Sunteți pe pagina 1din 44

ADN

SUBSTRATUL MOLECULAR
AL EREDITII
(stocarea i exprimarea informaiei)

Importana biomedical a acizilor


nucleici: baza chimic a ereditii
Un clugr din secolul XIX pe nume Gregor
Mendel a introdus pentru prima oar noiunea de
gen: unitate de baz responsabil pentru
deinerea i transmiterea a unei caracteristici
unice.
Iniial s-a crezut c proteinele car informaia
genetic, pn la mijlocul secolului XX, cnd s-a
descoperit c ADN-ul este baza ereditii, datorit
faptului c este capabil de auto-replicare.

Acizii nucleici = ADN-ul i ARN-ul


ADN
sediul principal al
localizrii ADN-ului
este nucleul celulelor.
sedii secundare :
mitocondriile i
cloroplastele (n celula
vegetal).

ARN
diferitele tipuri de
ARN sunt localizate n
nucleu, citoplasm,
mitocondrii, ribozomi.

Dogma Central a geneticii moleculare

DNA

Acid dezoxiribonucleic

Propus de ctre Francis Crick n


1958 pentru a descrie fluxul
informaiei genetice n celul.
Informaia depozitat n ADN este
transferat ARN-ului, care mai
departe o transfer proteinelor.

RNA

Protein

Acid ribonucleic

Dogma Central propus de Crick a


suferit numeroase revizii n ultimii 47
de ani.

Dogma Central a Geneticii


ADN

ARN
Transcriere

proteine
Traducere

transcrierea = transferul informaiei genetice de la


ADN la ARN (sintez de ARN pe matri de ADN)
traducerea = transferul informaiei genetice de la
ARN la proteinele functionale, a cror secven de
aminoacizi este codificat n structura ADN-ului.
replicarea = transferul informaiei genetice de la
celula mam la celulele-fiice prin copierea ADNului parental cu formarea a dou molecule de ADN
cu structur identic ADN-ului parental

Dogma Central Revizuit


Recombinarea=
reaaranjarea
materialului genetic
Recombination
Mutation/Repair

Mutaii/Reparare =
lezarea ADN cu
alterarea informaiei
genetice/ corectarea
leziunilor ADN
Revers- transcrierea =
transferul informaiei
genetice de la ARN la
ADN

Acizii nucleici (ADN/ARN)


polinucleotide = produi de policondensare a unor uniti
denumite nucleotide

nucleotidele = unitatea monomeric a ac. nucleici compuse din:


- o baz azotat heterociclic:
- purine: adenin (A) i guanin (G)
- pirimidine: citozin (C) i timin (T) pt ADN
citozin (C) i uracil (U) pt ARN
- o pentoz:
- dezoxiriboza (ADN)
- riboza (ARN)
- fosfat

Pirimidine
Citozina
NH2

Timina

Uracil

4
5

H3C

NH

NH
2

NH
1

NH

NH

atomii heterociclului pirimidinic sunt numerotai de la 1


la 6 astfel nct atomii de N din ciclu s primeasc
indicele minim

Purine
Adenina

Guanina

NH2

6
1

N
2

N
3

NH

HN
H2N

NH

atomii heterociclului purinic sunt numerotai de la 1 la 9


astfel nct atomii de N din ciclu s primeasc indicele
minim

Pentoze
Riboza
HO CH
5 2

Dezoxiriboza

OH
O

HO CH2

OH
O

OH OH

OH

lipsete
2-OH

atomii de carbon ai pentozelor sunt numerotai de la 1 la


5
n ADN - dezoxiriboza (creia i lipsete gruparea
hidroxil 2-OH)
n ARN - riboza.

Nucleozid = baz + pentoz


derivai ai bazelor azotate cu o
pentoz legat de un atom de azot
din heterociclu (N9 pt.purine; N1
pt. pirimidine) printr-o legtur N-glicozidic.
Legtur
-N-glicozidic

Nucleotid = nucleozid + 1, 2, 3 gr.fosfat


(leg. esteric ntre fosfat i 5-OH)

Mononucleotide (nucleozid-monofosfat) = nucleozid + 1 fosfat


Nucleozid-difosfat = nucleozid + 2 fosfat

Nucleozid-trifosfat = nucleozid + 3 fosfat

Terminologie comparativ
Ribonucleotide

Dezoxiribonucleotide

Adenozin monofosfat
(AMP) sau adenilat

Dezoxiadenozin monofosfat
(dAMP) sau dezoxiadenilat

Adenozin difosfat
(ADP)

Dezoxiadenozin difosfat
(dADP)

Adenozin trifosfat

Dezoxiadenozin trifosfat
(dATP)

Funciile fiziologice ale nucleotidelor


Crmizi pentru sinteza acizilor nucleici
Compui macroergici care furnizeaz energia
necesar diferitelor procese biologice (ex. ATP,
GTP)
Reglatori alosterici ai diferitelor enzime (ex.ADP
e activator alosteric al ICDH din ciclul Krebs)
Donori de grupe metil (ex. S-adenozilmetionina)
Mesageri intracelulari ai hormonilor hidrofili
(ex. AMPc, GMCc)

STRUCTURA ADN
1. structura primar
2. structura secundar
3. structura teriar

James Watson
Francis Crick
1962 Nobel Prize

http://www.sciencemag.org/cgi/content/full/300/5617/255
http://www.lecb.ncifcrf.gov/~toms/icons/Watson.Crick.Nature.jpg

STRUCTURA PRIMAR A
ADN-ULUI

HN
H2N

Lanul polinucleotidic al ADN


(structura primar/covalent)

Guanine

ADN este un
polidezoxiribonucleotid:
5' end HO CH 2
O
NH2
gruparea 3OH a unui
Cytosine
1
dezoxiriobonucleotid este
N
legat la gruparea 5OH a
O
dezoxiriobonu-cleotidului
N
O
3linkage
vecin printr-o legtur fosfat
CH 2
O P O
O
diesteric.
O
Lanul polinucleotidic este
5linkage
polar = prezint dou capete
O
distincte.
O P O
Captul 3este cel cu gruparea
O
3-OH liber.
O
Thymine
H3C
Captul 5este cel cu gruparea
NH
5-OH liber sau fosforilat.
Lanul polinucleotidic al ADN
NH
O
este ncrcat negativ la pH-ul
CH 2
O P O
O
fiziologic.
O

OH
3' end

Reprezentare simplificat a lanului ADN

Guanine
N

HN
H2N

5' end HO

CH 2

NH2

Cytosine

N
O
O P O

OH

Pentoza: linie orizontal

N
CH 2

Baza: litera corespondent

Leg. fosfodiesteric:

linie oblic i P la mijloc

3 G
P

3 C
P

O P O
O

O
H3C

Thymine
NH

NH

O P O

CH 2

O
OH
3' end

3
OH

Reprezentarea simplificat a catenei de ADN


O

Guanine
N

HN
H2N

5' end HO

CH 2

Prin convenie o caten de ADN


se scrie n direcia 5- 3

NH2

Cytosine

N
O
O P O

N
CH 2

ex. GCT nseamn 5GCT 3

O
O

O P O
O

O
H3C

Thymine
NH

NH

O P O

CH 2

O
OH
3' end

Exemplu de secven nucleotidic


1 gggcccggat
61 tttaaaaatg
121 tctttgacct
181 ataaagaggt
241 catttttcca
301 ataaagaact
361 atgtttacat
421 aaagatacac
481 tgattacctg
541 gtcttgctct
601 cacctcccgg
...........

catggcagtg
tgtgtgtgtg
agtagttcca
atctataggc
aaaataaggg
atgaatccat
gatgttacta
atacatacac
tggatactag
gtcaaccctg
gttcaagcaa

cactccagcc
tgtataagtg
cttccagaaa
agcatgtgta
gtggggagaa
gaaagtaatg
aattgaaaaa
acagtgaaaa
gactagaatg
gctagagtgc
ttcttgcacc

tgagcaagag
atttgataac
tttaacctta
taaaaacaag
aatagaaaat
atgtaaaaga
taaaaaatat
aggattataa
aaatatttca
agtggcacaa
tcagcctccc

agtaagcctc
caaatcaaaa
ggaaataaac
gggaaaagct
aaagtaggca
atatttaaag
ggtctaattt
acttaagcac
tttatttatt
tctcggttca
gcgtagctgg

STOCAREA INFORMAIEI

tgactctatt
ttttacataa
atgaatatga
gggaggccaa
cattaatagg
acatggagag
tagttttata
atcataaatg
tggagacgga
ctgcaacctc
gattacaggt

STRUCTURA SECUNDAR
A ADN

Dublu helixul ADN


Watson i Crick au decoperit c structura
secundar a ADN este un dublu helix format
din dou catene de ADN asociate prin
mperecherea bazelor
Inelele glucidice legate prin resturi fosfat
constituie scheletul extern al dublu helixului, n
timp ce bazele azotate hidrofobe sunt orientate
spre interior i perpendicular pe axa helixului.
ADN-ul uman conine aproximativ 3,5 x 109
perechi de baze.

Dublul helix al ADN


(structura secundar)
Stabilitatea ADNdc este
asigurat de:
- interaciunile hidrofobe
dintre bazele azotate
suprapuse (stivuite) de pe
aceeai caten
- leg. de hidrogen ce se
stabilesc ntre bazele
azotate de pe o caten i
cele complementare de pe
cealalt caten.
Cele dou catene de ADN
sunt complementare i
antiparalele.

ADN dublu helix


(structura secundara)
G-C are 3 legturi de H.
A-T are 2 legturi de H.
Cele dou catene sunt
complementare (G e
complementar C, A e
complementar T).
nr. A = nr. T
nr. G = nr. C

ntrebare
1. Scriei catena ADN complementar cu urmtoarea
caten: ATTTTAAGCTAAGGCCCTTT
2. Calculai numrul de legtuiri de H existent ntre
cele dou catene de ADN complementare.
3. Specificai ce baz exist la captul 3al fiecrei
catene.

Exist mai multe confomaii ale


ADN:
-

conformaia B (Watson i Crick):


dublu helix de dreapta, pasul
dublu helix = 34 (3,4 nm),
diametrul 2 nm, nr. perechi baze
per tur este 10; cea mai
rspndit.

conformaia A: dublu helix de


dreapta dar mai compact, pasul
elicei = 2,8 nm, nr. perechi baze
per tur este 11.

conformaia Z: dublu helix de


stinga, pasul elicei = 4,56 nm, nr.
perechi baze per tur este 12.

STRUCTURA TERIAR A
ADN

De la ADN la cromozomi
In eucariote ADN-ul este stocat n nucleu.
Deoarece nu este suficient spaiu iar molecula
ADN-ului este extrem de mare (lungimea ADN de
la o singur celul uman e 2 m!!!), ADN-ul
trebuie compactat.

Cum se mpacheteaz 2 metri de ADN


n cromozomii metafazici?

6 nivele de impachetare:

1.
2.
3.
4.
5.
6.

NUCLEOSOMUL
FIBRA DE 10 nm
FIBRA DE 30 nm
FIBRA DE 300 nm
FIBRA DE 700 nm
CROMOZOMUL
(1400 nm)

n urma mpachetrii, o molecul de ADN


- se ngroa de 700 de ori
- se scurteaz de 10 000 de ori

Nivelele de compactare
a ADN n nucleu
-Primul nivelr

Dublul helix de ADN se


nfoar n jurul unui octamer
proteic format din histonefiecare unitate de ADN
spiralat de 1,75 ori n jurul
unui compelx histonic se
numete nucleozom.
Histonele sunt proteine bazice
cu mas molecular mic
(max. 20.000), bogate n aa
bazici (Arg pt.H2A, H2B i,
Lys pt H3, H4).

Nivelele de compactare
a ADN n nucleu
-Primul nivel

n jurul octamerului histonic


(H2A H2B H3 H4) x 2 este spiralat
ADN-ul nucleozomic fomat din 140
perechi de baze.

Nucleozomii sunt legai ntre ei prin


ADN intrenucleozomic sau ADN
linker format din 30 perechi de
baze).Histona H1 interactioneaz cu
ADN linker, avnd rol n
superspiralizarea nucleozomilor.

Polinulceozomul seamn cu nite


mrgele pe a (= fibrile de
cromatin de 10nm ).

Aparena de
mrgele pe a a
ADN

Nivelele de compactare
a ADN n nucleu
-al doilea nivel Polinucleozomul se
superspiraleaz pentru a
forma structura de solenoid.
Solenoidul conine 6-7
nucleozomi per tur.Pasul e de
10 nm, diametrul de 30 nm.
Solenoidul formeaz fibrele
de cromatin de 30 nm.

Nivelele de compactare
a ADN n nucleu
-nivelele 3,4 i 5r
- Fibrele de cromatin se compacteaz
i mai mult form domenii n form de
bucl.
- Aceste domenii n bucl sunt
superspiralizate i organizate n
structuri distincte numite cromozomi.
- ADN -ul uman nuclear ( genomul)
const n 23 perechi de cromozomi.

NIVELE DE MPACHETARE A ADN

ADN

Nucleosom

Fibra de 300 nm

fibra de 10 nm

fibra de 700 nm

fibra de 30 nm

cromozom metafazic

EXPRIMAREA INFORMAIEI

TRANSCRIPIA

ARE LOC
N NUCLEU

transcrierea informaiei de pe catena ADN


pe o caten ARN nou-sintetizat, numit ARN mesager (ARNm)
Enzima ARN polimeraza ADN dependent

ARE LOC
TRANSLAIA
N CITOSOL SAU TRADUCEREA
LA NIVELUL Sinteza de proteine
RIBOZOMULUI(nlnuirea aminoacizilor
conform informaiei din ARNm
i CODULUI GENETIC

codon

ARNm

3 nucleotide

anticodon

ARNt

Un aminoacid

dipeptid

CODUL GENETIC

Khorana i Nirenberg, NOBEL 1968

PROPRIETILE CODULUI GENETIC

Este triplet (4 =3 64 combinaii)


Are un codon Iniiator/Start (AUG), trei codoni Stop
(UAA,UAG,UGA) codoni nonsens i 61 de codoni sens
Este degenerat (redundant) Codoni sinonimi, excepie Met i Trp
(mutaii silenioase)

Este nesuperpozabil i fr virgule mutaii misssens (un singur aa)


mutaii nonsens (codon STOP)
frame-shift (ir de aa)

Este lipsit de ambiguitate


Este universal Excepie codul genetic mitocondrial
Inginerie genetic

Bibliografie
Covic M. et al, Genetica medical

Cap. 2 Structura i organizarea celular a ADN


pag. 17 31

Cap. 4C Mecanismele moleculare ale expresiei genice


pag. 115 127

Diferena dintre celulele diploide i


celulele haploide
Majoritatea celulelor eucariote conin
perechi de cromozomi i sunt astfel
denumite diploide.
Celulele care conin cromozomi nepereche
sunt denumite haploide.

Cromozomii genomului uman