Sunteți pe pagina 1din 38

Pus la punct de ctre K. Mullis i echipa sa.

Nu se foloseau ADN
polimeraze termostabile i nici aparate automate pentru reproducerea
ciclurilor de temperatur.
Publicarea cercetrilor se face n 1985.
n 1991 apare primul numr dintr-o revist consacrat n ntregime
tehnicii PCR (PCR - Methods and Applications).
n 1993, Mullis primete Premiul Nobel pentru Chimie.
Tehnica PCR (Polymerase Chain Reaction) variante i
aplicaii
TEHNICI IN BIOLOGIA MOLECULARA
Practic are loc amplificarea unui fragment dintr-o matri ADN utiliznd
primeri sintetici desemnai pe baz de complementaritate.
Numrul de copii ale secvenei alese pentru amplificare este dublat la
fiecare replicare.
Principiu
5
5
3
3
d
.
NTP
Polimeraz termostabil,
tampon PCR, MgCl
2
Primers
5

Se adaug ADN i
mixul de reacie, 4
o
C
Denaturare, 95
o
C
5
3
5
3
5

Tub de reacie
Taq
Etapele reaciei PCR
Taq
Extindere (72
o
C)
5 3
5 3
5 3
5 3
5 3
5 3
5
5
Taq
Taq
3
5 3
Taq
5
5
Etapele se repet
Anelare (51-61
o
C)
Componentele reaciei PCR
Matria ADN
Poate proveni dintr-o mare varietate de probe
biologice.
Trebuie s aib un grad nalt de puritate
verificare spectrofotometric (A260/A280).
Cantitatea necesar poate scdea forensic,
ADN fosil, amplificarea fragmentelor marcate
fluorescent, esuturi mparafinate.

ADN polimeraza
Polimeraze termostabile
Taq/Amplitaq ADN polimeraza izolate din Thermus aquaticus,
modificat i clonat n E. coli. Vitez 35-100 nucleotide pe secund,
T optim 70-80oC, activitate 5-3 exonucleazic.
Pfu ADN polimeraza izolat din Pyrococcus furiosus, are activitate 5-3
i 3-5 exonucleazic (proof reading), specificitate de 10 ori mai mare
dect Taq polimeraza, utilizare n reaciile de secveniere.
Tth ADN polimeraza izolat din Thermus thermophilus, modificat i
clonat n E. coli, n prezena ionilor de Mn poate fi folosit ca i
reverstranscriptaz, iar n prezena ionilor de Mg i reia activitatea ADN
polimerazic.
Enzima Activitate
3-5
exonucleazic
Activitate
5-3
exonucleazic
Stabilitate termic
(minute trecute pn
la njumtirea
activitii enzimatice)
Viteza de
sintez a noii
catene (dNTP/
secund/mol)
Taq ADN polimeraza absent prezent 40 60 la 95
o
C 60 - 150
Tth ADN polimeraza absent prezent - 25
Pfu ADN polimeraza
(forma nativ sau
recombinant)
prezent absent 1140 la 95
o
C 60
Tli polimeraza (Vent
Polimeraza)
prezent absent 402 la 95
o
C 67
Tbr ADN polimeraza
(Dynazyme)
absent prezent 150 la 96
o
C -
Platinum Pfx prezent absent 720 la 95
o
C 100 300
Platinum Taq absent prezent 96 la 95
o
C 60 150
AdvanTaq polimeraza absent absent 40 la 95
o
C 40
Mth polimeraza prezent absent 12 la 75
o
C -
Amestec de nucleotide
Sunt livrate fie separat, sub form de soluii stoc de dATP, dCTP, dGTP
i dTTP, fie sub form soluie amestec a celor patru nucleotide.
Concentraiile optime depind de lungimea fragmentului ce trebuie
amplificat i de numrul de cicluri de amplificare.
Soluia tampon a polimerazei
Conine TRIS, HCl, KCl i are pH 8,3.
Exist i variante de tampon care includ clorura de magneziu.
MgCl
2
Ionii de magneziu sunt activatori ai polimerazelor. Ionii de magneziu sunt activatori ai polimerazelor.
Ap ultrapur Nuclease Free

Primeri
Reguli de desemnare a primerilor:
- sunt complementari cu matria ADN;
- au de obicei ntre 18 i 33 de nucleotide;
- este recomandat s conin un numr egal din cele 4 baze;
- trebuie evitat formarea de structuri secundare la nivelul lor;
- trebuie evitat formarea de dimeri ntre primeri;
- fragmentul amplificat trebuie s aib maxim 1500 pb, pentru un PCR
normal;
- trebuie optimizat Ta (Anneling Temperature) pentru a obine o
amplificare corect.
Primeri degenerai
Prescurtare standard Nucleotide corespunztoare
R G + A
Y T + C
S G + C
W T + A
K G + T
M A + C
D G + T + A
H T + A + C
B G + T + C
V G + A + C
N G + A + T + C
Principalele probleme ale Principalele probleme ale tehnicii PCR tehnicii PCR
Contaminarea matriei ADN sau a reactivilor folosii.
- Lipsa amplificrii.
- Imposibilitatea obinerii fragmentelor de interes.
Lipsa de fidelitate a polimerazei.
- ncorporarea greit a unor baze.
Amplificrile parazite.
- Obinerea de produi secundari de amplificare.
Variante ale tehnicii PCR Hot Start PCR
Principiul acestei variante este de a aduga polimeraza dup o prim etap de
denaturare. Astfel denaturarea poate fi mai lung n timp i permite o bun
separare a matriei ADN, fr a altera polimeraza.
La ora actual exist enzime (AmpliTaq Gold) modificate genetic care au
nevoie de o prim etap de activare la 95
o
C.
Nested PCR
Nested PCR
Const n realizarea a dou
amplificri succesive,
utiliznd dou perechi
diferite de primeri, dintre
care a doua flancheaz o
secven inclus n cea care
a fost amplificat cu prima
pereche.
RT-PCR
Se pornete de la ARNm. Utilizeaz la
nceput o revers transcriptaz care copiaz
ARN ntr-un ADNc. Apoi urmeaz o reacie
PCR clasic folosind drept matri ADNc.
PCR Multiplex
n acest caz, n reacie se introduc mai multe perechi de primeri. Acest lucru
permite amplificarea mai multor secvene de intres n acelai timp. Necesit o
calculare foarte precis ramp time i a Ta pentru fiecare pereche de primeri.
Touchdown PCR
Tehnica urmrete eliminarea la maxim a amplificrilor nespecifice.
Se pornete de la temperaturi crescute de hibridizare n primele cicluri, acestea
scznd treptat ctre sfritul reaciei. De asemenea, se folosesc diverse
substane cu rolul de a elimina suprancolcirile ADN din zonele bogate n GC.
PCR-RFLP (Restriction Fragment Lenght
Polymorphism)
Izolarea i purificarea ADN: se poate face din probe de snge, fire de
pr, material seminal, etc. cu ajutorul kiturilor sau a procedeului
clasic de extracie.
Puritatea i concentraia ADN extras: este verificat
spectrofotometric (DO260/280 nm).
ADN izolat este amplificat prin PCR.
Ampliconii rezultai sunt supui digestiei enzimatice cu ajutorul
enzimelor de restricie.
Vizualizarea produilor rezultai n urma digestiei se face prin
electroforez n gel de agaroz sau de poliacrilamid.
Diferenierea ntre dou
alele prin PCR-RFLP
Tehnica Real-Time PCR cantitativ
Reacia PCR este o reacie n lan deci produsul unui ciclu de amplificare servete
ca substrat pentru urmtorul ciclul.
Cantitatea de produs de reacie (amplimer) crete exponenial i nu linear
In condiii teoretice, ideale, cantitatea de produs se dubleaz la fiecare ciclu de
amplificare, conform ecuaiei 1:
2
0
2 = N N
(1)
N = numrul de molecule amplificate dup n cicluri
N
0
= numrul iniial de molecule ADN
Abateri de la ecuaia (1) sunt datorate n principal eficienei amplificrii (E)
Eficiena amplificrii (E)-fracia de amplimer replicat n decursul fiecrui ciclu de
amplificare. Experimental s-a determinat c eficiena amplificrii este mai mic dect
100% i ca urmare s-a introdus n ecuaia procesului PCR (1) sub forma:
( )
n
E N N + = 1
0
Eficiena amplificrii poate fi influenat de:
natura secvenei int (structuri secundare locale care defavorizeaz replicarea),
natura primerilor (temperatura de hibridizare a acestora, complementaritatea fa de
secvena recunoscut i stabilitatea legrii la aceast secven
lungimea secvenei de amplificat,
prezena impuritilor
calitatea ADN polimerazei termostabile folosite.
n condiii experimentale identice, apar variaii de la reacie la reacie, aa numitele
variaii tube-to-tube, datorate variaiilor de transfer termic. Experimental E variaz de la
0,46 la 0,99 pentru gene diferite i ntre 0,8 i 0,99 n cazul n care aceeai gen a fost
amplificat n condiii identice.
Pentru fiecare pereche de primeri i ADN int trebuie determinat eficiena
amplificrii.
(2)
Cinetica reaciei PCR (amplificarea unui fragment ADN int) poate fi urmrit n
timp real (Real-Time PCR) prin introducerea n amestecul de reacie a unor
fluorocromi (compui fluoresceni care se excit i emit cuante de energie la anumite
lungimi de und).
Tehnic permite cuantificarea cantitii iniiale a fragmentului ADN int dintr-o
prob.
Marcarea specific fluorescent a ADNdc se poate realiza prin mai multe metode,
cea mai simpl metod este utilizarea unui fluorocrom, de exemplu SYBR Green I,
care se intercaleaz ntre bazele azotate ale ADNdc i astfel intensitatea
fluorescenei crete direct proporional cu acumularea ampliconilor n timpul reaciei
PCR.
Principiul reacie Real-Time PCR
Fazele reacie Real-Time PCR
Reacia Real-Time PCR prezint patru faze:
n prima faz sau faza liniar care dureaz aproximativ 10-15 cicluri n funcie de
cantitatea de ADNdc iniial i/sau nivelul de exprimare al genei int, fluorescena
emis nu depete valoarea zgomotului (background).
n faza exponenial timpurie, nivelul fluorescenei atinge un prag (threshold)
care depete considerabil nivelul background-ului. Ciclul la care fluorescena
ampliconului depete considerabil nivelul de background se numete threshold
cycle (Ct sau CP). Valoarea Ct este invers proporional cu cantitatea iniial de
ADN int din proba de analizat.
n timpul fazei trei-exponenial sau logaritmic liniar, cantitatea de amplicon
se dubleaz la fiecare ciclu n condiii ideale
n ultima faz, cea de platou, reactanii devin limitai i msurarea fluorescenei
nu se mai justific.
Secven
Secven

ierea
ierea - determinarea structurii
primare (ordinii nucleotidelor) la nivelul
unei REGIUNI din ADN sau ARN;
Iniial Fred Sanger: metoda chain-termination;
- Maxam-Gilbert: metoda degradrii chimice;
Metode moderne secvenierea automatizat:
i) metoda dye-terminator (Sanger);
ii) secvenierea de nou generaie
(NGS New Generation Sequencing);
24
Metoda Sanger (dye-terminator): principiu
Utilizeaz o ADN polimeraz modificat
pentru a sintetiza o caten complementar
monocatenei ADN ; ADN Pol adaug
nucleotide noi la captul 3 al primerului
complementar cu catena matri.
Utilizeaz dideoxinucleotide (ddNTP),
caracterizate prin lipsa gruprii OH la
C3 al deoxiribozei;
Adugarea unui ddNTP la nivelul noii
catene = stoparea extensiei catenei.
dd NTP fr gruparea OH n poziia 3.
26
Deoarece ddNTP nu posed -
OH (care permite nucleotidelor
s se ataeze la o caten ADN
n cretere), sinteza este
stopat.
27
PCR
Purificare ampliconi
PCR secveniere
Purificare produi secveniere
28
ETAPE DE LUCRU
PREGTIREA
PROBELOR
Injecia probelor;
Separarea fragmentelor prin
electroforeza capilara;
Excitarea fluorocromilor;
Fluorescena emis de marcatorii
fluoresceni este separat n funcie
de lungimea de und i colectat de o
camer special (CCD);
Semnalul brut rezultat este
prelucrat cu un software special
rezultand o electroforegram
corespunztoare secvenei analizate.
29
Electroforeza
capilar
25
dATP
dTTP
dCTP
dGTP
ddATP
ddTTP
ddCTP
ddGTP
A - T - G - A - T - C - C - A - T - G - A - T - A - G - C
T - C - T - A - C - G
A - T - G - A - T - C - C - A - T - G - A - T - A - G - C
C - T
A - T - G - A - T - C - C - A - T - G - A - T - A - G - C
C - T -
A -
T
A - T - G - A - T - C - C - A - T - G - A - T - A - G - C
C - T - A
Matria ADN
T - A - C - T - A- G - G - T - A -
T - A - C - T - A- G - G - T - A -
T - A - C - T - A- G - G - T - A -
T - A - C - T - A- G - G - T - A -
Primer
P
C
R

S
E
C
V
E
N

I
E
R
E
Separarea fragmentelor
de ADN m.c.
n funcie de mrime
31
Electroforeza capilar
T - A - C - T - A- G - G - T - A - C - T - A - T - C - G
T - A - C - T - A- G - G - T - A - C - T - A -T - C
T - A - C - T - A- G - G - T - A - C - T - A -T
T - A - C - T - A- G - G - T - A - C - T - A
T - A - C - T - A- G - G - T - A - C -
T
T - A - C - T - A- G - G - T - A - C
Matrice de separare:
gel sau polimer;
Rezoluie 1 pb.
32
Sistem automat de
umplere cu polimer
Recipient polimer
Anod
Fereastr de detecie
Dispozitiv pentru ncarcare
probe, catod
Cuptor
Sistemul
de capilare
3130 Genetic Analyzer (Applied Biosystems)
33
Sistem cu 4 capilare
Sistem cu 16 capilare
Lungimi diferite:
- 22 cm
- 36 cm
- 50 cm
- 80 cm
- Diametrul interior:
50 m
- Pentru cel putin 100
de teste;
34
Capilarul i electrodul sunt
introduse n tubul ce conine
proba ADN de secveniat.
Se aplic un anumit voltaj.
Fragmentele ADN marcate
fluorescent ptrund n capilar i
migreaz ctre anod (+), situat la
cellalt capt al capilarului.
Capilar
Electrod (Catod)
Injecia
probelor
35
Detecia
semnalului
fluorescent
Laser
Energie
C
C
D
Electrophoresis
+
-
dye
Semnalul fluorescent emis de
fragmentele ADN marcate
fluorescent la nivelul celulei de
detecie este colectat de o camer
CCD (charge-coupled device).
36
Analiza i
prelucrarea
datelor
Vizualizarea datelor cu aplicatia
Sample Manager View.
Aplicaiile secvenierii
Secveniere de-novo Resecveniere
Scop: obinerea de secvene noi;
Probe: 500-900pb; BAC; Probe: produi PCR;
Rezulatat: adugarea de secvene Rezultat: detecie SNP.
noi n bazele de date.
GenBank
CTACTCCGTTCGCCCTTCGTTCTGGGT
CTACTCCGTTCGCCCTTCGTTCTGGGTGT
Scop: indentificarea variaiilor
existente ntre secvena consens
i secvena de referin;
Aplicaiile resecvenierii:
SNP: identificare/ validare;
Subtipizarea unor tulpini patogene: HCV;
Genotipare & identificare alele: HLA;
Medicin legal: ADNmt;
Genotipare CpG (metilare ADN).