas secciones pticas individuales de un total de 30, cada una de las cuales contribuye ligeramente a formar la imagen final. (Por cortesa de John White.)

Figura 4 -1 6 Lmite de resolucin del microscopio electrnico.

Electronmicrografa de una fina capa de oro, en la que los tomos individuales aparecen como manchas brillantes. La distancia entre los tomos de oro adyacentes es de unos 0,2 nm (2 A). (Por cortesa de Graham Hills.)

Observacin de la estructura de las clulas con el microscopio

157

T abla 4 -2 P rin cip ales a co n tecim ien to s en la evolucin del m icroscop io electr n ico y d e su ap licaci n a la biologa celu lar

1897 J J . T h om so n anunci la existencia de partculas cargadas negativamente, ms tarde denominadas electrones. 1924 de B roglie propuso que un electrn en movimiento tiene un comportamiento ondulante. 1926 B u sch demostr que era posible enfocar un haz de electrones utilizando una lente magntica cilindrica. As estableci los fundamentos de la ptica electrnica. 1931 Ruska y colaboradores construyeron el primer microscopio electrnico de transmisin. 1935 Knoll demostr que era posible construir un microscopio electrnico de barrido. Tres aos ms tarde, Von Ardenne construy un prototipo. 1939 Siem ens construy el primer microscopio electrnico de transmisin comercial. 1944 W illiam s y W yckoff introdujeron la tcnica de la metalizacin de las muestras. 1945 P o rte r, C laude y Fullan utilizaron el microscopio electrnico para observar clulas cultivadas, despus de fijarlas y contrastarlas con 0 s0 4. 1948 P ease y B ak er obtuvieron cortes finos (0,1-0,2 |j.m de grosor) de material biolgico. 1952 Palad e, P o rte r y Sjostrand desarrollaron mtodos de fijacin y de obtencin de cortes ultrafinos que permitieron observar por primera vez muchos orgnulos intracelulares. En una de las primeras aplicaciones de estas tcnicas, H .E. H uxley demostr que el msculo esqueltico contiene ordenaciones superpuestas de filamentos proteicos, apoyando as la hiptesis de los filamentos deslizantes de la contraccin muscular. 1953 P o rte r y B lu m disearon el primer ultramicrtomo que fue ampliamente aceptado, incorporando muchas de las caractersticas introducidas con anterioridad por C laude y Sjostrand. 1956 G lauert y colaboradores demostraron que la resina epoxi Araldite era un medio de inclusin altamente eficaz para la microscopa electrnica. Cinco aos ms tarde, Luft introdujo otra resina Epon para la inclusin. 1957 R obertson describi la estructura trilaminar de la membrana celular, observada por primera vez al microscopio electrnico. 1957 Las tcnicas de criofractura desarrolladas inicialmente por Steere fueron perfeccionadas por M oor y M hlethaler. Ms tarde (1966), B ran to n demostr que la criofractura permite visualizar el interior de la membrana. 1959 Singer utiliz anticuerpos acoplados a ferritina para detectar molculas de la clula al microscopio electrnico. 1959 B ren n er y H orn e desarrollaron la tcnica de la tincin negativa, inventada cuatro aos antes por Hall, convirtindola en una tcnica de aplicacin rutinaria para visualizar virus, bacterias y filamentos proteicos. 1963 Sabatini, B en sch y B a rrn e tt introdujeron el glutaraldehdo (generalmente seguido de 0 s0 4) como fijador ms utilizado en microscopa electrnica. 1965 C am bridge In stru m en ts construy el primer microscopio electrnico de barrido, de tipo comercial. 1968 de R osier y Klug describieron las tcnicas para la reconstruccin de las estructuras tridimensionales a partir de micrografas electrnicas. 1975 H en d erson y Unw in determinaron por primera vez la estructura de una protena de membrana mediante reconstruccin por ordenador de micrografas electrnicas de muestras no teidas. 1979 H euser, Reese y colaboradores desarrollaron una tcnica de grabado profundo con una alta resolucin, basada en una congelacin muy rpida.

son enfocados formando una imagen -d e una manera anloga a como se forma la imagen en el microscopio ptico- sobre una placa fotogrfica o sobre una pantalla fluorescente. Puesto que los electrones que han sido dispersados han desaparecido del haz, las regiones densas de la muestra aparecen como reas de un flujo bajo de electrones, que aparecen negras.

158

Captulo 4 : Cmo se estudian las clulas

fuente luminosa lentes condensador muestra lentes objetivo

filamento -" incandescente (fuente de electrones)

Figura 4 -1 7 Caractersticas principales de un microscopio ptico, de un microscopio electrnico de transm isin y de un m icroscopio electrnico de barrido. El dibujo pone

lente ocular

lente proyector

de relieve las similitudes generales del diseo de estos tipos de microscopios. Mientras que las lentes del microscopio ptico son de vidrio, las del microscopio electrnico son bobinas magnticas. Los dos tipos de microscopios electrnicos requieren que la muestra se coloque en el vaco.

detector

IMAGEN OBSERVADA DIRECTAMENTE MICROSCOPIO PTICO

IMAGEN SOBRE UNA PANTALLA FLUORESCENTE MICROSCOPIO ELECTRONICO DE TRANSMISIN MICROSCOPIO ELECTRONICO DE BARRIDO
O

CH2
ch2 ch2

I I

o . n \ S o o
^ Os %

-/c \

Para poder ser estudiadas al microscopio electrnico, las muestras biolgicas requieren una preparacin especial 9
En los primeros tiempos de su aplicacin a materiales biolgicos, el microscopio electrnico revel la existencia en las clulas de una gran cantidad de estructu ras inimaginables. Sin embargo, antes de que se pudieran hacer estos descubri mientos, los especialistas en microscopia electrnica tuvieron que desarrollar nuevos procedimientos de inclusin, de corte y de tincin de los tejidos. Puesto que las muestras para m icroscopia electrnica han de ser expuestas a un vaco muy intenso, no es posible la observacin de las muestras vivas y h medas. Normalmente los tejidos son protegidos por fijacin -prim ero con glutaraldehdo, que une covalentemente las molculas proteicas a sus vecinas, y despus con tetrxido de osmio , que une y estabiliza las bicapas lipdicas y tam bin las protenas (Figura 4-18). Puesto que los electrones tienen un poder pe netrante muy limitado, norm alm ente los tejidos fijados son cortados en seccio nes extremadamente finas (de 50 a 100 nm de espesor -aproxim adam ente 1/200 del espesor de una clula) antes de poder observarlos. Esto se logra deshidra tando la m uestra e infiltrndola con una resina m onom rica que polimeriza for mando un bloque slido de plstico; el bloque se puede cortar mediante una cuchilla de vidrio o de diamante, en un micrtomo especial (ultramicrtomo). Estas secciones ultrafinas, libres de agua y de otros solventes voltiles, se reco gen sobre una pequea rejilla m etlica circular para observarlas al microscopio (Figura 4-19). En el microscopio electrnico, el contraste depende del nmero atmico de los tomos de la muestra: cuanto ms elevado sea el nmero atmico mayor n mero de electrones sern dispersados y, por lo tanto, mayor ser el contraste obte nido. Las molculas biolgicas estn compuestas por tomos de nmero atmico muy bajo (fundamentalmente de carbono, oxgeno, nitrgeno e hidrgeno). Para hacerlas visibles, normalmente se contrastan (antes o despus de seccionarlas) con sales de metales pesados tales como el osmio, el uranio y el plomo. Los dife rentes componentes celulares aparecern con diferentes grados de contraste, en funcin de su diferente intensidad de contrastado de teido con estas sales. Los lpidos, por ejemplo, tienden a contrastarse de oscuro con el osmio, revelando as la localizacin de las membranas celulares (Figura 4-20).

glutaraidehdo

tetrxido de osmio

Figura 4 -1 8 Dos fijadores qumicos que se utilizan habitualm ente en m icroscopia electrnica. Los dos

grupos reactivos aldehido del glutaraidehdo le permiten establecer enlaces cruzados entre diversos tipos de molculas, formando uniones covalentes entre ellos. El tetrxido de osmio es reducido por numerosos compuestos orgnicos con los que forma complejos mediante puentes cruzados. Resulta especialmente til para la fijacin de las membranas celulares, ya que reacciona con los dobles enlaces C=C existentes en muchos cidos grasos.

rejilla de cobre recubierta con una pelcula de carbono y/o de plstico cinta de cortes seriados ultrafinos de una muestra

11111111111111111
3 mm-

Figura 4 -1 9 Esquem a de una rejilla de cobre utilizada com o soporte de los cortes ultrafinos de una m uestra, en la m icroscopia electrnica de transm isin.

Observacin de la estructura de las clulas con el microscopio

159

En algunos casos, en secciones ultrafinas se pueden localizar determinadas macromolculas mediante tcnicas adaptadas de la m icroscopa ptica. Ciertas enzimas celulares pueden ser detectadas incubando la muestra con un substrato cuya reaccin conduzca al depsito local de un precipitado denso a los electro nes (Figura 4-21). Alternativamente, como veremos en las pgs. 197-198, dife rentes anticuerpos pueden acoplarse a una enzima indicadora (normalmente

Figu ra 4 -2 0 Seccin ultrafna de una clula apical de la raz de una gramnea, contrastada con osmio y otros iones de metales pesados. Se observan fcilmente la pared celular, el ncleo, las vacuolas, las mitocondrias, el retculo endoplasmtico, el com plejo de Golgi y los ribosomas. (Por cortesa de Brian Gunning.)

Figura 4-21 Electronm icrografa de una clula, mostrando la localizacin de una determ inada enzima (la nucletido difosfatasa) en el complejo de Golgi. Una seccin ultrafna de la clula se incub con un substrato que, al reaccionar con la enzima, form un precipitado electrodenso. (Por cortesa de Daniel S. Friend.)

160

Captulo 4 : Cmo se estudian las clulas

peroxidasa) o a una molcula densa a los electrones (normalmente pequeas es feras de oro metlico, denominadas partculas de oro coloidal) y ser utilizados para localizar las macromolculas que reconocen (vase Figura 4-63).

Mediante la m icroscopa electrnica de barrido se pueden obtener imgenes tridim ensionales 10


Efectivamente, las secciones ultrafinas son cortes bidimensionales de un tejido y no revelan la disposicin tridimensional de los componentes celulares. Aunque la tercera dimensin puede ser reconstruida a partir de cientos de secciones se riadas (Figura 4-22), ello supone un proceso largo y tedioso. Afortunadamente existen sistemas ms directos de obtener una imagen tri dimensional. Uno de estos sistemas consiste en examinar las muestras con un m icroscopio electrnico de barrido (SEM, de Scanning Electron Microscope), que suele ser ms pequeo y sencillo que el microscopio electrnico de transmi sin. Mientras que el microscopio electrnico de transmisin utiliza los electro nes que han atravesado la muestra, el microscopio electrnico de barrido utiliza los electrones dispersados o emitidos a partir de la superficie de la muestra. La muestra a examinar se fija, se seca y se recubre con una capa delgada de un m e tal pesado. A continuacin la muestra es barrida por un haz focalizado de elec trones. La cantidad de electrones dispersados o emitidos cuando este haz pri mario bombardea consecutivamente cada uno de los puntos de la superficie metlica es medido y utilizado para controlar la intensidad del segundo haz, que se mueve sincrnicam ente con el haz primario y forma una imagen sobre una pantalla de televisin. De esta manera se construye una imagen completa y muy ampliada de la superficie de la muestra. La tcnica de SEM proporciona una tremenda profundidad de foco; ade ms, debido a que el grado de dispersin de los electrones depende del ngulo relativo entre el haz y la superficie, la imagen tiene puntos brillantes y sombras oscuras que le confieren un aspecto tridimensional (Figura 4-23). Sin embargo solamente se pueden examinar detalles superficiales, y en la mayora de mode-

F ig u ra4-22 Reconstruccin tridimensional a partir de secciones seriadas. A menudo las secciones ultrafinas individuales conducen a impresiones errneas. En este ejemplo, la mayora de las secciones de una clula que contiene una mitocondria ramificada parecen contener dos o tres mitocondrias diferentes. Adems, a partir de las secciones 4 y 7 se podra deducir que una mitocondria se halla en el proceso de divisin. Sin embargo, a partir de los cortes seriados se puede reconstruir la verdadera forma tridimensional.

Figura 4 -23 M icroscopa electrnica de barrido. Electronmicrografa obtenida con un microscopio de barrido, mostrando la disposicin cnica que adoptan los estereocilios que se proyectan desde la superficie de las clulas ciliadas del odo interno (A). Para comparar, la misma estructura se muestra observada por microscopa ptica de contraste de fases interferencial (B) y por microscopa electrnica de seccin fina (C). (Por cortesa de Richard Jacobs y Jam es Hudspeth.)

I________I 1 jim

i________ I 5| im

Observacin de la estructura de las clulas con el microscopio

161

los de SEM la resolucin alcanzable no es muy elevada (aproximadamente 10 nm, con un aumento efectivo de hasta 20 000 veces); por consiguiente, esta tcnica se utiliza para estudiar clulas enteras o tejidos y no orgnulos celulares (vase Figura 4-32).

El som breado metlico perm ite el examen a alta resolucin de detalles superficiales, mediante el microscopio electrnico de transm isin 11
El microscopio electrnico de transmisin puede ser utilizado para estudiar la superficie de una muestra -y generalmente a mayor resolucin que en un mi croscopio electrnico de barrido- de forma que pueden verse macromolculas individuales. Al igual que para la microscopia electrnica de barrido, sobre la muestra seca se evapora una fina pelcula de un metal pesado, como el platino. El metal se vaporiza desde un ngulo oblicuo de manera que se forma una capa que en algunos lugares es ms gruesa que en otros -u n proceso conocido como sombreado porque se crea un efecto de sombras que da una imagen con apa riencia tridimensional. Algunas muestras cubiertas de esta manera son suficientemente finas o sufi cientem ente pequeas para que el haz de electrones penetre en ellas directamen te; ste es el caso de las molculas, los virus y las paredes celulares (Figura 4-24). Pero para el caso de las muestras ms gruesas, el material orgnico ha de ser eli minado por disolucin despus del sombreado, de forma que tan slo quede la fina rplica m etlica de la superficie de la muestra. La rplica se refuerza con una pelcula de carbono para que pueda ser colocada en una rejilla y examinada al microscopio electrnico de transmisin de la manera habitual (Figura 4-25).

100

nm

Figura 4 -24 Electronmicrografifas de molculas aisladas de la protena miosina que han sido sombreadas con platino. La miosina es uno de los com ponentes principales del aparato contrctil del msculo; como se muestra aqu, se com pone de dos cabezas globulares unidas por un tallo comn. {Por cortesa de Arthur Elliot.)

muestra soporte

La microscopia electrnica de criofractura y la de grabado por congelacin proporcionan una nueva visin del interior celular 12
Otros dos mtodos que utilizan rplicas metlicas han sido particularmente ti les en la biologa celular. Uno de ellos, el de la microscopia electrnica de criofractura, constituye un sistema de visualizar el interior de las membranas celu lares. Las clulas se congelan a la temperatura del nitrgeno lquido (-196C) en presencia de un crioprotector (un anticongelante) para impedir la distorsin pro vocada por la formacin de cristales de hielo, y el bloque se fracciona con la hoja de una cuchilla. A menudo, el plano de fractura pasa a travs del centro hidrofbico de las bicapas lipdicas, exponiendo as el interior de las membranas celula res. Las caras de fractura resultantes se metalizan con platino, y las rplicas se observan al microscopio electrnico (como en la Figura 4-25). Estas rplicas es tn llenas de pequeas protuberancias, llamadas partculas intramembrana , que corresponden a grandes protenas de la membrana. Esta tcnica proporcio na una va adecuada y espectacular para visualizar la distribucin de este tipo de protenas en el plano de la mem brana (Figura 4-26). Otro mtodo importante de rplica es la microscopia de grabado por conge lacin (freeze-etch), que puede ser utilizado para examinar tanto el interior como el exterior de las clulas. En esta tcnica las clulas tambin se congelan muy rpidamente -utilizando por ejemplo un dispositivo especial para colocar la muestra contra un bloque de cobre congelado por ejemplo con helio lquido- y el bloque congelado se fragmenta con la hoja de una cuchilla, como acabamos de describir. Pero en este caso el nivel de hielo disminuye alrededor de las clulas (y en menor medida dentro de las clulas) mediante la sublimacin del agua en el vaco a medida que aumenta la temperatura (un proceso denominado deshidratacin por congelacin) (Figura 4-27). Las zonas de la clula expuestas a este pro ceso de grabado son sombreadas como antes, para conseguir una rplica de pla tino. Esta tcnica expone estructuras del interior de la clula y puede revelar su organizacin tridimensional con una claridad excepcional (Figura 4-28).

el metal pesado evaporado de un filam ento "som brea" la muestra

pelcula protectora de carbono evaporada encima de la m uestra

l i l i

la rplica se coloca sobre la superficie de un potente disolvente a fin de elim inar la muestra

la rplica se lava y recoge con una rejilla de cobre para su examen m icroscpico

Figura 4-25 Preparacin de una rplica metalizada de la superfcie de una muestra. Obsrvese que el grosor del metal refleja los contornos de la superficie de la muestra original.

162

Captulo 4 : Cmo se estudian las clulas

Figura 4 -2 6 Electronm icrografa de una criofractura de la m em brana del tilacoide de un cloroplasto de una clula vegetal. Las m em branas del tilacoide, que llevan a cabo la fotosntesis, se encuentran apiladas en mltiples capas (vase Figura 14-39). El plano de fractura se ha desplazado de capa a capa, pasando a travs de cada bicapa lipdica y exponiendo las protenas transm em brana que tienen un tamao en el interior de la bicapa suficiente para hacer sombra y aparecer com o partculas intram em brana en esta rplica de platino. Las partculas mayores que se aprecian en la m em brana son el fotosistema II com pleto -u n com plejo de mltiples protenas. (Por cortesa de L.A. Staehelin.)

0,1 iim
Puesto que lo que se observa al microscopio son las rplicas metlicas sombrea das y no las propias muestras, ambos mtodos, la criofractura y el sombreado por congelacin, pueden utilizarse para estudiar clulas congeladas sin fijar, evitndose pues el riesgo de obtener artefactos producidos por el proceso de la fijacin.

La tincin negativa y la microscopa crioelectrnica permiten observar macromolculas a alta resolucin 13


Aunque las macromolculas aisladas, tales como el DNA o las grandes protenas, pueden ser fcilmente visualizadas con el microscopio electrnico si se vaporizan con un metal pesado para darles contraste (vase Figura 4-24), se pueden visuali zar sus detalles finos utilizando tincin negativa. En este caso, las molculas co locadas sobre una fina pelcula de carbn (que resulta casi transparente a los electrones), se lavan con una solucin concentrada de una sal de un metal pesa do, como el acetato de uranilo. Una vez seca la muestra, una pelcula muy fina de la sal metlica cubre la pelcula de carbn por todas partes excepto por donde ha sido excluida debido a la presencia de una macromolcula adsorbida. Puesto que

Figura 4 -2 7 La m icroscopa electrnica por criofractura. La muestra es rpidamente congelada y el bloque de hielo es fracturado con una cuchilla (A). Entonces, el nivel de hielo se reduce por sublimacin del agua en el vaco, de forma que las estructuras de la clula que se encuentran cerca del plano de fractura quedan al descubierto (B). A continuacin, se prepara una rplica de la superficie todava congelada (tal com o se describe en la Figura 4-25) y se examina al m icroscopio electrnico de transmisin.

(A) FRACTURA

las (-|os caras de fractura de la m em brana externa de la envoltura

GRABADO

partcula hielo grabado interm em brana citoplasm a grabado

superficie externa de la m em brana plasm tica y del orgnulo rodeado de m em brana

Observacin de la estructura de las clulas con el microscopio

163

; <^KA'rx^F^ni^-r^ \ 2 ~ r_'

Figura 4-28 Ordenacin regular de los filamentos proteicos de un msculo de insecto. Para obtener esta imagen, las clulas musculares fueron rpidamente congeladas en helio lquido, fracturadas a travs del citoplasma y sometidas a grabado profundo. Luego, se prepar una rplica metalizada que se examin a gran aumento. (Por cortesa de Roger Cooke y John Heuser.)

,i |jm

la macromolcula permite que los electrones pasen mucho ms fcilmente que a travs del metal pesado circundante, se crea una imagen inversa o negativa de la macromolcula. La tincin negativa es especialmente til para visualizar grandes agregados macromoleculares, tales como virus o ribosomas, y para observar la estructura en subunidades de los filamentos proteicos (Figura 4-29). Tanto la tincin negativa como el sombreado son capaces de proporcionar visiones de alto contraste de la superficie de pequeos conjuntos m acromolecu lares; ambas tcnicas, sin embargo, tienen una resolucin limitada por el tam a o menor de las partculas metlicas utilizadas en el sombreado o en la tincin. Mtodos ms recientes proporcionan una alternativa que ha permitido la visualizacin directa a alta resolucin de incluso las caractersticas internas de estruc turas tridimensionales tales como los virus. En esta tcnica, llamada m icrosco pia crioelectrnica, sobre una rejilla de microscopia se prepara una capa muy delgada (100 nm) de muestra hidratada que es rpidamente congelada. Se re quiere un porta-objetos especial para colocar esta muestra a -160C en el vaco del microscopio, donde puede ser visualizada directamente sin necesidad de fi jacin, tincin, o secado. La homogeneidad de la capa de agua vitrificada y la utilizacin del contraste de fases bajo foco permite la obtencin de imgenes sorprendentem ente claras de estas muestras no fijadas (Figura 4-30). Independientemente del mtodo utilizado, al microscopio electrnico una molcula de protena nicamente da una imagen, dbil y poco definida. El inten to de obtener una m ejor informacin prolongando el tiempo de inspeccin o la intensidad de iluminacin resulta contraproducente, ya que con ello se daa el objeto a examinar. Por consiguiente, para descubrir los detalles de la estructura

Figura 4-29 Electronm icrografa de filamentos de actina por tincin negativa. Cada filamento tiene aproximadamente 8 nm de dimetro y, al examinarlo detenidamente, se observa que est formado por una cadena helicoidal de molculas globulares de actina. (Por cortesa de Roger Craig.)

164

Captulo 4 : Cmo se estudian las clulas

Figura 4-30 Microscopa electrnica de un virus. (A) Virus Semliki forest no teido en un capa fina de agua vitrificada, observado al microscopio crioelectrnico a -160C. Como en microscopia ptica, el contraste de fases se puede utilizar para obtener una imagen de una muestra no teida. Mediante mtodos de procesamiento de imgenes se puede combinar un gran nmero de estas imgenes produciendo una imagen tridimensional de alta resolucin. (Por cortesa de Stephen Fuller.)

molecular es necesario combinar la informacin obtenida de muchas molculas con el fin de eliminar los errores aleatorios de la imgenes individuales. Esto es posible para virus o filamentos proteicos, en los que las subunidades individuales se presentan ordenadas de forma regular y repetida; tambin es posible para cualquier substancia que pueda formar ordenamientos cristalinos en dos dimen siones en los que una gran cantidad de molculas presenten una orientacin idntica y posiciones espaciales regulares. Sobre una microfotografa de un orde namiento de cualquier tipo se pueden aplicar las tcnicas de procesamiento de imgenes para obtener la imagen media de una molcula individual, revelando as detalles oscurecidos por el ruido aleatorio de la fotografa original. Este sistema de reconstruccin de imgenes ha permitido obtener con una resolucin de 3,5 nm la estructura interna de virus recubiertos y obtener la forma de una molcula individual de protena a la extraordinaria resolucin de 0,35 nm (vase Figura 10-31). Sin embargo, la microscopa electrnica, incluso en sus for mas ms sofisticadas, no consigue obtener una descripcin completa de la es tructura molecular, ya que los tomos en una molcula estn separados por dis tancias de tan slo 0,1 o 0,2 nm. Para resolver la estructura molecular a detalle atmico, se necesita otra tcnica que utilice rayos X en lugar de electrones.

Resumen
Actualmente disponemos de muchas tcnicas de microscopa ptica que nos per miten la observacin de las clulas. Las clulas que han sido fijadas y teidas se pueden estudiar al microscopio ptico convencional, mientras que para localizar molculas especficas en las clulas se pueden utilizar anticuerpos marcados y es tudiar su localizacin mediante el microscopio de fluorescencia. El microscopio de barrido confocal proporciona finas secciones pticas y puede utilizarse para re construir imgenes tridimensionales. Las clulas vivas se pueden observar utilizan do tcnicas de contraste de fases, contraste de fases interferencial o pticas de cam po oscuro. Todos los tipos de microscopa ptica son ms fciles utilizando tcnicas electrnicas de procesamiento de imgenes, las cuales amplifican la sensibilidad e incrementan la resolucin. Para determinar la estructura detallada de las membranas y dlos orgnulos celulares se requiere una resolucin mayor, la cual se puede alcanzar con el micros copio electrnico de transmisin. Se pueden obtener imgenes tridimensionales de las superficies de clulas y tejidos mediante microscopa electrnica de barrido, mientras que el interior de las membranas y de las clulas puede observarse, respec tivamente, mediante la criofractura y la microscopa de grabado por congelacin. Tambin puede visualizarse fcilmente la forma de macromolculas aisladas, si han sido previamente sombreadas con un metal pesado o contorneadas por tincin negativa, utilizando la microscopa electrnica.
Observacin de la estructura de las clulas con el microscopio

165

Aislamiento y crecimiento de clulas en cultivo1 4


A pesar de que al m icroscopio pueden observarse las estructuras de los orgnulos y de las macromolculas de la clula, la comprensin molecular de la clula requiere un anlisis bioqumico detallado. Desgraciadamente los procedimien tos bioqum icos requieren gran cantidad de clulas y siempre empiezan rom pindolas. Si la muestra es un trozo de tejido, se mezclarn entre s fragmentos de todas sus clulas y si, como ocurre en la mayora de los casos, el tejido tena clulas de varios tipos diferentes, se originar una gran confusin. Con el objeto de preservar toda la informacin que sea posible sobre cada uno de los tipos ce lulares, los bilogos celulares han desarrollado tcnicas de disociacin de clu las a partir de los tejidos y de separacin de los distintos tipos celulares. Como resultado de estas tcnicas, pueden analizarse poblaciones relativamente hom o gneas de clulas -y a sea directamente o despus de que su nmero se haya in crementado notablem ente permitiendo que las clulas proliferen en cultivo.

Las clulas de un tejido pueden ser aisladas y separadas en diversos tipos celulares 15
El primer paso del aislamiento de clulas a partir de un tejido que contiene una mezcla de tipos celulares consiste en romper la matriz extracelular y las uniones intercelulares que m antienen unidas entre s las clulas. Normalmente las m ejo res recuperaciones de clulas disociadas viables son las obtenidas de tejidos fe tales o neonatales, tpicam ente tratndolos con enzimas proteolitcas (como la tripsina y la colagenasa) y con agentes [como el cido etilendiamn tetraactico o EDTA (de ethylendiamintetraacetic acid)] que une, o quela, el Ca2* del que de pende la adhesin clula-clula. Entonces, los tejidos pueden ser disociados en clulas individuales y viables, mediante agitacin suave. Para separar los diferentes tipos celulares a partir de una suspensin celular mixta se utilizan diversos mtodos. Uno de ellos consiste en aprovechar las dife rentes propiedades fsicas de las clulas. Por ejemplo, las clulas grandes pue den separarse de las pequeas y las clulas densas de las ligeras, mediante cen trifugacin. Estas tcnicas se describirn al hablar de la separacin de orgnulos y de m acromolculas, para lo cual fueron desarrolladas originalmente. Otra aproximacin se basa en la tendencia de algunos tipos celulares a adherirse fuertemente al cristal o al plstico, lo cual permite separarlas de clulas que se adhieran m enos fuertemente. Una mejora importante de esta ltima tcnica depende de las propiedades especficas de unin de los anticuerpos. Los anticuerpos que se unen especfica mente a la superficie de un solo tipo celular de un tejido pueden acoplarse a va rios tipos de m atrices -co m o colgeno, esferas de polisacridos o plstico- for mando una superficie de afinidad a la que nicam ente se unirn las clulas reconocidas por los anticuerpos. Las clulas unidas se recuperan ms tarde mediante agitacin suave, m ediante el tratam iento con tripsina para digerir las protenas que median la adhesin, o, en el caso de matrices digeribles (como la colgena), m ediante la degradacin de la propia matriz con enzimas (como la colagenasa). La tcnica ms sofisticada de separacin celular se basa en el mareaje espe cfico de las clulas con anticuerpos acoplados a un colorante fluorescente y posterior separacin de las clulas marcadas de las no marcadas mediante un clasificador celular activado por fluorescencia. En este aparato las clulas pa san en fila india a travs de un haz lser determinndose la fluorescencia de cada clula. Un poco ms adelante de la corriente de clulas, una boquilla vibra toria forma diminutas gotitas, la mayora de las cuales contienen una o ninguna clula. Las gotitas que contienen una sola clula reciben automticamente una carga elctrica positiva o negativa en el momento de formarse, dependiendo de si la clula es fluorescente o no lo es; a continuacin, las gotitas son desviadas por un intenso campo elctrico hacia un contenedor apropiado. Los grupos de

166

Captulo 4 : Cmo se estudian las clulas

Figura 4-31 Seleccionador de clulas activado por fluorescencia. Cuando una clula pasa a travs del rayo lser, es seleccionada de acuerdo con su fluorescencia. Las gotitas que contienen una sola clula reciben una carga negativa o positiva, segn sea la clula fluorescente o no. Luego, las gotitas son desviadas mediante un campo elctrico, en funcin de su carga, hacia los tubos de recogida. Tngase en cuenta que la concentracin celular debe ser tal que la mayora de las gotitas no contengan ninguna clula; la mayor parte de las gotitas, pues, fluirn al contenedor residual, junto con las gotitas que contengan ms de una clula. Este mismo aparato se puede utilizar tam bin para separar cromosom as marcados con fluorescencia de otros no marcados, proporcionando un valioso material de partida para el aislamiento y mapaje de genes.

clulas que se forman ocasionalmente son detectados por su mayor dispersin de luz y no reciben carga, de forma que caen en un contenedor residual. Estas mquinas pueden seleccionar 1 clula entre 1000 y clasificar unas 5000 clulas por segundo (Figura 4-31). Cuando, mediante alguno de los mtodos mencionados, se ha obtenido una poblacin uniforme de clulas, esta poblacin puede utilizarse directamente para anlisis bioqumicos. Alternativamente, esta poblacin celular constituye un material de partida adecuado para el cultivo celular, permitiendo estudiar el complejo comportamiento de las clulas bajo las condiciones estrictamente de finidas de una placa de cultivo.

Las clulas pueden cultivarse en una placa de cultivo 16


La mayora de tipos celulares tanto vegetales como animales sobreviven, se mul tiplican e incluso expresan propiedades diferenciales en una placa de cultivo en condiciones adecuadas. Las clulas pueden visualizarse al microscopio o anali zarse bioqumicamente, y se pueden estudiar los efectos de la adicin o elimina cin de molculas determinadas tales como hormonas o factores de crecim ien to. Adems, en cultivos mixtos pueden estudiarse las interacciones entre un tipo celular y otro. A menudo se dice que los experimentos con clulas cultivadas han sido realizados in vitro (literalmente en vidrio) para diferenciarlos de los ex perimentos realizados en organismos intactos, que se dice que han sido realiza dos in vivo (literalmente en el organismo vivo). Estos dos trminos pueden re sultar confusos porque a menudo se utilizan en un sentido diferente por los bioqumicos, para los que in vitro se refiere a las reacciones bioqumicas que se producen fuera de la clula mientras que in vivo se refiere a cualquier reaccin que se produce dentro de una clula viva.

Aislamiento y crecimiento de clulas en cultivo

167

El cultivo de tejidos empez en 1907 con un experimento destinado a finali zar una controversia de la neurobiologa. La hiptesis que se examinaba era co nocida bajo el nom bre de teora neuronal, la cual afirmaba que cada fibra ner viosa es una prolongacin de una sola clula nerviosa y no el producto de la fusin de varias clulas. Para dilucidar esta polmica se colocaron pequeos fragmentos de mdula espinal en plasma coagulado en una cmara hmeda y caliente y se observaron al microscopio a intervalos regulares de tiempo. Al cabo de un da ms o menos, se pudo observar que las distintas clulas nerviosas em i tan prolongaciones largas y finas hacia el plasma coagulado. De esta manera qued demostrada la teora neuronal y se establecieron las bases de la revolu cin del cultivo celular. Los experimentos originales de 1907 implicaban el cultivo de pequeos fragmentos de tejido, o explantes. En la actualidad, los cultivos se preparan ha bitualmente a partir de suspensiones de clulas obtenidas por disociacin de te jidos, com o se ha descrito ms arriba. A diferencia de las bacterias, la mayor par te de las clulas de los tejidos no estn adaptadas a crecer en suspensin, de forma que necesitan una superficie slida sobre la que poder crecer y dividirse. Actualmente este soporte lo constituye una superficie de plstico de una placa de cultivo (Figura 4-32). Sin embargo distintos tipos celulares tienen requeri mientos diferentes, de forma que algunos de ellos no crecen o no se diferencian a m enos que la placa de cultivo est recubierta de componentes de matriz extracelular, com o el colgeno o la laminina. Los cultivos preparados directamente a partir de los tejidos de un organis mo, con o sin fraccionam iento previo, reciben el nombre de cultivos primarios. En la mayora de los casos, las clulas de los cultivos primarios pueden recupe rarse de la placa de cultivo y utilizarse para formar un gran nmero de cultivos secundarios. De esta forma las clulas pueden ser subcultivadas repetidamente durante semanas o meses. A menudo estas clulas muestran propiedades dife renciadas tpicas de sus orgenes: los fibroblastos continan segregando colge no; las clulas derivadas del msculo esqueltico embrionario se fusionan for mando fibras musculares gigantes que se contraen espontneamente en la placa de cultivo; las clulas nerviosas emiten axones que son excitables elctricamente y que establecen sinapsis con otras clulas nerviosas; las clulas epiteliales for man extensas lminas con muchas de las propiedades de un epitelio intacto. Puesto que estos fenm enos se producen en los cultivos, resultan accesibles al estudio a travs de sistemas y tcnicas que no se pueden aplicar en los tejidos in tactos.

10 jim
Figura 4-32 Clulas en cultivo.
Electronmicrografa de barrido de fibroblastos de rata creciendo sobre una superficie plstica en cultivo de tejidos. (Por cortesa de Guenter Albrecht-Buehler.)

Los medios definidos qum icam ente, libres de suero, permiten la identificacin de factores de crecim iento especficos 17
Hasta principios de los aos 1970 el cultivo de tejidos era algo as como una mezcla de ciencia y brujera. Aunque los cogulos plasmticos fueron substitui dos por placas de medios lquidos conteniendo cantidades especficas de peque as molculas como sales, glucosa, aminocidos, y vitaminas, la mayora de los medios incluan tam bin una proporcin mal definida de una mezcla de m acro molculas en forma de suero de caballo o de suero fetal de ternera, o un extracto crudo de embrin de pollo. Estos medios todava se utilizan actualmente para la mayora de cultivos rutinarios (Tabla 4-3) pero resultan inadecuados para el es tudio de las necesidades de macromolculas que un tipo celular determinado tiene para prosperar y funcionar normalmente. Esta dificultad ha conducido al desarrollo de medios libres de suero definidos qumicamente. Adems de las pequeas molculas habituales estos medios defi nidos contienen una o ms protenas especficas que la mayora de clulas nece sitan para sobrevivir y proliferar en cultivo. Entre ellas se encuentran los factores de crecim iento que estimulan la proliferacin y la transferrina que transporta hierro al interior de las clulas. La mayora de las molculas sealizadoras protei cas extracelulares esenciales para la supervivencia, desarrollo y proliferacin de

168

Captulo 4 : Cmo se estudian las clulas

Tabla 4-3 Composicin de un medio tpico adecuado para el cutivo de clulas de mamfero Protenas (necesarias en medios qumicamente definidos, libres de suero) Insulina Transferrina Factores de crecimiento especfico

Aminocidos Arginina Cisterna Glutamina Histidina Isoleucina Leucina Lisina Metionina Fenilalanina Treonina Triptfano Tirosina Valina

Vitaminas Biotina Colina Folato Nicotinamida Pantotenato Piridoxal Tiamina Riboflavina

Sales NaCl KC1 NaH2 P04 NAHCO3 CaCl2 MgCl2

Varios Glucosa Penicilina Estreptomicina Rojo fenol Suero total

La glucosa se utiliza a concentraciones de 5 a 10 mM. Todos los aminocidos son de la forma l y con una o dos excepciones se utilizan a con centraciones de 0,1 a 0,2 mM; las vitaminas se utilizan a concentraciones 100 veces menores, es decir, alrededor de 1 |j.M . El suero, que gene ralmente es de caballo o de ternera, se aade hasta formar el 10% del volumen total. La penicilina y la estreptomicina son antibiticos que se utilizan para inhibir el crecimiento de las bacterias. El rojo fenol es un colorante indicador del pH, que permite seguir la variacin de color para asegurar que el pH sea de 7,4 aproximadamente. Generalmente los cultivos se mantienen en recipientes de plstico o de vidrio, con una superficie preparada adecuadamente que permi ta la adherencia de las clulas. Los recipientes se conservan en una estufa de cultivo a 37C, en una atmsfera de 5% de C 0 2 y 95% de aire.

determinados tipos celulares se han descubierto a travs de estudios de cultivos celulares y la bsqueda de nuevas molculas ha sido enormemente facilitada por la asequibilidad de medios definidos qumicamente y libres de suero.

Las lneas celulares eucariotas constituyen una fuente ampliamente utilizada para la obtencin de clulas homogneas 18
La mayora de las clulas de los vertebrados mueren tras un nmero finito de di visiones en cultivo: por ejemplo, las clulas cutneas humanas en cultivo sobre viven durante algunos meses, dividindose nicamente entre 50 y 100 veces an tes de morir. Se sugiri que esta vida limitada estaba relacionada con la vida limitada del animal del que derivan las clulas. Sin embargo, en cultivo ocasio nalmente surgen algunas clulas que han sufrido algn cambio gentico que las hace realmente inmortales. Estas clulas proliferan indefinidamente y pueden propagarse com o una lnea celular (Tabla 4-4). Las lneas celulares preparadas a partir de clulas cancerosas difieren de las preparadas a partir de clulas normales, en varios aspectos; por ejemplo, a m e nudo las lneas de clulas cancerosas crecen sin fijarse a ninguna superficie y proliferan en una placa de cultivo hasta una densidad mucho mayor que la de las clulas normales. Experimentalmente pueden inducirse propiedades simila res a stas en clulas normales mediante la transformacin con un virus o con una substancia qumica inductora de tumores. Las lneas celulares transform a das resultantes son capaces de provocar tumores si se inyectan a un animal. Las lneas celulares, tanto transformadas como no transformadas, resultan extrema damente tiles para la investigacin celular como fuente de un nmero muy ele vado de clulas de un tipo uniforme, especialmente porque se pueden guardar en nitrgeno lquido a -196C durante un perodo indefinido de tiempo, y des pus de descongeladas todava son viables. Sin embargo, es importante recono cer que las clulas de ambos tipos de lneas celulares casi siempre difieren de sus clulas progenitoras de los tejidos de las que derivan, en algunas caractersticas importantes. Tabla 4-4 Algunas lneas celulares utilizadas habitualmente Lnea celular* 3T3 BHK 21 MDCK HeLa PtK l L6 PC 12 SP 2 Tipo celular y origen fibroblasto (ratn) fibroblasto (hmster sirio) clula epitelial (perro) clula epitelial (humana) clula epitelial (rata canguro) mioblasto (rata) clula cromafnica (rata) clula plasmtica (ratn)

* Muchas de estas lneas celulares deri van de tumores. Todas ellas son capaces de multiplicarse indefinidamente en cul tivo y expresan por lo menos algunas de las propiedades diferenciales de su ori gen celular. Las clulas BHK 21, HeLa y SP 2 son capaces de crecer en suspen sin; las otras lneas celulares requieren un substrato de cultivo slido para multi plicarse.

Aislamiento y crecimiento de clulas en cultivo

169

A pesar de que todas las clulas de una lnea celular son muy similares entre s, a menudo no son idnticas. La uniformidad gentica de una lnea celular puede mejorarse con el clonaje celular, mediante el cual se asla una nica clu la y se le permite proliferar hasta formar una gran colonia. Un clon es cualquier poblacin de clulas derivadas de una nica clula ancestral. Una de las aplica ciones ms importantes del clonaje celular ha sido el aislamiento de lneas celu lares mutantes con defectos en determinados genes. A menudo el estudio de las clulas que son defectuosas en una protena determinada revela muchos datos sobre la funcin que tiene esta protena en las clulas normales.

Las clulas pueden fusionarse formando clulas hbridas 19


Es posible fusionar una clula con otra formando una clula combinada con dos ncleos separados, denominada heterocarionte. La fusin se suele realizar tra tando una suspensin de clulas con ciertos virus inactivados o con polietiln glicol, que altera las m embranas plasmticas de las clulas de tal forma que s tas tienden a fusionarse entre s. Los heterocariontes ofrecen la posibilidad de mezclar los com ponentes de dos clulas diferentes para estudiar sus interaccio nes. Por ejemplo, el ncleo inerte de un eritrocito de pollo cuando es expuesto por fusin celular al citoplasma de una clula en cultivo en crecimiento, se reac tiva produciendo RNA y con el tiempo, replicando su DNA. La primera prueba directa de que las protenas de mem brana son capaces de desplazarse en el pla no de la mem brana plasmtica se obtuvo de un experimento en el que se fusio naron clulas de ratn con clulas humanas: aunque las protenas de superficie de las clulas de ratn y de la clula humana inicialmente estaban confinadas en sus propias mitades de la mem brana plasmtica del heterocarionte, rpidamen te difundieron y se mezclaron por toda la superficie de la clula. Con el tiempo, el heterocarionte sufrir una mitosis, producindose una c lula hbrida en la que las dos envolturas nucleares se han disgregado permitien do que todos los crom osom as se agrupen en un gran ncleo nico (Figura 4-33). Aunque estas clulas hbridas puedan ser clonadas generando lneas celulares hbridas, las clulas hbridas iniciales tienden a ser inestables y a perder crom o somas. Por razones desconocidas estas clulas hbridas hombre-ratn pierden de forma predominante cromosomas humanos. Estos cromosomas se pierden de manera aleatoria, dando lugar a diversas lneas celulares hbridas hombre-ratn diferentes, cada una de las cuales contiene algunos (o uno solo) crom oso mas humanos. Este fenmeno ha permitido determinar la localizacin de genes en el genoma humano. Por ejemplo, nicamente las clulas hbridas que contie nen el crom osom a humano 11 sintetizan la insulina humana, lo cual indica que el gen que codifica la insulina se halla situado en el cromosoma 11. Estas mis-

SUSPENSIN DE DOS TIPOS CELULARES, CENTRIFUGACIN Y ADICIN DE UN AGENTE DE FUSIN FUSIN CELULAR Y FORMACIN DE HETEROCARIONTES, QUE POSTERIORMENTE SON CULTIVADOS

tres clones de clulas hbridas, cada uno de los cuales conserva un nm ero reducido de crom osom as hum anos diferentes junto con toda la dotacin crom osm ica del ratn EL MEDIO SELECTIVO SOLO PERMITE PROLIFERAR A LOS HETEROCARIONTES, LOS CUALES SE CONVIERTEN EN CLULAS HBRIDAS QUE POSTERIORMENTE SERN CLONADAS

fibroblasto clula tum oral hum ano de ratn

heterocarionte

clula hbrida

Figura 4-3 3 Produccin de clulas hbridas. Clulas humanas se fusionan con clulas de ratn, producindose heterocariontes (cada uno de ellos conteniendo dos o ms ncleos) que posteriormente darn lugar a clulas hbridas (cada una de ellas con un nico ncleo fusionado). Estas clulas hbridas en particular resultan tiles para localizar genes humanos en los cromosomas, ya que la mayora de los cromosomas humanos se pierden rpidamente de manera aleatoria, con lo que quedan clones que conservan tan slo uno o unos cuantos genes. A menudo, las clulas hbridas producidas por fusin de otros tipos celulares conservan la mayora de sus cromosomas.

170

Captulo 4 : Cmo se estudian las clulas

Tabla 4-5 Algunos de los hitos en el desarrollo del cultivo de tejidos 1885 Roux demostr que las clulas embrionarias de pollo pueden mantenerse vivas en una solucin salina, fuera del cuerpo del animal. 1907 Harrison cultiv mdula espinal de anfibio en un cogulo linftico, demostrando as que los axones se producen como prolongaciones de clulas nerviosas. 1910 Rous indujo un tumor utilizando un extracto filtrado de clulas tumorales de pollo, que ms tarde se demostr que contenan un virus de RNA (virus del sarcoma de Rous). 1913 Carrel demostr que las clulas podan crecer en cultivo durante mucho tiempo, siempre que fueran alimentadas regularmente y bajo condiciones aspticas. 1948 Earle y colaboradores aislaron clulas de la lnea celular L y demostraron que en cultivo tisular forman clones de clulas. 1952 Gey y colaboradores establecieron una lnea continua de clulas derivada de carcinoma cervical humano, que ms tarde se convirti en la conocida lnea celular HeLa. 1954 Levi-Montalcini y colaboradores demostraron que el factor de crecimiento nervioso (NGF, de Nerve Growth Factor) estimula el crecimiento de los axones en cultivo. 1955 Eagle desarroll la primera investigacin sistemtica sobre los requerimientos nutricionales esenciales de las clulas en cultivo y encontr que las clulas animales se pueden propagar en una mezcla definida de pequeas molculas suplementada con una reducida proporcin de protenas sricas. 1956 Puck y colaboradores seleccionaron mutantes con requerimientos de crecimiento alterados a partir de clulas HeLa en cultivo. 1958 Temin y Rubin desarrollaron un mtodo cuantitativo para la infeccin de cultivos de clulas de pollo mediante el virus del sarcoma de Rous purificado. En la dcada siguiente Stoker, Dulbecco, Green y otros virlogos establecieron las caractersticas de sta y de otras transformaciones vricas. 1961 Hayflick y Moorhead demostraron que los fibroblastos humanos en cultivo mueren tras un nmero finito de divisiones. 1964 Littlefeld introdujo el medio HAT para el crecimiento selectivo de hbridos celulares somticos. Junto con la tcnica de la fusin celular, este medio hizo accesible la gentica de las clulas somticas. Kato y Takeuchi obtuvieron una planta completa de zanahoria a partir de una sola clula de raz de zanahoria mantenida en cultivo. 1965 Ham introdujo un medio definido, sin suero, capaz de permitir el crecimiento clonal de ciertas clulas de mamfero. Harris y Watkins produjeron los primeros heterocariontes de clulas de mamfero, mediante la fusin inducida vricamente de clulas humanas y de clulas de ratn. 1968 Augusti-Tocco y Sato adaptaron al cultivo clulas nerviosas tumorales de ratn (neuroblastoma) y aislaron clones que eran excitables elctricamente y producan prolongaciones nerviosas. En esta poca se aislaron otras clulas diferenciadas, entre ellas lneas celulares hepticas y de msculo esqueltico. 1975 Khler y Milstein produjeron las primeras lneas celulares de hibridomas que segregaban anticuerpos monoclonales. 1976 Sato y colaboradores publicaron el primero de una serie de informes, demostrando que para crecer en un medio sin suero, las lneas celulares diferentes requieren mezclas diferentes de hormonas y de factores de crecimiento. 1977 Wigler y Axel y colaboradores desarrollaron un eficiente mtodo para introducir genes humanos de copia nica en el interior de clulas cultivadas, adaptando los mtodos desarrollados inicialmente por Graham y van der Eb.

mas clulas hbridas tam bin se utilizan como fuente de DNA humano para pre parar libreras de DNA de cromosomas humanos. Ms adelante en este captulo aprenderemos de qu forma se han utilizado las clulas hbridas en la produc cin de anticuerpos monoclonales.

Aislamiento y crecimiento de clulas en cultivo

171

En la Tabla 4-5 se enumeran algunas de las etapas ms importantes del de sarrollo del cultivo en tejidos.

Resumen
Habitualmente los tejidos de organismos muy jvenes se pueden disociar en sus componentes celulares, a partir de los cuales pueden purificarse diferentes tipos ce lulares individuales, los cuales pueden utilizarse para su anlisis bioqumico o para establecer cultivos celulares. Muchas tipos de clulas animales y vegetales so breviven y proliferan en una placa de cultivo si se les suministra el medio de cultivo adecuado conteniendo nutrientes y factores de crecimiento especficos. Aunque la mayora de las clulas animales mueren despus de un nmero finito de divisiones, en los cultivos surgen espontneamente unas clulas variantes inmortales que pue den ser mantenidas indefinidamente como lneas celulares. Los clones derivados de una nica clula ancestral hacen posible aislar poblaciones uniformes de clulas mulantes con defectos en una sola protena. Pueden fusionarse dos tipos diferentes de clulas formndose heterocariontes (clulas con dos ncleos), que pueden utili zarse para estudiar las interacciones entre los componentes de las dos clulas origi nales. Con el tiempo los heterocariontes forman clulas hbridas (con un ncleo fu sionado), las cuales proporcionan un mtodo muy adecuado para localizar genes en los cromosomas.

Fraccionamiento de las clulas y anlisis de sus molculas20


Aunque los anlisis bioqumicos requieren la disgregacin de la delicada anato ma de la clula, se han desarrollado mtodos suaves de separacin que preser van la funcin de los diversos com ponentes celulares. De la misma forma que un tejido puede ser disgregado en sus diferentes tipos celulares vivos, tam bin la clula puede ser fraccionada en sus orgnulos y macromolculas funcionales. En esta seccin vamos a centrarnos en los mtodos que permiten la purificacin de orgnulos y de macromolculas. En el Captulo 7 se discuten las poderosas tcnicas del DNA recom binante, utilizadas para analizar genes y protenas.

cmara acorazada

m aterial en sedim entacin

Los orgnulos y las macrom olculas pueden separarse por ultracentrifugacin 21


Las clulas pueden disgregarse de varias maneras: pueden someterse a shock os mtico o a vibraciones ultrasnicas, pueden hacerse pasar a travs de un pequeo orificio o pueden molerse. Estos procedimientos rompen muchas de las membra nas de la clula (incluidas la membrana plasmtica y las membranas del retculo endoplasmtico) y los fragmentos se unen inmediatamente formando pequeas vesculas cerradas. Sin embargo, si estos procedimientos de disgregacin se apli can cuidadosamente, dejan fundamentalmente intactos diversos orgnulos como el ncleo, las mitocondrias, el complejo de Golgi, los lisosomas y los peroxisomas. As, la suspensin de clulas queda reducida a un espesa sopa (denominada homogenado o extracto) que contiene una gran diversidad de partculas unidas a membrana, cada una de un tamao, una carga y una densidad caractersticas. Si se ha escogido cuidadosamente el medio de homogeneizacin (mediante el siste ma de prueba y error para cada orgnulo), las diferentes partculas -incluyendo las vesculas derivadas del retculo endoplasmtico, llamadas microsomas- conservan la mayor parte de sus propiedades bioqumicas originales. A continuacin, se pueden separar los diferentes componentes de este homogenado. Esto nicam ente es posible gracias al desarrollo comercial, a princi pios de los aos 1940, de un instrumento conocido con el nombre de ultracentrfuga preparativa, en el que los preparados de clulas rotas se exponen a altas

refrigeracin

m otor

vaco

Figura 4 -34 La ultracentrfiiga preparativa. La muestra se coloca en unos tubos que quedan insertados en un anillo de orificios cilindricos de un rotor metlico. La rpida rotacin del rotor genera unas fuerzas centrfugas enormes, que provocan la sedimentacin de las partculas de la muestra. El vaco disminuye el rozamiento, con lo que el rotor no se calienta tanto y el sistema de refrigeracin puede m antener la muestra a 4C.

172

Captulo 4 : Cmo se estudian las clulas

velocidades de giro (Figura 4-34). Este tratamiento separa los componentes ce lulares en funcin de su tamao y su densidad: en general, las unidades mayores experimentan mayores fuerzas centrfugas y se desplazan por el tubo ms rpi damente. A una velocidad relativamente reducida sedimentan los com ponentes de tamao mayor, como los ncleos y las clulas enteras, formando un precipi tado (pellet) en el fondo del tubo de la centrfuga; a una velocidad algo superior se deposita un precipitado de mitocondrias, y a velocidades an ms altas y con perodos de centrifugacin ms prolongados, se pueden recoger primero las pequeas vesculas cerradas y luego los ribosomas (Figura 4-35). Todas estas fracciones son impuras pero se pueden eliminar muchos de sus contam i nantes resuspendiendo de nuevo los precipitados y repitiendo varias veces el procedimiento descrito de centrifugacin. El mtodo de centrifugacin constituye el primer paso de la mayora de fraccionamientos, pero slo separa los com ponentes que son muy diferentes en tamao. Se puede obtener un mayor grado de separacin colocando el homogenado como una estrecha banda en la parte superior de una solucin salina dilui da que llene el tubo de centrfuga. Cuando se centrifuga, los diversos com po nentes de la mezcla se desplazan a travs de la solucin salina como series de bandas distintas, cada una a diferente velocidad, en un proceso denominado ve locidad de sedimentacin (Figura 4-36). Para que el proceso sea efectivo, las bandas deben ser protegidas del mezclado por conveccin, lo cual sucede habi tualmente cuando una solucin densa (por ejemplo, una que contenga orgnulos) se halla en la parte superior de otra de menor densidad (la solucin salina). Esto se consigue rellenando el tubo de centrfuga con un gradiente de sacarosa preparado con un aparato especial de mezclado; el gradiente de densidad resul tante, con la zona ms densa en el fondo del tubo, consigue que cada una de las regiones de la solucin salina sea ms densa que cualquier solucin superior evitando as el mezclado por conveccin que distorsionara la separacin. Cuando el homogenado es sedimentado a travs de estos gradientes de den sidad, los diferentes com ponentes celulares se separan en distintas bandas que pueden ser recolectadas individualmente. La velocidad a la que sedimenta cada uno de los com ponentes depende fundamentalmente de su tamao y de su for ma, y suele expresarse como coeficiente de sedimentacin o valor s. Las ultracentrfugas actuales pueden alcanzar velocidades superiores a 80 000 rpm y produ cir fuerzas de ms de 500 000 veces la de la gravedad. A estas enormes fuerzas se pueden separar entre s en funcin de su tamao incluso las macromolculas pequeas como las molculas de tRNA y las enzimas sencillas. Rutinariamente se utilizan los coeficientes de sedimentacin de los complejos macromoleculares para determinar la masa total del complejo y, por tanto, el nmero de subunidades de cada tipo que presentan. La ultracentrfuga se utiliza tambin para separar los componentes celulares en funcin de su densidad de flotacin, independientemente de su tamao. En este caso, la muestra normalmente se hace sedimentar a travs de un gradiente discontinuo que contiene una concentracin muy elevada de sacarosa o de clo ruro de cesio. Cada com ponente celular empieza a descender por el gradiente com o en la Figura 4-36, hasta que llega a una zona en la que la densidad de la so lucin es igual a su propia densidad. En este lugar del tubo el com ponente flota y ya no puede desplazarse ms. Por consiguiente, en el tubo de la centrfuga se forman series de bandas distintas, siendo las bandas que contienen los com po nentes de mayor densidad de flotacin las que se hallan ms cerca del fondo del tubo de centrfuga. El mtodo, denominado equilibrio de sedimentacin, es su ficientem ente sensible para separar macromolculas que han incorporado is topos pesados, como el 13C o el 15N de las mismas macromolculas no marcadas. De hecho, el mtodo del cloruro de cesio fue desarrollado, en 1957, para separar el DNA marcado del no marcado producido despus de la exposicin de una po blacin de bacterias en crecimiento a precursores de nucletidos con 15 N; este experimento clsico proporcion la prueba directa de la replicacin semiconservativa del DNA.

hom ogenado celular

CENTRIFUGACION A VELOCIDAD BAJA


*

el precipitado contiene clulas SOBRENADANTE SOMETIDO A CENTRIFUGACIN A VELOCIDAD MEDIA

enteras, ncleos y citoesqueleto

el precipitado contiene m itocondrias, lisosom as y peroxisom as SOBRENADANTE SOMETIDO A CENTRIFUGACIN A VELOCIDAD ALTA

el precipitado contiene m icrosom as y pequeas vesculas v_y SOBRENADANTE SOMETIDO A CENTRIFUGACIN A VELOCIDAD MUY ALTA

el precipitado contiene ribosom as, virus y grandes m acrom olculas

Figura 4-35 Fraccionam iento celular por centrifugacin. Centrifugaciones repetidas a velocidades progresivamente mayores fraccionarn los extractos celulares en sus componentes. En general, cuanto menor sea el tamao del componente subcelular mayor ser la fuerza centrfuga necesaria para sedimentarlo. Los valores tpicos de las diversas etapas de centrifugacin mostradas en la figura son las siguientes: vel. baja: 1000 veces la gravedad durante 10 minutos vel. media: 20 000 veces la gravedad durante 20 minutos vel. alta: 80 000 veces la gravedad durante 1 hora vel. muy 150 000 veces la gravedad alta: durante 3 horas

Fraccionamiento de las clulas y anlisis de sus molculas

173

(A)
- muestra gradiente de sacarosa estabilizador

(B)

gradiente discontinuo de sacarosa (e.g., 20-70%)

CENTRIFUGACIN

com ponente de sedim entacin lenta com ponente de sedim entacin rpida FRACCIONAMIENTO com ponente de baja densidad

---- com ponente


de alta densidad

Los detalles moleculares de los procesos celulares complejos nicam ente se pueden descifrar en sistemas libres de clulas 22
Los estudios de orgnulos y de otros grandes com ponentes subcelulares obteni dos por ultracentrifugacin han constituido avances muy importante en la de term inacin de la junciones de los diferentes com ponentes de la clula. As por ejemplo, diferentes experimentos sobre mitocondrias y cloroplastos purificados por centrifugacin demostraron la funcin central de estos orgnulos en las in~ terconversiones energticas. Anlogamente, las vesculas formadas de nuevo a partir de fragmentos del retculo endoplasmtico liso y rugoso (microsomas) han sido separadas unas de otras y analizadas como modelos funcionales de es tos mismos com partim entos en las clulas intactas. Una extensin de esta apro ximacin hace posible estudiar otros procesos biolgicos libres de todas las complejas reacciones laterales que ocurren en la clula, y sin las constricciones de tener que m antener las clulas como un todo. Por ello, los extractos celulares fraccionados que mantienen su funcin biolgica (denominados sistemas libres de clulas) son ampliamente utilizados en biologa celular. Uno de los primeros xitos de este sistema de estudio fue la deduccin del mecanismo de sntesis proteica. El punto de partida lo constituy un extracto ce lular crudo que era capaz de traducir las molculas de RNA a protena. El fraccio namiento de este extracto dio lugar a ribosomas, tRNA y varias enzimas, que, en conjunto, constituyen la maquinaria de la sntesis proteica. Una vez se dispuso de los componentes individuales purificados, fue posible ponerlos o quitarlos uno a uno del medio de incubacin, consiguindose as definir el papel exacto de cada uno de estos componentes. Ms tarde se utiliz este mismo sistema de traduccin in vitro para descifrar el cdigo gentico, usando polirribosomas sintticos de se-

Figura 4-36 Comparacin entre los mtodos de velocidad de sedimentacin y equilibrio de sedimentacin. En velocidad de sedimentacin (A), la muestra se coloca sobre una solucin diluida de sacarosa y los componentes subcelulares sedimentan a diferentes velocidades de acuerdo con su tamao. Para estabilizar las bandas que sedimentan y evitar que se mezclen por fenmenos de conveccin originados por pequeas diferencias de temperatura o de concentracin de los solutos, el tubo contiene un gradiente continuo de sacarosa que aumenta de concentracin hacia el fondo del tubo (tpicamente desde 5% a 20% de sacarosa). Despus de la centrifugacin, los diferentes componentes pueden recogerse por separado; el sistema ms sencillo de hacerlo consiste en perforar el tubo de la centrfuga y recoger el medio gota a gota, tal como ilustra la figura. En el equilibrio de sedimentacin (B) cuando los componentes subcelulares se centrifugan en un gradiente, pueden desplazarse arriba y abajo hasta que alcanzan una zona en que su densidad est comprendida entre las densidades vecinas del gradiente. Aunque aqu se presenta un gradiente de sacarosa, para separacin de protenas y de cidos nucleicos se utilizan habitualmente gradientes de densidad preparados con cloruro de cesio. Las bandas finales, en el equilibrio, se pueden recoger como en (A).

174

Captulo 4 : Cmo se estudian las clulas

cuencia conocida como RNA mensajero (mRNA) para ser traducido. Hoy en da se utilizan diversos sistemas de traduccin in vitro para determinar cmo las pro tenas recin sintetizadas son clasificadas y dirigidas a diversos compartimentos intracelulares y tambin para identificar las protenas que son codificadas por pre paraciones purificadas de mRNA -u n paso importante en los mtodos de clonaje gnico. En la Tabla 4-6 se presentan algunos de los hitos del desarrollo de los m todos utilizados en el fraccionamiento de extractos celulares. Una gran cantidad de la informacin que hoy en da conocemos acerca de la biologa molecular de la clula, se ha descubierto estudiando sistemas libres de clulas. Para citar algunos de los muchos ejemplos, estudios de este tipo se han utilizado para analizar los detalles moleculares de la replicacin y la transcrip cin del DNA, de la maduracin por corte y empalme del RNA (splicing), de la contraccin muscular y del movimiento de partculas a lo largo de los microtbulos. Los sistemas libres de clulas se han utilizado en estudios de procesos tan complejos y altamente organizados como el ciclo de divisin celular, la separa cin de cromosomas sobre el huso mittico y los procesos de transporte vesicu lar implicados en los desplazamientos de las protenas desde el retculo endoplsmico, a travs del complejo de Golgi hasta la membrana plasmtica. El anlisis de un sistema libre de clulas supone la separacin completa final de to dos sus com ponentes macromoleculares individuales y en particular de todas sus protenas. Ahora consideraremos cmo se puede lograr esta separacin.

Tabla 4-6 Algunos de los principales acontecimientos del desarrollo de la ultracentrifuga y de la preparacin de extractos libres de clulas 1897 Buchner demostr que los extractos de levadura, libres de clulas, pueden fermentar los azcares produciendo dixido de carbono y etanol, con lo que se establecironlas bases de la enzimologa. 1926 Svedberg desarroll la primera ultracentrfuga analtica y la utiliz para estimar el peso molecular de la hemoglobina, que cifr en 68 000 daltons. 1935 Pickels y Beams introdujeron varias caractersticas nuevas en el diseo de la ultracentrfuga, que condujeron a su utilizacin como instrumento preparativo. 1938 Behrens emple la ultracentrifugacin diferencial para separar los ncleos del citoplasma de clulas hepticas, tcnica que luego desarrollaron Claude, Brachet, Hogeboon y otros durante los aos 1940 y principios de los 1950 para el fraccionamiento de orgnulos celulares. 1939 Hill demostr que los cloroplastos aislados, cuando se iluminaban, podan efectuar reacciones de fotosntesis. 1949 Szenz-Gyorgyi demostr que las miofibrillas aisladas de clulas de msculo esqueltico se contraen al aadirles ATP. En 1955 Hofmann-Berling desarroll un sistema libre de clulas similar a ste para estudiar el movimiento ciliar. 1951 Brakke utiliz la centrifugacin en gradiente de densidad en soluciones de sacarosa para purificar un virus vegetal. 1954 de Duve aisl lisosomas por centrifugacin y, ms tarde, peroxisomas. 1954 Zamecnik y colaboradores desarrollaron el primer sistema libre de clulas que realizaba sntesis proteica. A ello sigui una dcada de intensa actividad de investigacin, durante la cual fue dilucidado el cdigo gentico. 1957 Meselson, Stahly Vinograd desarrollaron la centrifugacin en gradiente de densidad en soluciones de cloruro de cesio para separar cidos nucleicos. 1975 Dobberstein y Blobel demostraron la translocacin de protenas a travs de membranas, en sistemas libres de clulas. 1976 Neher y Sakmann desarrollaron el registro de zona para medir la actividad de canales inicos aislados. 1983 Lohkay Masui produjeron extractos concentrados a partir de huevos que in vitro realizaban el ciclo celular completo. 1984 Rothman y colaboradores reconstituyeron in vitro el trfico de vesculas de Golgi utilizando un sistema libre de clulas.

Fraccionamiento de las clulas y anlisis de sus molculas

175

Las protenas pueden separarse mediante cromatografa 23


Uno de los mtodos de utilidad ms general para el fraccionamiento de las pro tenas es el de la crom atografa, tcnica desarrollada para separar pequeas molculas como azcares y aminocidos. Un tipo muy comn de cromatografa, todava muy utilizado actualmente para separar pequeas molculas, es la cro matografa de particin. Tpicamente, una gota de la muestra se aplica como una m ancha en una hoja de material absorbente, que puede ser papel (cromato grafa de papel) o una hoja de plstico o de cristal recubierta de una fina capa de un material absorbente inerte, com o celulosa o gel de slice (cromatografa en capa fina). A continuacin, se deja que una mezcla de disolventes, como por ejemplo el agua y un alcohol, impregne la hoja desde uno de sus extremos; a me dida que el lquido se va desplazando a travs de la hoja, va separando las mol culas de la muestra en funcin de su solubilidad en cada uno de los dos disol ventes. Los disolventes se escogen de forma que uno de ellos se adsorba con mayor intensidad en el material absorbente que el otro formando una capa de disolvente estacionaria en la superficie de la hoja. En cada regin de la hoja las molculas se equilibran entre el disolvente estacionario y el mvil: las que son ms solubles en el disolvente fuertemente adsorbido son relativamente retarda das porque consum en ms tiempo en la capa estacionaria, mientras que las que son ms solubles en el otro disolvente se mueven ms rpidamente. Despus de un cierto nmero de horas, la hoja se seca y se tie para localizar la situacin de las diferentes molculas (Figura 4-37). Las protenas se suelen fraccionar mediante la cromatografa en columna, en la que una mezcla de protenas en solucin se hace pasar a travs de una co-

Figura 4-37 Separacin de molculas pequeas mediante crom atografa sobre papel. Despus de aplicar la muestra en un extremo del papel (el origen) y de secarla, se permite que una solucin que contiene una mezcla de dos disolventes fluya lentam ente a lo largo del papel por capilaridad. Los diferentes com ponentes de la muestra se desplazan sobre el papel a velocidades distintas, en funcin de su solubilidad relativa en el solvente que es adsorbido preferentemente por el papel. El desarrollo de esta tcnica revolucion los anlisis bioqumicos durante los aos 1940.

solvente aplicado de form a aplicacin continua a la parte superior de la de la colum na desde un m uestra gran depsito de solvente

Figura 4-3 8 Separacin de molculas mediante crom atografa en columna. La muestra se aplica en la parte superior de una columna cilindrica de vidrio o de plstico, que contiene una matriz slida permeable, por ejemplo de celulosa, inmersa en un solvente. A continuacin se hace pasar lentamente a travs de la columna una gran cantidad de solvente, recogindolo en tubos separados a medida que sale de la parte inferior de la columna. Los diversos com ponentes de la muestra se desplazan a distintas velocidades a travs de la columna quedando as fraccionados en tubos distintos.

1^

tubo de ensayo tiem po

I
molculas fraccionadas eluidas y recogidas

176

Captulo 4 : Cmo se estudian las clulas

flujo de solvente 1 I
i + -# + + +

flujo de solvente i esfera cargada positivam ente molcula de carga negativa unida m olcula de carga positiva libre

flujo de solvente 1 I ! t esfera con un substrato unido covalentemente m olcula de enzima unida otras protenas pasan a travs de la m atriz

O *C
esferas porosas
*

\ a

+ #. - + + # + + + + v -

molcula pequea retardada m olcula grande no retardada


/ \

(A) CROMATOGRAFIA DE INTERCAMBIO INICO

(B) CROMATOGRAFIA DE FILTRACION EN GEL

(C) CROMATOGRAFA DE AFINIDAD

Figura 4-39 Tres tipos de matriz utilizados en crom atografa. En la cromatografa de intercambio inico (A) la matriz insoluble presenta cargas inicas que retardan las molculas de carga opuesta. Las matrices utilizadas habitualm ente para separar protenas son la dietilaminoetilcelulosa (DEAE-celulosa), de carga positiva, y la carboximetilcelulosa (CMcelulosa) y la fosfocelulosa, de carga negativa. La fuerza de unin entre las molculas disueltas y la matriz de intercambio inico depende de la fuerza inica y del pH de la solucin eluyente que atraviesa la columna, parmetros que pueden variarse de una manera sistemtica (como en la Figura 4-40) para conseguir una separacin ms efectiva. En la cromatografa de filtracin en gel (B) la matriz es inerte pero porosa. Las molculas suficientem ente pequeas para penetrar en el interior de la matriz se retrasan y viajan ms lentamente a travs de la columna. En el com ercio existen bolitas de polisacridos con puentes cruzados (dextrano o agarosa) en una amplia gama de tamaos de poro adecuadas para el fraccionamiento de molculas de diversos pesos moleculares, desde menos de 500 hasta ms de 5 x 106 daltons. La cromatografa de afinidad (C) utiliza una matriz insoluble que est unida covalentemente a un ligando especfico, com o por ejemplo una molcula de anticuerpo o un substrato enzimtico, que se unir a una protena determinada de la muestra. Las molculas de enzima que se han unido a substratos inmovilizados en columnas de este tipo se pueden eluir con una solucin concentrada del substrato en forma libre, mientras que molculas que se han unido a anticuerpos inmovilizados pueden eluirse disociando el com plejo antgeno-anticuerpo con soluciones concentradas de sales o con soluciones de pH alto o bajo. A menudo se consiguen purificaciones elevadas con un solo paso a travs de estas columnas.

lumna que contiene una matriz slida porosa. Las diferentes protenas de la mez cla se van retrasando ms o menos a causa de su interaccin con la matriz de la columna y pueden recogerse por separado en su estado funcional nativo a medi da que fluyen por el extremo inferior de la columna (Figura 4-38). En funcin del tipo de matriz que se utilice, las protenas se pueden separar segn su carga (cro matografa de intercambio inico), su hidrofobicidad (cromatografa hidrofbica), su tamao (cromatografa de filtracin), o su capacidad para unirse a deter minados grupos qumicos (cromatografa de afinidad). Actualmente se comercializan un gran nmero de tipos diferentes de matriz para cromatografa (Figura 4-39). Las columnas de intercambio inico estn lle nas de pequeas bolitas que contienen cargas positivas o negativas, de modo que las protenas se separan en funcin de la disposicin de cargas de su super ficie. Las columnas hidrofbicas estn llenas de unas bolitas con cadenas latera les hidrofbicas que sobresalen de ellas, de modo que las protenas que tengan regiones hidrofbicas al descubierto quedan retardadas en su trnsito por la co lumna. Las columnas de filtracin en gel, que separan protenas en funcin de su tamao, contienen diminutas bolitas porosas: a medida que van descendiendo por la columna, las molculas suficientemente pequeas para penetrar en los poros pasan sucesivamente por el interior de estas esferas, mientras que las m o lculas ms grandes permanecen en la solucin fluyendo entre las esferas, y por lo tanto, eluyen ms rpidamente a travs de la columna y salen primero. Ade ms de permitir la separacin de las molculas, la cromatografa de filtracin en gel constituye un buen sistema para determinar el tamao de las molculas. Este tipo de cromatografa en columna no produce fracciones altamente pu rificadas si se parte de una mezcla compleja de protenas: un nico paso a travs de una columna suele incrementar la proporcin en la mezcla de una protena determinada en no ms de veinte veces. Puesto que la mayora de las protenas

Fraccionamiento de las clulas y anlisis de sus molculas

177

(A) CROMATOGRAFA DE INTERCAMBIO INICO

nm ero de fracciones 1 -------1 estas fracciones se recogen, se mezclan y se aplican a la colum na siguiente (B) CROMATOGRAFA DE FILTRACIN EN GEL

nm ero de fracciones 1 -------- 1 estas fracciones se recogen, se mezclan y se aplican a la colum na siguiente (C) CROMATOGRAFA DE AFINIDAD protena solucin de elucin aplicada a la colum na actividad

Figura 4 -4 0 Purificacin de protenas por crom atografa. Resultados tpicos que se obtienen cuando se utilizan sucesivamente tres pasos cromatogrficos diferentes para purificar una protena. En este ejemplo se fraccion un extracto completo hacindolo pasar primero a travs de una resina de intercambio inico empaquetada en una columna (A). La columna se lav y las protenas se eluyeron haciendo pasar desde la parte superior de la columna una solucin de sal a una concentracin progresivamente mayor. Las protenas con menor afinidad por la resina de intercambio inico pasaron directamente a travs de la columna y fueron recogidas en las primeras fracciones eluidas que salieron por la parte inferior de la columna. Las restantes protenas fueron eluidas de manera secuencial de acuerdo con su afinidad por la resina -las unidas ms intensam ente necesitaron una concentracin de sal ms elevada para ser eluidas. La protena de inters sali en forma de un pequeo pico y se detect por su actividad enzimtica. Las fracciones con actividad fueron recogidas y aplicadas a una segunda columna de filtracin en gel (B). La posicin de elucin de la protena todava impura fue determinada de nuevo por su actividad enzimtica, y las fracciones activas fueron recogidas y purificadas hasta homogeneidad mediante una colum na de afinidad (C) que contena inmovilizado un substrato de la enzima.

nm ero de fracciones se recogen y mezclan estas fracciones, que ahora contienen la protena altamente purificada
representan individualmente m enos del 1/1000 de la protena celular total, para conseguir purificarlas suele ser necesario utilizar sucesivamente varios tipos di ferentes de columnas para conseguir la pureza suficiente (Figura 4-40). Un pro cedimiento ms eficiente, conocido como crom atografa de afinidad, utiliza in teracciones de enlace, importantes desde el punto de vista biolgico, que se producen en la superficie de las protenas. Por ejemplo, si un substrato enzim tico se acopla covalentemente a una matriz inerte, como pueden ser pequeas esferas de un polisacrido, la enzima especfica de este substrato fijado a la co lumna ser retenida en la matriz y podr ser eluida (lavada) en forma casi pura. De forma similar, puede inmovilizarse un DNA corto de secuencia diseada es pecficamente y utilizarse para purificar protenas que se unan al DNA y que re conozcan esta secuencia de nucletidos en los cromosomas (Figura 9-23). Alter nativamente, se pueden acoplar anticuerpos especficos a una matriz para purificar molculas proteicas reconocidas por los anticuerpos. Debido a la ele vada especificidad de estas columnas de afinidad, algunas veces se pueden con seguir, en un solo paso, purificaciones del orden de 1000 a 10 000 veces. Captulo 4 : Cmo se estudian las clulas

178

La resolucin de las columnas convencionales de cromatografa est limita da por la falta de homogeneidad de las matrices (como la celulosa), la cual gene ra un flujo desigual de los disolventes a travs de la columna. Se han desarrolla do nuevas resinas cromatogrficas (la mayora basadas en compuestos de slice) en forma de diminutas esferas (de 3 a 10 im de dimetro) que pueden ser empa quetadas mediante un aparato especial formando un lecho uniforme en la co lumna. Con estas columnas de crom atografa lquida de alta resolucin (HPLC, de High Performance Liquid Chromatography) se alcanza un alto grado de sepa racin. Como las columnas de HPLC contienen partculas empaquetadas de for ma muy compacta, la velocidad de flujo a travs de ellas es prcticam ente nula a menos que se apliquen altas presiones. Por esta razn, normalmente estas m a trices se empaquetan en cilindros de acero y requieren un sistema sofisticado de bombas y vlvulas para forzar a fluir el disolvente a travs de la columna a la pre sin suficiente para producir un flujo deseado de aproximadamente un volumen de columna por minuto. En la cromatografa en columna convencional, la velo cidad de flujo debe ser lenta (a menudo de aproximadamente un volumen de columna por hora) para dar tiempo a los solutos a que se fraccionen en equili brio con el interior de las grandes partculas de la matriz. En la HPLC los solutos se equilibran rpidamente con el interior de las diminutas esferas, de manera que solutos con diferentes afinidades por la matriz son separados entre s de for ma muy eficiente, siempre a rpida velocidad de flujo. Esto permite que muchos fraccionamientos puedan realizarse en cuestin de minutos, mientras que para obtener una separacin pobre en la cromatografa convencional se requieren horas. Por consiguiente, la HPLC se ha convertido en el mtodo escogido para muchas separaciones de protenas y de pequeas molculas.

CH3
c h c h c h

2 2 2 2 2 2 2 2 2

1
c h c h c h

1
c h

1
c h c h

1 CH2 1 c h 2 1

OH
c h

o j o = s1= o
O SDS N a

7 2

|
c h

SH

p-mercaptoetanol

Mediante electroforesis en gel de poliacrilamida con SDS, pueden determ inarse el tam ao y la composicin de subunidades de una protena 24
Las protenas suelen tener una carga neta positiva o negativa, que refleja la de los aminocidos cargados que contienen. Si se aplica un campo elctrico a una solucin que contenga una molcula proteica, la protena migrar a una veloci dad que depender de su carga neta, de su tamao y de su forma. Esta tcnica, conocida como electroforesis, se utiliz inicialmente para separar mezclas de protenas tanto libres en soluciones acuosas como incluidas en una matriz sli da porosa tal como el almidn. A mediados de los aos 1960 se desarroll una versin modificada de este mtodo -conocid a como electroforesis en gel de poliacrilamida con SDS (o SDS-PAGE, de SDS PolyAcrilamide-Gel Electrophoresis), que ha revolucionado los sistemas de anlisis rutinarios de las protenas. Como matriz inerte a travs de la que migran las protenas, se utiliza un gel de poliacrilamida con numerosos puentes cruzados. Normalmente el gel se prepara inmediatamente antes de uti lizarse mediante la polimerizacin a partir de los monmeros; el tamao del poro del gel puede ajustarse de forma que sea el adecuado para retrasar la m i gracin de las molculas proteicas de inters. Las protenas no se colocan en una solucin acuosa simple, sino en una solucin que contiene un potente detergen te de carga negativa, el dodecil sulfato sdico, o SDS (de Sodium Dodecyl Sulfate) (Figura 4-41). Como este detergente se une a las regiones hidrofbicas de las molculas proteicas, haciendo que se desplieguen las cadenas polipeptdicas, las diferentes molculas proteicas quedan liberadas de sus asociaciones con otras molculas proteicas o lipdicas y se disuelven libremente en la solucin del detergente. Adems, se suele aadir un agente reductor como el mercaptoetanol (Figura 4-41) con objeto de romper los enlaces S-S que pudieran existir en las protenas, de forma que puedan analizarse separadamente todos los polipptidos constitutivos de las molculas que tengan varias subunidades. Qu sucede cuando una mezcla de protenas solubilizadas con SDS se so mete a electroforesis a travs de una lmina de gel de poliacrilamida? Cada mo-

F ig u ra4-41 El detergente dodecil sulfato sdico (SDS) y el agente reductor [-m ercaptoetanol. Estos dos reactivos qumicos se utilizan para solubilizar protenas para electroforesis en gel de poliacrilamida con SDS. El SDS se presenta aqu en su forma ionizada.

Fraccionamiento de las clulas y anlisis de sus molculas

179

(A)
ctodo
O

m uestra cargada en el gel m ediante una pipeta caja de plstico

(B)

protena con dos subunidades, A y B, unidas entre s mediante un enlace disulfuro

protena de una sola subunidad

CALENTAMIENTO CON SDS Y MERCAPTOETANOL @ nodo

tam pon
Figura 4 -42 Electroforesis en gel de poliacrilamida con SDS (SDS-PAGE). (A) Aparato. (B) Las distintas cadenas polipeptdicas forman un com plejo con las molculas cargadas negativamente de dodecil sulfato sdico (SDS) y, entonces, migran en forma de com plejo protena-SDS cargado negativamente, a travs de un gel poroso de poliacrilamida. Puesto que la velocidad de migracin en estas condiciones es mayor cuanto menor sea el polipptido, esta tcnica puede utilizarse para determinar de una forma aproximada el peso molecular de una cadena polipeptdica, as como la com posicin de subunidades de una protena. Sin embargo, si la protena contiene una gran cantidad de carbohidratos, se desplazar de forma anmala por el gel, de forma que su peso molecular aparente estimado por la SDS-PAGE ser errneo.

ir

lm ina de gel de poliacrilam ida

lcula de protena se une a una gran cantidad de molculas del detergente, car gadas negativamente, que anulan la carga intrnseca de la protena y hacen que cuando se aplica un voltaje la pro tena migre hacia el electrodo positivo. Las protenas del mismo tamao tienden a comportarse de forma idntica ya que (1) su estructura nativa est com pletam ente desplegada por el SDS, por lo que presentan la misma forma, y (2) unen la misma cantidad de SDS y por tanto tie nen la misma cantidad de carga negativa. Las protenas grandes, con mayor car ga, estn sujetas a grandes fuerzas elctricas pero tambin a mayores resisten cias. En solucin libre, ambos efectos podran contrarrestarse, pero en las redes del gel de poliacrilamida, que acta como un filtro molecular, las grandes prote nas son retardadas mucho ms severamente que las pequeas. En consecuen cia, una mezcla com pleja de protenas es fraccionada en series de bandas protei cas discretas, que se hallan ordenadas en funcin de su peso molecular (Figura 4-42). Las protenas mayoritarias se detectan fcilmente tiiendo el gel con un colorante como el azul de Coomassie, mientras que las protenas minoritarias se pueden visualizar en los geles tratados con una sal de plata (pudindose detectar en cada banda una cantidad tan pequea com o 10 ng de protena). La electroforesis en gel de poliacrilamida con SDS es un procedimiento ms poderoso que cualquier otro mtodo anterior de anlisis de protenas, principal mente debido a que puede utilizarse para separar todos los tipos de protenas, incluyendo las que sean insolubles en agua. Pueden resolverse protenas de membrana, protenas com ponentes del citoesqueleto y protenas que forman parte de grandes agregados macromoleculares. Debido a que el mtodo separa los polipptidos en funcin de su tamao, tam bin proporciona informacin so bre el peso molecular y la com posicin de subunidades de cualquier complejo

180

Captulo 4 : Cmo se estudian las clulas

Figura 4 -43 Anlisis de muestras proteicas por electroforesis en gel de poliacrilamida con SDS. La fotografa muestra un gel que se ha utilizado para detectar las protenas presentes en los sucesivos estadios de la purificacin de una enzima. El carril izquierdo (carril 1) contiene la mezcla com pleja de protenas en el extracto celular de partida, y cada uno de los carriles sucesivos analizan las protenas obtenidas despus de un fraccionamiento cromatogrfico de la muestra de protenas analizada en el carril anterior (vase Figura 4-40). En cada carril se carg la misma cantidad de protena (10 jig). Normalmente, cada pro tena aparece como una fina banda teida; sin embargo, las bandas se ensanchan cuando contienen demasiada protena. (Por cortesa de Tim Formosa.)

poso

. 100 000

m olecular

_ S O000

proteico. En la Figura 4-43 se presenta una fotografa de un gel utilizado para analizar cada una de las sucesivas etapas de la purificacin de una protena.

Mediante electroforesis tridimensional sobre gel de poliacrilamida, se pueden resolver ms de 1000 protenas sobre un mismo gel25
Dado que en un cromatograma las bandas muy prximas tienden a superponer se, cualquier mtodo unidimensional de separacin, como la electroforesis en gel de poliacrilamida con SDS o la cromatografa, slo pueden resolver un n mero relativamente reducido de protenas (por lo general menos de 50). Por el contrario, la electroforesis tridimensional sobre gel, que com bina dos procedi mientos diferentes de separacin, puede ser utilizada para resolver ms de 1000 protenas diferentes, en forma de un mapa proteico bidimensional. En el primer paso, las protenas son separadas en funcin de su carga. La muestra se disuelve en un volumen reducido de una solucin que contenga un de tergente no inico (no cargado) y un reactivo desnaturalizante como la urea o el mercaptoetanol. Esta solucin disuelve, desnaturaliza y disocia todas las cadenas polipeptdicas sin alterar su carga intrnseca. Luego, las cadenas polipeptdicas son fraccionadas mediante un procedimiento denominado enfoque isoelctrico o isoelectroenfoque, que se basa en el hecho de que la carga neta de una molcula proteica varia con el pH de la solucin. Para cada protena existe un pH caracters tico, denominado punto isoelctrico, al que la protena no presenta carga neta y, por lo tanto, no migrar en un campo elctrico. En el isoelectroenfoque las prote nas son sometidas a electroforesis en un tubo estrecho de gel de poliacrilamida en el que se ha establecido un gradiente de pH mediante unas mezclas de amortigua dores especiales. Cada protena se desplaza hasta la zona de gradiente que presen ta un pH igual a su punto isoelctrico, y all permanece inmvil (Figura 4-44). sta es la primera dimensin de la electroforesis bidimensional sobre gel. En el segundo paso, el estrecho gel que contiene las protenas separadas se somete otra vez a electroforesis, pero en una direccin perpendicular a la utiliza da en el primer paso. Esta vez se aade SDS, y las protenas son separadas en

_ 15 000

i9
10

en el p u n to is o e l c tric o la p ro te n a ca re ce de c a rg a n e ta , p o r lo q u e d e ja de d e s p la z a rs e en el c a m p o e l c tric o ; para la p ro te n a d e la ilu s tra c i n el pH is o e l c tric o es 6,5

Figura 4 -4 4 Separacin de molculas proteicas por isoelectroenfoque. A pH bajo (elevada concentracin de H+ ) los grupos cido carboxilo de las protenas tienen tendencia a quedar sin carga (-COOH) y los grupos nitrogenados bsicos, a quedar cargados (por ejemplo, -N H 3+ ) confiriendo a la mayora de las protenas una carga neta positiva. A un pH elevado, los grupos cido carboxilo estn cargados negativamente (-COO-) y los grupos bsicos tienden a estar sin carga (por ejemplo, -N H 2), confiriendo a la mayora de las protenas una carga neta negativa. A su pH isoelctrico una protena carece de carga neta debido a que las cargas positivas y negativas se anulan. As, cuando un tubo que contiene un determinado gradiente de pH se somete a un campo elctrico intenso, cada tipo de protena migra hasta formar una banda bien delimitada en su pH isoelctrico, como se muestra en la ilustracin.

Fraccionamiento de las clulas y anlisis de sus molculas

181

bsico

----------

gradiente estable de pH

cido

Figura 4-45 Electroforesis bidimensional sobre gel de poliacrilamida. En este gel se separan todas las protenas de una bacteria E. coli ; cada mancha corresponde a una cadena polipeptdica diferente. Las protenas fueron separadas primero de acuerdo con sus puntos isoelctricos mediante isoelectroenfoque, de izquierda a derecha. Despus fueron fraccionadas de nuevo segn sus pesos moleculares mediante electroforesis en presencia de SDS, de arriba a abajo. Obsrvese que las distintas protenas se hallan presentes en cantidades muy diferentes. La bacteria fue alimentada con una mezcla de aminocidos marcados con radioistopos, de manera que todas sus protenas resultaron radiactivas y pudieron fcilmente detectarse mediante autorradiografa (vase pg. 191). (Por cortesa de Patrick O'Farrell.) Figura 4 -46 Transferencia de tipo Western (Western blotting) o immunoblotting. Todas las protenas de clulas del tabaco en divisin mantenidas en cultivo se separaron primero mediante electroforesis bidimensional sobre gel de poliacrilamida, como se muestra en la Figura 4-45, y sus posiciones se revelaron mediante una tincin sensible a las protenas (A). Las protenas separadas en un gel idntico al anterior se transfirieron a un papel de nitrocelulosa, el cual se incub con un anticuerpo que reconoce las protenas que durante la mitosis resultan fosforiladas en residuos de treonina. Se revel la posicin de la docena de protenas de este tipo que son reconocidas por este anticuerpo, mediante un segundo anticuerpo unido a una enzima (B). (De J A Traas, A.F. Bevan, J.H. Doonan, J. Cordewener y P J . Shaw. Plant Journal 2:723-732,1992, con permiso de Blackwell Scientific Publ.)

funcin de su tamao, como en el caso de la SDS-PAGE de una dimensin: el es trecho gel original se empapa en SDS y se sita en un borde de una lmina de gel de poliacrilamida-SDS, a travs del cual cada cadena polipeptidica migra for mando una m ancha discreta. sta es la segunda dimensin de la electroforesis bidimensional sobre gel de poliacrilamida. Las nicas protenas que no se resol veran seran las que tuvieran un tamao idntico y un punto isoelctrico idnti co, lo cual es relativamente poco frecuente. Por este sistema pueden detectarse sobre el gel incluso cantidades traza de cada una de las cadenas polipeptdicas, mediante diversos procedimientos de tincin -o por medio de autorradiografa si la muestra estaba marcada con un radioistopo. En un mismo gel bidimensio nal se pueden separar hasta 2000 cadenas polipeptdicas -lo cual constituye la mayor parte de las protenas de una bacteria- (Figura 4-45). Este sistema tiene un poder de resolucin tan elevado que permite diferenciar fcilmente dos pro tenas idnticas entre s que solamente se diferencian en un solo aminocido cargado. Tras su resolucin tanto en geles unidimensionales com o bidimensionales, una determinada protena puede identificarse exponiendo todas las protenas presentes a un anticuerpo especfico que ha sido acoplado a un istopo radiacti vo, a una enzima fcilmente detectable o a un colorante fluorescente. Por conve niencia, normalmente esto se realiza despus de que todas las protenas presen tes en el gel se han transferido (mediante blotting) a una lmina de papel de nitrocelulosa, com o describiremos ms adelante para los cidos nucleicos (va se Figura 7-13). Este mtodo de deteccin de protenas se denomina transferen cia de tipo Western (Western blotting) (Figura 4-46).

182

Captulo 4 : Cmo se estudian las clulas

T abla 4 -7 H itos en el d esarrollo de la cro m ato g rafa y de la electroforesis y de su ap licacin a las m olculas biolgicas

1833 F arad ay describi las leyes fundamentales sobre el paso de la electricidad a travs de soluciones inicas. 1850 R unge separ compuestos qumicos inorgnicos en funcin de su adsorcin diferencial sobre el papel, tcnica precursora de las posteriores separaciones cromatogrficas. 1906 Tsw ett invent la cromatografa en columna, pasando extractos de petrleo de hojas de plantas a travs de columnas de greda en polvo. 1933 Tiselius introdujo la electoforesis para separar protenas en solucin. 1942 M artin y Synge desarrollaron la cromatografa de particin, que dos aos ms tarde condujo a la cromatografa en papel. 1946 Stein y M oore determinaron por primera vez la composicin de aminocidos de una protena utilizando inicialmente una columna cromatogrfica de almidn y desarrollando posteriormente la cromatografa sobre resinas intercambiadoras de iones. 1955 Sm ithies utiliz geles preparados con almidn para separar las protenas sricas mediante electroforesis. S anger complet el anlisis de la secuencia de aminocidos de la insulina bovina, que fue la primera pro tena que se secuenci. 1956 In gram produjo las primeras huellas dactilares de protenas, demostrando que la diferencia entre la hemoglobina de la anemia falciforme y la hemoglobina normal radica en la variacin de un solo aminocido. 1959 R aym ond introdujo los geles de poliacrilamida, mejores que los de almidn, para separar protenas por electroforesis; en los aos siguientes, O m stein y Davis desarrollaron mejores sistemas de amortiguadores que permitieron la separacin a elevada resolucin. 1966 Maizel introdujo el uso del dodecil sulfato sdico (SDS) para mejorar la electroforesis en gel de poliacrilamida de las protenas. 1975 OFarrell ide el sistema bidimensional sobre gel para analizar mezclas de protenas; la electroforesis en gel de poliacrilamida con SDS se combin con la separacin segn el punto isoelctrico.

protena nativa

LA INCUBACIN CON TRIPSINA GENERA UNA MEZCLA DE PPTIDOS

En la Tabla 4-7 se presentan algunos hitos en el desarrollo de la cromatogra fa y la electroforesis.

LA CROMATOGRAFA Y LA ELECTROFORESIS PRODUCEN UN MAPA DE DOS DIMENSIONES, O "HUELLA DACTILAR", DIAGNSTICO DE LA PROTEINA

La hidrlisis selectiva de una protena genera un conjunto caracterstico de fragmentos peptdicos 26


Aunque el peso molecular y el punto isoelctrico son rasgos caractersticos de una protena, la identificacin inequvoca de una protena se basa, en ltimo trmino, en la determinacin de su secuencia de aminocidos. La primera fase de este proceso, que consiste en la rotura de la protena en fragmentos ms pe queos, puede proporcionar por s misma mucha informacin til que ayude a caracterizar la molcula. Disponemos de enzimas proteolticas y de reactivos qumicos que rompen las protenas entre determinados residuos de am inoci dos (Tabla 4-8). La enzima tripsina, por ejemplo, corta por el lado carboxilo de los residuos de Usina o de arginina, mientras que el compuesto qumico bromu ro de ciangeno corta los enlaces peptdicos prximos a los residuos de metionina. Puesto que estas enzimas y compuestos qumicos actan en un nmero rela tivamente reducido de lugares de una protena, tienden a producir un nmero relativamente pequeo de pptidos, que son bastante largos. Si una mezcla de pptidos como sta se separa mediante cromatografa o electroforesis, el patrn resultante, o m apa peptdico, tiene un valor de diagnstico de la protena a par tir de la cual fueron generados los pptidos, y a veces recibe el nombre de hue lla dactilar de la protena (Figura 4-47). La determinacin de las huellas dactilares de las protenas fue desarrolla da en 1956 como un sistema para comparar la hemoglobina normal con la forma

------- crom atografa


Figura 4 -47 Confeccin de un m apa peptdico, o huella dactilar, de una protena. En este caso, la protena fue digerida con tripsina, generndose una mezcla de numerosos fragmentos polipeptdicos pequeos diferentes, que luego se fraccionaron en dos dimensiones mediante electroforesis y cromatografa de particin. El patrn de manchas obtenido tiene valor diagnstico para la protena analizada.

Fraccionamiento de las clulas y anlisis de sus molculas

183

T abla 4 -8 A lgunos de los reactiv o s utilizados n o rm alm en te p a ra ro m p e r los en laces p eptfdicos de las p roten as A m inocido 1 A m inocido 2

Enzima
Tripsina Quimotripsina Proteasa V8 Lys o Arg Phe, Trp o Tyr Glu Met cualquiera cualquiera cualquiera cualquiera cualquiera Cys

Compuesto qumico
Bromuro de ciangeno 2-Nitro-5-tiocianobenzoato

Se indica la especificidad por los aminocidos de ambos lados del enlace que se rompe. El gru po carboxilo del aminocido 1 se libera por la rotura; este aminocido queda a la izquierda del enlace peptdico tal como se escribe normalmente (vase Panel 2-5, pgs. 58-59).

mutante de la protena encontrada en pacientes que sufren de anemia falciforme. Se encontr un solo pptido diferente entre ambas formas de hemoglobina, diferencia que ms tarde se atribuy a un solo aminocido cargado, demostrn dose por primera vez que una mutacin puede cambiar un solo aminocido de una protena.

Mediante m quinas automatizadas pueden analizarse secuencias cortas de am inocidos 27


Cuando una protena ha sido fragmentada en pequeos pptidos, el siguiente paso lgico del anlisis consiste en determinar la secuencia de aminocidos de cada fragmento peptdico aislado. Esto se realiza mediante una serie repetida de reacciones qumicas, proceso ideado originalmente en 1967. Primeramente el pptido se expone a un compuesto qumico que nicamente forma un enlace covalente con el grupo amino libre del extremo amino terminal del pptido. Luego, este compuesto qumico es activado mediante su exposicin a un cido dbil, con lo que se rompe especficam ente el enlace peptdico que une el ami nocido amino terminal a la cadena polipeptdica; seguidamente el aminocido que se ha separado se identifica utilizando mtodos cromatogrficos. A conti nuacin, el pptido restante, que tiene un aminocido menos, se somete a la misma secuencia de reacciones, y as sucesivamente hasta que todos los am ino cidos del pptido hayan sido determinados. La naturaleza reiterativa de estas reacciones conduce por s misma a la auto matizacin; existen mquinas comerciales, denominadas s e c u e n c ia d o re s de a m in o c id o s , que permiten la determinacin automtica de la secuencia de aminocidos de fragmentos peptdicos. El paso final del proceso consiste en co locar las secuencias de aminocidos de los diferentes fragmentos peptdicos en el orden en que se presentan en la cadena peptdica intacta. Tradicionalmente esto se realiza comparando y superponiendo las secuencias de diferentes grupos de fragmentos peptdicos obtenidos mediante fraccionamiento de la misma protena utilizando diferentes enzimas proteolticas. Los adelantos tecnolgicos han aumentado marcadamente la velocidad y la sensibilidad de la determinacin de la secuencia de aminocidos de protenas, permitiendo el anlisis de muestras diminutas; en una sola noche y a partir de pocos microgramos de protena -la cantidad disponible a partir de una nica banda en un gel de poliacrilam ida- se puede obtener la secuencia de varias do cenas de aminocidos del extremo amino terminal de un pptido. Este procedi miento ha resultado importante para caracterizar muchas protenas celulares minoritarias, com o los receptores para las hormonas esteroideas y polipeptdi cas. Frecuentem ente la determinacin de tan slo 20 aminocidos de la secuen

184

Captulo 4 : Cmo se estudian las clulas

cia de una protena es suficiente para lograr disear una sonda de DNA que per mita clonar su gen (vase Figura 7-27). Una vez se ha aislado el gen, el resto de la secuencia de aminocidos de la protena se puede deducir en referencia al cdi go gentico. sta es una gran ventaja porque, incluso con automatizacin, la de terminacin directa de la secuencia completa de una protena resulta ser una ta rea difcil. Una protena de 100 residuos puede ser secuenciada en un mes de trabajo intenso, pero la dificultad se increm enta extraordinariamente tanto con la longitud de la cadena polipeptdica como con las particularidades qumicas de los fragmentos peptdicos individuales que impiden que el proceso sea ruti nario. Dado que la secuenciacin del DNA puede hacerse de una forma ms r pida y sencilla (vase Capitulo 7), generalmente las secuencias de la mayora de las protenas se determinan, en la actualidad, a partir de la secuencia de nucletidos de su gen.

La difraccin de rayos X por cristales de protena puede revelar la estructura exacta de una protena 28
A partir de la secuencia de aminocidos de una protena pueden a menudo pre decirse los elementos de la estructura secundaria de la protena, com o las hli ces a que atraviesan la membrana, as como el parecido de la protena con otras protenas conocidas. Sin embargo por ahora no es posible deducir de forma se gura el plegamiento tridimensional de la protena a partir de su secuencia de aminocidos, y sin conocer la estructura detallada no es posible comprender las bases moleculares de su funcin. La principal tcnica que se ha utilizado para determinar la estructura tridimensional de las molculas, incluidas las protenas a nivel atmico, es la cristalografa de rayos X. Los rayos X, como la luz, son una forma de radiacin electromagntica, pero de una longitud de onda mucho menor, tpicamente de alrededor de 0,1 nm (el dimetro de un tomo de hidrgeno). Si se dirige un haz estrecho y paralelo de rayos X a una muestra de una protena pura, la mayora de los rayos X pasarn a su travs. Sin embargo una pequea fraccin de ellos sern dispersados por los tomos de la muestra. Si la muestra es un cristal bien ordenado, los haces dis persados se reforzarn unos a otros en ciertos puntos (vase Figura 4-2) y apare cern como m anchas de difraccin cuando los rayos X sean recogidos sobre un detector (Figura 4-48). La posicin e intensidad de cada m ancha en el patrn de difraccin de ra yos X contiene informacin sobre las posiciones de los tomos en el cristal que intentamos deducir. La deduccin de la estructura tridimensional de una gran molcula a partir del patrn de difraccin de su cristal es una tarea compleja, y no se consigui para una molcula de protena hasta 1960. Recientem ente los anlisis de difraccin de rayos X se han automatizado cada vez ms, y ahora el proceso ms lento es el de la produccin de cristales proteicos adecuados. Ello requiere grandes cantidades de una protena muy pura y a menudo, supone aos de tanteo en la bsqueda de las condiciones de cristalizacin adecuadas. Todava hay muchas protenas, especialmente protenas de membrana, que han resistido todos los intentos de cristalizacin. El producto inmediato de un anlisis de un patrn de difraccin es un com plejo mapa tridimensional de densidades electrnicas. Interpretar este mapa re sulta una tarea complicada, y requiere la secuencia de aminocidos de la prote na. Fundamentalmente mediante prueba y error se consigue correlacionar la secuencia y el mapa de densidades electrnicas mediante un ordenador, inten tando conseguir el m ejor resultado. La fiabilidad del modelo atmico final de pende de la resolucin de los datos cristalogrficos iniciales: una resolucin de 0,5 nm puede producir un mapa de baja resolucin del esqueleto polipeptdico, mientras que una resolucin de 0,15 nm permite situar todos los tomos (excep to los de hidrgeno) en la molcula. A menudo, un modelo atmico completo resulta demasiado complejo para ser observado directamente, pero a partir de l se pueden derivar versiones simplificadas que muestren las caractersticas es-

Fraccionamiento de las clulas y anlisis de sus molculas

185

(A)

Figura 4 -48 Cristalografa de rayos X. (A) Cristal proteico de ribulosa bisfosfato carboxilasa, una enzima que juega un papel crucial en la fijacin de C 0 2 durante la fotosntesis. (B), Patrn de difraccin de rayos X obtenido a partir del cristal. (C) Modelo simplificado de la estructura de la protena obtenido a partir de la informacin de la difraccin de rayos X. El modelo atmico completo es difcil de interpretar, pero esta versin muestra claramente sus caractersticas estructurales (hlices a en verde, lminas P en rojo). (A, por cortesa de C. Branden; B, por cortesa de J. Hajdu e I. Andersson; C, adaptado del original cedido por B. Furugren.)

Y i l

\-< '

VA _

< 1 C ' ' ' C

': \ \

:-r

.>. i- . :: .. -Y

; v;

<B>

tructurales esenciales de la estructura (vase Figura 3-34). Mediante cristalogra fa de rayos X se ha determinado la estructura de varios centenares de protenas, lo cual es suficiente para empezar a entrever familias de estructuras comunes. A menudo, estas estructuras resultan ms conservadas durante la evolucin que las secuencias de aminocidos que las forman.

Tambin se puede determ inar la estructura molecular utilizando espectroscopia de resonancia m agntica nuclear (NMR)29
La espectroscopia de resonancia m agntica nuclear (NMR, de Nuclear Magne tic Resonance) se haba utilizado para analizar la estructura de pequeas mol culas y actualmente se utiliza cada vez ms para estudiar la estructura de peque as protenas o de dominios proteicos. A diferencia de la cristalografa de rayos X, la NMR no requiere tener una muestra cristalizada; simplemente necesita un pequeo volumen de una solucin proteica concentrada, la cual se coloca en un fuerte campo magntico. Algunos ncleos atmicos, particularmente los de hidrgeno, tienen un m o mento magntico o espn: es decir, tienen una magnetizacin intrnseca, como una barra magntica. El espn se alinea en el interior de un fuerte campo m agn tico, pero puede variarse a un estado semialineado al ser excitado en respuesta a una aplicacin de pulsos de radiofrecuencia (RF) de radiacin electromagntica. Cuando los ncleos de hidrgeno excitados se relajan a su estado alineado, em i ten radiacin RF, la cual puede ser medida y expresada en forma de espectro. La naturaleza de la radiacin emitida depende del ambiente de cada ncleo de hidr geno, de forma que si se excita un ncleo influir la absorcin y la emisin de ra-

186

Captulo 4 : Cmo se estudian las clulas

(B)

diacin de otro ncleo que est suficientemente cerca de l. Por tanto es posible, mediante una ingeniosa elaboracin de la tcnica bsica de NMR conocida como NMR bid