iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

Transcriptomic study reveals new pathways and genes involved in Enterococcus faecalis V583 response to a therapeutic dose of Vancomycin

Tnia Ribeiro1, Neuza Teixeira1, Ryoji Yokohata2, Jiro Nakayama2, Michael S. Gilmore3, Maria de Ftima S. Lopes1,4*
1 Instituto de Tecnologia Qumica e Biolgica, Universidade Nova de Lisboa, Oeiras, Portugal. 2 Department of Bioscience and Biotechnology, Faculty of Agriculture, Kyushu University, Higashi-ku, Fukuoka, Japan. 3 Harvard Medical School, Massachusetts Eye and Ear Inrmary, Boston, Massachusetts, USA. 4 IBET, Oeiras, Portugal.
Correspondencia: opes@itqb.unl.pt

Maria de Ftima Silva Lopes. Address: IBET, Apartado 12, 2781-901 Oeiras, Portugal; Phone: +351214469559; Fax: +351214421161

Abstract
Background: An enterococcal strain carrying the VanB resistance type can become susceptible if impaired in other genes unrelated to the vanB operon. This fact alone illustrates the lack of knowledge on the vancomycin mode of action. This antibiotic is still usable to treat serious infections caused by multiresistant enterococcal strains, but may not be so for long. This work was thus set up to gather a body of knowledge that can be used in the future to increase efcacy against both vancomycin resistant (VRE) and susceptible enterococci (VSE).

Methods and Findings: Microarrays were used to detect the genetic response
of the VanB carrying strain Enterococcus faecalis V583 to a therapeutic dose (10 mg/ml) of vancomycin. Besides the vanRS genes, two other two-component systems were induced. The therapeutic dose of vancomycin was found to act as an anti-virulence agent, by turning-off the Fsr quorum-sensing system. Key regulators and metabolic enzymes, involved in trafcking carbon sources into glycolysis and isoprenoid synthesis and utilization, were also affected in order to support cell-wall synthesis. Also, cell-wall modication involving lipotheicoic acid synthesis, DNA repair and protein folding were highly responsive functions to the vancomycin dose tested.

Conclusions: Overall, our results provide clues on the ability of a VRE strain to This article is available from: www.acmicrob.com
stand vancomycin and on the mode of action of the antibiotic. VRE response to a vancomycin therapeutic dose involves an intricate regulatory network and metabolic adjustment which is worth solving as it can help nding new targets to ght both VRE and VSE infections.

Introduction
During the ve decades of vancomycin usage, eight genotypes of resistance to this antibiotic have been described in only one genus, Enterococcus. Vancomycin, a cell-wall active glycopeptide antibiotic, was rst introduced to clinical practice in the 60s and in 1986 the rst resistant enterococcal strain was isolated [] [1] . Since then, vancomycin resistant enterococci (VRE) have been isolated from endocarditis, bacterae Copyright iMedPub

mia, urinary tract infections and wound infections, and have emerged as one of the major nosocomial agents in hospitals [2]. It is currently unknown why so many different resistance genotypes have converged in the genus Enterococcus. S. aureus (2002) recently acquired vancomycin resistance from an enterococcal strain [3]. Among the eight resistance types, VanA and VanB constitute the two most widely disseminated, both conferring resist-

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

ance by the same mechanism and encoding related enzymes [4] . In both cases, resistance is due to synthesis of peptidoglycan precursors ending in the depsipeptide D-alanylDlactate (D-AlaD-Lac) that binds glycopeptides with reduced afnity [5]. The vanB operon contains the vanYBWHBBXBV resistance genes [6], and vanH, vanB and vanX are essential for resistance phenotype. vanHB encodes a dehydrogenase that reduces pyruvate to D-Lac; vanB encodes a ligase that synthetizes the depsipeptide D-Ala-D-Lac; and VanXB hydrolyses the D-Ala-D-Ala dipeptide synthetized by the native Enterococcus Ddl ligase. Expression of the resistance genes is regulated by the vanRBSB two-component system, which is composed of a membrane-associated sensor kinase (VanSB), and a cytoplasmic response regulator (VanRB) that acts as a transcriptional activator [5, 7]. The regulatory and resistance genes are transcribed from distinct promoters that appear to be co-ordinately regulated [8]. Although the genetic basis for vancomycin resistance is known, there are additional details that remain to be elucidated. It is currently not understood why a vancomycin resistant strain becomes susceptible if impaired in the two-component system (TCS) CroRS (for ceftriaxone resistance) [9], which is part of the E. faecalis core genome [10]. The molecular basis for the range of MIC values conferred by each genotype is also not clear. Knowledge of the factors that contribute to the resistome of Enterococcus for vancomycin will be important for the design of new drugs to treat resistant infections. The cellular response of E. faecalis to chloramphenicol and erythromycin [11, 12] has been studied in a resistant strain, V583, revealing an intricate array of genes involved in response of E. faecalis V583 to two distinct antibiotics. These studies showed valuable in identifying genes putatively responsible for the E. faecalis typical intrinsic resistance to antibiotics. Moreover, studying erythromycin response in a resistant strain showed that other gens, besides those involved in resistance to the antibiotic, are responsible for survival and growth maintenance in the presence of the antibiotic. As a key last line drug for treating multidrug resistant enteroccoccal infections, one that is increasingly compromised by resistance [13, 14] it is important to understand how the organism responds to vancomycin, including all of the factors that contribute to its resistance. To achieve this goal, we subjected E. faecalis V583, the rst VRE genome to be sequenced, to vancomycin, and examined the transcriptional response by microarray to identify the cellular pathways affected. A therapeutic dose of vancomycin (10 g/ml) was chosen to represent the range between peak levels of 20-40 g/ml and trough serum levels of 5-10 g/ml achieved in therapy [15]. Among genes differentially regulated by vancomycin during the time of the experiment are three two-component systems, besides the VanRS, responding to the antibiotic. We found that CroRS

(ef3289-ef3290), and TCS06 (ef1260-ef1261, named as is by Hancock and Perego, 2002) [9] are induced by vancomycin in both VRE and in vancomycin susceptible enterococci (VSE), and that Fsr quorum-sensing system, and the genes directly regulated by it, are repressed by the cell-wall active antibiotic. Moreover, we observed additional genes that are highly induced suggesting possible contributions to the resistome of Enterococcus for vancomycin.

Methods
Bacterial strains and growth conditions
Strains used in this study are described in Table 1. For the microarray experiments E. faecalis V583 was grown overnight in Brain Heart Infusion (BHI) at 37C. Cultures were then diluted 20 fold and grown in BHI until an optical density of 0.4-0.45 at 600 nm was reached. Cultures were split in two, and vancomycin (Sigma) was added to one of the cultures to a nal concentration of 10 g/ml. Control and experimental cultures (BHI and BHI plus vancomycin) were then further incubated, and 5 ml samples of each were collected 10 min (t10) and 30 min (t30) following vancomycin addition. Samples were immediately suspended in RNA Protect solution (QIAGEN), and centrifuged for 10 min at 4C. Pellets were held at 4C prior to RNA extraction.

Table 1. Strains and primers used in this study.

Relevant characteristics Strains V583 JH2-2 JH22croR JH22err06 SAVE 9 SAVE 11 VI13 Plasmids pAT80 Primers Gene Sequence (5-3) PRvanRSPHHAXcat [19] Clinical isolate, VaR, with VanB type of resistance FusR RifR, clinical isolate derived strain, plasmid free croR deletion mutant of JH2-2 err06 deletion mutant of JH2-2 JH2-2 with pAT80 JH2-2 croR with pAT80 E. faecalis V583 fsrB, GelE-, GBAP[5] [16] [17] [17] This study This study [18] Reference

Copyright iMedPub

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

croR

CCAATCATGGATGGAATGGAAG (forward) CCAACTCCCCACACTGTTTG (reverse) GCTGTTCTCTATTGGCGCTTA (forward) GCCAGACCTAAACCAGTACC (reverse) GCAAAGTTTCAGCCAATGTTCC (forward) GGATGACTTGAGGACCCACTT (reverse) GCAGGCGTTTCAGATCGAG (forward) GGCATCCGCCATAAATTGACG (reverse) TCATTCATTGACCAG (forward) AACGGATAACACAGGGG (reverse) CATTCTTAAAACTTTCAGCCAC (forward) TAACTTTGATCGCCGG (reverse) CCTACCCTGTCTTTGTGAAGC (forward) ATTGTCCTGCTGCTTCTATCG (reverse)

This study

croS

This study

err06

This study

ehk06

This study

For each condition three batches of RNA were puried from three separate biological replicates and analysed by hybridization to the microarray. cDNA synthesis, fluorescent labelling, oligonucleotides array hybridization and preliminary data analysis were performed by the company Genome Explorations (Memphis, Tennesse). Average relative fold changes were calculated from the average of the signal log ratio (SLR) from three separate experiments by using the following equations: for an SLR of 0, average relative fold change = 2SLR; for an SLR of <0, average relative fold change =-12(-1SLR). Relative changes of 2-fold in independent experiments were considered indicative of differences in transcript amounts, on the basis of previous comparisons in which transcript amounts were also determined by Northern blotting or reverse transcription-PCR [21]. Results from this experiment can be accessed through GEO platform under the accession number GSE52263.

gelE

[20]

sprE

[20]

Semi-quantitative reverse transcriptase PCR (RT-PCR)

Studies on the effect of vancomycin on the expression of croRS and err06-ehk06 genes, coding for CroRS and ef1260-ef1261 proteins, in strain JH2-2 and JH2-2croR were performed using semi-quantitative RT-PCR. RNA samples were collected from cells grown in presence and absence of vancomycin (10 g/ml), and collected before and 30 minutes after exposure to the antibiotic. Total RNA extraction was performed as before using RNeasy Mini columns (Qiagen). DNA was digested using 1 U of RNase-free DNase I (Roche) at 37C for 1 hour. RNA was puried from DNase I using the RNA clean-up kit (Qiagen). Prior to PCR reactions, DNA contamination of the RNA samples was assessed by a standard (30 cycles) PCR reaction with primers targeting a chromosomal E. faecalis gene, without reverse transcriptase addition. For quantitation of mRNA, reverse transcription was used to generate cDNA using the Transcriptor High Fidelity cDNA Synthesis reagents (Roche), according to the manufacturers instructions, and using 1 g of RNA as template. Semi-quantitative RT-PCR was done using serial cDNA dilutions. Primers used in PCR reactions are described in Table 1. 16S rRNA was included as a control.

vanB

This study

Microarray experiments
Total RNA extraction was performed using RNeasy Mini columns (QIAGEN). DNA was eliminated on the columns by adding RNase-free DNase (QIAGEN), with incubation at room temperature for 30 min. For hypridization experiments, 10 g of each RNA sample was used. The custom Afmetrix microarrays used were described previously by McBride et al. (2007) [] [10] . Briefly, the microarray design includes a total of 3582 probes representing 3182 predicted ORFs from the chromosome of strain V583; additional pathogenicity island genes of strain MMH594, known to be absent in V583; and E. faecalis plasmid and antibiotic resistance genes or clusters from other E. faecalis strains for which nucleotide sequences had been reported previously, namely the vanA operon, blaZ, bcr operon, vanG operon, vanE operon, tetM, pRE25 plasmid/cat, as well as the genes present on the V583 endogenous plasmids pTEF1, pTEF2, and pTEF3 were included. Additionally, microarrays included 111 Affymetrix designed eukaryotic and prokaryotic negative control probe sets. A full list of probe sets including genes represented and excluded from the microarray is available in the ArrayExpress public repository at http://www. ebi.ac.uk/ under accession number E-MEXP-1090. Details of the algorithm used in construction of custom Affymetrix GeneChips are available at the manufacturers website (www.affymetrix.com/technology/index.affx). Copyright iMedPub

Susceptibility testing
MIC values for vancomycin were determined by E-test (Biodisk), according to manufacturers instructions. E. faecalis ATCC29212 was used as a control.

Quorum-sensing experiments
The effect of vancomycin on the ability of E. faecalis V583 to sense the quorum regulator of the fsr system, GBAP (gelatinase biosynthesis-activating pheromone), was directly evaluated by

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

measuring changes in expression of fsr regulated genes gelE and sprE. To control the timing of the response of this operon, we used an fsrB mutant of V583 [] [18] , which is unable to produce GBAP by itself, but is able to sense and activate Fsr upon GBAP addition. This strain, termed V583DfsrB, was grown in BHI to an OD ~0.4, and the culture was then split. To half, only GBAP (10nM), which was chemically synthesized [22], was added. To the other portion, both GBAP (10 nM) and vancomycin (10 g/ml) were added, and after 10 or 20 minutes, cells were collected for RNA extraction and expression levels of gelE, sprE and vanB genes were evaluated.

were differentially transcribed. Figure 2 shows all functional categories of genes that were differentially expressed under the conditions tested. Of this total, 41% of genes were affected by changes of more than 5 fold. These results highlight the complexity of the E. faecalis V583 response to vancomycin exposure. A full list of genes differentially expressed in the presence of vancomycin is given in Table S1. Some functional classes of genes were relatively unaffected by vancomycin exposure, including genes involved in fatty acid and phospholipid metabolism, mobile and extrachromosomal element functions, protein synthesis and transcription. Hypothetical proteins and proteins of unknown function constituted 17% and 23%, respectively, of the genes differentially expressed in response to vancomycin. The functional categories most affected by vancomycin were cell envelope, regulatory functions and signal transduction, energy metabolism, and transport and binding. Nine genes were upregulated at one time point and downregulated at the other, and encode proteins putatively involved in cell envelope (ef0095 and ef2713), nucleotide metabolism (ef1714), hypothetical proteins of unknown function (ef0054), and signal transduction/transport and binding (ef1012, ef1017, ef1018, ef1019 and ef2213). Several genes involved in cell-wall synthesis and modication, and in energy metabolism, were included among those responding to vancomycin. Figure 3 highlights those that are directly or indirectly involved in E. faecalis cell-wall synthesis and modication. Four genes coding for PBPs were up-regulated (ef0746, ef0680, ef2476 and ef2857 ), as well as other genes involved in cell-wall synthesis, namely murB (ef2733), murM (ef2658) and ef2585, and the vancomycin resistance genes vanX (ef2293), vanY (ef2297 ), vanB (ef2294) and vanH

Results
The expression prole of E. faecalis V583 exposed to a therapeutic dose of vancomycin for 10 and 30 min, was compared with the expression prole of V583 cells grown in the absence of the antibiotic. This allowed us to identify genes which respond either to vancomycin, or to the changes introduced by the induction of the vanB operon genes in response to the antibiotic. Figure 1 shows the growth curves of V583 cultures, exposed and not exposed to vancomycin. The culture exposed to vancomycin enters stationary phase before the control culture, 30 min following exposure to the antibiotic. 10 min after exposure to vancomycin no differences in growth were observed between the exposed culture and the control one.

Transcriptome of V583 in the presence of vancomycin

In total, 130 different genes, corresponding to 4% of the V583 chromosomal genes represented in the array ships,

Figure 1. E. faecalis V583 growth curve in the presence and absence of vancomycin. At OD 0.4 10 g/ml vancomycin was added to half of the culture and growth was followed in the presence (square) and absence (asterisk) of the antibiotic.

Copyright iMedPub

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

Figure 2. Number of differentially expressed genes by functional category and fold-change value. Grey bars: genes found to be differentially expressed with fold-change values below 5; Black bars: genes found to be differentially expressed with fold-change values above or equal to 5. A, Aminoacid biosynthesis; B, Biosynthesis of cofactors/prosthetic groups/carriers; C, cell envelope; D, cellular processes; E, Central intermediary metabolism; F, DNA metabolism; G, Energy metabolism; H, Transport and binding; I, Signal transduction; J, Protein fate; K, Purine/pyrimidine/nucleoside and nucleotides; L, Regulatory functions; M, Hypothetical proteins; N, Unknown function.

Citrate Oxaloacetate
EF3319 EF3320 EF3321

Acetyl-CoA
EF1363, EF1364

EF3316 EF2295

Mevalonate

IPP

EF2495

UPP D-Lac
EF2294

Pyruvate GLYCOLYSIS

D-Ala D-Ala-D-Lac
EF2585

Pep@doglycan
EF2658, EF0746 EF0680, EF2476 EF2857, EF2293 EF2297

Fru-1,6P
EF1503

UDP-MurNAc-L-Ala-D-Glu-L-Lys-D-Ala-D-Lac

EF2733

Fru-6P

EF2151(GlmS)

GlcN-6P

UDP-MurNAc

Glucose-6-P
Figure 3. V583 loci and pathways involved, or related to, peptidoglycan biosynthesis, and affected by vancomycin. Overall, the increased expression of ef 2294 requires D-lac, which is provided by the increased expression of ef 2295, which converts pyruvate into D-Lac. Pyruvate is likely fuelled into EF2295 reaction through increased levels of Fru-1,6P entering into glycolysis. This is possible due to repression of ef1503 and ef 2151, which allows Fructose-6P to be increasingly converted into Fru-1,6P. As peptidoglycan synthesis induced by the up-regulation of the vanB operon also requires UPP, this is likely achieved by increasing the input of acetyl-CoA into UPP synthesis. Down-regulated (light grey) and up-regulated (underlined) loci are shown. Single steps between metabolites are shown as single arrows and pathways involving several steps and loci are shown as multiple arrows on a line. UPP, undecaprenyl pyrophosphate; IPP, isopentenyl pyrophosphate; UDP, uridine diphosphate; MurNAc, N-acetylmuramic acid; GlcN, glucosamine; Fru, fructose; D-Lac, D-lactate; D-Ala, D-alanine; D-Glu, D-glutamate; L-Lys, L-lysine.

Copyright iMedPub

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

(ef2295 ). glmS (ef2151) and ef1503 genes, both involved in fructose metabolism, were repressed. Down-regulation of both genes likely directs D-fructose-6P into glycolysis for pyruvate synthesis, the precursor of the D-lactate synthesized by the highly up-regulated vanH gene. Also down-regulated was the citrate gene cluster (ef3316 to ef3326 ), which codes for the enzymes involved in citrate transport and conversion into oxaloacetate and pyruvate [23]. Genes coding for the enzymes involved in the mevalonate pathway, which converts acetyl-coA into IPP (isopentenyl pyrophosphate), which is further converted into the carrier lipid UPP (undecaprenyl pyro-

phosphate) required for cell-wall peptidoglycan biosynthesis, were up-regulated (ef1363, ef1364 and ef2495 ).

Genes highly affected by vancomycin

Aside from the van operon (ef2292-ef2297 ), there were also other 18 genes for which mRNA abundance exhibited a change of more than 9-fold, including four that exhibited decreases ( Table 2). As this huge response to vancomycin can provide some insights into its mode of action, we further analysed these highly affected genes.

Table 2. List of genes, by locus number, differentially expressed at both time points (t10 and t30 min) under exposure to 10 g/ml of vancomycin, with fold-change values higher than 9, at least at one of the assayed times. Fold change values are given for each gene, as well as its putative function and role, according to NCBI.
Locus EF0559 EF0746 EF0802 EF0972 EF1097 EF1231 EF1302 EF1303 EF1304 EF1503 EF1813 EF1814 EF1815 EF2292 EF2293 EF2294 EF2295 EF2296 EF2297 EF2896 EF3244 EF3245 EF3325 EF3326 Gene name vanV vanX vanB vanH vanW vanYB Descriptions polysaccharide biosynthesis family protein penicillin-binding protein, putative hypothetical protein DNA repair exonuclease family protein hypothetical protein conserved hypothetical protein transcriptional regulator, putative transcriptional regulator, LysR family magnesium-translocating P-type ATPase fructose-1,6-bisphosphatase, putative sulfatase domain protein drug resistance transporter, EmrBQacA family protein transcriptional regulator, LysR family, putative hypothetical protein D-alanyl-D-alanine dipeptidase D-alanine-D-lactate ligase D-specic alpha-keto acid dehydrogenase vancomycin B-type resistance protein VanW D-alanyl-D-alanine carboxypeptidase hypothetical protein hypothetical protein cell-envelope associated acid phosphatase sodium ion-translocating decarboxylase, biotin carboxyl carrier protein conserved hypothetical protein Role Cell envelope Cell envelope Unknown function DNA metabolism Unknown function Hypothetical proteins Regulatory functions Regulatory functions Transport and binding proteins Energy metabolism Unknown function Transport and binding proteins/Cellular processes Regulatory functions Unknown function Protein fate Protein fate Cell envelope/Cellular processes Cellular processes/Signal transduction Cell envelope/Cellular processes Unknown function Unknown function Unknown function Transport and binding proteins/Energy metabolism Hypothetical proteins Fold change t10 4.6 8.5 19.3 7.6 -7.1 29.8 6.4 7.2 3.5 -4.8 4.1 3.2 3.3 131.5 129.5 188.0 203.5 219.1 145.6 14.2 14.0 10.9 -3.9 -5.1 t30 9.5 13.2 26.3 11.7 -12.5 49.3 10.1 13.4 15.7 -9.3 14.1 15.3 9.2 176.9 123.9 132.9 217.8 241.1 170.5 28.7 13.2 10.1 -11.8 -12.7

Copyright iMedPub

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

Three of these four highly reduced messages are either regulated by, or part of operons, as shown in Table S1. Of those, ef1097 is predicted to be regulated by the Fsr system in OG1-RF [24]; and ef3325 and ef3326 are part of the citrate transport and metabolism, which was also overall down-regulated by vancomycin. ef1503, which codes for the fructose1,6-biphosphatase key metabolic enzyme, was highly downregulated by vancomycin. Genes corresponding to increased levels of mRNA are mainly involved in regulatory functions, cell-envelope and transport and binding. Three orphan LysR family regulators (ef1302, ef1303 and ef1815 ) were highly induced by vancomycin. LysR regulators often control the transcription of genes responsive to environmental conditions [25]. It is possible that ef1304, annotated as magnesium translocating P-type ATPase, is under the control of ef1302 and ef1303, which are transcribed in the opposite direction compared to ef1304, as often found in LysR regulators [26]. The vancomycin molecule has been found to chelate ions [27], raising a possible connection between induction of these three genes by vancomycin and depletion of free magnesium in the extracellular environment. Similarly, the orphan regulator ef1815, which may be the positive transcriptional regulator of ef1813 and ef1814, is also highly induced by vancomycin. ef1814, annotated as a putative MFS protein, is possibly a drug-resistance transporter but its subtrates are currently unknown. ef1813 encoded protein has a sulphatase domain (Table S1) and is paralogous to ef1264, which is annotated as an ltaS gene. Recently, Reichman and Grundling (2011) have proposed that ef1813 and ef1264 work together in LTA (lipotheichoic acid) synthesis in E. faecalis. They also predict the existence of a permease, which would act as the LtaA protein of S. aureus [28]. ef0559 is annotated as involved in polysaccharide synthesis. Proteins with the same motifs include those involved in sporulation, namely flippases and translocases. This protein has 12 transmembrane domains, as does the LtaA transporter protein. Although further studies are needed it is possible that ef0559 acts as the E. faecalis permease LtaA. Two genes, annotated as involved in DNA repair and metabolism, ef0972 ( Table 2) and ef1587 ( Table S1), were also higly up-regulated, suggesting a possible role for reactive oxygen species (ROS) in vancomycin mode of action. Half of the genes listed in Table 2 code for hypothetical proteins of unknown function. Using several bioinformatics tools we were able to provide some prediction on their putative role ( Table S2 for details). Ef0802 is in operon with ef0803. Although bioinformatics analysis does not allow reliable prediction of their activity ( Table S2), speculatively, it suggests that these genes may be involved in biotin transport. Biotin is required for proper activity of several biotin-dependent carboxylases. ef1231 is a Ser/Thr romoterse with a signal peptide Copyright iMedPub

region and a transmembrane segment. Ser/Thr phosphatases are often involved in activation/deactivation of other proteins by dephosphorylation, including TCS or proteins involved in cell-division or metabolism [29]. Further studies are needed to dene the substrate of ef1231. N o known structural domains could be identied with condence for ef2896, but low level identity and hydrophobic character suggests that ef2896 is a membrane protein potentially involved in cellenvelope protein folding, signalling or chaperoning. HslVU chaperones (ef1646-ef1647) were found to be up-regulated by vancomycin ( Table S1). These proteins are encoded in what appears to be the codY operon of E. faecalis ef1648ef1647 (hsIV )-ef1646 (hsIU )-codY. All the putative codY operon genes are induced by vancomycin exposure at similar levels. ef3244 and ef3245 also appear to be in an operon. ef3245 is a LytR-CpsA-Psr protein with a type 2 phosphatidic acid phosphatase superfamily domain (PAP2), and likely has a role in cell-wall maintenance ( Table S2). Paralogues to ef3245, also containing the LytR-CpsA-Psr motif, are ef1212 and ef1569 (Psr), and are also up-regulated by vancomycin ( Table S1). A similar system in S. aureus, MsrRA, has been shown to respond to glycopeptides and other cell-wall active agents, and to control virulence associated genes [30].

Two-component regulatory systems responding to vancomycin

Out of 17 TCS predicted in the V583 genome [] [31] , four responded to vancomycin. Three were up-regulated, namely VanRS (TCS11, ef2298-ef2299), CroRS (TCS05, ef3289ef3290) and TCS06 (ef1260, which corresponds to the regulator protein), and one, FsrAC (TCS15, ef1820 which corresponds to FsrC, the kinase component of this TCS), was down-regulated ( Table S1).

The VanRS two-component system

VanRS induced all genes from the vancomycin resistance operon (ef2292 to ef2299), although to different levels. vanV [5], vanYB, vanW, vanHB, vanB and vanXB were the most strongly induced genes, showing huge fold-change values, between 100 and 250 ( Table 2). vanRBvanSB had a discrete increased expression (fold-change values of 2.8/3.0 and 3.0/3.2, respectively, for 10/30 min exposure) ( Table S1), as expected from two-component systems.

CroRS two-component system

The croRS romoter has been found previously to respond to vancomycin in E. faecalis JH2-2, a vancomycin susceptible strain [32]. In the present work we observed that it also responds to vancomycin in a strain carrying the VanB type of resistance. Mutation in croR gene in V583, carrying the VanB type of resistance, leads to susceptibility to vancomycin

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

[9]. We wondered if the same was true for the VanA type of resistance. We thus introduced pAT80 plasmid, which carries PRvanRSPHHAXcat construction [33] into JH2-2, a vancomycin susceptible strain with an MIC value of 3 g/ml, and into its isogenic croR deletion mutant, which had a MIC value for vancomycin of 1 g/ml. Vancomycin MIC values for the constructed transformants, SAVE 9 and SAVE 11 strains, were 256 mg/ml and 4 mg/ml, respectively. The SAVE 11 strain, despite carrying a functional vanA operon in the pAT80 plasmid, remained susceptible to vancomycin. This result demonstrates that CroRS is essential for expression of the VanA phenotype in E. faecalis. Concerning the other two TCS, namely TCS06 and TCS11, they had never been associated before with vancomycin or cell-wall stress response.

tive bactericidal antibiotics induce intracellular oxidative stress [34]. TCS06 could be responding to vancomycin indirectly, being dependent on simultaneous induction of other genes responding to cell-wall perturbations. We thus asked if the cell-wall perturbations, sensed by CroRS, could be linked to TCS06 induction. We measured the expression levels of err06 and ehk06 genes in JH2-2DcroR strain, under exposure to vancomycin. JH2-2DcroR strain has neither VanRS nor CroR. As shown in Figure 4C, neither err06 nor ehk06 responded to vancomycin. Collectively, these results suggest that the presence of an intact CroRS system is important for induction of the TCS06 system by vancomycin.

Fsr Two-component system

The Fsr system was repressed following the addition of vancomycin (Table S1), and message corresponding to genes known to be regulated by this system, namely gelE and sprE, was less abundant. At the late exponential growth phase when the cells were collected, we would have expected that GBAP was accumulating outside the cells and thus activating the Fsr system [35]. The reduction in mRNA for the Fsr system was unexpected. One explanation would be that vancomycin affected the ability of FsrC to sense the external GBAP, and interfering with Fsr autoinduction, resulting in down-regulation of the system and the genes it controls. To test this hypothesis, we used the V583DfsrB strain, which can sense GBAP and activate fsr and gelE-sprE transcription, but is unable to produce GBAP [18]. We added chemically synthesized GBAP to cultures of this strain, with and without vancomycin, and looked for induction of gelE and sprE gene expression. As shown in Figure 5B, and as expected, expression of both genes was increased upon GBAP addition to V583DfsrB cells. However, when added with vancomycin, neither gelE nor sprE were induced (Figure 5A), demonstrating that vancomycin somehow prevents the Fsr system from

TCS 06
We detected increased message levels in the presence of vancomycin, only for the regulator gene, err06 (ef1260), of the TCS06. This sensory and regulatory system has not been previously associated with vancomycin exposure or other cellwall stressors. We wondered if TCS06 response to vancomycin could also be generalized to susceptible strains. We therefore compared the expression of err06 and ehk06 (ef1261) genes in JH2-2, in the absence and presence of vancomycin. Expression of croR and croS genes in JH2-2 served as a positive control, as croR promoter was previously shown to be induced by vancomycin in this strain (Figure 4A). Both croR and croS were induced following exposure to vancomycin conrming previous data from Comenge et al. [32]. Similar changes were observed for TCS06 (Figure 4B), demonstrating that TCS06 responds to vancomycin in susceptible E. faecalis. TCS06 has been implied in response to oxidative stress in E. faecalis JH2-2, and our results suggest that it also responds to cell-wall stress. Recently, it was shown that cell-wall ac-

Figure 4. Effect of vancomycin on the expression of croRS and err06-ehk06 genes, measured by semi-quantitative RT-PCR. A, E. faecalis JH2-2; B, E. faecalis JH2-2; C, E. faecalis JH2-2croR.

Copyright iMedPub

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

Figure 5. Effect of GBAP and vancomycin on the expression of gelE, sprE and vanB genes in strain V583. A, vancomycin was added at T0, prior to addition of GBAP; B, GBAP was added alone at T0.

responding to its quorum signal. In this experiment, vanB gene was, as expected, induced by vancomycin, corroborating the microarray data and also validating our results with GBAP and the V583DfsrB strain.

Discussion
As previously seen with other transcriptome studies of the effect of antibiotics on strain V583 [11,12], substantial global changes in mRNA abundance occur. The aim of this study was to nd specic genes that contribute to the response of the bacterium to vancomycin. We found genes that i) had very high fold-changes; ii) were part of TCSs, which are known to be key players in transducing environmental information into bacterial phenotypes; iii) were involved in metabolic pathways and cell-wall synthesis and modication. The molecule actually sensed by the VanS sensor that regulates the van operon is currently controversial. Recent work from Ma et al. (2008) [36] has shown that vancomycin is not the activating signal for VanS phosphorylation. Recently, Eirich et al. (2011) have shown that vancomycin binds ef0911, one component of an oligopeptide transport system in V583 [37]. This binding likely induces a cascade of events which involve the genes identied in this work, as illustrated in a very simple way in Figure 6. CroRS, which is clearly needed for both VanA and VanB phenotypes, can be involved in regulation of genes which expression is essential for phenotypic expression of the VanA and Copyright iMedPub

VanB types of resistance, which likely includes some of the genes detected in this study. The transversal effect of CroRS impairment in resistance to cell-wall antibiotics puts this TCS in the rst line of E. faecalis defense, by both sensing cellwall perturbing agents and by regulating genes involved in cell-wall synthesis and in the metabolic events that support cell-wall synthesis. Our ndings also suggest that cell-wall perturbations sensed by CroS may be providing the signal for TCS06 induction. This sensory and regulatory system has been associted with oxidative stress response in JH2-2 strain [38] and with resistance to heat and SDS in V583 [9]. Although VanRS is responsible for induction of the vancomycin resistance operon, our results indicate that both CroRS and TCS06 control unknown steps that are crucial for E. faecalis cells to tolerate vancomycin and allow for the activities of vanA and vanB to protect the cell. CroRS and TCS06 may represent important targets for future research on antibiotic therapy against both VRE and VSE. The immediate repression of the Fsr system upon exposure to vancomycin, indicates that for reasons unknown, FsrC becomes blind to the quorum signal GBAP. The quorum-sensing disrupting activity of vancomycin would be predicted to limit the contributions of GelE and SprE proteases to bacterial virulence. It is possible that other cell-wall active antibiotics may produce the same effect. Possibly, vancomycin prevents FsrC phosphorylation, as is the case for the antimicrobial peptide siamycin I. Siamycin I, active against E. faecalis and previously found to inhibit both gelatinase and GBAP production [39], directly inhibits autophosphorylation of FsrC kinase [40].

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

Figure 6. Representation of the main, or most affected, loci likely involved in either (or both) vancomycin mode of action and VRE response to a therapeutic dose of this antibiotic. Dotted lines represent putative or unconrmed direct or indirect interaction,; lled lines represent previously known, or here demonstrated, interactions. Regulators EF1815, EF1302 and EF1303 are represented outside the cell in order to simplify this representation. Likely, information leading to increased expression of these regulators is transduced from the outside to the inside compartment, by a yet unknown source or pathway which induces, inside the cell, the increased expression of their genes.

Cell-wall synthesis-associated enzymes were induced by vancomycin, as demonstrated by the up-regulation of PBP coding genes, namely ef0746, of Mur proteins, of FtsW/RodA/ SpoE family proteins and the MreD and MreC proteins. Other pathways which are likely providing the substrates for cellwall synthesis were also induced, namely the isoprenoid synthesis and utilization, and the deviated flux of fructose into glycolysis in order to provide pyruvate for lactate synthesis and incorporation into the nascent cell-wall precursors, required for the induced production and activity of Van genes, namely VanB, VanH, vanY and VanX. Apparently, fructose metabolism, and in particular, two enzymes GlmS (ef2151) and Fbp (ef1503), are key players in linking cell-wall stress/ synthesis to metabolism. The key metabolite in the activation of glycolysis is fructose-1,6-biphosphate (FBP). The high repression of ef1503 suggests that FBP, and thus glycolysis, is also crucial in the events produced by the therapeutic dose of vancomycin. The down-regulation of the citrate transport and utilization enzymes may imply that the cell stops using this pathway to produce pyruvate. The citrate gene cluster, recently found to be regulated by the citO gene product, is involved in pH homeostasis and in regulation of reducing power from NAD(P)H [] [23] . It is possible that these important metabolic traits are involved in activation/deactivation of metabolic pathways, which are obviously affected by the presence of vancomycin and the need to produce a different

cell-wall precursor, i.e, D-Ala-Dlac instead of D-Ala-DAla. In S. aureus it has been reported that genes involved in sugar distribution for cell-wall synthesis and glycolysis, namely glmS, have an impact in susceptibility to cell-wall active antibiotics [41]. Down-regulation of the citrate and malate utilization enzymes, which probably leads to acetyl-CoA being directed to mevalonate pathway and cell-wall-synthesis, will result in the reduction of NAD(P)H availability [23, 42]. Kohanski et al. (2007) [42] have proposed that bactericidal antibiotics, regardless of their cell target, kill bacteria by depletion of reducing power from NAD(P)H, which in turn induces the production of hydroxyl radicals responsible for cell damage and death. As we detected increased expression of a gene coding for a DNA repair enzyme (ef0972), it is possible that, in VRE, induction of the vanB operon by vancomycin may actually increase cell damage by ROS, potentially due to decreased NAD(P)H. However, further studies are needed to clarify this. Although the concentration of vancomycin used in our experiments with V583 was bacteriostatic (Figure 1), it is possible that the induction of the resistance mechanism also produces a burst of ROS. Supporting this prospect is the observation that ef1587 was also up-regulated. ef1587 encodes a MutT protein, which hydrolyses 8-oxo-dGTP to 8-oxo-dGMP, an event that can prevent the misincorporation Copyright iMedPub

10

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

of 8-oxoguanine opposite adenine in DNA. 8-oxoguanine (8oxoG), a damaged form of guanine (G) generated by reactive oxygen species, is known to have highly mutagenic potency because of its mispairing with adenine. Kohanski et al. (2007) [42] suggest that bactericidal drugs can be potentiated by targeting bacterial systems that remediate hydroxyl radical damage, including proteins involved in triggering the DNA damage response. Further studies will be required to clarify the relationship between vancomycin exposure and oxidative damage in enterococci. Another important trait highly affected by the presence of vancomycin was LTA synthesis. Two LtaS proteins are predicted in the V583 genome, ef1813 and ef1264, and the rst was highly induced by vancomycin. ef1815 may regulate positively the expression of LTA synthesis in response to vancomycin, which also involves the up-regulation of ef0559, which may have the corresponding activity to LtaA. ef1746 (GalU) is one of the enzymes in the cytoplasm responsible for precursor synthesis for the LTA biosynthesis. Recently, Rigottier-Gois et al. (2011) [43] showed that impairing this gene in E. faecalis has multiple effects on antibiotic resistance and virulence. If any of these effects is related with LTA biosynthesis and activity of ef1813 and ef0559 is yet to be determined, but we can, based on the actual knowledge, hypothesise that vancomycin induced in E. faecalis cells genes involved in LTA synthesis and thus may have implications on the ability of VRE to increase pathogenicity and antibiotic resistance under the presence of the antibiotic. It is possible that E. faecalis may, through LTA synthesis, be able to stand therapeutic doses of vancomycin. Our results suggest that E. faecalis is well suited to accommodate and metabolically support the expression of the Van operon genes, therefore limiting the impact of the Van operon on the tness of E. faecalis, perhaps making enterococci especially conducive for hosting and spreading this resistance. We found that vancomycin possesses surprising ability as a disruptor of signaling systems in VRE. This warrants additional study, as quorum-sensing is not only involved in biolm and virulence, but also in regulation of autolysis. Modied vancomycin molecules are being examined for activity against both VSE and VRE [44]. It will be of interest to determine whether these molecules also disrupt TCS systems. Here we examined the cascade of events that follows exposure of a vancomycin resistant E. faecalis strain to vancomycin. This allowed us to identify genes that may play important supportive roles for the expression of the cell wall modifying activity of the vancomycin resistance operon, and contribute to an understanding of the success of this pathway in enterococci. Some of these genes may represent candidates for future studies aimed at sensitizing VRE to vancomycin.

Acknowledgements
The authors acknowledge Kelli Palmer for assisting in the microarrays analysis and RNA extraction protocol, and Isabel Marques for helping with the bioinformatic analysis of the hypothetical proteins.

Funding
This work was partially supported by Fundao para a Cincia e Tecnologia (POCTI/CVT/59636/2004 and PTDC/ CVT/67270/2006, co-nanced through FEDER, PEst-OE/ EQB/LA0004/2011, SFRH/BD/21535/2005 to TR and SFRH / BD / 65750 / 2009 to NT). Portions of the work conducted in the US were supported by the Harvard-wide Program on Antibiotic Resistance (AI083214), and NIH research grant AI072360).

Competing interests
There are no competing interests.

Copyright iMedPub

11

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

References
1. Leclercq, R., Derlot, E., Duval, J., Courvalin, P. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med. 1988; 319: 157-161. 2. Arias, CA., Murray, BE. The rise of the Enterococcus: Beyond vancomycin resistance. Nat Rev Microbiol. 2012; 10: 266-278. 3. Sievert, DM., Boulton, G., Stolman, D., Johnson, M., Stobierski, G., Downes, PAS. et al. Staphylococcus aureus resistant to vancomycin-United States, 2002. MMWR Morb Mortal Wkly Rep. 2002; 51: 565567. 4. Reynolds, PE., Snaith, HA., Maguire, AJ., Dutka-Malen, S., Courvalin, P. Analysis of peptidoglycan precursors in vancomycin-resistant Enterococcus gallinarum BM4174. Biochem J. 1994; 301 (Pt 1): 5-8. 5. Evers, S., Courvalin, P. Regulation of VanB-type vancomycin resistance gene expression by the VanS(B)-VanR (B) two-component regulatory system in Enterococcus faecalis V583. J Bacteriol. 1996; 178: 13021309. 6. Ribeiro, T., Santos, S., Marques, MI., Gilmore, M., de Fatima Silva Lopes, M. Identication of a new gene, vanV, in vanB operons of Enterococcus faecalis. Int J Antimicrob Agents 2011; 37: 554-557. 7. Arthur, M., Depardieu, F., Snaith, HA., Reynolds, PE., Courvalin, P. Contribution of VanY D,D-carboxypeptidase to glycopeptide resistance in Enterococcus faecalis by hydrolysis of peptidoglycan precursors. Antimicrob Agents Chemother 1994; 38: 1899-1903. 8. Aslangul, E., Baptista, M., Fantin, B., Depardieu, F., Arthur, M. et al. Selection of glycopeptide-resistant mutants of VanBtype Enterococcus faecalis BM4281 in vitro and in experimental endocarditis. J Infect Dis. 1997; 175: 598-605. 9. Hancock, LE., Perego, M. Systematic inactivation and phenotypic characterization of two-component signal transduction systems of Enterococcus faecalis V583. J Bacteriol. 2004; 186: 7951-7958. 10. McBride, SM., Fischetti, VA., Leblanc, DJ., Moellering, RC. Jr., Gilmore, MS. Genetic diversity among Enterococcus faecalis. PLoS ONE 2007; 2: e582. 11. Aakra, A., Vebo, H., Indahl, U., Snipen, L., Gjerstad, O. et al. The Response of Enterococcus faecalis V583 to Chloramphenicol Treatment. Int J Microbiol. 2010; 483048. 12. Aakra, A., Vebo, H., Snipen, L., Hirt, H., Aastveit, A. et al. Transcriptional response of Enterococcus faecalis V583 to erythromycin. Antimicrob Agents Chemother 2005; 49: 2246-2259. 13. Cattoir, V., Leclercq, R. Twenty-ve years of shared life with vancomycin-resistant enterococci: Is it time to divorce? J Antimicrob Chemother 2013; 68: 731-742. 14. Zhu, W., Clark, NC., McDougal, LK., Hageman, J., McDonald, LC. et al. Vancomycin-resistant Staphylococcus aureus isolates associated with Inc18-like vanA plasmids in Michigan. Antimicrob Agents Chemother 2008; 52: 452-457. 15. Rybak, M., Lomaestro, B., Rotschafer, JC., Moellering, R. Jr., Craig, W. et al. Therapeutic monitoring of vancomycin in adult patients: a consensus review of the American Society of Health-System Pharmacists, the Infectious Diseases Society of America, and the Society of Infectious Diseases Pharmacists. Am J Health Syst Pharm. 2009; 66: 82-98. 16. Jacob, AE., Hobbs, SJ. Conjugal transfer of plasmid-borne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J Bacteriol. 1974; 117: 360-372. 17. Le Breton, Y., Boel, G., Benachour, A., Prevost, H., Auffray, Y. et al. Molecular characterization of Enterococcus faecalis two-component signal transduction pathways related to environmental stresses. Environ Microbiol. 2003; 5: 329-337. 18. Teixeira, N., Santos, S., Marujo, P., Yokohata, R., Iyer, VS. et al. The incongruent gelatinase genotype and phenotype in Enterococcus faecalis are due to shutting off the ability to respond to the gelatinase biosynthesis-activating pheromone (GBAP) quorum-sensing signal. Microbiology 2012; 158: 519-528.

19. Arthur, M., Molinas, C., Courvalin, P. The VanS-VanR two-component regulatory system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J Bacteriol. 1992; 174: 2582-2591. 20. Gaspar, F., Teixeira, N., Rigottier-Gois, L., Marujo, P., Nielsen-LeRoux, C. et al. Virulence of Enterococcus faecalis dairy strains in an insect model: the role of fsrB and gelE. Microbiology 2009; 155: 3564-3571. 21. Ng, WL., Kazmierczak, KM., Robertson, GT., Gilmour, R., Winkler, ME. Transcriptional regulation and signature patterns revealed by microarray analyses of Streptococcus pneumoniae R6 challenged with sublethal concentrations of translation inhibitors. J Bacteriol. 2003; 185: 359-370. 22. Nakayama, J., Cao, Y., Horii, T., Sakuda, S., Nagasawa, H. Chemical synthesis and biological activity of the gelatinase biosynthesisactivating pheromone of Enterococcus faecalis and its analogs. Biosci Biotechnol Biochem. 2001; 65: 2322-2325. 23. Espariz, M., Repizo, G., Blancato, V., Mortera, P., Alarcon, S. et al. Identication of malic and soluble oxaloacetate decarboxylase enzymes in Enterococcus faecalis. FEBS J. 2011; 278: 2140-2151. 24. Bourgogne, A., Hilsenbeck, SG., Dunny, GM., Murray, BE. Comparison of OG1RF and an isogenic fsrB deletion mutant by transcriptional analysis: the Fsr system of Enterococcus faecalis is more than the activator of gelatinase and serine protease. J Bacteriol. 2006; 188: 2875-2884. 25. Russell, DA., Byrne, GA., OConnell, EP., Boland, CA., Meijer, WG. The LysR-type transcriptional regulator VirR is required for expression of the virulence gene vapA of Rhodococcus equi ATCC 33701. J Bacteriol. 2004; 186: 5576-5584. 26. Maddocks, SE., Oyston, PC. Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology 2008; 154: 3609-3623. 27. Pfeiffer, RR. Structural features of vancomycin. Rev Infect Dis. 1981; 3 (Suppl.): S205-209. 28. Reichmann, NT., Grundling, A. Location, synthesis and function of glycolipids and polyglycerolphosphate lipoteichoic acid in Grampositive bacteria of the phylum Firmicutes. FEMS Microbiol Lett. 2011; 319: 97-105. 29. Pereira, SF., Goss, L., Dworkin, J. Eukaryote-like serine/threonine kinases and phosphatases in bacteria. Microbiol Mol Biol Rev. 2011; 75: 192-212. 30. Rossi, J., Bischoff, M., Wada, A., Berger-Bachi, B. MsrR, a putative cell envelope-associated element involved in Staphylococcus aureus sarA attenuation. Antimicrob Agents Chemother 2003; 47: 2558-2564. 31. Hancock, L., Perego, M. Two-component signal transduction in Enterococcus faecalis. J Bacteriol. 2002; 184: 5819-5825. 32. Comenge, Y., Quintiliani, R. Jr., Li, L., Dubost, L., Brouard, JP. et al. The CroRS two-component regulatory system is required for intrinsic beta-lactam resistance in Enterococcus faecalis. J Bacteriol. 2003; 185: 7184-7192. 33. Arthur, M., Molinas, C., Courvalin, P. Sequence of the vanY gene required for production of a vancomycin-inducible D, D-carboxypeptidase in Enterococcus faecium BM4147. Gene 1992; 120: 111-114. 34. Dwyer, DJ., Kohanski, MA., Collins, JJ. Role of reactive oxygen species in antibiotic action and resistance. Curr Opin Microbiol. 2009; 12: 482-489. 35. Nakayama, J., Cao, Y., Horii, T., Sakuda, S., Akkermans, AD. et al. Gelatinase biosynthesis-activating pheromone: A peptide lactone that mediates a quorum sensing in Enterococcus faecalis. Mol Microbiol. 2001; 41: 145-154. 36. Ma, P., Yuille, HM., Blessie, V., Gohring, N., Igloi, Z. et al. Expression, purication and activities of the entire family of intact membrane sensor kinases from Enterococcus faecalis. Mol Membr Biol. 2008; 1-25. 37. Eirich, J., Orth, R., Sieber, SA. Unraveling the protein targets of vancomycin in living S. aureus and E. faecalis cells. J Am Chem Soc. 2011; 133: 12144-12153.

12

Copyright iMedPub

iMedPub Journals

2013 ARCHIVES OF CLINICAL MICROBIOLOGY

Vol. 4 No. 5:3 doi: 10.3823/274

Our Site: http://www.imedpub.com/

38. Muller, C., Sanguinetti, M., Riboulet, E., Hebert, L., Posteraro, B. et al. Characterization of two signal transduction systems involved in intracellular macrophage survival and environmental stress response in Enterococcus faecalis. J Mol Microbiol Biotechnol 2008; 14: 59-66. 39. Nakayama, J., Tanaka, E., Kariyama, R., Nagata, K., Nishiguchi, K. et al. Siamycin attenuates fsr quorum sensing mediated by a gelatinase biosynthesis-activating pheromone in Enterococcus faecalis. J Bacteriol. 2007; 189: 1358-1365. 4 0. Ma, P., Nishiguchi, K., Yuille, HM., Davis, LM., Nakayama, J. et al. Anti-HIV siamycin I directly inhibits autophosphorylation activity of the bacterial FsrC quorum sensor and other ATP-dependent enzyme activities. FEBS Lett 2011; 585: 2660-2664. 41. Komatsuzawa, H., Fujiwara, T., Nishi, H., Yamada, S., Ohara, M. et al. The gate controlling cell wall synthesis in Staphylococcus aureus. Mol Microbiol. 2004; 53: 1221-1231.

42. Kohanski, MA., Dwyer, DJ., Hayete, B., Lawrence, CA., Collins, JJ. A common mechanism of cellular death induced by bactericidal antibiotics. Cell 2007; 130: 797-810. 43. Rigottier-Gois, L., Alberti, A., Houel, A., Taly, JF., Palcy, P. et al. Largescale screening of a targeted Enterococcus faecalis mutant library identies envelope tness factors. PLoS One 2011; 6: e29023. 4 4. Xie, J., Pierce, JG., James, RC., Okano, A., Boger, DL. A redesigned vancomycin engineered for dual D-Ala-D-ala And D-Ala-D-Lac binding exhibits potent antimicrobial activity against vancomycin-resistant bacteria. J Am Chem Soc. 2011; 133: 13946-13949.

Follow us:

Publish with iMedPub http://www.imedpub.com

Archives of Clinical Microbiology (ACMicrob) is a new peer-reviewed, international journal with world famous scientist on the editorial board. ACMicrob is an open access journal with rapid publication of articles in all fields and areas of microbiology and infectious diseases. ACMicrob covers all aspects of basic and clinical microbiology relevant to infectious diseases including current research on diagnosis, management, treatment, preventive measures, vaccination, and methodology. Clinical microbiology relevant inmmunology, pathophysiology, genetics, epidemiological, and genomics studies are also welcome.

Medicalia.org
Where Doctors exchange clinical experiences, review their cases and share clinical knowledge. You can also access lots of medical publications for free. Join Now! http://medicalia.ning.com/

Submit your manuscript here:

http://www.acmicrob.com

Copyright iMedPub

13