Sunteți pe pagina 1din 20

Obezitatea

n gene ???

LEP, LEPR, MC4R, POMC , PCSK1, BDNF, NTKR2, SIM1, GLP1,
SNR
Studiul factorilor genetici ai obezitatii au permis identificarea a
peste 70 gene , ale caror variatii predispun la aceasta maladie.
Astfel , 70% din variatia IMC sunt de origine genetica , chiar daca
impactul genelor poate diminua la indivizii care au adoptat o dieta
echilibrata si un regim de sport .
Doua idei favorabile se disting:
1)Nu suntem determinati de mediul ambiant sa devenim obezi ,
mai ales ca unii dintre noi sunt protejati de patrimoniul lor
genetic.
2)Chiar daca nu am mostenit lotul bun de gene , noi putem rezista
in fata acestui fenomen , dar si a pesimismului ambiant .
Unele forme de obezitate , uneori extreme , sunt legate de prezenta unei
mutatii pe o gena . Pina in prezent , opt gene au fost identificate (LEP,
LEPR, MC4R, POMC , PCSK1, BDNF, NTKR2, SIM1 ) care conduc la sinteza
unor proteine responsabile de cresterea in greutate, dar i de alte
neregulariti specifice.

GENELE asociate obezitii


Gena FTO


Cel mai relevant exemplu este gena FTO (descoperita de frnacezi
si apoi de englezi ) , despre care s-a aflat ca unele mutatii
determina cresterea pina la 67 % a riscului de obezitate ; 137%
pentru personale care prezinta mutatii pe ambele copii ale genei .
Actualmente , gena FTO este pricipala care predispune cel mai
mult in acumularea grasimii. Ea i mpiedic pe oameni s se
simt stui i i face s simt frecvent pofta de dulciuri i
mncruri grase, spun oamenii de tiin, care au descifrat recent
mecanismul prin care gena FTO influeneaz greutatea corporal.






http://www.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENS
G00000140718;r=16:53737875-54155853;t=ENST00000464071
Particulariti

Simbol:FTO
Descriere:fat mass and obesity associated(masa de grasime si obezitatea asociate )
Localizare:chr16:53737875-54155853

Promotorul genei
Cromozomul 16 secventa genei (exoni)
chromosome:GRCh37:16:53737275:54156453:1


TATGAAGCTAGCAAGTTATGGAGGTAATCACATGATAAACAAATAATATATAATTAAGCAAACAATAGACCACTCA
AGGTTTAGGGTCTACCAACCAACTCCTAATCCAGGGCAAATGAGCAAACTGTGTTAGGGACCTACAACTTGCAGGA
TCTGGATAGAGATGGCAATTAGCAGCATCAACTCTCACCTTCATGGCTGGGATATAACATTTCAAATTGGTCCTGG
ACGTGGGGATAAAGGGCGGCCTGTGATTCAGGCTGAGGATGTGGAGGTGTCTTGGGCTGGGCTGCTTTCACGCC
AGCAGAACTCCAGGGCCAACTCCAGGGCCTTCTCCAGGCGGCAGAGCGGACCCTAGGACCCCGGCCCGCGCTGC
AGTGGGGAGGGTCAGCAACCTCCACCCACCCTCATCCTCCCCCATCCTCCCGGGTACTCACCGTGCCACTGGCCC
TGCAGCTAGCTACCGTTGCTATAGCGCCGACAGCGTGGCGGGCGGCTGGCCGAGAGGAGCACGGGAGAAACT
GCAGGCCCCGTAGCCTCCTGGGAAATGTAGTTCTCCTTGGACTCTAGCCTGTTTGCTCGCGGGGTAGCGGACTAC
GCTCTTCCAGCTGTCGGACCTGGGAAATTCTCCTGTGCTAAATCCCGTGGCGCTCGCGGGTGTCGCGCGG
TGCATCCTGGGAGTTGTAGTTTTTTCTACTCAGAGGGAGAATAGCTCCAGACGGGAGCAGGACGCTGAG
AGAACTACATGCAGGAGGCGGGGTCCAGGGCGAGGGATCTACGCAGCTTGCGGTGGCGAAGGCGGCTTTA
GTGGCAGCATGAAGCGCACCCCGACTGCCGAGGAACGAGAGCGCGAAGCTAAGGTATGTCGGGCTCCCGGGGC
CTGGAGATCTTCGTGCGCTGTGAGCAAGGATCAGGGAACCGGAAGGGCTTGGTTTGATGGCGAGCGGATGCGCG
GTGTTAAACTAAGGGATGACAGGGCCTTGTCAGCAAGGGACCTGGAGATATTAGAGGGGATGTTACAAATTCGTG
CTCTTCAGGATGCAGGCCGAGTCTTGTTGGATCGGCTCAAAAATGAGAAGCAAGATACCCATTTCCTTGTCCTTCT
TCTGCATCTATTCCTTGGTTAAATTTGT..



http://www.ensembl.org/Homo_sapiens/Gene/Sequence?db=core;g=ENSG00000140718;r=16:537
37875-
54155853;t=ENST00000471389;t1=ENST00000471389;t2=ENST00000460382;t3=ENST00000463
855;t4=ENST00000431610;t5=ENST00000268349;t6=ENST00000394647
Secvena codificatoare
5' upstream sequence ..........gaaatgtagttctccttggactctagcctgtttgctcgcggggtagcgga

1. ENSE00001407106
CTACGCTCTTCCAGCTGTCGGACCTGGGAAATTCTCCTGTGCTAAATCCCGTGGCGCTCG
CGGGTGTCGCCGCGGTGCATCCTGGGAGTTGTAGTTTTTTCTACTCAGAGGGAGAATAGC
TCCAGACGGGAGCAGGACGCTGAGAGAACTACATGCAGGAGGCGGGGTCCAGGGCGAGGG
ATCTACGCAGCTTGCGGTGGCGAAGGCGGCTTTAGTGGCAGCATGAAGCGCACCCCGACTGCCGAGGAACGAGAGCGCGAAGCTAAG

Intron 1
gtatgtcgggctcccggggcctgga..........atatgtaattattattttcaaacag

2. ENSE00003499057
AAACTGAGGCTTCTTGAAGAGCTTGAAGACACTTGGCTCCCTTATCTGACCCCCAAAGAT
GATGAATTCTATCAGCAG

Intron 2
gtaaggtattttaatatttttatca..........tgtttttgctttggttttgttttag

3. ENSE00001319762
TGGCAGCTGAAATATCCTAAACTAATTCTCCGAGAAGCCAGCAGTGTATCTGAGGAGCTC
CATAAAGAGGTTCAAGAAGCCTTTCTCACACTGCACAAGCATGGCTGCTTATTTCGGGAC
CTGGTTAGGATCCAAGGCAAAGATCTGCTCA...
GGCATGGGGAAAATGGCAGTGAGCTGGCATGTGGCAGTGTACAGTTATAGCTGTGAAG

Intron 3 gtacagtctgctcttggaaaaagca..........tgatcattttcttctcttttggcag

4. ENSE00003480244
GCCCTGAAGAGGAAAGTGAGGATGACTCTCATCTCGAAGGCAGGGATCCTGATATTTGGC
ATGTTGGTTTTAAGATCTCATGGGACATAGAGACACCTGGTTTGGCGATACCCCTTCACC
AAGGAGACTGCTATTTCATGCTTG

Intron 4
gtaatctttggaaaatcaaaattat..........tacatttctggtgtttttcctgtag

5. ENSE00003523757
ATGATCTCAATGCCACCCACCAACACTGTGTTTTGGCCGGTTCACAACCTCGGTTTAGTT CCACCCACCGAGTGGCAGAG

Intron 5
gtaagtgtaaataaaaatgtgattc..........gtgattgctggttctgtctcaacag


Intron 5
gtaagtgtaaataaaaatgtgattc..........gtgattgctggttctgtctcaacag

6. ENSE00003575733
TGCTCAACAGGAACCTTGGATTATATTTTACAACGCTGTCAGTTGGCTCTGCAGAATGTC
TGTGACGATGTGGACAATGATGATGTCTCTTTGAAATCCTTTGAGCCTGCAGTTTTGAAA
CAAGGAGAAGAAATTCATAATGAG

Intron 6
gtaaggactttcttttttttttttt..........accatcttctctttatggtccacag

7. ENSE00003604517
GTCGAGTTTGAGTGGCTGAGGCAGTTTTGGTTTCAAGGCAATCGATACAGAAAGTGCACT
GACTGGTGGTGTCAACCCATGGCTCAACTGGAAGCACTGTGGAAGAAGATGGAGGGTG

Intron 7
gtaagtccatcagacctgggaccgt..........ctctgttttggatcatttcttgtag

8. ENSE00003492841
ACAAATGCTGTGCTTCATGAAGTTAAAAGAGAGGGGCTCCCCGTGGAACAAAGGAATGAA
ATCTTGACTGCCATCCTTGCCTCGCTCACTGCACGCCAGAACCTGAGGAGAGAATGGCAT
GCCAG

Intron 8
gttagttctgttgtgaaatgggatt..........taatttcctatttttactcttccag

9. ENSE00001946879
GTGCCAGTCACGAATTGCCCGAACATTACCTGCTGATCAGAAGCCAGAATGTCGGCCATA
CTGGGAAAAGGATGATGCTTCGATGCCTCTGCCGTTTGACCTCACAGACATCGTTTCAGA

.....................................................................................................................GGTCCAGGGCAGGCGACAGGAACGAGCCCAGCGT
GTGACAAAGCCTAACCTACTTTCCTC TTTCCCAAGCTTTTTCAGAGACTCTGGAGTGGACCCAGCCCTCTGGGGAAAGACAGAACT
..
CCAGAAGCCCCGGCTCTTAGAGTTTCTATTAAGATGTACCTCATAAATATATACGCCTCC
TATGTACCCACAAAAATTAAAAATAAAAAAATTGAAATCA

3' downstream sequence
ctcatttatgcttggtgttatgattgtaactaagaatcctggagtgagct..........
Transcripia genei
In acest proces participa mai multi factori de transcriptie care se ataseaza
de promotorul genei si permit initierea si reglarea acesteia:

Egr-1 , FOXD3 ,NF-AT ,MEF-2A , S8 , NF-AT2 , FOXA2 , aMEF-2 ,
NF-AT1 , FOXO1 , Sp1










USF (upstream stimulatory factor ) factor de stimulare
TSS situs de start al trancriptiei
Processing-ul
In rezultatul spliceng-ului se formeaza 9 transcripturi
(datorita tipurilor de splicing )


Name Transcript ID Length (bp) Protein

FTO-001 ENST00000471389 11766 ENSP00000418823
FTO-005 ENST00000463855 3056 ENSP00000417843
FTO-008 ENST00000268349 2799 ENSP00000268349
FTO-002 ENST00000460382 1517 ENSP00000417422
FTO-201 ENST00000394647 1065 ENSP00000378142
FTO-006 ENST00000431610 707 ENSP00000415636
FTO-003 ENST00000464071 1065 ENSP00000418424
FTO-007 ENST00000472835 847 No protein product
FTO-009 ENST00000570395 555 No protein product
Transcript: FTO-001 ENST00000471389



Exons: 9 Coding exons: 9 Transcript length: 11,766 bps Translation length: 505 residues
(number of amino acids in the protein)


Transcript: FTO-008 ENST00000268349



Exons: 3 Coding exons: 3 Transcript length: 2,799 bps Translation length: 129 residues

Transcript: FTO-007 ENST00000472835




Exons: 2 Coding exons: 0 Transcript length: 847 bps


Transcript: FTO-003 ENST00000464071 (previne expresia proteinelor eronate)




Exons: 8 Coding exons: 3 Transcript length: 1,065 bps Translation length: 70 residues (number
of amino acids in the protein)
Rol Biologic :

Niv. molecular : codifica sinteza proteinelor : ENSP00000418823 , ENSP00000417843 ,
ENSP00000268349
Niv. celular : dezvoltarea si mentinerea tesutului adipos

Niv. de organism : aparitia obezitatii si a altor maladii grave ( diabet , schizofrenie )



Procesele Biologice :

- homeostazia temperaturii

- reglementarea de cretere a organismului

- reparatia ARN

- reglementarea sistemului respirator

- dezvoltarea tesutului adipos

- reglementarea proliferarii celulelor adipoase albe

- demetilarea oxidativa

- demetilarea AND-ului


Studii independente au demonstrat ca lipsa unui fragment din cromozomul 16
(16p11.2 ) mariste cu 50% riscul de a deveni obez . De asemenea , lipsa
acestui fragment este asociata cu autism , schizofrenie ,retard mental
caracteristici relevate la majoritatea indivizilor obezi in cadrul unui stiudiu .
Nucleozide N6-methyladenosine, o modificare n ARN, s-a dovedit a fi un
substrat major al genei FTO.



Regiunea defecta a cromozomului 16 implica mai multe
gene , printre care SH2B1 , care se manifesta in replicarea
fenotipului obezitatii. Acesta gena codifica o proteina care
interactioneaza cu un regulator al receptorului pentru
leptina . Pacientii care au aceasta gena inactiva , manifesta
o reziztenta mare pentru insulina si un exces de leptina
hormon produs in straturile de grasime care stimuleaza
apetitul .


Colectivul german, a constatat ca in absenta genei FTO,
soarecii de laborator nu s-au ingrasat de loc, chiar si dupa
ce au primit si consumat hrana in cantitati mari, si in
pofida faptului ca au fost lasati sa leneveasca. Concluzia
preliminara ar fi aceea ca in celulele soarecilor fara FTO,
grasimile sunt transformate in energie mai repede decat in
cazul soarecilor care dispun de o gena FTO activa.
Oamenii care au aceast variant (botezat de
cercettori gena obezitii sau gena foamei)
tind s mnnce mai mult i, cel mai adesea,
eueaz n ncercarea de a pierde n greutate prin
diet.


Potrivit unui studiu , unii dintre noi, pur i simplu
sunt programai biologic s mnnce mai mult.
Nu numai c aceste persoane au niveluri mai
mari de grelin i de aceea se simt mai flmnde,
dar creierele lor reacioneaz diferit la grelin (un
hormon secretat de stomac, care stimuleaza
apetitul) i la vederea imaginilor cu alimente.
Este o dubl problem .
SPORT vs GENOM
Persoanele sedentare care prezint o singur variaie a
genei FTO au cu 30% mai multe anse s devin obeze, pe
parcursul vieii. n schimb, persoanele cu aceeai
caracteristic genetic dar care sunt active fizic i reduc
riscurile cu 8%. Exerciiile fizice asociate cu o alimentaie
echilibrat ajut i mai mult la "pclirea" genelor,
reducnd pericolul ngrrii cu 27%.
n cazul persoanelor care au dou variaii ale genei FTO, ce
prezint aproape 70% risc de obezitate, exerciiile fizice au
reuit s scad acest pericol cu 21%.
Oamenii de tiin caut n prezent dovezi care s
demonstreze c att stilul de via, ct i genele cauzeaz
obezitatea i ncearc s afle modul n care activitatea fizic
poate atenua predispoziia genetic.
"Sportul nu neutralizeaz total predispoziia genetic
la ngrare, dar studiul arat c programarea
genetic nu este liter de lege i nu conduce
neaprat la obezitate", a declarat coordonatorul
cercetrii, prof. dr. Ruth Loos.
Specialitii n educaie fizic i sport, precum i medicii
epidemiologi recomand persoanelor predispuse genetic la
obezitate s fac minimum o or de sport pe zi.
O alimentaie sntoas i un regim de soprt

echilibrat contrabalanseaz loteria genetica !!!