Sunteți pe pagina 1din 234

Segunda edicin

Barsallo Cabrera Ferrer


MANUAL de talleres y laboratorios de BIOLOGA 10

Vistenos en:
www.pearsoneducacion.net

Segunda edicin

ISBN: 978-607-32-0393-7

MANUAL de talleres y laboratorios de

BIOLOGA

10

T. E. Barsallo
D. F. Cabrera
L. E. Ferrer

Manual de talleres
y laboratorios de
BIOLOGA 10
Segunda edicin

Tayra Elizabeth Barsallo Marengo


Magster en Educacin con Especializacin en Investigacin y Docencia de la Educacin Superior
Profesora de Biologa
Instituto Justo Arosemena
Ciudad de Panam
Diana Francia Cabrera Chifundo
Magster en Administracin y Gestin de Centros Escolares
Profesora de Biologa
Instituto Jos Dolores Moscote
Ciudad de Panam
Lidia Esther Ferrer Vega
Magster en Educacin con nfasis en Administracin Educativa
Profesora de Biologa
Instituto Jos Dolores Moscote
Ciudad de Panam

ZZZPHGLOLEURVFRP
Prentice Hall

Datos de catalogacin bibliogrfica


BARSALLO, CABRERA y FERRER
Manual de talleres y laboratorios de Biologa 10.
Segunda edicin
PEARSON EDUCACIN, Mxico, 2011
ISBN: 978-607-32-0393-7
rea: Ciencias
Formato: 2127 cm

Pginas: 232

Este libro es una adaptacin autorizada de la edicin original titulada: Biologa 10 Manual de talleres y laboratorios,
2 ed. de Tayra Elizabeth Barsallo Marengo, Diana Francia Cabrera Chifundo y Lidia Esther Ferrer Vega; publicado por Pearson Educacin de Mxico S.A. de C.V., publicado como PRENTICE HALL, Copyright 2009.
ISBN 978-607-442-184-2.
Todos los derechos reservados.
Editor:

Melvin Nez Vquez


melvin.nunez@pearsoned.com
Editor de desarrollo:
Claudia Celia Martnez Amign
Supervisor de produccin: Enrique Trejo Hernndez
SEGUNDA EDICIN, 2011
D.R. 2011 por Pearson Educacin de Mxico, S.A. de C.V.
Atlacomulco 500-5 Piso
Industrial Atoto
53519, Naucalpan de Jurez, Estado de Mxico
Cmara Nacional de la Industria Editorial Mexicana. Reg. nm. 1031.
Prentice Hall es marca registrada de Pearson Educacin de Mxico, S.A. de C.V.
Reservados todos los derechos. Ni la totalidad ni parte de esta publicacin pueden reproducirse, registrarse o transmitirse, por un sistema de recuperacin de informacin, en ninguna forma ni por ningn medio, sea electrnico,
mecnico, fotoqumico, magntico o electroptico, por fotocopia, grabacin o cualquier otro, sin permiso previo
por escrito del editor.
El prstamo, alquiler o cualquier otra forma de cesin de uso de este ejemplar requerir tambin la autorizacin
del editor o de sus representantes.
ISBN 978-607-32-0393-7
Impreso en Mxico. Printed in Mexico.
1 2 3 4 5 6 7 8 9 0 14 13 12 11

Prentice Hall
es una marca de

www.pearsoneducacion.net

ISBN 978-607-32-0393-7

Contenido

Prefacio v
Manual de talleres y laboratorios de Biologa 10
Prctica 1

Materiales de laboratorio 1

Prctica 2

El microscopio compuesto y su uso 5

Prctica 3

Las tcnicas microgrficas 11

Prctica 4

La lupa binocular o estereomicroscopio 17

Prctica 5

Ramas de la biologa y ciencias auxiliares 23

Prctica 6

Sopa de especialidades cientficas 27

Prctica 7

Caractersticas de los seres vivos 29

Prctica 8

Adaptaciones de los seres vivos 33

Prctica 9

Cmo empez la vida: creencias y teoras 37

Prctica 10

Teoras sobre el origen de la vida 41

Prctica 11

La biognesis 45

Prctica 12

Mtodo cientfico

Prctica 13

La bibliografa 53

Prctica 14

Los cmics

Prctica 15

Los compuestos orgnicos 63

Prctica 16

Crucigrama de las molculas biolgicas 73

Prctica 17

Las molculas orgnicas y su importancia en la nutricin 75

Prctica 18

Movimiento molecular 81

Prctica 19

Estructura de las clulas eucariticas 85

Prctica 20

Clula animal 89

Prctica 21

Clula vegetal 93

Prctica 22

Sopa eucaritica 97

Prctica 23

Extraccin de ADN 99

49

57

iii

Contenido

Prctica 24

Construyamos un modelo de ADN 103

Prctica 25

Sntesis de protenas

Prctica 26

La mitosis 113

Prctica 27

La meiosis 119

Prctica 28

Mitosis y meiosis 123

Prctica 29

El cncer 127

Prctica 30

Las leyes de la probabilidad 131

Prctica 31

Las leyes de la herencia 135

Prctica 32

Gentica, dominancia y recesividad 139

Prctica 33

Cromosomas sexuales femeninos 143

Prctica 34

Variaciones sobre el tema mendeliano 147

Prctica 35

Problemas de gentica 151

Prctica 36

Hominizacin 157

Prctica 37

Evidencias de la evolucin 165

Prctica 38

Seleccin natural 169

Prctica 39

Adaptaciones al ambiente 173

Prctica 40

Clasificacin 179

Prctica 41

Clasificacin de los organismos 185

Prctica 42

Clave taxonmica 191

Prctica 43

Factores abiticos 195

Prctica 44

Factores fsicos y biolgicos de diversos biomas terrestres 199

Prctica 45

Biomas y ecosistemas 203

Prctica 46

Los niveles trficos 207

Prctica 47

Cadena alimentaria 211

Prctica 48

Red alimentaria 215

Prctica 49

Sopa reproductiva 219

Prctica 50

Las enfermedades de transmisin sexual 221

Bibliografa 225

iv

109

Prefacio

En sus inicios, el hombre tena que observar, analizar y probar los fenmenos y cosas que ocurran a su alrededor. Deba aprender de sus experiencias, y transmita estos conocimientos por medio de la demostracin directa a sus congneres; es decir,
experimentando y repitiendo lo aprendido. Esa forma emprica se ha transformado
y formalizado en el mtodo cientfico. La historia de la ciencia se ha caracterizado porque la mayor parte de los conocimientos se fundamenta en dicho mtodo: una
vez que se haca la observacin de un hecho, se formulaba una teora y se construa
un modelo, el cual se deba comprobar por medio de reproducciones a escala bajo
condiciones controladas, que nosotros conocemos como experimento.
Son varias las ciencias experimentales: la fsica, la qumica, etc. La biologa es
una de las ms completas, pues incluye o emplea conocimientos de todas las anteriores, como auxiliares, y adems se apoya de otras ciencias que usa como herramientas, como las matemticas. Las ciencias experimentales se distinguen porque
contienen una parte terica que se deriva de la experimentacin, por lo cual, para
entender con mayor claridad los conceptos tericos debemos remitirnos a los experimentos prcticos. Sin embargo, en la enseanza de la biologa es muy comn
darle mayor peso a la parte terica, debido a la poca cantidad de prcticas que se
realizan o que estn presentes en los manuales de laboratorio.
Este manual propone un esquema que trata los puntos generales del mtodo
cientfico, lo que le permite al estudiante iniciar la aplicacin de conceptos cientficos, el desarrollo de sus habilidades en el manejo del instrumental bsico de laboratorio, la investigacin, el manejo de datos experimentales, el trabajo en equipo
y la capacidad para poder integrar su experiencia con el conocimiento adquirido en
la clase terica.
Tayra Elizabeth Barsallo Marengo
Diana Francia Cabrera Chifundo
Lidia Esther Ferrer Vega

Materiales de
laboratorio

Prctica

1
INTRODUCCIN
El laboratorio es el lugar donde se llevan a cabo trabajos experimentales de carcter cientfico.
En el caso concreto de un laboratorio de escuela secundaria es el lugar donde,
tanto profesores como alumnos, realizan experiencias de investigacin y demostraciones relacionadas con el curso de biologa.
Se utiliza una amplia variedad de instrumentos o herramientas que en conjunto se denominan materiales del laboratorio de biologa.
Difcilmente se podra describir su montaje completo sin incurrir en el olvido de
alguna pieza; sin embargo, en todo buen laboratorio hay que considerar siempre
salas, instalaciones e instrumentos.
Los instrumentos y aparatos deben estar ubicados de manera que se encuentren al alcance de los estudiantes, a fin de evitar desplazamientos innecesarios.
Todos los materiales que se usan tienen un fin especfico, y el empleo adecuado de ellos requiere ciertos cuidados para evitar que se deterioren o se destruyan;
asimismo, es conveniente limpiarlos y acomodarlos en un lugar especial de acuerdo con las indicaciones del profesor(a) antes y despus de utilizarlos.

OBJETIVOS

MATERIALES Y REACTIVOS

Identificar el material que se usa en el laboratorio de biologa


Describir el uso de cada uno de sus materiales

Figuras de los materiales y aparatos del


laboratorio de biologa
Hojas blancas de 8 1/2  11 pulgadas
Tijeras
Goma

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
A continuacin se presenta un listado de los materiales del laboratorio de biologa, que est clasificado segn el material que lo constituye.
1. Materiales de madera
-Gradilla.
-Horquillas.
2. Materiales de vidrio
-Probetas graduadas.
-Pipetas serolgicas.
-Tubos de ensayo.
-Vasos qumicos.
-Frasco gotero.
-Varillas agitadoras.
-Cajas de Petri.
-Embudo.
-Vidrios reloj.
-Matraces.
-Erlenmeyer.
-de Florencia.
-Portaobjetos.
-Cubreobjetos.
-Pipeta volumtrica.
3. Materiales de porcelana
-Cpsula para evaporacin.
-Mortero y piln.
-Crisol con tapa.
4. Instrumental
-Estuche de diseccin.
(Tijeras, aguja, pinza, bistur)
-Termmetro.

-Gotero.
5. Limpieza
-Brochas lavadoras.
-Detergente.
-Papel toalla.
-Pao para limpiar.
6. Material de goma
-Tapones de hule.
7. Material de metal
-Asa bacteriolgica.
-Trpode.
-Soporte universal.
-Pinzas.
-Esptula.
-Malla con asbesto.
-Bandeja para diseccin.
8. Calentamiento
-Plancha caliente.
-Mechero.
9. Sustancias
-Colorantes.
-Indicadores.
-Otros reactivos.
10. Materiales pticos
-Lupa.
-Microscopio compuesto.
-Lupa binocular.

1. Tu profesor(a) te mostrar los materiales y mencionar sus respectivos nombres, as como


el uso de cada uno en el laboratorio.
2. Divide una hoja de 8 1/2  11 pulgadas en cuatro partes iguales, en cada parte, dibuja un
instrumento de laboratorio, pon su nombre arriba y abajo explica para qu sirve.
Nombre
Figura
Uso

Nombre
Figura
Uso

Nombre
Figura
Uso

Nombre
Figura
Uso

a. Utiliza las hojas necesarias de acuerdo con la cantidad de materiales proporcionados en la


lista.

PRCTICA 1

Materiales de laboratorio

PREGUNTAS
1. Cmo debes comportarte en el laboratorio?
__________________________________________________________________________________
2. Escribe algunas de las recomendaciones que debes seguir para desempear adecuadamente el trabajo en el laboratorio.
__________________________________________________________________________________
3. Cules son los aspectos que se requieren para mantenerlo limpio y ordenado?
__________________________________________________________________________________
4. Qu cuidados son necesarios para la conservacin de los aparatos y el material de vidrio utilizados?
__________________________________________________________________________________

CONCLUSIONES:

Prctica

El microscopio compuesto
y su uso

2
INTRODUCCIN

El microscopio es un instrumento diseado para examinar objetos que no pueden


verse a simple vista. Sin su ayuda, el ojo humano no podra distinguir objetos menores a 0.1 mm. El microscopio compuesto est constituido por la combinacin de
dos sistemas de lentes convergentes y divergentes: uno prximo al ojo del observador, por lo cual se llama ocular, y otro prximo al objeto, denominado objetivo.
Tambin est constituido por partes mecnicas (tornillos y soporte), partes pticas
(objetivos) y partes de iluminacin (lmpara, diafragma, condensador).
La utilizacin del microscopio implica una preparacin especial de la muestra
que vamos a observar porque la luz tiene que pasar a travs de ella para que nuestros ojos la puedan observar.

OBJETIVOS

MATERIALES Y REACTIVOS

Conocer el uso y cuidados del microscopio


Identificar, nombrar y sealar las funciones de
las diferentes partes del microscopio
Aprender a preparar y enfocar una placa
hmeda

Microscopio
Papel peridico
Bistur
Gotero
Porta y cubreobjetos
Vidrio-reloj
Hojas de alguna planta
Hilos azul y rojo
Papel de lente
Palillos de dientes

PROCEDIMIENTO
A. Observa los distintos elementos del microscopio y anota las funciones de las partes del microscopio compuesto.
B. Las siguientes indicaciones te ayudarn a cuidar y utilizar correctamente el microscopio.
Para transportar el microscopio se recomienda utilizar siempre las dos manos, sujetndolo por el
brazo con una mano y sostenindolo por el pie o base con la palma de la otra mano.
1. Se debe desplazar en posicin vertical
para evitar la cada del ocular.
2. Coloca el microscopio sobre la mesa de
trabajo.

3. El brazo tiene que quedar hacia el observador. El aparato debe apoyarse correctamente hacia el centro de la mesa.

Biologa 10. Manual de talleres y laboratorios

4. El observador debe situarse siempre de espaldas a cualquier lmpara potente de luz


(Sol, luz general del laboratorio) ya que as
se evitan los reflejos y el objeto de estudio
queda ms contrastado y se reduce la fatiga visual del observador.
5. Al principio de la observacin selecciona
el objetivo de menor aumento y al terminar de usar el microscopio asegrate de
que el revlver tenga en posicin de
enfoque el objetivo 4X.
6. Al cambiar los objetivos, un ruido avisa
cuando el objetivo encaja en su lugar, alineado perfectamente con el tubo ptico.
7. Al efectuar el primer enfoque, el objetivo
tiene que estar muy cerca de la preparacin sin llegar a tocarla. Se coloca en esta
posicin mirando lateralmente el microscopio. Para enfocar, el desplazamiento del
tubo ptico se efecta de abajo hacia arriba. Debes evitar tocar la preparacin con la
lente de los objetivos.
7.1. Enciende la lmpara y abre el diafragma.
La luz debe permanecer apagada mientras el microscopio no est en uso. La
cantidad de luz (regulada por el diafragma) debe ser directamente proporcional
al aumento usado.

7.2. Mira por el lente del ocular, ajusta el diafragma para que todo el campo microscpico sea igualmente iluminado y evitar
el deslumbramiento.
7.3. Coloca la muestra y sujtala con las pinzas.
7.4. Asegrate de que el tubo del microscopio
llegue a su posicin ms baja con la
ayuda del tornillo micromtrico.
7.5. Enfoca con el tornillo macromtrico
hasta obtener una imagen ms o menos
clara. Recuerda que para enfocar con el
tornillo macromtrico debes bajar el tubo
mirando de lado y no por el ocular.
7.6. Afina la imagen con el tornillo micromtrico para obtener detalles a varios niveles.
7.7. Si cambia a alto poder, gira lentamente el
revlver y coloca el objetivo deseado en
posicin. No mires a travs del ocular,
mira el revlver para asegurarte de que
el objetivo no toca la preparacin. Luego
afina la imagen con el tornillo micromtrico.
7.8. Terminada la observacin, apaga la fuente luminosa y sube el ptico; o baja la
platina y retira la preparacin.

Mover siempre lenta y suavemente cualquier elemento del microscopio.


Utiliza papel de seda fina especial o gamuza para lentes para la limpieza del ocular y los
objetivos.
C. Uso del microscopio con diferentes preparaciones
1. Prepara un montaje hmedo de la letra h.
Corta un fragmento de peridico donde se encuentre la letra h.
Coloca la letra en el portaobjetos y luego agrega una gota de agua, cbrela con un cubreobjetos, evita que se formen burbujas.
Procede a observar la preparacin con el objetivo de 10x y el de 40x.
Observa la posicin de la letra h con respecto a su colocacin sobre la platina, el movimiento de la letra al desplazarla de arriba hacia abajo, hacia la derecha y hacia la izquierda. Dibuja y explica lo observado.

100 X

400X

PRCTICA 2

El microscopio compuesto y su uso

2. Observacin de una clula


Pon una gota de solucin de azul de metileno diluido en un portaobjetos.
Abre la boca y con la parte plana de un palillo de dientes raspa la cara interna de tu mejilla.
Coloca el contenido del raspado que hiciste sobre el portaobjetos, golpeando suavemente
el palillo en la gota de colorante, y cubre la preparacin con un cubreobjetos. Observa a travs
del microscopio con los objetos de 10x y 40x. Dibuja lo observado.

3. Preparacin de una placa con dos hilos (azul y rojo)


Coloca sobre el portaobjetos dos hilos (azul y rojo) de manera que se crucen entre s, aade una
gota de agua y coloca el cubreobjetos.
Enfoca con el objetivo de bajo poder, ahora mueve el micromtrico y describe qu observas.
Dibjalo. Identifica qu hilo est superpuesto.

4. Medicin del campo visual del microscopio


Con el objetivo de bajo poder haz un dibujo del campo del microscopio, colocando una regla
sobre la platina, mide el campo observando por el ocular.
Cuntos milmetros mide?_________________________________

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. De qu partes del microscopio depende la correcta iluminacin de la preparacin?
__________________________________________________________________________________
__________________________________________________________________________________
2. Por qu la imagen que se obtiene en el microscopio compuesto es invertida?
__________________________________________________________________________________
__________________________________________________________________________________
3. Cul es la utilidad del portaobjetos y el cubreobjetos?
__________________________________________________________________________________
__________________________________________________________________________________
4. Qu papel desempean en el funcionamiento del microscopio los tornillos macromtrico y
micromtrico?
__________________________________________________________________________________
__________________________________________________________________________________
5. Por qu se llama microscopio compuesto?
__________________________________________________________________________________
__________________________________________________________________________________
6. Por qu es importante el cuidado del microscopio?
__________________________________________________________________________________
__________________________________________________________________________________
7. Qu es un montaje hmedo?
__________________________________________________________________________________
__________________________________________________________________________________
8. Cmo vara el campo de visin en cada cambio de objetivo?
__________________________________________________________________________________
__________________________________________________________________________________
9. Cmo se calcula el aumento total del microscopio?
__________________________________________________________________________________
__________________________________________________________________________________

PRCTICA 2

El microscopio compuesto y su uso

a) Qu combinaciones de aumentos (del ocular, del objetivo) pueden hacerse con el microscopio de que dispones?
__________________________________________________________________________________
__________________________________________________________________________________
10. Cules son las utilidades del carro mecnico de la platina?
__________________________________________________________________________________
__________________________________________________________________________________
11. A continuacin aparece un esquema del microscopio compuesto. Indica las partes que lo integran.

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

10

Prctica

Las tcnicas
microgrficas

3
INTRODUCCIN

Las tcnicas microgrficas son los distintos mtodos que se requieren para poder
observar en el microscopio las estructuras celulares.
La clula puede ser estudiada bajo diversos aspectos: morfolgicos, qumicos y
fisiolgicos.
Las preparaciones se llevan a cabo con el portaobjetos; es lo primero que se necesita para poder hacer observaciones al microscopio, luego se usar la tcnica que
se requiera.
Debido a la transmisin de la luz en el microscopio, las tcnicas de observacin
exigen que los objetos a estudiar respondan a ciertas condiciones.
Para que la luz pueda atravesarlo deben tener poco espesor (del orden de algunas micras), por lo que hay que efectuar cortes muy finos. La observacin al microscopio slo proporciona informacin si ciertas regiones del objeto absorben luz
mejor que otras, es decir, si el objeto presenta contrastes, en general los constituyentes celulares tienen muy pocos contrastes uno con respecto a otros, por lo cual
es necesario usar ciertos artificios para aumentarlos; por ejemplo, se crean artificialmente ciertos contrastes realizando combinaciones entre los constituyentes
qumicos celulares y productos que absorban ciertas longitudes de onda de la luz,
llamados tcnicas de tincin.
Los cortes de algunas micras de espesor slo pueden efectuarse si la dureza de
la muestra es apropiado. Si la muestra es muy blanda, es necesario endurecerla artificialmente para poder cortarla. Esto se puede lograr actuando sobre el constituyente ms abundante de las clulas, que es el agua, hacindola pasar del estado lquido al slido y congelando la clula por medio de la tcnica de congelacin, o
bien, sustituyndola por otro lquido que pueda ser endurecido en ciertas condiciones. Esto se conoce como el mtodo de inclusin.
Sin embargo, estos mtodos que permiten endurecer las clulas alteran en modo considerable su organizacin. Por eso es necesario consolidar previamente las
estructuras por medio de una serie de operaciones que constituyen la fijacin. Es
un tratamiento fsico o qumico efectuado sobre clulas vivas, que permite ciertas
manipulaciones posteriores con un mnimo de alteracin en las estructuras celulares y mantener su morfologa.
Si las preparaciones quieren conservarse de forma permanente se les llaman
preparaciones permanentes, y las que son para uso slo del momento son las preparaciones temporales.
Hay un gran nmero de mtodos y tcnicas para la observacin de la gran cantidad de materiales biolgicos. El ms simple es el montaje simple en un portaobjetos con cubreobjetos, usando un colorante vital y observndolo al microscopio;
y uno ms complejo sera, la fijacin - inclusin - corte - coloracin - montaje - sellado.
En el laboratorio se trabaja con material biolgico del nivel celular, por lo que
se hace necesario el uso de algunas tcnicas microgrficas para poder hacer observaciones ms precisas.

11

Biologa 10. Manual de talleres y laboratorios

OBJETIVO

MATERIALES Y REACTIVOS

Conocer algunas tcnicas microgrficas bsicas para el laboratorio de biologa.

Microscopio
Yogurt
Hojas de diversas plantas
Flores de diversas plantas
Portaobjetos y cubreobjetos
Juego de diseccin
Hojas de plantas
Orcena asptica
Hematoxilina
Alcohol etlico
Blsamo de Canad
Alas de mariposa
Cinta adhesiva transparente
Palillos de dientes que tengan un extremo
plano
Metanol al 95%

PROCEDIMIENTO
Preparaciones
1. Montaje en seco
Corta un pedacito del ala de una mariposa,
de ser posible, que sea de las que tienen
bellos colores. Ponlo sobre el portaobjeto y
fjalo con papel adhesivo transparente, observa y dibuja. Luego levanta la cinta adhesiva, en ella quedarn pegadas las escamas
del ala.
Sacude los fragmentos de la misma, vuelve
a pegar el papel adhesivo al portaobjetos.
Observa y dibuja.

12

Puedes montar de esta forma todas las


preparaciones que requieran pequeos aumentos y tengan poco espesor.
2. Montaje con agua
Limpia el portaobjetos, coloca unas gotas
de agua y sobre ellas una pequea cantidad de un raspado suave del envs de una
hoja. Con cuidado deja caer el cubreobjetos
procurando que no aparezcan burbujas de
aire. stas se pueden eliminar con la ayuda
de la aguja de diseccin o levantando de
nuevo el cubreobjetos, si ellas aparecen
porque el portaobjetos tiene grasa, hay que
volverlo a lavar y hacer nuevamente la preparacin. Observa con los objetivos de 10X
y 40X. Dibuja.

PRCTICA 3

Las tcnicas microgrficas

Observars abundante Bacillus bulgariens,


si hubiera contaminacin, hallars estreptococos. Es imprescindible utilizar el objetivo de mximo aumento.

100 X

B. Tejido epitelial. Mucosa bucal


Raspa la cara interna de tu mejilla con un
palillo.
Extiende las clulas sobre un portaobjetos
limpio.
Fijacin con metanol al 95% durante el frotis, espera 15 minutos. Retira el exceso de
alcohol.
Scalo al aire (para mayor rapidez abanica
el portaobjetos).
Sumerge durante cinco minutos en orcena
actica al 2%.
Lava con agua por ambos lados del portaobjetos, a fin de quitar el exceso de colorante.
Seca al aire.
Observa al microscopio con el objetivo de menor aumento, localiza la zona que deseas estudiar. Observa con el objetivo de 40X. Dibuja.

400X

3. Teido y montaje con agua


Algunos de los colorantes que se emplean
son: azul de metileno, lugol, hematoxilina,
acetocarmn, etctera.
A. Bacterias del yogurt
Se extiende un poco de yogurt en un portaobjetos con la ayuda de otro, despus se
pasa por la llama del mechero rpidamente. Aade azul de metileno y djalo actuar
durante cinco minutos. Lava, para eliminar
el exceso de azul de metileno. Procede a
observar al microscopio con el objetivo de
10X, 40X, 100X. Dibuja.

C. Observacin de granos de polen


Toma una flor y sacdela sobre un vaso
qumico con alcohol al 70%.
Esto debe hacerse 24 horas antes de realizar la experiencia.
Lava con agua, pero antes retira el alcohol
y seguidamente adale el agua.
Coloca los granos de polen sobre un portaobjetos, pon el cubreobjetos. Observa y
dibuja.
D. Observacin de la epidermis de una hoja
Pellizca con las pinzas de diseccin la epidermis de una hoja. Si lo has realizado
correctamente, la epidermis arrancada pre-

13

Biologa 10. Manual de talleres y laboratorios

senta un aspecto translcido y uniforme.


Introduce en agua la epidermis de la hoja
para que recobre la posicin normal.
Recorta la epidermis en pequeos rectngulos.
Utiliza uno o dos para colocarlos sobre el
portaobjetos.
Agrega hematoxilina.
Djala actuar por 10 minutos.
Lava minuciosamente con agua, quta el exceso de colorante. Seca por debajo con papel toalla.
Vierte una gota de agua, pon el cubreobjetos. Observa y dibuja.

PREGUNTAS
1. Por qu los cortes que se van a observar al microscopio deben tener poco espesor?

2. Cul es la funcin de los colorantes?

3. Qu es una preparacin temporal?

4. Qu es una preparacin permanente?

5. Para qu se usa la tcnica de congelacin?

6. Cul es la importancia de la fijacin cuando se est trabajando con alguna tcnica microgrfica?

14

PRCTICA 3

Las tcnicas microgrficas

CONCLUSIONES:

15

Prctica

Lupa binocular o
estereomicroscopio

4
INTRODUCCIN

El esteromicroscopio ampla el campo de la experimentacin visual. Su utilizacin


es ms sencilla que la del microscopio.
Consta de dos microscopios completos, cada uno con su objetivo y ocular en los
que al no coincidir sus ejes pticos, las imgenes formadas en los oculares son distintas, lo mismo que ocurre con la visin ocular, por lo que vemos una imagen en
tres dimensiones.
No debe confundirse este aparato ptico con los microscopios binoculares, ya
que en stos la imagen formada en un nico objetivo es desdoblada en dos imgenes idnticas por un prisma situado entre el objetivo y los dos oculares.
La mayora de las normas de cuidado, limpieza y transporte recomendadas para
el microscopio compuesto deben considerarse tambin al utilizar la lupa binocular.
Adems debes tener en cuenta que:
Moviendo los tubos oculares se busca la distancia interpupilar adecuada para
cada observador.
El tornillo de sujecin debe estar suficientemente apretado para evitar la cada
del brazo de la lupa.
Debe colocarse en la platina una placa de contraste, de color tal, que realce la
observacin.
Cuando se va a realizar una observacin con la lupa binocular, lo primero que
hay que hacer es fijar el objeto a observar sobre la platina de la lupa, sujetndola
con las pinzas. Enciende la lmpara. Con el objetivo, regula la altura mediante la
rueda micromtrica o cremallera situada en ambos lados de la lupa. As, se puede
enfocar el objeto a observar y apreciar sus caractersticas con claridad.
La lupa tambin dispone de un mecanismo para acomodar ambos ojos en unos
tubos, de la misma manera como se hace con unos binoculares, corrigiendo las variaciones de visin del observador. Para obtener imgenes muy ntidas del objeto a
observar es bsico y prctico el enfoque y el acomodo de la vista. Una vez conseguida la calidad de la imagen, debes observar las diferencias o los detalles.

OBJETIVO

MATERIALES Y REACTIVOS

Estudio de las caractersticas y manejo de la


lupa binocular.

Verde de metilo
Lupa binocular
Plato Petri
Gotero
Juego de diseccin
Agua de charco
Cebolla
Hojas de algunas plantas

17

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO

1. Identifica las partes de la lupa binocular.


1

1._________________________________

2._________________________________
3._________________________________
4._________________________________
6
5._________________________________
7
8

6._________________________________
7._________________________________
8._________________________________

9._________________________________
4
10

2. Observacin de la epidermis de la hoja de


una planta
Coloca una hoja de alguna planta sobre la
platina y sujtala con las pinzas. Mueve los
tubos oculares buscando la distancia interpupilar adecuada. Dibuja lo observado.

18

10._________________________________
3. Observacin de las clulas de la epidermis
de la cebolla
Parte una cebolla a la mitad y separa la
membrana transparente que est en la
parte interna de una de sus hojas.
Corta un trozo de ella con un bistur y colcala sobre el portaobjetos.
Agrega una gota de verde de metilo. Deja
actuar por cinco minutos. Luego, lava con
agua.
Coloca el portaobjetos sobre la platina.
Observa y dibuja.

PRCTICA 4

4. Observacin de un insecto
Inicia observando a simple vista un insecto. Anota todo y realiza una descripcin.
Dibuja lo mejor posible.

La lupa binocular o estereomicroscopio

6. Observacin de organismos unicelulares


Con la ayuda de un gotero coloca una gota
de agua estancada sobre un plato Petri.
Observa con la lupa binocular.
Identifica algunos organismos. Dibuja lo
observado.

5. Observacin del mismo insecto con la lupa


binocular
Coloca el insecto sobre la platina.
Mueve los tubos oculares buscando la distancia interpupilar adecuada.
Enfoca la imagen hasta que obtengas la
calidad de imagen deseada.
Dibuja los detalles que se observan.

19

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Cul es la distancia de trabajo de la lupa binocular en relacin con la del microscopio compuesto? Cmo ayuda esa distancia?

2. Cmo es la profundidad de campo?

3. Por qu no existe tornillo micromtrico?

4. Al desplazar un objeto observado, en qu sentido se mueve la imagen final? La visin del


objeto es por reflexin o por refraccin?

5. En qu parte de la lupa hay que distinguir la luz de la fuente luminosa?

6. Cules son las tres caractersticas de la imagen final?

7. Qu finalidad tiene el ocular ajustable?

8. Qu combinaciones de aumentos pueden hacerse en la lupa que hay en el laboratorio?

9. Haga un cuadro comparativo entre las partes pticas y mecnicas y el funcionamiento del
microscopio compuesto y el de la lupa binocular.

20

PRCTICA 4

La lupa binocular o estereomicroscopio

CONCLUSIONES:

21

Prctica

Ramas de la biologa
y ciencias auxiliares

5
INTRODUCCIN

La ciencia encargada del estudio de los seres vivos es la Biologa. A los seres vivos se
les llama tambin orgnicos, para poder diferenciarlos de los inertes o inorgnicos.
La Biologa est ntimamente relacionada con otras ciencias que la auxilian en
su estudio, y a su vez sta se subdivide en varios grupos que reciben el nombre de
Ramas de la Biologa.

OBJETIVO

MATERIALES Y REACTIVOS

Delimitar el campo de estudio de la biologa y


su relacin con otras ciencias.

Lpices de colores
Tijeras
Goma o pegamento

23

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
Completa el siguiente diagrama de las ciencias que auxilian a la Biologa. Anota los nombres que
faltan en las elipses y colorea.

FSICA

BIOQUMICA

BIOLOGA

BIOESTADSTICA

GEOGRAFA

24

PRCTICA 5

Ramas de la biologa y ciencias auxiliares

PROCEDIMIENTO
Coloca los nombres de las Ramas de la Biologa en el crculo interno. El profesor dar el nombre
de las ramas de la Biologa que seleccione.
Escribe el significado de cada una en los espacios ms grandes.

BIOLOGA

25

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

26

Prctica

Sopa de especialidades
cientficas

6
E

PROCEDIMIENTO
Localiza en la sopa de letras las siguientes especialidades cientficas y profesiones:

CARDIOLOGA
CIRUGA
DERMATOLOGA
ENDOCRINLOGO
FISIATRA
GERIATRA
GINECOLOGA

HEMATOLOGA
INFECTOLOGA
NEFROLOGA
NEUMOLOGA
NEUROLOGA
OBSTETRICIA
OFTALMLOGO

ONCOLOGA
ORTOPEDIA
PATOLOGA
PODIATRA
UROLOGA

27

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

28

Prctica

Caractersticas
de los seres vivos

7
INTRODUCCIN

No existe ninguna definicin sencilla de la vida. No es un concepto abstracto, puesto


que no existe vida sino seres vivos. Para diferenciar a stos de los objetos inanimados
se debe recurrir a un conjunto de caractersticas que les son particulares, como que
sus componentes estn organizados simultneamente en los niveles molecular, celular, organsmico y poblacional, presentar metabolismo (la habilidad para tomar la
materia y la energa del medio para transformarlas y satisfacer sus necesidades),
responder a estmulos (irritabilidad), tener movimiento, reproducirse, crecer y desarrollarse, adaptarse y evolucionar.
Todas estas funciones son comunes a todos los organismos; en ocasiones, algunos materiales o compuestos presentan algunas de estas caractersticas, por lo
cual se debe diferenciar con la mayor precisin posible si todas las caractersticas
mencionadas se encuentran presentes.

OBJETIVO

MATERIALES Y REACTIVOS

Conocer, a travs de la comparacin de los


sistemas vivos e inertes, las caractersticas de
los seres vivos, para comprender el objeto de estudio de la biologa.

Cuaderno de notas
15 semillas de lentejas
3 agujas de diseccin o esptulas
Agua
1 plato de plstico
1 g de cloruro de hierro III
Algodn
1 g de cloruro de cobalto
1 frasco de vidrio o un vaso de precipitados
1 g de sulfato ferroso
1 ml de solucin acuosa de silicato de sodio
(solucin coloidal)
Portaobjetos
Microscopio ptico
Cubreobjetos
Navaja o bistur

PROCEDIMIENTO
Desarrollo de plntulas
1. Coloca el algodn sobre el plato y satralo con agua, posteriormente coloca las se-

millas separadas e insrtalas firmemente


dentro del algodn.

29

Biologa 10. Manual de talleres y laboratorios

2. Mantenlas durante 10 das cerca de la luz,


vigilando que el algodn siempre est hmedo.
3. Realiza observaciones cada tercer da y regstralas en el cuadro 1, hasta que las plntulas se hayan desarrollado.
4. Por ltimo, ya en el laboratorio, coloca las
plntulas junto a una ventana durante 30
minutos, anota y dibuja lo que sucede.
5. Realiza un corte del tallo de la planta, colcalo en el portaobjetos y obsrvalo con
el microscopio.

Jardn qumico
6. En el frasco de vidrio o en un vaso de precipitados, vierte 100 ml de la solucin coloidal y colcala junto a una ventana.

7. Con ayuda de una aguja de diseccin, agrega cuatro cristales de cloruro de hierro III
y observa lo que sucede, a continuacin
agrega cuatro cristales de cloruro de cobalto y posteriormente cuatro de sulfato
ferroso, registrando tus observaciones en
el cuadro 2.
8. Evita movimientos bruscos del frasco.
9. Gira el frasco al lado contrario de donde
le d la luz, espera unos minutos y anota
y dibuja lo que sucede.
10. Toma una muestra de los cristales y colcala en un portaobjetos para observarla
con el microscopio.

Cuadro 1
Observaciones
Da
1
4
7
10

Cuadro 2
Observaciones
Cloruro de hierro III
Cloruro de cobalto
Sulfato ferroso

30

PRCTICA 7

Caractersticas de los seres vivos

PREGUNTAS
1. Qu caractersticas presentan en comn los datos de los cuadros 1 y 2?
2. Cul es la diferencia que se da en el elemento comn entre el sistema vivo y el inerte?
3. Con respecto a la reaccin a la luz, sta es la misma para ambos sistemas?
4. Con respecto a las observaciones en los microscopios, cul estructura corresponde de manera tpica a los seres vivos?

Bibliografa para consultar


Alexander, P. et al., Biologa, Prentice-Hall, Mxico, 1992.
Audesirk, T. et al., Biologa, la vida en la tierra, Prentice-Hall, Mxico, 2003.
Cervantes, M. y M. Hernndez, Biologa general, Publicaciones Cultural, Mxico, 1999.
CNEB, Biologa. Unidad diversidad y continuidad de los seres vivos, CECSA, Mxico.
Gavio, G. et al., Tcnicas biolgicas selectas de laboratorio y de campo, Limusa, Mxico, 2a Ed. 2001.
Nelson, E., Principios de biologa, Limusa, Mxico, 2002.
Villee, C. et al., Biologa, McGraw-Hill, Mxico, 1996.

31

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

32

Prctica

Adaptaciones de los
seres vivos

8
INTRODUCCIN

Las adaptaciones son estructuras, procesos fisiolgicos o conductas que ayudan a


la supervivencia y la reproduccin en un ambiente dado. Este ambiente no slo
comprende factores fsicos, sino, tambin, los dems organismos con los que el ser
vivo en estudio interacta.

OBJETIVO
Reconocer las adaptaciones que presentan
los organismos que les permiten incrementar
las posibilidades de supervivencia y reproduccin.

PREGUNTAS
1. Adaptaciones para conseguir alimentos
Para saber si alguna parte del cuerpo es una adaptacin, es necesario saber en qu medio habita el ser vivo, qu come y qu procedimientos realiza para hacerlo. En los siguientes esquemas
de crneo observa e identifica las partes que le sirven para conseguir su alimento.
Seala con una cruz el sitio donde se localiza la adaptacin.
Por qu crees que hay una adaptacin?
Cules son los seres vivos representados en estos esquemas?

33

Biologa 10. Manual de talleres y laboratorios

2. Adaptaciones al calor
Al realizar ejercicio fsico u otra actividad la temperatura del cuerpo se eleva.
Cmo se manifiesta en nuestro cuerpo esta sensacin de calor?
Cules son los rganos que permiten que nuestro cuerpo se mantenga fresco?
Por qu experimentamos esa sensacin de calor cuando hacemos ejercicio?

3. Adaptaciones en los vegetales


Los vegetales han desarrollado estructuras que facilitan su conservacin y les sirven para
protegerse o adaptarse al clima. Observa los esquemas y responde lo que se te pide.

Cul es la funcin de las espinas de una planta de rosal?

Qu tiene el girasol sobre la superficie de la hoja y para qu le sirve?

Cules son las adaptaciones que desarrollan los cactus y cul es su funcin?

34

PRCTICA 8

Adaptaciones de los seres vivos

4. Adaptaciones en los animales


De acuerdo con la ilustracin, seala los rganos que le permiten a cada animal adaptarse a su
medio y coloralos.

35

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

36

Prctica

Cmo empez la vida:


creencias y teoras

OBJETIVO
Discutir de manera crtica las teoras que aplican el origen de la vida.

PROCEDIMIENTO
1. Analiza la siguiente lectura e ilustra cada una de las creencias y teoras.
2. Contesta las preguntas.
Cmo empez la vida:
creencias y teoras
Cmo se origin la vida en la Tierra es una de
las preguntas ms fascinantes de la biologa y
constituye un gran reto. Se han propuesto muchas ideas, hiptesis y teoras, pero el misterio an no est resuelto.
Orgenes divinos. Es comn que en la historia registrada de las culturas humanas, exista la creencia de que la vida en la Tierra no
surgi espontneamente, sino que fue insuflada por un creador. Las principales religiones actuales ensean que un ser superior
cre la vida. Muchas personas encuentran imposible creer que la vida pudiera surgir sin la
intervencin de fuerzas ms all del entendimiento humano. La creacin divina es ms
una creencia que una teora cientfica, porque
es aceptada con base en la fe.
Origen extraterrestre. Esta teora sugiere
que la vida no empez del todo en la Tierra,
sino que fue trada por meteoritos (trozos de rocas transportados por el espacio que quedan
atrapados por la fuerza gravitacional de la Tierra. Probablemente, son los restos despedazados de cometas.) Los meteoritos contienen

cantidades pequeas de materia orgnica, lo


cual puede ayudar a explicar la forma como
entraron a los ocanos primitivos de la Tierra
las molculas orgnicas que son consideradas
necesarias para la formacin de las clulas
vivas.
La sopa primordial. La versin ms ampliamente aceptada entre los cientficos es
que la vida surgi por medio de procesos naturales. Esta teora propone que los ocanos
primitivos de la Tierra fueron una sopa primordial, llena de molculas orgnicas, y que la
atmsfera contena nitrgeno, metano, y amoniaco, pero no oxgeno. La energa proveniente
del Sol, los volcanes y los relmpagos impulsaron las reacciones qumicas que combinaron
estas molculas y gases en aminocidos, lpidos y otras molculas orgnicas complejas,
que se encuentran en las clulas vivas. Sin
embargo, hay puntos dbiles en esta teora.
De acuerdo con el registro fsil, la vida debi
desarrollarse ms rpido de lo que supone
esta teora, y algunos cientficos sospechan
que la atmsfera primitiva pudo no haber contenido amonaco ni metano.
La teora de la burbuja. A manera de sustitucin, esta teora postula que las reacciones

37

Biologa 10. Manual de talleres y laboratorios

qumicas de la sopa primordial se desarrollaron dentro de pequeas burbujas de lpidos


que fueron creadas por accin del viento, las
olas y la lluvia. Hay evidencia de que el metano
y el amonaco pudieron estar presentes dentro de estas burbujas de lpidos. Cuando las
molculas que reaccionan se mantienen cerca
en un espacio cerrado, las reacciones qumicas se llevan a cabo con mayor rapidez que
cuando las molculas estn en capacidad de
alejarse.
Un punto importante que se aplica a ambas
teoras cientficas descritas arriba, es que las
protenas, los lpidos y otras molculas orgnicas grandes tienden a amontonarse para formar esferas pequeas. Esta tendencia puede
representar el primer paso para la organizacin de molculas complejas en estructuras
que nosotros llamamos clulas: las unidades
bsicas de la vida.
La hiptesis del endosimbionte
Hace muchos aos, los cientficos notaron que
las cianobacterias y los cloroplastos se pareEvolucin de clulas animales y vegetales por
endosimbiosis

38

can. De la misma manera, vieron que las mitocondrias y las bacterias tambin tenan apariencia similar.
Estas observaciones clave llevaron a la hiptesis del endosimbionte. La hiptesis plantea que los eucariotas evolucionaron a travs
de relaciones simbiticas entre procariotas
primitivos.

Evolucin de clulas animales


y vegetales por endosimbiosis
Origen de la hiptesis del endosimbionte. En
1962, los cientficos descubrieron ADN en los
cloroplastos. Este descubrimiento condujo a la
biloga norteamericana Lynn Margulis a desarrollar la hiptesis del endosimbionte. A partir de
entonces, ella ha estado recogiendo evidencias que respalden la hiptesis. Otras observaciones incluyen el hecho de que los cloroplastos
y las mitocondrias tienen sus propios ribosomas,
y crecen y se reproducen de forma independiente de la clula en la que se encuentran, y que las
clulas no tienen medios para fabricar ni cloroplastos ni mitocondrias.
Evidencia estructural. Cmo desarrollaron
una relacin simbitica las cianobacterias y
las bacterias, y cmo empezaron a funcionar
como organelos celulares, es materia de amplia especulacin cientfica. Sin embargo, la
evidencia estructural que ha sido recopilada
indica que los ancestros de las mitocondrias y
los cloroplastos fueron una vez procariotas de
vida libre. Por ejemplo, las mitocondrias y las
bacterias pueden reproducirse a s mismas,
poseen cidos nucleicos similares, tienen aproximadamente el mismo tamao y la misma forma
y hacen sntesis de protenas en ribosomas.
Los cloroplastos y las cianobacterias tambin
comparten caractersticas importantes, de las
cuales la principal es la capacidad de llevar a
cabo la fotosntesis.

PRCTICA 9

Cmo empez la vida: creencias y teoras

PREGUNTAS
1. Confecciona un cuadro para conocer las fortalezas y debilidades de la teora de la sopa primordial, la teora de la burbuja y la teora del origen extraterrestre.
2. De qu manera se apoyan entre s las tres teoras?

3. Crees que sus debilidades tienden a apoyar la creencia de la formacin de la vida por medios divinos?

4. Hoy en da algunos procariotas viven en estrecha asociacin con eucariotas. Puede usarse
este hecho como evidencia para la hiptesis del endosimbionte? Explica tu respuesta.

39

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

40

Prctica

Teoras sobre el origen


de la vida

10
INTRODUCCIN

No se sabe cul fue la primera forma de vida. Lo nico que se puede hacer es formular una suposicin coherente acerca de sus caractersticas. Se plantea que la primera forma de vida fue el resultado de un conjunto de reacciones que sufrieron los
compuestos inorgnicos y que estos permitieron la formacin de la materia viva,
evolucionando hasta formar a los organismos actuales.

OBJETIVO

MATERIALES Y REACTIVOS

Interpretar algunas teoras sobre el origen de


la vida.

Pltano maduro
Frascos con tapa (2)
Etiquetas engomadas

PROCEDIMIENTO
A. Comprobacin de lo errneo de la Teora de la Generacin Espontnea.
1. Esteriliza los frascos (con agua hervida).
2. Etiqueta los frascos, anotndole los nmeros 1 y 2.
3. Coloca la mitad del pltano maduro en el
frasco nmero 1 y djalo destapado.
4. La otra mitad del pltano maduro colcala en el frasco nmero 2 y tpalo hermticamente.

5. Observa lo que pasa en ambos frascos


durante cinco das.
6. Registra tus observaciones diariamente,
en el cuadro.

41

Biologa 10. Manual de talleres y laboratorios

Da

Frasco 1

Frasco 2

B. Escribe las aportaciones de los siguientes investigadores en relacin con el origen de los
seres vivos:
1. Lzaro Spallanzani
2. Francisco Redi
3. Luis Pasteur
4. Alexis Ivanovich Oparin
5. Stanley L. Miller

42

PRCTICA 10

Teoras sobre el origen de la vida

PREGUNTAS
1. Cules son las diferencias que observaste en los frascos?
2. Por qu en el frasco nmero 2 no hay presencia de organismos vivos?
3. De dnde provinieron los organismos vivos del frasco nmero 1?
4. Analiza y concluye. Es acertada la Teora de la Generacin Espontnea? Explica tu respuesta.
5. Con base en los conocimientos adquiridos, cul de las teoras acerca del origen de los seres
vivos consideras ms acertada?
6. Explcala.

43

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

44

Prctica

La biognesis

11
INTRODUCCIN

Los estudios cientficos con microorganismos establecieron la biognesis como una


explicacin de la forma como se producen los seres vivos. Ella sostiene que los
seres vivos proceden de otros seres vivos.

OBJETIVO

MATERIALES Y REACTIVOS

Demostrar que todo ser vivo proviene de otro


ser vivo.

Caldo de res
Papel filtro
Cuatro tubos de ensayo
Mechero
Algodn
Vaso qumico
Varilla agitadora
Cinta adhesiva
Tapn de caucho

PROCEDIMIENTO

1. Calienta uno de los extremos de los tubos


y tpalos.
2. Calienta agua en el vaso qumico y agrega
el caldo de res, agita con la varilla.
3. Agrega el caldo de cultivo en partes iguales a los tubos y numralos del uno al cuatro.

4. Tapa el primer tubo con un algodn y el


segundo con papel filtro. Cierra el extremo
del tercero con un tapn de caucho y al
cuarto no le hagas nada, slo djalo abierto.
5. Coloca los tubos en una gradilla y djalos
en un lugar fresco por ocho das.

45

Biologa 10. Manual de talleres y laboratorios

Obsrvalos cada da y registra los resultados.


_____________________________________
6. Despus de los ocho das, toma una gota
de cada tubo y obsrvala en el microscopio. Anota las observaciones.

PREGUNTAS
1.

Qu es la biognesis?
__________________________________________________________________________________
__________________________________________________________________________________

2. Qu cambios observaste en los tubos de ensayo durante el experimento? Cul de los tubos
present primero un cambio de colocacin?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
3. Se apreciaron cambios en todos los tubos? En cuales?
__________________________________________________________________________________
__________________________________________________________________________________
4. Cul es la unidad bsica de que estn constituidos los seres vivos?
__________________________________________________________________________________
__________________________________________________________________________________
5. Qu cientficos explicaron la biognesis? Explica.
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

46

PRCTICA 11

La biognesis

CONCLUSIONES:

47

Prctica

Mtodo cientfico

12
INTRODUCCIN

El mtodo cientfico es la base de la investigacin cientfica. Es un conjunto de conocimientos organizados y ordenados lgicamente que conducen al descubrimiento
de la verdad de los fenmenos cientficos. Consta de cuatro operaciones bsicas interrelacionadas: observacin, experimentacin, hiptesis y conclusin.

OBJETIVO

MATERIALES Y REACTIVOS

Diferenciar el conocimiento emprico del


conocimiento cientfico.

Una rosa
Estampa con una rosa

PREGUNTAS
A. Compara el conocimiento emprico con el conocimiento cientfico.

________________________________________

Olor de la rosa

________________________________________

Tamao de la rosa

________________________________________

PE
GU
E

Color de la rosa

AQ
U

1. Observa la figura de la rosa y anota las caractersticas que se te solicitan.

Qu conocimiento te proporcion esta operacin?

2. Observa la planta del rosal y contesta lo que se te solicita


Color de la rosa

________________________________________

Olor de la rosa

________________________________________

Tamao de la rosa

________________________________________

49

Biologa 10. Manual de talleres y laboratorios

3. El resultado obtenido mediante este procedimiento es un ejemplo De qu tipo de conocimiento?


4. Anota las diferencias que encontraste entre el anlisis de un esquema y un ejemplar real.
5. Qu conocimiento emprico (esquema) o cientfico (planta), es ms importante en nuestra
ciencia?
6. Por qu?

MATERIALES Y REACTIVOS

Matraz Erlenmeyer
Tapn de hule
Tubo de vidrio
Tubo de hule
Vaso de precipitados
Agua
Alka Seltzer o Sal Andrews
Agua de cal

B. Elabora una hiptesis e identifica los pasos del mtodo cientfico.

SE

AL
LT

KA

ZE

agua de cal

matraz Erlenmeyer

50

vaso de precipitados

PRCTICA 12

1. Coloca dentro de un matraz Erlenmeyer la


mitad de una pastilla de Alka Seltzer soluble y agrega 15 mililitros de agua.
2. Cubre la boca del matraz inmediatamente
con el tapn que tenga un tubo de cristal insertado.
3. Introduce en el extremo del tubo de cristal
el tubo de hule, y conecta el otro tubo de
cristal (de desprendimiento) en el vaso de
precipitados que contiene agua simple.
4. Qu sucede en el vaso de precipitados?

Mtodo cientfico

7. Qu sucede?

8. El resultado de este experimento es tu


segunda hiptesis. Escrbela.

5. El resultado del experimento es tu primera


hiptesis. Escrbela.
9. Qu diferencia encuentras en las reacciones observadas en el vaso con agua
simple y en el que contiene agua de cal?

6. Repite el procedimiento 1 y 2 e introduce


el extremo del tubo de desprendimiento
en el vaso de precipitados que contiene
150 ml agua de cal.

10. Compara si tu experimento funcion de


la misma manera que el realizado por los
dems grupos del laboratorio.

51

Biologa 10. Manual de talleres y laboratorios

11. Escribe tu hiptesis final.

12. Anota los pasos del mtodo cientfico


que hayas empleado.
1.
2.
3.
4.
5.

CONCLUSIONES:

52

Prctica

La bibliografa

13
INTRODUCCIN

Inmediatamente despus de que tu profesor(a) te asigne el tema de investigacin,


acrcate a la biblioteca para buscar la bibliografa que utilizars.
La bibliografa se refiere la descripcin de un libro o lista de libros utilizados o
consultados para la realizacin de un trabajo y que se incluye en orden alfabtico
al final de la obra.
Los elementos que componen la bibliografa de un libro son:

Autor(es).
Ttulo de la obra.
Ao de publicacin.
Nmero de edicin.
Editorial.
Lugar publicacin.
Total de pginas.

Los elementos que componen la bibliografa de una revista son:

Autor(es).
Ttulo del artculo (entre comillas).
Nombre de la revista (subrayado).
Lugar de publicacin.
Volumen y nmero.
Fecha de publicacin.
Paginacin.

La bibliografa debe aparecer en forma alfabtica tomando como referencia el apellido del primer autor o segundo autor en el caso que sean dos o ms.

OBJETIVO

MATERIALES Y REACTIVOS

Ofrecer algunas directrices para la elaboracin y presentacin de referencias bibliogrficas que pueden ser necesarias para utilizarlas
en trabajos de estudio o investigacin.

Libros
Revistas
Material extrado de Internet

53

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Elabora y presenta cinco bibliografas de los libros seleccionados.
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
2.

Elabora y presenta cinco bibliografas de las revistas seleccionadas.


____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________

3.

Enlista cinco direcciones del material extrado de Internet.


____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________

54

PRCTICA 13

La bibliografa

PREGUNTAS
1. Cules son los elementos que integran la bibliografa de un libro?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
2. Cules son los elementos que integran la bibliografa de una revista?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
3. Qu importancia tiene la investigacin bibliogrfica?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

CONCLUSIONES:

55

Prctica

Los cmics

14
INTRODUCCIN

Hacemos una diferencia entre caricatura y cmic: la primera es una manera de dibujar un estilo; el segundo es un medio de comunicacin que a menudo se sirve de la
caricatura. La definicin no enumera gneros ni tipos de materias, ni estilos de prosa o poesa, nada dice sobre papel, tinta, imprenta, pluma, cartulinas, lpices, etctera, no descarta material ni clases de herramientas, no hace mencin de blanco y
negro o color, exageracin de anatoma o estilo realista o cmico.
En resumen, la diferencia entre ellos consiste en que una caricatura es una vieta aislada donde no existe una secuencia y se refiere slo a una manera de dibujar; en cambio, el cmic es un medio de comunicacin que en algunas ocasiones utiliza la caricatura.
Cmic: Ilustraciones y otras imgenes yuxtapuestas en secuencia deliberada,
con el propsito de transmitir informacin y obtener una respuesta esttica del lector.

OBJETIVO

MATERIALES Y REACTIVOS

Representar temas de inters biolgico a travs


de los cmics.

Tema de inters
Lpiz
Lpices de colores

Creando un personaje:

Paso 1:

Aqu te daremos en cinco pasos una muestra de


cmo crear un personaje bsico para tus cmic:

Dibuja un crculo y divdelo en cuatro partes,


como si fuese una torta.

57

Biologa 10. Manual de talleres y laboratorios

Paso 2:

Paso 4:

Dibuja dentro del crculo los rasgos faciales (ojos,


nariz, boca, etctera.)

Para agregar volumen dibujaremos una cara en


una esfera. Para esto, las lneas divisorias se hacen curvas, lo dibujamos de tal manera que donde stas se cruzan, se dibuja la nariz y luego
agregamos el resto de los elementos. Practica
con diferentes expresiones.

Paso 3:
Si los dibujas en la parte inferior, la cara parece
mirar hacia abajo.
Si los pones en la parte superior, parece mirar
hacia arriba. De igual forma, si los pones hacia la
izquierda o la derecha, la cara parece mirar a los
respectivos costados.
Paso 5:
Ahora, entinta sobre el dibujo a lpiz (las lneas
divisorias no se entintan). Espera que se seque
y borra el lpiz con la goma. Si le aades pelo,
ya tienes la cara terminada.

IMAGINEMOS LA SIGUIENTE HISTORIA


A un joven y a su novia,
mientras pasean, se les aparecen unos extraterrestres.
stos destruyen la ciudad y
ponen a la chica en peligro.
El protagonista se transforma, vence a los extraterrestres y rescata a su novia.

58

Para determinar cuntas pginas ocuparemos


en la historia, haremos el siguiente cuadro:

Pginas
1a3
4a5
6a9
10 a 16

Contenido
El protagonista pasea con su novia.
Viene un ovni.
Del ovni salen unos extraterrestres.
En una pelea los extraterrestres
destruyen la ciudad.
17 La chica est en peligro.
18 a 19 El protagonista se transforma.
20 a 29 Lucha con los extraterrestres.
30 Final feliz.

PRCTICA 14

Los cmics

Hay dos puntos esenciales que deben ser tomados en cuenta: primero, la Tcnica Plstica que
se usa para plasmar la historia y, segundo, el Lenguaje Narrativo. Ambos son extremadamente
difciles de dominar, por esto creo que la mejor manera de practicarlos es realizando muchas historias cortas. Cuando uno comienza en esto, tiende a dibujar historias eternas que dejan al Seor de los Anillos como un simple panfleto. Error, lo mejor es hacer una serie de historias cortas
con un comienzo, desarrollo, clmax y desenlace; es la nica manera de comenzar a entender el
mecanismo del cmic. Experimenta mucho hasta que por fin encuentres el estilo y el lenguaje
que te queden ms cmodos.
En cuanto al lenguaje narrativo, el tema es extenso y complejo, pero de todos modos creo que
puedo aclarar algunos puntos esenciales.
1. El Mensaje debe ser claro. Aunque parezca tonto decirlo, lo esencial es que la idea que t
quieres comunicar (por ms compleja que sea tu historia) se entienda. Por esto mi estilo es
cada vez menos barroco y, al contrario, me he ido simplificando mucho ms.
2. Dominar el ritmo. Este punto es lo ms difcil en la creacin de un cmic. El ritmo hace que
tu historia sea lo que es: si tu historia es de terror lo recomendable es que el ritmo sea lento
y tenso, que cree una atmsfera determinada. Si, al contrario, tu historia es de accin, lo correcto es que uses un ritmo rpido que cree dinamismo en la lectura, etctera.
Para manejar este factor es necesario saber aplicar el salto entre vietas, el uso del dilogo y
el texto descriptivo, el impacto visual de la vieta en s y bueno, podra seguir enumerando,
pero el asunto es complejo y vara con las diferentes culturas. El Manga tiene un ritmo diferente
al del cmic estadounidense y ste a su vez es diferente al del cmic europeo. Si te interesa este asunto te recomiendo la lectura de los siguientes libros de dos grandes autores:
1. Cmo se hace un cmic? de Scott Mc Cloud (un libro extraordinario que ser de inters
para cualquier persona que se interese en entender cmo funciona nuestra mente ante la
avalancha visual que hoy en da nos acorrala).
2. Cmic el Arte Secuencial de Will Eisner, maestro de maestros.
El Boceto es como un mapa de lo que t plasmars en tu pgina de cmic, es la etapa ms entretenida de la creacin de una historieta, es el momento en que estableces la disposicin de las vietas y las secuencias entre stas para que favorezcan la lectura de la pgina.
Para esto tienes que disponer tu pgina con el conocido sistema de lectura en z, es decir, la
atencin debe ser dirigida de izquierda a derecha, luego bajar a la prxima secuencia de vietas
y comenzar nuevamente por el extremo izquierdo; y as continuar hasta que el foco de atencin
abandone la pgina por el extremo inferior derecho de la hoja. A esta manera de llevar la atencin del lector se le llama El Recorrido Visual. Para controlar este recorrido se utilizan diversos
elementos de la pgina como la forma de las vietas, la disposicin de los globos de dilogos o
los textos en off ; tambin la disposicin de los elementos dentro de las vietas (ngulos de cmara, masas en movimiento, direccin de mirada, lneas cinticas, etctera) puede ayudar a crear
un recorrido ms claro.
El trazado a lpiz corresponde a la forma definitiva que tendr el trabajo. Hoy en da est de
moda realizar un dibujo muy fino y detallado, esto se debe a que comnmente en el cmic estadounidense el trabajo a lpiz y el entintado son realizados por artistas diferentes, por eso la nica manera de que el arte de un dibujante destaque plenamente es realizando un excelente dibujo a lpiz.

59

Biologa 10. Manual de talleres y laboratorios

En el original que aqu puedes ver notars que casi todo el diseo del boceto permaneci hasta
la etapa de entintado. Digo casi, porque siempre es posible hacer algunas modificaciones al trabajo final, sobre todo si se trabaja con un editor.
Es muy comn que las reas de sombras extensas no se sombreen con el lpiz, slo son marcadas con pequeas equis (x). El entintador sabe que eso significa que debe cubrir el rea con
tinta.
Se puede trabajar con un portaminas 0.5 para el detalle y con un 0.9 para el visitado. Tambin
se usan minas b y hb. En cuanto al papel, puede servir prcticamente cualquiera que soporte el
entintado, pero lo ideal es que sea de superficie lisa para que el lpiz y la pluma corran con facilidad. El porte ideal de una plancha, para m, es de 4028 cm, aproximadamente.
Un punto importante de esta etapa es el rotulado o el escribir los textos en los globos. Actualmente, por lo menos en Estados Unidos, los textos y los globos de dilogo son agregados digitalmente al trabajo final, pero se puede hacer una buena rotulacin a mano.
Lo importante de este asunto es el diseo de las vietas. Durante el dibujo a lpiz se debe dejar el suficiente espacio libre de informacin para colocar los globos de dilogos y las cajas de
texto en off.
Aqu, nuevamente, las posibilidades son infinitas. Se recomienda por el estilo de entintado basado en el dibujante americano Mike Mignola y en menor medida en el trabajo de Frank Miller.
La principal misin del entintado es dar volumen a los elementos, crear efectos de profundidad de campo y proporcionar detalles a la composicin, pero principalmente el entintado tiene
que definir qu es qu en la pgina.
Los grandes maestros ocupaban generalmente pinceles y plumas para llevar a cabo esta tarea.
Estas dos herramientas son, por mucho, las ms difciles de ocupar con eficacia. Hoy en da algunos artistas usan plumones biselados para hacer el trabajo, lo cual no es recomendable porque
estn hechos a base de alcohol, y esto hace que el trabajo final se desvanezca con el tiempo. Por
esta razn es mejor gastar un poco ms de plata y comprarse una buena tinta china.
Se debe usar una pluma fina para delinear los detalles y pinceles de diferentes grosores y cortes para cubrir las zonas de sombra; tambin se debe usar tiralneas de diferentes grosores para
delinear contornos y rotular.
Lo ideal es entintar la pgina de una sola vez y evitar correcciones o pegar vietas sobre alguna que te quedo un poco fuera.

60

PRCTICA 14

Los cmics

Bueno, qu es el volumen? El volumen es lo que nos va a permitir convertir una imagen plana
en otra en tres dimensiones. Vamos a darle profundidad a nuestros dibujos tan slo con un par
de lneas gruesas superpuestas.
Por supuesto que el efecto de volumen, perspectiva y 3D puede aplicarse con infinitud de tcnicas, pero creo que por el momento, con que conozcas slo una ya es ms que suficiente, que
esto se est extendiendo demasiado.
Veamos el siguiente dibujo:

Observa cmo la cabeza del dragn se encuentra en primer plano, el guerrero en segundo y los
rboles en tercer lugar. Fjate tambin en el grosor de las lneas. Una lnea gruesa provoca un
efecto de acercamiento. Una lnea muy fina, todo lo contrario, de lejana.

61

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

62

Prctica

Los compuestos
orgnicos

15
INTRODUCCIN

La mayora de los compuestos que se encuentran en la clula son orgnicos, esto significa que contienen el elemento carbono. En su mayora, los compuestos orgnicos
de los sistemas vivientes se pueden colocar en uno de los siguientes grupos: carbohidratos, lpidos, protenas y cidos nucleicos. En esta actividad realizars pruebas para
identificar la presencia de las molculas orgnicas en los alimentos.

OBJETIVOS

MATERIALES Y REACTIVOS

Identificar la presencia de carbono en los carbohidratos.


Usar pruebas qumicas para detectar la presencia de algunas molculas orgnicas en los
alimentos.

Crisoles
Trpodes
Mecheros Bunsen
Tubos de ensayo
Tenazas
Almidn al 1%
Gelatina al 1%
Papel de envolver
Solucin Benedict
Reactivo de Biuret
Miel para beb
Aceite vegetal o manteca
Lugol o yodo
Clara de huevo diluida
Granos de maz
Sudan III

63

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
PARTE A. Contienen carbono los carbohidratos?
Los azcares y los almidones son ejemplo de carbohidratos. Si alguna vez has quemado una papa
(almidn) habrs notado que se pone negra. El responsable de este color es el carbono que posee
el almidn. En esta actividad determinars si los cristales de azcar tambin poseen carbono.
Coloca una pequea cantidad de cristales de azcar en un crisol. Luego pon el crisol en un trpode y calienta con el mechero Bunsen. Observa el azcar a medida que lo calientas.
Qu le pasa a los cristales de azcar? ___________________________________________________
_____________________________________________________
Sujeta un tubo de ensayo con unas tenazas y colcalo invertido sobre el crisol. Deja que el tubo
de ensayo se enfre en esa posicin. _____________________________________________________
Qu observas? _______________________________________________________________________
Qu otra sustancia consideras que estaba presente en el vapor? ___________________________
Contina calentando el crisol hasta que observes un residuo negro en el fondo. ______________
Qu crees que sea esta sustancia? _____________________________________________________
Qu le sucedi a los tomos de hidrgeno y de oxgeno que estaban presentes en la molcula de
azcar? ______________________________________________________________________________
Qu tipo de cambio ocurri en el azcar? _______________________________________________
Hubo algn cambio de color? _________________________________________________________
Explica tu respuesta. __________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________

PARTE B. Prueba para determinar la presencia de molculas orgnicas.


Hay una serie de pruebas qumicas que sirven para determinar la presencia de molculas de carbohidratos (azcar, almidn), grasas y protenas en una sustancia.

Prueba para azcares simples


Toma dos tubos de ensayo marcados. En el tubo 1 coloca cinco gotas de agua y en el tubo 2, cinco gotas de la miel para beb. Agrega 1 ml de solucin Benedict a cada uno de los dos tubos.
Qu color aparece en los tubos? _______________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Calienta los tubos colocndolos a bao Mara por unos cinco minutos. Observa el cambio de color.

64

PRCTICA 15

Los compuestos orgnicos

Qu cambios de color hubo en el tubo 1? _______________________________________________


_____________________________________________________________________________________
_____________________________________________________________________________________
Qu cambios de color hubo en el tubo 2? _______________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Cul es la coloracin final del tubo 2? __________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Este color indica la presencia de azcares simples reductores. Este resultado indica una prueba
positiva.
Cul es el propsito del tubo 1 cuyo resultado indica una prueba negativa?
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Dibuja

65

Biologa 10. Manual de talleres y laboratorios

Prueba para almidn


Toma dos tubos de ensayo marcados. Coloca cinco gotas de agua en el tubo 1 y cinco gotas de
solucin de almidn al 1% en el tubo 2. Agrega dos gotas de lugol a cada uno de los tubos.
Qu cambios de color hubo en el tubo 1? _______________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Qu cambios de color hubo en el tubo2? _______________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Lo que observaste en el tubo 2 es una prueba positiva para almidn.
Dibuja

Prueba para grasas y aceites


Riega dos gotas de aceite en un pedazo de papel para envolver carnes. Sostnlo contra la luz.
Observas una mancha de grasa translcida en el papel?_________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________

66

PRCTICA 15

Los compuestos orgnicos

En otro papel para envolver carnes riega dos gotas de agua.


Djalo secar por un rato y luego compara las dos manchas _________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Hay otra prueba que es ms exacta. Coloca aproximadamente 1 cc de una sustancia que va a ser
probada en un tubo de ensayo seco y agrega 10 gotas de Sudan III. En otro tubo vierte 1 cc de
agua y tambin agrega 10 gotas de Sudan III. Deja reposar los tubos por unos 10 minutos.
Examina y describe los resultados _______________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Dibuja

Pruebas para protenas


Toma dos tubos de ensayo marcados con 1 y 2. Coloca 20 gotas de agua en el tubo 1 y 20 gotas
de gelatina al 1% y clara de huevo diluida en el tubo 2. Agrega dos gotas de reactivo de Biuret a
cada uno de los tubos.
NOTA:
Ten cuidado al usar el reactivo de Biuret porque te puede quemar la piel o la ropa.
Qu cambios de color ocurrieron en el tubo 1? __________________________________________
__________________________________________________________________________________

67

Biologa 10. Manual de talleres y laboratorios

Qu cambios de color ocurrieron en el tubo 2? __________________________________________


_____________________________________________________________________________________
La solucin de gelatina es una protena, qu cambios de color en el reactivo de Biuret indican la
presencia de protenas? ________________________________________________________________
_____________________________________________________________________________________
_____________________________________________________________________________________
Dibuja

Completa el siguiente cuadro


Compuesto

Reactivo

Resultado

Almidn
Azcar (miel)
Aceite
Protena (huevos)

Pruebas utilizando granos de maz


Las pruebas anteriores para almidn, aceites y protenas pueden repetirse utilizando granos de
maz que han estado en agua por 24 horas aproximadamente y luego cortados longitudinalmente.

68

PRCTICA 15

Los compuestos orgnicos

Qu reas del grano de maz muestran la presencia de almidn? __________________________


_____________________________________________________________________________________
_____________________________________________________________________________________
Qu reas del grano de maz muestran la presencia de protenas?
_____________________________________________________________________________________
_____________________________________________________________________________________
Dibuja un grano de maz y con lpices de colores muestra las reas en las que se observaron resultados positivos de las pruebas.

Una vez terminada la prueba lava todos los utensilios de vidrio.

69

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Qu prueba utilizaras para determinar la presencia de carbono en un compuesto orgnico?
__________________________________________________________________________________
__________________________________________________________________________________
2. Cul es la composicin de un azcar reductor?
__________________________________________________________________________________
__________________________________________________________________________________
3. Hay algn cambio de color cuando se calienta el azcar?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
4. Explica tu respuesta___________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
5. De qu color se pone el yodo cuando se agrega al almidn?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
6. Qu indicador reacciona cambiando de azul a chocolate o naranja cuando se calienta en presencia de ciertos azcares?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
7. Cmo reacciona el reactivo de Biuret con una protena?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
8. Por qu el Sudan III tie las grasas y no el agua?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

70

PRCTICA 15

Los compuestos orgnicos

CONCLUSIONES:

71

Prctica

Crucigrama de las
molculas biolgicas

16
PROCEDIMIENTO

Completa el siguiente crucigrama sobre las molculas biolgicas


1

2
3
4

8
10

11

12

13

Verticales
1. Unidad estructural de las protenas. Contiene un grupo amino (NH2) y un grupo carboxilo (COOH).
2. Forman parte de la masa de un organismo,
pero en pequeas cantidades.
3. Compuestos orgnicos que sirve ncomo
fuente de energa para los seres vivos.
5. Catalizadores del mundo vivo.
6. Fabricacin de molculas orgnicas por los
seres vivos.
8. Parte ms pequea de un elemento. En su
interior contiene protones, electrones y
neutrones.

Horizontales
4. Compuestos orgnicos aceitosos, no solubles en agua.
7. Sustancias que al mezclarse con agua contienen mayor cantidad de iones de H+.
9. Constituyentes estructurales de las clulas.
10. Unin de aminocidos mediante enlaces
peptdicos.
11. Tiene igual nmero de protones y electrones, su nmero de neutrones vara.
12. Monosacridos unidos entre s formando
largas cadenas.
13. Unidades estructurales de los cidos nucleicos formados por un grupo fosfato, un
azcar y una base nitrogenada (purina o
pirimidina).

73

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

74

Prctica

Las molculas orgnicas y su


importancia en la nutricin

17

INTRODUCCIN
Los alimentos son las sustancias que el hombre ingiere con el fin de elaborar sus
propias clulas y obtener la energa necesaria para llevar a cabo sus funciones
vitales.
Se clasifican siguiendo distintos criterios, entre los que se destacan el origen,
el papel fisiolgico, la composicin, etc.
Los requerimientos nutricionales son especficos. En nuestra dieta deben
estar presentes lpidos, carbohidratos, protenas, minerales y vitaminas para que
se satisfagan las diversas necesidades del cuerpo.

OBJETIVO

MATERIALES Y REACTIVOS

Analizar la composicin de los alimentos


que consumimos diariamente.

Veinte etiquetas de productos alimenticios


consumidos en casa
Tijeras
Goma

PROCEDIMIENTO
1. Analiza cada una de las etiquetas determinando los nutrientes que contiene
cada producto (carbohidratos, lpidos,
protenas y vitaminas).

2. Completa el cuadro 1.
3. Recorta el frente y el contenido nutricional de cinco etiquetas y pgalos en el
rea indicada.

75

76

20

19

18

17

16

15

14

13

12

11

10

(ETIQUETA)

PRODUCTO

MONOSACRIDO

DISACRIDO

POLISACRIDO

CARBOHIDRATOS
LPIDOS

MOLCULAS ORGNICAS

PROTENAS

VITAMINAS

Biologa 10. Manual de talleres y laboratorios

PRCTICA 17

Las molculas orgnicas y su importancia en la nutricin

ETIQUETAS DE PRODUCTOS

77

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Qu alimentos o productos contienen carbohidratos?
__________________________________________________________________________________
__________________________________________________________________________________
2. Cul es la funcin de los carbohidratos?
__________________________________________________________________________________
__________________________________________________________________________________
3. Qu alimentos o productos contienen protenas?
__________________________________________________________________________________
__________________________________________________________________________________
4. Cul es la funcin de las protenas?
__________________________________________________________________________________
__________________________________________________________________________________
5. Qu alimentos o productos contienen lpidos?
__________________________________________________________________________________
__________________________________________________________________________________
6. Cul es la funcin de los lpidos?
__________________________________________________________________________________
__________________________________________________________________________________
7. Qu alimentos o productos contienen vitaminas?
__________________________________________________________________________________
__________________________________________________________________________________
8. Cul es la funcin de las vitaminas?
__________________________________________________________________________________
__________________________________________________________________________________

78

PRCTICA 17

Las molculas orgnicas y su importancia en la nutricin

CONCLUSIONES:

79

Prctica

Movimiento molecular

18
INTRODUCCIN

La membrana celular es la entrada a la clula. Todos los materiales que entran o


que salen de la clula deben atravesar la membrana celular y el paso de esas sustancias tiene que ser regulado para que ella mantenga dentro un balance qumico
adecuado.

OBJETIVOS

MATERIALES Y REACTIVOS

Demostrar la accin diferencial de la membrana permeable.


Observar los mecanismos del movimiento
molecular a travs de membranas biolgicas.

Vaso qumico de 600 ml


Embudo
Papel celofn
Hilo, pabilo y ligas
Portaobjetos y cubreobjetos
Sulfato de cobre
Solucin saturada de glucosa
Tubos de ensayo
Solucin Benedict
Betabel
Bistur
Solucin de sal al 30%
Solucin de lugol
Solucin de almidn
Microscopio

PROCEDIMIENTO
I. Difusin
A. Llena un tubo de ensayo con agua.
Aade un poco de sulfato de cobre.
Deja el tubo en la gradilla y obsrvalo a

intervalos hasta que termine el periodo


de laboratorio.
B. Arma un sistema como el de la figura
que aparece a continuacin.

81

Biologa 10. Manual de talleres y laboratorios

4. Con un lpiz de cera marca el nivel del lquido.


5. Coloca el embudo con la solucin dentro
de un vaso qumico, llnalo con agua,
aproximadamente hasta la mitad del embudo.
6. Djalo all por varias horas.
7. Observa lo que ocurri dentro del embudo. Antalo.
_____________________________________
_____________________________________
_____________________________________
_____________________________________

1. Amarra con un pedazo de hilo o liga uno


de los extremos de una bolsa de celofn.
2. Llnalo con una solucin de almidn, ten
cuidado de que no se derrame.
3. Agrgale 40 gotas de una solucin saturada de glucosa.
4. Ata el otro extremo y lava muy bien por
fuera.
5. Coloca la bolsita de celofn en un vaso qumico con agua y unas gotas de lugol o yodo
de la forma en que se observa en la figura.
6. Despus de transcurridos 30 minutos, observa lo que ocurre y toma 5 ml de la solucin de vaso qumico y agrgale solucin Benedict, caliente a bao Mara.
Observa y anota tus resultados.
_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________
II. smosis
1. Toma un embudo pequeo y tapa el extremo ms amplio con papel celofn.
2. Amarra fuertemente.
3. Invierte el embudo y llvalo con una solucin saturada de agua y azcar hasta
donde se inicia el tallo del embudo.

82

Figura:
III. Observacin de los fenmenos de turgencia y plasmlisis
1. Realiza cortes finos de un betabel; una
vez hechos los cortes, mntalos en un
portaobjetos, agrega una gota de agua,
coloca su cubreobjetos.
2. Observa que todo el citoplasma aparece
rojizo. Dibuja.

PRCTICA 18

Movimiento molecular

3. Quita el exceso de agua y agrega una gota de una solucin de sal al 30%.
4. Al cabo de unos cinco minutos observa y
comprueba lo que le ha ocurrido al citoplasma.
Anota y dibuja lo observado.
_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________

PREGUNTAS
1. Qu es una membrana semipermeable?
__________________________________________________________________________________
2. Qu es difusin?
__________________________________________________________________________________
3. Qu es plasmlisis?
__________________________________________________________________________________
4. Qu es turgencia?
__________________________________________________________________________________
5. Qu apariencia tom la solucin cuando le coloc sulfato de cobre?
__________________________________________________________________________________
6. Al cabo de una hora, que sucedi?
__________________________________________________________________________________
7. Para qu se usa Benedict?
__________________________________________________________________________________
8. Qu uso se le dio al lugol?
__________________________________________________________________________________

83

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

84

Prctica

Estructura de las
clulas eucariticas

19
INTRODUCCIN

Las clulas eucariticas difieren de las procariticas en algunos aspectos como el


tamao, pueden medir ms de 10 micras de dimetro; estructuras encerradas por
membranas llamadas organelos; citoesqueleto y DNA dentro del ncleo, delimitado
por la doble membrana de la envoltura nuclear.

OBJETIVO

MATERIALES Y REACTIVOS

Conocer las funciones de cada una de las estructuras de las clulas eucariticas

Libro de texto
Lpices de colores

PROCEDIMIENTO
1. Completa el cuadro con las funciones de cada una de las estructuras de la clula animal
y la clula vegetal.

ESTRUCTURAS DE LAS CLULAS EUCARITICAS


Estructura

Funcin

Tipo de clula en
que se encuentra

Pared celular
Membrana
Plasmtica
Ncleo
Membrana
Nuclear
Nucleolo

85

Biologa 10. Manual de talleres y laboratorios

Ncleo plasma
Citoplasma
Organelos
citoplsmicos
Retculo
endoplsmico
(RE)
Liso
Rugoso
Ribosomas
Complejo
de Golgi
Lisosomas
Vacuolas
Microcuerpos
Peroxisomas
Glioxisomas
Mitocondrias
Plastidios
Leucoplastos
Cloroplastos
Cromoplastos
Citoesqueleto
Microtbulos
Microfilamentos
Filamentos
intermedios
Centrolos
Cilios
Flagelos
Uniones
intercelulares
Desmosomas
Uniones estrechas
Uniones en
hendiduras

86

PRCTICA 19

Estructura de las clulas eucariotas

2. Identifica las estructuras sealadas en las clulas animal y vegetal.

a. Clula animal

b. Clula vegetal

87

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

88

Prctica

Clula animal

20
INTRODUCCIN

A Robert Hooke, en el ao 1665, se le ocurri mirar una laminilla finsima de corcho


con un microscopio muy sencillo. Observ una multitud de huecos o celdillas a las que
llam clulas. Ms adelante, otros cientficos comprobaron que todos los seres vivos
estaban formados de clulas.
Las clulas tienen organelos que les permiten vivir por s solas. Existen organismos formados por una o varias clulas. stos se llaman unicelulares o pluricelulares,
respectivamente.
La clula es la unidad bsica y estructural de todo ser vivo. En ella cada orgnulo
y organelo realiza funciones especficas.
Toda clula consta de tres partes fundamentales: la membrana celular, el ncleo
y el citoplasma. Dentro del citoplasma encontramos otros organelos, como las mitocondrias, los lisosomas, ribosomas, aparato de Golgi, vacuolas, retculo endoplasmtico, plastidios y otros.
Entre las clulas animal y vegetal existen diferencias bsicas: la clula animal carece de cloroplastos, mientras que la clula vegetal si los tiene; la clula vegetal tiene
una pared celular, la animal no; la vegetal produce clorofila y celulosa, mientras que la
animal no.
En el siguiente experimento podrs observar las estructuras de la clula animal.

OBJETIVOS

MATERIALES Y REACTIVOS

Describir qu es la clula.
Identificar las estructuras fundamentales de
una clula animal.

Palillos de dientes
Portaobjetos
Cubreobjetos
Microscopio
Yodo o lugol
Mucosa bucal
Lpices de colores

89

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Con un palillo de dientes haz un raspado de la mucosa bucal interna (muy suavemente) y procede a hacer el frotis en el portaobjetos; coloca una gota de yodo o lugol y luego cubre con
el cubreobjetos.
2. Coloca el portaobjetos sobre la platina y procede a identificar la forma, el ncleo, la membrana celular y el citoplasma.
3. Haz un dibujo de lo observado y calcula el poder de aumento.

PREGUNTAS
1. Qu formas presentaron las clulas epiteliales?

90

PRCTICA 20

Clula animal

2. De qu color se ti el ncleo y el citoplasma en las clulas epiteliales?

3. Qu funcin desempea el portaobjetos?

4. Qu funcin desempea el cubreobjetos?

5. De acuerdo con la evolucin de las clulas, cmo se clasificara a las clulas epiteliales?

91

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

92

Prctica

Clula vegetal

21
INTRODUCCIN

Entre la clula animal y la clula vegetal existen diferencias. En el experimento anterior vimos que la clula animal carece de cloroplastos. La clula vegetal, adems,
posee una pared celular de celulosa, la cual da dureza y soporte a los vegetales. Al
mismo tiempo, la clula vegetal presenta algunas formas geomtricas, mientras
que la animal generalmente no las presenta.
En la clula vegetal tambin podemos encontrar algunas sustancias como las
antocianas, que le dan un color violeta o morado (remolacha) y carotenos, que le
dan un color anaranjado, como es el caso de la zanahoria.
Tambin, tienen los vegetales pequeas estructuras como las clulas ptreas
que se encuentran, por ejemplo, en la pera.
Los cloroplastos son muy importantes en los vegetales, ya que en ellos se realiza la fotosntesis, proceso que permite a la planta elaborar su propio alimento, de
lo cual dependemos todos los seres vivos que poblamos la Tierra, ya sea en forma
directa o indirecta. El pigmento que le da el color verde a las plantas se llama clorofila y se localiza en los cloroplastos. Este pigmento absorbe la energa de la luz
solar para que la planta pueda realizar el proceso de la fotosntesis.
En el presente laboratorio podrs observar e identificar las estructuras de la
clula vegetal.

OBJETIVOS

MATERIALES Y REACTIVOS

Reconocer las diferencias que existen entre la


clula vegetal y la clula animal.
Identificar algunos pigmentos y estructuras
que se localizan en la clula vegetal.

Microscopio
Portaobjetos
Cebolla
Gotero
Cubreobjetos
Hojas de lirio
Jugo de pera

93

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Desprende el catfilo de cebolla y colcalo en un portaobjetos. Pon una gota de yodo sobre
la preparacin y luego cbrela con el cubreobjetos. Repite la operacin con la hoja de lirio.
2. Lleva la preparacin al microscopio e identifica la pared celular, el ncleo y el citoplasma.
Dibuja.

3. Coloque una gota de jugo de pera en el portaobjeto, coloque el cubreobjeto. Observe y dibuje.

94

PRCTICA 21

Clula vegetal

PREGUNTAS
1. Qu diferencias observaste entre las clulas de la cebolla y el lirio?

2. Qu funcin desempea la pared celular?

3. Enumera algunas diferencias entre la clula animal y la clula vegetal.

95

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

96

Prctica

Sopa eucaritica

22
PROCEDIMIENTO

Localiza en la sopa de letras las siguientes estructuras de las clulas:


EUCARITICAS
PARED CELULAR
MEMBRANA PLASMTICA
MEMBRANA NUCLEAR
NUCLEOLO
CENTRIOLOS
NCLEO

NUCLEOLO
NUCLEOPLASMA
CITOPLASMA
RETCULO ENDOPLASMTICO
LEUCOPLASTOS
CLOROPLASTOS
CENTRIOLOS

RIBOSOMAS
APARATO DE GOLGI
LISOSOMAS
VACUOLAS
MITOCONDRIAS
CROMOPLASTOS
CITOESQUELETO

Q W

R E

A E

R F

N S

O U

C G

O F

M I

C R

A A

97

Actividades Biolgicas 10. Talleres y laboratorios

CONCLUSIONES:

98

Prctica

Extraccin de ADN

23
INTRODUCCIN

El ADN (cido desoxirribonucleico) permite a los organismos o a las clulas de un


organismo transmitir informacin con precisin de una generacin a otra.
El ADN se compone de cuatro nucletidos, cada nucletido est formado por
tres partes: un grupo fosfato, un azcar llamado desoxirribosa y una de las cuatro
bases nitrogenadas que son adenina, timina, guanina y citosina.
El ADN es una molcula muy larga que tiende a agruparse y de all su facilidad
para extraerla.

OBJETIVOS

MATERIALES Y REACTIVOS

Observar sin la ayuda del microscopio los


filamentos del ADN.

Semillas de lentejas
Cebolla
Espinaca
Jugo de pia o ablandador de carne
Alcohol etlico al 95%
Una licuadora
Un colador
Detergente lquido
Vasos qumicos
Varilla de vidrio
Sal
Tubos de ensayo

PROCEDIMIENTO
A. Estudio del ADN en las lentejas
1. Toma media taza de lentejas y ponlas en
agua con una pizca de sal por cinco minutos. Todo esto colcalo en una licuadora
y procsalo por 15 segundos. Finalmente,

filtra la mezcla resultante para eliminar


cualquier partcula de gran tamao.
2. A la mezcla obtenida agrgale dos cucharaditas de detergente lquido y revuelve
suavemente sin formar espuma. Luego

99

Biologa 10. Manual de talleres y laboratorios

3.

4.

5.

6.

deja reposar de cinco a diez minutos. Por


ltimo, coloca la mezcla en tres vasos
qumicos.
Agrega a cada vaso qumico una pizca de
ablandador de carne o jugo de pia y revuelve muy despacio. Si lo haces muy rpido tal vez no logres observar nada al final del experimento.
Inclina el vaso qumico que contiene la
mezcla y vierte muy lentamente alcohol
etlico al 95%, de modo que se forme
una capa sobre la mezcla anterior. Vierte
tanto alcohol como mezcla haya en el vaso qumico.
El ADN comenzar a coagularse como
una masa blancuzca y subir hasta la
parte donde est el alcohol.
Retralo con la ayuda de la varilla de vidrio y obsrvalo detenidamente. Describe lo observado.
_____________________________________
_____________________________________
_____________________________________
_____________________________________

_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________
B. Estudio del ADN en la cebolla y hojas
de espinaca
Repite todo el procedimiento anterior,
pero utilizando ahora cebolla y luego
espinaca.
Observa y anota
_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________
_____________________________________

PREGUNTAS
1. Por qu se us sal al momento de hacer la mezcla inicial?
__________________________________________________________________________________
2.

Qu se quera lograr al usar la licuadora?


__________________________________________________________________________________

3.

Cul es la funcin del ablandador de carne o del jugo de pia?


__________________________________________________________________________________

4. Cul es la funcin del alcohol?


__________________________________________________________________________________
__________________________________________________________________________________
5. En cul de las tres muestras se observ en mayor cantidad el ADN?
__________________________________________________________________________________

100

PRCTICA 23

Extraccin de ADN

CONCLUSIONES:

101

Prctica

Construyamos un
modelo de ADN

24
INTRODUCCIN

La construccin de un modelo de la molcula de ADN es realizada por los cientficos para visualizar la informacin obtenida de l. Esta observacin facilita la comprensin del funcionamiento de dicha molcula.

OBJETIVO

MATERIALES Y REACTIVOS

Construir el modelo molecular del ADN y relacionar el cdigo gentico con su replica.

Lpices de colores
Tijeras
Goma
Hojas 81/2  14 pulgadas

PROCEDIMIENTO
1. Elabora tu propio modelo de ADN hasta con nueve nucletidos con las figuras que aparecen
en la hoja adjunta. Resalta el carcter complementario de las purinas pirimidinas. Pinta cada
una de sus partes.
2. Construye un modelo de ARNm a partir de la primera cadena de ADN. Pinta los componentes de tu modelo.

103

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Al darte el siguiente cdigo, podras predecir a qu base se enlaza cada una?
G __________________

A ________________

T __________________

C ________________

2. A continuacin, hay una secuencia de bases en una cadena de ADN, cul sera la secuencia
correspondiente de la cadena complementaria?
A

3. Cul es la estructura de una molcula de ADN?

4. Cmo estn formados los lados de la molcula de ADN?

5. Cules son los componentes de cada nucletido?

104

PRCTICA 24

Construyamos un modelo de ADN

6. Cules son las bases de purina del ADN?

7. Cules son las bases de pirimidina del ADN?

8. Cules son las letras del cdigo de las bases?

9. Qu mantiene unidas las tiras de la molcula de ADN?

10. Qu aminocidos codifica la secuencia de nucletidos de tu modelo?

105

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

106

PRCTICA 24

Construyamos un modelo de ADN

T
G
P

A
U

107

Prctica

Sntesis de protenas

25
INTRODUCCIN

En el ncleo, el ADN contiene instrucciones para hacer miles de protenas diferentes, recuerda que ste no puede salir del ncleo. Cuando se necesita cierta protena, se forma el mRNA, de la informacin que hay en el ADN. El proceso de producir mRNA de las instrucciones del ADN se llama transcripcin.
El ensamblaje de una molcula de protena, de acuerdo con el cdigo de una
molcula de mRNA, se conoce como traduccin porque comprende el cambio del
lenguaje de los cidos nuclicos (sucesin de bases) al lenguaje de las protenas
(sucesin de aminocidos); al completarse la traduccin, la informacin almacenada en el ADN se expresa como una protena especfica.
El cdigo gentico se descifr usando mRNA artificiales, el cdigo suele escribirse en trminos de los tripletes de bases del mRNA (en lugar de las del ADN) que
representan cada aminocido. Estos tripletes de mRNA se llaman codones y existen 64 codones para formar los 20 aminocidos esenciales.
Los codones de terminacin o de alto marcan el trmino de la sntesis de la
protena.

OBJETIVOS

MATERIALES Y REACTIVOS

Comprender los pasos de la sntesis de protenas.


Utilizar el cdigo gentico para determinar los
aminocidos de una protena.

Libro de texto. Cdigo gentico

109

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Utilizar el cdigo gentico para indicar
qu aminocidos se forman con las combinaciones de las siguientes bases:
AAG__________
CUC__________
ACU__________
CCU__________
CAC__________
UUC__________
AUU__________
CGC__________
GUG__________
UGC__________

Isoleucina__________________________

2. Con ayuda del cdigo gentico encuentra las combinaciones de bases que forman estos aminocidos.

Valina______________________________

Leucina_____________________________
Fenilalanina_________________________
Prolina______________________________

Alanina_____________________________
Metionina___________________________
Arginina_____________________________
Treonina____________________________
Serina______________________________

3. Determina la secuencia de aminocidos


a partir de la siguiente cadena del ARN
mensajero.
Separa con un guin cada codn.
Escribe el nombre de cada aminocido.
UCAUGCAUACUUCCUAGAUUCGCA

PREGUNTAS
1. Por qu el cdigo gentico utiliza tripletes de mRNA en lugar de tripletes de ADN?
__________________________________________________________________________________
__________________________________________________________________________________
2. Qu indican los codones de terminacin o de alto?
__________________________________________________________________________________
__________________________________________________________________________________

110

PRCTICA 25

Sntesis de protenas

CONCLUSIONES:

111

Prctica

La mitosis

26
INTRODUCCIN

El nmero de cromosomas de un organismo se mantiene por un proceso de divisin


celular que recibe el nombre de mitosis. La mitosis se lleva a cabo en una serie de
etapas consecutivas conocidas como interfase, profase, metafase, anafase y telofase.
En las clulas somticas, el ncleo se divide por mitosis, de tal manera que cada
una de las clulas hijas resultantes recibe exactamente el mismo nmero y tipo de
cromosomas que la clula madre.

OBJETIVO

MATERIALES Y REACTIVOS

Demostrar el proceso de mitosis en clulas


vegetales.

Solucin fijadora, acetocarmn. (una parte


de cido actico y tres partes de alcohol etlico al 95%)
Races de cebolla
cido clorhdrico (molar)
Microscopio
Porta y cubreobjetos
Pinzas
Navajas, cuchilla o bistur
Mechero

113

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Define los siguientes conceptos:

a. Cariocinesis _______________________________________________________________________
__________________________________________________________________________________
b. Citocinesis ________________________________________________________________________
__________________________________________________________________________________
c. Huso acromtico___________________________________________________________________
__________________________________________________________________________________
d. Profase ___________________________________________________________________________
__________________________________________________________________________________
e. Metafase __________________________________________________________________________
__________________________________________________________________________________
f. Anafase___________________________________________________________________________
__________________________________________________________________________________
g. Telofase___________________________________________________________________________
__________________________________________________________________________________

2. Observacin de las fases de la mitosis


Coloca los bulbos de cebolla en agua por lo menos cinco das antes de realizar el laboratorio.
Dibuja su aspecto una vez transcurridos los cinco das.

114

PRCTICA 26

La mitosis

Cuando las races hayan llegado de dos a cinco centmetros de largo, corta un centmetro
terminal de varias races.
Coloca los cortes en la solucin fijadora durante 24 horas.
Pasa los fragmentos de raz en un vaso qumico que contiene HCI durante 10 minutos, al final
del cual los fragmentos tendrn una consistencia blanda, la cual se puede detectar con una
aguja de diseccin.
Coloca dos gotas de acetocarmn en un portaobjetos.
Transfiere las races al portaobjetos.
Con una cuchilla o bistur corta los fragmentos de raz en piezas ms pequeas y espera 10
minutos.
Coloca un cubreobjetos sobre la preparacin.
Calienta suavemente con el mechero.
Coloca el portaobjetos con la superficie superior invertida sobre un pedazo de papel filtro.
Presiona suavemente sobre la superficie del papel y con este movimiento aplasta la preparacin, de manera que las clulas se dispersen.
Observa al microscopio en 10x y 40x, localiza las fases de la mitosis.
Dibuja

115

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Qu es mitosis?
__________________________________________________________________________________
2. Cules estadios de la mitosis puedes localizar?
__________________________________________________________________________________
3. En qu etapa se encuentran la mayor parte de las clulas?
__________________________________________________________________________________
4. Qu tamao tienen las clulas al final de la telofase respecto de las otras clulas?
__________________________________________________________________________________
5. Puedes contar los cromosomas en algunas clulas?
__________________________________________________________________________________
6. Cuntos cromosomas posee la cebolla?
__________________________________________________________________________________
7. Cul crees que sea la funcin del fijador empleado para preparar las placas de cebolla?
__________________________________________________________________________________
8. Cul es la principal diferencia entre la telofase animal y la vegetal?
__________________________________________________________________________________

116

PRCTICA 26

La mitosis

CONCLUSIONES:

117

Prctica

La meiosis

27
INTRODUCCIN

La reproduccin sexual est basada en la formacin de gametos que se unen en el


momento de la fecundacin. Todas las clulas del adulto provienen de este huevo
fecundado y, como l, contienen n cromosomas procedentes del vulo y n cromosomas procedentes del espermatozoo. Es decir, contienen dos series homlogas
de cromosomas, por lo que se dice que son diploides 2n. Los gametos, en cambio, contienen solo n cromosomas y se llaman haploides (n). La reduccin del
nmero de cromosomas que aparecen al final de la gametognesis ocurre gracias
a una forma especial de divisin celular llamada meiosis.

OBJETIVO

MATERIALES Y REACTIVOS

Reconocer y comprender la dinmica del


proceso de la miosis.

Placas fijas de meiosis


Microscopio
Lpiz
Lpices de colores

PROCEDIMIENTO
1. Fases de la meiosis
A. Elabora un cuadro sinptico indicando las divisiones y las fases de la meiosis.

a._______
1 ______________

b._______
c._______
d._______

____________________

a._______
2 ______________

b._______
c._______
d._______

119

Biologa 10. Manual de talleres y laboratorios

B. Dibuja las fases de la meiosis que observes al microscopio y anota sus caractersticas.

Fase:_______________

Fase:_______________

Fase:_______________

Fase:_______________

Fase:_______________

120

PRCTICA 27

La meiosis

PREGUNTAS
1. Qu es la meiosis?
__________________________________________________________________________________
__________________________________________________________________________________
2. Qu nombres reciben las clulas sexuales femenina y masculina?
__________________________________________________________________________________
__________________________________________________________________________________
3. Qu son las clulas haploides?
__________________________________________________________________________________
__________________________________________________________________________________
4. Qu son las clulas diploides?
__________________________________________________________________________________
__________________________________________________________________________________
5. Cuntas divisiones presenta la meiosis?
__________________________________________________________________________________
__________________________________________________________________________________
6. Cules son las etapas de la primera divisin?
__________________________________________________________________________________
__________________________________________________________________________________
7. Cules son las etapas de la segunda divisin?
__________________________________________________________________________________
__________________________________________________________________________________
8. Cuntas clulas hay al final de la primera divisin meitica?
__________________________________________________________________________________
__________________________________________________________________________________
9. Cuntas clulas hay al final de la segunda divisin meitica?
__________________________________________________________________________________
__________________________________________________________________________________
10. Por qu es necesaria la meiosis para la reproduccin sexual?
__________________________________________________________________________________
__________________________________________________________________________________

121

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

122

Prctica

Mitosis y meiosis

28
INTRODUCCIN

Todas las clulas necesitan reproducirse y para ello realizan divisiones celulares.
Todos los organismos eucariotas, con pequeas diferencias, realizan el proceso
conocido como mitosis, donde, a partir de un nmero diploide (2n) de cromosomas
de una clula madre, se forman dos clulas hijas con el mismo nmero cromosmico, es decir, se mantiene la misma informacin gentica. Este proceso se realiza
en organismos unicelulares para poder reproducirse, y se lleva a cabo en los pluricelulares para el crecimiento o reparacin de tejidos y rganos. La mitosis forma
parte del ciclo celular, donde hay dos periodos, la interfase, dividida en tres fases:
G1, S y G2; y la mitosis, que est dividida en cuatro fases: profase, metafase, anafase y telofase.
La meiosis es un proceso de divisin celular que emplean los organismos con
sexos distintos para poder reproducirse. A diferencia de la mitosis, aqu las clulas
hijas presentan un nmero haploide de cromosomas (n), es decir, tan slo tienen la
mitad de la informacin gentica de la clula madre. Las clulas obtenidas en este
proceso reciben el nombre de gametos y son las clulas sexuales. La meiosis presenta dos divisiones consecutivas que se dividen en fases semejantes a las de la
mitosis, slo que algunas se repiten: profase I, metafase I, anafase I, telofase I, que
constituyen la primera divisin meitica; sigue una fase llamada intercinesis, similar a la interfase, sin que se dupliquen los cromosomas, y despus inicia la segunda divisin meitica con la profase II, metafase II, anafase II y telofase II. El nmero total de clulas obtenidas es de cuatro.

OBJETIVOS

MATERIALES Y REACTIVOS

Distinguir el proceso mitico del mittico,


observando las distintas fases en clulas
animales y vegetales en un fotograma.
Establecer diferencias entre la mitosis y la
meiosis.

Libro de texto

123

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Identifica las distintas fases de la mitosis y la meiosis en clulas vegetales y animales.

Nm. de
la clula

Nm. de
la clula

Mitosis (fase)

Meiosis (fase)

2. Completa el siguiente cuadro comparativo de la mitosis y la meiosis.


Mitosis

Meiosis

Definicin
Nmero de cromosomas
de las clulas hijas
Nmero de divisiones
Nmero de clulas hijas
Clulas donde ocurre

PREGUNTAS
1. Por qu los cromosomas no son visibles durante la interfase?
__________________________________________________________________________________
__________________________________________________________________________________
2. Por qu es esencial que cada clula resultante de la mitosis reciba exactamente la misma
cantidad de material nuclear?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

124

PRCTICA 28

Mitosis y meiosis

3. Dnde se encuentran los cromosomas en la clula? Siempre estn presentes?


__________________________________________________________________________________
__________________________________________________________________________________
4. Cul es la funcin de la mitosis?
__________________________________________________________________________________
__________________________________________________________________________________
5. Cul es la funcin de la meiosis?
__________________________________________________________________________________
__________________________________________________________________________________

CONCLUSIONES:

125

Biologa 10. Manual de talleres y laboratorios

Observa las siguientes fotografas. Ordena del 1 a 6, y escribe el nombre a cada una de las fases,
de acuerdo con lo que aprendiste en esta prctica.

126

(a)_______________________

(a)_______________________

(a)_______________________

(a)_______________________

(a)_______________________

(a)_______________________

Prctica

El cncer

29
INTRODUCCIN

Todas las partes de un organismo, animal o vegetal, estn constituidas por clulas.
Cada clula nace, vive, se multiplica y muere. En principio, la multiplicacin celular
o mitosis da origen a dos clulas hijas de cada clula madre. Las caractersticas de
las clulas producidas por mitosis son idnticas a las de la clula madre: tienen el
mismo nmero de cromosomas (2n) y el cdigo gentico de stos es igual para todas las clulas del linaje. Dicho de otro modo, cada una de ellas desempear el
mismo papel bioqumico, bioenergtico y fisiolgico de la clula madre, excepto
cuando la divisin corresponde al proceso de diferenciacin celular en el desarrollo embrionario.
La multiplicacin no es indefinida. Un organismo animal en equilibrio no debe
tener ni demasiadas ni pocas clulas sanguneas, hepticas, seas, etctera.
Las clulas que mueren son sustituidas y las excedentes son destruidas o eliminadas. El organismo es un universo que controla rigurosamente los nacimientos
y que, a diferencia de las sociedades humanas, evoluciona como si supiera con precisin cul debe ser el nivel exacto cuantitativo y cualitativo de la demografa
celular.
Cules son los revisores de esta demografa?
El jefe de los revisores es el cdigo gentico, es decir, el ADN celular. La vigilancia
local la ejercen los tejidos orgnicos sanos, que se oponen naturalmente a toda proliferacin intempestiva. La regulacin general depende de los controles hormonales y del sistema inmunitario. Cuando estos controles fallan por causas que todava
se desconocen en conjunto, se puede ver cmo ciertas clulas se multiplican anrquica y anormalmente en una regin determinada del organismo y se extienden
despus progresivamente en l, formando en todas partes focos de proliferacin
anormal.
La multiplicacin local anormal de las clulas contribuye a la formacin de un
tumor. ste puede ser benigno, es decir, que no provoca ninguna consecuencia grave
para la salud del individuo que lo padece, al menos si se cuida de manera apropiada
(lobanillos, verrugas, ciertos quistes, etctera); sin embargo, cuando se extiende, cuando algunas de las clulas que contiene migran y constituyen otros focos tumorales en el organismo, recibe el nombre de cncer y se le califica de maligno. La
palabra cncer en latn significa cangrejo (el tumor que se difunde se asemeja a un
cangrejo que extiende lentamente las patas).
El cncer es un tumor que tiende a crecer, destruye los tejidos que lo rodean y
produce colonias similares en otros lugares del cuerpo.
Sin embargo, los especialistas contemporneos han ampliado el sentido de este trmino, y hoy ya no se designa al tumor en s mismo, sino al conjunto de la enfermedad y su evolucin: tumor + colonizacin a distancia + trastornos diversos del
organismo en relacin con este estado = cncer.

127

Biologa 10. Manual de talleres y laboratorios

OBJETIVO
Determinar la relacin entre el cncer y el
proceso mittico.

PROCEDIMIENTO
1. Analiza la lectura y contesta las preguntas.

128

PRCTICA 29

El cncer

PREGUNTAS
1. Cmo definiras el cncer? Enumera algunos tipos de cncer que hayas odo mencionar.

2. Qu procedimientos mdicos se utilizan para controlar el cncer?

3. Qu instituciones de tu regin luchan contra este terrible mal?

4. Hay mecanismos de prevencin del cncer?

129

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

130

Prctica

Las leyes de la probabilidad

30
INTRODUCCIN

La probabilidad es el estudio de la forma como operan las leyes del azar; el azar se
refiere a la posibilidad de que ocurra determinado evento. Por ejemplo, obtener
sello al tirar una moneda al aire.
Probabilidad =

Nmero de veces que ocurre un evento


Nmero total de eventos posibles

Cuando tiramos una moneda al aire puede que caiga cara o sello, un total de dos
eventos, por lo que hay una probabilidad en dos posibles eventos de que caiga sello
(1/2).
En gentica se usan dos principios importantes en la probabilidad:
1. Regla de eventos independientes: los eventos que ya ocurrieron no afectan
la probabilidad de que pueda ocurrir uno de esos mismos eventos.
2. La regla del producto: la probabilidad de que ocurran a la vez eventos independientes es el producto de las probabilidades de que esos eventos ocurran
por separado.

OBJETIVO

MATERIALES Y REACTIVOS

Demostrar las leyes de la probabilidad.

Dos monedas
Cinta adhesiva
Tijeras
Papel

131

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Trabaja con un compaero o compaera. Lanza al aire dos monedas al mismo tiempo.
2. Lanza las monedas 10 veces, luego 50 y despus 100 y anota los resultados. Determina el
nmero de caras y sellos obtenidos (razn).
Tabla 1

Nmero de
lanzadas al aire

cara /cara

cara/sello

sello/sello

10
50
100

3. Corta cuatro pedazos de cinta adhesiva del tamao de las monedas y cubre cada una de sus
caras. En un lado escribe T mayscula y en la otra t minscula. Imagina que T representa
plantas de guisantes altas y t plantas bajas.
4. Lnzalas al aire al mismo tiempo, 10, 50 y 100 veces. Registra los resultados en la Tabla 2.
Tabla 2

Nmero de
lanzadas

TT

Tt

tt

10
50
100

Al lanzar dos monedas ests representando el cruce entre dos plantas de guisantes hbridas,
como en el cruce de la generacin filial 1 de Mendel.

132

PRCTICA 30

Las leyes de la probabilidad

PREGUNTAS
1. Cmo funciona la Ley de la Probabilidad?
__________________________________________________________________________________
__________________________________________________________________________________
2. Determina el fenotipo y el genotipo del procedimiento 3.
__________________________________________________________________________________
__________________________________________________________________________________
3. Cul es la razn dominante al lanzar las monedas?
__________________________________________________________________________________
__________________________________________________________________________________
4. Cul es la razn dominante al lanzar las monedas con las letras?
__________________________________________________________________________________
__________________________________________________________________________________
5. Cmo relacionas esta experiencia con las leyes de Mendel?
__________________________________________________________________________________
__________________________________________________________________________________
6. Elabora un cuadro de Punnett para el procedimiento 3.
__________________________________________________________________________________
__________________________________________________________________________________
7. Qu fenotipo poseen los descendientes?
__________________________________________________________________________________
__________________________________________________________________________________
8. Diferencia fenotipo de genotipo.
__________________________________________________________________________________
__________________________________________________________________________________

133

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

134

Prctica

Las leyes de la herencia

31
INTRODUCCIN

Todo ser vivo, planta o animal, microbio o ser humano, posee caractersticas heredadas de uno o dos progenitores, segn sea el caso. Desde el principio de la historia las personas han tratado de comprender cmo se transmite la herencia de una
generacin a la otra.
El trabajo del monje austriaco Gregorio Mendel tuvo particular importancia para comprender la herencia biolgica. Sus trabajos de investigacin lo llevaron a sacar dos conclusiones: la primera fue que la herencia biolgica est determinada por
factores que se transmiten de una generacin a la siguiente; y la segunda es conocida como el principio de la dominancia. Los principios de Mendel son la base de la
ciencia de la Gentica.

OBJETIVO
Conocer el principio de transmisin y expresin de los caracteres hereditarios.

PROCEDIMIENTO
I.

Gregorio Mendel al trabajar con flores de chcharos utiliz factores o genes contenidos en los gametos.

1. Escribe con qu otros nombres se conoce a los gametos.

y
2. La letra minscula simboliza que el factor es

135

Biologa 10. Manual de talleres y laboratorios

3. Anota cul color ser dominante en la flor del siguiente ejercicio, si el factor G expresa color
verde de las flores y la g flores amarillas.
Datos
G

= verde

= amarillas

Factores

Color dominante

GG
Gg
gg

II. Primera ley de Mendel


Anota los datos que se solicitan en los espacios vacos.
Gametos 
G
Gametos 

F1

g
Primera generacin filial
1. Anota cul color se ocult o se convirti en recesivo.

2. En la generacin F1, qu color fue dominante?

3. Qu proporciones se encontraron?

El siguiente cuadro nos ayudar para responder el comportamiento de la generacin F2 ; anota


los resultados de los cruces que se solicitan.
Gametos
G
Gametos

G
g
Segunda generacin filial

136

F2

PRCTICA 31

Las leyes de la herencia

4. Qu proporciones aparecen ahora?

5. Cules colores se expresaron?

III. Segunda ley de Mendel


1. Ahora estudiaremos la herencia expresada por dos o ms factores contenidos en un gameto.

2. Examina la distribucin de dos caracteres en las generaciones F1 y F2 en el chcharo, donde


la generacin P1 es una variedad de semilla lisa (LL) y redonda (RR), con una variedad de
semilla rugosa (ll) y alargada (rr).

Generacin P1

Semilla

Semilla

Fenotipo

Lisa redonda

Rugosa alargada

Genotipo

LLRR

llrr

Gametos

LR

lr

3. Con la informacin anterior resuelve el siguiente cuadro:

F1

Gametos

Gametos

lr

LR

LR

lr
4. Anota las caractersticas que a continuacin se te indican.
Bsate en el cuadro anterior, de la Generacin P1 .
Proporciones fenotpicas: _____________________________
Proporciones genotpicas: ____________________________
Gametos: ____________________________
Generacin F2
Gametos:

137

Biologa 10. Manual de talleres y laboratorios

5. Escribe las siguientes caractersticas:


Proporciones
fenotpicas

______________________________________________________
______________________________________________________
______________________________________________________

Proporciones
genotpicas

______________________________________________________
______________________________________________________
______________________________________________________

CONCLUSIONES:
CONCLUSIONES:

138

Prctica

Gentica, dominancia y
recesividad

32
INTRODUCCIN

Los genetistas consideran al organismo individual como depsito temporal de una


coleccin de genes ordenados.
No es fcil estudiar la herencia en el hombre, ya que sus cruzamientos son a
voluntad, sus descendientes escasos (desde el punto de vista gentico) y el tiempo
entre generacin y generacin bastante largo. As, se ha recurrido a estudios estadsticos y a la gentica de las poblaciones.
Sin embargo, en la citologa de los humanos se ha adelantado bastante y se han
desarrollado tcnicas como el ideograma o cariotipo.

OBJETIVO

MATERIALES Y REACTIVOS

Conocer las caractersticas hereditarias ligadas


al sexo.

Ejemplar de estudio (alumnos)

PROCEDIMIENTO
Herencia ligada al sexo
1. La especie humana posee 46 cromosomas distribuidos de la siguiente forma: 22 pares de
autocromosomas y uno de heterocromosomas (XX para la hembra y XY para el macho).
2. Analiza el diagrama de cruces genticos y resulvelo.
(Recordemos que en el cruce de hombre-mujer, un solo gene de cada uno formar parte del
nuevo ser.)

139

Biologa 10. Manual de talleres y laboratorios

vulos

Espermatozoides
Figura 1

Mujer
X X

XX

XX

XY

XY

3. Observa la figura 1.
Contesta las preguntas y realiza las actividades que se indiquen.

X
X
vulos

5. Cul de los cromosomas ligados al sexo


es el de menor tamao?

6. Los cromosomas XY son para el varn,


qu letras corresponden a la mujer?

4. En la figura 2 encierra con un crculo


rojo los cromosomas correspondientes a
la mujer y con azul los del varn.

Ideogramas  y  en humanos

Figura 2

140

Hombre
X Y
X
Y
Espermatozoides

PRCTICA 32

7. De los cruces obtenidos en el cuadro anterior, qu cantidad en porcentaje se form.


de XX

____________%

y de XY

____________%

Gentica, dominancia y recesividad

Analiza con tu equipo los resultados anteriores y compralos con la versin de que nacen
ms mujeres que hombres.
Anota tu conclusiones.

8. El cromosoma X alberga gran cantidad de


genes, y el cromosoma Y genticamente
est casi vaco; en realidad es un cromosoma en trance de regresin.
Manifestacin de un gene dominante
1. La presencia de un gene dominante permite abarquillar la lengua; por el contrario,
las personas que slo tienen el gen no
dominante o recesivo son incapaces de
hacerlo.

Labio

2. Puedes abarquillar tu lengua con facilidad?

3. Realiza un estudio estadstico de cuntos


alumnos del grupo abarquillan su lengua.
Esta ser una muestra representativa.

Lengua

Ejemplo: se realiz una encuesta de lengua


abarquillada en una poblacin de 100 personas y se obtuvieron los siguientes resultados:
64 abarquillaban la lengua y 36 no. Se anot
y se calcularon los porcentajes correspondientes.

Anota cuntos son: ___________


4. Mediante una encuesta directa con los
resultados de cada uno de los equipos del
grupo, contesta los datos que se piden en
el siguiente cuadro:

Caractersticas

Lengua
abarquillada
Lengua no
abarquillada

Ejemplo

Poblacin

Poblacin
100 personas

______ personas

Nm.

Nm.

72
18

Cuadro 1. Porcentaje de la frecuencia del gene que expresa


lengua abarquillada.

141

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

142

Prctica

Cromosomas sexuales
femeninos

33
INTRODUCCIN

Los cromosomas son estructuras celulares que se localizan en el ncleo; estn formados por cromatina y slo son visibles durante la divisin celular.
En la especie humana existen 46 cromosomas, agrupados en 23 pares; 22 de
ellos se denominan autosomas y el ltimo es el par sexual. Los cromosomas sexuales determinan el sexo de los individuos. El sexo masculino est determinado por la
presencia del par sexual denominado cromosomas XY y el femenino por un par de
cromosomas XX.
Uno de los cromosomas sexuales femeninos, denominado cuerpo de Barr, se
puede observar en preparaciones de clulas de la mucosa bucal de las mujeres. Es
una estructura ovoide adherida a la membrana nuclear, teida de un color ms
oscuro que el resto del ncleo.

OBJETIVO

MATERIALES Y REACTIVOS

Identificar la presencia de cromosomas sexuales en la mucosa bucal femenina.

Palillos de dientes
Portaobjetos
Cubreobjetos
Microscopio
10 ml de colorante acetato de orcena
10 ml de solucin de alcohol al 50%
10 ml de colorante verde de Janus
20 ml de alcohol etlico
1 gotero
Lpices de colores
10 ml de solucin de alcohol al 95% previamente filtrado
Aceite de inmersin

143

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO

1. Con un palillo, efecta un raspado de atrs


hacia adelante en la parte interna de la
mejilla.

cuado. Vierte sobre la preparacin una


gota de aceite de inmersin y cambia al
objetivo de mayor aumento.

2. Extiende el raspado bucal de abajo hacia


arriba en el portaobjetos como si realizaras un frotis.

7. Observa cuidadosamente y vers los cuerpos de Barr en la periferia de cada ncleo


celular como puntos de color lila. Dibjalos
y coloralos.

3. Agrega cuatro gotas de alcohol al 95%;


procura que cubra perfectamente la preparacin y espera diez minutos. Despus
hidrata la preparacin, aadiendo cuatro
gotas de alcohol al 50% y aguarda cinco
minutos.
4. Incorpora a la preparacin cinco gotas de
acetato de orcena y deja transcurrir ocho
minutos; lava la preparacin con agua
para eliminar el exceso de colorante.
5. Coloca cuatro gotas de colorante verde de
Janus (de contraste), espera un par de
minutos y lava de nuevo la preparacin
para retirar el exceso de colorante. Deja
secar al aire.
6. Acomoda la preparacin en el microscopio
y obsrvala con el objetivo de menor
aumento; localiza un campo visual ade-

144

PRCTICA 33

Cromosomas sexuales femeninos

PREGUNTAS
1. Cules son los cromosomas sexuales femeninos?
__________________________________________________________________________________
__________________________________________________________________________________
2. Qu nombre recibe cada uno de los cromosomas sexuales femeninos?
__________________________________________________________________________________
__________________________________________________________________________________

CONCLUSIONES:

145

Prctica

Variaciones sobre el
tema mendeliano

34
INTRODUCCIN

De acuerdo con lo estudiado de las leyes de Mendel (principios mendelianos), podramos pensar que siempre hay dos posibles alelos para cada gen y que un alelo
es completamente dominante sobre el alelo recesivo. Sin embargo, esto no es as,
si Mendel hubiera estudiado otras caractersticas y no las que seleccion, se habra
encontrado con que casi todas las caractersticas son influidas en formas ms variadas y sutiles.
Hoy se conoce que se dan otros tipos de herencia, que no responden a las leyes mendelianas (herencia no mendeliana), como la herencia con dominancia incompleta o codominancia y los alelos mltiples de un solo gen.

OBJETIVO

MATERIALES Y REACTIVOS

Comprobar que la mayor parte de los rasgos


esta sujeta a influencias variadas y sutiles.

Regla
Lpiz

PROCEDIMIENTO
1. En la dominancia incompleta, el fenotipo de los heterocigotos es intermedio entre los fenotipos de los homocigotos. Por ejemplo, en las plantas buenas tardes al cruzar plantas de flor
roja (RR) con homocigotos de flor blanca (rr), los hbridos (Rr) son de flor rosada. Qu ocurre al cruzar plantas de buenas tardes rosadas entre s? Realiza el cruce como si se tratara
de un monohbrido ordinario. Indica el fenotipo para el probable retoo.
Analiza la representacin esquemtica del cruce antes descrito.
R = flor roja
Cruce:

r = flor blanca
homocigoto dominante
RR

Gametos

homocigoto recesivo
X

rr
r

147

Biologa 10. Manual de talleres y laboratorios

Cuadro de Punnett
r

Rr

Rr

Genotipo: 100% heterocigoto

Rr

Rr

Fenotipo: 100% flor rosada

Autocruce (las plantas de la F1 entre s)


Cruce:

heterocigoto
Rr
R

Gametos:

heterocigoto
Rr

Cuadro de Punnett
R

RR

Rr

Rr

rr

Genotipo: 25% homocigoto dominante,


50% heterocigoto y 25% homocigoto recesivo.
Fenotipo: 25% flor roja, 50% flor rosada
y 25% flor blanca.

La dominancia incompleta es una forma en que se manifiesta este tipo de herencia, pero tambin se puede evidenciar como una codominancia, en la cual los dos fenotipos sern visibles.
Un ejemplo de esta situacin la representan los tipos sanguneos humanos, en que el fenotipo
resultante no es una mezcla de los fenotipos de los progenitores, sino que ambos alelos ejercen su dominio; este comportamiento recibe el nombre de codominancia.
Por eso encontramos personas cuyo grupo sanguneo es AB.
2. Alelos mltiples, muchas variantes para un mismo gen.
El fondo gentico, poza o acervo de genes de una poblacin, es el conjunto total de los alelos de
todos los genes en una poblacin. Si en un fondo comn de genes existen ms de dos alelos para
una determinada caracterstica, se habla de polimorfismo gentico o de alelos mltiples.
Una de las formas ms sencillas de evidenciar este fenmeno es el tipo sanguneo.
Cuntos tipos sanguneos existen en tu aula de clases?

Los tipos sanguneos A, B, AB y O son el resultado de tres alelos diferentes de un mismo gen,
generalmente designado como 1A, 1B e i.
Con la simbologa anterior podras indicar cules son alelos dominantes y cules son
recesivos.

148

PRCTICA 34

Variaciones sobre el tema mendeliano

El alelo 1A determina la sntesis de glucoprotena A, el alelo 1B determina la sntesis de glucoprotena B que sobresalen en la superficie de los eritrocitos, pero el alelo i no produce la sntesis
de glucoprotenas.
Determina los seis probables genotipos de la combinacin de estos tres alelos. Utiliza la
simbologa IA IA, IB IB.

Los alelos IA e IB son codominantes uno con el otro y dominantes ante i. Lo anterior, qu quiere decir?

Las glucoprotenas de los eritrocitos pueden reaccionar con anticuerpos en el plasma sanguneo. Si una persona, por ejemplo, con el tipo sanguneo A recibe una transfusin de sangre tipo
B, los anticuerpos anti-B hacen que las clulas de tipo sanguneo A se aglutinen, y se mantienen unidas por los anticuerpos tipo B. Estas aglutinaciones pueden formar cogulos, de consecuencias mdicas graves.
Analice el siguiente cuadro con informacin de donadores y receptores de sangre de acuerdo con el tipo sanguneo.
Por qu el tipo sanguneo AB es el receptor universal y el tipo O el donador universal?
Donadores y receptores de sangre
en transfusiones
Grupo del
donador
A
B
AB

Grupo
permitido del
receptor
A
AB
B
AB
AB
A
B
AB
O

149

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Cules son las probables combinaciones genotpicas de la descendencia de una pareja conformada por un hombre de tipo sanguneo O y una mujer de tipo AB?
2. Cules son las probables combinaciones genotpicas de la descendencia de una pareja conformada por un hombre de tipo sanguneo A, hijo de un hombre AB y una mujer O; y una mujer de tipo B, hija de un hombre tipo O y una mujer B? Recuerda que el tipo ii corresponde a
un homocigoto recesivo e IA IB a codominancia.
3. Un hombre antepone una demanda de divorcio alegando que el tipo sanguneo B del tercer
hijo de su esposa no es suyo, puesto que sus dos hijos anteriores son de tipo A, igual al de l.
Para la verificacin, los microbilogos determinan el tipo sanguneo de los padres del hombre, establecido que el padre es A y la madre es O. La esposa es de tipo sanguneo B, tiene
un hermano de tipo A y una hermana de tipo B, su padre es AB y su madre es O.
Es el nio hijo del esposo de la mujer? Respalda tu respuesta con el cuadro de Punnett para el cruce respectivo.
4. Otro tipo de protena presente sobre los eritrocitos es el factor Rh (Rhesus). Si se encuentra
presente, la sangre se describe como Rh positiva (Rh+); y si la protena est ausente, la sangre es Rh negativo (Rh). El factor Rh+ es una caracterstica gentica dominante.
Practica con la informacin anterior, tanto de factor como de tipo sanguneo, el siguiente cruce dihbrido y determina las probables combinaciones genotpicas y fenotpicas de la descendencia.
Una mujer doble homocigota dominante tipo sanguneo A y Rh+ y un hombre doble heterocigota tipo sanguneo B y Rh+.

CONCLUSIONES:
CONCLUSIONES:

150

Prctica

Problemas de gentica

35
INTRODUCCIN

Los principios de la gentica clsica fueron establecidos por Gregorio Mendel al


realizar sus famosos experimentos de entrecruzamiento de plantas. De estos estudios, Mendel concluy que cada carcter en particular est controlado o determinado por un par de genes. A los genes alternativos de una caracterstica se les da
el nombre de alelos.
Cuando se cruzan individuos homocigticos que tienen alelos alternativos para
una misma caracterstica, se produce un hbrido que presenta una sola de las caractersticas alternativas para esa caracterstica (la dominante, la cual enmascara la
expresin de los alelos recesivos). Primera Ley de Mendel: El enmascaramiento de
alelos recesivos dar por resultado organismos con un mismo fenotipo pero diferente genotipo.
De acuerdo con la Segunda Ley de Mendel, de la segregacin, cada gameto
recibe slo un alelo de los genes del organismo. Los dos alelos de un gen se segregan uno del otro en la meiosis. Cuando un espermatozoide fecunda un vulo, la
progenie resultante recibe un alelo del padre y uno de la madre.
Con frecuencia, un genetista debe analizar la herencia de dos o ms rasgos en
el mismo grupo de individuos.
La Tercera Ley de Mendel, ley de la distribucin independiente de los caracteres sostiene que los alelos de un rasgo se distribuyen a los gametos con independencia de los alelos de los otros rasgos.

OBJETIVOS

MATERIALES Y REACTIVOS

Determinar los genotipos y fenotipos resultantes de la combinacin de gametos en el


zigoto.
Determinar las razones o proporciones fenotpicas resultantes.

Libro de texto

151

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
A. Define los siguientes conceptos:

1.

Alelo: _____________________________________________________________________________
__________________________________________________________________________________

2. Recesivo: _________________________________________________________________________
__________________________________________________________________________________
3. Dominante:________________________________________________________________________
__________________________________________________________________________________
4. Fenotipo:__________________________________________________________________________
__________________________________________________________________________________
5. Genotipo: _________________________________________________________________________
__________________________________________________________________________________
6. Homocigoto:_______________________________________________________________________
__________________________________________________________________________________
7. Heterocigoto: ______________________________________________________________________
__________________________________________________________________________________
8. Puro: _____________________________________________________________________________
__________________________________________________________________________________
9. Hbrido: ___________________________________________________________________________
__________________________________________________________________________________
10. Cuadro de Punnett: ________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

152

PRCTICA 35

Problemas de genticas

B. Resuelve cada uno de los problemas que se plantean a continuacin en F1 y F2, indicando el
genotipo y fenotipo en cada caso.
1.

Si una planta homocigtica de tallo alto (AA) se cruza con una planta homocigtica de tallo
enano (aa), recordando que el tallo alto es dominante sobre el tallo enano. Cmo sern los
genotipos y fenotipos de la F1 y de la F2?
F1

Genotipo________________ Fenotipo______________________

F2

Genotipo________________ Fenotipo______________________
Genotipo________________ Fenotipo______________________
Genotipo________________ Fenotipo______________________

153

Biologa 10. Manual de talleres y laboratorios

2. Encuentra las proporciones fenotpicas y genotpicas de un cruce de un tallo alto con semillas
amarillas (TTAA) con un tallo enano con semillas verdes (ttaa) En F1 y F2:
F1

Genotipo________________ Fenotipo______________________

F2

Genotipos:
__________________________________________________________________________________
__________________________________________________________________________________

Fenotipos:
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

Proporcin fenotpica:
__________________________________________________________________________________
__________________________________________________________________________________

154

PRCTICA 35

Problemas de gentica

CONCLUSIONES:

155

Prctica

Hominizacin

36
INTRODUCCIN

El hombre y su proceso evolutivo. En su clasificacin de los seres vivos, Linneo


(1707-1778) consider al hombre como una especie del Reino Animal: Homo sapiens.
Un siglo despus, Darwin (1809-1882) escandaliz a gran parte de los sabios de
su poca al sentar las bases de la moderna concepcin evolucionista de la vida con
la publicacin de El Origen de las Especies (1859) y del origen de la especie humana en su obra El Origen del Hombre (1871).
La polmica suscitada al respecto tuvo amplia resonancia en la opinin pblica
debido a que, las ideas evolutivas en general, y las del origen del hombre en particular, no afectaban tan slo al pensamiento cientfico, sino que sus consecuencias
incidan tambin en la filosofa de la poca.
Se trataba de la concepcin que el hombre tena de s mismo. Y, si en el periodo del Renacimiento, la Tierra haba dejado de ser el centro del Universo para convertirse en un simple planeta del Sistema Solar, ahora el hombre ya no se consideraba un ser aparte, sino el resultado de un proceso evolutivo regido por los mismos
mecanismos que han llevado a todas las especies vivientes a su estado actual.
Esta concepcin evolucionista del origen del hombre ha encontrado su soporte material en diversas ramas del conocimiento biolgico: la paleontologa, la anatoma comparada, la embriologa, la bioqumica, la serologa, la fisiologa, la etologa, e incluso, la parasitologa, que han aportado pruebas para aquellas ideas
revolucionarias del siglo pasado que haban situado correctamente al hombre en el
lugar que le corresponde en la naturaleza.
La especie humana, tal como la conocemos en la actualidad, es resultado de un
largo proceso de evolucin biolgica y cultural, que podra explicarse fundamentalmente por la accin combinada de los siguientes mecanismos: mutacin, seleccin
natural, derivacin gentica, migracin, flujo gentico, consanguinidad y matrimonios selectivos.
La evolucin es un proceso biolgico que nos obliga a considerar la variabilidad
humana en el tiempo. En qu momento aparece la especie humana? Cmo se ha
llegado al estado actual?
Para responder estas preguntas, los antroplogos estudian el proceso de hominizacin.
Las pruebas de este proceso estn constituidas por restos fsiles pertenecientes a distintas pocas y con caractersticas tambin distintas. Los diferentes rasgos
esquelticos se comparan entre s y con otras especies de primates, adems de con
el hombre actual. Tambin se intenta conocer a qu poca pertenecieron (datacin)
y se estudian sus utensilios para inferir el desarrollo cultural de quienes los fabricaron.

157

Biologa 10. Manual de talleres y laboratorios

OBJETIVOS

MATERIALES Y REACTIVOS

Estudiar la evolucin de los rasgos anatmicos craneales en el proceso de hominizacin.


Analizar la variabilidad del hombre en el
tiempo.

Perfiles de crneos de hombres de diferentes pocas


Cinco acetatos
Cinco lpices de colores
Una hoja milimtrica

PROCEDIMIENTO
1.

Se estudiarn los caracteres descriptivos del crneo de estos fsiles por ser el componente
esqueltico que ha sufrido los cambios relativamente ms importantes a lo largo del proceso
de hominizacin y porque alberga al cerebro, lo que hace que la capacidad craneal y el volumen cerebral estn ntimamente relacionados.
En el crneo pueden considerarse las siguientes partes:

NEUROCRNEO

Crneo

ESPLACNOCRNEO
(O CARA)

MANDBULA

2. En esta prctica se adjuntan una serie de perfiles a escala natural representativos del
Australopithecus africanus, Homo erectus, H. sapiens neanderthalensis, H. sapiens fossilis, y
del hombre actual.

3. Se calcarn los cinco perfiles del siguiente modo: primero el perfil correspondiente al hombre
actual y se unirn los puntos G e I mediante una recta. Despus, y sobre el mismo papel, se
har lo mismo con los dems perfiles haciendo coincidir los puntos G (glabela: punto ms prominente de la regin interciliar de la frente) y situando a los puntos /(inion: punto ms prominente de la protuberancia occipital externa) sobre la recta que pasa por G e I trazada anteriormente. La utilizacin de colores diferentes para los distintos perfiles contribuir a una
mejor comprensin del dibujo. Tambin si se desea se pueden superponer, en hojas aparte, los
perfiles de dos en dos.

158

PRCTICA 36

Hominizacin

4. Una vez realizada la superposicin de perfiles, responde las siguientes preguntas.


A partir de los datos de la tabla, construye una grfica de la evolucin de la capacidad craneal.
En qu punto se observa una inflexin importante en la grfica? Interpreta dicha grfica.
5. Evolucin de la capacidad craneal.

PROSIMIOS
SIMIOS
DRIOPITECOS
AUSTRALOPITECOS
H. HABILIS
PITECANTROPOS
H. SAPIENS

Millones de aos
70
40
20
4
2,5
0,5
0

Capacidad craneal
50CC
80
175
550
675
1000
1500

PREGUNTAS
1.

Qu ocurre con el prognatismo (proyeccin hacia adelante de la cara) en el proceso de


hominizacin?
__________________________________________________________________________________
__________________________________________________________________________________

2. Compara los arcos superciliares en todos los perfiles, qu puede decirse de este carcter
anatmico despus de la observacin de los distintos estadios evolutivos?
__________________________________________________________________________________
__________________________________________________________________________________
3. Qu aspecto presenta el occipital del Hombre de Neandertal?
__________________________________________________________________________________
__________________________________________________________________________________
4. Observando el neurocrneo y esplacnocrneo (cara) en cada uno de los estadios evolutivos,
qu se puede decir de la relacin entre el tamao del crneo y el de la cara (relacin neurocrneo/esplacnocrneo) a lo largo de la hominizacin?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
5. Observa en cada caso el hueso frontal, Qu podemos decir de su inclinacin?
__________________________________________________________________________________
__________________________________________________________________________________

159

Biologa 10. Manual de talleres y laboratorios

6. Qu implica lo anterior con respecto a la capacidad craneal?


__________________________________________________________________________________
__________________________________________________________________________________
7. Puede existir alguna relacin entre la capacidad intelectual y los distintos grados de inclinacin del frontal? Explica (recuerda la funcin de los lbulos frontales del cerebro).
__________________________________________________________________________________
__________________________________________________________________________________
8. Valora (de 1 a 5) todos los caracteres en cada uno de los estadios de la hominizacin.
PROGNARELACIN
TISMO
CRNEO/CARA

ARCOS SUPER- INCLINACIN CAPACIDAD


CILIARES
DEL FRONTAL CRANEAL

AUSTRALOPITECO
PITECANTROPO
NEANDERTAL
CROMAN
ACTUAL

9. Compara los caracteres anteriormente considerados entre el chimpanc y otros simios y el


hombre actual. Cules estn ms desarrollados en cada una de las especies? Cules lo
estn menos?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
10. Observa el esquema Filogenia de los Primates puede decirse que el hombre desciende
del chimpanc o de algn otro mono actual?, qu sentido puede tener el dicho de que el
hombre desciende del mono?
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

160

PRCTICA 36

Hominizacin

CONCLUSIONES:

161

Biologa 10. Manual de talleres y laboratorios

1. Hombre actual. (H. sapiens)

2. Australopiteco (A. Africanus)

162

PRCTICA 36

Hominizacin

3. Pitecantropo (H. erectus)

4. Neandertal (H. sapiens neanderthalensis)

163

Biologa 10. Manual de talleres y laboratorios

5. Croman (H. Sapiens fossilis)

164

Prctica

Evidencias de la evolucin

37
INTRODUCCIN

La evolucin es considerada por los bilogos como un hecho; es un proceso de cambio mediante el cual se forman nuevas especies a partir de especies preexistentes.
Existen muchas pruebas o evidencias que confirman que las diferencias que se
aprecian entre los organismos han sido producto del proceso evolutivo, originadas
por la necesidad que los organismos han tenido de adaptarse al medio.

OBJETIVO

MATERIALES Y REACTIVOS

Identificar las evidencias de la evolucin.

Libro de texto
Figuras de las evidencias
Tijeras
Goma

PROCEDIMIENTO
1. Define los siguientes conceptos
a. Evolucin: ______________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
b. Fsil: __________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________

165

Biologa 10. Manual de talleres y laboratorios

c. Estructura homloga: ___________________________________________________________


__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
d. Estructura anloga: _____________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
e. Estructura vestigial: _____________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
__________________________________________________________________________________
2. Completa el mapa conceptual sobre evolucin e ilustra cada evidencia

Evolucin
es

Evidencias

ejm

ejm

Figura

166

Figura

como

Figura

como

Figura

PRCTICA 37

Evidencias de la evolucin

PREGUNTAS
1. Cul es la ciencia que estudia los fsiles?
2. Menciona algunas estructuras semejantes en el desarrollo embrionario de varias especies.
3. Qu estudia la embriologa?
4. Define qu es evolucin convergente.
5. Qu evidencias anatmicas puedes mencionar?
6. Cules son las diferencias entre las estructuras homlogas y las anlogas?

CONCLUSIONES:

167

Prctica

Seleccin natural

38
INTRODUCCIN

La seleccin natural es el proceso propuesto por Charles Darwin, en ella explica que
los organismos estn sometidos a diferentes presiones ambientales factores fsicos como luz, presin, temperatura, relieve topogrfico, y existe una competencia
entre individuos de la misma especie por el alimento y espacio para poder reproducirse. Debido a esto, Darwin pensaba que aqullos que presentaban mejores adaptaciones (caractersticas fsicas, fisiolgicas o de comportamiento heredadas que
facilitan su supervivencia) a su ambiente, tenan mayor probabilidad de desarrollarse y reproducirse para mantener su informacin gentica como especie. Aquellos
que no presentaran o desarrollaran dicha capacidad, no podran reproducirse o sus
descendientes representaran una pequea proporcin de la poblacin. Es importante mencionar que Darwin no pensaba en la supervivencia de un solo individuo,
sino en la de varios organismos de una poblacin. La especiacin son los cambios
que se presentan en una poblacin a lo largo del tiempo, y se pueden mantener o
no, pues varan segn las presiones de seleccin que existan en un momento dado,
as tenemos distintos estados de la poblacin y este proceso da origen a nuevas especies.

OBJETIVOS

MATERIALES Y REACTIVOS

Demostrar, con ayuda de una simulacin, uno


de los mecanismos de la seleccin natural.
Comprender cmo una caracterstica de los
organismos de una poblacin permite predecir su supervivencia y las variaciones que tendrn a lo largo del tiempo.

Cuaderno de notas
2 pliegos de papel peridico
1 hoja de papel blanco
1 hoja de papel negro u oscuro
Tijeras

PROCEDIMIENTO
1. Recorta uno de los pliegos de papel peridico en cuadrados de 3  3 cm, haz lo
mismo con las hojas de papel negro y papel blanco. Con 35 piezas de cada color de
papel ser suficiente. Cada tipo de papel
representa una especie distinta.

2. Extiende el pliego de papel peridico restante y emplalo como ambiente, coloca


al azar todos los recortes de papel en la
superficie, trata de distribuirlos de manera homognea y que no queden amontonados en un solo lugar.

169

Biologa 10. Manual de talleres y laboratorios

3. Para realizar la prctica, t y tus compaeros actuarn el papel de depredadores,


para esto debern colocarse de espaldas
al pliego de papel, voltear rpidamente y
tomar el primero de los recortes que vean.
Cada uno hgalo 5 o 10 veces. Registra
los datos de organismos capturados en la
siguiente tabla:

Depredador

Animales blancos

4. Calcula el nmero de organismos sobrevivientes de cada especie y de la poblacin total, trata de predecir qu ocurrir
en la siguiente generacin, qu tipo de especie tendr ms organismos. Compara
los resultados de tu equipo con el resto
del saln y trata de explicar las diferencias.

Animales negros

Animales manchados

#1

#2

PREGUNTAS
1. Segn los resultados del experimento, qu tipo de animales sobrevivieron en mayor proporcin? Explica por qu.
2. Da algunos ejemplos que se dan en forma semejante en la naturaleza.
3. Si el ambiente (el papel peridico) fuera cambiando a un color ms oscuro, habra cambios
en la frecuencia poblacional? Por qu?

170

PRCTICA 38

Seleccin natural

CONCLUSIONES:

171

Prctica

Adaptaciones al
ambiente

39
OBJETIVO

MATERIALES Y REACTIVOS

Analizar las diferencias que presentan los organismos en sus estructura.

Figuras de las semillas de tomate, caoba,


guayacn y coco
Figuras de los siguientes animales, avestruz,
pato, garza, pelcano, halcn, guila, guacamaya, azulejo y palomino

PROCEDIMIENTO
A. Recorta y pega en el espacio correspondiente las semillas que se te piden.

Tomate

Guayacn

Caoba

Coco

173

Biologa 10. Manual de talleres y laboratorios

Anota la informacin que se te solicita.

Nombre de la semilla

Caracterstica
morfolgica que
presenta

Forma de dispersin
o propagacin

Cuadro No. 1. Caractersticas de las semillas.

B. Recorta y pega los picos de las aves que se te piden en el siguiente cuadro.

Garza

guila

Pelcano

Halcn

Cuadro No. 2. Las caractersticas de las formas de los picos.

Nombre del ave

174

Caracterstica
morfolgica que
presenta

Alimento que
consume

PRCTICA 39

Adaptaciones al ambiente

C. Recorta y pega las patas de las aves que se te solicitan en el siguiente cuadro.

Pato

Avestruz

guila

Azulejo

Palomino

Guacamaya

Cuadro No. 3. Caractersticas de las formas de las diferentes patas.

Nombre de las
aves

Formas de las
patas

Caractersticas
o morfolgicas

Funcin de la
estructura

175

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Explica, utilizando un ejemplo, qu entiendes por adaptacin morfolgica.

2. Explica qu entiendes por adaptacin fisiolgica.

3. Explica cul es el papel biolgico o importancia de las semillas.

4. Cul es el papel biolgico de los picos de las aves?

5. Cul es el papel biolgico o importancia de las patas de las aves?

6. Cul es el papel biolgico o importancia de las hojas de las plantas?

176

PRCTICA 39

Adaptaciones al ambiente

7. Con base en las observaciones realizadas y ayudado por tu libro, escribe la definicin de:
a. Nicho ecolgico

b. Hbitat

8. Cul es la relacin entre un nicho ecolgico y el hbitat de un organismo y las adaptaciones


que ste presente?

CONCLUSIONES:

177

Prctica

Clasificacin

40
INTRODUCCIN

La taxonoma o sistemtica, es la ciencia que se ocupa de clasificar a los seres vivos


de acuerdo con sus semejanzas y diferencias, en un sistema integrado por categoras.

OBJETIVO

MATERIALES Y REACTIVOS

Conocer los elementos tiles para una clasificacin.

Libro
Revista
Bolgrafo
Pluma fuente
Moneda de 50 cts
Monedas

PROCEDIMIENTO

A. Uso e importancia de la clave dicotmica


en la clasificacin
1. Todas las claves taxonmicas siguen un modelo dicotmico que se ejemplifica a continuacin.
2. Coloca sobre tu mesa un libro, una revista,
una pluma fuente, un bolgrafo, una moneda de cincuenta centavos y otra de un nuevo peso. Numralos en orden progresivo.
3. Observa detenidamente el primer objetivo.
4. Tienes tres posibilidades para clasificarlo;
consulta el cuadro A y si la primer descripcin (1) se acerca a la definicin del objeto
escogido contina para completarla con las

opciones que se indican en el recuadro de


la derecha.
5. En caso de que la descripcin no concuerde con la definicin del objeto, pasa a la segunda (2), y de haber acertado, contina
con las opciones que estn en el recuadro
de la derecha.
6. Si ninguna de las dos primeras descripciones es correcta, pasa a la tercera (3) y contina con las opciones del recuadro de la
derecha.
7. Realiza esta operacin con los dems objetos hasta conseguir su definicin completa
y correcta.

179

Biologa 10. Manual de talleres y laboratorios

Cuadro A
1. Formado por hojas de papel en las que existen 4. Con cubierta dura... libro
signos impresos. S es as, contina con las
4a. Con cubierta flexible hecha del mismo material
opciones 4 o 4a
que las hojas del interior... revista
2. Objeto de forma cilndrica con punta que deja
una marca al deslizarse sobre el papel. Si es
as, contina con las opciones 5 o 5a

5. Con punta cnica negra... pluma fuente


5a. Con punta en forma de pequea bolita...
bolgrafo

3. Metlico en forma de disco... Continuar en la


opcin 6 o 6a

6. De color plateado... moneda de 50 cts.


6a. De color plateado / bronce y pequea...
moneda de un centavo o diez cts.

B. Clasificacin de formas geomtricas

2. Guate por el ejemplo del cuadro A.


3. Dibjalos y escribe en el espacio correspondiente del cuadro B los argumentos en
que te fundamentaste.

1. Los siguientes dibujos presentan varias formas y sombreados; obsrvalos y determina


un mtodo para agruparlos en seis grandes
nmeros.

J
L

180

PRCTICA 40

Clasificacin

Cuadro B

Grupo

Clasificacin

Fundamento

Ejemplo

Forma geomtrica

I
II
III
IV
V
VI

C. Clasificacin de los organismos


1. Observa las siguientes figuras de organismos y clasifcalos en cinco grupos: monera,
hongos, protistas, animales y plantas.

Alga

Camello

Bacteria

Paramecio
Pino
Girasol

Grillo
Hombre
Sombrerillo

Hongo

Esporas
Micelio

Lminas

Pie o
columna
Hifas

181

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Podras mencionar algunas fallas de la clave anterior?

2. Cmo la mejoraras?

3. Qu es una clave dicotmica?

4. Qu es clasificacin?

5. Qu es taxonoma?

6. Cul es la utilidad de las clasificaciones?

7. Clasifica las imgenes del recuadro como protistas, monera, hongos, animales y plantas.

8. En qu reino est ubicado el hombre?

182

PRCTICA 40

Clasificacin

CONCLUSIONES:

183

Prctica

Clasificacin de los
organismos

41
INTRODUCCIN

La taxonoma de la palabra griega taxis, que significa arreglo u ordenamiento es la


ciencia que permite hacer estudios sobre la clasificacin de los seres vivos y permite colocarlos dentro de categoras.
Las categoras taxonmicas forman un orden jerrquico, es decir, una serie de
niveles en los que la categora mayor abarca a todas las dems.
Hay siete categoras principales: especie, gnero, familia, orden, clase, divisin
para las plantas y similares a ellas, o filum y reino.
Cada categora desde la especie hasta el reino, es cada vez ms general e incluye organismos cuyo antepasado comn era cada vez ms remoto en su relacin
evolutiva.
La siguiente tabla refleja la relacin existente entre los organismos:
El nombre cientfico de un organismo se forma de las dos categoras ms pequeas: el gnero y la especie. Por ejemplo, el nombre cientfico para el ser humano, Homo sapiens, nos coloca en el gnero Homo (hombre) y en la especie
sapiens (pensante).
El gnero es una categora que comprende organismos muy estrechamente
emparentados que, por lo general, no se cruzan.
La especie es una categora limitada de los organismos que se cruzan bajo condiciones naturales esto slo para los que los hacen sexualmente; por ejemplo: El
gnero Sialia (azulejos) incluye el azulejo oriental (Sialia sialis), el azulejo occidental (Sialia mexicana) y el azulejo de la montaa (Sialia currucoides), aves muy parecidas que normalmente no se cruzan.
Los nombres cientficos deben siempre subrayarse o escribirse en cursiva. La
primera letra del nombre del gnero siempre se escribe con mayscula y la primera del nombre de la especie con minscula.
La comunidad de bilogos reconoce estos nombres en todo el mundo, lo cual
supera las barreras idiomticas y permite una comunicacin precisa, puesto que los
nombres comunes o vulgares varan en las diferentes regiones.

185

Biologa 10. Manual de talleres y laboratorios

OBJETIVOS

MATERIALES Y REACTIVOS

Utilizar la taxonoma para clasificar y estudiar a los seres vivos.


Reconocer la importancia de clasificar a los
seres vivos.

Figuras
Tijeras
Goma

Categora

Ser humano

Chimpanc

Lobo

Mosca de
fruta

rbol
secoya

Girasol

Reino

Animalia

Animalia

Animalia

Animalia

Plantae

Plantae

Filum

Chordata

Chordata

Chordata

Arthropoda

Coniferophyta

Anthophyta

Clase

Mammalia

Mammalia

Mammalia

Insecta

Coniferosida

Dicotyledoneae

Orden

Primates

Primates

Carnvora

Diptera

Coniferales

Asterales

Familia

Hominidae

Pongidae

Canidae

Drosophilidae

Taxodiaceae

Asteraceae

Gnero

Homo

Pan

Canis

Drosophila

Sequoiadendron

Helianthus

Especie

Sapiens

troglodytes

lupus

melanogaster

giganteum

annuus

PREGUNTAS
1. Escribe ejemplos de seres que estn clasificados bajo algn criterio o propiedad.

2. Por qu es importante clasificar?

3. Cuntos organismos conoces? Escribe una lista. Clasifcalos teniendo en cuenta alguna propiedad.

186

PRCTICA 41

Clasificacin de los organismos

4. Explica las siguientes afirmaciones:


a. La clasificacin refleja la relacin existente entre los organismos.

b. Es necesario clasificar los organismos.

c. Las categoras taxonmicas son provisionales y estn sujetas a revisin mientras se siga
descubriendo ms sobre la vida en la Tierra.

5. Escribe predicciones:
a. Si los organismos no tuvieran un nombre cientfico, cmo se afectara la comunidad
cientfica?

b. Si organismos de diferentes especies se cruzan, qu puede suceder?

6. Con base en las caractersticas descritas, clasifica los organismos en los reinos que hoy existen. Pega figuras representativas de:
a. Organismo con pared celular de celulosa.

b. Organismo que se alimenta absorbiendo o ingiriendo nutrientes o haciendo fotosntesis.

c. Generalmente, son organismos no mviles que absorben los nutrientes.

187

Biologa 10. Manual de talleres y laboratorios

7. Escribe las diferencias entre:


a. El reino Animal y Plantae:

b. El reino Fungi y Plantae:

c. El reino Monera y Protista:

8. Con base en las interpretaciones realizadas sobre el tema, cuntas especies existen?
a. Elabora una tabla de datos sobre la abundancia de especies identificadas.

b. Realiza un diagrama de barras con la anterior tabla de datos.

c. En qu se basa la distribucin de la abundancia de especies?

188

PRCTICA 41

Clasificacin de los organismos

CONCLUSIONES:

189

Prctica

Clave taxonmica

42
INTRODUCCIN

En la prctica anterior ya aprendiste que se manejan diferentes criterios para clasificar a los seres vivos. Todos estos criterios dan la descripcin del organismo, sin
embargo, el buscar la descripcin especfica de uno en particular, sera demasiado
laborioso y complicado, por lo que se cre un sistema de claves dicotmicas para
poder llegar a determinar qu organismo estamos estudiando. Se nombran dicotmicas porque con dos enunciados se compara la presencia o ausencia de una caracterstica, o la diferencia en nmero o posicin. El saber cmo emplearlas es de
gran ayuda para los taxnomos e investigadores, pues se puede especificar con qu
especie se est trabajando.

OBJETIVOS

MATERIALES Y REACTIVOS

Aprender el uso de una clave taxonmica.


Identificar a un organismo por medio de los
criterios marcados en la clave dicotmica.

Cuaderno de notas
Hojas de diferentes clases de pinos

PROCEDIMIENTO
1. Observa cuidadosamente las hojas de pino, nota que estn agrupadas en grupos
que se llaman fascculos, cada hoja se llama folio o fololo, y de manera comn se
les denomina como agujas.

2. Usa la siguiente clave taxonmica para


identificar a qu especie o gnero pertenecen las hojas que colectaste.

a) Hojas con forma de ramas

Cipreses

b) Hojas con forma de aguja

Pasa a c)

c) Hojas con forma de aguja individuales

Casuarinas o Abies

d) Hojas con forma de aguja agrupadas en fascculos

Pinos, pasa a e)

e) Fascculos de tres a cinco agujas

Pasa a h)

f) Fascculos de cuatro a seis agujas

Pasa a j)

191

Biologa 10. Manual de talleres y laboratorios

g) Fascculos de cuatro a seis agujas

Pasa a j)

h) Fascculos de tres agujas, hojas flexibles y colgantes

Pino patula

i)

Fascculos de tres agujas, hojas rgidas no colgantes

Pasa a l)

j)

Agujas de ms de 15 cm de largo

Pasa a n)

k) Agujas de menos de 15 cm de largo

Pasa a p)

l) Conos de 3-6 cm, caf plido sin resina

Pino teocote

m) Conos de 7-14 cm, caf oscuro con resina

Pino hartwegi

n) Agujas gruesas de ramillas escamosas

Pino montezumae

o) Agujas delgadas de ramillas casi lisas

Pino pseudostrobus

p) Agujas con vaina resistente

Pino hartwegii

q) Agujas con vaina caediza

Pasa a r)

r) Conos persistentes de 4-6 cm, caf grisceo

Pino leiophylai

s) Conos caedizos de 20-40 cm, caf amarillento

Pino ayacahiote

PREGUNTAS
1.

Menciona los pasos para usar una clave taxonmica.

2. Hay algn error en esta clave?


3. La anterior fue una clave bastante sencilla, sin embargo, otros organismos son ms complejos. Qu conocimientos crees que deberas tener para poder usar esas claves?
4. Es igual una gua de campo que una clave taxonmica? En qu casos se empleara cada una?

192

PRCTICA 42

Clave taxonmica

CONCLUSIONES:

193

Prctica

Factores abiticos

43
INTRODUCCIN

Un ecosistema es un sistema de organismos vivientes y del medio con el cual


intercambia materia y energa.
Un ecosistema contiene componentes biticos (todo lo vivo en el ecosistema),
tales como poblaciones de plantas, animales y microorganismos y componentes
abiticos (fsicos, sin vida) tales como agua, suelo, radiacin.
Los factores ambientales abiticos son los componentes del ecosistema que
carecen de vida pero ejercen una influencia determinante en la vida de los seres vivos. Los principales factores abiticos son la luz, la temperatura, la humedad, la
presin, la salinidad y la presin atmosfrica.
Los factores abiticos intervienen en la reproduccin, la irritabilidad, el crecimiento, el metabolismo y la adaptacin de los seres al medio.

OBJETIVO

MATERIALES Y REACTIVOS

Analizar la influencia de la luz y la temperatura ambiental en el crecimiento de las plantas.

Vaso de precipitados de 250 ml


20 semillas de pimentn
20 semillas de tomate
20 semillas de poroto
Tres bolsas para emparedado medianas
Ocho tiras de cartn de 8 cm de largo
Un colador
Tres platos Petri
Dos cajas de cartn
Linterna
Algodn

195

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Coloca las semillas dentro del vaso y agrega 100 ml de agua, djalas reposar durante 10 minutos.
2. Rotula los platos Petri con los nmeros del 1 a 3. Acomoda en cada uno dos tiras de cartn de
manera que el plato Petri quede dividido en cuatro porciones.
3. Coloca una capa de algodn humedecido en cada plato Petri.
4. Vierte el contenido del vaso qumico en el colador. Enjuaga las semillas.
5. Coloca cinco semillas en cada una de las divisiones del plato Petri. Ver figuras.

#1

Pimentn

#2

Tomate

#3

Poroto

6. Introduce el plato 1 dentro de una caja de cartn y colcala en un lugar fro; el plato 2 en un
lugar clido e iluminado y el plato 3 dentro de una caja en una zona con temperatura alta
durante siete das.
7. Registra los resultados en la tabla 1.
Tabla 1

Tipo de Semilla
Ejote
Tomate
Pimentn

196

Nmero de semillas germinadas


Caja 1
Caja 2
Caja 3

PRCTICA 43

Factores abiticos

PREGUNTAS
1. Qu factores abiticos intervinieron en el experimento?
__________________________________________________________________________________
2. En qu ambiente germinaron ms semillas?
__________________________________________________________________________________
3. En qu ambiente germinaron menos semillas?
__________________________________________________________________________________
4. Qu factores pudieron ocasionar la falta de germinacin de las semillas?
__________________________________________________________________________________

CONCLUSIONES:

197

Prctica

Factores fsicos y biolgicos de


diversos biomas terrestres

44

INTRODUCCIN
En los biomas se dan comunidades biticas, que constituyen poblaciones mutuamente acopladas, las cuales interactan y utilizan los factores fsicos que se
encuentren en ellos.

OBJETIVO

MATERIALES Y REACTIVOS

Identificar los diferentes factores fsicos y biolgicos que componen algunos biomas terrestres.

Libro de texto de biologa


Figuras de plantas y animales representativos de la selva, sabanas y desiertos

PROCEDIMIENTO
1. Completa el siguiente cuadro indicando los principales factores fsicos y biolgicos de la selva,
la sabana y los desiertos. En el caso de los factores biolgicos ilustra con las figuras de plantas y animales.

199

200

Sabana

Desierto

Selva

Biomas
Terrestres
Clima

Vientos

Temperatura

Factores fsicos
Lluvia

Plantas y animales

Factores biolgicos

Biologa 10. Manual de talleres y laboratorios

PRCTICA 44

Factores fsicos y biolgicos de diversos biomas terrestres

PREGUNTAS
1. Menciona algunos factores fsicos de los biomas terrestres.

2. Menciona algunos factores biolgicos de cada uno de los biomas terrestres estudiados.

CONCLUSIONES:

201

Prctica

Biomas y ecosistemas

45
INTRODUCCIN

La energa fluye a travs de los ecosistemas a partir de los productores fotosintticos y a lo largo de varios niveles de consumidores. Cada categora de organismo
constituye un nivel trfico (literalmente, nivel de alimentacin).

OBJETIVO

MATERIALES Y REACTIVOS

Identificar los niveles trficos que integran las


cadenas alimentarias.

Lpices de colores
Libro de texto

PROCEDIMIENTO
1. Biomas y cadenas alimentarias.
Confecciona con figuras una cadena alimenticia de cada uno de los biomas terrestres.
2. Ecosistema local.
Dibuja algn ecosistema del sitio donde vives. Indica cules son los productores primarios y
los consumidores primarios, secundarios y terciarios.

203

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Qu es la bisfera?
2. Qu es un ecosistema?
3. Qu es un bioma?
4. Cmo fluye la energa en los ecosistemas?
5. Cules son las caractersticas de la selva tropical?
6. Cules son las caractersticas de las sabanas?
7. Cules son las caractersticas de los bosques caducifolios de clima templado?
8. Cules son las caractersticas de los bosques de clima templado lluvioso?
9. Cules son las caractersticas de los chaparrales?
10. Cules son las caractersticas de los desiertos?
11. Cules son las caractersticas de la tundra y la taiga?
12. Qu es el fitoplancton?
13. Qu es el zooplancton?
14. Cules son las caractersticas de los arrecifes de coral?
15. A qu se puede llamar bosques de algas y pastizal marino?

204

PRCTICA 45

Biomas y ecosistemas

Qu aprendiste?
Resuelve el siguiente crucigrama

2
6
3
1

5
5

205

Biologa 10. Manual de talleres y laboratorios

Horizontales

Verticales

1. Ecosistema formado por plantas acuticas con aspecto de pasto.

1. Es la superficie del planeta donde hay seres vivos.

2. Ecosistema formado por rboles de hojas


anchas y caducas.

2. La vegetacin dominante es de pastos,


musgos y lquenes.

3. Hay bosques de este tipo en las partes


media de Norteamrica hasta Centroamrica, Europa occidental y Asia oriental.

3. Est en el norte de Amrica y Eurasia. Su


vegetacin es de abetos, pinos y cipreses.

4. En ellos el flujo de materiales es cclico.

4. Ecosistema donde dominan las algas


verdes.

5. En este bioma hay cactus y carneros cuernilargo.

5. En este bioma hay animales como el guila harpa y el jaguar.

6. La relacin de los integrantes de este ecosistema es mutualista.

6. Se le conoce como sabana en frica y


pradera en Norteamrica.

CONCLUSIONES:

206

Prctica

Los niveles trficos

46
INTRODUCCIN

Para entender el flujo de energa en un ecosistema, los organismos se clasifican de


acuerdo con quin come a quin, en niveles trficos. Se distinguen dos grandes
grupos, productores y consumidores. Los productores fabrican su propio alimento,
es decir, los fotosintetizadores y quimiosintetizadores, y por la forma de obtener la
energa se denominan auttrofos.
Los productores constituyen siempre en una cadena alimenticia el primer nivel trfico.
Los consumidores, por la forma de obtener la energa tambin se denominan
hetertrofos.
Dentro del grupo de los consumidores estn los que se alimentan de productores, los herbvoros o consumidores primarios; los que se alimentan de animales, carnvoros o consumidores secundarios. Los carnvoros pueden ser primarios, secundarios, etc. Los omnvoros pueden alimentarse de productores, herbvoros y
carnvoros.
Finalmente, estn los descomponedores o reductores, un tipo especial de hetertrofos que cumplen una importante funcin en el ecosistema al realizar el reciclaje de todos los nutrientes que salen del sistema.

OBJETIVO
Determinar las categoras de organismos de
una comunidad y su posicin en la cadena alimentaria.

207

Biologa 10. Manual de talleres y laboratorios

PROCEDIMIENTO
1. Mediante un ejemplo escribe cmo es que t formas parte de una cadena alimentaria.
__________________________________________________________________________________
__________________________________________________________________________________
2. Busca en tu libro de texto cada concepto y defnelo.

A. CONSUMIDOR
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
B. PRODUCTOR
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
C. DESCOMPONEDOR
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________
__________________________________________________________

208

PRCTICA 46

Los niveles trficos

PREGUNTAS
1. Enumera los diferentes niveles trficos de acuerdo con su jerarqua.
__________________________________________________________________________________
__________________________________________________________________________________
2. Podran vivir los auttrofos sin los hetertrofos? Explica.
__________________________________________________________________________________
__________________________________________________________________________________

CONCLUSIONES:

209

Prctica

Cadena alimentaria

47
INTRODUCCIN

El ecosistema es una regin natural del planeta constituido por dos factores: un
abitico, determinado por el suelo, la temperatura y el agua bsicamente; y otro
bitico, integrado por flora y fauna, en el que por necesidades de alimentacin, proteccin y reproduccin se establecen interrelaciones que reciben el nombre de cadenas y redes alimenticias.
En una cadena alimentaria se establece una relacin lineal de alimentacin de
una comunidad, con base en un solo representante de cada nivel trfico.

OBJETIVO

MATERIALES Y REACTIVOS

Apreciar el papel de los productores consumidores y reintegradores en las cadenas alimentarias.

Tijeras
Goma
Figuras de plantas, animales y organismos
desintegradores

PROCEDIMIENTO
1. Investiga y anota las definiciones de los siguientes trminos:
a) Abitico

b) Bitico

c) Flora

d) Fauna

e) Productor

211

Biologa 10. Manual de talleres y laboratorios

f) Consumidor

g) Desintegrador

2. Ejemplo de cadena alimenticia terrestre.


a) Recorta las figuras.
b) Arma la cadena alimenticia, con las figuras que trajiste a clase, formando un ciclo de la
materia. En el espacio asignado pgalos y seala con flechas las secuencias correspondientes.

212

PRCTICA 47

Cadena alimentaria

PREGUNTAS
1. Mencione algunos organismos productores que conozcas.
2. De el nombre de algunos consumidores primarios.
3. Conoces algunos consumidores secundarios? Escribe su nombre.
4. Cules consumidores terciarios conoces?
5. Menciona algunos descomponedores

CONCLUSIONES:

213

Prctica

Red alimentaria

48
INTRODUCCIN

Las cadenas y redes alimentarias describen las relaciones de alimentacin dentro


de un ecosistema e ilustran quin se come a quin.
La cadena alimentaria establece las relaciones lineales y las redes alimentarias
son las que muestran las mltiples cadenas alimentarias de un ecosistema interconectadas. Ellas describen las relaciones de alimentacin efectivas dentro de un
ecosistema especfico.

OBJETIVOS

MATERIALES Y REACTIVOS

Realizar una red alimenticia con los componentes dados.


Distinguir los consumidores de los productores y de los descomponedores.
Conectar los componentes de una red alimenticia.

Esquemas trados por los estudiantes para


realizar la red alimenticia.

PROCEDIMIENTO
1. Realiza las conexiones entre los diferentes organismos quin se come a quin. Puedes utilizar diferentes colores para colocar las flechas que indicarn que tal organismo se come al
otro, por ejemplo, el gato se come al ratn...
2. Despus de haber realizado la red alimenticia o cadena alimenticia, contesta el cuestionario
observando su trabajo y comentando con tus compaeros.

215

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. De cules organismos se alimenta una vbora?

2. De cules organismos se alimenta un halcn?

3. Qu pasara si la zorra comiera un solo tipo de organismo?

4. Cules son los organismos que se alimentan del maz?

5. Menciona un organismo que consume la mayor cantidad de otros organismos.

6. En esta cadena alimentaria, qu componentes estn ausentes?

Consumidores terciarios
omnvoros superiores
Tigre

Consumidores secundarios
carnvoros

Ratn
Culebra

Bho

Zorro

Consumidores
primarios (herbvoros)
Conejo
Venado
Pjaro

216

Ardilla

PRCTICA 48

Red alimentaria

Productores

rbol

Hierbas

Descomponedores

UNA RED ALIMENTICIA SENCILLA

217

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

218

Prctica

Sopa reproductiva

49
OBJETIVO

Reconocer la importancia de la sexualidad en


el desarrollo integral del ser humano.

PROCEDIMIENTO
1. En la siguiente sopa reproductiva, localiza cuatro rganos del sistema reproductor femenino y
cuatro del sistema reproductor masculino.
T

2. Redacta una muy pequea definicin de los rganos del sistema reproductor masculino y femenino localizados en la sopa reproductiva.

rganos femeninos

rganos masculinos

219

Biologa 10. Manual de talleres y laboratorios

PREGUNTAS
1. Qu otro nombre reciben las clulas sexuales?

2. Qu nombre recibe la clula sexual femenina?

3. Qu nombre recibe la clula sexual masculina?

4. Qu rgano est presente tanto en el sistema reproductor femenino como en el masculino?

4.1 Cul es la funcin de ese rgano en el sistema reproductor femenino y masculino?

5. Menciona la funcin de cada uno de los rganos encontrados en la sopa reproductiva.

CONCLUSIONES:

220

Prctica

Las enfermedades de
transmisin sexual

50
INTRODUCCIN

Algunas de las enfermedades ms graves que afectan a los humanos son transmitidas por medio del contacto sexual. Se llaman enfermedades de transmisin sexual
o ETS.

OBJETIVO

MATERIALES Y REACTIVOS

Identificar algunas de las enfermedades de


transmisin sexual y sus mtodos de prevencin.

Lpices de colores

PROCEDIMIENTO
1. Coloca al lado de cada microorganismo la letra de la enfermedad que causa.
Enfermedad

Microorganismo

(a) Gonorrea

Treponema pallidum

(b) Sfilis

Tricomonas vaginalis

(c) Herpes

Virus VIH

(d) SIDA

Neisseria gonorrhoeae

(e) Tricomoniasis

Virus del herpes

PREGUNTAS
2. Cules son las infecciones de transmisin sexual ms comunes?

221

Biologa 10. Manual de talleres y laboratorios

3. Cmo se previenen las enfermedades de transmisin sexual o ETS?

4. Cul es el virus que se transmite por mantener relaciones sexuales con personas infectadas?

5. Por qu el SIDA es la ETS ms peligrosa que existe.

6. Cmo se transmite el VIH?


7. Marca con una X y colorea los factores de riesgo para la transmisin del virus que causa el SIDA.
Dar la mano
Recibir transfusiones

222

PRCTICA 50

Tener relaciones sexuales

Besarse

Asistir a clase

Las enfermedades de transmisin sexual

Abrazar a un enfermo de SIDA

Recibir una vacuna con una


jeringa

Comer en restaurantes

223

Biologa 10. Manual de talleres y laboratorios

CONCLUSIONES:

224

Bibliografa

AUDESIRK, Teresa; Audesirk, Gerald; Bruce, Byerss. Biologa. La vida en la Tierra. Sexta Edicin. Mxico. 2003.
BIGGS, Alton; Kapicka, Christ; Lundgren, Linda. Biologa. La dinmica de la vida. McGraw Hill. Mxico.1999.
CAMPBELL, Neil A.; Mitchel, Laurence G.; Reece, Jane. Biologa: Conceptos y Relaciones. Tercera Edicin. Pearson Educacin. Mxico. 2001.
DELGADO, Mara Cecilia; Eslava, Edgar. Aventura. Cuaderno de Actividades. Ciencias 7.Grupo Editorial Norma Educativa. Bogot, Colombia. 1999.
ESPINEL A., Mara del P.; Mendieta, Jenny, Arbelez, G. Nydia; Alcarcel G., Martha L. Ciencias 7, 8, 9. Prentice Hall. Pearson Educacin Colombia. Colombia. 2000.
INFANTE C., Hilda. Prcticas de Biologa 2. Quinta reimpresin. Santillana, S.A. de C. V. Mxico. 2001.
LEN, Sara; Ortiz, Andrs; Caballero, Arturo. Prcticas de Laboratorio de Biologa 1. Esfinge. Mxico. 1994.
MENESES, Paulo; Meja Galvn, Elsa; Jarquere, Vicente; H., Gustavo. Biologa: Actividades y Prcticas de Laboratorio. Limusa. Mxico. 1988.
MILLER, Kenneth; Levine, Joseph. Biologa. Pearson Educacin. New Jersey. 2004.
ORAM, Raymond, Hummer, Paul; Smoot, Robert. Biologa. Sistemas Vivientes. Compaa Editorial Continental. Mxico.
1986.
PARGA, Diana. Olimpiadas: Ciencias 7. Libro de Actividades. Voluntad. Bogot, Colombia. 2000.
PARGA, Diana. Olimpiadas: Ciencias 8. Libro de Actividades. Voluntad. Bogot, Colombia. 2000.
PARGA, Diana. Olimpiadas: Ciencias 9. Libro de Actividades. Voluntad. Bogot, Colombia. 2000.
PETER, Alexander; Bahret, Mary Jean; Chvez, Judith; Courts, Gary; Skolky DAlessio, Naomi. Biologa. Prentice Hall.
SALGADO, Reina; Ramrez, Jos Martn; Hernndez M., Pedro. La Biologa y t. Ediciones Pedaggicas. Mxico.1993.
SAND Urea, Rita. Biologa. Un enfoque prctico. Educacin diversificada. Primera Edicin. 2000.
SAND Urea, Rita. Biologa. Un enfoque prctico. Educacin diversificada. Primera Edicin. 2002.
VERGARA V., Csar A. Biologa 1 y 2. Guas de Investigacin. REA. Internacional Editorial. Panam. 2001.

225