Oten Biology

Gill Sans Bold
Biology
HSC Course
Stage 6
Maintaining a balance
BIOHSC41284
XP005618
OTEN
Acknowledgments
This publication is copyright Learning Materials Production, Open Training and Education Network
Distance Education, NSW Department of Education and Training, however it may contain material from
other sources which is not owned by Learning Materials Production. Learning Materials Production
would like to acknowledge the following people and organisations whose material has been used.
All reasonable efforts have been made to obtain copyright permissions. All claims will be settled in
good faith.
Writer:
Tom Grant
Editor:
Rhonda Caddy
Instructional design:
Jane West
Illustrator:
Thomas Brown
Consultant:
Gina Grant
Copyright in this material is reserved to the Crown in the right of the State of New South Wales.
Reproduction or transmittal in whole, or in part, other than in accordance with provisions of the
Copyright Act, is prohibited without the written authority of Learning Materials Production.
Learning Materials Production, Open Training and Education Network Distance Education,
NSW Department of Education and Training, 2000. 51 Wentworth Rd. Strathfield NSW 2135.
Contents
Module overview ........................................................................iii

Outcomes ............................................................................................ iii
Indicative time...................................................................................... iv
Resources............................................................................................ iv
Icons..................................................................................................... vi
Glossary.............................................................................................. vii
Part 1: Enzymes..................................................................127
Part 2: Homeostasis and temperature regulation ............... 141
Part 3: Mammalian blood ....................................................142
Part 4: Transport in plants...................................................128
Part 5: Excretion..................................................................141
Part 6: Maintaining water balance .......................................133
Module evaluation ................................................................... 35
Introduction
ii
Module overview
From the molecular and organelle levels in cells, through the specialised
organ systems of multicellular species to whole ecosystems, biological
processes are balanced by a range of internal coordination mechanisms.
Some organisms maintain a constant internal environment while others
tolerate a much greater variation in internal conditions. However, all
species have a range of external conditions under which they can survive
and reproduce. The nature of control mechanisms in plant and animal
species, including humans and native Australian species, is considered in
this module.
Outcomes
This module contributes to the following HSC course outcomes:
A student:
Introduction
H4
assesses the impacts of applications of biology on society and

the environment
H5
identifies possible future directions of biological research
H6
explains why the biochemical processes associated with cell

organelles are related to macroscopic changes in the organism
H11
justifies the appropriateness of a particular investigation plan
H12
evaluates ways in which accuracy and reliability could be

improved in investigations
H13
uses terminology and reporting styles appropriately and

successfully to communicate information and understanding
iii
H14
assesses the validity of conclusions from gathered data and

information
H15
explains why an investigation is best undertaken individually or

by a team
H16
justifies positive values about and attitudes towards both the

living and non-living components of the environment, ethical
behaviour and a desire for critical evaluation of the
consequences of the applications of science.
Indicative time
This module should take 30 hours to complete. There are six parts to the
module and each part should take approximately five hours.
Resources
During this module there are some activities that require you to gather
and process information. There is some information provided with the
module and there is more at the end of each part in the Additional
resources section. As well as this information, there are Internet sites
supplied throughout the unit. A visit to your local library should turn up
some useful books too.
There are also practical activities to complete within this unit. You will
need the following equipment.
Part 1
iv
test tube-sized containers of the same size made of glass or

heat-resistant plastic
glass or heat-resistant plastic containers into which two of the

test tube-sized containers will fit
1 junket tablet (You will need to buy a packet.)
1 small container of full cream milk
1 tray of ice blocks
1 eye dropper or pipette
1 medicine measure
13 thermometers (0100C range)
powdered milk
Part 2
stopwatch or clock with a second hand
clinical thermometer
Part 4
fresh stick of celery
single sided razor blade
glass or container with water
food dye
Part 5
Introduction
sheeps kidney
cutting board
scalpel or knife
knitting needle
Icons
The following icons are used within this module.
The meaning of each icon is written beside it.
The hand icon means there is an activity for you to do.
It may be an experiment or you may make something.
You need to use a computer for this activity.

Discuss ideas with someone else. You could speak with
family or friends or anyone else who is available.
Perhaps you could telephone someone?
There is a safety issue that you need to consider.
There are suggested answers for the following questions
at the end of the part.
There is an exercise at the end of the part
for you to complete.
vi
Glossary
The following words, listed here with their meanings, are found in the
learning material in this module. They appear bolded the first time they
occur in the learning material.
Introduction
activation energy
the energy necessary to start a chemical reaction
active transport
movement of substances across a membrane by a

process requiring expenditure of energy
ambient
environmental or surrounding (eg. ambient

temperature)
ammonia
main nitrogenous waste product of bony fish;

excreted diluted in large amounts of water
angiosperms
flowering plants
artery
blood vessel which carries blood away from the

heart
Bowmans capsule
the capsule at the end of the vertebrate kidney

which contains the glomerulus
buffer
a solution of two or more chemicals which

prevent marked changes in hydrogen ion
concentration (pH) when either an acid or base
(alkali) is added to the system
cambium
group of cells which divide to form new xylem

and phloem cells
capillary
microscopic blood vessel with walls one cell

thick, across which materials are exchanged
between blood and tissues
cell
smallest unit of life capable of reproducing itself
chromosome
structure made up of genetic material (DNA) and

protein found mainly in the nucleus
cohesion
attraction between molecules of water
concentration
the amount of a substance in a specific amount of

a mixture or solution. Normally expressed as
weight per unit volume (eg. 25 grams of salt per
litre of water; 25 g/L) or as molarity
denatured
structural change in proteins
diffusion
movement of particles in gases, liquids or

solutions from where they are more concentrated
to where they are less concentrated
distal tubule
part of the nephron where water is extracted
vii
viii
DNA
abbreviation for deoxyribonucleic acid; the

molecule which makes up the genetic material of
the chromosomes
effector
part of an organism which produces a response

(eg. heart, diaphragm)
ectotherm
organism that changes its body temperature by

using heat from the environment; plants and
most animals except for mammals and birds are
ectothermic
enantiostasis
the maintenance of metabolic and physiological

functions in response to variations in the
environment
endocrine system
hormonal system that produces internal

secretions which act upon organs
endotherm
animal that regulates its body temperature using

heat generated by its metabolism; mainly birds
and mammals are endothermic
enzyme
a highly specialised cellular protein that reduces

the amount of energy required to initiate a
chemical reaction, thereby increasing the speed
of reaction; the names of enzymes often end in
-ase eg. cellulase enzyme digests cellulose
Eucaryotic
(eukaryotic)
cells which have their genetic material

(chromosomes) inside a nucleus bounded by a
membrane and which have other membranebound organelles; includes cells of protists, fungi,
animals and plants
endocrine system
the system of glands that secretes hormones
evaporative cooling
removing heat from the body by changing liquid

water to water vapour using heat from the skin
surface (eg. sweating) or from respiratory
surfaces (eg. panting)
excretion
the elimination of harmful and unwanted

products of metabolism
excretory organs
organs involved in the removal of wastes

(eg. kidneys, lungs, skin)
gene
a unit of inheritance, usually part of a specific

DNA molecule (chromosome)
glomerulus
a bunch of capillaries found in the vertebrate

kidney
gymnosperms
cone-bearing plants
haemoglobin
a complex protein molecule found in red blood

cells which transports oxygen
Introduction
herbaceous
Characteristic of a soft plant; having no woody

tissue
homeostasis
the tendency in an organism towards maintenance

of physiological stability
homeothermy
maintenance of a stable body temperature

independent of changes in environmental
temperature
hypothalamus
area in the brain which acts to integrate the

endocrine and nervous systems in homeostatic
control of many body functions (eg. temperature
regulation)
kidney
an organ involved in excretion and

osmoregulation
lignin
a material which strengthens and keeps xylem

vessels open; the major component of wood
lymphatic system
system of thin-walled vessels and groups of

tissue (lymph nodes) which drain the fluids from
around cells back to the bloodstream (as a fluid
called lymph); the system is also involved in the
immune response and with transport of the
breakdown products of fat digestion
Malphigian tubules
excretory organ found in insects
metabolic pathway
a series of step-wise chemical reactions, each of

which is governed by an enzyme. Cellular
respiration and photosynthesis are metabolic
pathways
metabolism
all of the biochemical reactions occurring in the

cells of the body; heat is produced as a
by-product of metabolism
nephron
microscopic tubules which make up the

functional units of the mammalian kidney
nervous system
the system of nerves and nerve centres in an

animal
nitrogenous wastes
waste products from metabolic activities

involving nitrogen-containing compounds
(eg. proteins, amino acids)
optimum
conditions at which enzymes work best; includes

temperature and pH
organ
functional and structural unit of most

multicellular organisms, consisting of at least
two types of tissues eg. in plants roots, stems,
leaves; in animals heart, kidney, liver
ix
organelle
any part of a cell which has a specific functional

role; in eucaryotic cells, organelles are normally
bound by a membrane
osmosis
the movement of water from where it is in high

concentration to where it is in low concentration
through a selectively permeable membrane
osmoregulation
the control of body water and salt levels
phloem
tissue which transports products of

photosynthesis (translocation) in ferns,
gymnosperms and angiosperms
pituitary
small structure in the brain which secretes

hormones, including ones which control the
functions of other endocrine glands (eg. thyroid
gland)
plasma
liquid part of the blood, making up around 55%

in humans, in which materials are dissolved
(eg. carbon dioxide, sugars, amino acids) and
formed blood elements are carried (red cells,
white cells and platelets)
platelets
fragments of cells found in the blood which are

involved in the clotting process
procaryotic
(prokaryotic)
cells which do not have their genetic material

(chromosomes) bound by a membrane and do
not have other membrane-bound organelles in
their cells; includes Archaebacteria and
Eubacteria
proximal tubule
convoluted tubule between the loop of Henle

and Bowmans capsule
pulse rate
measure of heart rate (beats per minute) taken by

palpating a position where an artery crosses a
bone
rate of reaction
the speed at which a reaction proceeds. It is

normally measured as the amount of substrate(s)
used up or the amount of product(s) formed in a
given amount of time
receptor
sensory cell responding to some internal or

external environmental variable (eg. cells in the
brain responding to CO2 level or temperature of
the blood)
renal artery
the aretery bringing blood to the kidney
renal vein
the vein taking blood from the kidney
Introduction
rennin
an enzyme found in the stomachs of mammals

(especially young), which makes milk go solid
(coagulate). It is found in junket tablets used to
make a dessert out of milk and flavouring (sort
of yoghurt dessert)
respiratory surface
a special surface for gaseous exchange
response
change in an organism produced by a change in

its internal or external environment
stimulus
an environmental factor (inside or outside the

body) which is detected by a receptor (eg. CO2
levels in the blood, temperature of the blood)
salt gland
structure found in marine birds and turtles which

permits excretion of excess salts
stomates (stomata)
holes (pores) in the leaves of plants. These

pores are controlled by two guard cells which
regulate the loss of water from the leaves
(transpiration)
temperature gradient
difference in temperature. Heat energy flows

from an area of higher temperature to one of
lower temperature
thyroid gland
endocrine gland in the throat area which

produces thyroid hormones
thyroid hormones
hormones involved with regulating the level of

body metabolism
thyroid stimulating
hormone
TSH; hormone released by the pituitary gland

which controls the functioning of the thyroid
gland
tension
part of the transpiration-tension-cohesion theory

of water movement in xylem tubes; it refers to
the 'pulling' of water molecules from the roots to
the leaves by negative pressure
tissue
a group of cells, usually of similar type, found in

a multicellular organism having a specific
structure and function (eg. in plants epidermis,
xylem, phloem; in animals epithelium, blood,
bone)
Trachaeophyta
vascular plants
translocation
movement of products of photosynthesis in the

phloem of plants
transpiration
evaporation of water from the leaf surfaces of

plants
transpiration stream
movement of water in the xylem tissue
xi
xii
urea
breakdown (deamination) of excess amino acids;

diluted by water and excreted in urine
uric acid
main nitrogenous waste product of insects,

reptiles and birds; largely insoluble and excreted
as a paste with little water
urine
a waste product containing 2% urea
vascular bundle
a group of phloem, xylem and cambium tissue in

a stem
vascular plants
plants which have conducting vessels, xylem

and phloem, including the plants ferns,
gymnosperms and angiosperms, which belong to
the phylum Trachaeophyta
vasodilation
increase in the diameter of blood vessels to

increase blood flow
vasoconstriction
decrease in the diameter of blood vessels to

decrease blood flow
vein
blood vessel which returns blood to the heart
xylem
tissue which transports water and minerals

upwards from roots to leaves in ferns, conebearing and flowering plants (Trachaeophyta)
Biology
HSC Course
Stage 6
Part 1: Enzymes
Contents
Introduction ............................................................................... 2
Enzymes ................................................................................... 4
The role and chemical composition of enzymes.................................4
Enzyme models ....................................................................................6
Enzymes and temperature...................................................................7
Enzymes and pH ..................................................................................9
Enzymes and substrate concentration ..............................................10
Some questions about enzymes ......................................................11
Investigating an enzymes activity ....................................................13
The enzyme catalase and hydrogen peroxide .................................18
Suggested answers................................................................ 21
Exercises Part 1 ................................................................... 25
Part 1: Enzymes
Introduction
During your study of the Preliminary you learnt that DNA is the genetic
material of most living organisms. DNA makes up the chromosomes
found in the nucleus of eucaryotic organisms and forms chromosomes not
bound by a nuclear membrane in procaryotic cells.
Genes are sections of specific DNA molecules making up the
chromosomes that determine cell function, and therefore ultimately the
functioning of whole organisms, by determining which proteins will be
produced in cells. Some proteins form part of the structure of cells (for
example, part of the cell membrane) but many are enzymes, which control
the functioning of cells by speeding up chemical reactions that would not
normally occur under conditions found in cells.
This part of the module looks at the action of enzymes. You will need the
following equipment for an experiment:
test tube-sized containers of the same size, made of glass or

glass or heat-resistant plastic containers into which two of the test

tube-sized containers will fit
1 junket tablet (You will need to buy a packet.)
milk powder
1 medicine measure
13 thermometers (0100C range).
In this part you will have the opportunity to learn to:
identify the role of enzymes in metabolism, describe their chemical

composition and use a simple model to describe their specificity on
substrates
identify the pH as a way of describing the acidity of a substance
describe the effect of the following on enzyme activity:
increased temperature
change in pH
change in substrate concentrations.
In this part you will have the opportunity to:
identify data sources, plan, choose equipment or resources and

perform a firsthand investigation to demonstrate the effect of:
increased temperature
change in pH
change in substrate concentrations on the activity of a named

enzyme.
Extracts from Biology Stage 6 Syllabus 1999 Board of Studies NSW,

originally issued 1999. The most up-to-date version can be found on the
Boards website at:
http://www.boardofstudies.nsw.edu.au/syllabus99/syllabus2000_list.html
Part 1: Enzymes
Enzymes
The role and composition of enzymes

Enzymes are organic catalysts. They cause chemical reactions to proceed
which would not normally occur under the conditions found in most cells.
An example of an enzyme sucrase

Sucrose, which is the sugar used in sweets and cakes and to sweeten tea
and coffee, is normally extracted by crushing out the contents of the
phloem tissue of sugarcane plants. This carbohydrate consists of two
simpler sugar molecules one glucose and one fructose molecule.
Sucrose is too large to be absorbed directly into the bloodstream from the
digestive system. It is broken down in the small intestine into its two
component sugars by an enzyme called sucrase. The molecules of glucose
and fructose are small enough to be directly absorbed through the
membranes of the digestive system into the bloodstream. The reaction can
be summarised as follows, where the sucrose molecule (the substrate or
reactant) is digested to form glucose and fructose (the products).
SUBSTRATE
sucrose molecule
PRODUCTS
sucrase enzyme present
glucose + fructose
The sugar in your sugar bowl does not break down into glucose and
fructose and will only do so when the enzyme sucrase is present.
This enzyme will only break down sucrose sugar.
Another example
Maltose sugar, also found in a lot of sweets, is made up of two glucose
units. Like sucrose, this sugar needs to be digested using an enzyme
before it can be absorbed into the bloodstream.
Here is the overall reaction for the breakdown of maltose:
SUBSTRATE
PRODUCTS
maltose molecule
glucose + glucose
Predict the name of the enzyme that causes

this to happen in the small intestine.
_____________________
Yes, maltase. Many enzyme names end in -ase. You might remember
from the Patterns in Nature module that bacteria in the stomachs of cattle,
sheep and kangaroos digest the high fibre in their diets. Fibre is mainly a
material called cellulose. Cellulase enzymes in the stomachs of these
species digest cellulose.
This demonstrates that enzymes are very specific. Each enzyme changes
the rate of one kind of chemical reaction only. This means that there are
many different enzymes within each organism to control all the reactions
that are part of the organisms metabolism.
Chemical composition
Enzymes are proteins. The building blocks of proteins are amino acids.
There are only 20 types of amino acids which make up proteins but they
can be joined in various ways to produce different proteins. As well as the
type, number and arrangement of the amino acids (their primary structure),
protein molecules also have a three dimensional structure as well, which
gives each protein molecule a particular shape.
The shape of each enzyme molecule makes it able to take part in a specific
kind of chemical reaction.
Do Exercise 1.1 now.
Part 1: Enzymes
Enzyme models
Why is the shape of each enzyme important? Here are two models to
explain how the shapes of enzymes are involved in speeding up reactions.
A simple lock and key model

At a molecular level, the shape of an enzyme permits it to bind at a
particular site (active site) to the substrate molecule (or molecules),
causing a reaction to occur. This can be thought of as a key (the substrate)
fitting the lock (the enzyme). Unless a key is right for a particular lock, it
wont open the door!
It is thought that the enzyme only fits particular molecules to cause them
to react. The enzyme is not used up in the reaction and can be used again.
This model of enzyme function is sometimes called the lock and key
model. It works a bit like this:
substrate + enzyme
enzyme/substrate
complex
products + enzyme
The complex between the enzyme and the substrate (or substrates)
molecules reduces the energy required to get the reaction to happen
(activation energy). In normal chemistry, heating to high temperatures
provides this energy but, of course, this is not possible in cells.
An induced fit model

A more refined explanation or model for enzyme function is that the shape
of the enzyme on its own does not quite fit the substrate molecules shape
but the shape of the enzyme is changed so that it becomes an exact fit.
This is referred to as the induced fit model of enzyme function. It is like a
glove being roughly the shape of your hand but not fitting completely until
it is pulled on.
product
substrate
enzyme
enzyme-substrate
complex
enzyme resumes
original configuration
Induced fit model of enzyme function.
Use the following explanation to interpret the diagram of the induced fit
model.
The enzyme has an active site in its structure into which the substrate
(or substrates) fit (left picture).
The formation of the enzyme-substrate complex induces a change in

the shape of the enzyme molecule so that it fits the substrate perfectly
at the active site (middle picture).
Once the substrate is broken down (or the substrates are joined) into
the product, the enzyme is released from the complex and resumes its
original shape (right picture).
Enzymes and temperature

Temperatures affect all proteins. Think about the white of an egg
it mainly consists of protein. If you cook it (raise it to high temperature), it
changes from being a clear liquid to become a white solid. Its properties
have changed and this change is not reversible even if you cool the egg
white down again it remains a white solid!
However, if you put the uncooked egg white into the freezer, it becomes
solid and goes a little milky in colour but returns to being a clear liquid if
you thaw it out. The change brought about by cooling is reversible.
Because enzymes are proteins, they are also affected by changes in
temperature. If you heat them above the temperature at which they work
best (their optimum temperature), they stop working. If you cool
enzymes down, they slow down in their activity and eventually they no
longer make the specific reactions work. But if you warm them up once
more they work again until the temperature goes past their optimum.
This can be represented in a graph, which shows a slow increase in
enzyme activity as temperature increases to the optimum, followed by a
rapid fall in activity to zero above that temperature. The fall occurs
because the enzyme is said to be denatured irreversibly.
The graph is on the following page.
Part 1: Enzymes
maximum activity
at optimum temperature
Percentage maximum activity
100
80
enzyme denatured (damaged)

by too high a temperature
increasing activity as
temperature increases
60
40
low activity at
low temperature
activity falls to zero because
enzyme has been irreversibly
changed
20
0
10
20
30
40
50
60
Temperature (C)
The effect of temperature on enzyme activity.
At low temperatures there is little activity but this increases as the

temperature is raised to the optimum (temperature at which the enzyme
works best). Above this optimum temperature the activity rapidly drops to
zero.
Change with cooling occurs because the lower temperature changes the
shape of the enzyme molecule. Above the optimum, the shape of the
enzyme is changed rapidly so that it no longer fits the substrate. The
change brought about by cooling is reversible but that caused by excess
heating is irreversible that is, the change in shape of the enzyme is
permanent the enzyme is said to have become denatured.
You might realise now why having your body temperature above the
normal of 37C can be considered quite serious. Your enzymes work best
at around 37C and are denatured above this temperature. However, there
are other species whose enzymes can function over a greater range of
temperatures.
So why does denaturing happen? Well, going back to the egg white
example, the number, type and sequence of amino acids does not change
when you heat it but the three-dimensional shape of the molecule does
change. For an enzyme this means that its shape no longer fits the
substrate and so the enzyme can no longer work. This shape change
caused by heating damages the enzyme molecule permanently. Cooling
also changes the shape of the molecule but this change does not
permanently stop the enzyme from functioning.
Enzymes and pH
Relative activity
Each enzyme also has a specific pH at which it works best (optimum pH)
but enzymes are rapidly denatured either above or below that optimum.
The following graph shows the relationship between pH and enzyme
activity for two digestive enzymes.
pepsin
trypsin
6
pH
10
12
The effect of pH on enzyme activity.
An enzyme has a pH at which it works best (its optimum). This can be

different for different enzymes. For example, pepsin is an enzyme found
in the stomach, which has very acid conditions, while trypsin is found in
the small intestine, where conditions are slightly alkaline. Enzymes are
denatured both above and below their optimum pH.
Use the graph to answer these questions.
1
What is optimum pH for pepsin and trypsin?

_____________________________________________________
Could pepsin continue to work when it moves with food from the
stomach into the small intestine? Why?
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

It should be remembered that many species have very narrow ranges of pH
over which they function. Humans, for example, maintain their blood pH
at 7.4 and will die if it goes above 7.7 (less acid) or below 7.0 (more acid).
Part 1: Enzymes
So what is pH?
pH is a figure given for acidity or alkalinity of a solution. It rises in jumps
of 10. For example, a solution with a pH of 2 (such as stomach acid) is 10
times more acidic than one with a pH of 3 and 50 times more acidic than
one with a pH of 7. A pH of seven is called neutral because it is neither
acidic or alkaline. With a pH 7.4, human blood is very slightly alkaline.
caustic soda
cloudy ammonia
blood
pure water
milk
detergent
rain water
celery
lemon juice
battery acid
vinegar
Here are some examples of substances along the pH scale.
Glo
MILK
Pure
DISTILLED
stomach
2.0
Water
2.9
3.8 5.2 5.5 5.6 5.9 6.0 6.8
7.0
tea
Mr
Top
Cream
Cleanser &
Ammonia
BRASSO
OVEN
Cleaner
Metal
Polish
7.4 8.8 9.5
10.0
11.0 11.9
12.5 13.0
Complete Exercise 1.3 now.
Enzymes and substrate concentration

In any chemical reaction, increasing the concentration of substrate tends
to make the reaction occur more quickly the rate of reaction is
increased. So you would expect that the rate of any reaction would keep
on getting faster if more substrate is made available; for example, more
substrate could be taken into the body as food or produced by other
chemical reactions in cells.
However, in living organisms, the rate of a reaction is controlled more by
the concentration of enzyme available than by the concentration of
substrate.
The graph on the next page shows a typical response in the rate of reaction
to the increase in substrate concentration in a living organism. The graph
shows that the rate of a reaction will increase as the substrate concentration
is increased, but only to a certain level.
10
Rate of reaction
Substrate concentration
The effect of substrate concentration on rate of reaction. The concentration of
substrate is increased but the amount of enzyme held constant. After an initial
rise in the rate, the rate of reaction becomes constant.
The reaction rate slows then becomes constant because there are not
enough enzyme molecules to combine with each substrate molecule to
make the reaction work any faster. The available active sites on the
enzyme molecules become saturated. However, remember that the
enzyme molecules can be reused. As a reaction proceeds, enzymes
released from their complex with substrate molecules are used again. This
tends to keep the rate of reaction constant unless the enzyme concentration
changes or conditions of temperature or pH are modified.
The rates of reactions in living organisms are therefore determined by:
temperature
pH
substrate concentration
the amount of enzyme available.
Some questions about enzymes

Answer the following questions to check your comprehension of the role
of enzymes.
1
Part 1: Enzymes
Which statement below best describes the role of an enzyme in cells?

A
It speeds up the rates of all reactions.
It speeds up the rate of a specific reaction.
It breaks down larger molecules into smaller ones only.
It builds up small molecules into complex ones only.
11
Combination of a substrate with an enzyme is necessary to permit the

enzyme to function. This is because the enzyme-substrate complex:
A
increases the energy of the reaction
reduces the amount of energy produced by the reaction
reduces the amount of energy necessary to start the reaction
increases the amount of energy necessary to start the reaction.
Enzymes are affected by:

A
temperature but not pH and are not used up in the reaction
pH but not temperature and are used up in the reaction
temperature and pH and are not used up in the reaction
temperature and pH and are used up in the reaction.
Fill in the missing words using the following word list

temperature
specific
unchanged
pH
amounts
proteins
speed up
Enzymes:
12
are chemicals called _________________________________
___________________ the rate of chemical reactions in cells
are involved in chemical reactions but are _______________ at

the end of the reaction and can be reused
are needed only in very small ____________
are _____________ to particular reactions or groups of reactions
are affected by ________________
are affected by ________________
may need other chemicals as coenzymes (often containing

vitamins) or cofactors (often minerals) to help them function.
Draw a graph which represents the change in the activity of an

enzyme from the stomach of a human as its temperature is changed
from 0 to 45oC.
100
80
60
40
20
0
10
20
30
40
50
60
Which is more acidic, a pH of 3 or a pH of 11? _______________
Check your answers.
Investigating an enzymes activity

The pH, temperature and concentration of substrate and the accumulation
of products can alter the rates of enzyme-mediated reactions. The easiest
factor to manipulate outside a laboratory is temperature.
The effect of changing temperature

Your task is to perform an experiment to demonstrate how changing
temperature affects the activity of an enzyme. You can use an enzyme
found in the stomachs of mammals, especially young ones which consume
a lot of milk. This enzyme, called rennin, causes milk to go solid. Rennin
naturally occurs in the stomach because, by making milk solid, it slows the
movement of milk through the animals digestive system.
You can buy rennin, in junket tablets, from the grocery store or
supermarket. People use junket tablets to make a sort of yoghurt dessert
from milk.
Part 1: Enzymes
13
You can plan and perform your own investigation. Read the directions on
the junket packet for some clues. Or, if youd like some help, follow the
experimental plan below.
Aim: To investigate the effect of changing temperature on enzyme
activity.
Method: You will need the following:
6 test tube-sized containers of the same size made of glass or

3 glass or heat-resistant plastic containers into which 2 of the

test tube-sized containers will fit
1 junket tablet (you will need to buy a packet)
waterproof felt-tipped pen
1 medicine measure
13 thermometers (0100C range).
You will also need access to boiling water from an electric jug or urn.
Be careful with this!
ice
water
10 mL milk
05C
3540C
water baths
7580C
e = enzyme c = control
Experimental set up for investigation of the effect of temperature on enzyme
activity using the enzyme rennin.
14
The diagram shows how you should set up the experiment. You need to
use the three larger containers as water baths, which you maintain around
05C (cold), 3540C (body temperature) and 7580C (hot). Ice in
water should keep the cold bath within the temperature range but you will
need to keep adding hot water from time to time to maintain the
temperatures in the other water baths.
Steps:
1
Label three test tube-sized containers as control and three as enzyme

using a waterproof felt-tipped pen.
Measure 10 mL of milk into each of the six test tube-sized containers.
Place 1 control and 1 enzyme container into each water bath container.
Now use the ice and water (hot/cold) to bring your water baths to the
three different temperatures. Use your thermometer(s) to determine
when the milk in the containers has reached the temperatures in each
water bath.
Grind up a junket tablet in about 10 mL of cold water.
When the milk is at the correct temperature, add 45 drops of the

junket mixture to each of the enzyme containers (not the controls).
Record the time immediately.
Record the time it takes for the milk to go solid. If it has not gone
solid within 15 minutes after adding the enzyme mixture, you can
assume the enzyme is not working.
Work through the rest of the practical exercise but do not clean up your
experimental set up yet. You will need to use it again in the next
practical.
Hypothesis: You need to have made a hypothesis for what you expected
to happen. You probably expected the enzyme to make the milk go solid
at body temperature (the temperature in the stomach where it normally
works) but probably not to work at the cold or hot temperatures. Would
this be a reasonable hypothesis? State what you expected to happen in
your own words.
_________________________________________________________
_________________________________________________________
_________________________________________________________
Part 1: Enzymes
15
Results: Record your results in the table below.

Temperature range
Time for milk to set (minutes)

Control
Enzyme
05C
3540C
7580C
Discussion:
Did your experiment support your hypothesis?
_________________________________________________________
Did the milk go solid in any of the control tubes? Explain why you used
the control containers.
_________________________________________________________
_________________________________________________________
You will remember that changes to enzymes by cooling them below their
optimum temperatures are normally reversible, while heating above the
optimum usually denatures them. State what you would expect to happen
if you put the containers of milk from the hot and the cold water baths into
the 3540C bath?
_________________________________________________________
_________________________________________________________
Make sure that your 3540C water bath is at the right temperature and
then transfer the containers from the hot and the cold baths to it.
Describe the results. Were the results what you expected?
_________________________________________________________
_________________________________________________________
Do Exercise 1.4 as a conclusion to this experiment.
16
The effect of changing pH

You could have done an experiment similar to this one using different pH
levels, but it is difficult to set exact levels of pH outside a laboratory,
where you have access to chemicals and equipment used to accurately
change the pH and to measure its change.
However, you can alter the pH of the milk (substrate) in your experiment
by adding a few drops of vinegar (acid) or a quarter of a teaspoon of
bicarbonate of soda (alkali).
Plan and perform your own simple experiment to investigate how
changing the pH of milk affects the ability of rennin to thicken milk.
(Hint: Perform your tests at 3540C.)
What hypothesis are you testing? (What do expect to happen?)
_________________________________________________________
_________________________________________________________
Write your conclusion in Exercise 1.5.
The effect of changing substrate concentrations

The substrate in your experiment is substances found in milk. You can
reduce the concentrations of these substances by adding water to the milk.
If you have powdered milk, you can increase the concentrations of these
substances by adding powdered milk to normal milk. Plan and perform
your own simple experiment to investigate how changing the
concentration of milk substances affects the ability of rennin to thicken
the milk.
What hypothesis are you testing?
_________________________________________________________
_________________________________________________________
Write your conclusion in Exercise 1.6.
Are you confident that you can describe how increases in temperature,
changed pH and variations in substrate concentrations affect an enzymes
activity? Here is another example of an enzyme that you can use to check
your understanding of enzymes.
Part 1: Enzymes
17
The enzyme catalase and hydrogen peroxide

Hydrogen peroxide solution is used as an antiseptic and as a bleach. It is
also the product of some reactions in cells. It is poisonous and so living
organisms have an enzyme in their cells which quickly breaks it down into
oxygen and water, both of which are harmless substances.
The reaction looks like this:
2H2O2
catalase enzyme
hydrogen
peroxide
2H2O
water
O2
oxygen
Without the enzyme catalase, this reaction occurs but very, very slowly.
If small cubes of potato of the same size are placed into test tubes of
hydrogen peroxide, oxygen is released, since potato cells contain some of
the catalase enzyme. Oxygen bubbles form in the liquid in the test tube,
and make a froth on the surface. The height of this froth can be measured
as an indication of the amount of enzyme activity.
You could have investigated the effect of temperature on this reaction by
comparing the amount of oxygen released at different temperatures, much
as you did with the rennin experiment. It can also be used to show the
effect of pH on the catalase enzyme.
Look at the diagram below which shows such an experiment done by a
student at four different pH levels.
no reaction
froth = evolution of oxygen
froth
hydrogen
peroxide
cube of potato
cells (containing
catalase enzyme)
pH level
10
Catalase/hydrogen peroxide experiment.
18
Study the experiment then answer the following questions.

1
Describe the effect of pH changes on catalase enzyme function.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
State what the optimum pH for this enzyme might be. Provide an
explanation for your answer.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
The student did not use a control in the experiment. Describe how
you would have designed the experiment to include a control.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Design an experiment to investigate the effect on enzyme activity of

increasing the concentration of hydrogen peroxide (substrate
concentration) perhaps use 2, 5, 10, 20% hydrogen peroxide
solutions. Remember your design needs to contain a control and you
need to indicate how you would measure the enzyme activity. Predict
the results for your experiment.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 1: Enzymes
19
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.
As you have seen, enzymes operate optimally with very specific
conditions. So how does this affect a living organism?
Take you, for example. There are many different enzymes within your
body, taking part in many different reactions to make up your metabolism.
The conditions inside your body have to be very carefully controlled for all
these reactions to occur at their best. Any little change in conditions has to
be noticed and put right to keep your body functioning normally. Youll
learn about how this monitoring (measuring) and control occurs in Part 2.
20
Suggested answers
Enzymes and pH
1
The optimum pH for pepsin is approximately 2.9; the optimum pH for

trypsin is approximately 8.
Pepsin would be denatured as it was moved from the acidic stomach

into the slightly alkaline small intestine.
Some questions about enzymes

1
B is correct. Any enzyme speeds up a specific reaction (or type of

reaction) in a cell.
C is correct. The enzyme-substrate complex reduces the amount of

energy which is necessary to start the reaction (called the activation
energy).
C is correct. Enzymes are affected by both temperature and pH but

are not used up in reactions.
Enzymes
Part 1: Enzymes
are chemicals called proteins
speed up the rate of chemical reactions in cells
are involved in chemical reactions but are unchanged at the end of

the reaction and can be reused
are needed only in very small amounts
are specific to particular reactions or groups of reactions
are affected by temperature
are affected by pH
may need other chemicals as co-enzymes (often vitamins) or

co-factors (often minerals) to help them function.
21
The graph should show an increase in activity from low/no activity at

0C to maximum activity around the normal body temperature of a
human (37C). It should drop rapidly to no activity above 37C.
Percentage maximum activity
100
80
60
40
20
0
10
20
30
40
50
60
Temperature (C)
A pH of 3 is more acid than one of 11. Remember that decreasing pH

equals increasing acidity, and increasing pH equals increasing alkalinity.
The enzyme catalase and hydrogen peroxide
22
The enzyme activity, measured by the height of the froth produced by

the oxygen given off, was zero at a pH of 2 but increased up to a pH
of 8, after which it declined to very little at pH 10.
The optimum pH for the enzyme was between 8 and 10 the height of
the froth was highest at pH 8 but had declined markedly by pH 10.
Experiments at pH levels between these 8 and 10 would need to be
done to find out the optimum more accurately.
A control test tube with hydrogen peroxide (and acid or alkali added
to produce the required pH level), but with no potato, would need to
be included for each pH level. This would establish that the reaction
only occurred in the presence of the potato (containing the enzyme).
Here is an example of suitable experiment.
Set up two test tubes using each concentration of H2O2 (2, 5, 10,
20%). Use the same volume in each test tube.
Insert a piece of potato of the same size into one tube (to supply
the same amount of enzyme) of each pair of test tubes.
The tubes without the potato are the control experiments.
After the same amount of time (say 2 minutes), record the height
of the froth as a measure of enzyme activity.
Hypothesis (what you expected)
There would be no reaction (no froth) in any of the control tubes,

indicating that the presence of the potato (containing the enzyme)
caused the reaction.
The highest level of activity (height of the froth) would be in the most
concentrated solution.
Remember, of course, that your hypothesis may not have been supported
as there may not have been enough catalase enzyme available for the
reaction to keep increasing with increased substrate concentration (see
Enzymes and substrate concentration in this part of the module). In that
case, the level of activity (height of the froth) may have levelled off after a
certain concentration.
Part 1: Enzymes
23
24
Exercises Part 1
Exercises 1.1 to 1.6
Name: _________________________________
Exercise 1.1: The role and chemical composition of

enzymes
a)
What is the role of enzymes in the metabolism of an organism?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) What is the general chemical composition of enzymes?

_____________________________________________________
_____________________________________________________
c)
Give an example of an enzyme and outline the reaction in which it

participates.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 1: Enzymes
25
Exercise 1.2: Enzyme models

Look at the following model used to explain the action of enzymes.
substrate
a)
products
From the choices below, select the enzyme that would speed up the
above reaction. Give reasons to justify your choice.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Each enzyme has an active site in its structure that fits into only one
substrate. Why do enzymes have different shapes?
_____________________________________________________
_____________________________________________________
Exercise 1.3: Enzymes and pH

Normal human urine has a pH of less than 6. Is this acidic or alkaline?
________________________________________________________
26
Exercise 1.4: The effect of changing temperature

Write a couple of sentences stating what this experiment has shown you
about the effects of temperature on enzyme function.
Conclusion:
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 1.5: The effect of changing pH

Write a conclusion for your investigation.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 1.6: The effect of changing substrate

concentrations
Write a conclusion for your investigation.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Part 1: Enzymes
27
Biology
HSC Course
Stage 6
Part 2: Homeostasis and temperature regulation
Contents
Introduction ............................................................................... 2
Homeostasis ............................................................................. 4
Collecting and using information .........................................................4
Homeostasis and feedback .................................................................5
Temperature regulation for endotherms .................................... 8

Control of body heat production (heat gain)........................................9
Control of heat loss ............................................................................11
Summary.............................................................................................12
Limitations to temperature regulation ................................................15
Temperature regulation for ectotherms ................................... 16

Finding out more about temperature regulation ...................... 18
Australian endotherms and ectotherms ............................................18
Some questions about temperature regulation.................................18
Human responses to temperature change........................................21
Suggested answers................................................................. 25
Additional resources................................................................ 27
Exercises Part 2 ................................................................... 35
Introduction
Multicellular organisms are made up of a number of organ systems.

The tissues in each systems, and the cells that make up those tissues, are
specialised to carry out specific tasks. Here are some examples:
the muscles of the skeleton carry out support and movement
the lungs bring about gaseous exchange
the digestive system facilitates digestion and absorption of food

substances and materials needed by the cells
waste products formed in the cells are transported around the body
by the blood system.
All of these organ systems need to be controlled and coordinated in their

functions. This control and coordination is brought about by two systems
in mammals the nervous system and the endocrine (or hormonal)
system.
During this part of the module you will need a stopwatch or clock with a
second hand, and a clinical thermometer.
explain why the maintenance of a constant internal environment is

important for optimal metabolic efficiency
describe homeostasis as the process by which organisms maintain a

relatively stable internal environment
explain that homeostasis consists of two stages:
detecting changes from the stable state
counteracting changes from the stable state
outline the role of the nervous system in detecting and responding to

environmental changes using temperature change as an example
outline the role of a feedback mechanism in maintaining a stable

body temperature
identify receptors and responses used by humans to maintain a stable

internal temperature across a range of environmental conditions
identify the broad range of temperatures over which life is found

compared with the narrow limits for individual species
distinguish between the terms ectotherm and endotherm, naming

Australian examples
describe responses of Australian ectothermic and endothermic

organisms to changes in the ambient temperature and explain how
these responses assist temperature regulation
identify some responses of plants to temperature change.
gather, process and analyse information from secondary sources and

use available evidence to develop a model of a feedback mechanism
gather, process and analyse information from secondary sources to

distinguish between ectotherms and endotherms, name Australian
examples and use available evidence to describe adaptations or
responses of these organisms that assist temperature regulation.

Boards website at:
Homeostasis
How do organisms maintain a balance within their tissues, to keep

conditions optimal for cellular processes? When conditions are optimal,
the cells metabolism will be most efficient.
Collecting and using information

All organisms receive information from the various parts of their bodies
and from their environment in the form of stimuli (singular is stimulus).
These stimuli normally result in some sort of response from a particular
organ or number of organs. The stimulus often does not affect an organ
directly but instead responses occur as a result of transmission through
the nervous system, the endocrine (hormonal) system, or both. Stimuli
received from the environment make you aware of your surroundings.
Heat from a fire, for example, stimulates special cells in the skin of your hand
resulting in nerve impulses being transmitted to the part of your brain that
interprets these impulses as your hand getting hot. If your hand comes too
close to a fire, you respond by pulling it away. The heat is the stimulus and
using the muscles of your arm to pull your hand away is the response.
Stimuli also come from inside the body. For instance, during exercise,
respiration in the muscle cells increases the carbon dioxide (CO2) level in
the blood. This stimulates an increased breathing rate, which gets rid of
the extra CO2.
Using information to maintain a balance

Responses to stimuli, using the nervous and hormonal systems, are
responsible for most control and coordination in animals. Plants have a
hormonal system which controls and coordinates body processes.
However, the way this system works is less well understood in plants
than in mammals. As far as is known, plants do not have a nervous
system, but their activities are controlled and coordinated so that

homeostasis is maintained.
You have already come across the idea of homeostasis, or the process of
keeping conditions inside the organism relatively constant, or stable.
Homeostasis involves the systems of control and coordination.
Homeostasis consists of two stages:
counteracting changes from the stable state.
Homeostasis and feedback

The working of a typical household electric water heating system is a
practical application of how homeostasis is maintained. Follow around
the cycle in the diagram below, beginning at the stimulus.
STIMULUS
reduction in cylinder
water temperature
RECEPTOR
thermostat senses
drop in water
temperature
FEEDBACK
change in cylinder
water temperature
RESPONSE
heater heats up
water in cylinder
EFFECTOR
heater
TRANSMISSION
electric current in
wires transmits
information to the
heater
When you turn on the hot tap in the shower or the sink, you get water
flowing from the hot water cylinder at about 70C. This water is replaced
by colder water coming into the cylinder. The drop in water temperature is
detected by the thermostat and it switches on the heater in the cylinder.
Once the water has heated back up to 70C, the return to the normal
temperature level is detected by the thermostat and the heater is turned off.
When you are not using hot water, the insulation surrounding the cylinder
reduces the loss of heat. But heat will still gradually be lost and the
temperature of the water in the cylinder will fall. Any change in temperature
is again sensed by the thermostat and the heater is switched on and off during
the day to maintain the temperature of the water inside the cylinder.
Homeostasis is maintained and you have hot water when you need it.
The diagram below represents a general model, which can be applied to

many biological examples. It is sometimes referred to as the
stimulusresponse model.
STIMULUS
RECEPTOR
FEEDBACK
RESPONSE
EFFECTOR
TRANSMISSION
You've seen that this model can be used to explain the hot water cylinder
example mentioned above. It can also be used for biological feedback,
such as the effect of exercise on breathing rate.
When you are exercising, the cells of your muscles are producing a lot of
carbon dioxide (CO2) which needs to be removed from your body.
During exercise, the level of CO2 in your blood rises. This rise is
detected by a centre in your brain, which sends more frequent nerve
impulses to the muscles of your chest and diaphragm, so that they
contract more often and you breathe more rapidly.
The rapid breathing gets rid of excess CO2 through the lungs and the
level in the blood falls back towards normal. If you keep exercising,
your breathing will remain rapid, as the level of CO2 in your blood will
rise again almost immediately. If you stop exercising, the rapid
breathing will result in the CO2 level of the blood coming right back to
normal. This will be detected by your brain which will then reduce the
frequency of nerve impulses to your chest muscles and diaphragm.
Your breathing will slow down again.
Use the information you have just read (about how CO2 levels in your blood
are controlled) to complete the diagram on the next page. The stimulus
information has been done for you to get you started.
STIMULUS
RECEPTOR
increase of CO2
in blood
FEEDBACK
RESPONSE
EFFECTOR
TRANSMISSION
Check your answers.

How did you go? In this example, the raised blood CO2 is the stimulus,
the breathing centre in the brain is the receptor and transmission of
information to the muscles and diaphragm occurs as impulses passing
through the nerves. The effectors are the chest muscles and the
diaphragm which produce the response of rapid breathing. Dont worry
too much if you didnt get it all correct. There are lots of systems like
this in the body, which control and coordinate its functions, and others
you will deal with in this module further illustrate the concept of
stimulus-response pathways to maintain homeostasis.
The term feedback appears in the diagrams of the models and it needs to
be discussed. In homeostasis, change often occurs to meet demands, but
the system ensures that normal levels are eventually re-established.
A feedback occurs when the response changes the stimulus. In the
example of the hot water cylinder, the heating response is turned off as
the temperature of water in the cylinder (stimulus) increases back to
70oC. It is turned on when the water in the cylinder decreases in
temperature; for example, when you use more hot water, or as the water
cools slightly during the day.
Control and coordination in mammals are normally maintained in a similar
way because the response modifies the initial stimulus and, as a result, the
response itself is changed. In the example of breathing rate changing in
response to exercise, the response (rapid breathing) is turned off once the
high carbon dioxide level (stimulus) is reduced back to normal.
Complete Exercise 2.1.
Temperature regulation
for endotherms
Birds and mammals control their body temperatures at constant levels

over the range of environmental temperatures in the places in which they
live. These groups are the endotherms or endothermic species which
you considered earlier in the Preliminary course in the module called
Evolution of Australian biota. (You also considered ectotherms, which
do not internally maintain a stable body temperature with changing
environmental temperatures.)
Body temperatures are maintained around 32C in the monotreme
mammals (platypus and echidnas), 36C in the marsupials and 37C in
the placental mammals. In birds, body temperatures are normally
regulated 45C higher than in placental mammals.
How can these animals maintain a stable temperature?
Heat is a form of energy

Heat moves from where there is a lot of it (something which is hotter) to
where there is less of it (something which is colder). Temperature is a
measure of the amount of heat present in an object. For example, a can
of drink taken from the fridge feels cold because heat is moving from
your hand (which is hotter than the can) to the can (which is colder than
your hand). There is no such thing as cold. Something feels cold
because you are losing heat to it. On a cold day you are losing more heat
from your body to the environment than you would on a warm day and
so you feel cold.
If an animal is to maintain a constant body temperature:
Heat gained must equal heat lost.
The heat an organism loses or gains from the environment has to be

balanced against the heat that it produces by its own cellular processes
(metabolism), especially cellular respiration.
Endothermic animals gain heat from the environment but most of the
heat used to control their body temperature is generated by their own
metabolism. Except in cold environments, most endothermic animals
produce more heat than they need for temperature regulation and this
excess heat needs to be lost to the environment.
In mammals and birds, the metabolism generates a great deal of heat.
This generation of heat is largely controlled by the endocrine system.
Minute to minute regulation of temperature is controlled by the nervous
system, involving a number of feedback systems, including sweating,
shivering and dilation and constriction of blood vessels. In other words,
it is the interaction of both the endocrine and nervous systems that
controls body temperature.
Control of body heat production (heat gain)

Mammals (such as you) have two main ways of producing heat to keep
the body temperature higher than the surroundings. These are:
by increasing the metabolic rate of cells throughout the body
by shivering.
Increasing the bodys metabolic rate

The thyroid gland produces thyroid hormones which act on a number
of organs, especially the liver and muscles, to increase the level of
metabolism. Most metabolic processes, especially cellular respiration,
produce heat and this is used to regulate the body temperature of
endothermic organisms.
Any slight reduction of the temperature of the blood is detected by the
hypothalamus in the brain, which stimulates the pituitary gland to
secrete a hormone (thyroid stimulating hormone, TSH) into the blood.
This hormone stimulates the thyroid gland to produce its hormones. The
secretion of these hormones into the bloodstream results in an increase in
metabolism, generating the extra heat needed to control body temperature
under cold winter conditions.
In hotter conditions, less metabolic heat is lost to the environment. Any
increase in blood temperature is detected by the hypothalamus, resulting
in the secretion of less TSH from the pituitary gland, less secretion of
thyroid hormones from the thyroid gland and therefore less heat being
generated by metabolism of tissues.
So from winter to summer, the organism is able to turn up and turn down
heat production so that a stable body temperature is maintained.
Shivering
When environmental temperatures change quite quickly, like when a cold
southerly buster comes through and you have left your jumper at home,
there is a more rapid response. Heat is produced by shivering, where
muscle fibres rapidly contract and relax, generating lots of heat that is
used only to maintain the body temperature. This response is controlled
by the nervous system.
However, the change in blood temperature stimulating the shivering
response is still detected by the hypothalamus (the receptor in the
stimulus-response model). But in this instance, the response is
transmitted through the nervous system (the transmission) to the muscles
(the effector).
The hypothalamus and pituitary

The pituitary gland is often referred to as the master gland as it secretes
hormones which control the functioning of other glands.
For example, hormones released into the blood by the pituitary gland
include hormones that stimulate the thyroid gland, ovaries and testes.
The pituitary produces some of its own hormones but others are
produced in a part of the brain called the hypothalamus, which is
connected to the pituitary by a series of nerve fibres.
The hypothalamus is involved in the control of many body functions,
including regulation of body water levels and body temperature
regulation.
Considering that enzyme function is affected by both temperature and
pH levels, the role of the hypothalamus and pituitary in governing the
constancy of these is of great importance to the survival of many species.
The diagram on the following page shows the positions of the
hypothalamus and pituitary near the brain.
10
cerebral hemisphere
hypothalamus
pituitary
medulla oblongata
cerebellum
spinal cord
The human brain showing the position of the hypothalamus and the pituitary.
Control of heat loss

Heat is lost more quickly to the environment in cold conditions, whereas
it is lost more slowly in hot conditions. Or, in fact, may be gained in
conditions which are hotter than the body temperature. As mentioned
above, heat moves from an area of higher temperature to one of lower
temperature. The rate of heat movement depends on the difference
between the two temperatures (the temperature gradient). As
environmental temperatures decrease, the rate of heat loss speeds up but
as it approaches body temperature, the heat loss slows down.
Increasing heat loss

When environmental temperatures increase above body temperature, heat
moves from the environment into the body.
So how can the body lose heat to maintain a constant body temperature?
Endotherms use the process of by evaporative cooling. Water is
evaporated from the skin or respiratory surfaces. Evaporative cooling
works because heat is required to change liquid water into water vapour
and this heat is drawn from the body.
Sweating from the skin is the most important method of evaporative
cooling in humans. However, in many mammals, rapid shallow
breathing (panting) may also be used in evaporative cooling of the body.
11
For example, dogs lose most heat by panting. Some species such as the
red kangaroo lick their skin to spread saliva, which then evaporates and
results in cooling.
These evaporative cooling responses are controlled by the nervous
system, again as a result of the temperature centre in the hypothalamus
detecting small changes in blood temperature.
Heat loss to the environment is increased if small blood vessels
(capillaries) at the skin surface are fully open, or dilated. This is called
vasodilation. Most heat loss is lost through skin at the extremities, such
as the legs, arms, hands, feet and ears. Vasodilation is controlled by the
hypothalamus via the nervous system.
Reducing heat loss

Heat loss to the environment can be reduced by reducing the flow of
blood through capillaries near the skin's surface. For example, have you
noticed how cold your hands, feet and ears can become when you are
feeling cold? The capillaries are partially closed, or constricted, in
vasoconstriction. Again, this process is controlled by the hypothalamus.
Another way of reducing heat loss also involves the skin.
Have you noticed that you get goose bumps when you are cold? This is
caused by small muscles attached to the base of the hairs on your body
contracting to make the hair stand up. This does not do much good for
you and is a hang over from your ancestry. However, in animals with a
thick fur coat, this response increases the depth of the air layer trapped in
the fur. This air acts as better insulation, reducing the amount of heat
loss from the body. The goose bump response is also controlled by the
hypothalamus and the nervous system, with feedback through minute
temperature changes in the blood.
It should also be noted that heat and cold receptors in the skin also result
in information being directed to the brain by the passage of impulses
along nerves. These are received by the hypothalamus. Another area of
the brain is also stimulated, resulting in the feeling of cold or hot.
Summary
The diagrams on the following page summarise the regulation of
responses in an endotherm to the body to day-to-day changes in
environmental temperatures. These regulatory responses to minute
changes in blood temperature are controlled by the nervous system using
feedback through the hypothalamus.
12
13
This diagram combines the ones from the previous page.
SKIN
cold
receptors
decrease
cause changes
in blood temperature
skin surface cooler

than surroundings
THYROID
STIMULATING
HORMONE
increased
METABOLISM
increased
more heat
produced
increase
skin surface warmer

than surroundings
HYPOTHALAMUS HYPOTHALAMUS
heat loss
heat gain
centre
centre
SHIVERING
THYROID
HORMONE
increased
SKIN
heat
receptors
BLOOD
TEMPERATURE
THYROID
STIMULATING
HORMONE
decreased
SWEATING OR
PANTING
VASOCONSTRICTION
VASODILATION
ERECTION
OF HAIR
LOWERING
OF HAIR
more heat
produced,
less heat lost
more heat
produced
THYROID
HORMONE
decreased
METABOLISM
decreased
less heat
produced
Note: Rectangles indicate involvement of the nervous system,

circles show endocrine involvement and triangles mark responses.
14
Limitations to temperature regulation

Endothermic species can occupy areas with a much wider range of
temperatures than most ectotherms. They can control their body
temperatures independently of the external environmental temperature
within the range over which their enzymes work best. But there is still a
limit to the range of temperature over which each species can survive.
For example, the platypus can maintain its body temperature around its
normal 32C, even when swimming around in water near 0C, but it quickly
dies from heat stress at temperatures higher than 30C. The red kangaroo
can tolerate environmental temperatures well above its body temperature of
36C but could not survive under such cold conditions as the platypus.
The range of temperatures over which an endothermic animal can regulate
its body temperature varies between species but at some point for every
species, there is an upper and lower limit to this regulation. The graph
below shows this for a species such as the platypus which can tolerate cold
temperatures but is poor at regulating its temperature in the heat.
50
Body temperature C
45
40
35
30
25
20
15
10
5
15
10
10
15 20 25 30
Ambient temperature C
35
40
45
Body temperature regulation for a species that can tolerate cold but not
hot conditions. This species is unable to regulate its normal body temperature
(32C) below 10C or above 35C.
At temperatures below about 10C, this species is no longer able to

regulate and its body temperature begins to fall. Above 30C, it begins
to overheat and its body temperature rises. In both instances, the
enzyme-dependent reactions of the species metabolism will fail and the
animal will die. The range of temperature over which a human can
regulate body temperature, without extra clothes, heating or air
conditioning, is much smaller than that of an animal such as a platypus!
15
Temperature regulation
for ectotherms
So why is temperature regulation important? Well, for a lot of

organisms, it isnt that important and many simply let their body
temperatures change with that of the environment. However, organisms
which do this are restricted to:
living in places where the temperature of the environment is within

the range of temperature over which their enzymes work
only being active at times when the environmental temperature is

close to the optimum temperature of their enzymes.
Outside this range of temperatures, the enzymes would either be

denatured, due to the temperature being too hot, or would be prevented
from working by it being too cold. There are living organisms (mainly
extremophile bacteria), which occupy extremes of temperature, with
some being able to tolerate temperatures below the freezing point of
water and others surviving above 100C.
But most species have a limited range of temperature over which they
can survive and reproduce. These species, which do not regulate their
body temperature at a constant level, are called ectotherms. Although
some heat is generated by their metabolisms it is not sufficient to regulate
their temperatures and so they depend on heat from the environment to
stay at temperatures at which their enzymes function.
Many ectothermic animals and plants can change their body temperatures
even when their physical surroundings are above or below the
temperatures at which they function best. They mainly do this by
changing the amount of heat they take up from the environment.
16
Ectothermic animals
Many ectothermic animals alter their body temperature using energy from
the sun. For example, ectothermic species can bask in the sun to absorb
the heat energy it provides. In many species a dark colour facilitates
absorption of heat. (These animals move into the shade during hot periods
to prevent overheating.)
Dilation or constriction of blood vessels in the skin can increase or
decrease the amount of heat which is taken up or lost to the environment.
You may have seen lizards basking in the sun and snakes are renowned
for it, but many other species of animals also make use of the suns heat.
A dark coloured lizard basking in the sun. (Photo: J West)
Ectothermic plants
Plants often receive too much heat from the sun on the surface of their
leaves. They can prevent becoming overheated by evaporative cooling
through transpiration of water from their stomates.
Also, plants living in very hot areas tend to be species with less leaf
surface area. Many Eucalyptus species growing in hot areas of Australia
can actually move their leaves so that the edges rather than the surface of
their leaves are exposed to the sun at the hottest part of the day.
17
Finding out more about

temperature regulation
In this section, you can learn more about temperature regulation by

reviewing materials from this module and from the Preliminary course.
You can also find out more by performing an investigation of your own.
Australian ectotherms and endotherms

You will find some revision material from the Preliminary course in the
Additional Resources section. This material deals with adaptations to
extreme environments with respect to temperature regulation in some
Australian species. Use this material and any extra material from the
Internet or books to complete the following exercise.
Do Exercise 2.3.
Some questions about temperature regulation

Use information from this module to complete the following tasks.
1
In the stimulus-response model that you considered near the

beginning of this part, there was only one transmission and one
effector. However, when one endocrine gland is controlling another,
there are two of each of these.
Use the diagram on the next page to complete a feedback loop
showing the regulation of body temperature by varying heat
production under hot conditions (such as in the summer).
The stimulus has been filled in for you as a starting point.
18
STIMULUS
slight decrease in
blood temperature
RECEPTOR
FEEDBACK
TRANSMISSION
RESPONSE
EFFECTOR
TRANSMISSION
EFFECTOR
An endotherm in a colder environment experiences a slight fall in

blood temperature. Describe the feedback system through the
hypothalamus, pituitary and thyroid gland that would correct this
organism's body temperature back to its normal level.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
The constancy of body temperature in mammals and birds is

maintained by the:
A
endocrine system and the blood vessels of the skin
nervous system and sweat glands
endocrine and nervous systems
nervous system and respiratory surfaces.
19
An ectotherm is best defined as an animal which:

A
regulates its body temperature using heat generated by its

metabolism
controls its body temperature by using heat from the

environment
permits its body temperature to change exactly with that of the

environment
allows its body temperature to fluctuate depending on its

activity.
A response to a cold environmental temperature in an endothermic

species is most likely to include:
A
sweating, vasoconstriction of surface capillaries and decreased

metabolism
shivering, vasodilation of surface capillaries and increased

metabolism
shivering, vasoconstriction of surface capillaries and erection of

hairs (fur)
sweating, reduced metabolism and erection of hairs (fur).
Which of the following statements applies most accurately to

temperature regulation in plants?
A
Plants have no control over their temperature.
Transpiration and movement of their leaves can affect the

temperature of some plant species.
The temperature of plants is always exactly the same as that of

the external environment.
Plants can stand much higher temperatures than animals.
Check your answers.
20
Human responses to temperature change

To be able to respond to day to day changes in the environment,
humans have to have senses to detect changes and the responses to
these changes. You have already read that the hypothalamus is
important in temperature sensing in humans and learnt about some
other ways that endotherms maintain a stable body temperature.
Here is a summary of human responses to temperature changes.
They are grouped into low temperature responses and high
temperature responses.
Low temperature responses
shivering
vasoconstriction of blood vessels near skin
increased metabolic rate
hairs stand on end
High temperature responses
sweating
vasodilation of blood vessels near skin
Look again at each of the points above. Identify how you collect
the information (identify the receptors) that leads to each response.
Then complete Exercise 2.4.
Investigating some body changes during exercise

Exercise increases the demand by cells for glucose and oxygen to
provide energy through cellular respiration. Muscle cells use this
energy, and the carbon dioxide produced needs to be eliminated from
the body. Heat is also generated by cellular respiration. It can be
used to regulate body temperature but excess heat produced during
exercise must also be lost to the environment.
21
The following body functions are affected by these demands for uptake
and output of materials. These can be easily measured:
Heart rate is measured by counting the number of beats per minute

(beats/min). By palpating (feeling) a position where an artery
crosses a bone, you can feel the beats of the ventricles driving blood
around the body (pulse rate) through the artery. This is usually done
on the wrist or on the side of the neck.
Breathing rate is measured in breaths per minute (breaths/min).

There are instruments which can record the rising and falling of the
chest wall as breathing speeds up or slows down, but you can simply
measure breathing rate by counting the number of times the chest
rises and falls, or by the number of times per minute that breath is
expelled from the nose or mouth.
Body temperature is measured by placing a clinical thermometer

under the arm or in the mouth for 2 minutes. It is measured in
degrees Celsius (C).
You might expect that all of these measurements would change with
exercise. Before you start this practical, write a hypothesis for what you
expect to happen to body temperature, breathing rate and heart rate,
immediately after exercise and then in recovery.
During exercise (measured immediately after exercise)
________________________________________________________
________________________________________________________
________________________________________________________
A while after exercise

________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
Requirements:
22
stopwatch (or watch with stopwatch function)
clinical thermometer (available from most pharmacies)
several friends/family members to be either the subjects or to record

results.
Procedure:
Ask several (23) friends or relatives, who have no medical problems
which would prevent them from doing some exercise, to volunteer to
help you. Test each person (subject) one at a time. Record all your
results in Exercise 2.5. Here are the steps to follow.
1
Sit the experimental subject down and measure the resting heart rate,
temperature and breathing rate. Record the results.
The subject should then do a set amount of exercise (eg. walking up and
down three flights of stairs for 5 minutes or jogging around the park).
Remember, do not ask anyone who has a medical condition to volunteer.
Immediately at the end of the exercise, ask the subject to sit down then
measure the heart rate, breathing rate and temperature. Record the
results. The subject must remain seated for the rest of the activity.
Repeat the measurements of heart rate, breathing rate and body

temperature after 5, 10, 15 and 20 minutes. (These measurements
describe the recovery period from the exercise.) Record the results.
Observe any changes in the subjects during the activity, such as the
colour of the skin or the appearance of sweat.
Results:
During the activity, you have recorded your results in Exercise 2.5.
Now complete the graphs in this exercise.
Discussion:
Earlier in this part of the module you investigated the homeostatic
feedback control of breathing rate. Heart rate is also controlled by a
complex interacting series of feedbacks through the nervous system in
response to blood pressure and to oxygen and CO2 levels in the blood.
What did you notice in this experiment? Your graphs should show that
these control systems permit rapid and considerable change in response to
the demands of exercise but return heart rate and breathing rate back to a
normal or resting level after the demand is over. These control systems
detect changes in the body (increasing CO2 and reduced oxygen) and act to
counteract these changes (by reducing CO2 and increasing oxygen). So,
the breathing and heart rates change considerably throughout the activity.
You will have seen from your results that the system controlling body
temperature does not permit the same degree of change.
Complete a discussion about the results in Exercise 2.6.
23
24
Suggested answers
Homeostasis and feedback
STIMULUS
increase of carbon
dioxide in blood
RECEPTOR
breathing centre in
brain senses
increased carbon
dioxide
FEEDBACK
changes of carbon
dioxide in blood
RESPONSE
increased
breathing rate
EFFECTOR
chest muscles
and diaphragm
TRANSMISSION
nerve impulses to
chest and
diaphragm
Do not worry if you found this task difficult. It is not an easy idea.
Keep thinking about how feedback works. Then try the problem again
when you have learnt more about homeostasis.
25
So why is temperature regulation important?

1
STIMULUS
slight decrease in
blood temperature
RECEPTOR
hypothalamus
to pituitary
FEEDBACK
increase in blood
temperature to
normal
TRANSMISSION
thyroid stimulating
hormone (TSH)
RESPONSE
heat production
EFFECTOR
muscles and liver
26
TRANSMISSION
thyroid hormones
EFFECTOR
thyroid gland
Any slight fall in blood temperature is detected by the hypothalamus,

which reduces the release of thyroid stimulating hormone (TSH)
from the pituitary. This in turn reduces the amount of thyroid
hormones being released from the thyroid gland, resulting in a
reduction in heat production by metabolism. The blood temperature
returns to normal.
C is correct. The endocrine system is involved in maintaining

metabolic heat production while the nervous system controls
shivering and the mechanisms that help to reduce or increase heat
loss from the body.
B is correct. Ectothermic species may permit their body

temperatures to follow that of the environment, but by using heat
from the environment, many of these species can have some control
over their temperature.
C is correct. Shivering generates heat, and heat loss to the cold

environment is reduced by vasoconstriction of surface capillaries,
especially in the extremities (eg. feet, ears), and erection of hairs to
increase insulation of the fur.
B is correct. Some plants, particularly those living in very hot

conditions, such as are found in areas of Australia, can regulate their
temperatures to some extent by evaporative cooling due to
transpiration. Some plants can also move their leaves so that they
get less heat from the sun in the middle of the day.
Additional resources
Here is some material extracted from the Preliminary course module

called Evolution of Australian biota.
The water holding frog

The water holding frog (Cyclorana platycephala) is one of several
Australian species of burrowing frogs which live in arid conditions
a rather unusual place for frogs to live, you would expect! Frogs have
external fertilisation and so must have water in which to mate and
produce tadpoles.
The frogs themselves survive for extended dry periods by living in a
cocoon about 0.5 m underground. When the temporary pools in which
they live begin to dry up, the frogs burrow down into the soil, away from
the heat of the sun, and form cocoons around themselves made from dead
skin and mucus secreted by the skin. This cocoon is quite impermeable
to water and so their water losses to the surroundings are low. They can
survive for many months, possibly even years, between rainfall events.
These frogs can tolerate some dehydration (loss of body fluids) and an
increase in toxic waste products arising from their metabolism, which is
lowered during their time underground. As soon as water from new rains
soaks down to them, the frogs break out of their cocoons and make their
way back to the surface to feed and mate in the pools.
Australian desert frogs can survive drought conditions by burrowing
down into the clay soil and forming a layer of dead skin around their
bodies, which reduces water loss to the soil.
27
The red kangaroo

The red kangaroo occupies the central and central western areas of
Australia. In other words, it lives in an area where summer temperatures
are very high and winter temperatures can be below freezing, while
rainfall is very low at most times of the year.
The following table lists some characteristics of red kangaroos.
Body dimensions of the red kangaroo
Head and body length
Tail length
Weight
Measurement range
Measurement average
0.91.4 m (male)
1.1 m (male)
0.71.0 m (female)
1.0 m (female)
0.71.0 m (male)
0.9 m (male)
0.50.9 m (female)
0.8 m (female)
2285 kg
(male)
66 kg (male)
1735 kg
(female)
27 kg (female)
You can see that males are much larger than females. A large red
kangaroo is about the weight of an adult human male and, when standing
up on its hind legs, is also about the same height as a fairly tall human.
Regulating body temperature

Once the external temperature is high enough to equal the body
temperature of an animal, the only way that the animal can get rid of heat
produced by its own metabolic processes is to carry out evaporative
cooling by sweating or panting.
You will remember that birds and mammals living in hot dry conditions
keep their body temperature constant by evaporating water through
sweating or panting. However, they need to balance the water they use
in this evaporative cooling against their water intake to maintain
regulation of their body fluids (osmoregulation).
28
In central Australia in the hottest summer temperatures, a red kangaroo

lying in the direct sunlight in the middle of the day would need to
evaporate around four litres of water per hour to regulate its body
temperature. This means that after a couple of hours in the sun it would
need to drink eight full litres of water just to keep its body water at a
constant level.
Red kangaroos only usually need to drink about every five days and so
the species obviously has adaptations which permit it to balance its heat
loss and regulation of body water under such severe conditions. Lets
have a look at how it does it.
As discussed before, water loss has to be balanced by water gain and heat
loss to heat gain if the kangaroo is to keep its body temperature and body
water levels constant. The animal gains heat from the environment
(mainly heat from the sun) and from its own metabolism, including extra
heat generated during exercise.
At rest the red kangaroo loses heat by panting. This consists of shallow
and rapid breathing passing air over the membranes of the nasal
passages. Increased blood flow in vessels supplying these membranes
permits a great deal of heat to be lost by evaporation. Sweating is not as
efficient a way of losing heat as panting, but the red kangaroo also sweats
to lose heat if it needs to exercise during the hot periods of the day.
The kangaroos also have a mass of small blood vessels under the skin on
its forelimbs. The kangaroo spreads saliva on its forelimbs and
evaporation results in heat loss from these blood vessels. Remember that
heat loss is the same as cooling. When you pick up a can of drink out of
the fridge it feels cold because your hand is losing heat to the cold can.
Water balance
This seems good so far the kangaroo can get rid of excess heat by
panting, spreading saliva and by sweating if necessary but what about
the water it loses in these processes, when it only gets to drink every five
days or so? The red kangaroo has other strategies to reduce water losses.
A kangaroos kidneys reabsorb a great deal of water, so that its urine is
very concentrated and it urinates quite infrequently during hot times.
Water is also very efficiently reabsorbed by the large intestine, resulting
in very little water being lost in the dry faeces.
You have possibly also heard the saying that mad dogs and Englishmen
go out in the midday sun, relating to the times when settlers and
explorers moved around in the hottest parts of the day in tropical areas,
whereas most indigenous people avoided those parts of the day by
seeking shade. The red kangaroo does the same as these indigenous
29
people, seeking out even the slightest shade provided by low shrubs or
trees in its environment. It also only moves around in the middle of the
day if it really has to, as exercise means the production of more body
heat, which must be got rid of by evaporating water.
The red kangaroo then is very well adapted in these ways for living in
hot, dry conditions. However, it should be noted that these strategies are
not just found in this species. In Australia, other kangaroo and wallaby
species, small mammals and birds from dry areas have similar
adaptations, as do animals such as camels, jack rabbits and prairie dogs
living in desert conditions in other parts of the world.
Red kangaroos increase heat losses by evaporative cooling by: panting
(at rest); sweating (during exercise); and saliva spreading (at rest).
Red kangaroos decrease in heat gain or heat production by: seeking
shade and avoiding exercise.
Water conservation adaptations of red kangaroos include: concentrated
urine and dried faeces.
The platypus
The platypus is quite a small animal although the species seems to be
much larger in Tasmania (with some individuals reaching 3 kg). On the
mainland, females are around 1 kg in weight and males a bit heavier at
around 1.5 kg..
The table following shows average body dimensions.
Body dimensions of the platypus
Measurement range
Measurement average
Total length,
including tail
4560 cm (male)
50 cm
(male)
3955 cm (female)
43 cm
(female)
Tail length
1115 cm (male)
12.5 cm (male)
913 cm
11.2 cm (female)
Weight
30
(female)
1.02.4 kg (male)
1.7 kg
(male)
0.71.6 kg (female)
0.9 kg
(female)
The platypus is found over a range of different habitats, as the map

following shows.
Non-permanent Rivers
Permanent Rivers
Distribution
Distribution map of the platypus (Ornithorhynchus anatinus).
(From The Platypus. A unique mammal. Grant, T. 1995. NSW University

Press, Sydney.)
You will notice that the distribution of the platypus ranges from tropical
areas in the north of Queensland to very cold areas in Tasmania, the
tablelands of New South Wales and Victoria, and in the Snowy
Mountains and Victorian alpine areas. In these cold areas, the platypus
experiences not only low air temperatures, which fall well below freezing
in winter, but also low water temperatures, which can drop to freezing.
What are some adaptations that permit platypuses living in these sorts of
areas to survive such harsh conditions?
31
The diagram following summarises some adaptations of the platypus.

Tail fat: fat stored in the
tail acts as an energy source for
body metabolism, which increases
to regulate body temperature
during the winter.
Fur: dense fur traps a layer of

air acting as insulation.
Counter-current heat
exchange system: veins and
arteries flowing in opposite directions
exchange heat in the muscles of the
pelvic area, reducing heat loss through
the rear feet.
Webbed front feet: large

surfaces of the webs provide
propulsion in the water but have
restricted blood supply to
conserve heat.
Adaptations of the platypus for cold conditions.
(From The Platypus. A unique mammal. Grant, T. 1995. NSW University Press, Sydney.)
The photo opposite shows a cross-section

through the platypus fur. The flat blades
of the guard hairs and the wavy shape of
the fine underfur layer trap air, which acts
as a very good insulator.
Platypuses were hunted until around 1900
and their skins used for rugs, hats and
gloves because the fur insulation was so
good in air. Even in water, the platypus fur
has about the same insulation as a wetsuit.
The platypus also has behavioural
adaptations to help it to survive cold
conditions. It lives in a burrow where the
soil acts as insulation to prevent the
burrow losing heat to the cold outside air.
This behaviour also helps the species
survive in the hotter areas of its range as
the burrow insulates against heat coming
in from outside too. When it is active in
hotter areas, the platypus is often in the
water, which keeps it cool.
32
Crosssection of a platypuss fur.
(From The Platypus. A unique

mammal. Grant, T. 1995. NSW
University Press, Sydney.)
Air
winter minimum 12C
summer maximum 34C
Burrow
winter minimum 14C
summer maximum 18C
Water
winter minimum 5C
summer maximum 24C
A platypus burrow.
(From The Platypus. A unique mammal. Grant, T. 1995. NSW University Press,
Sydney.)
Because platypuses have mainly evolved adaptations to survive the cold,

they are poorly adapted to hot conditions when they are out of water or
away from their burrows. They quickly die of heat stress in temperatures
above their body temperature.
The platypus body temperature is 32C, quite a bit lower than that of
most other mammals but it maintains it at a constant level. Like most
placental, or eutherian, mammals, humans have a body temperature of
37C, while most marsupials, including the red kangaroo, have slightly
lower body temperatures of around 36C.
As noted with the red kangaroo, the platypus has evolved adaptations
which are quite similar to those of species from other parts of the world
that also live in similar very cold environments (eg. musk rats, beavers).
33
34
Exercises Part 2
Name: _________________________________
Exercise 2.1: Using information to maintain a

balance
a)
Define homeostasis.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Why is it important to maintain a constant internal environment?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
35
Exercise 2.2: Summary

Outline the role of the nervous system in detecting and responding to
changes in environmental temperature in a mammal.
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
Exercise 2.3: Australian ectotherms and endotherms

Using Australian examples, identify two ectotherms and two endotherms.
For each named organism describe an adaptation or response that assists
temperature regulation. (Try to describe a different method of
temperature regulation for each organism.)
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
36
Exercise 2.4: Human responses to temperature

change
What receptors and responses do humans have for maintaining a stable
internal temperature?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 2.5: Results

Complete your results in the tables provided.
Subject 1
Heart rate
(beats/min)
Breathing rate
(breaths/min)
Body temperature
(C)
Other
observations
At rest
Immediately
after exercise
5 minutes after
exercise
10 minutes
after exercise
15 minutes
after exercise
20 minutes
after exercise
37
Subject 2
Heart rate
(beats/min)
Breathing rate
(breaths/min)
Body temperature
(C)
Other
observations
Heart rate
(beats/min)
Breathing rate
(breaths/min)
Body temperature
(C)
Other
observations
At rest
Immediately
after exercise
5 minutes after
exercise
10 minutes
after exercise
15 minutes
after exercise
20 minutes
after exercise
Subject 3
At rest
Immediately
after exercise
5 minutes after
exercise
10 minutes
after exercise
15 minutes
after exercise
20 minutes
after exercise
38
Now select a suitable kind of graph to present your results. You will
need to prepare one graph to compare breathing rates, another graph for
heart rates and a third graph for body temperature. Use different colours
or different symbols to represent each subject.
Graph of changes in breathing rate due to exercise and during recovery
Graph of changes in body temperature due to exercise and during

recovery
39
Graph of changes in heart rate due to exercise and during recovery
Exercise 2.6: Discussion

a)
Describe the difference between the graph for body temperature and
the graphs for breathing rate.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
40
b) What evidence did you collect in the experiment to show that

changes were occurring in the subjects to enable them to keep their
body temperature stable?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
Near the beginning of this part, you learnt about the two stages of
homeostasis. They are:
counteracting changes from the stable state.
Using information from your experiment and from this part,

outline how maintaining a stable body temperature requires these
two stages.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
41
Biology
HSC Course
Stage 6
Part 3: Mammalian blood
Contents
Introduction ............................................................................... 2
Blood
..................................................................................... 4
A review of the circulatory system .......................................................4
Composition of blood ...........................................................................7
Substances transported in blood .........................................................9
Learning more about red blood cells ................................................10
Blood vessels .......................................................................... 18

Comparing arteries, veins and capillaries .........................................18
What happens at capillaries? ............................................................20
pH of the blood........................................................................ 21
Normal pH for body fluids .................................................................21
Keeping pH stable .............................................................................22
Measuring pH .....................................................................................23
Finding out more ...............................................................................25
Exercises Part 3 ................................................................... 33
Introduction
Transport in multicellular animals is necessary to move nutrients and

wastes around the body. This occurs in a watery medium, usually blood
or lymph.
identify the form(s) in which each of the following is carried in

mammalian blood:
carbon dioxide
oxygen
water
salts
lipids
nitrogenous waste
other products of digestion
explain the adaptive advantage of haemoglobin and discuss the

physiological responses of mammals to decreased oxygen
concentrations experienced at high altitudes
compare the structure of arteries, capillaries and veins in relation to

their function
describe the main changes in the chemical composition of the blood

as it moves around the body and identify tissues in which these
changes occur
outline the need for oxygen in living cells and explain why removal
of carbon dioxide from cells is essential
outline the bodys response to increased carbon dioxide

concentration in the blood as an example of maintaining the balance
in blood composition concentrations.
identify data sources, plan, choose equipment or resources and

perform a first-hand investigation to demonstrate the effect of
dissolved carbon dioxide on the pH of water
perform a first-hand investigation using the light microscope and

prepared slides to gather information to estimate the size of red and
white blood cells and draw scaled diagrams of each

identify current technologies that allow measurement of oxygen
saturation and carbon dioxide concentrations in blood and describe
and explain the conditions under which these technologies are used

identify and describe the products extracted from donated blood and
the uses of these products
gather, process, analyse and present information from secondary

sources to report on progress in the production of artificial blood and
use available evidence to propose reasons why such research is
needed.

originally issued 1999. The most uptodate version can be found on the
Boards website at:
Blood
You have seen the importance of the temperature of the blood in

maintaining a stable body temperature in an endotherm (such as a
mammal). The blood has an important role in distributing heat
throughout the body.
The blood has a vital role in distributing other substances too. As the
main transport system of the body, the watery liquid called blood
transfers materials from where they are absorbed or produced to other
places in the body where they are needed or removed.
The blood travels through blood vessels due to the ceaseless beating of a
strong muscular heart. Together, these things blood, blood vessels and
heart make up the circulatory system.
A review of the circulatory system

You will probably remember the general circulation of blood in the body
of a mammal, from the Preliminary course. Here is an activity for you to
do to familiarise yourself again with the circulatory system.
Use two different colours of pen:
one for blood with high oxygen concentration (oxygenated blood)
one for blood with low oxygen concentration (deoxygenated blood).
Draw in the blood flow between the parts of the body represented by the
boxes, diamonds and circles in the diagram on the next page.
A diagram of the human circulatory system
head
and
arms
lungs
heart
liver
digestive
system
kidneys
abdomen
and
legs
Check your answer.
The diagram in the Suggested answers is fairly simple.

A less diagrammatic (but harder to draw!) scheme of circulation in the
human body is shown below.
head and arms
lung
left atrium
right atrium
right ventricle
left ventricle
intestine
kidney
legs
oxygenated blood
deoxygenated blood
Blood circulation in a human.
The exact positions of the organs and the lengths of the vessels may
change a bit between, say, a human and a giraffe but the circulation in all
mammals has the same basic plan.
Composition of blood
In the Preliminary course you looked briefly at the cells which are found
in the blood the red and white blood cells. Here is a table of
information to remind you about the cells and cell fragments (formed
elements) in blood.
Types of blood cells and fragments
% of formed
elements
Formed elements
(4347% of blood)
Function in body
red cells
99%
transport oxygen
white cells
<1%
combat infection
platelets
(cell fragments)
<1%
blood clotting
These cells make up less than 50% (4347%) of the blood in humans.
The rest of the blood is a liquid called plasma.
If you were to spin a tube of blood in an instrument called a centrifuge,
the spinning would force the solid elements (cells and cell fragments) to
the bottom of the tube, leaving the plasma floating on the top as a pale
yellow liquid. The diagram below shows this separation of blood
components due to centrifugation.
clear liquid fraction

(55% plasma)
cell fraction
(45% red cells, white cells and platelets)
Composition of blood.
Blood plasma
ions, wastes and

nutrients (about 1%)
Here is a pie graph showing

the main components of
blood plasma.
proteins
Use information from the

graph to complete the table
below.
water
(about 92%)
Components in blood plasma
Plasma
(5357% of blood)
% composition
of plasma
Function in body
proteins
osmotic balance of blood,

enzymes, blood clotting
ions
osmotic balance of body fluids;

involved in many metabolic
activities
nutrients such as:

amino acid
building structural proteins and

enzymes
lipids
provide energy, building

structures (eg. membranes)
carbohydrates
mainly energy
wastes
eliminated, no function
water
solvent for many substances
Check your answers.

You can see that plasma is very important for transporting substances
around the body. Apart from oxygen (which is carried by red blood
cells), all the other main substances are dissolved in plasma.
Substances transported in blood

The circulatory system is the main transport system of the body, carrying
essential materials to cells throughout the body and removing their wastes.
Essential materials (such as oxygen and digested food) are brought into the
body from outside through the respiratory and digestive systems. Wastes
(such as carbon dioxide and urea) are eliminated (removed) from the body
through the excretory and respiratory systems. So the substances present
in blood vary around the body, depending on what is being used or added
by cells or which body system it is passing through.
The table below summarises the materials carried in blood, their source
and where they are used or eliminated.
Summary about substances carried in the blood
Materials in blood
Form in which
material is carried
Material enters
blood
Material leaves
blood
oxygen
mainly attached to
haemoglobin in
red cells
respiratory
system
used by all cells
carbon dioxide
mainly dissolved as
bicarbonate ions
from all cells
respiratory system
lipids (fats)
as particles called
chylomicrons
digestive system
used by cells
amino acids
dissolved
digestive system
used by cells
simple sugars
dissolved
digestive system
used by cells
vitamins
dissolved
digestive system
used by cells
salts (ions)
dissolved
digestive system
urinary system
water
water molecules
digestive system
used by all cells
nitrogenous wastes
(mainly urea)
dissolved
liver
urinary system
products of digestion
Learning more about red blood cells

Blood normally looks red because of the many red blood cells it contains.
But if you have had a blood test, you may have noticed that blood looks
very dark purple, rather than red, when it is taken from a vein into the
syringe. Why does the colour change?
The red colour of the blood of most vertebrate animals is due to the
presence of a complex protein molecule called haemoglobin, which is
made up of four long amino acid chains (polypeptides), each one
assembled around an atom of iron.
Haemoglobin has a very strong affinity for (great ability to pick up)
oxygen, when oxygen is in higher concentration than it is in the blood.
This happens at the lungs. Haemoglobin can also release oxygen in an
area where oxygen is in lower concentration than it is in the blood.
This is why red blood cells release oxygen to cells throughout the body.
When haemoglobin picks up oxygen it becomes bright red in colour, but
haemoglobin changes back to a dark purple once it has given up its oxygen.
When you cut yourself, the blood looks really red because it rapidly picks
up oxygen from the air, which is 21% oxygen. However, blood which is
collected from a vein looks purple because it is low in oxygen
(deoxygenated). Remember that the blood in the veins is being returned to
the heart, which will then pump it to the lungs to be reoxygenated.
Oxygen combines chemically with haemoglobin (Hb) at the lungs to
form a molecule called oxyhaemoglobin. Each haemoglobin molecule
combines with four molecules of oxygen.
haemoglobin + oxygen
oxyhaemoglobin
Hb
+ 4O2
Hb(O2)4
At the tissues, haemoglobin releases the oxygen:
oxyhaemoglobin
Hb(O2)4
haemoglobin + oxygen
Hb
+ 4O2
So haemoglobin is used over and over, to carry oxygen from the lungs to cells.
Quite a few invertebrate animals that are adapted to living in places
where oxygen is in very low concentrations also have haemoglobin in
their blood. For example, tubifex or bloodworms are found in places
where oxygen has been used up by bacteria breaking down dead organic
material (such as in sewage treatment ponds and the muddly bottoms of
lakes). The larvae of some biting midges (sandflies) also live in the mud.
They have haemoglobin in their blood to help them absorb oxygen.
Other worms and insects, not so well adapted to low oxygen conditions,
have blood which is not red, but colourless.
10
The effect of altitude

As altitude increases, the amount of oxygen in the air available for
absorption decreases. In humans this can lead to dizziness, coma or even
death at high altitudes, as brain cells get insufficient oxygen to function
properly.
When first exposed to a low oxygen atmosphere, a persons heart rate
and breathing rate increases to move red blood cells more quickly
between the lungs and the tissues. However, this response gives way
over 23 weeks to the body producing an increase in the number of red
cells in the blood. These three responses are examples of physiological
responses (changes in the way that the body works).
You might have heard that Olympic athletes often train at higher
altitudes. Why do you think this would help them? If athletes train at a
higher altitude than the one at which they would normally be competing,
their bodies produce extra red blood cells. These will make more oxygen
available for exercise at the lower altitude, when oxygen is more
available in the air they are breathing.
Animals can have a similar response to altitude, but most species living
normally at high altitudes have evolved even better adaptations. For
example, the llamas of the high Andes Mountains in South America have
fewer red blood cells in their blood than humans. However, they have
more haemoglobin packed into each red blood cell and their haemoglobin
itself is even more efficient at picking up oxygen than is human
haemoglobin.
So you can see that haemoglobin is an extremely important molecule
when it comes to the survival of many animals.
The structure of red blood cells

You may hear the word erythrocyte or red blood corpuscle being used
instead of red blood cell. They all mean the same and it is best for you to
stick to using one name, but you need to recognise the other names just
in case you see them in something you are reading, especially if it is an
examination paper!
Red blood cells are very small cells indeed and you will look at their
actual size in a later exercise. Their small size gives them a very large
surface area to volume ratio, which makes movement of oxygen across
the cell membrane very efficient.
11
It is made even more efficient by the shape of the red blood cell it is
flattened and both sides are concave so that it is thicker at the edges than
in the middle. It looks a bit like a doughnut where the hole does not go
all the way through. This shape is shown below.
7 m
red blood cell
cut in half
Shape of a red blood cell.
If you treat a smear of blood on a microscope slide with a stain which

colours the nucleus (usually dark purple), then you will see a whole lot of
cells under the microscope, but only the white blood cells, which have
nuclei, will be stained. By the time they enter the bloodstream after
being formed in the bone marrow, each red blood cell in mammals,
including humans, has lost its nucleus.
Look at the following photographs of blood smears, as seen through
a microscope.
Human blood smear under a light microscope at x400 magnification.
12
white blood cells
red blood cells
Red and white blood cells taken with an electron microscope
(Gould, J.L. and Keeton, W.T. 1996. Biological Science. 6th Edition, p.823
Norton, New York)
In the electromicrograph (phototograph from an electron microscope),

there appears to be as many white blood cells as there are red blood cells.
However, remember that red cells make up a bit less than 50% of blood
and the white cells and platelets together make up less than 1%.
The size of red blood cells

How could you measure the size of a red blood cell? A microscope
makes objects that you look at seem larger. You can estimate or measure
the sizes of these images. But this does not tell you the size of the object,
only the size of its image through the microscope.
When you know the magnification of the microscope you are using, you
can calculate the sizes of objects from measurements of images that you
see through the microscope.
13
You will probably remember from using a microscope before, from

reading the Science Resource Book for the Preliminary course or from
working on the website (http://www.lmpc.edu.au/science) that
magnification by the microscope depends on two sets of lenses. The
ocular, or eyepiece lens, on most microscopes normally magnifies x10
and the objective lenses can be changed between x10, x40 and x100.
eyepiece
coarse adjustment
body tube
fine adjustment
arm
objectives
stage clip
stage
base
mirror
Parts of an older style of light microscope. Note the location of the eyepiece
(ocular lens) and objective lenses.
Finding total magnification for a light microscope

The total magnification of the microscope is calculated by multiplying
the two lens magnifications together as is shown in the table below.
Lens combinations and magnification for a light microscope
Eyepiece
(ocular) lens
14
Objective lens
Total
magnification
x10
x10
x100
x10
x40
x400
x10
x100
x1000
Field of view
Making measurements in a field of view

There is another column in the table on the previous page, headed
field of view. This is the actual diameter of the circle you look at when
you see down the microscope with the particular lens combination.
Before you can calculate the size of these fields of view (or often just
called the fields ) you need to have a unit of measurement which is small
enough to use. The unit usually chosen is called a micrometre, micron or
just m (the Greek letter and the abbreviation for metre).
1 micrometre (m) =
=
Or you can say,
1 millimetre (mm) =
or 1 metre (m) =
1 thousandth of a millimetre (0.001 mm)

1 millionth of a metre (0.000 001 m)
1 000 micrometres (m)
1 000 000 microns (m)
Now you can work out some field diameters.

Look at the diagram below. It is a drawing of what you would see if you
looked at a piece of graph paper with 1 mm divisions through a microscope
at x100 total magnification. You can see one full division across (1 mm)
plus a bit more on each side (0.3 mm + 0.3 mm say, 0.6 mm). So you have
measured the full field as being 1.6 mm across.
How many micrometres (m) is that? Yes, 1 600 m (1.6 mm 1 000).
diameter of
field of view
grid lines on
graph paper
0.3 mm
1.0 mm
0.3 mm
Measured field of view at x100 magnification.
You now know that anything you look at under x100 magnification on
this microscope which completely fits across the field is 1600 m in
length. (You have to measure the field of view for each microscope.)
15
Now look at the next diagram. There is an object called a paramecium

that fits half way across the field.
diameter of
field of view
1600 m
Object measured in field of view at x100 magnification.
How long is the paramecium?

Yes, it is 800 m (It takes up half of the field of view; 1600 2.)
How wide is the paramecium? ________________________________
It fits six times across the field of view so it is 1600 6 = 267 m
If you had an organism under the microscope which you
estimated fitted across the field four times, how big would it be? _____
Correct, 400 m or 1600 4 = 400 m.
So you can estimate the approximate size of anything you look at under
that power of the microscope because:
size of an object =
16
diameter of the field of view of microscope ( m )

number of times the object fits across the field
Did you wonder about fields of view under other magnifications? Well,
you can calculate these using the x100 field that you have measured
using the graph paper. Here it how it is done.
measured diameter of the field of view (in m )
number of times magnification has been increased
Since x100 field = 1600 m
size of field =
then
x400 field =
1600
=
4
Complete the calculate and put your answer (in micrometres) into the earlier
table comparing total magnification and field of view.
Now do the calculations for the field under x1000 magnification.
Show your working then put the answer into the table.
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answers.
17
Blood vessels
Blood travels throughout the body via interconnecting blood vessels.

These are arteries, veins and capillaries.
Comparing arteries, veins and capillaries
outer layer
muscle layer
inner layer
artery
layer one
cell thick
vein
capillary
Arteries
Arteries take blood away from the heart. They have thick muscular walls to
withstand the pressure of the blood resulting from the pumping of the heart
muscles. These muscular walls also even out the flow of blood by
expanding and contracting themselves. Blood in the arteries is always under
high pressure and so always flows in the one direction, away from the heart.
Veins
On the other hand, veins return blood to the heart from all parts of the body.
The pressure of blood in the veins can be quite low, particularly for blood from
the outer and lower parts (arms and legs). The return of blood against gravity
is aided by body muscles contracting and helping to squeeze the veins.
The walls of veins are also muscular, but the muscle layers are not as well
developed as they are in arteries. As well, valves prevent blood from
flowing backward in areas where the pressure may be quite low.
The diagram on the next page shows this happening.
18
muscle
tendon
valve closes and

prevents backflow of
valve opens and blood

flows towards heart
vein squeezed by muscle
Movement of blood in veins due to skeletal muscle contraction.
Standing in one place for a long time can cause a person to become dizzy
or even faint because insufficient blood returns the heart from the lower
parts of the body, so the brain does not get quite enough blood to
function properly. This is because the leg muscles are not contracting to
move the blood in the veins back up to the heart.
Capillaries
In each organ of the body, the main arteries subdivide to form smaller and
smaller vessels until the network of tiny microscopic vessels (capillaries)
supply individual cells or groups of cells. These capillaries rejoin into
larger vessels, taking blood out of the organ and empties it into the largest
veins that return blood to the heart.
direction of blood flow
artery
capillary
vein
connective tissue
connective tissue
elastic fibres and

smooth muscle
elastic fibres and

smooth muscle
endothelium
endothelium
(one cell thick)
endothelium
A capillary network and the structure of arteries, veins and capillaries.
The capillaries are extremely small and so have a large surface area
through which to unload some materials (oxygen and nutrients) and to
receive others (carbon dioxide and other wastes).
19
What happens at capillaries?

Complete the following table to show the exchange of substances between
blood in capillaries and the surrounding tissues. The first row has been done
for you, as an example.
Organ System
Blood entering organ
Blood leaving organ
Lungs
oxygen
more
less
carbon dioxide
less
more
urea
no change
no change
glucose
more
less
Kidney
oxygen
carbon dioxide
urea
glucose
Leg muscle
oxygen
carbon dioxide
urea
glucose
Small intestine
oxygen
carbon dioxide
urea
glucose
Check your answers.

How did you go? Remember that all cells use up oxygen and glucose in
their cellular respiration. Urea is produced in the liver. The kidney (and
to a very small extent, the skin) is the only other organ which changes the
concentration of urea in the blood.
20
pH of the blood
Like all substances, the acidity of blood can be described using the
pH scale.
Normal pH for body fluids

Normally, blood in arteries has a pH of 7.40, while in the veins it is 7.35.
That doesnt seem much of a difference but having a blood pH outside
this range quickly leads to death in humans.
For proper functioning of the cells, especially those of the nervous
system, a constant pH level must be maintained in the blood and the fluid
which surrounds cells. This fluid is constantly leaking from the blood
plasma into tissue due to blood pressure. The fluid does not accumulate
in tissues but drains into the thin walled vessels of the lymphatic system.
The fluid, then called lymph, is moved only by pressure from
surrounding muscles (in the same way that blood moves in veins). So
lymph travels through the body and empties into the veins of the neck.
Changes in pH
Acids in food and a variety of acids produced by a range of metabolic
reactions have the capacity to change the pH of the body fluids, including
blood and lymph.
These fluids can also be made more acidic by the presence of carbon
dioxide, which is transported away from cells carrying out cellular
respiration. Most carbon dioxide carried by the blood forms carbonic
acid, a weak acid that breaks up into H+ ions and hydrogen carbonate
ions (bicarbonate, HCO3) when it dissolves in water. The presence of
H+ ions in plasma increases the acidity (reduces the pH) of blood and
lymph.
21
Keeping pH stable
There are a number of homeostatic mechanisms which prevent the
pH range of body fluids from exceeding or going below the levels
necessary for survival (7.07.7). These include: buffers in body fluids,
kidney function and variations in breathing rate.
Buffers in body fluids

A buffer is a solution of two or more chemicals which prevents marked
changes in H+ ion concentration (pH) when either an acid or alkali (base) is
added to the system. If a few drops of concentrated acid are added to water,
the pH falls quickly. However, if a buffer is present in the water, the buffer
takes up most of the H+ ions and the pH changes only very slightly.
For example, study these equations.
A
carbon dioxide
water
carbonic acid
CO2
H2 O
H2CO3
carbonic acid
water
hydrogen ion
attached to water
H2CO3
H2 O
(H2O)H
bicarbonate ion
water
hydrogen ion
attached to water
H2 O
(H2O)H
HCO3
+ bicarbonate ion
HCO3
carbonate ion
CO3
In equation B and equation C, hydrogen ions are added to the solution so

it becomes more acidic (lower pH).
However, these reactions can also happen in reverse.
D
carbonate ion
CO3
bicarbonate ion
HCO3
hydrogen ion
hydrogen ion
bicarbonate ion
HCO3
carbonic acid
H2CO3
In equation D and equation E, hydrogen ions are removed from the

solution so it becomes less acidic (higher pH).
22
In other words, when carbon dioxide dissolves in water it acts as a buffer.

If the solution is too acidic, carbonate and bicarbonate ions will take up
+
H ions and raise the pH. If the solution is too alkaline, bicarbonate ions
+
and carbonic acid will give out H ions and lower the pH.
In the same way, carbon dioxide dissolved in plasma is a buffer in the
blood. However, blood contains enzymes (such as carbonic anhydrase)
to speed up these reactions so that the pH of blood remains stable.
Blood also contains other chemicals, including proteins like
haemoglobin, that act as buffers to maintain the acid balance of blood.
Kidney function
The nephrons of the kidney are capable of excreting more acidic or more
alkaline urine depending on the level of H+ ions in the blood passing
through the kidney. So the concentration of H+ ions (pH) can be varied
by the kidneys.
Variations in breathing rate

Increased breathing flushes excess CO2 from the blood and reduces the
level of carbonic acid in the blood and therefore the acidity (H+ ion
concentration).
In Part 2 you considered control of breathing rate. Why is this an
important mechanism?
During exercise, it is essential that breathing rate increases to get rid of
the extra CO2 produced by muscle cells. Otherwise the pH of the blood
could be lowered to dangerous levels. The feedback system you
considered in Part 1 (stimulus-response model) plays an important part in
ensuring that this normally does not happen.
Measuring pH
The pH of a liquid can be measured using an electronic pH meter.
However, it can also be found using an indicator. An indicator is a
chemical that has a different colour depending on whether the conditions
are acidic or alkaline. You probably used litmus paper at school and saw
that blue litmus paper went red in acidic conditions and red litmus paper
turned blue in alkaline conditions. This test only indicates acid or alkali.
23
There are other indicators that change colour depending on the actual pH
of the liquid. Universal indicator paper is one of these. The table below
shows some colours of universal indicator at different pHs.
Substance
pH
Colour of universal indicator
domestic cleaner
14
dark blue
window cleaning liquid
10
dark green
baking soda (NaHCO3)

dissolved in water
green
saliva
6.5
light orange
vinegar
dark orange
lemon juice
red
You can look at the science website to see a colour version of the universal
indicator scale.
You may be able to get some universal indicator to use from your
local school or TAFE. However, you can make your own. A lot of
plants have coloured pigments which change colour depending on the
acid level of the soil in which they grow. For example, hydrangea
flowers for example are blue if the plant grows in acidic soils and pink in
alkaline soil.
Making your own indicator

Finely chop about a handful of red cabbage (or flower petals).
Then boil the cabbage in a small saucepan (or microwave container)
with just enough water to cover it. Once the water is a good purple
colour tip it into a container and let it cool.
You now have your indicator. You can test it with some of the substances
in the table above to see the changes in colour at various pH levels.
24
Observing the effect of dissolved carbon dioxide on

the pH of water
Design a simple experiment which shows that dissolving carbon dioxide in
water makes the water more acidic. Here are a few things that might help.
Blowing into a drinking straw is a good way to get CO2 into some
water, but it will take several minutes to get enough dissolved to affect
your indicator.
Soda water is produced by bubbling CO2 into water under pressure.
You already have made an indicator that changes colour when pH

changes.
If you are going to use soda water, read the label on the bottle before you
buy it. You will need one which simply says carbonated water. If it
has potassium bicarbonate in it, the results of your experiment will be
poor as the bicarbonate acts as a buffer, which as was discussed earlier,
reduces the change in acidity.
Remember you need a control in your experiment. You need to be able
to show that any change in your indicator colour is caused by dissolving
carbon dioxide and not by something else.
In Exercise 3.5, write a brief introduction, identifying why you are doing the
experiment, followed by a description of your methods and a presentation of
your results. A discussion of your results should include consideration of
how the results relate to carbon dioxide being carried in the blood and how
these concentrations are maintained in balance.
Finding out more

On the next page, there are three research areas that deal with advances
in technology in the study of blood. You should gather information
about these areas and then analyse the information. Use the Internet,
your local library and/or the information in the Additional Resources
section of this part.
Some useful websites can be found at:
http://www.lmpc.edu.au/Science
25
Measurement of gases dissolved in the blood
Current technology allows the measurement of oxygen concentration

(called oxygen saturation) and carbon dioxide concentration in the blood.
Two of these new techniques involve:
a pulse oximeter
arterial blood gas analysis.
In Exercise 3.6, describe why oxygen and carbon dioxide concentrations are
of interest to doctors and write a summary about each of the new techniques
listed above.
Blood the vital factor
You or someone in your family may have donated blood in the past. Often
the blood is separated into different products that have different uses.
In Exercise 3.7, describe the products extracted from donated blood and
the uses of these products.
Artificial blood
Donated blood supplies in Australia often run low during holiday times, when
there is a major accident or when an unusually high number of surgical
operations are performed. These shortages would be less important if
artificial blood could be developed and produced.
In Exercise 3.8, report on the progress towards the production of artificial
blood and use available evidence to propose reasons why such research
is needed.
So, as you have seen, blood plays an important role in the transport of
material and the maintenance of homeostasis in the body. In the next
part you will be looking at the transport of materials in plants.
26
Suggested answers
A review of the circulatory system

head
and
arms
lungs
heart
liver
digestive
system
kidneys
abdomen
and
legs
oxygenated blood
deoxygenated blood
27
Blood plasma
Plasma
(5357% of blood)
% composition
of plasma
Function in body
proteins
7%
osmotic balance of blood,

enzymes, blood clotting
ions
<1%
osmotic balance of body fluids;

involved in many metabolic
activities
nutrients such as:
<1%
amino acid
building structural proteins and

enzymes
lipids
provide energy, building

structures (eg. membranes)
carbohydrates
mainly energy
wastes
<1%
eliminated, no function
water
92%
solvent for many substances
Finding total magnification for a light microscope

Eyepiece
(ocular) lens
28
Objective lens
Total
magnification
Field of view
x10
x10
x100
1 600
x10
x40
x400
400
x10
x100
x1000
1.6
What happens at capillaries?

Organ System
Blood entering organ
Blood leaving organ
Lungs
oxygen
more
less
carbon dioxide
less
more
urea
no change
no change
glucose
more
less
Kidney
oxygen
more
less
carbon dioxide
less
more
urea
more
less
glucose*
more
less
Leg muscle
oxygen
more
less
carbon dioxide
less
more
urea
no change
no change
glucose
more
less
Small intestine
oxygen
more
less
carbon dioxide
less
more
urea
no change
no change
glucose
less
more
* Note: The kidney reabsorbs any glucose lost into the nephron but
some glucose is used up in respiration in the kidney cells.
29
Pulse oximeter
This device senses the change in colour of the blood as it circulates
through the skin. As you will remember, the blood becomes bright red
when more oxygen is attached to the haemoglobin (forming
oxyhaemoglobin) and becomes a dark purple when less oxygen is
present. This difference in colour can be responsible for a sick person
looking blue in colour. The pulse oximeter looks like a clothes peg
which fits over the finger. Light (red and infrared) is emitted from the
top part of the peg and the amount of light passing through the skin is
determined by an electronic sensor on the bottom part.
The instrument then uses this value to calculate the amount of oxygen in
the blood flowing through the arterial capillaries of the skin. The result
is displayed as the percent saturation of the blood with oxygen.
Maximum saturation is 100% and blood in the arteries is normally
95100% saturated. This instrument is used to monitor the amount of
oxygen in the blood of patients who are undergoing surgery or who have
abnormal breathing or circulation. Additional oxygen can be supplied to
these patients if the oxygen saturation falls too low.
Pulse oximeter.
30
Arterial blood gas analysis

Modern blood gas analysis machines can measure the amount of oxygen
and carbon dioxide in a sample of blood by using the diffusion of these
gases through artificial membranes which are permeable to these gases.
The movement of oxygen molecules through a membrane from the blood
produces an electrical current which is converted by the machine to a
digital reading of the amount (partial pressure*) of oxygen in the blood.
The diffusion of carbon dioxide through another membrane changes the
pH of the solution inside the membrane and this is used by the instrument
as a measure of the amount of carbon dioxide present in the blood.
These measurements are very useful in monitoring patient progress
during treatment or surgery and in diagnosis of disease. For example, the
following blood gas analysis came back from a patient who was admitted
to a hospital casualty department with bluish skin colour and who was
breathing quickly.
pH
7.4
normal range
7.367.44
carbon dioxide
concentration
30mmHg
normal range
3545 mmHg*
oxygen concentration
50mmHg
normal range
90100mmHg*
This suggested a respiratory illness and a chest xray later showed that
the patient had pneumonia, which was then quickly treated with
intravenous antibiotics.
*
Blood gases are often expressed in terms of pressure that the gas
exerts and have the units, mm Hg. A barometer measures air
pressure in the same units.
31
Blood The vital factor

Less than half of all blood donations is used as whole blood in
transfusions. Most is separated into its components (fractions) and is
often used separately.
The diagram below shows the major fractions and how they are normally
used.
Serum albumin
for illnesses resulting
in low plasma protein
levels (eg. some liver
diseases)
Concentrated clotting
factors for illness
involving reduced blood
clotting (eg. haemophilia)
Unprocessed blood
for some transfusions
Whole blood
Packed red cells

for transfusion after
blood loss to increase
oxygen carrying
capacity
Immunoglobulins
(concentrated
antibodies) for passive
immunity and immune
deficiency illnesses
Stable protein plasma

for transfusion after
blood loss and/or
shockin an emergency
before blood is
available
Source: Australian Red Cross Society Blood Transfusion Service 1985
32
Artificial blood
The first blood transfusion was carried out in 1665 between dogs. Later
animal blood was transfused into humans, usually with fatal results.
Even when human-to-human transfusion began in 1818 it was often fatal.
The reason for this was not discovered until 1900, when it was found that
antibodies produced by the cells of different blood groups caused the
clumping together of the red blood cells of another blood group. For that
reason blood has to be cross matched so that it is compatible with the
blood group of the recipient before transfusion takes place. This can be a
great disadvantage in emergency situations and so it would be great if
artificial blood could be developed. Of course this would be very
difficult, considering the complexity of this living tissue which is the
blood.
No suitable fluid has yet been researched that would replace blood but a
number of short-term substitutes can be used in emergency situations
involving blood loss. Here are some examples.
stable protein plasma solution there are no red cells in this solution
so that it does not have to be cross matched. It does not help the loss
of oxygen-carrying capacity of the remaining blood but does replace
the volume of fluid lost and aids in restoring blood pressure. It is
often used after fluid loss as a result of burn injuries.
Dextrose solution (4% glucose solution in a fluid with the same

salinity as blood) can be used to restore blood pressure after blood
loss.
Haemoglobin can now be extracted from donor blood and

administered to treat accident victims. Because there are no red cells
cross matching is not necessary. Haemoglobin can be stored for
long periods and can be sterilised.
33
34
Exercises Part 3
Name: _________________________________
Exercise 3.1: Blood

Identify the form(s) in which each of the following is carried in
mammalian blood:
a)
carbon dioxide _________________________________________

_____________________________________________________
b) oxygen _______________________________________________
_____________________________________________________
c)
water _________________________________________________
_____________________________________________________
d) salts__________________________________________________
_____________________________________________________
e)
lipids _________________________________________________
_____________________________________________________
f)
nitrogenous wastes ______________________________________

_____________________________________________________
g) other products of digestion. _______________________________

_____________________________________________________
35
Exercise 3.2: The effect of altitude

Haemoglobin occurs in the blood and gives it a red colour.
a)
What special features of the haemoglobin molecule enable it to move

oxygen around the body?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Discuss the physiological responses of mammals to decreased

oxygen concentrations experienced at high altitudes.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
36
Exercise 3.3: The size of red blood cells

Here is a diagram of a blood smear viewed under a microscope.
The field of view is 75 m. At this magnification, six red blood cells fit
across the field of view. What is the diameter of a red blood cell?
Show your working.
7 microns
a)
At this magnification, six red blood cells fit across the field of view.
What is the diameter of a red blood cell? Show your working.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) The diagram (which is drawn to scale) in the notes shows that white
blood cells are quite a bit larger than red cells. You have calculated
the size of a red blood cell above. Use this information to calculate
the size of the white blood cells from the diagram. Show your
working.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
37
c)
38
Look back at the photographs and diagrams of red and white blood
cells in Part 3. Then draw a large diagram, at the same scale, of
these two kinds of cells. Put them side by side so that it is easy to
compare their sizes. (Hint: A reasonable scale to use would be
1m = 0.5 cm on the drawing.)
Exercise 3.4: Comparing arteries, veins and

capillaries
Compare the structure of arteries, capillaries and veins by completing the
table below. In the first column, draw a simple labelled diagram of each
type of blood vessel. In the second column, describe how the structure of
each blood vessel suits its function.
Diagram
Suitability of structure for function
arteries
veins
capillaries
39
Exercise 3.5: Observing the effect of dissolved

carbon dioxide on the pH of water
Introduction
________________________________________________________
________________________________________________________
Method
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
Results
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
Discussion
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
40
Exercise 3.6: Measurement of gases dissolved in the

blood
a)
Why is the amount of oxygen in blood important?

_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Why is the amount of carbon dioxide in blood important?

_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
Summary about a pulse oximeter

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
d) Summary about arterial blood gas analysis

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
41
Exercise 3.7: Blood the vital factor

Describe the products extracted from donated blood and the uses of these
products.
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
Exercise 3.8: Artificial blood

Report on the progress on the production of artificial blood and use
available evidence to propose reasons why such research is needed.
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
42
Biology
HSC Course
Stage 6
Part 4: Transport in plants
Contents
Introduction ............................................................................... 2
Movement of materials in plants................................................ 3
Investigating vascular tissue................................................................5
A different look at vascular tissue......................................................10
Movement of substances through xylem and phloem tissue ...........12
Comparing transport systems ................................................ 17

Exercises Part 4 ................................................................... 27
Introduction
So far you have been concentrating on the transportation of materials in

animals. In this part you will look at the movement of materials in
plants. To study the vessels that carry the materials you will need to
purchase some celery, a single sided razor blade and some food dye.
describe current theories about processes responsible for the

movement of materials through plants in xylem and phloem tissue.
choose equipment or resources to perform a first-hand investigation

to gather first-hand data to draw transverse and longitudinal sections
of phloem and xylem tissue
gather, process, analyse and present information from secondary

sources to compare the movement of materials through mammals
and flowering plants.

Boards website at:
Movement of materials
in plants
The native Tasmanian oak tree (Eucalyptus regnans) grows to a height of

over 120 metres approximately the height of an 810 storey building!
Water must reach the leaves of this tree to be used in its photosynthesis
and the products of photosynthesis need to be transported from the leaves
to other parts of the tree, including the roots. How is this possible?
You should be familiar with xylem tissue, which transports water and
minerals in the plant, and with phloem, through which the products of
photosynthesis are transported within the plant. You also need to know
about the stomates or stomata (singular stomate or stoma), which are
responsible for the uptake of carbon dioxide from the atmosphere and for
transpiration. (See the Additional Resources section for revision material.)
Xylem tissue
Xylem tissue is made up of long tubular cells which join into pipes.
These form the vascular system of ferns, gymnosperms and angiosperms,
which are called the vascular plants and they belong to the phylum
Trachaeophyta.
The cells of the xylem grow to maturity and then die but are kept open by a
material called lignin. Lignin is the major component of wood. In woody
plants, old xylem cells form growth rings in the stem as the plant grows.
bark
operative xylem
and phloem
woody growth rings
Tree rings are formed from old xylem cells.
Phloem tissue
Phloem tissue is also made up of long tubular cells but these cells are
living and not thickened with lignin. They contain sieve plates at the
ends of the cells so that fluids can move through the cells but cell
components remain within each living cell.
Vascular tissue
In young stems of woody plants and the stems of all herbaceous plants
(soft herbs), xylem and phloem occur in bundles (vascular bundles).
In the roots of plants, xylem and phloem form a cylinder.
Here is a three-dimensional diagram of a stem showing the position of
the xylem and phloem tissues.
epidermis
pith
cortex
xylem
cambium
FIBRES dead cells with walls
thickly coated with lignin are also
found around and within the
vascular tissue. These provide
support to keep the plant erect.
vascular bundle
phloem
Three-dimensional section of a stem from a flowering plant.
Investigating vascular tissue

A section can be cut across a plant stem or root and this is called a
transverse section (TS) or cross-section (XS). If you cut down from top
to bottom the section is called a longitudinal section (LS).
longitudinal
section (LS)
transverse section (TS) or

cross-section (XS)
Diagram showing both transverse and longitudinal sections.
The photograph below shows the same cuts through a celery stalk.
A transverse section and a longitudinal section of a celery stalk. (Photo: J West)
Very thin sections can be cut by a machine called a microtome, which

slices the tissue so thinly that light can pass through and it can be viewed
using a microscope.
The photographs below show vascular bundles in a transverse section
from a stem. The other tissues shown in the photographs are of less
concern to you and have a variety of functions. They include:
cambium produces new xylem and phloem cells as the stem grows
cortex sometimes called packing cells which have a range of

functions but mostly are involved in storing materials (eg. starch)
epidermis the outer layer of cells all over the plant
pith larger cells similar to the cortex but in the middle of the stem.
epidermis
xylem
phloem
pith
cortex
vascular bundle
Cross-section of a stem. ( unknown)
This photograph is a larger magnification of one vascular bundle.
xylem
cambium
phloem
Close-up of a vascular bundle. ( unknown)
Without a microscope, it is difficult to study these tissues in detail.

However, you will be able to observe xylem and phloem tissues in
a longitudinal section and a transverse section from a soft plant
(non-woody or herbaceous) such as celery.
Preparing and observing your tissue sections

You will need:
a fresh stick of celery
a single sided razor
a glass or container with water
food dye (red works well).
(Photos: J West)
What to do:
Place an end of a freshly cut stick
of celery, with its leaves still
attached, into a container
containing a strong solution of
food dye. Leave it overnight.
For a transverse section

Take a piece of the celery stalk and use a hard-backed razor blade to cut
across it. This makes a transverse section. (Be careful not to cut yourself!
If you do use a double sided blade, put some tape over one side to make it
safer to use.)
Cutting a transverse section through the celery stick. (Photo: J West)
Look at the cut end, either with the unaided eye or using a hand lens.
You should see the vascular tissue (xylem and phloem) as bundles.
The red dye, which will have moved up through the xylem cells, will
highlight the bundles.
The darker regions are the vascular bundles. (Photo: J West)
If you have a powerful hand lens you may be able to distinguish separate
xylem cells. You will see what looks like the ends of very small tubes.
If you do have access to a microscope (and know how to use it or can get
someone to show you), you can cut fine transverse sections of the celery
using the razor blade. Place a thin slice on a slide in a drop of water,
cover it with a coverslip then view it under the microscope with x100
total magnification. (Can you remember which lenses you need to use?
Yes, the x10 eyepiece lens and x10 objective lens.)
The image you see will not be as clear as shown in the photographs here,
but you should see that the xylem cells are very large with thick walls.
It is hard to distinguish the phloem unless you stain it, as has been done
in the slides used for the photographs.
In Exercise 4.1, draw a simple diagram of your transverse section of the
celery, showing the positions of the xylem and phloem in the vascular
bundles.
For a longitudinal section

Cut off a piece of celery about 2 cm long. Cut a longitudinal section
down through the piece, making sure that you are cutting through at least
one vascular bundle. Use your hand lens, if you have one, to look
closely at the long tubes.
In Exercise 4.2, draw a simple diagram of your longitudinal section showing
the position of the xylem and phloem in the vascular bundle.
A different look at vascular tissue

In your investigation, you have studied vascular tissue from a stem.
Your observations (and diagrams) would be slightly different if you had
prepared a transverse section and longitudinal section of a root instead.
The following photograph shows a transverse section of a root.
Compare it with the photograph of the transverse section of a stem
earlier in this part. By comparing the photographs, you will be able to
identify the different types of cells present in the root cross-section.
Then draw a simplified diagram of the transverse section of the root in
the space below its photograph. Label the cells that you have identified.
(Do not attempt to draw all the cells! Draw an outline and label the
areas of different cell types.)
10
Cross-section of a root. ( unknown)
Check your answer.
11
Did you notice that the xylem vessels in the root are arranged in a cross
or star shape at the centre of the root? The phloem vessels are in bundles
around the xylem cells. Here is a close-up of the vascular bundle at the
centre of a transverse section of a root.
cortex
endodermis
xylem
phloem
Close-up of the vascular bundle of a root. ( unknown)
Movement of substances through xylem

and phloem tissue
The xylem and phloem tissues in the plant are responsible for the
transport of materials around the plant. These materials include water,
minerals and the products of photosynthesis.
Movement of water in plants

Water moves into the plant through the large surface area of the root
hairs. It moves from the soil, where it is usually in a higher
concentration than in the plant. This process is called osmosis. Water
moves from cell to cell within the plant by osmosis until it reaches the
xylem cells.
12
Several theories arose for how water moved in the xylem once it reached
this tissue. (Refer also to the Additional resources.)
Originally biologists thought that the pressure created by osmosis in

the roots pushed water up through the xylem. However, once it
was possible to calculate pressures inside plants it was concluded
that this pressure was not strong enough to push water up to reach
the leaves of tall trees like the Tasmanian oak tree.
It was also suggested that water crept up the very fine tubes of the
xylem, a bit like ink moving through the fibres of blotting paper.
This movement is called capillarity but again it was worked out that
this movement would still not move water to the top of a tall tree.
The suggestion that the water was pumped by the cells using
energy from cellular respiration (active transport) was quickly
abandoned. Since xylem cells are dead, they cannot carry out
cellular respiration to produce the required energy.
So how is it done? The theory which has most support is called the
transpiration-tension-cohesion theory. This is how it appears to work.
Water enters the roots by osmosis and reaches the xylem by the same
process (by moving from an area of higher concentration to an area
of lower concentration).
A continuous column of water molecules occurs in the xylem.

Water molecules stick together by a process called cohesion, where
the positive end of one water molecule is attracted to the negative
end of the next one in the xylem cells.
As one water molecule evaporates (in transpiration) from the leaf

surface through the stomate, another one is pulled up the column of
water in the xylem by the negative pressure (tension) created, to
replace it.
In turn, another molecule of water moves by osmosis into the bottom

of the xylem to replace the one that has moved up.
In this way, microscopic columns of water continue to move up the

xylem vessels, being essentially pulled up from the leaves
(transpiration-cohesion-tension theory) rather than being pushed up
from the roots (root pressure, capillarity and active transport theories).
The movement of water from the roots through the xylem to the leaves is
referred to as the transpiration stream.
So is there evidence for this theory? Yes, there is; indeed some good
evidence.
Very accurate measurements of the stems of plants show that the

stems actually shrink very slightly while the plant is transpiring,
indicating pulling from the top. If water were being pushed from
13
the bottom, you would expect a slight expansion of the stem as a

result of that positive pressure.
Water continues to move through a plant whose roots have been cut
off (eg. cut flowers). If root pressure were the mechanism for water
movement, you might expect the removal of the roots to
significantly reduce water movement.
Plants which have been chilled or poisoned to kill all living cells
continue to conduct water. This rules out active transport as a
mechanism of water transport.
The figure below summarises the theory of the functioning of the

transpiration stream.
leaf
water moves along

xylem into leaf
water evaporates
into air spaces in
spongy mesophyll
stem
water vapour escapes

through stomata
water drawn up
xylem in the stem
water around soil particles
water enters root hairs by osmosis
water enters
xylem in root
Movement of water in plants.
Do Exercise 4.3.
14
Movement of minerals in plants

Most minerals (ions) are dissolved in water in the soil. They move into
the plant through root hairs and then travel through xylem tissue.
Some mineral ions enter the plant by diffusion, when they are in high
concentration in the soil but are in lower concentration inside the plant
roots. However, most are moved from the soil into the root by active
transport.
Some minerals are recirculated within the plant through the phloem. For
example, it has been shown that radioactively marked phosphorus is
transported from old leaves that are dying to new leaves which require
this mineral for their growth.
However, other minerals do not seem to be recycled (eg. calcium).
These minerals need to be constantly taken up from the soil.
Movement of products of photosynthesis

Biologists studied the ways that radioactively marked sugars move
throughout plants. Some observations include that:
their movement in the phloem is very rapid (as quickly as 1 metre

per hour)
the direction of movement can be reversed
movement of materials can be in different directions in different

parts of the same vascular bundle.
These observations need to be explained by any theory of movement of

products of photosynthesis in the phloem (usually called translocation).
Obviously, the movement of materials in phloem is different from that in
xylem. Unlike xylem cells, phloem cells are living so material stops
moving through them when phloem cells die. This suggests that the
translocation of products of photosynthesis through phloem tissue is an
active process that demands the use of energy.
The following diagram is a summary of the current theory for how
translocation of sugars works. This theory is called the pressure flow
theory.
15
site of sugar
production
in leaves
HIGH
osmotic
pressure
Sugars are pumped into the

phloem cell due to active
transport. This results in a
higher sugar concentration
inside the phloem cells.
Water moves into the

phloem cells due to osmosis
as a result of the higher
sugar concentration.
movement of sugar and water

through the phloem along
an osmotic pressure gradient
Sugars are pumped out of
phloem cells by active
transport.
Water moves out of
phloem cells by osmosis
due to more sugars in the
surrounding cells.
LOW
osmotic
pressure
site of use of
sugars in fruit,
flowers, root
and stem
Diagram representing the pressure flow theory for the translocation of sugars in
vascular plants.
16
Comparing
transport systems
The syllabus considers transport systems of flowering plants and

mammals together in this module and in the Preliminary module called
Patterns in Nature. You need to make a comparison between these
two systems.
Construct a table to compare the transport systems in flowering plants and
mammals. Remember that the word compare means giving similarities and
differences.
There is a suggested table format with some information filled in for you
on the following page but you can construct your own. You can also add
more categories for comparison if you like.
When you have finished the activity (which is good revision for this part
of the module), compare your table with the one in the Suggested
answers. Then answer the question below.
Do flowering plants, like mammals, have a circulatory system? Explain.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
A definite answer to this question is probably not possible. However,
while there are similarities, it would seem that the transport systems of
these two very unrelated groups are very different from each other.
Almost certainly, these transport systems have been produced through
different evolutionary pathways.
17
Comparison of transport systems in mammals and flowering plants
Nature of vessels
Mammals
Flowering plants
living multicellular tubes with

flexible muscular walls
rows of dead rigid cells (xylem)

or living cells with cellulose
cell walls (phloem)
Nature of material
transported
a fluid made up of water and

minerals (xylem sap) or
water, minerals and sugars
(phloem sap)
Source of energy for

movement
heat energy from the sun for

evaporation (xylem) or ATP
energy from cellular respiration
(phloem)
into and out of vessels
osmosis, diffusion and active

transport
Materials transported:
water
circulated via blood and

lymphatic systems
minerals (ions)
mainly circulated via blood and

lymphatic systems
oxygen
carbon dioxide
dissolved in plasma and

transported in blood vessels
organic compounds
digestion products carried in

blood and lymph vessels
hormones
predominantly one way through

the plant; lost by transpiration
not carried in vessels

carried in phloem vessels
Remember to check your answers.
18
Suggested answers
A different look at vascular tissue

epidermis
small cells in cortex
large cells in cortex
xylem
phloem
19
Comparing transport systems
Mammals
Flowering plants
Nature of vessels
living multicellular tubes with

flexible muscular walls
rows of dead rigid cells (xylem)

or living cells with cellulose
cell walls (phloem)
Nature of material
transported
tissue made up of living cells

suspended in a fluid
a fluid made up of water and

minerals (xylem sap) or
water, minerals and sugars
(phloem sap)
Source of energy for

movement
muscular pumping by the heart

(arteries) and body muscles
(veins and lymph vessels)
heat energy from the sun for

evaporation (xylem) or ATP
energy from cellular respiration
(phloem)
into and out of vessels

transport

transport
Materials transported:
20
water
circulated via blood and

lymphatic systems
predominantly one way through

the plant; lost by transpiration
minerals (ions)
mainly circulated via blood and

lymphatic systems
some recirculated through

phloem but many lost in dead
leaves and such
oxygen
carried by red blood cells through

blood vessels
carbon dioxide
dissolved in plasma and

transported in blood vessels
organic compounds
digestion products carried in

blood and lymph vessels
photosynthetic products carried

in phloem vessels
hormones
carried in plasma through

blood vessels
carried in phloem vessels
This information comes from the Preliminary module, Patterns in

Nature.
Vascular bundles
This is the term used to describe the groups of conducting tissue in
a stem. Each bundle contains three types of tissue: xylem, phloem and
cambium.
Xylem
Xylem forms long tubes up to 1 m in length. They are made up of dead
cells, thickened with woody material, with cross walls that have broken
down. They are known as xylem vessels. Xylem gives support, strength
and rigidity to the stem, and transports water and mineral ions upwards
from the roots to the leaves. Note: Water and mineral ions travel only in
one direction in the xylem upwards.
Phloem
Phloem consists of living sieve-tube cells forming long columns.
There are perforations in the cell walls so that the cytoplasm of the cells
connects along the tubes. Associated with the sieve-tube cells are
companion cells and other supporting tissue. Organic materials
including sugars, amino acids and hormones are transported by the living
sieve-tube cells of phloem tissue. This movement is called translocation.
Materials move both up and down the plant through phloem tissue.
The movement is too fast to be caused by diffusion only. There are
several theories suggesting possible forces involved but the exact
mechanism remains unknown.
21
Cambium
Cambium cells are capable of cell division. They divide to form cells
which become new xylem and phloem tissue. In older stems, division of
cambium cells results in a continuous ring of vascular tissue.
How water travels up plant stems

Why does water move upwards in plants? Some of Australias tallest
trees, such as the Mountain Ash in Victoria and Tasmania, are more than
100 metres tall. How does water move to this height, defying gravity?
Several processes seem to be involved in the upward movement of water.
The processes include:
adhesion
capillarity
root pressure
transpiration-cohesion
guttation.
Adhesion
Adhesion refers to the forces of attraction which exist between different
types of particles. Using tissues or a cloth to mop up water works
because of the force of attraction between dissimilar particles, the cloth
particles and the water particles, or the tissue particles and the water
particles. A piece of plastic would not be used to soak up water because
the forces of attraction between the plastic particles and water particles
are very weak while those between cloth and water are much stronger.
In plants, cellulose acts like blotting paper or a cloth. Cell walls are
made of cellulose. They help the plant to absorb water from the soil.
Capillarity
Capillarity is the name given to the action by which the surface of a
liquid (usually water) is elevated when in contact with a solid surface by
attraction of molecules between the liquid and solid surfaces. The water
particles at the top of a column of water help to pull up the water
particles beneath them. When the liquid is in a narrow vessel, the level
of water will rise quickly, but capillarity can also occur in structures such
as soils, causing a rise in the watertable.
22
The xylem vessels in plants extend from the roots to the leaves. They are
extremely minute tubes or capillaries and water rises up them partly by a
process of capillarity.
Root pressure
If the stem of a well-watered plant is cut off, water can be seen to come
out of the plant from the severed xylem vessels. If a glass tube were
attached to the cut stem with a piece of rubber tubing, water would be
seen to rise up the glass tube. It can rise from several centimetres to
more than one metre. This rise is said to be caused by root pressure.
Root pressure is caused by the intake of water due to osmosis. Scientists
have found that root pressure is too small to account for the rise of water
upward in plants which are taller than several metres.
Transpiration-cohesion
At the moment, the best theory which attempts to explain the upward
movement of water in plants is the transpiration-cohesion theory.
Water is continually leaving the plant via the leaves. This loss of water,
in the form of water vapour from the leaves, is called transpiration. Now,
as each water molecule passes out of the leaf, more water is drawn up,
because of forces of cohesion (attraction) between water particles. The
columns of water in plants can be likened to chains of beads. As one
bead (water molecule) is pulled out of the leaf, the whole chain of beads
(water molecules) is pulled up a little. As more beads (water molecules)
are pulled out of the plant, more enter the plant in the root region. So,
there is this continual stream of water molecules upwards in plants.
Guttation
You may have noticed, occasionally, drops of water (not dew) on certain
outdoor plants and indoor plants, such as a Monstera deliciosa
commonly called Monsteria (mon-stear-e-ah) or fruit salad plant.
Generally, plants lose water in the form of water vapour; that is, water in
the form of a gas. However, when humidity is high and plants are well
watered, they may lose water as drops of liquid water. This process is
called guttation.
Many plants have special openings through which drops of water are
forced out. These special openings may be found along the edges of
leaves or near the ends of their veins. It is thought that high root pressure
may cause guttation.
23
Summary
Several processes appear to be involved in the upward movement of
water in plants. They include:
adhesion forces of attraction between different particles are called

forces of adhesion. The cellulose cell walls in plants soak up water
by this process, in much the same way as a blotter soaks up water
capillarity the rise of water in thin tubes by forces of adhesion and

cohesion. Water rises up thin tubes because of attraction between
the particles of the plant and water particles (adhesion) and because
of the attraction between the water particles themselves (cohesion)
root pressure the upward movement of water caused by the

pressure from water moving into the root as a result of osmosis
transpiration-cohesion the loss of water molecules from the leaves

(that is, transpiration) results in the upward movement of more water
molecules since these molecules are attracted to each other by forces
of cohesion
guttation the loss of water in the form of a liquid from openings on

the leaves.
Water enters the plant through the roots. The roots are covered by fine
root hairs which increase the surface area for absorption of water. The
root hairs are single celled extensions of the root epidermis (surface or
outer layer of the root). Water enters the root hair by diffusion since the
concentration of solutes in the soil water is lower than their concentration
inside root hair cells. Water will move from an area of high water
concentration (in the soil) to an area/region of low water concentration
(within the root hair cells).
root hair
soil particles
water
Water moves into the plant from the soil through the root hairs.
24
One of the main functions of stems is transport of substances around the

plant. Internally, stems contain tubes of conducting tissue or vascular
bundles, which consist of xylem and phloem, that carry materials
between the shoot and root systems. The conducting tissue can be
arranged in a ring or scattered throughout the stem tissue.
Cross section of plant stem. Vascular bundles are scattered throughout the cortex.
Australian Key Centre for Microscopy. The University of Sydney.
25
26
Exercises Part 4
Name: _________________________________
Exercise 4.1: For a transverse section

Draw a transverse section of a celery stem in the space below.
Remember to carefully label the diagram, including the xylem and
phloem.
Exercise 4.2: For a longitudinal section

Draw a longitudinal section of a celery stem in the space below.
Carefully label the diagram, including the xylem and phloem.
27
Exercise 4.3: Movement of water in plants

Outline three theories that have been used to explain the movement of
water through xylem tissue.
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
What is the accepted theory today and what evidence is there for this
theory?
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
28
Biology
HSC Course
Stage 6
Part 5: Excretion
Contents
Introduction ................................................................................2
Water and wastes ......................................................................3
Water balance ......................................................................................3
Wastes..................................................................................................5
Excretory systems......................................................................8
A review of respiratory and excretory systems...................................8
Dissection of a mammalian kidney....................................................13
Functioning of a mammalian kidney..................................................15
What can be done when kidneys dont function? .............................21
Suggested answers..................................................................23
Additional resources.................................................................27
Exercises Part 5 ....................................................................39
Part 5: Excretion
Introduction
The kidneys play a vital part in maintaining the internal balance of

animals. In this part you will look at the structure and function of a
kidney and what happens when kidneys fail. During this part you will
need to purchase a sheeps kidney from your local butcher.
recall the role of the respiratory and excretory systems in maintaining

humans as functioning organisms
identify the role of water as a solvent for metabolic reactions in living cells
and explain why the concentration of water in cells must be held constant
explain why the removal of wastes is essential for continued metabolic

activity
compare the waste products of a range of terrestrial and aquatic organisms

and explain why these differences occur
explain why the processes of diffusion and osmosis are inadequate in

removing dissolved nitrogenous wastes
distinguish between active and passive transport and relate these to

processes occurring in the mammalian kidney
explain how the processes of filtration and reabsorption in the mammalian

nephron regulate body fluid composition.
perform a first-hand investigation of the structure of a mammalian

kidney by dissection, use of a model or visual resource and identify
the regions involved in the excretion of waste products

compare the process of renal dialysis with the function of the kidney.

Boards website at:
Water and wastes
Water is an extremely important substance as it acts as a solvent for many

substances in organisms. These dissolved substances can be involved in
chemical reactions within cells and can be transported within organisms.
Within animals, these substances are usually transported in blood whereas
in vascular plants they are carried in xylem and phloem sap.
Water balance
Many of these dissolved substances also determine the movement of
water within organisms and between cells due to osmosis. In many
animals the concentration of water and dissolved substances, especially
salts, in the fluids surrounding cells and in the blood must be maintained
within very narrow limits to prevent loss or uptake of water which could
result in damage to cells.
If water is not readily available, organisms may die as a result of not
having enough. On the other hand, excess water may need to be quickly
removed from organisms to maintain osmotic balance. To maintain their
water balance, organisms must match their water gains with their water
losses.
Some reactions involving water

Water is produced by some reactions in the bodies of organisms (for
example, cellular respiration) and required by others (for example,
photosynthesis). For revision, write an equation for each of these examples.
Cellular respiration
Photosynthesis
Check your answers.
Part 5: Excretion
A reminder about osmosis

Osmosis is the movement of water from where it is in higher
concentration to where it is in lower concentration through a selectively
permeable (sometimes called semi-permeable) membrane.
Osmotic is the word which describes things (an adjective) related to
osmosis. So for example, osmotic pressure is exerted by water when it
moves into cells. Movement of water from one cell to another, or
between organisms and their external environment due to concentration
differences, can be called osmotic movement. Remember that the
adjective osmotic always describes a situation where water is moving
from where water is in higher concentration (a more dilute solution) to
where water is in lower concentration (a more concentrated solution) and
where that movement is through a selectively permeable membrane.
movement of water
A concentrated solution has

a higher concentration of
solute (dissolved substance)
but a lower concentration
of water.
A dilute solution has a lower

concentration of solute but
a higher concentration
of water.
selectively
permeable
membrane
Wastes
Do you recall what metabolism means? The definition in the glossary
tells you that metabolism is all of the biochemical reactions occurring in
the cells of the body.
These reactions normally occur as a series of chemical reactions, which
is called a metabolic pathway. Each step in a metabolic pathway is
governed by a specific enzyme. Cellular respiration is one metabolic
pathway with which you are familiar. Many products of metabolic
reactions are wastes, which are normally eliminated from the body.
Some products of reactions in the body are in fact poisonous (toxic) and
must be broken down to less toxic substances or be very quickly
eliminated from the body.
In most vertebrate species the liver is responsible for producing many
waste products, due to enzymatic breakdown of potentially harmful
substances taken into the body or produced by metabolism. Organs
which remove these wastes are known as excretory organs. The two
main excretory organs in vertebrate animals are the respiratory surfaces
(lungs, gills) and the kidneys.
Some examples of waste products

The respiratory surfaces excrete the carbon dioxide formed during
cellular respiration (the final metabolic process in the breakdown of fats
and carbohydrates). The kidneys get rid of other metabolic wastes
including water and nitrogenous wastes. These nitrogenous wastes are
formed from the breakdown of materials which contain nitrogen,
particularly proteins.
Ammonia is a very soluble and very poisonous nitrogenous waste. It is
produced in tadpoles and in most fish and aquatic invertebrates that have
access to plenty of water to dilute it.
Terrestrial species produce nitrogenous wastes in the form of either urea
or uric acid. Both of these wastes are less toxic than ammonia.
Urea is fairly soluble in water; for example, it is a major waste in urine.
Urea is excreted by most mammals, adult amphibians, sharks and rays.
Since it needs to be diluted in water to reduce its toxicity, urine is a
source of water loss for these species.
Reptiles, birds and insects excrete a material called uric acid. It is very
insoluble (and the least toxic form of nitrogenous waste) and so needs
little water to get rid of it.
Part 5: Excretion
The table below compares some properties of the nitrogenous wastes

produced by terrestrial and aquatic organisms.
Comparing nitrogenous wastes
Excretory
product
Solubility
Toxicity
Example
ammonia
very soluble
very toxic
tadpoles, most fish,

aquatic invertebrates
urea
fairly soluble
less toxic
most mammals, adult

amphibians, sharks
uric acid
insoluble
least toxic
reptiles, birds, insects
Waste products (such as carbon dioxide, water and nitrogenous wastes)

must be removed from living cells to enable them to continue to
function normally. For example, an accumulation of carbon dioxide
would lead to changes in pH inside cells. You will recall that changes
in pH can bring metabolic processes to a standstill by denaturing
enzymes.
Accumulation of other wastes would cause water to move into cells by
osmosis, altering the water balance. Finally, some wastes, such as urea,
are toxic and so must be removed.
Some metabolic products are not necessarily directly detrimental.
Indeed, some are essential to cell functioning. However, the
concentrations of these substances must also be closely regulated as
they may produce conditions that also result in cell death. For example,
too much or too little salt can result in cell damage or the
malfunctioning of organ systems.
You read earlier about the importance of respiratory surfaces and kidneys
for removing wastes. However, these are not the only excretory organs.
For example, in mammals, some wastes are eliminated by the skin (for
example, salts, urea and lactic acid in sweat) and a few are got rid of
through the digestive system (for example, the breakdown products of
haemoglobin are added into faeces).
The diagram below summarises processes that produce wastes and

how these can be removed.
Cellular
respiration
CO2
respiratory
surface (gills
or lungs)
water
Other metabolic
pathways
kidney
nitrogenous
wastes
skin
(for example,
urea and
lactic acid)
other
metabolic
wastes
large
intestine
(for example,
products of
haemoglobin
breakdown)
Summary of modes of excretion.
Part 5: Excretion
Excretory systems
Different organisms have different kinds of excretory mechanisms for

removing their wastes.
In unicellular organisms, waste products are quickly lost into the
environment through the cell membrane by diffusion. This can occur
because each cell has a large surface area to volume ratio.
However, in multicellular organisms, complex excretory organs are
needed to provide the necessary surface area for the elimination of
wastes. You learnt about these in the Preliminary course. The relevant
sections have been reprinted for you in the Additional resources at the
back of this part.
A review of respiratory and excretory systems

Scan the Additional resources to refresh your memory. Read any sections
that are unfamiliar. Then you can check your knowledge of the roles of
respiratory and excretory systems by competing the tasks below.
Respiratory systems
1
Explain why a fish out of water cannot obtain enough oxygen from
the air to survive, although there is much more oxygen in air than is
ever found in water.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Insects have evolved a completely different system for gaseous

exchange than is found in terrestrial vertebrate species.
a) Briefly describe the structure of this system.
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
b) Briefly explain how it works.
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
c) There are no insects anything like the size of any terrestrial
vertebrate animals. With respect to their gaseous exchange
(respiratory) system, suggest a reason why insects are restricted
in body size.
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
Part 5: Excretion
On the following diagram of the respiratory system of a mammal,

label the parts listed in the table and then complete the table by
inserting a description of the function of each part. The first row in
the table has been completed for you as an example.
Fill in the missing labels below.
nose
trachea wall
magnified
epiglottis
to the stomach
bronchus
bronchiole
rib
right lung
showing
lobes
left lung
diaphragm
from pulmonary
artery
10
air
to pulmonary
vein
Structure
Function
nasal cavity
warms incoming air, removes dust particles and cools and

condenses moisture in outgoing air so that it is reabsorbed
back into the capillaries lining the cavity
trachea
alveolus
(plural is alveoli)
capillaries
cilia
Part 5: Excretion
11
Excretory systems
4
Briefly describe the excretory system of an animal other than a

mammal.
______________________________________________________
______________________________________________________
______________________________________________________
Complete the following table showing the functions of various parts

of the mammalian urinary system.
Structure
Function
kidney
ureter
bladder
urethra
Check your answers.

Now complete Exercise 5.3.
12
Dissection of a mammalian kidney

If you dissected a kidney during the Preliminary module called Patterns
in Nature, you need only to refer back to that module. However, if you
did not do the dissection then, you really need to do it here.
You can use a model or a video if you have access to one but it is not
much trouble to buy a sheeps kidney from the local butcher and dissect
it yourself. (A sheeps kidney is very similar to a human kidney, except
that a sheeps kidney is smaller.)
If you know the local butcher, you could ask for a kidney in the fat.
The kidney is embedded in fat to hold it in place in the body and this also
acts to protect it. When the kidney is removed at the abattoir or when the
fat is trimmed away, the ureter and blood vessels are usually cut off too.
If you can get a kidney that has not been trimmed, you can carefully pick
the fat away and you are more likely to see the ureter and blood vessels.
Ask the butcher to give you some idea of the weight of the sheep from
which the kidney was taken. How heavy is a kidney? Although kidneys
are very important organs, they are quite small compared with the size of
the animal.
Materials required:
sheeps kidney
small kitchen knife
cutting board or plate
knitting needle or similar
newspaper.
What to do:
1
Observe the shape of the kidney.
Observe the protective outer layer of skin, called the capsule.
Identify the three tubes which enter the kidney. These are not easy
to see because they are all connected together with tissue and may
have been cut off the kidney you have. Also, there is a lot of fat
where they are connected to the kidney. The three tubes are:
a) the ureter, which is the large tube in the centre
b) the renal artery, which has a thick wall
c) the renal vein, which has a thinner wall.
Part 5: Excretion
13
To observe the internal structure of the kidney, cut through the kidney
lengthwise, carefully cutting away from your fingers.
Now look inside. You will notice a funnel-shaped structure with a hole
in the centre. This hole leads into the ureter. Take an object like a
knitting needle and push it gently through the opening. Discover where
the ureter leaves the kidney.
Continue cutting down to open up the kidney as shown in the

photograph below.
capsule
cortex
medulla
pelvis
ureter
The internal structure of a sheeps kidney.
14
Find the following structures:
the brown outer layer, or cortex. This is where the waste

substances are squeezed out through the membranes of the
glomeruli into the Bowmans capsules
an inner pink layer of medulla. Here, water and some salts are
reabsorbed into the blood from the tubules of the nephrons
a hollow whitish region. This is the pelvis of the kidney where

large collecting tubes empty urine into the funnel-shaped
beginning of the ureter.
On the following page, draw a fully labelled diagram of the dissected

kidney.
Diagram of a dissected kidney
Functioning of a mammalian kidney

You have revised some information about how kidneys work from the
Additional resources. Before investigating the functioning of the kidney
in more detail, you need to quickly revise your understanding of the way
materials move into and out of living cells.
A review of osmosis, diffusion and active transport

Since particles in matter are constantly moving, materials move from
where they are more concentrated to where they are less concentrated;
this is diffusion. If the diffusion of water occurs through a selectively
permeable membrane, the process is called osmosis.
However, living cells can make substances move from where they are
less concentrated to where they are more concentrated by using energy;
this is called active transport. Active transport may also involve changes
in the structure of the membranes, thus permitting materials to be moved
against the concentration gradient.
As you will see, all of these processes diffusion, osmosis and active
transport are very important in the functioning of the kidney.
Part 5: Excretion
15
Try this short quiz to test your knowledge of these substance-moving

processes.
1
Osmosis is a special case of diffusion because it:

A
involves the movement of water only
involves the movement of water only and always occurs through

a membrane
occurs in plants only where the cell wall prevents cells from
bursting
occurs in plants and animals but not in microorganisms.
Diffusion occurs in:

A
liquids, gases and solids
liquids, gases and solutions
liquids and solutions only
liquids and gases only.
The energy necessary for osmosis and diffusion is due to the:

A
size of the particles involved
process of cellular respiration
number of particles present
movement of the particles involved.
Active transport occurs in:

A
solutions, liquids and gases
all cells
living cells
animal cells but not in plant cells.
Check your answers.

How did you go? Now that you are familiar with the structure of the
kidney and the mechanisms responsible for movement of particles in
organisms, the information below about the functioning of the kidney
should be much easier to follow.
16
The functional units of the kidney nephrons

The diagram below shows the structure of the kidney and its blood
supply. (Turn back to check that you correctly labelled your diagram of
a dissected kidney.)
medulla
cortex
renal vein
renal artery
ureter
The following diagram shows the position of tiny structures, called

nephrons, which make it up the kidney.
position of
nephon
There are around 1.2 million of these nephrons in each of your kidneys,
making a surface area of approximately 12 m2 in humans. The great
surface area created by so many nephrons in the kidney makes it efficient
in carrying out its two important functions. These are:
excretion the elimination of harmful and unwanted products of

metabolism
osmoregulation the control of body water and salt levels.
The kidneys also have some role in regulating blood pH by the secretion
of H+ ions into the nephron by active transport.
Part 5: Excretion
17
An individual nephron is shown below, where the parts are named and
the complex blood capillary network associated with each nephron is
shown. The Bowmans capsule and the proximal and distal tubules are
found in the cortex, which you will remember from your dissection is the
outer dark brown-coloured layer of the kidney. The loop of Henle and
the collecting tubule (or collecting duct) protrude down into the medulla,
which is the the lighter-coloured part towards the centre of the kidney.
glomerulus
proximal
tubule
distal
tubule
branch of
renal artery
Bowmans
capsule
branch of
renal vein
collecting
tubule
loop of
Henle
capillaries
A mammalian nephron.
Each part of the nephron has an important role in the filtration of blood
and the osmoregulation of the animal.
renal artery brings blood containing small particles, including
nitrogenous wastes (especially urea), water, salts, glucose and amino
acids to the kidney
glomerulus blood passing through the glomerulus is under high
pressure. Substances are forced out of the blood in this knot of
capillaries into Bowmans capsule. The process is largely governed by
the size of the pores in the membranes of the capillaries and Bowmans
capsule, which let small molecules and ions through but prevent the
movement of larger molecules (such as large proteins) and blood cells.
Bowmans capsule a cup-shaped structure surrounding the glomerulus
that collects materials forced out of the blood
18
proximal tubule, loop of Henle and distal tubule these structures are
joined together, making a long, very thin tube. As the substances filtered
from the blood travel through this tube, useful substances are reabsorbed
back into the blood in the capillaries surrounding the tube. This involves
active transport. Most of the glucose and amino acids are reabsorbed in
this way. Water and salts are reabsorbed in these parts of the nephron.
The process of reabsorption involves both the movement of materials,
especially ions, by active transport and the movement of water by osmosis
collecting tubule (or collecting duct) materials remaining after
reabsorption are the wastes that move into the collecting tubule. As these
wastes move through the tubule, more water is taken back into the
bloodstream from the tubule. The waste in the collecting tubule is urine,
which is passed down into the pelvis of the kidney
renal vein capillaries that surround the proximal tubule, loop of Henle
and distal tubule join together into the renal vein. This blood vessel
carries blood that has been cleaned by the nephron back into the bodys
circulation.
So, in summary, osmoregulation and excretion by nephrons in the kidney
are accomplished by the production and elimination of urine. Urine is
produced by:
filtration of many substances, both wastes and useful ones, from the
blood (at the glomerulus/Bowmans capsule)
reabsorption of useful substances into the blood (at the tubules and
loop of Henle).
Diffusion, osmosis and active transport in a nephron

Substances move from the blood into the Bowmans capsule because of
the high pressure of the blood through the glomerulus. But why do
substances move from the tubules back into the blood?
Some substances can move by diffusion, because there is a lower
concentration of them in the blood and a higher concentration in the
tubule. However, once the concentration difference between the blood and
various parts of the nephron is balanced, energy must be used to move
useful substances, such as glucose and amino acids, back into the blood.
Since active transport is used, the body can determine the amount of each
substance that is reabsorbed. For example, all glucose will be reabsorbed
but only some salt. In this way, the amount of substances including salt
and water reabsorbed is precisely controlled to balance water and salt
intake and losses, so that the composition of blood and fluid surrounding
cells is maintained at a constant level. This process is controlled by the
endocrine system and will be discussed later.
Part 5: Excretion
19
A summary of filtration and reabsorption in a nephron

The following table summarises the functioning of the kidney by
indicating the general composition of the fluid which enters Bowmans
capsule (sometimes called the filtrate) and the fluid which eventually
drains out of the collecting tubules into the renal pelvis (the urine).
This shows that, for the most part, active transport is used to pump useful
materials back into the bloodstream, rather than specifically pumping
undesirable substances into the nephron.
Material
Bowmans capsule
(filtrate)
Renal pelvis
(urine)
nitrogenous wastes
(mainly urea)
yes
yes
glucose
yes
no
amino acids
yes
no
salts (ions)
yes
variable amount
water
yes
variable amount
large proteins
no
no
blood cells
no
no
Turn back to the diagram of the nephron in this section and label:
where filtration and reabsorption occur
some substances that are reabsorbed from the tubules into the blood
the wastes that leave the collecting tubule as urine.
Check your answers.

20
What can be done when kidneys dont

function?
In people who have impaired kidney function, waste products can be
removed from their blood using a process called renal dialysis. The
blood of the patient is passed through a coil separated by a membrane
from a salt (saline) solution which has the same concentration as the
blood (called a dialysing solution).
The dialysis membrane is permeable to water and to nitrogenous and
other waste products of metabolism, especially urea. For 45 hours
about three times a week, the blood of the patient is circulated through
the haemodialysis machine depicted in the diagram below.
artery
to dialyser
superficial
vein
dialyser
membrane
from
dialyser
bubble trap
fresh
dialysing
solution
constant
temperature
bath
used
dialysing
solution
Haemodialysis machine.
Dialysis can also be carried out within the body by a process known as
peritoneal dialysis. In this instance, a saline solution is passed into the
body cavity (peritoneum) of the patient by a catheter (fine tube). Wastes
diffuse from the body fluids and pass through the membrane that lines
the peritoneum into the saline solution, which is then drained out by
another catheter. This process avoids the necessity to circulate the blood
from the patients body, with the possible risk of blood clotting and
infection.
Part 5: Excretion
21
Comparing renal dialysis with normal kidney function

Refer to the diagram of the haemodialysis machine and use your knowledge
from throughout this module to deduce answers to the following.
1
Explain the reason for the constant temperature bath in the machine.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
The membrane in the haemodialysis machine is equivalent to which

part of the nephron of the kidney?
A
the membrane of the tubule
the membrane of Bowmans capsule
the capillaries surrounding the nephron
the walls of the collecting tubules
State a reason for your selected answer.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
3
Explain why the dialysing solution has the same salt concentration
as blood.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
22
Suggested answers
Some reactions involving water

Cellular respiration
glucose
+ oxygen
C6H12O6 +
6O2
many enzyme
controlled steps
many enzyme
controlled steps
carbon + water + energy

dioxide
6CO2 + 6H2O + energy
Photosynthesis
carbon
dioxide
water + light
energy
6CO2
6H2O + light
energy
many enzyme
controlled steps
many enzyme
controlled steps
glucose + oxygen
C6H12O6 +
6O2
C6H12O6 +
6O2
or
6CO2
+ 12H2O + light
energy
many enzyme
controlled steps
+ 6H2O
A review of respiratory and excretory systems

1
Gill filaments float in water to maintain their large surface area in

contact with the water. In air this surface area is reduced as the gill
filaments collapse together.
Water movement over the gills is continuous and in one direction
this maintains the concentration difference in gases between the
water and the gill capillaries. This movement would not occur in air.
Moisture is necessary for gaseous exchange. The gill filaments
would be directly exposed to the air and so would dry out.
Part 5: Excretion
23
a) The tracheal system consists of a series of branching tubes (the

trachea and tracheoles) open from pores (spiracles) in the
impervious external covering of the insect (exoskeleton).
b) Gases enter and leave the body through openings called
spiracles. The gases diffuse through tubes, called trachea, which
subsequently divide into finer branches (tracheoles). Gases are
exchanged into fluid at the ends of the tracheoles, which are
finely divided enough to come close to most body cells.
Muscular activity in movement helps to move gases in and out
of the tracheal system.
c) The surface area of the tracheal system is not large enough and
the transport system not efficient enough to distribute oxygen
and pick up carbon dioxide for a large animal with a small
surface area to volume ratio.
nose
nasal cavity
trachea wall
magnified
epiglottis
cilia
to the stomach
trachea
bronchus
bronchiole
rib
right lung
showing
lobes
left lung
dissected to
show
internal
diaphragm
from pulmonary
artery
air
to pulmonary
vein
cluster of
alveoli
capillaries
24
Structure
Function
nasal cavity
warms incoming air, removes dust particles and cools and

condenses moisture in outgoing air so that it is reabsorbed
back into the capillaries lining the cavity
trachea
rings of cartilage keep this tube open to permit air to pass to

and from the lungs
alveolus
(plural is alveoli)
thin-walled air sacs which increase the surface area for

gaseous exchange
capillaries
provide a large surface area for gaseous exchange of oxygen

and carbon dioxide between the alveoli and the bloodstream
cilia
move mucus, which contains trapped dust and

microorganisms, out of the lungs and into the throat
Answers will vary. For example, you may have outlined the
excretory system of a fish, a bird or an insect.
5
Structure
Function
kidney
produces urine which contains metabolic waste products and

regulates the amount of salt and water lost from the body
ureter
transports urine from the kidney to the bladder
bladder
stores urine before periodically getting rid of it from the body
urethra
tube which transports urine from the bladder to the outside of

the body
A review of osmosis, diffusion and active transport

1
Part 5: Excretion
The energy of movement of the particles is responsible for the

movement. This energy (kinetic energy) increases with temperature.
It is not supplied by the cells themselves through respiration.
25
A summary of filtration and reabsorption in a nephron

Here is a sample answer.
salts (such as NaCl, HCO3 and K+)
nutrients and water
many substances
from blood
salts, nutrients
and water
H+ (to balance pH)
FILTRATION
salts,nutrients
and water
urine (water, urea and salts)

REABSORPTION
Comparing renal dialysis with normal kidney function
26
If the constant temperature bath were not used to keep the solution at
body temperature, the blood would lose heat to the solution in the
core and the patient could become hypothermic (have a body
temperature below normal).
B is correct. The membrane of Bowmans capsule is the equivalent

structure in the nephron, where filtration occurs. Remember that
reabsorption occurs in the other parts of the nephron.
If the solution had a higher salt concentration than blood, the patient
would lose water into the solution by osmosis. If it were less
concentrated, water would pass into the patients blood by osmosis
through the membrane.
Here is a description of respiratory and excretory systems in a variety of

animals, extracted from the Preliminary course module called Patterns in
nature Sets 5 and 6.
Fish
Most fish use gills for gaseous exchange. Gills are external structures
they hang outside the main body cavity and often have a protective cover
over them. Gills have a large surface area because they are thin and
highly folded.
The structures involved in gaseous exchange in a fish.
Source: Brocklehurst, KG and Ward, H. (1958.) General School Biology.

The English Universities Press Ltd. London.
Part 5: Excretion
27
Water enters a fishs mouth and passes over its gills. When most fish are
stationary they gulp water to maintain the flow over the gills. This also
explains why so many fish (sharks included) swim with their mouth open
this allows water to pass into the mouth and over the gills without the
need to gulp water.
Gases are exchanged between the surrounding water and the fish on the
gill surface. The gases enter the circulatory system to be transported to
cells throughout the body. The main blood vessels entering the gills
branch into tiny tubes called capillaries.
The capillaries are very close to the gill surface. It is the colour of the
blood in the capillaries that makes gills appear red. Capillaries, being
tiny and numerous, make the surface area to volume ratio for diffusion of
gases very high in the gills.
Frogs
Frogs have two methods of gaseous exchange: gaseous exchange via the
lungs and gaseous exchange via the skin. The diagram below shows the
structures involved.
The structures involved in gaseous exchange in a frog.
Source: Brocklehurst, KG and Ward, H. (1958.) General School Biology.

The English Universities Press Ltd. London.
Gaseous exchange via the lungs

Lungs are internal organs involved in gaseous exchange. The gaseous
exchange surfaces of terrestrial organisms are usually internal to prevent
desiccation (drying out). You will have noticed that the gaseous exchange
28
surfaces of insects (also terrestrial) are internal too. Frogs ventilate their
lungs by positive pressure breathing. This means that they force air into
the lungs. This method of breathing is very different from the negative
pressure breathing seen in mammals.
Unlike human nostrils which stay open all the time, frogs are able to
open and close their nares (nostrils). To breathe, a frog:
closes its mouth and opens its nares
lowers the floor of the mouth which causes air to be sucked into
the mouth cavity
closes the nares (nostrils)
raises the floor of the mouth.
This forces the air from the mouth into the lungs.
Lung structure of a frog

The internal structure of a frog lung is not too dissimilar to a human lung.
Air enters the lungs and then moves through a series of branching tubes.
The tubes become smaller and smaller as they branch. (This is becoming
a familiar theme for gaseous exchange). The finest tubes are in close
association with capillaries (small blood vessels). Gases diffuse into and
out of the blood at these sites. Waste gases diffuse out and oxygen
diffuses in.
Like fish, the circulatory system delivers the gases to cells. The
circulatory system also receives waste gases from cells and delivers them
to the lungs.
Gaseous exchange via the skin

The skin of a frog is thin and is kept moist by the habitat in which the
frog lives. The skin is permeable to water (unlike human skin) and frogs
dehydrate rapidly if they are not kept in a moist environment. This is
why you find frogs in moist locations.
Gases from the atmosphere can dissolve into the moisture on the skin.
From there the gases can diffuse into capillaries beneath the skin. The
skin does not exchange sufficient gases for all of a frogs needs.
However, the gaseous exchange is important and allows the frog to
remain submerged for longer than if it had to depend upon lungs alone.
While submerged, gaseous exchange occurs on the frogs skin between
gases dissolved into the surrounding water and the frog.
Part 5: Excretion
29
Mammals
Mammalian lungs are internal. This helps to reduce the loss of water and
heat through these structures since they have a high surface area to
volume ratio.
To get air into the lungs, a mammal lowers the air pressure in the lungs.
When the air pressure in the lungs is lower than the surrounding
atmosphere, air enters via the nose.
To remove air from the lungs, mammals increase the pressure of the air
in the lungs. When air pressure in the lungs is higher than the
surrounding atmosphere, air moves out of the lungs.
Air enters the body through the nostrils. The nasal cavity warms the air
and filters it to remove dust. The air then moves into the throat region or
pharynx. It enters the largest air tube the trachea through an opening
called the glottis. The epiglottis is a flap of tissue that closes over the
glottis and stops food going down the wrong way when you swallow.
nose
nasal cavity
trachea wall
magnified
epiglottis
cilia
to the stomach
trachea
bronchus
bronchiole
rib
right lung
showing
lobes
left lung
dissected to
show
internal
diaphragm
from pulmonary
artery
air
to pulmonary
vein
cluster of
alveoli
capillaries
Structures involved in the exchange of gases in humans.
30
The upper part of the trachea is the larynx, or voice box, which contains
your vocal cords.
The trachea branches into two bronchi (singular is bronchus). Each
bronchus branches into smaller air passages called bronchioles and these
end in very thin-walled alveoli (singular is alveolus). Blood capillaries
are wrapped closely around alveoli. The following diagram shows how
gases are exchanged between air in alveoli and blood in capillaries.
blood from body
(low in oxygen, high in carbon dioxide)
blood capillary
wall of alveolus
air inhaled
air exhaled
carbon dioxide
oxygen
blood cell
blood to rest of body

(high in oxygen,
low in carbon dioxide)
Movement of material at an alveolus.
It has been estimated that the total surface area of the alveoli of an adult
male is about one third the area of a tennis court. A large surface area
obviously allows for a greater quantity of gases to be exchanged. The
thinness of the walls of the alveoli allows for rapid diffusion of oxygen
into the blood and carbon dioxide out of the blood. The moisture in the
alveoli walls allows the gases to dissolve.
Part 5: Excretion
31
Composition of inhaled and exhaled air is shown in the table below.

Gases
Inhaled air
Exhaled air
oxygen
21%
16%
carbon dioxide
0.04%
4%
nitrogen
about 80%
about 80%
water vapour
varies according to the

humidity of the air
more than in inhaled air
Air passages
Rings of cartilage keep the trachea and bronchi open and prevent them
closing when the air pressure inside the body falls. The lining, or
epithelial, cells of the air passages have numerous cilia. These minute
hair-like projections sweep to and fro.
Mucus is secreted by special gland cells, also present in the lining cells.
Dust particles and bacteria in the air are trapped by the mucus film. The
movements of cilia sweep them away in the mucus to the larynx then the
mucus is swallowed or coughed up.
Nasal hairs and mucus also trap dust and foreign particles.
Around the lungs is a membrane, the pleural membrane, which covers
the outside of the lungs and the inside of the chest cavity. It contains a
fluid which lubricates the surface so that there is no friction between the
tissues during breathing movements.
The mechanism of breathing

In mammals, breathing refers to the movements of the chest that result in
air entering and leaving the lungs.
The movement of air in and out of your chest is brought about by
changes in the pressure of the air in the chest cavity. This pressure varies
because the volume of the chest cavity varies. The chest cavity is airtight
and enclosed by ribs with intercostal muscle between them. At the base
of the chest cavity is the diaphragm. The diaphragm is the muscular
sheet which separates the chest (also called thorax) and abdomen.
32
At rest, the diaphragm is curved upwards. The intercostal muscles relax

at the same time and the ribs move downwards and inwards. These
collapsing movements reduce the size of the chest cavity, increase the
pressure of the air in the lungs and thus force it out.
During inhalation, the diaphragm contracts and flattens, being more
taunt, or tight. At the same time, the intercostal muscles contract and
move the ribcage up and outwards. This increases the volume of the
chest cavity and reduces the pressure of the air in it. Thus, air moves into
the lungs.
You can check these movements by placing your fingers over your
ribcage as you inhale and exhale.
Excretion in mammals
There are a number of wastes produced in the body as a result of the
many chemical changes occurring. Some metabolic wastes are:
water
carbon dioxide
urea.
The removal of wastes from metabolic processes in cells is called

excretion.
Metabolic wastes
Water is continually formed in cells as a result of respiration.
The generalised equation for respiration is:
glucose + oxygen water + carbon dioxide + energy
Water
Water is excreted from the body by way of the kidneys, lungs and skin.
You can see that exhaled air has a lot of water vapour. If you blow onto a
cold mirror surface, a film of water droplets forms. This is the exhaled
water vapour which has changed from a gas to a liquid.
This effect (called condensation) is also seen on windows inside cars as
they mist up when the windows are up and the glass is cold. This mist is
mostly exhaled water vapour which has condensed to form a liquid.
Demisters are used to warm up the cold glass and prevent water vapour
Part 5: Excretion
33
from condensing as a liquid. These observations can be used as evidence

that water is excreted from the lungs as water vapour (a gas). A person
may lose up to 400 mL of water from the lungs in a 24 hour period!
Water vapour and carbon dioxide pass through the capillary walls where
they are in close contact with the alveoli of the lungs. The alveoli are
extremely thin walled and have a large surface area of about 70 m2.
About one third of our waste carbon dioxide is carried by the red blood
cells; the rest is carried in blood plasma. A certain amount of carbon
dioxide is necessary. It not only helps to keep the breathing processes
going but also is important in maintaining the right blood acidity.
Too much carbon dioxide, however, is harmful because it can interfere
with chemical changes and also prevent oxygen from reaching the cells.
Since there is a large moist surface area in the lungs, a certain amount of
water is lost by evaporation into the air spaces. Heat is also lost from the
body by means of the air breathed out of the lungs. This helps to maintain
a constant body temperature.
Most of the urine which is excreted from the kidneys is water. Urine also
contains urea and excess salts.
Urea
Urea is a nitrogenous waste which has the formula CO(NH2)2. It is
formed from the breakdown of amino acids in the liver. This chemical
change is referred to as deamination. Urea, which is soluble in water, is
carried away from the liver in the blood and is eventually excreted by the
kidneys.
The urinary system

The human urinary system is shown on the next page. It includes the
kidneys, ureters, urinary bladder and urethra. Its function is to remove
urine from the body.
Urine is the fluid which contains water, urea, some salts and other
substances. These substances are metabolic wastes which could be
harmful, if not removed regularly from the body.
The formation of urine in the kidneys is a remarkable process. Each kidney
in a human contains about one million filtering units called nephrons.
34
pelvis
ureter
(a long tube)
bladder
(a storage sac)
muscle
urethra (tube leading out
of the body)
Human urinary system.
The nephron
The nephron filters blood. Each nephron consists of three major parts:
Bowmans capsule
glomerulus
loop of Henle.
Blood, under pressure from the contraction of the heart, passes into the
twisted capillary known as the glomerulus. Most substances in the
capillary are literally squeezed out through membranes, due to the
pressure, into Bowmans capsule.
The substances removed from the blood in this part of the nephron
include urea, water, various salts and glucose. Substances which are not
removed include the blood cells and plasma proteins. These substances
are larger and do not usually pass through the blood capillary wall.
As the substances removed from the blood pass along the loop of Henle,
glucose and some of the salts and water are reabsorbed into the blood.
There are various regulatory processes which determine how much water
and salt are reabsorbed. The water and urea which remain in the tubule
pass eventually into the ureter. From there they pass to the muscular
urinary bladder where urine is stored before being finally excreted
through the urethra.
Part 5: Excretion
35
The renal artery carries blood into the kidneys, while the filtered blood
leaves the kidneys via the renal vein.
The kidneys have two important functions.
Firstly, they get rid of metabolic wastes, in particular, urea which is

moderately toxic.
Secondly, the kidneys, by their filtration and reabsorption, keep the

amount of water and concentration of salts (ions such as potassium
and calcium) fairly constant in the blood.
This maintenance of fairly constant conditions in the body is referred to

as homeostasis. The kidneys play an important role in achieving this.
Summary
Metabolism is the name given to describe the sum total of chemical

changes in the body.
Chemical changes include respiration, digestion and deamination.
Wastes produced include water, carbon dioxide and urea.
The removal of metabolic wastes is called excretion. (Defaecation is the

removal of substances from the digestive tract, which are not formed by
metabolic processes but rather are the unused remains of food.)
Waste water is excreted from the lungs, skin and kidneys.
Waste carbon dioxide is excreted by the lungs.
Urea is a soluble nitrogenous chemical formed from the deamination

of amino acids in the liver. It is excreted by the kidneys.
The urinary system includes the kidneys, ureters, urinary bladder and
urethra.
The filtering units in the kidneys are the nephrons. Each nephron
consists of a Bowmans capsule, glomerulus and loop of Henle.
Wastes are passed through membranes out of the twisted capillary,

or glomerulus, by pressure. The wastes include urea, water and
salts, collectively called urine. (Blood cells and plasma proteins are
too large to pass through the same membranes.)
The renal artery carries blood to the kidneys while the renal vein
carries the filtered blood away from the kidneys.
The kidneys:
a) remove metabolic wastes such as urea
b) help regulate the amount of water and salts in the blood.
36
The maintenance of constant conditions in the body is called

homeostasis.
Removal of wastes in fish

The diagram below illustrates some adaptations that fish have to survive
in salt and fresh water. Excess salt is removed by special cells located on
the gills.
water and salts
salts
water
salts
isotonic urine
salts
Saltwater fish
(hypotonic relative to medium)
water
dilute urine
Freshwater fish
(hypertonic relative to medium)
Salt and water exchange in fish.
Removal of wastes in insects

Malpighian tubules
rectum
midgut crop
hindgut (intestine)
salivary gland
Organs of a grasshopper.
The grasshopper is an example of an insect. The excretory organs of

insects are called the Malpighian tubules located between the midgut
and the hindgut. They are bathed in blood directly from the open
circulatory system. Fluid is absorbed from the blood into the tubules,
nitrogenous material is precipitated as uric acid and much of the water
and salt is reabsorbed. The concentrated material is then passed into the
hindgut and then into the rectum. Any water that remains in the material
is now reabsorbed and the urine and faeces leave the rectum as very dry
material.
The insect rectum is very efficient at reabsorbing water. It is very similar
to that of the cloaca of birds and some vertebrates, where the water is
almost completely removed from the waste, leaving uric acid to be
eliminated as a nearly dry powder or hard mass.
Part 5: Excretion
37
38
Exercises Part 5
Name: _________________________________
Exercise 5.1: Water balance

What is the solvent for metabolic reactions in living cells? __________
Why is it important that the concentration of this solvent remains
constant in living cells? (What might happen if it did not?)
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 5.2: Some examples of waste products

a)
Metabolic processes constantly produce wastes such as carbon

dioxide, nitrogenous wastes and water. Why is it essential for
continued metabolic activity that these wastes are removed from
cells?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 5: Excretion
39
b) Three forms of nitrogenous wastes are ammonia, urea and uric acid.
Construct a table to compare the toxicity; the relative amount of
water needed for dilution and examples of groups of animals that
excrete these forms of wastes.
Exercise 5.3: A review of respiratory and excretory

systems
Simple organisms, such as unicellular animals, are able to rely on
diffusion and osmosis to remove wastes such as nitrogenous wastes and
water. However, multicellular organisms, such as mammals, require
complex organs and body systems for excretion.
Explain why the processes of diffusion and osmosis are inadequate in
removing dissolved nitrogenous wastes from multicellular organisms.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
40
Exercise 5.4: A summary of filtration and

reabsorption in a nephron
a)
Why do substances move out of the blood into Bowmans capsule at

the glomerulus?
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Why do substances move out of the tubules and loop of Henle into
the blood in the surrounding capillaries? (Discuss osmosis and
active transport in your answer.)
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
List five substances that are filtered from the blood at the nephron.
Then circle the ones that are reabsorbed.
_____________________________________________________
_____________________________________________________
_____________________________________________________
d) Explain how filtering then reabsorbing some substances enables the

kidney to control the composition of body fluids, such as blood.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 5: Excretion
41
Biology
HSC Course
Stage 6
Part 6: Maintaining water balance
Contents
Introduction ............................................................................... 2
Hormonal control of body fluid composition............................... 4
Antidiuretic hormone ............................................................................4
Aldosterone...........................................................................................6
Osmoregulation ......................................................................... 8
In other animals ....................................................................................8
Adaptations for demanding environments ........................................13
Adaptations for changing environments............................................18
Exercises Part 6 ................................................................... 29
Introduction
So far in this module, you have been studying the internal mechanisms that
are responsible for maintaining the balance in organisms. In this part you
will move out into the external environment of organisms, to look at some
adaptations they have evolved to sustain life in different ecosystems.
identify the role of the kidney in the excretory system of fish and
mammals
outline the role of the hormones, aldosterone and ADH

(vasopressin), in the regulation of water and salt levels in blood
define enantiostasis as the maintenance of metabolic and

physiological functions in response to variations in the environment
and discuss its importance to estuarine organisms in maintaining
appropriate salt concentrations
describe adaptations of a range of terrestrial Australian plants that

assist in minimising water loss.
gather, process, analyse and present information to outline the

general use of hormone replacement therapy in people who cannot
secrete aldosterone and use available evidence to discuss the
importance of this therapy
perform a first-hand investigation to gather information about

structures in plants that assist in the conservation of water

compare and explain the differences in urine concentration of
terrestrial mammals, marine fish and freshwater fish
process and analyse information from secondary sources and use

available evidence to explain the relationship between the
conservation of water and the production and excretion of
concentrated nitrogenous wastes in a range of Australian insects and
terrestrial mammals

available evidence to discuss processes used by different plants for
salt regulation in saline environments

available evidence to assess the impact of urban development on the
health of aquatic organisms inhabiting these waterways.

Boards website at:
Hormonal control of
body fluid composition
In Part 5, you learnt about the functioning of the kidneys to control

excretion of wastes and osmosregulation. In Part 6, you will learn about
how osmoregulation occurs due to coordination by the endocrine system
(hormonal system).
Two hormones are involved in the regulation of the levels of salt and
water in the body. These are:
antidiuretic hormone (ADH) and
aldosterone.
Antidiuretic hormone
Antidiuretic hormone (ADH, sometimes also called vasopressin) is
secreted by the posterior pituitary gland and acts mainly on the collecting
tubules (collecting ducts) of the kidneys. It makes these tubules more
permeable to water so that more water is reabsorbed back into the
bloodstream meaning that less is lost in the urine. The result of ADH is
to make urine more concentrated, since it contains less water but the
same amount of urea.
If the water level in the blood is lower than normal, this is detected by the
hypothalamus in the brain, which in turn stimulates the secretion of
ADH. If the water level in the blood is higher than normal, the
hypothalamus inhibits secretion of ADH. This is a feedback system
which regulates body water levels in response to water intake and loss.
The diagram below shows the feedback system controlling the regulation
of body fluid concentration by antidiuretic hormone.
stimulate
posterior pituitary
to secrete ADH
increased
reabsorption of
water by collecting
ducts in kidneys
receptor cells in
hypothalamus
RESPONSE TO
WATER LOSS
lowered blood
water level
increased blood
water level
homeostasis
of blood
fluid level
increased blood
water level
decreased blood
water level
RESPONSE TO
WATER INTAKE
decreased
reabsorption of
water by collecting
ducts in kidneys
receptor cells in
hypothalamus
inhibit secretion of
ADH by pituitary
Hormonal regulation of body fluid levels by ADH.
Aldosterone
Aldosterone is secreted by the adrenal gland, which is a small structure
on top of each kidney. This gland consists of two parts the cortex and
the medulla. Steroid hormones with a variety of functions are secreted
by the cortex, while the medulla secretes adrenalin.
Aldosterone is a steroid hormone from the cortex of the adrenal gland
and its primary function is to increase the reabsorption of sodium ions
(Na+) or potassium ions (K+) in the loop of Henle and distal tubules of
the nephron. For example, if Na+ ions are in lower than normal
concentration in the blood, less sodium is excreted as these ions are
moved from the nephron into the surrounding capillaries by active
transport and water also moves as a result of osmosis. This increases the
blood volume and so maintains blood pressure, as well as the sodium ion
levels of the body fluids.
Maintenance of blood pressure is essential to the efficient transport of
materials around the body and in the functioning of many organs,
including the kidneys themselves. Blood pressure determines the
filtration rate from the glomerulus into the Bowmans capsule of the
nephrons of the kidney.
Aldosterone secretion is also controlled by a feedback system, but this
system is complicated by a number of influences on the action of the
adrenal cortex, including the secretion of hormones from the pituitary.
The system is much more complex than the regulation of body water
involving ADH.
However, in general terms, changed secretion rates of aldosterone in
response to changes in the ionic composition of the blood and/or in blood
pressure act to maintain homeostatic control of blood pressure and ionic
composition of the body fluids.
Do Exercise 6.1.
Adrenal cortex hormone replacement therapy

Although their incidence is not high, a number of medical conditions can
affect the normal functioning of the part of the adrenal gland (the adrenal
cortex) which produces the hormone aldosterone. Conditions which
affect the adrenal cortex directly are relatively uncommon and
functioning of this part of the adrenal gland is more often impaired by
diseases or medications which affect the adrenal cortex indirectly, often

through the action of the pituitary. The pituitary produces a hormone
that influences the secretion of hormones from the adrenal cortex,
including aldosterone.
Addisons disease is a disease affecting the adrenal cortex. It can be
caused as a result of tuberculosis, but often appears to have an
autoimmune basis. John F. Kennedy, the former president of the United
States who was assassinated in 1963, had Addisons disease. People
suffering from this disease produce insufficient levels of all adrenal
cortex hormones and require multiple hormone replacement therapy,
including a synthetic form of aldosterone (fludrocortisone).
All of the hormones secreted by the adrenal cortex are steroids and are
produced from cholesterol. They include:
hormones which are involved with the metabolism of fats and

protein to increase blood sugars and liver glycogen. They appear to
be involved in coping with long-term stress in animals
hormones involved in the control of blood pressure and body fluid

composition, especially aldosterone
certain sex hormones whose exact functions are unknown, but are
probably involved in the development of secondary sexual
characteristics, such as body hair in males.
You now know a lot about the processes of excretion and osmoregulation
in mammals, but what about other organisms?
Osmoregulation
Both plants and animals need adaptations and mechanisms for

maintaining stable concentrations of water and salts.
In other animals
Consider osmoregulation in fish and other animals, and some specialised
adaptations of Australian animals for conserving water.
Osmoregulation and excretion in fish

Fish use lots of water to remove wastes. You will remember that bony
fish excrete mainly ammonia from their kidneys as a nitrogenous waste
product. Ammonia is very soluble and very toxic, but fish avoid
poisoning because they have access to plenty of water in which to dilute
the ammonia and they get rid of urine very quickly from their bodies.
They have no bladder to store urine and so urinate continuously.
Sharks and rays are fish that have a skeleton made of cartilage rather than
bone. They excrete urea by continuous urination.
Because they live in water, you would think that fish would have no
problem in regulating the level of water in their body fluids. However, if
you think harder about it, you will realise that fish need to osmoregulate
because their body tissues contain substances in different concentrations
from their surroundings.
Saltwater fish
Fish living in salt water, in the sea or estuaries, have a higher
concentration of water in their bodies than occurs in the water around
them; they constantly lose water to their surroundings due to osmosis.
In the sea, water rapidly leaves the body of a fish by osmosis, especially
through the membranes of the gills. The fish drinks and takes in water
with its food to replace this water loss.
You probably know that humans should not drink salt water to replace
their water losses because their kidneys would not be able to get rid of
the salts quickly enough to maintain normal salt balance. However, fish
have special cells in the gills that can excrete excess salt back into the
water by active transport. Their kidneys also excrete quite concentrated
urine; that is, they excrete urine with a low water content.
Freshwater fish
Freshwater fish have the opposite problem water is constantly taken
up from the surrounding water, where the concentration of water is much
higher than in the body fluids of the fish. Fish have the added
disadvantage that their gills have a huge surface area in contact with the
water to carry out gaseous exchange, but as a result this area also permits
osmosis to occur very efficiently.
Being a fish in freshwater is a bit like being in a leaky boat; water
keeps coming in, and unless you keep bailing it out you are in trouble.
Bailing it out is exactly what the fish does. Its kidneys work very
efficiently to constantly produce large quantities of very dilute urine. It
loses some salts in its urine in this way, but is able to take these up, even
although they are in very lower concentration in the surrounding water.
What is the process involved? Yes, this movement against the
concentration gradient is brought about by active transport in specialised
cells in their gills.
Fish that move between salt and fresh water

A number of fish species which live in Australian rivers move freely
between salt and fresh water. For example, the native bass (Macquaria
novemaculeata) lives mainly in the freshwater sections of the coastal
rivers of eastern Australia, from Fraser Island in Queensland to Wilsons
Promontory in Victoria. It returns to the estuaries of these rivers in
winter to breed.
The two native eel species also migrate between fresh and marine waters.
So how do these species cope with the osmotic changes they encounter in
these different environments?
The eels and bass, which move between fresh and salt environments, are
capable of changing their responses to their changing environments.
The figure below summarises the responses of fish species living in
freshwater (Australian bass) and in saltwater (sea mullet, Mugil
cephalus) to enable them to cope with their osmotic environment.
scales and mucus secretion
make skin fairly impervious
to water loss
water taken by drinking

salt water
Saltwater
Sea mullet
(Mulgil cephalus)
water lost through

the gills by osmosis
concentrated
urine
scales and mucus

secretion make skin fairly
impervious to water
salts excreted by
active transport
some water taken

with food
Freshwater
Bass
(Macquaria novemaculeata)
salts taken up by
active transport
continuous production
of dilute urine
water uptake through

the gills by osmosis
Osmoregulation in fish.
Now complete these tasks.

1
What organ in fish and mammals is responsible for removing almost all
nitrogenous wastes?
_____________________________________________________
10
In the space below, construct a table to compare and explain the

differences in urine concentration of terrestrial mammals, freshwater
fish and marine (saltwater) fish.
Check your answers.
Osmoregulation in other animals

All vertebrate animals produce metabolic wastes in their livers and
excrete them through the kidneys. Reptiles and birds, you will
remember, produce their nitrogenous wastes mainly as uric acid. This is
not very toxic to them because it does not dissolve well in water. It is
excreted as a soft paste, which also helps species living in arid areas to
reduce their water losses through their urine.
Next time you see a fresh bird dropping on something, such as a car
windscreen, have a closer look at it! It will often be a mixture of white
and brown material. The brown material is faeces and the white the
urine, which is mainly uric acid. In birds, the digestive system
(producing the faeces) and urinary system (producing urine) exit through
a single opening to the outside of the body, called the cloaca.
11
Marine birds and reptiles can get rid of excess salts, taken in by drinking
and with their food, by excreting it through active transport from
salt glands situated just below their eyes.
Insects also produce uric acid as their major nitrogenous waste. It is
produced in structures called fat bodies, which have some similar
functions to the livers of vertebrates. The uric acid is concentrated and
excreted into the digestive system by finger-like structures called
Malpighian tubules.
Many species of Australian insects, including a number of ant and
grasshopper species, live in arid regions where reduced water loss due to
the excretion of uric acid is a distinct advantage for their survival.
Ants excrete uric acid. This is an advantage in arid regions. (Photo: J West)
12
Adaptations for demanding

environments
Over half of the Australian continent is considered to be arid. Under
such dry conditions, plants and animals need to carefully balance their
water gains and losses in order to maintain the level of water and salts in
their tissues.
Some animal adaptations

How are Australian insects and terrestrial mammals adapted to survive in
arid environments?
One important adaptation for conserving water is the production and
excretion of concentrated nitrogenous wastes. Your task in Exercise 6.3 is
to explain why this adaptation is valuable for a range of Australian insects
and mammal species.
You will find some information in the sections you have already read
within this part. You also looked at some animal adaptations to arid
environments in the Preliminary course in Adaptations to the Australian
environment. The relevant pages are included in the Additional
resources section at the end of this part.
Read through the information provided and highlight any information
that will help you to explain examples where producing and excreting
concentrated nitrogenous wastes helps Australian animals to conserve
water. Then present your information in Exercise 6.3.
Some plant adaptations

You looked at some plant adaptations to arid environments in the
Preliminary course in Evolution of Australian biota and Adaptations to
the Australian environment. The relevant pages are included in the
Additional resources section at the end of this part. Read through these
before continuing.
13
Plant adaptations to reduce water loss

Plants have many adaptations to enable them to conserve water. Many
Australian plants, in particular, have evolved features that permit them to
survive under dry conditions.
Some plant structures that may be specially adapted for conserving water
include:
leaf surface area
positioning of stomates
shape of leaves
depth and nature of roots
arrangement of leaves
thickness of cuticle
number of stomates
colour of leaf surface.
Some of these features are shown in the diagram below.

flattened petioles
flattened
succulent
stem
flattened stem
axillary bud
leaflets of
compound
leaf
small leaf
stem
spines
tap root
Some plant adaptations for arid conditions.
Use information from within this part and from the Additional materials to
complete Exercise 6.4.
14
Your own investigation of plant adaptations

Investigate your local environment, the nearest botanical garden, your
own garden or even a local garden centre to find two species of plants
which are able to grow under conditions where water is not readily
available.
Cacti are obvious examples, but if possible you should try to find native
species. There are no native cacti, although some, like the prickly pear
(Opuntia species), do occur in the wild.
Prickly pear. (Photo: J West).
Collect as much information as you can for the plants you have chosen to
investigate about their adaptations for water conservation. Some features
that you could observe are listed and shown on the previous page.
If you have a microscope, or access a microscope at your local school or
TAFE college, you could count stomates on these species and compare
the number with other species not adapted to dry areas. Or, you could
count the number of stomates on the upper and lower surfaces of the
leaves and compare them.
Present your information about the two plant species you study as a table
in Exercise 6.5.
15
Plant adaptations to saline environments

Saline soils occur naturally in Australia, as a considerable amount of the
continent was under the sea during the high sea levels between the
various ice ages in the Pleistocene Period (2 million to 10 000 years ago).
A number of native species of plants can cope with high levels of salt in the
soil. For example, some species such as salt bushes can excrete the excess
salts which they take up from the soil using special glands in their leaves.
The area affected and the extent of soil salinity has increased dramatically
since European occupation of the continent for a variety of reasons,
including:
a rise in the saline watertable (artesian groundwater) brought about

by clearing of native salt-tolerant trees. These trees previously
extracted water from the watertable and kept its level lower than it is
today
irrigation water draining into the saline artesian groundwater,

causing the watertable to rise
poor drainage, which also raises the level of the saline watertable.
As saline water reaches the root zones of crop plants and pasture grasses,
they die as they lose water from the roots by osmosis to the more saline
soil (since there is a lower concentration of water outside the plant roots
than inside). This is exactly the same reason that you can use salt as a
weed killer around courtyards and paths.
Some crop plants, like cotton and barley, can tolerate more salty
conditions than others, such as fruit trees and lucerne (alfalfa). In areas
where soil salinity is a problem, some farmers have been able to switch
their crops, but in other areas conditions are so salty that no plants have
adaptations to cope with it.
A badly salt-affected area has been planted with saltbush. (Photo: L McGilchrist)
16
In the Preliminary course you considered some adaptations in mangroves

to regulate their internal salt concentrations. Not only do they need
adaptations to survive in a highly saline environment. These salt
concentrations can vary depending on the tide and the amount of fresh
water coming in from the river at the head of the estuary.
Different species of mangroves have different adaptations. For example:
most species in New South Wales exclude salt from entering the plant
some species, including the river mangrove, are able to excrete salt
through special glands in their leaves
other species accumulate salt in various parts of the plant, such as

the leaves. These leaves drop off with age and therefore the plant
gets rid of the accumulated salt.
Salt crystals on the leaves of the river mangrove. (Photo: J West)
Write your own outline about processes used by different plants for salt
regulation in saline environments.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
17
Adaptations for changing

environments
Organisms need adaptations to be able to survive in a changing
environment. These changes may be natural variations, such as the
changing salt concentrations in estuaries that you considered when you
read about adaptations of estuarine fish and mangroves. Environments
also change as a result of human activity.
Many organisms are able to maintain a stable internal environment
despite changes in external conditions. This is the process called
homeostasis. But not all organisms can do this completely. The process
in such organisms is called enantiostasis.
What is enantiostasis?
Although you will have trouble finding the word enantiostasis in any
dictionary of biology or first year university textbook, it is used in the
syllabus and is defined as:
the maintenance of metabolic and physiological functions in response to
variations in the environment.
Extract from Biology Stage 6 Syllabus 1999 Board of Studies NSW,

originally issued 1999.
In other words, enantiostasis seems to embrace the whole range of

adaptations that you have already considered, by which organisms
control their internal environments.
Most of the adaptations you have examined have been in organisms that
closely regulate their internal environments with respect to their external
surroundings. These organisms are often called regulators and the
processes they use to maintain stable internal conditions are collectively
known as homeostasis:
the tendency in an organism towards maintenance of physiological stability
Extract from Gould, J.L. and Keeton, W.T. 1996. Biological Science. 6th ed.
Norton, New York.
You may think that there does not seem to be much difference between
homeostasis and enantiostasis. You are right!
However, there are a large number of organisms, particularly invertebrate
animals and many plants, which tend not to maintain their internal
environment at a different level from that of their external environment.
18
The internal environments of these organisms vary pretty much in line

with changes in their surroundings. These organisms are often referred
to as conformers rather than regulators. It is a fine distinction, but
presumably enantiostasis has been included in the biology syllabus to
include these organisms which do not maintain complete homeostasis.
You should learn the definitions of both homeostasis and enantiostasis
and understand that all organisms respond to changes in their external
environment (that is, carry out enantiostasis) but some organisms do not
necessarily tend to maintain stability in their internal environments; that
is, not all organisms carry out homeostasis.
Urban development and estuaries

Estuaries occur all along the Australian coastline, and that is where most
Australians live. This causes considerable conflict between urban
development and the health of aquatic organisms inhabiting these
waterways.
Human impacts include dumping of rubbish and clearing of complete
communities of organisms to make way for housing developments,
marinas and the like. The effects of human activity are quite complex
(and will not be studied in detail in this module).
However, some of the more indirect consequences of urban development
have an effect on the distribution and abundance of estuarine organisms
(such as mangroves) by affecting their abilities to survive change in their
environment and their response, or lack of response, to that change (that
is, their enantiostasis). These include:
changed drainage patterns

For example, road, bridge and flood gate construction can
dramatically change the natural salinity levels, which may be
detrimental to the organisms occupying the area
pollution
For example, sewage pollution and the leaching of fertilisers into an
estuarine system can stimulate the growth of some plant species and
deter the growth of others. Pesticides and oil may poison organisms
by affecting their physiology and metabolism.
So why is the effect of urban development on estuarine communities

important? Could Australia do without mangrove swamps, squishy
salt marshes and muddy estuaries?
You might like to carry out some research on these questions.
19
Have a look at the virtual mangrove webpage in the Local Ecosystem

module on the LMPC webpage.
http://www.lmpc.edu.au/science
You will find lots of information on the Internet, but below are two
simple publications produced by NSW Fisheries and one other general
reference, which might be somewhere to start:
Middleton, M. 1985. Estuaries their ecological importance.

AGFACTS F2.3.1
West, R.J. 1985. Mangroves AGFACTS F. 2.0.1
Australian Academy of Science. (1994) Environmental Science.

Australian Academy of Science, Canberra.
You may also find information about local waterways at your local
library and in newspapers.
Finally, complete Exercise 6.6.
You have now reached the end of the module. There are many difficult
concepts covered in this topic and if you have time, revise some of the
concepts before going on.
20
Suggested answers
Osmoregulation and excretion in fish

1
kidneys
Here is an example of a suitable table.
Organism
Main wastes
in urine
Concentration
of urine
Reason(s) for urine

concentration
mammal
urea, salts and

water
dilute to
relatively
concentrated
urea is not very toxic;

water is needed to
wash wastes out of
body
freshwater fish
ammonia, water
dilute urine
urine very dilute

because of large
amounts of water
being excreted
saltwater fish
ammonia, salts
concentrated
urine;
salt glands in
gills remove
most salt
urine must be
concentrated to reduce
water loss; urine
released continuously
to reduce toxic effect
of ammonia
21
This section contains extracts from the Preliminary modules called

Evolution of Australian biota and Adaptations to the Australian
environment.
Introduction
The concentrations of salts and water within the cells and bodies of many
living organisms is regulated very precisely. Changes brought about by
dehydration or an imbalance of salts (ions) within the cells can quickly
lead to the death of an organism. The regulation of water and salts in the
body is called osmoregulation.
On land the air is very dry, especially in arid areas and in places where
high temperatures and wind greatly increase evaporation. For plants,
which must take up CO2 through their stomates for photosynthesis, water
loss can be a severe problem. Terrestrial animals also rapidly lose water
to their surrounding environment. This is a problem in birds and
mammals which normally use evaporation of water to keep their body
temperatures constant in hot environments.
Mammals and birds closely control the losses and gains of water by
utilising a variety of adaptations. Drinking water is the main way that
species gain water, but they can also obtain water in their food (eg. fleshy
fruits) and some can use metabolic water which is produced during
cellular respiration. You should remember the overall equation for
respiration.
glucose + oxygen
carbon dioxide + water + energy
There are many ways in which water losses can be minimised, including
seeking shade to reduce the need to evaporate water for cooling.
Reabsorption of water by the kidneys produces more concentrated urine,
so that less water is excreted from the body.
22
Birds, reptiles and insects reduce the amount of water they lose in their
urine by excreting a waste product called uric acid, which, unlike the
urea excreted by mammals, does not have to be dissolved in water.
Some species, such as the camel, red kangaroo and desert rats and mice,
also have cooling structures in their nasal passages. These cause some of
the moisture, normally lost when breathing out, to condense and be
reabsorbed back into the bloodstream.
Some animal adaptations for

maintaining water balance
Here is information about adaptations of a common Australian mammal.
The red kangaroo
Distribution map of the red kangaroo (Macropus rufus).
(from The Mammals of Australia. Strahan, R. 1995. Reed, Sydney)
As is shown on the map, the red kangaroo occupies the central and
central western areas of Australia. In other words, it lives in an area
where summer temperatures are very high and winter temperatures can
be below freezing, while rainfall is very low at most times of the year.
23
The following table lists some characteristics of red kangaroos.

Body dimensions of the red kangaroo
Head and body length
Tail length
Weight
Measurement range
Measurement average
0.91.4 m (male)
1.1 m (male)
0.71.0 m (female)
1.0 m (female)
0.71.0 m (male)
0.9 m (male)
0.50.9 m (female)
0.8 m (female)
2285 kg
(male)
66 kg (male)
1735 kg
(female)
27 kg (female)
You can see that males are much larger than females. A large red
kangaroo is about the weight of an adult human male and, when standing
up on its hind legs, is also about the same height as a fairly tall human.
Regulating body temperature

Once the external temperature is high enough to equal the body
temperature of an animal, the only way that the animal can get rid of heat
produced by its own metabolic processes is to carry out evaporative
cooling by sweating or panting.
You will remember that birds and mammals living in hot dry conditions
keep their body temperature constant by evaporating water through
sweating or panting. However, they need to balance the water they use
in this evaporative cooling against their water intake to maintain
regulation of their body fluids (osmoregulation).
In central Australia in the hottest summer temperatures, a red kangaroo
lying in the direct sunlight in the middle of the day would need to
evaporate around four litres of water per hour to regulate its body
temperature. This means that after a couple of hours in the sun it would
need to drink eight full litres of water just to keep its body water at a
constant level.
Red kangaroos only usually need to drink about every five days and so
the species obviously has adaptations which permit it to balance its heat
loss and regulation of body water under such severe conditions. Lets
have a look at how it does it.
24
As discussed before, water loss has to be balanced by water gain and heat
loss to heat gain if the kangaroo is to keep its body temperature and body
water levels constant. The animal gains heat from the environment
(mainly heat from the sun) and from its own metabolism, including extra
heat generated during exercise.
At rest the red kangaroo loses heat by panting. This consists of shallow
and rapid breathing passing air over the membranes of the nasal
passages. Increased blood flow in vessels supplying these membranes
permits a great deal of heat to be lost by evaporation. Sweating is not as
efficient a way of losing heat as panting, but the red kangaroo also sweats
to lose heat if it needs to exercise during the hot periods of the day.
The kangaroos also have a mass of small blood vessels under the skin on
its forelimbs. The kangaroo spreads saliva on its forelimbs and
evaporation results in heat loss from these blood vessels. Remember that
heat loss is the same as cooling. When you pick up a can of drink out of
the fridge it feels cold because your hand is losing heat to the cold can.
Water balance
This seems good so far the kangaroo can get rid of excess heat by
panting, spreading saliva and by sweating if necessary but what about
the water it loses in these processes, when it only gets to drink every five
days or so? The red kangaroo has other strategies to reduce water losses.
A kangaroos kidneys reabsorb a great deal of water, so that its urine is
very concentrated and it urinates quite infrequently during hot times.
Water is also very efficiently reabsorbed by the large intestine, resulting
in very little water being lost in the dry faeces.
You have possibly also heard the saying that mad dogs and Englishmen
go out in the midday sun, relating to the times when settlers and
explorers moved around in the hottest parts of the day in tropical areas,
whereas most indigenous people avoided those parts of the day by
seeking shade. The red kangaroo does the same as these indigenous
people, seeking out even the slightest shade provided by low shrubs or
trees in its environment. It also only moves around in the middle of the
day if it really has to, as exercise means the production of more body
heat, which must be got rid of by evaporating water.
The red kangaroo then is very well adapted in these ways for living in
hot, dry conditions. However, it should be noted that these strategies are
not just found in this species. In Australia, other kangaroo and wallaby
species, small mammals and birds from dry areas have similar
adaptations, as do animals such as camels, jack rabbits and prairie dogs
living in desert conditions in other parts of the world.
25
Red kangaroos increase heat losses by evaporative cooling by: panting

(at rest); sweating (during exercise); and saliva spreading (at rest).
Red kangaroos decrease in heat gain or heat production by: seeking
shade and avoiding exercise.
Water conservation adaptations of red kangaroos include: concentrated
urine and dried faeces.
Australian plant adaptations

Like animals, plants must also balance their loss of water against that which
they take up through their roots. They must evaporate water in hot conditions
to keep their leaves cool and to keep water flowing in the xylem so that it can
be transported to the leaves to be used in photosynthesis.
As discussed earlier, there are a number of strategies which plants adopt to
conserve water, so that they have to take up less from the environment to
maintain their body water levels. Below are descriptions of two examples
of native Australian species which are adapted to living in arid conditions.
Mulga a shrubland survivor

Mulga is a type of tall shrub which is found in the shrubland areas of
Australia. It makes use of any rain which may fall by having its leaves
arranged so that they catch the falling rain and direct it to the base of the
tree, where there are plenty of roots to absorb it.
As well as this adaptation, the roots of the mulga are very long, shallow and
spreading, permitting the absorption of as much available water as possible.
These two adaptations increase water gain, but the plant also has
strategies for conserving this scarce water. Its leaves have an extremely
thick cuticle to reduce the loss of water from the leaf surfaces and its
stomates close for longer periods of time each day, especially in the
middle of the day when it is hotter, as drought conditions increase. As a
result of this, very little water is lost from the species during drought
periods. Obviously it must have its stomates open long enough to collect
enough carbon dioxide for its photosynthesis, but this aspect of the
biology of the species has not been investigated.
26
Porcupine grass a desert grass

As this native tussock grass often grows in sandy soils, it also has
shallow and widely spread roots near the surface to quickly absorb any
available rainfall.
The long, narrow leaves of the grass are rolled and the stomates are
found at the bottom of pits inside the rolled surface. The diagram
following shows the arrangement of these.
stomatal grooves
(A)
Leaf open
junction of
leaf edges
(B)
Leaf rolled
stomatal
grooves
Cross sections through the rolled leaf of porcupine grass.
(from Web of Life. Academy of Science. 1981. 3rd Ed.)
The rolling of leaves and sinking of stomates in pits means that a high
humidity is maintained around the openings of the stomates and the
effects of wind around the stomates is reduced.
You probably remember that high humidity reduces evaporation. This is
the main reason that you feel uncomfortable on a hot humid day. The
water in your sweat is not evaporating as quickly as it would on a dry day
and so your evaporative cooling is not working as well as it should.
27
Maintaining humidity around the openings of the stomates reduces water

loss in this way. It probably means that the porcupine grass also is a bit
hotter than it would have been if it hadnt rolled its leaves, but at least it
is conserving water. Its light, shiny leaf surfaces also help here as they
reflect a lot of the heat from the sun.
The table below summarises the adaptations which have occurred during
evolution of these two native Australian species, permitting them to
survive under arid conditions in the grassland areas of Australia. You
need to note once more that similar adaptations are also found in dry area
grasses and shrubs in other parts of the world.
Summary of adaptations of mulga and porcupine grass plants
to hot arid conditions
Adaptation to:
Porcupine
grass
Mulga
shrub
Increase water gain
wide expanse of roots
leaves direct rainfall to the base of the plant
Decrease water loss
impermeable thick waxy cuticle
light coloured surface reflects heat
leaves rolled reduce evaporation
stomates sunk in pits reduce evaporation
reduce stomate opening during drought periods
+ indicates adaptation present

indicates adaptation either not found or not identified.
28
Exercises Part 6
Name: _________________________________
Exercise 6.1: Antidiuretic hormone and aldosterone

Outline the role of the hormones aldosterone and ADH in the regulation
of water and salt levels in blood.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 6.2: Adrenal cortex hormone replacement

therapy
Consider the following chain of events in terms of your understanding of
the involvement of the kidneys and hormonal system in the regulation of
salt and water balance in a mammal.
Sam is working in the garden on a hot dry summers day. She is
sweating a lot, which is regulating her body temperature, but she notices
that she is also losing water and salts from her body in sweat. Although
she has been drinking some water, she has not had to urinate (go to the
toilet to release urine) all day. When she finally urinates at the end of the
day, she notices that her urine is quite dark in colour.
29
a)
Explain why Sam has not needed to urinate during the day.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Why is Sams urine a darker colour when eventually she urinates?

_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
Describe what could be the result of such heavy work in the heat over
a number of days and if Sam does not drink much water in that time.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
d) Now imagine that Sam has the disease called Addisons disease.
i
Name the hormone that Sam would need to treat her disease.
_________________________________________________
ii
How would she obtain this hormone?

_________________________________________________
iii Discuss why treatment with this hormone is important for Sam.
(How does it help her? Find out, if you can, if it does any harm.)
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
30
Exercise 6.3: Animal adaptations

Explain the relationship between the conservation of water and the
production and excretion of concentrated nitrogenous wastes in a range
of Australian insects and terrestrial mammals. (You do not have to use
all the lines provided.)
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
31
Exercise 6.4: Plant adaptations to reduce water loss

Describe some adaptations of a range of terrestrial Australian plants that
assist in minimising water loss. (You do not have to use all the lines
provided.)
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
________________________________________________________
32
Exercise 6.5: Your own investigation of plant

adaptations
Construct a table to present information you have collected about
some structures of two plants that assist in the conservation of water.
Exercise 6.6: Adaptations for changing environments

a)
Define enantiostasis.
_____________________________________________________
_____________________________________________________
b) Why does a mangrove need to carry out enantiostasis?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
33
Student evaluation of the module
We need your input! Can you please complete this short evaluation to
provide us with information about this module. This information will
help us to improve the design of these materials for future publications.
1
Name: _______________________________________________
Location: _____________________________________________
Did you find the information in the module easy to understand?

_____________________________________________________
Were the instructions clear? ______________________________
What did you most like learning about? Why?

_____________________________________________________
_____________________________________________________
_____________________________________________________
Which sort of learning activity did you enjoy the most? Why?
_____________________________________________________
_____________________________________________________
_____________________________________________________
35
Did you complete the module within 30 hours? (Please indicate the
approximate length of time spent on the module.)
_____________________________________________________
_____________________________________________________
Do you have access to the appropriate resources? eg a computer, the

internet, scientific equipment, chemicals, people that can provide
information and help with understanding science
_____________________________________________________
_____________________________________________________
_____________________________________________________
Please return this information to your teacher, who will pass it along to
the materials developers at OTEN DE.
36
Learning Materials Production

Open Training and Education Network Distance Education
NSW Department of Education and Training
Gill Sans Bold
Biology
HSC Course
Stage 6
Blueprint of life
BIOHSC41285
XP005440
OTEN
Acknowledgments
Australian Academy of Science (1981) Biological Science. The Web of Life, Australian Academy of
Science, Canberra
Board of Studies NSW (1999) Biology Stage 6 Syllabus
Board of Studies NSW, extracts from various past HSC examination papers
Flannery, T (19XX), Kangaroos: 15 Million years of Australian bounders,
Messel, H (1963) Science for High School Students, Nuclear Research Foundation within the University
of Sydney, Sydney
Photographs of dividing cells in Part 3 by M Ricketts, Sydney University
Photograph of polydactyly by Dr E Klatt MD, Department of Pathology, University of Utah, Salt Lake
City, Utah, USA
Extract from interview broadcast on ABC between R Williams and Dr D Turner
Article titled Thailand: Government passes up pest free cotton,
<http://www.netlik.de/Zeitung/971205.htm> (accessed 10 April 2001)
Article titled Human-pig embryo accusation provokes debate, ABC Online (accessed 9 October 2000)
good faith.
Writer:
Steven Vassallo
Jane West
Editor:
Rhonda Caddy
Illustrators:
Thomas Brown, Barbara Guerney
Contents
Module overview
Outcomes .............................................................................................v
Indicative time...................................................................................... vi
Resources............................................................................................ vi
Icons ................................................................................................... vii
Glossary............................................................................................. viii
Part 1: Evolution..................................................................165
Part 2: Patterns of inheritance.............................................147
Part 3: Chromosomes .......................................................162
Part 4: How genes operate .................................................149
Part 5: Playing with nature ..................................................138
Part 6: What have you learnt?.............................................138
Module evaluation
Introduction
ii
Blueprint of life
Module overview
DNA is often called the blueprint of life. Like the blueprint for
building a complex skyscraper, DNA for an organism contains all the
details about what should be included, the order in which these parts
should be assembled and how they should work together.
But DNA is more than just a set of instructions that is used once then
thrown away. The DNA blueprint remains in every living cell and
continues to provide information about how the cell must function. It
does this by controlling the proteins that are made within cells. The
blueprint is passed to every new cell that forms. If the organism
reproduces sexually, half of the information is placed into each sex cell
so that it can influence the growth, development and functioning of new
generations of organisms.
In this module you will learn about DNA and how it behaves in these
situations. You will also learn about how DNA is passed from one
generation to another and how the information causes characteristics that
follow predictable patterns. Youll also find out about the development
of the theory of evolution and the importance of DNA in this process.
Outcomes
The main outcomes to which this module contributes are:
A student:
Introduction
H1
evaluates how major advances in scientific understanding and

technology have changed the direction or nature of scientific
thinking.
H4
assesses the impacts and applications of biology on society and

the environment.
H5
identifies possible future directions of biological research
iii
H6
explains why the biochemical processes associated with cells are

related to macroscopic changes in the organism.
H7
analyses the impact of natural and human processes on

biodiversity
H8
evaluates the impact of human activity on the interactions of

organisms and their environment
H9
describes the mechanisms of inheritance in molecular terms
H10
describes the mechanisms of evolution and assesses the impact

of human activity on evolution
H11
H12
evaluates the ways in which accuracy and reliability could be

improved in investigations.
H13

successfully to communicate information and understanding.
H14

information.
H15

by a team
H16

behaviour and a desire for a critical evaluation of the
consequences of the applications of science
Extracts from Biology Stage 6 Syllabus Board of Studies NSW, originally

issued 1999. The most up-to-date version can be found on the Boards website
at: http://www.boardofstudies.nsw.edu.au/syllabus99/syllabus2000_list.html
Indicative time
Blueprint of life should take 30 indicative hours to complete. Each part
of the module is approximately five hours work.
iv
Blueprint of life
Resources
Here is a list of things you may like to get before you start this module.
Most of the items will probably be in the kitchen cupboard already.
You will use these items in some of the practical work for this topic.
Part 1
red and green food colouring
a packet of toothpicks
two small plates
two forks
some paper towel
Part 3
three each of two different coloured pipe cleaners
Part 4
Introduction
dried peas
salt
eucalyptus wool wash
methylated spirits
Icons
The following icons are used within this module. The meaning of each
icon is written beside it.

There is an exercise at the end of the part for you to
complete.
vi
Blueprint of life
Glossary
The following glossary provides the scientific meaning for many of the
scientific terms used in this module. They appear in bold the first time
that they occur in the learning material.
Introduction
Term
Meaning
anatomy
the science of the structure of living organisms
artificial selection
features of organisms selected by humans
axial
between the leaf and the stem
biochemistry
the chemistry of living things
biogeography
the study of the distribution of living things
biotechnology
the use of organisms for the manufacture of useful

or commercial products
centromere
a constriction of a chromosome used for

identification
chromatids
one of a pair of duplicated chromosomes
chromosomes
coiled structure found in the nucleus that contains

DNA
codon
a group of three DNA nucleotide bases
cross-pollination
pollination between different plants of the same

species
diploid
cell containing two of each chromosome pair
dominant
one allele masking another recessive allele
embryology
the study of the developing embryo
endemic
occurs in one particular geographical area
equilibrium
when gene frequencies (the number of times the

gene occurs) are constant in a population
extinct
no longer existing
factors
a term used by early geneticists, now replaced with

allele
gene pool
the total collection of all possible genes in a

population
genetic engineering
the modification of genetic material
genetics
relating to genes
vii
viii
genotype
the genetic makeup of an organism
gill slits
embryonic slits found in chordate embryos
haploid
when a cell contains one of each chromosome pair
heterozygous
having two different alleles
homologous pairs
containing the same genetic locations
homozygous
having two identical alleles
linkage
when alleles are located on the same chromosome
mass extinction
when large numbers of species disappear at similar

identifiable dates
maternal
from the mother
meiosis
the type of cell division that occurs in sex cells,

resulting in a halving of chromosome number
monohybrid cross
the first genetic cross between sex cells
niche
the location of an organism in an ecosystem;

dependant on all of the biotic and abiotic features
notochord
longitudinal skeleton of the embryos of chordates
nuclear transfer
the transfer of a nucleus from one cell to another

that has had the nucleus removed
ova/ovum
female sex cell
palaeontology
the study of fossils
paternal
from the father
pentadactyl
bearing five digits
phenotype
observable features of an organism
plasmid
circular piece of DNA found in bacteria
pollen
a small structure containing the male gamete of

plants
pollination
transfer of pollen from male to female sex organs in

plants
polymerase chain
reaction
production of large numbers of DNA segments
polypeptide
a sequence of amino acids joined together to form a

protein
punctuated
equilibrium
evolution occurring through short periods of rapid

change without intermediate forms
Blueprint of life
Introduction
segregate
separation of chromosomes during meiosis
self-pollination
when pollen is transferred on the same plant
sperm
male sex cell
recessive
when a characteristic is only displayed if both

alleles are the same
recombinant DNA
when DNA from one organism is taken into another
restriction enzymes
Proteins that cut the DNA chain at particular points
T plasmid
a small ring of DNA found in some bacterial cells
terminal
at the end
trait
the particular property being studied in genetics
transgenic species
a species containing some genes of another species
transitional forms
fossils thought to be intermediate between other

groups
vestigial
an organ that loses its function over time
viable
able to live and reproduce
viscosity
the property of stickiness
Wallace's line
a hypothetical line that separates the Asian and the

Australian faunas
xenotransplantation
animal to human transplantation
ix
Biology
HSC Course
Stage 6
Blueprint of life
Part 1: Evolution
Contents
Introduction ............................................................................... 2
Environment and evolution........................................................ 5
Earths constantly changing environment ...........................................6
Modelling natural selection ..................................................................9
A case study .......................................................................................13
Evidence for evolution ............................................................. 14

Fossils ................................................................................................15
Transitional forms...............................................................................23
Biogeography .....................................................................................25
Comparative anatomy........................................................................29
Comparative embryology ...................................................................30
Biochemistry .......................................................................................32
Other evidence ...................................................................................33
The evolution of evolution ....................................................... 38

Exercises Part 1 ................................................................... 57
Part 1: Evolution
Introduction
Popular culture often depicts the process of evolution as a development

of organisms from lower simple forms to higher and more sophisticated
states of organisation. These descriptions often place humans at the top
of the evolutionary ladder. This is a notion as outdated as the Earth
being the centre of the universe.
The famous American evolutionary biologist, Stephen Jay Gould said:

Darwins revolution will be completed when we smash the pedestal
of arrogance and own the plain implications of evolution for lifes
non-predictable nondirectionality.
That is, evolution does not necessarily produce more complex and
sophisticated organisms. Rather, it produces different ones.
The evolution of species results from changes in the environment.
Individual members of a species that can survive the pressures of change
have some special features, called adaptations, which enable it to cope
and to reproduce.
Blueprint of life
The first part of this unit deals with the nature of these environmental
changes be they physical, chemical or a result of competition for scarce
resources.
You will be asked to prepare a case study either on the evolution of the
Australian megapods (kangaroos) or the plant Nothofagus, showing how
changes in the Australian environment have led to changes in a species.
Many sciences today describe and explain how present and past species
are related to each other. Evidence that species evolve from a common
ancestor has come from studies such as palaeontology (the study of
fossils), comparative anatomy and embryology.
The sciences of biogeography (the study of the distribution of organisms)
and biochemistry (the study of molecules that make up living matter)
also reinforce what is understood about evolution. This part of the
module will describe, using specific examples, how evolution is
supported by these studies.
To complete an activity in this unit you will need red and green food
colouring, a packet of toothpicks, two small plates, two forks and some
paper towel. Please get them ready before you start this part.
Part 1: Evolution
outline the impact on the evolution of plants and animals of:
changes in physical conditions in the environment
changes in chemical conditions in the environment
competition for resources
describe, using specific examples, how the theory of evolution is

supported by the following areas of study:
palaeontology, including transitional forms
biogeography
comparative embryology
comparative anatomy
biochemistry
explain how Darwin/Wallaces theory of evolution by natural

selection and isolation accounts for adaptive radiation leading to
divergent evolution and convergent evolution.
plan, choose equipment or resources and perform a first-hand

investigation to model natural selection
identify data sources, gather, process, analyse and present evidence from
secondary sources and use available evidence to prepare a case study
using an Australian example to show how changes in physical and
chemical conditions, or increased competition for resources, have led to
changes in a species
process and analyse information from secondary sources to trace the

fossil record of one group of organisms
perform a first-hand investigation or gather information from secondary

sources (including photographs/ diagrams/models) to observe, analyse
and compare the structure of a range of vertebrate forelimbs
identify data sources, gather, analyse and present information from

secondary sources on the historical development of theories of
evolution and use available evidence to assess social and political
influences on these developments.

Boards website at:
Blueprint of life
Environment and
evolution
The fact that species become extinct indicates that its members were not
very successful at coping with changes in their environment. Whether
they were sudden or gradual changes, the fact remains that the members
of the species did not survive the pressures of change and were not able
to thrive and reproduce.
Adaptations to suit environments

Your experiences with nature and living things on Earth have probably
come from reading books, watching television and video, and going out
in the bush or to the beach. You may have had the opportunity to go to
different environments around Australia or even to other parts of the
world. The Preliminary course must have also broadened your ideas
about life on Earth.
Whatever your experiences and observations have been, you would
conclude that living things survive best in the environment that they are
most suited for. What is less obvious is that all living things evolved to
become suited to the environment that they live in. While adaptations
are easily observed and described, the evolution of these adaptive
features is not usually noticed in a human lifetime.
In past times, people thought that species never changed and neither did
the environment. Today we know that the environment is constantly
changing and that species evolve to make the most of conditions in their
background. Species with features most suited to their environment
thrive and live to reproduce.
Environments on Earth are diverse; therefore there is a diverse range of
life on the planet. Some environments change periodically, for example,
seasons. Some environments have regular changes over longer periods
of time. Sometimes environments change gradually over millions of
years; at other times, environments may undergo a sudden drastic
change.
Part 1: Evolution
Whichever way the environment changes, the organisms living there

have pressure put on them to survive. The adaptive features of
individuals give them survival value. Environmental pressure selects
those individuals with the greatest survival value.
Using the information you have just read, write a paragraph to state the link
between the environment and evolution of organisms.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
Earths constantly changing environment

Changes to the environment can be grouped into one of the following:
changes in physical conditions

These include any non-living natural conditions such as wind,
temperature and availability of water. Some changes in physical
conditions can occur suddenly or annually.
changes in chemical conditions

The concentration of chemicals in the environment that an organism
uses or is adapted to may change. For example, the salt
concentration (salinity) in soil or in water might increase.
competition for resources

Changes to the amount of resources available affects the struggle for
survival among the species and within the species. Situations such
as the introduction of a successful competitor change the dynamics
in a community, often causing a strain on resources.
Blueprint of life
Think about all the possible changes that can happen in an environment.
For example, the climate may become warmer or a new species may be
introduced into an area.
1
List as many features in the environment that you can think of that
change over a period of time.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Now group these changes into physical, chemical and ones caused
by changes to competition. List these in the table below.
Physical
Part 1: Evolution
Chemical
Changes to competition
A number of scenarios to do with environmental change are listed

below. Describe an adaptive feature of an animal and/or a plant that
will help it to survive the change.
a) An area dries out because of climatic changes.
__________________________________________________
__________________________________________________
__________________________________________________
b) A new species of frog moves in, reproducing and spreading
rapidly. It is poisonous to the predators of the new area.
__________________________________________________
__________________________________________________
__________________________________________________
c) The salinity (amount of salt) of the soil of an area slowly
increases.
__________________________________________________
__________________________________________________
__________________________________________________
Check all your answers.

Most biologists today agree that major evolutionary changes have been
associated with dramatic changes to the Earths environment. These
changes have mostly been brought about by the drifting continents,
causing ocean currents to change as well as affecting volcanic activity
and mountain building.
More recently, scientists have shown direct links between mass
extinctions (where most species on Earth become extinct over a short
period of time) and collisions with extraterrestrial objects such as comets
and meteoroids.
Blueprint of life
Modelling natural selection

In the module called Evolution of Australian biota, you learnt that
changes in a population are due to selection pressures. Perhaps the best
example of this is the classic study of the peppered moth.
An example of natural selection

Both the light and dark forms of the moth occur naturally in the
population. In industrial areas the trees were blackened by soot from the
factory chimneys. When the dark moths rested on tree trunks during the
day, they were less obvious to the birds that fed on them, while the light
variation was easily seen and more often taken by these predators. In
these areas, light coloured moths became less and less common.
In the non-industrial areas the opposite was the case the light coloured
variation was harder to see against the light backgrounds of the trees so
fewer were taken by predators. These were then able to reproduce and
form the next generation. It was the dark coloured moths that
disappeared.
The light variation is easily seen on the dark background and the dark variation
is easily seen on the light background.
Adapted from Biological Science. The Web of Life, Australian Academy of Science.
Biologists attempt to explain the evolution of camouflage by using the

principles of natural selection. If individuals of a population are obvious
to their natural predators, then their numbers would be fewer than those
that blend into their environment.
An open-ended investigation of natural selection

In this experiment you are going to model natural selection by observing
which colours are most easily selected against different backgrounds.
Plan and perform your own activity if you can, or follow the instructions
provided on the following pages.
Part 1: Evolution
Aim
To demonstrate the process of natural selection
Equipment
You will need:
small bottles of food colouring from the supermarket one red,

one green
a packet of about 100200 toothpicks
two small plates and two forks
paper towel.
Methodpreparation
1
Place 50 toothpicks in each plate. Colour one plate red and the other
green by pouring enough food colouring over the toothpicks so that
they are immersed in the colouring liquid.
fork
toothpicks
OD
FO RING
U
O
L
CO
plate
10
Leave the toothpicks in the liquid for at least half an hour. Make
sure the toothpicks are stained all over by stirring them around with
the fork.
Using the fork, scrape the toothpicks out of the plate and onto some
paper towels to dry.
Once they are dry you should have a bunch of 100 toothpicks
50 red, 50 green.
Shuffle these around in your hand so that they are randomly mixed.
Now you are going to model natural selection by observing which

colours are selected against different backgrounds.
You should choose either a member of your family or a friend to act

as the predator. You will do if you are unable to get anyone else.
The toothpicks act as the prey and the background colour will be the
environment.
Blueprint of life
Steps
1
Sprinkle the random bunch of toothpicks over an area of green

surface, such as a lawn or a green blanket.
Get the predator to stand about 5 metres away. When you signal, the
predator must run up to the area and randomly pick 10 toothpicks in
less than 10 seconds. The predator then runs back, puts down what
has been collected, and runs back to do it again. In total, the predator
picks up five bunches of 10 toothpicks (50 toothpicks all together).
Sort the toothpicks using their colour, count them and record the
information in the table below.
Do at least 5 trials.
Repeat the entire experiment on a neutral coloured background such

as a concrete surface or wooden floor. Record these results in the
table below.
Results
Record your results in the table below.
On green background
Trial
Red
Green
On neutral background
Red
Green
1
2
3
4
5
Average
Write a statement comparing the results for the green background and the
neutral background.
_________________________________________________________
_________________________________________________________
_________________________________________________________
Part 1: Evolution
11
Conclusion
You must account for the difference between the results obtained with
the green background compared with the neutral background. Answer
the following questions.
1
Predict the results you would obtain if the experiment were repeated
on a reddish pink background.
______________________________________________________
______________________________________________________
______________________________________________________
Assume that the predator is always present in this environment.

If the toothpicks were able to breed, what could be the most frequent
colour found in a few generations when:
a) the background is reddish-pink
__________________________________________________
__________________________________________________
b) the background is green.
__________________________________________________
__________________________________________________
Write an explanation for selection by camouflage.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
12
Blueprint of life
A case study
Your task in this case study is to show how changes in physical and
chemical conditions or increased competition for resources have led to
changes in an Australian species.
Use resources such as the Internet and books, as well as the information
given in the Additional resources section of this part.
Here are two possible case studies that you may choose for this activity.
Case study 1: The evolution of kangaroos
Australia has undergone changes in its climate over time. The kangaroo
is a good example of a species that has evolved over a long period of
time in response to these climatic changes.
Case study 2: The distribution of the Southern Antarctic beech
This tree had a wide distribution in previous times. Now it is restricted
to small pockets in rainforests.
Prepare a short case study and present your report in Exercise 1.3.
Part 1: Evolution
13
Evidence for evolution
For any real links between changes in the environment and the evolution
of life, scientists have to make observations that span many millions of
years. This can only be done by indirect methods.
Since Charles Darwins book, On the origin of species, was first
published in 1859, overwhelming support for evolution has came from
all areas of science.
The science of palaeontology (the study of fossils) has provided evidence
for the evolution and history of life on Earth. Palaeontologists have been
documenting details of past life forms (the fossil records) and working
out when they existed and how they may have evolved.
The science of anatomy shows similarities between closely related
species by describing features of their body structure that they have in
common. Comparisons between the embryos of related species is further
support for the idea that species have common ancestors.
Advances in technology, especially in biochemical and DNA analysis,
have given biochemists the best tools yet to accurately describe the
relationships between species. This further supports the theory of
evolution.
In summary, evidence for evolution comes from:
palaeontology
biogeography
comparative anatomy
comparative embryology
biochemistry.
You will investigate some of this evidence in more detail on the

following pages.
14
Blueprint of life
Fossils
A palaeontologist is a scientist who studies fossils. Since the movie,
Jurassic Park, palaeontology has become very glamorous but in reality
only a few scientists get to study exciting dinosaur fossils.
Reconstructed Tyrannosaurus Rex skeleton at the American Museum of

Natural History, New York (Photo: R Caddy)
Most palaeontologists are busy trying to fill in missing details of the life
histories of less spectacular organisms.
Fossilised worm burrows (Photo: T Reid)
Part 1: Evolution
15
The fossil records have revealed a few interesting facts about the history
and evolution of life on Earth.
All the species of living organisms on the Earth today represent only
a minute number of the species that have ever lived here over the
past three and a half billion years.
The species that exist on Earth today have similarities to some of the
pre-existing life forms found in the fossil records.
New fossils are constantly being discovered and their clues are
giving scientists a clearer picture of the relationships between past
and present life.
The work of a palaeontologist involves more than hunting for fossils,

digging them out and preparing them for exhibition in museums.
Palaeontologists are also concerned with trying to work out what changes
took place in organisms over geological time, and what relationships the
various fossils bear to one another. This requires careful study of large
numbers of fossils (often mere fragments) and detailed comparisons
between the fossil material available.
Fossilised leaf of an extinct plant called Glossopteris (Photo: M Khun)
Palaeontologists, like most other scientists, usually record both their data
and their comparisons as measurements. Much of this work is done in
the laboratory.
To better understand the information available from fossils, you are
going to study some of the fossil record of a group of organisms horses.
16
Blueprint of life
The fossil record of horses

This activity is designed to give you an idea about the way that
palaeontologists work out the changes that took place in organisms
over millions of years. (It is adapted from material by H Messel in
Science for High School Students.)
Some groups of organisms are very well represented in the fossil record.
One of these groups is the horse family, for which large numbers of
fossils have been found in North America, Europe and Asia. Their
skeletal remains, particularly those of the teeth and toes, have given
important clues to the relationships between them. It has been possible
to suggest the early history of the horse family from this evidence.
Background Information
Horses have their grinding teeth at the back of the mouth, separated from
the front teeth by a toothless space. Their grinding teeth (cheek teeth)
consist of three premolars and three molars on either side of the jaw.
The skeletal characteristic to be used in this exercise is the distance
spanned by the cheek teeth.
span of cheek teeth
premolars
molars
Horse skull showing how the span of cheek teeth is measured.
Aim
To infer likely relationships between various horses of the past, using
some of the methods of the palaeontologist
Procedure
The span of the cheek teeth has been measured in many fossil specimens
of horses. The data for seventeen of the twenty or so known genera are
presented in the table on the following page.
Part 1: Evolution
17
Genera of equidae
Time of existence
Hyracotherium
Early Eocene
4.3
Orohippus
Middle Eocene
4.3
Epihippus
Late Eocene
4.7
Mesohippus
Early Oligocene
7.2
Middle Oligocene
7.3
Late Oligocene
8.4
Early Miocene
8.3
Miohippus
Parahippus
Early Miocene
10.0
Anchitherium
Early Miocene
11.3
Archaeoshippus
Middle Miocene
6.5
Merychippus
Middle Miocene
10 2
Late Miocene
12.5
10 Hypohippus
Late Miocene
14.2
11 Megahippus
Early Pliocene
21.5
12 Pliohippus
Early Pliocene
15.5
Middle Pliocene
15.6
Early Pliocene
11.0
Late Pliocene
10.7
14 Calippus
Early Pliocene
9.3
15 Neohipparion
Middle Pliocene
13.1
16 Astrohippus
Middle Pliocene
11.8
Late Pliocene
11.8
Late Pliocene
18.8
Pleistocene
17.6
13 Nannippus
17 Equus
18
Span of cheek teeth (cm)
Blueprint of life
Each measurement has been plotted as short bars on the graph grid below.
Beside each bar plotted, write the number from the table of the genus it
represents. The first one is done for you.
24
20
S pa n o f c h e e k t e e t h ( i n c m )
16
12
1
4
Middle
EOCENE
60
Late
Early Middle Late

40
OLIGOCENE
Early
30
Middle
MIOCENE
Late
Early Middle Late

10
PLIOCENE
Millions of years ago
PLEISTOCENE
Early
1 0
Check your answer before proceeding.

How have the spans of cheek teeth changed between genera living at
different times? Find out by following the instructions and answering the
questions that follow.
Start at the oldest genus (Hyracotherium) and work towards the younger
fossils. Draw pencil lines between the bar representing each genus and
the bar representing another younger genus.
Connect the points representing the genera Hyracotherium, Orohippus,
Epihippus, Mesohippus, and Miohippus.
Part 1: Evolution
19
Why cant you join two or three genera that occurred at the same
time?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Determine what appears to have happened to the span of the cheek

teeth in horses up to late Oligocene times.
______________________________________________________
______________________________________________________
Continue the graph by showing the relationship between late

Oligocene and early Miocene genera. The change in span of cheek
teeth can be shown by a single line up to the late Oligocene. What
happens from that time to the early Miocene?
______________________________________________________
______________________________________________________
______________________________________________________
What does this suggest about the origin of Parahippus and

Anchitherium?
______________________________________________________
______________________________________________________
Working with your pencil, complete the graph to the Pleistocene by

indicating what you consider to be the relationships between the
various genera. What problem are you confronted with?
______________________________________________________
______________________________________________________
______________________________________________________
20
Blueprint of life
When you have completed your graph, compare it with the graphs
drawn in the suggested answers. What could you do to help decide
which graph was best?
_____________________________________________________
_____________________________________________________
_____________________________________________________
Since the fossil material is abundant, particularly in western North

America, palaeontologists are able to consider a great many structural
characteristics when working out relationships between these horse-like
animals. The relationships based on any single characteristic like the span
of cheek teeth may conflict with relationships worked out from other
characteristics. The most widely accepted hypothesis of relationships,
based on all available data to date, is shown in the figure following.
Equus
Pliohippus
Calippus
Nannippus
Neohipparion
Merychippus
Astrohippus
Megahippus
Hypohippus
Anchitherium
Parahippus
Miohippus
Archaeohippus
Mesohippus
Epihippus
Orohippus
Hyracatherium
Part 1: Evolution
21
Are all the relationships proposed by your graph the same as the
relationships proposed in the figure you have just studied? Consider any
similarities or differences then answer the questions below.
Conclusion
7
What was the approximate average change in cheek teeth span per
million years from Hyracotherium to Miohippus?
______________________________________________________
______________________________________________________
What was the approximate average change in cheek teeth span per
million years from Miohippus to Equus?
______________________________________________________
______________________________________________________
From these results, what generalisation can be made about the rate of
evolution of horses? (This may serve as an indication of the rates of
evolution one might find in other organisms.)
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
10 There are countless millions of fossils in sedimentary rocks

throughout the world. Yet the history of life on Earth is still very
incompletely known. List as many reasons as you can why this
is so.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
22
Blueprint of life
Transitional forms
The example you have just examined of the evolution of the horse is well
studied because there is an abundance of fossil material.
Palaeontologists have been able to describe the relationships between
these fossils because the links between one form and another have been
found. The ancestral tree of 60 million years of horse evolution shows a
gradual development from one genera to the next while giving rise to
other groups.
However most fossil records tracing the ancestors of groups of organisms
are not as complete as the horse. With no fossils showing features
intermediate between two forms that are believed to be linked, scientists
have a hard time explaining natural selection.
You may have seen newspaper headlines like:
Scientists find fossil believed to be the missing link!
These refer to the discovery of human fossils believed to show our

knowledge of human evolution. Intermediate forms or links are called
transitional forms.
Transitional fossils
A transitional fossil is the fossil of a transitional form. A transitional
form, as traditionally used, meant an organism halfway between two
classes or kinds of organisms. Archaeopteryx is often used as an
example of an intermediate form between a reptile and bird.
Archaeopteryx was once believed to be an intermediate form between reptile and bird.
Part 1: Evolution
23
However, this view of evolution is outdated. Archaeopteryx is not a

transitional form between reptile and bird. It is both reptile and bird or a
class of its own. (Remember that a classification system is something
invented by humans and imposed on nature.)
One of the problems Darwin had explaining natural selection was the big
difference in features between the classes. Transitional fossils were
supposed to bridge the gap or be the missing link in the fossil record.
Modern biologists explain these differences by saying there is a gap in
the fossil record. As more fossils are found, these gaps will be filled and
the gradual progression of change will be shown.
Why do palaeontologists continue to look for transitional forms in the
fossil record?
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
Equilibrium
In 1972, after studying many fossil observations, Eldredge and Gould
claimed that most species appear suddenly and their history shows little
evidence of change. Individual populations might change both
genetically and structurally due to adaptation but overall a species
exhibits a net equilibrium. That is, it tends to stay much the same.
To explain why transitional fossils are not found, Niles Eldredge and
Stephen Jay Gould (1972) came up with the punctuated equilibrium
model of evolution.
Punctuated equilibrium
This view suggests that species originate suddenly whenever rapid
changes in the environment occur. This abrupt appearance of new
species is a random event and is usually associated with a large number
of extinctions called mass extinction.
You will learn more about this concept when you do part 4 of this
module.
24
Blueprint of life
Biogeography
Biogeography (sometimes called zoogeography) is the study of the
distribution of organisms. It is a science that describes where plant and
animal families are found on the Earth today and tries to explain how
they came to be where they are. Biogeography explains these
distributions by bringing together concepts from biology, geology,
palaeontology and chemistry.
The science of biogeography had its beginnings in the early part of the
last century and depends heavily on the work of Charles Darwin and
Alfred Russel Wallace, among others. Notice that these same individuals
were prominent in developing the theory of evolution by natural
selection.
Biogeography as evidence for evolution

Each region has similar species occupying similar niches within its
borders. However, the species are clearly different from those in
adjacent areas.
The boundaries between biogeographic zones are drawn according to the
distribution of vertebrate groups (in particular, families). The regions are
based on the relationships of birds; but the same regional limits work
well enough for fish, amphibians, reptiles and mammals.
There are six biogeographical zones (or provinces), each with distinct
flora and fauna. They are:
Palaearctic North Africa, North Europe and Northern Asia
Ethiopian Africa below the Sahara desert
Australian Australia
Nearctic North America
Neotropical South America
Oriental Southeast Asia and India.
These zones are shown on the map of the world following.
Part 1: Evolution
25
N
3
3
2
3
Palaearctic
Nearctic
Oriental
Neotropical
Ethiopian
Australian
Biogeographic zones of the world.
Look at the map of biogeographic zones above.

With what physical features of the Earth do the borders coincide?
_________________________________________________________
_________________________________________________________
Check your answer.
Populations that become geographically isolated by means of a barrier
will tend to change. These barriers include seaways, rivers, mountain
ranges, deserts and other hostile environments. They put a wedge
between whole groups of organisms, eventually causing related
organisms species, genera, families and so on to diverge.
Wallaces line
Alfred Russel Wallace, the so-called father of animal geography,
formulated his ideas on evolution by natural selection while observing
and collecting wildlife in the islands of Southeast Asia. He was
particularly impressed by the sudden difference in bird families he
encountered when he sailed some twenty miles east of the island of Bali
and landed on Lombok.
On Bali the birds were clearly related to those of the larger islands of
Java and Sumatra and mainland Malaysia. On Lombok the birds were
clearly related to those of New Guinea and Australia. He marked the
channel between Bali and Lombok as the divide between the Oriental
and Australian biogeographic zones.
26
Blueprint of life
In his honour this dividing line, which extends northward between

Borneo and Sulawesi, is still referred to today as Wallaces Line.
Philippines
Thailand
South China Sea
M a l a y s i a
Brunei
Pacific Ocean
Sabah
Celebes
Sea
Borneo
Singapore
Halmahera
Papua
New Guinea
Kalimantan
Sumatra
Sulawesi
Irian Jaya
Java Sea
Banda Sea
Java
Flores
Timor
Bali
Lombok
Arafura Sea
Timor Sea
Indian Ocean
0
100 200 300 400 500
Gulf of
Carpentaria
Kms
Wallaces Line
Australia
Map of South-East Asia showing Wallaces line.
To the west, the Asian animal community includes such mammals as the
rhinoceros, orangutan, tapir, tiger and elephant. To the east are found
animals related to Australian fauna. They include birds such as
cockatoos, bowerbirds and birds of paradise as well as marsupials such as
bandicoots and cuscus.
The core areas of the Oriental and Australian provinces are clearly
distinct but overlaps exist on the edges of the boarders. Thus some
biogeographers recognise the region of islands between Java and New
Guinea as a mixing zone of Oriental and Australian fauna.
Rather than try to fix where the line between these two realms should lie,
most modern biologists recognise that the whole Indonesian archipelago
region represents a zone of changeover. Within this zone, the two faunas
progressively replace one another.
This changeover zone exists because, as the Asian and Australian
landmasses drifted closer together, organisms were able to move out of
the places where they originated into new territories.
When the world is divided into zones using the distribution of flowering
plant groups, the resulting zones do not coincide with biogeographic zones
based on vertebrates. What factors could account for the differences in the
distribution patterns of vertebrates and flowering plants?
_________________________________________________________
_________________________________________________________
Check your answer.
Part 1: Evolution
27
Biogeographic distributions
There are three important principles used to determine a biogeographic
zone.
Environment cannot account for either similarity or dissimilarity,

since similar environments can harbour entirely different species
groups.
Affinity or similarity of groups on the same continent (or sea) is

closer than between continents (or seas).
Geographical barriers, such as seas, oceans and mountain chains,

usually divide these different groups. The degree of difference
between families relates to the rate of migration or ability to disperse
across the barriers.
Look back at the world map that shows the biogeographic zones of the
world. Think about the different kinds of plants and animals in each
zone. Think about the different environmental conditions in each zone.
Try to think of some examples to illustrate each of the principles above.
For example, environmental conditions in parts of the Ethiopian zone are
similar to conditions in the Australian zone. Some organisms in these
zones, such as arid area plants, are very similar. However, some
organisms, such as gazelle and kangaroos, are very different. Within the
Australian zone, species of kangaroo and wallaby are much more similar
to each other than they are to organisms in other zones. And notice the
positions of the lines separating zones oceans separate the Australian
zone from other zones, whereas the Oriental and Palaearctic zones are
separated from each other by the Himalayas.
Six degrees of separation

Remember that the degree of separation is the amount of difference
between similar groups of organisms. Three criteria of mammalian
families and their distribution patterns are used to delineate the six
regions known as biogeographic zones, or provinces. These are:
the total number of families
the number of families originating from (endemic to) this province.

This is a measure of uniqueness of the mammalian fauna
the number and location of other regions with which mammalian

families are shared.
Rank the biogeographic zones by dividing the number of endemic families

by the number of shared families. (Hint: Australia would be first because
it only has eight endemic families and only one shared family.
The calculations have been done in the first row as an example.)
28
Blueprint of life
Biogeographic
zone
Total number of
families
Ethiopian
Number of
endemic families
38
12
Number of
shared families
2
Endemic families
shared families
12
2
Neotropical
32
16
Oriental
30
Palaearctic
28
Nearctic
24
Australian
=6
Check your answers.

The comparison of endemic to shared families is used as a measure of
how much biological separation exists between mammals of the
biogeographic zones.
Comparative anatomy
Different groups of organisms often have similar structural features.
This observation is also used as evidence that species can evolve from a
common ancestor.
Comparing the mouthparts of insects

The mouthparts of insects are an example of a similar structure modified
for its function. In various insects, the same basic plan has been
functionally modified for biting, piercing, chewing or sucking.
Part 1: Evolution
29
Vestigial structures
Those structures that functioned in ancestral organisms but are reduced
(in structure and function) in the descendant are called vestigial
structures. Some examples in humans include vertebrae of coccyx
(tailbone) and the appendix on the intestines. In some other mammals,
the appendix is a larger organ with a function in digestion.
Comparing vertebrate forelimbs

The skeletons of vertebrates provide a clear example of structural
similarities. The five fingered limbs (called pentadactyl limbs) of
vertebrates are considered to be similar structures. The hand of a human,
the forefoot of a horse, the flipper of a dolphin and the wing of a bat all
have the five-fingered plan. The same basic plan is modified to serve a
different function for each type of vertebrate.
In your next exercise you will need to observe, analyse and compare the
structure of a range of vertebrate forelimbs. You can do this by looking
at some in a museum, looking them up on the Internet and/or using
information in the diagram in Exercise 1.5.
You will find some helpful starting points on the Science online webpage at:
Now complete the tasks in Exercise 1.5.
Comparative embryology
Embryology is the study of embryos and their development.
Embryologists have discovered that all vertebrate embryos look alike
during their early development. It is almost impossible to distinguish
between the early embryos of fish, chickens and humans. They become
recognisable later in their development.
The common features of embryo development
found throughout the vertebrate group include:
30
gill slits appear even in embryos of fully

terrestrial organisms with no sign of gills
as adults.
tail
notochord develops into vertebrae in

all vertebrates.
gill slits
notochord
tail
A vertebrate embryo.
(Adapted from Messel, Science

for High School Students)
Blueprint of life
Study the following diagram showing the stages of development of four

vertebrate groups and determine which row shows the most similarity.
man
pig
salamander
fowl
Stages of development of four vertebrate groups.
(Adapted from Messel, Science for High School Students)
Check your answer.
Part 1: Evolution
31
Biochemistry
The building blocks of life are fundamentally the same for all living
things and they use the same basic biological molecules for similar
functions. For example, the amino acid building block molecules are the
same in all known species. Biochemists can analyse the sequence of
amino acids of a protein common to many species, match the similarities
and then compare them with other species.
The table below shows the number of amino acids for a common protein
called cytochrome c that are different in humans and another species.
Species compared
Number of different amino acids
human/chimpanzee
human/horse
human/snake
11
human/fly
13
human/cauliflower
19
human/yeast
26
Based on the similarities between amino acid sequences for

cytochrome c:
a) which species is the most similar to humans? _____________
b) which is the least similar to humans? ____________________
What can you infer from this information?

______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.

There are many more techniques used by biochemists and molecular
biologists for showing similarities between species. A good example is
DNA sequencing. These techniques are better explained further on in the
module after you have learnt about DNA and biotechnology in Part 4.
32
Blueprint of life
Other evidence adaptive radiation

There are two other ways to organise evidence that are used to support
the theory of evolution. These use observations from the areas you
have already considered (comparative anatomy and so on).
These other ways are:
divergent evolution
convergent evolution.
When a new area, such as an island, appears or something causes an area

to become vacant, colonising organisms move in. Those with features
best suited to the new environment will function more efficiently, thrive
and produce offspring because there will be little competition for
resources. Adaptations make it possible for these colonising organisms
to cope with the new (changed) environmental conditions.
Because organisms in a population are slightly different from each other,
groups within the population will be able to thrive and reproduce best in
different parts of the new environment, so the groups will gradually
become different from each other. Or, different species could become
more alike to better use the same environment. This is adaptive radiation.
Adaptive radiation commonly occurs immediately following an
evolutionary breakthrough. This means a population with an innovative,
better adapted feature colonises a vacant ecosystem, speciates (forms
species) and radiates to occupy the available space. (Speciation can also
occur in the same environment.)
An example of adaptive radiation dinosaurs and mammals
At the beginning of the Triassic period, some 250 million years ago,
the terrestrial surface of Earth had many environments unoccupied by
vertebrates. The only vertebrates living on land were amphibians
and these were restricted to wet areas close to rivers, lakes and the coast.
1
Why didnt the amphibians venture inland?

_____________________________________________________
_____________________________________________________
_____________________________________________________
Which group of animals would have lived inland?

_____________________________________________________
Part 1: Evolution
33
By the middle and toward the end of the Triassic period, a variety of
egg-laying vertebrates evolved and diversified to occupy every
environment on Earth, including the seas. They were, of course, the
dinosaurs. They are well documented in books, museums, videos and
movies. Their dominance on the planet was to span the Jurassic period
and last some 200 million years.
3
What feature did dinosaurs possess that enabled them to venture

away from water?
______________________________________________________
______________________________________________________
Mammals evolved during the Triassic period but had to be content with
occupying the nooks and crannies of a planet dominated by dinosaurs.
Fossils of mammals from around these times show them to be small
rat-like creatures with little variation among them. They remained this
way for 100 million years.
A mass extinction event, believed to be due to a collision with an asteroid,
caused the dinosaurs to rapidly disappear from their dominant position.
Only one variety is thought to have survived to become the ancestor of birds.
Around 60 million years ago, with the dinosaurs out of the way, the
mammals began to occupy environments and niches left vacant by their
previous occupants. The fossil record shows a sudden increase in
diversity of mammal forms. Eventually millions of mammals ended up
dominating almost every environment on Earth. Some varieties
occupying the seas and oceans gradually changed to become the whales
and dolphins of today.
4
What factors lead to the sudden increase in mammals diversity?

______________________________________________________
______________________________________________________
______________________________________________________
Explain what adaptive radiation means in your own words.

______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
34
Blueprint of life
Divergent evolution
The finches of the Galapagos Islands are examples of many species
evolving from one, to take advantage of the available environments.
Diversity in a species may eventually result in speciation, which is the
creation of new species, when an area or environment has not reached its
potential or been fully colonised. The kind of adaptive radiation that
leads to the evolution of many divergent forms from one species is called
divergent evolution.
It is believed that one species of finch may have arrived on a Galapagos
island and then divergent evolution lead to the many different species of
finch found on the Galapagos Islands today.
Finches of the Galapagos.
Diagram from Biological Science. The Web of Life. 1981. Australian Academy
of Science, Canberra.
Charles Darwin explained adaptive radiation by using the finches of the

Galapagos Islands as an example. Look up this work in a biology book at
your local library or on the Internet (use the words Galapagos, finches and
Darwin in a search engine). Then complete Exercise 1.6.
Part 1: Evolution
35
Convergent evolution
Today there is a staggering array of life forms on the Earth and each
reflects diverse ways of life. There are probably as many ways of life as
there are species.
Many organisms that have evolved independently now live in very
similar ways. Organisms that live in similar environments have the same
selective pressures applied to them. In the example below there are three
different vertebrates groups, all showing a similar body structure. This is
called convergent evolution.
mammal
reptile
fish
The diagrams above show major vertebrate groups that occupied the seas.
What physical features do all these animals have in common?

_____________________________________________________
_____________________________________________________
_____________________________________________________
36
Blueprint of life
Although each sea creature represents a completely different

vertebrate group, they all look very similar. How would the theory
of natural selection (by Darwin and Wallace) explain what caused
each of these vertebrate groups to have the same body shape?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

Another example of convergent evolution can be seen in the shape of
wings for flying. The diagram below illustrates this example.
bat
bird
pterosaur
Adaptation to flight is an example of convergent evolution.
Part 1: Evolution
37
The evolution of evolution
A requirement for this part of the course is that you

assess the social and political influences on the historical development
of theories of evolution.
What does this mean? You can find out by reading the information below
and answering the questions. Then you will have a clearer understanding
of how and why theories of evolution develop.
Introducing the idea of evolution

It is one thing to discover and explain the workings of nature but the rest
of society has to understand and accept it. Developing an understanding
of how species evolve has been one of the greatest human intellectual
endeavours throughout history.
This long journey of discovery took humans from considering
themselves as the most magnificent of Gods creations to just another
species of animal and a very recent arrival at that. The problem with the
scientific explanation for evolution is that it challenged the foundations
upon which western culture is based.
Western societies were governed by religious institutions that controlled
not only politics but also the way people viewed nature. The idea that
God made man in his image to rule over all other living things was
indisputable. Therefore any challenge to this idea was seen as a threat to
the establishment.
What restrictions were there in society to alternative explanations for the
nature of life on Earth?
_________________________________________________________
_________________________________________________________
Check your answer.
38
Blueprint of life
A variation in viewpoint
The two statements below contrast the way variations among individuals
in a population was viewed during ancient Greek times in comparison
with modern biology today.
Ancient Greek Platos view from The Republic
Each species is a fixed entity that never changes. All individual
variations in a population are unimportant imperfections of the ideal
form. The perfect essence of form is made up of the best parts of the
various individuals.
Nineteenth century Darwins view from On the origin of species
Species have always been changing and always will. Variations among
individuals of a population are necessary for natural selection the chief
agent of change. It is these very differences between individuals that
make evolution possible and inevitable.
The current view

Since Darwin/Wallaces explanations for evolution were first proposed,
the science of modern biology was born. Today, biologists use the
principles of evolution by natural selection in their everyday work.
In the Additional resources section, there is a summary of the major
scientific thinkers who have contributed to the modern theory of
evolution. Read these now.
Then complete Exercise 1.7.
Part 1: Evolution
39
40
Blueprint of life
Case study 1: The evolution of kangaroos

The kangaroos offer a unique opportunity to study evolutionary
changes within a group of Australian mammals. This is because they
have the best known fossil record and are the most extensively studied
of all Australian mammals. Also because they have undergone rapid
evolutionary change and are commonly good indicators of restricted
environments.
From Kangaroos: 15 Million years of Australian bounders by Tim Flannery
The earliest record of kangaroos is found among the fossils of the

Etadunna formation in central Australia. These deposits were formed
during the late Oligocene to early Miocene epoch, some 2515 million
years ago.
This region, now a hot dry desert, was cool to temperate and the rainfall
was consistently moderate, with many freshwater lakes and rivers. It was
heavily forested and supported a wide variety of faunas including many
types of marsupials, crocodiles, flamingoes and even freshwater
dolphins.
These early kangaroos were tiny (about the size of a rabbit) and are
believed to have descended from arboreal (tree dwelling) ancestors. The
Musky-rat kangaroo, which lives in the rainforests of north Queensland,
still retains this way of life.
By the middle of the Miocene some 10-12 million years ago, Australia
began to warm up. As time progressed and Australia moved further
north, aridity (dryness) increased and rainfall became seasonal. Forests
began to change and were dominated by eucalypts with some pockets of
open forests and grasslands thriving in the drier conditions. Kangaroos
became abundant, evolving to take advantage of the variety of new
environments emerging from these changes.
Part 1: Evolution
41
They dominated these emerging grassland areas, increasing in size and

rapidly diversifying. The kangaroo fossils of this age show some
evidence of hopping. The fifth toe, which is an adaptation to an arboreal
way of life, has been lost. This can be seen in the diagram of the fossils
showing the paw and toes of a middle Miocene kangaroo.
3
cm
0
Kangaroo fossils of the middle Miocene showing the paw on the left and
toes adapted for hopping on the right (A, B).
These and other fossils from this period show adaptations to a grazing
mode of life. Among some of these habitats, the modern types of
kangaroo developed.
During the Pliocene period, 52 million years ago, the continent
continued to dry out at a faster rate. Rainforests became restricted to the
coastal regions of Victoria, NSW and Queensland. In central Australia
and some coastal areas, woodlands and grasslands had replaced the
rainforests.
The following drawing of a fossil shows the side and top view of
kangaroo molars. Scientists say that they are an adaptation to grazing.
42
Blueprint of life
A
molar
0
molarmolar
3
cm
Top and side view of Pliocene fossil, showing molars adapted to grazing.
By the end of the Pliocene and early Pleistocene times, conditions were
even drier than today. Kangaroos evolved bounding strides to take
advantage of the vast grassland plains that had taken over in the arid
areas. This adaptation was to become more important as grasslands
emerged.
The Pleistocene, 1.6 million years ago to the present, saw the evolution
of vegetation that gave rise to the flora that dominates the continent
today. Ice ages were a feature of this period of time. Effects on the
Australian environment were not as dramatic as in the Northern
Hemisphere but they did influence sea levels, which may have fluctuated
some 200 metres. This is significant when considering land bridges,
especially to the north.
This was the time when the well known marsupial megafauna had
evolved. Kangaroos were at their most diverse. They varied from the
giant kangaroos to small types, being adapted to a variety of
environments. As the drying continued, adaptations to overcome long
periods of drought evolved.
Giant kangaroos, wallabies and wombats and the huge Diprotodon would
have been quite a familiar sight among the first humans when they
arrived some 40 000 to 60 000 years ago. Their presence is believed to
have influenced the demise of the megafauna. The Aboriginal practice of
burning further changed the vegetation and favoured grazing species.
European settlers have been responsible for further extinctions, both
because of hunting and through habitat destruction.
From Kangaroos: 15 Million years of Australian bounders by Tim Flannery.
Part 1: Evolution
43
Case study 2: Southern Antarctic Beech

Forests dominated by southern Antarctic Beech, Nothofagus fusca,
persisted in coastal regions of the Antarctic continent until the late
Oligocene. They co-existed with the emerging glaciers (similar to the way
they exist today in southern Chile) until Antarctica froze over completely.
90
India
Africa
South
America
New Guinea
0
S Antarctica
Australia
New Zealand
Distribution of Nothofagus during the Oligocene.
The diagram following shows the distribution pattern of the Southern

Antarctic Beech (Nothofagus) as it is today. It is found in rainforests in
Tasmania and in the south-eastern Australian mainland. There are also
populations in New Zealand, New Caladonia and New Guinea and also
on the southern tip of western South America.
New Guinea
Australia
New Caledonia
New Zealand
Antarctica
South America
tor
Present day distribution of Nothofagus.
Fossil records and the modern distribution pattern of the Southern Beech
(Nothofagus) show that it originated on the outer edge of Gondwana
during the late Cretaceous period, around 70 million years ago.
44
Blueprint of life
Theories about evolution

For thousands of years, people accepted that living things never change.
There was no need to explain evolution until the evidence that creatures
have changed became overwhelming.
Leonardo Da Vinci (14521519)

Leonardo made geological and palaeontologic observations of rocks and
fossils found in north Italy. The fossils were mostly of Cenozoic
molluscs found on the tops of mountains.
Leonardo hypothesised these shell fossils had once been living things and
that they had been buried at a time before the mountains were raised.
It must be presumed that in those places there were sea coasts, where
all the shell were thrown up, broken and divided.
Leonardos contribution to our understanding of life was to suggest that

fossils indicated the history of the Earth far beyond human records.
Robert Hooke (16351703)

Robert Hooke observed fossils with a microscope and concluded that
shell-like fossils really were the shells of certain shell-fishes. He also
observed that many fossils represented extinct organisms. Palaeontology
had become the science that can be used to help understand the history of
life on Earth.
George-Louis Buffon (17071778)

George-Louis Buffon published Les Epoques de Ja Nature (1788), where
he suggested that life was much older than 6 000 years as suggested by
the Bible. In his 44 volume publication, Histome Naturelle, Buffon
questioned the Churchs doctrines by proposing that organisms changed.
He did not suggest how but noted that the environment acted directly on
organisms. Buffon goes down in history as having paved the way for
others.
Part 1: Evolution
45
Carolus Linnaeus (17071778)

A Swedish botanist who was the founder of the binomial (two name)
system contributed to evolution by suggesting that species in a genus
have arisen through hybridisation. This is where two different
individuals produce a new kind of offspring.
He originally fought the idea that species had changed and believed they
were all created in the beginning and none had become extinct. Later in
life, he showed that his ideas were changing.
Erasmus Darwin (17311802)

A leading eighteenth century intellectual and naturalist, Erasmus Darwin
formulated the first modern theory of evolution in his book, The laws of
organic life.
Describing how one species could evolve into another, he suggested that
sexual selection and competition could cause changes in species. He
wrote:
the final course of this contest among males seems to be that the
strongest and most active animal should propagate the species which
should thus be improved.
He also helped to introduce the concept of adaptation by saying that

organisms are fit for the environment in which they live and that their
structure reflects the functions they perform throughout their lives.
Jean-Baptiste de Lamarck (17441829)

Lamarck is always associated with the discredited theory of evolution
where features acquired throughout an individual lifetime are inherited
by offspring. Lamarck proposed that an organism develops features by
use or disuse throughout its lifetime. For example, a giraffe develops a
long neck by stretching to eat the leaves of tall trees. This acquired
feature is then passed on to its offspring.
Although wrong, Lamarcks ideas did pave the way for natural selection
and made a major contribution to the development of evolutionary
thought.
Sadly his theories were ignored and Lamarck died a poor man. His
colleagues even used the eulogy at his funeral to discredit him.
46
Blueprint of life
Alfred Russel Wallace (18231913)
Just north of Australia, through the middle of Indonesia and between the
islands of Borneo and Sulawesi, is an imaginary line. This line separates
the islands of Bali and Lombok and is called the Wallace line.
Biologists use this line to describe the separation of Australia flora and
fauna from Asian flora and fauna. It was named after Wallace because of
the observations he did in this region. It was in Indonesia that Alfred
Wallace concluded that species evolved by a process called natural
selection. He wrote to Charles Darwin.
Charles Darwin had independently arrived at the same conclusion after
his extensive observations and work at the Galapagos Islands. The
theory of natural selection was actually proposed by Wallace but has
historically become known as the Darwin/Wallace theory of natural
selection to incorporate the work done by Charles Darwin.
Part 1: Evolution
47
Charles Darwin (18091882)
Charles Darwin was a founder of modern biology and author of the

famous book, On the origin of species. He suggested that plants and
animals in nature produce far more offspring than can survive. Each
individual has its own variety of features. There is a continual struggle
for existence. Those individuals with variations that increase their
chance of survival (the fittest) reproduce more. Hence, this interaction
between a variety of individuals and the harsh environment is the direct
cause of change in species and explains evolution.
Charles Darwin was aware of the social and political upheaval his ideas
may cause. He did not publish his famous book about evolution for
almost 25 years, until Wallace suggested the theory, and Darwin felt
more confident about presenting his observations and thoughts.
48
Blueprint of life
Viewpoints about evolution

From the time that the theory of evolution was first presented, it has met
with opposition and misunderstanding. People have tended to react to it
emotionally and philosophically, rather than assessing it as a scientific
explanation that seeks to best explain available evidence.
The theory of evolution does not attempt to undermine religious beliefs
or ideas about the worth of people. Instead, these are non-scientific
arguments that are separate from the debate about whether the theory of
evolution is supported by sufficient scientific evidence and whether it is,
indeed, the best explanation of that evidence.
The theory of evolution has continued to develop and be refined
throughout the twentieth century, as more and more evidence has been
collected. The theory will continued to be used and examined into the
twenty first century because it remains, to date, the best scientific
explanation of many observations of changes in living things, both past
and present.
Here are some examples of social and political thinking about evolution
for you to evaluate.
Example 1: Cartoons
Cartoons are a common way that social comment is made in newspapers
and magazines. There have been many cartoons drawn about evolution.
Some show organisms slowly changing form over time. For example,
look back at the cartoon in the introduction to this part.
Other cartoons were drawn to ridicule evolutionists. (And some have
been drawn to ridicule people who oppose evolution too.) A famous
cartoon from the 1800s shows Charles Darwin looking like an ape.
Example 2: A view of a nineteenth century scientist

What is man? A profound thinker, Cardinal de Bonald, has said,
Man is an intelligence assisted by organs. We would fain adopt this
definition, which brings into relief the true attribute of man,
intelligence, were it not defective in drawing no sufficient distinction
between man and the brute. It is a fact that animals are intelligent,
and that their intelligence is assisted by organs; but their intelligence
is infinitely inferior to that of man.
whence comes man? Wherefore does he exist? the problem is
beyond the reach of human thought. but it will be sufficient for our
present purpose to say that it can be shown that man is not derived, by
Part 1: Evolution
49
a process of organic transformation, from any animal, and that he

includes the ape not more than the whale among his ancestry; but that
he is the product of a special creation.
Let us say that the creation of the human species was an act of God,
that man is one of the children of the great Arbiter of the universe, and
we shall have given to this question the only response which can
content at once our feelings and our reason.
Louis Figuier in his nineteenth century book, The human race.
Example 3: A modern view

You may be able to borrow a book by Stephen J Gould that includes
information about some of these social and political influences.
You could also look at some of the many Internet sites on this subject.
Youll find plenty of information in favour of and opposed to the theory of
evolution. You will find some helpful starting points on the Science online
webpage at: http://www.lmpc.edu.au/science
50
Blueprint of life
Suggested answers
Adaptations to suit environments

Changes in the environment put pressure on the species living there.
Species with features that enable them to survive will thrive and
reproduce while those without the adaptations for survival become
extinct.
Earths constantly changing environment

1
Part 1: Evolution
Features of the environment that may change include:
available water wetter or drier
temperature hotter or colder
pH more acidic or more alkaline
available space - less space or more space
concentration of dissolved minerals
introduction of a new more competitive species
competition from members of the same species.
Some other features are also included in the following table.

Physical
Chemical
Changes to competition
changes in
temperature
predatory competition introduction

of prey/predator
changes in
pressure
availability of
gases such as
oxygen or
carbon dioxide
lack of space
changes in
light
changes to pH
competition from members of the

same species
changes to
salinity
disease
51
a) Adaptations for an area drying out include: a skin coating or

cover to prevent desiccation, more concentrated urine and less
surface area of leaves in plants.
b) Adaptations for a new species of poisonous frog include:
resistance to the poison and seeking alternative food sources.
c) Adaptations for increased salinity include: the ability to absorb
water by active transport and the ability to excrete salt as a
waste.
The fossil record of horses

24
11
20
17
17
12
16
12
10
15
9
12
13
6
5
8
16
16
13
9
14
60
Middle
EOCENE
Late
Early Middle Late

40
OLIGOCENE
Early
30
Middle
MIOCENE
Late
Early Middle Late

10
PLIOCENE
1 0
52
PLEISTOCENE
Early
They have descended from a common ancestor and did not give rise
to one another at the same time.
The span is becoming longer in length.
There is diversity in the teeth span: some less, some more.
They may have originated from the same ancestor as Miohippus.
There are many valid interpretations.
Blueprint of life
Here are two possible alternative answers.

24
11
20
17
17
12
16
12
10
15
9
12
13
6
5
16
16
13
14
Middle
Late
EOCENE
60
Early Middle Late

40
OLIGOCENE
Early
Middle
Late
MIOCENE
30
Early Middle Late

PLIOCENE
10
PLEISTOCENE
Early
1 0
24
11
20
17
17
12
16
12
10
15
9
12
16
7
6
5
13
16
13
14
60
Middle
EOCENE
Late
Early Middle Late

40
OLIGOCENE
Early
30
Middle
MIOCENE
Late
Early Middle Late

10
PLIOCENE
Part 1: Evolution
PLEISTOCENE
Early
1 0
To decide which graph is best (yours or either of the ones above),

you would need to use data from other characteristics of these
organisms, not just the span of their cheek teeth.
53
Your answers for the following questions depend upon how similar your
graph is to the ones shown.
7
4 cm
About 10.5 cm
The horse evolves slowly at first, then, after a series of rapid

diversifications, evolves quickly.
10 Many organisms dont preserve very well. Life forms, as recorded

in fossils, are still only a fraction of the number that have ever lived.
We are only just finding new techniques for determining the makeup
of past life forms. With further development in these areas, more
knowledge will be obtained.
Transitional fossils
Scientists want to find the steps that led from one life form to another.
Although most modern scientists do not expect to find real transitional
forms in between organisms they continue to search for evidence of
evolution.
Biogeography as evidence for evolution

The borders of the biogeographic zones are oceans and mountain ranges.
Wallaces line
Most vertebrates, apart from birds and bats, are restricted to regions
bordered by coastlines and mountain ranges. Flowering plants have
dispersal methods which enable them to be distributed beyond these
limiting barriers.
Six degrees of separation

In order from most different to least different are: 1 Australian (8),
2 Ethiopian (6), 3 Neotropical (5.3), 4 Nearctic (1.3) and Oriental (1.3),
and 6 Palaearctic (0.6).
Comparative embryology
The middle row is the most similar.
54
Blueprint of life
Biochemistry
1
a) chimpanzee
b) yeast
The more closely related the species, the fewer number of amino
acid differences.
Other evidence adaptive radiation

1
Amphibians reproduce in water and their early stages of

development require a life in water.
Insects and other arthropod groups could live inland.
Dinosaurs reproduced by internal fertilization and laid eggs.
Ecosystems left vacant by the perishing dinosaurs enabled mammals

to diversify and establish themselves in new specialised niches.
They had plenty of food and little competition for resources.
Adaptive radiation is when one group or species evolves into two or

more groups to occupy new niches.
Convergent evolution
1
The physical feature that they all have is a streamlined body. This is
an adaptation for overcoming the viscosity of water.
Moving about through water swiftly is important for the survival of

these animals. Natural selection has selected animals which have
evolved to this shape so these very different animals look much the
same.
The evolution of evolution

Politics was centred around the beliefs of the church. Alternative
explanations were against the dogma of the church; therefore they
challenged the establishment.
Accepting an idea such as evolution of species required people, including
scientists, to sort through many issues, including what science is, what
religion is and why human society is organised in particular ways.
Part 1: Evolution
55
56
Blueprint of life
Exercises Part 1
Name: _________________________________
Exercise 1.1: Earths constantly changing environment

a)
List some physical conditions that might change in the environment.

_____________________________________________________
_____________________________________________________
b) List some chemical conditions that may change in the environment.

_____________________________________________________
_____________________________________________________
c)
How might these changes impact on the evolution of plants and

animals? Choose two physical changes and two chemical changes
that you have listed and outline their effects.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 1: Evolution
57
Exercise 1.2: An open-ended investigation of natural

selection
Describe an open-ended investigation that you have done that illustrates
natural selection.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 1.3: A case study

Name of Australian species studied: ____________________________
Describe changes in this species that have occurred over time because of
changes in chemical or physical conditions, or because of increased
competition for resources.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
58
Blueprint of life
Exercise 1.4: Wallaces line

The Wallace line falls between Borneo and Sulawesi and between the
tiny islands of Bali and Lombok. The latter pair of islands is separated
by a mere 30 km, but for the most part they are inhabited by different
families of mammals and even different birds.
Philippines
Celebes
Sea
Sabah
Limit of native placental

mammals other than bats,
Muridea, Sus and Cervus
Pacific Ocean
Limit of marsupials
Borneo
1000 km
Sulawesi
Irian Jaya
Wa
llac
e s
Lin
Halmahera
Papua
New Guinea
Banda Sea
Sumbawa
Flores
Timor
Arafura Sea
Timor Sea
Australia
Gulf of
Carpentaria
Australia
a)
How would you account for these differences?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) How did these observations influence Wallace to propose his theory

of evolution?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 1: Evolution
59
Exercise 1.5: Comparative anatomy

a)
Compare the finger bones labelled 1, 2, 3, 4 and 5 for a bat, human,

whale, lizard, cat, frog and bird by filling in the following tables.
The first entry in each table is done for you.
humerus
Bat
humerus
ulna
Human
radius
humerus
carpal
radius
1
Bird
radius
ulna
ulna
carpal
5
5
carpal
humerus
4
2
radius
ulna
carpal
Whale
5
3
4
3
3
2
Lizard
humerus
humerus
Cat
Frog
ulna
humerus
radius
radius
radius
1
ulna
ulna
carpal
2
3
5
carpal
carpal
4
1
2
1
5
3 45
2
4 3
Fingerbones of vertebrates.
60
Blueprint of life
) or absent (x)
Fingerbone present (
Organism
frog
lizard
bird
cat
bat
whale
human
Analyse how the structure is related to the function of each by filling in

the following table.
Organism
Function of limb
frog
limb used for support and cleaning
lizard
bird
cat
bat
whale
human
Part 1: Evolution
61
b) Compare the structure of the pentadactyl limb for three of the above
vertebrates.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
c)
How would an evolutionary biologist explain the pentadactyl features?

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
62
Blueprint of life
Exercise 1.6: Other evidence adaptive radiation

Describe how the finches of the Galapagos Islands are an example of
adaptive radiation.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Part 1: Evolution
63
Exercise 1.7: The evolution of evolution

a)
Do your own research on the historical development of theories of

evolution. You can also use the material in the Additional resources
section titled Theories about Evolution. Present your information
in the table below.
Identify the data source(s) you used.
______________________________________________________
______________________________________________________
______________________________________________________
Name of scientist
Dates
Contribution
Leonardo Da Vinci
Robert Hooke
George-Louis Buffon
Carolus Linnaeus
Erasmus Darwin
Jean-Baptiste de
Lamarck
Alfred Russel Wallace
Charles Darwin
64
Blueprint of life
b) Do your own research on social and political influences on the

development of the theory of evolution. (You can also read the
information in the Additional resources section.)
How do you think social conditions and political ideas have affected
the development and acceptance of an evolutionary explanation for
life on Earth?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 1: Evolution
65
Biology
HSC Course
Stage 6
Blueprint of life
Part 2: Patterns of inheritance
Contents
Introduction ............................................................................... 2
Gregor Mendel and his work ..................................................... 4
The principles of heredity ........................................................ 15
Monohybrid crosses ...........................................................................15
Mr Punnett and his squares...............................................................19
Investigating human variation.................................................. 22

Pedigrees ................................................................................ 25
Constructing a pedigree.....................................................................25
Using a pedigree to investigate a trait...............................................28
Using a pedigree to make predictions...............................................30
Hybridisation in farming practices............................................ 33

Exercises Part 2 ................................................................... 41
Introduction
The idea that offspring inherit features from their parents has been
known for a long time. It was believed that the features inherited from
each parent blended together.
The Austrian monk, Gregor Mendel, decided to breed pea plants and
study one clearly defined characteristic at a time. He kept a careful
statistical record of results and his conclusions became the basis of the
laws used to explain how offspring inherit features from their parents.
Once fundamental patterns of inheritance were understood the ability to
predict the types of offspring likely to be produced became possible.
This study of inheritance gave birth to the science of genetics and was a
boost to agriculture and breeding. Today it is important to medical
practitioners investigating the likelihood of people inheriting diseases.
This section outlines the experiments carried out by Mendel, now
regarded as the founder of genetics, and explains how his experimental
techniques led to an understanding of the patterns in inheritance. This
will enable you to describe the basis of Mendels experiments and
teaches you skills that you can use to solve problems involving
inheritance.
In this part you will have opportunities to learn to:
outline the experiments carried out by Gregor Mendel
describe the aspects of the experimental techniques used by Mendel

that led to his success
describe outcomes of monohybrid crosses involving simple

dominance using Mendels explanations
distinguish between homozygous and heterozygous genotypes in

monohybrid crosses
distinguish between the terms allele and gene, using examples
Blueprint of life
explain the relationship between dominant and recessive genes and

phenotype using examples
outline the reasons why the importance of Mendels work was not
recognised until some time after it was published.
perform an investigation to construct pedigrees or family trees, trace

the inheritance of selected characteristics and discuss their current
use
process information from secondary sources to analyse and solve

problems involving monohybrid crosses using Punnet squares or
other appropriate techniques
process information from secondary sources to identify and describe

examples of hybridisation in horticulture or agriculture and explain
its advantages/disadvantages.

Boards website at:
Gregor Mendel and

his work
It requires indeed some courage to undertake a labour of such farreaching extent; this appears, however, to be the only right way by
which we can finally reach the solution of a question the importance
of which cannot be overestimated in connection with the history of the
evolution of organic forms.
From Mendels famous paper, Experiments in Plant Hybridisation,
published in 1865.
In the mid 1800s, an Austrian monk and keen botanist called Gregor
Mendel observed that the offspring of certain plants had physical
characteristics similar to those of its parents and ancestors. He wondered
why related organisms had a tendency to resemble one another and if it
could be explained.
Blueprint of life
Observing traits
Mendel reasoned that close observations of inheritance might provide the
answers. So in 1857 he decided to conduct breeding experiments with
the pea plant (Piscum sativum) because it had a short reproductive cycle.
He selected plants and caused them to reproduce. This is called
performing a cross (X), or crossing the plants. Then he compared
features of the parent plants with those of the new plants produced.
Mendel studied seven separate characteristic features of pea plants.
These features or characteristics are referred to as character traits
(pronounced trays with a silent t near the end). The seven traits Mendel
examined were plant height, flower colour and position, seed colour,
seed shape and pod colour and shape.
He noted that each trait comes in two different forms or factors. For
example, the seed pod colour is either yellow or green. This means that
the trait for pod colour has a yellow factor or green factor.
Examinations of the seed shape factor led to an interesting observation.
Mendel wrote:
the hybrid character resembles that of one of the parental forms so
closely that the other either escapes observation completely or cannot
be detected with certainty.
A hybrid refers to the offspring that result from a cross between parents
with different factors.
When Mendel used plants with round peas and ones with wrinkled peas as
the parents, only plants with round peas were observed.
1
Which plants were crossed?

_____________________________________________________
_____________________________________________________
What feature do the offspring (or progeny) have?

_____________________________________________________
What is the hybrid character that Mendel refers to in the extract above?
_____________________________________________________
Check your answers.
Dominant and recessive traits

Mendel stated that those characters that are transmitted unchanged are
termed dominant. The feature not visible in the appearance of the
offspring was said to have hidden or stored hereditary information.
In Mendels experiment, when the round pea hybrids were crossed, the
wrinkled factor reappeared unchanged in some of their offspring.
Mendel wrote:
the expression recessive has been chosen because the characters
thereby designated withdraw or entirely disappear in the hybrids, but
nevertheless reappear unchanged in their progeny.
Each of the seven traits that Mendel studied had a dominant factor and
a recessive factor. The feature exhibited by all of the offspring in the
first generation is the dominant factor and the recessive factor is the
feature that has been hidden but is shown, or expressed again in the
second generation.
Mendels results are summarised in the following table.
Expt
Trait examined
First generation
Second generation
seed shape
all round
5474 round,
1850 wrinkled
seed colour
all yellow
6022 yellow,
2001 green
flower colour
all violet-red flowers
705 violet-red,
224 white
form of seed pods
all inflated pods
882 inflated,
299 constricted
colour of seed pods
all green pods
428 green pods,

152 yellow
position of flower
all axial
651 flowers axial,

207 flowers terminal
length of stem
all long stem
787 long stem,

277 short stem
Blueprint of life
Use information from the previous table to complete these tasks.

1
Has the recessive factor been destroyed in the first crossing?

How did Mendel explain its reappearance?
_____________________________________________________
_____________________________________________________
_____________________________________________________
Complete the table below. The first row has been done for you.
Expt
Trait examined
Dominant
factor
Recessive
factor
Ratio in second
generation
seed shape
round
wrinkled
round
5474
=
wrinkled 1850
seed colour
flower colour
form of seed pods
colour of seed pods
position of flower
length of stem
Are the ratios for the second generation similar? ______________
What is the average ratio of dominant to recessive factors in the

second generation of all the traits examined?
_____________________________________________________
In terms of scientific method, why did Mendel use such a large

number of pea plants for his investigations?
_____________________________________________________
_____________________________________________________
Check your answers before reading on.
Mendels conclusions
From his investigations with pea plants, Mendel made some conclusions
about how characteristics are inherited.
Each characteristic is controlled by a pair of factors in the parents

which are passed on in the gametes (sex cells that form offspring).
These factors separate when gametes are formed. The gametes then
contain only one factor from the pair.
At fertilisation, gametes unite at random therefore ratios of offspring

are predictable.
One factor (the dominant factor) may mask the effect of the other
(the recessive factor) when both are present.
The factors are unchanged from generation to generation, even when

their effect is not expressed (does not produce an observable
feature).
Mendels success
Mendel succeeded in finding a pattern to explain and predict the
inheritance of many features. From what you have read about his
experiments, why do you think he was successful in finding the pattern?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Here are some features of his experimental techniques that contributed to

his success.
Mendel studied character traits that had a clearly distinguishable pair

of factors.
Mendel carried out an enormous number of experiments using a

large number of plants for each.
Mendel took care to keep the plants of one experiment isolated from
other experiments. He personally transferred the pollen from one
plant to the other using hand pollination techniques. He also
collected the seeds and sowed them himself.
Mendel rigorously collected data and kept a thorough record of

results obtained. He used mathematical and statistical analysis on
this data to interpret the results of his breeding experiments.
Blueprint of life
Explaining Mendels observations

Mendel explained his observations by denoting the dominant factor with
a capital letter (eg. A) and the recessive factor with a small letter (eg. a).
Each individual has a pair of factors. Therefore, the possible factors that
individuals can have for this feature are:
AA pure dominant form
aa pure recessive form
Aa hybrid form.
Mendel used letters such as these to explain how the 3:1 ratio was
obtained in each of his experiments. Remember that offspring inherit
one factor for the feature from each parent during crossbreeding.
Looking at an example
Consider the example of round seeds (R) and wrinkled seeds (r).
Complete the following table for this feature.
Form
Factors
pure dominant
pure recessive
hybrid
Check your answers.

What will happen if a pure dominant (round-seeded) parent is crossed
with a pure recessive (wrinkle-seeded) parent?
The pure dominant parent can only produce
gametes that contain the dominant (R) factor.
The diagram to the right shows how this is
often represented.
RR
parent
R gametes
The pure recessive parent can only produce gametes with the recessive
(r) factor.
Because each offspring must inherit a factor from each parent, you can
see that the progeny in the first generation can only ever be Rr.
Here is a diagram to represent this cross.

wrinkled (rr)
round (RR)
RR
Rr
rr
Rr
Rr
Rr
All round but carry the hidden factor for wrinkled peas (Rr)
So all the offspring of a cross between pure dominant round-seeded

plants (RR) and pure recessive wrinkle-seeded plants (rr) are
round-seeded hybrids (Rr).
Now look at what happens when you cross the hybrid forms to produce
the second generation.
round (Rr)
round (Rr)
Rr
RR
Rr
Rr
Rr
rr
round : wrinkled = 3 : 1
10
Blueprint of life
Did you notice how each hybrid parent can contribute a dominant (R)
factor or a recessive (r) factor? To determine the possible combinations
of these factors, Mendel used a mathematical device called binomial
expansion. Here is an explanation.
There are four possible ways the offspring can inherit a factor from each
parent.
Using the first factor
in each pair:
Rr
Rr
RR
Using the second factor

in each pair:
Rr
Rr
rr
Using the inside factors

in each pair:
Rr
Rr
Rr
Using the outside factors

in each pair:
Rr
Rr
Rr
There is an equal chance of each of these four possibilities. Therefore, if
you observe a large enough number of crosses (and Mendel used
thousands), there should be an equal proportion of each.
Hence:
one quarter will be RR, pure round-seeded
one quarter will be rr, pure wrinkle-seeded
two quarters (or a half) will be Rr, the hybrid round-seeded form.
The ratio predicted by this explanation is

round-seeded plants : wrinkle-seeded plants = 3 : 1
This was the ratio that Mendel observed.
11
Another example
The diagram below represents the observed results of Mendels
experiments to study the inheritance of plant stem length in pea plants.
Parents
(one pure tall,
one pure short)
First generation
(all tall)
Second generation
(787 tall and 277 short)
Using the letter T for the dominant factor and t for the recessive factor,
answer the questions that follow.
1
Mendel used pure long-stemmed plants and crossed them with

short-stemmed plants. What factors were inherited in the
first generation of plants?
______________________________________________________
12
Blueprint of life
What ratio of long-stemmed to short-stemmed plants was observed

in the second generation?
_____________________________________________________
Use letters to represent the possible offspring in the second

generation.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.
Recognition of Mendels work

After eight years of collecting data from nearly 30 000 pea plants,
Mendel discovered the natural laws of inheritance. Mendels findings on
plant hybridisation were presented in two lectures before the Society for
the Natural Sciences in 1865 in Brnn, Moravia (now called Brno in the
Czech Republic).
His paper, Versuche ber Pfanzenhybriden, was published in the
Societys proceedings in 1866 and sent to 133 other associations of
natural scientists and to the more important libraries in a number of
different countries.
Unfortunately, there was no response to his findings and its importance
was not recognised until 34 years after the publication of his results.
Mendels approach and the nature of his experimentation were simply
too unconventional for his age. Nobody before him had ever attempted
to use mathematical and statistical analysis as a means of interpreting the
results of biological experiments. Biologists in those days were mostly
people interested in natural history (observing and recording the features
and behaviour of things in the world around them) and not necessarily
familiar with mathematics.
Mendel sent his reports to the most famous botanist in Europe at the
time, Karl Wilhelm von Nageli of Switzerland. He hoped to gain his
sponsorship (support of his work) but Von Nageli ignored Mendels
work and sent it back to him. Mendel was able to get his paper published
in a scientific journal several years later but no-one acknowledged it
because he was an unsponsored amateur.
13
Another reason for the absence of any response from the scientific
fraternity of the day was the limited number of people who read the Brno
Associations records. Also Mendel was known as a relatively shy
person and might not have presented his results with the necessary
emphasis and stress to get others to notice them.
Just before his death on January 6, 1884, he commented:
my scientific labours have brought me a great deal of satisfaction, and I am
convinced that before long the entire world will praise the result of these
labours.
And that is what happened. By the end of the nineteenth century,

breeders and horticulturists were looking for a reliable set of rules to
ensure the propagation of certain features in their crops and livestock.
Then, in the spring of 1900, an amazing coincidence occurred. Three
botanists, Hugo de Vries from Holland, Carl Correns from Germany and
E. von Tschermak from Austria, independently reported the same
conclusions as Mendel. This amounted to a rediscovery of Mendels
inheritance research, verifying his work and giving rise to a new branch
of biology called genetics. Each of these men gave full credit to Mendel
for the discovery.
14
Blueprint of life
The principles of
heredity
You have been studying Mendels experiments that examine the inheritance
of a single trait involving one pair of factors. Breeding experiments of this
kind are called monohybrid crosses. (Mono- refers to the one feature being
studied and -hybrid refers to the two forms of the feature.)
Monohybrid crosses
Monohybrid crosses are the simplest way to study how features are
inherited. There are only four kinds of monohybrid crosses involving
simple dominance. They are:
crosses of two of the same pure breeding forms

For example, AA AA or aa aa
The offspring of these crosses will always be the same as their parents.
crosses of a pure breeding dominant with a pure breeding recessive

For example, AA aa
You will recall that this type of cross results in all the offspring having
the hybrid form of the feature. In this case, Aa.
crosses of a pure breeding dominant with the hybrid form

For example, AA Aa. If you use the technique explained
previously you will notice the following outcome:
AA
AA
Aa
Aa
AA
Aa
Half of the offspring are pure breeding dominant and the other half
are hybrids. However, they will all look alike.
15
crossing a pure breeding recessive with the hybrid form

For example, aa Aa. Use the technique above to determine the
possible outcomes of this cross. Show your working as a diagram.
Check your answer.

Mendels explanations were based on the language of his day. It has
limitations when trying to describe the complexities of todays genetics.
You need to learn how to use some new words so that you can go on
further with this module.
Homozygous and heterozygous

An organism with a pure breeding trait is said to be homozygous for that
feature. So AA and aa are both homozygous; AA is pure breeding
dominant and aa is pure breeding recessive.
The hybrid character is called heterozygous. Aa is an example.
To help you to remember these terms better, just remember the
word stem:
homozygous when a trait has the same two factors
heterozygous when a trait has two different factors.
To help you to recognise and use these terms better, complete the following
tasks then check your answers.
1
Brown eyes in humans are dominant over blue eyes. Using the letters
B for dominant and b for recessive, write the letters for:
a) homozygous for blue eyes ____________________________
b) homozygous for brown eyes __________________________
c) heterozygous for brown eyes __________________________
Predict the likelihood of a couple, heterozygous for brown eyes,

having a baby with blue eyes.
______________________________________________________
______________________________________________________
Check your answers.
16
Blueprint of life
Genes and alleles

The word factor is not used much today because it is now known that genes
are responsible for transmission of inherited information. The word gene
comes from the Greek word genesis that means birth. The term genetics was
coined by the famous British biologist William Bateson in 1902.
A gene is a unit of genetic material with information about one feature.
Alleles are alternative forms of a gene. For example, the height of a pea
plant (length of stem) depends on the organism having genes for tallness.
Each plant has two genes for this trait. The plant can be pure breeding tall
(homozygous, TT) with identical alleles; it can be hybrid tall (Tt) with
different alleles; or it can be pure breeding short (tt) with identical alleles.
Consider the cross below.
hybrid tall plants
Which plant(s) definitely:

1
has/have identical alleles? ________________________________
has/have different alleles? ________________________________
is/are homozygous? _____________________________________
is/are heterozygous? ____________________________________
Check your answers.

17
Genotype and phenotype

In Mendels experiments, each trait observed was a result of the
expression of one or both genes in a pair of genes. (Not only are genes
responsible for the transmission of information but they control what an
organism looks like.)
The appearance of a trait in an organism is called its phenotype.
The genetic information that produces the trait in the organism is called
its genotype. For example, for the feature of plant height (length of
stem), the tallness phenotype can be expressed by two genotypes TT
or Tt. The genotype for the recessive short phenotype is tt.
Whenever you do problems and calculations involving genotype, use the
letters that represent the genes. When describing phenotype, just
describe the looks of the trait in the organism.
1
Complete the table below for the trait of seed shape, that involves the
alleles R (the gene for round seeds) and r (the gene for wrinkled seeds).
Phenotype
Genotype(s)
round seeds
wrinkled seeds
Why are there only two phenotypes for this trait?

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
18
Blueprint of life
Mr Punnett and his squares

Reginald Crundall Punnett was born in England in 1875. He was a
geneticist who, with William Bateson, discovered genetic linkage.
(Youll learn more about genetic linkage later in the module.)
Punnetts work helped to establish Mendels theories. In fact, in 1905
he wrote a book called Mendelism.
In 1912, Punnett became a fellow of the Royal Society of London and
was named professor of genetics at Cambridge. He is best known for
devising the Punnett square for summarising the fusion of gametes in
genetic crosses. (Punnett is spelt in a variety of ways in different books,
including punnet, Punnet and punnett.)
A Punnett square is constructed in the following way.
1
Draw a 3 3 grid.
Write the alleles for one parent

(often the male) in the left
column and the alleles for the
other parent (often the female)
in the top row.
For example, Rr Rr
RR
Rr
Rr
rr
+
R
r
Fill in the empty squares by

combining the gametes as
shown. When you combine
the genes in the gametes, you
are finding out the genes that
are in the offspring.
So the offspring have genotypes of RR, Rr, Rr and rr. That is, one
quarter are homozygous dominant, one half are heterozygous and one
quarter are homozygous recessive. Their phenotypes for this trait will be
three with the dominant feature to one with the recessive feature, or 3 : 1.
19
Use Punnett squares to solve the following problems.

1
What are the possible genotypes and phenotypes for the offspring of a
couple who have brown eyes? The male is homozygous (BB) and the
female is heterozygous (Bb).
a) Draw a 3 3 grid.
(It has been done for you.)
b) Write the alleles for one
parent in the left column
and the alleles for the other
parent in the top row.
c) Fill in the empty squares by

combining the gametes.
d) Now answer the question in the problem.
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
2
What is the genotype and phenotype of a person who has a

homozygous brown-eyed mother and a blue-eyed father?
a) Draw and complete a Punnett square.
b) Answer the question in the problem.

__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
20
Blueprint of life
Determine the possible genotypes and phenotypes for the offspring

of a couple where the male is blue-eyed (bb) and the female is
brown-eyed but has a blue-eyed father.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
In each of the problems above, the characteristic (eye colour) can have
two phenotypes but there are three possible genotypes (BB, Bb and bb).
4
Using this example, explain the relationship between dominant and

recessive genes and the phenotype observed.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________

21
Investigating
human variation
You have been looking at the variation that Mendel studied in pea plants.
Variation in humans has also been extensively studied. Complete your
own investigation of human variation by reading and following the
instructions below.
Aim
A single pair of genes (alleles) controls certain traits or characteristics in
humans. The aim of this activity is for you to examine some of these human
inherited traits in yourself and someone you know.
Procedure
Read the list of some human traits and their descriptions below.
Then determine which of these characteristics you possess. Record your
phenotype and genotype in the result table on the next page. Then
identify and record the information for a friend or family member.
List of some human traits
22
ear lobes
may be attached or free. Free ear lobe (G) is dominant over

attached (g)
cheek dimples
may be present in one cheek only, in both cheeks or there may

be more than one dimple in each cheek. Dimples (D) is
dominant over no dimples (d)
tooth gap
may occur in the centre of the top row of teeth. Front teeth
close together (T) is dominant over a tooth gap (t).
vision
short or long sight (V) are dominant over normal vision (v)
eyelashes
long eyelashes (S), 10 mm or more, are dominant over short

eyelashes, less than 10 mm (s). (Use a small ruler to measure
the length of eyelashes)
tongue rolling
the ability to roll the sides of the tongue upwards to form a

U-shape. This ability is dominant (R) over inability to roll the
tongue (r)
Blueprint of life
widow's peak
where the hairline on the forehead comes down to a peak in the

middle is dominant (W) over a straight or curved hair line (w)
freckles
spots on the skin (freckles) are dominant (F) to no freckles ((f)
mid digital hair
hair on the back of the middle segments of the fingers. Hair on

the middle segment of one or more fingers (H) is dominant over
lack of hair on the middle segments of the fingers (h)
handedness
right-handedness (P) is dominant over left-handedness (p)
second toe
length
the second toe may be shorter than the big toe, which is
dominant (B), or longer than the big toe, (b)
hair form
determined by a pair of genes, which are incompletely

dominant. Homozygous gene combinations produce straight
hair (CC) or curly hair (cc) while the heterozygous combination
produces wavy hair (Cc). Youll learn more about this in Part 3.
Results
Characteristic
For you
Phenotype
Possible
genotype
For a friend or relative

Phenotype
Possible
genotype
ear lobes
cheek dimples
tooth gap
vision
eyelashes
tongue rolling
widow's peak
freckles
mid digital hair
handedness
second toe length
hair form
23
Discussion
Compare your features with someone else in your family. Can you see
any pattern in features that may have been inherited?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
24
Blueprint of life
Pedigrees
A pedigree is a record of the features of family members. It is often

shown as a diagram. You might call this diagram a family tree. It can
help you to examine and explain the inheritance of the feature.
A pedigree is quite easy to draw if you follow the instructions below.
Constructing a pedigree
1
Start with the parents.

Use the male and female
symbols shown.
Draw all the offspring of
these parents using the same
symbols for male and female.
male
parents
son
For each offspring that has had

children, draw in their partner,
husband or wife.
daughter
parents
son
female
daughter daughters
husband
25
Repeat step 2 for the next generation.
F (parents)
father
mother
F1 (first generation)
son
daughter
daughters husband
F2 (second generation)
daughters children
Notice that the son has no children but the daughter has two sons and
one daughter.
An example of a family pedigree

From the description of the Vassallo family below, draw the pedigree.
My mother and father had me first (a boy) and then they had my two sisters.
The first born sister has one daughter. The next sister has a son and a
daughter. I have two daughters.
Check your answer.
26
Blueprint of life
Other pedigrees
Some people have more complicated families, as in the example
shown below.
my father
my adopted
older sister
my mothers
second husband
my mother
me
my sister
my brother
half
sister
half
brother
second
husbands
first wife
step sister
Look at the differences between a sister, adopted sister, half sister and
stepsister.
Now try drawing your own family pedigree in the space below.
27
Using a pedigree to investigate a trait

To investigate the inheritance of a feature, you draw up a pedigree then
colour in each member who displays that trait. Here are the pedigree
symbols to use.
Standard set of pedigree symbols
male without the trait being investigated

male with the trait being investigated
female without the trait being investigated
female with the trait being investigated
Notice how the individuals with the trait are coloured in.
Hair form in the Vassallo family
Suppose you were to investigate the inheritance of the trait for curly hair in
the Vassallo family. (You drew their family tree in an earlier activity.)
The person who wrote the original statement says that both he and his father
have curly hair and so does his second daughter and his first sister.
His second sister has straight hair but her husband and both their children
have curly hair.
Shade in the symbols for people with the curly hair trait on the pedigree
below.
my parents
my mother
my father
me and my sisters
me
my sisters
my niece
our children
my children
my nephew
my niece
Check your answer.
28
Blueprint of life
How are pedigrees used?

Taronga Zoo and zoos all around the world use pedigrees to record the
mating of animals in their breeding programs. In this way, zoos can
prevent diseases that occur when closely related organisms reproduce.
(This is called inbreeding and tends to cause disease because it is more
likely that related parents will carry a recessive gene for the same disease.)
To prevent inbreeding, zoos plan outbreeding programs by including
unrelated animals from other zoos around the world.
The royal family of Europe
A famous example of inbreeding is shown in the pedigree below.
Royal families traditionally marry other royal people. These means that
many closely related people have reproduced together in the royal
families of Europe.
The pedigree below shows members of the royal families of Europe since
Queen Victoria (mid 1800s). It shows all the members with a genetic
disease called haemophilia. Haemophilia sufferers are unable to produce
Factor 8, which is responsible for the clotting ability of blood. This
means that even a small injury can cause death due to excessive bleeding.
The inheritance of this trait can be examined and even predicted by
studying this pedigree.
Prince
Albert
Victoria
EdwardVII Alexandra
Alice
Alfred
Queen
Victoria
Helena Louise Arthur
Leopold
Bertrice
Frederick
William
Mary
George V
Victoria
Irene
Nicholas II
of Russia
Alexandra
Alice
Alfonso XII Victoria Leopold Maurice

of Spain
Eugenia
Prince
Andrew of
Greece
?
George VI
Margaret
Elizabeth
Elizabeth II
Alice Waldermar Henry of

of Prussia Prussia
Alexis
died in Alfonso
Rupert
(Tsarevich) (Viscount infancy (Crown
Trematon)
Prince of
Asturias)
Gonzalo
Philip
(Duke of Edinburgh)
Charles Anne Andrew Edward
29
Using a pedigree to make predictions

Sometimes you can determine the genotype of the parents by looking at
the childrens phenotypes as well as those of the parents. A pedigree is a
useful tool for solving these kinds of problems.
For example, a blue-eyed male (recessive trait) has four children with a
brown-eyed female. Two of the children have blue eyes. You can use a
monohybrid cross to determine that the mother was a hybrid, or carrier of
blue eyes, giving them a 50 : 50 chance of having blue-eyed children.
1
Here is an example of a family whose pedigree shows members with

blue eyes (the coloured in members of the pedigree).
parents
F
children
F1
grand
children
F2
10
11
12
13
14
15
16
18
17
a) Predict the phenotype for 10, 11 and 12. Explain your answer.
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
b) Predict the genotype for 6. Explain your answer.
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
30
Blueprint of life
Study the pedigree below.
F
2
F1
3
F2
10
11
12
13
14
15
16
17
18
a) Is the trait being investigated dominant or recessive? Explain.

_________________________________________________
_________________________________________________
_________________________________________________
b) What are the chances of each of the first generation having the
recessive genotype?
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
c) If the parents just kept on having children, what chance would
there be of the dominant trait eventually showing through?
_________________________________________________
_________________________________________________
_________________________________________________
d) What could be the possible genotypes for each of the members
numbered below?
2
_______
______
______
11 _______
_______
______
______
15 _______
31
Dominant traits can get a bit trickier because you need to determine
whether the character being investigated is homozygous or heterozygous.
Studying a pedigree of the family can help you to do this.
3
Consider this example.
F
2
F1
3
F2
10
11
12
13
14
15
16
17
18
a) The trait being studied in this pedigree is recessive. The parents

(1 and 2) do not have the trait yet two of their children (5 and 7)
do. Explain the inheritance of the recessive trait in 5 and 7.
__________________________________________________
__________________________________________________
b) Is 9 homozygous or heterozygous? Explain.
__________________________________________________
__________________________________________________
c) Is 6 homozygous or heterozygous? Explain.
__________________________________________________
__________________________________________________
d) How could you determine if 4 is homozygous or heterozygous?
__________________________________________________
__________________________________________________
32
Blueprint of life
Hybridisation in
farming practices
By now you should have a bit of an idea of what hybrid means in
genetics. You learnt that the hybrid form of a trait results from the
inheritance of two different alleles.
In horticulture and agriculture, hybrid has a much less specific meaning.
A hybrid is produced from parents with very different characteristics.
Offspring produced from two quite different varieties of a species or even two
different species (as in the case of a mule) will be hybrids of those parents.
Producing hybrids is a very common practice amongst plant breeders.
Triticale is an example of a species produced by crossing wheat and rye.

(Photo: J Haeusler)
Hybridisation is the practice of selecting parent stocks with different

characteristics on purpose in order to obtain more desirable features in the
offspring. There are many advantages of using hybridisation. As soon as
farmers began to produce hybrid crops, their productivity increased. Plant
nurseries sell lots of popular varieties that are hybrids.
The disadvantages of hybridisation stem from the nature of hybrids.
Propagation is usually hampered by the fact that the offspring have such
33
diverse hereditary characteristics that they may be infertile or not have

the desired features from their parents.
An open-ended investigation of plant hybrids

Visit your nearest plant nursery or ring them. Ask if you may speak with a
nurseryman or someone who knows about hybrids.
Ask the following questions and make a basic summary of the responses
in a table. (You need to draw up a table below to record your answers.)
What are the names of at least five different hybrid plants on sale at
the moment?
What feature of a hybrid makes the plant more desirable than its
parent stock?
Are the hybrids fertile or sterile?
Now use the information you have collected to identify some advantages
and disadvantages of hybridisation.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
34
Blueprint of life
Suggested answers
Observing traits
1
Plants with round seeds were crossed with plants with

wrinkled seeds. This is usually written in the form:
round seeds wrinkled seeds.
The offspring plants all produce round peas.
The hybrid character is round peas (which all have the round factor
and the wrinkled factor).
Dominant and recessive traits

1
The recessive factor is not destroyed, only hidden in the first

generation. It shows up in the second generation because the
recessive factor is passed on, unchanged, to some offspring.
The ratios are shown in the most simplified form.
Expt
Trait examined
Dominant
factor
Recessive
factor
seed shape
round
wrinkled
3:1
seed colour
yellow
green
3:1
flower colour
violet-red
white
3:1
form of seed pods
inflated
constricted
3:1
colour of seed pods
green
yellow
3:1
position of flower
axial
terminal
3:1
length of stem
long
short
3:1
Ratio in second
generation
35
Yes, the ratios for traits in all the second generations are very
similar.
dominant : recessive = 3 : 1
A large number of peas were needed to give a large sample size.

This means that enough information could be gathered to provide a
reliable ratio.
Explaining Mendels observations

Form
Factors
pure dominant
RR
pure recessive
rr
hybrid
Rr
Tt
long-stemmed : short-stemmed = 787 : 277 = 3 : 1
One quarter will be TT.

Two quarters (one half) will be Tt.
One quarter will be tt.
Monohybrid crosses
aa
Aa
Aa
aa
Aa
Aa
Half of the offspring are Aa hybrids, showing the dominant feature.

Half of the offspring are aa, showing the recessive feature.
Homozygous and heterozygous

1
a) bb
b) BB
c) Bb
36
Both parents have Bb genes. Therefore, their offspring are likely to

be a quarter BB, a half Bb and a quarter bb. That is, there is one
chance in four, or a 25% chance, that a baby will have blue eyes.
Blueprint of life
Genes and alleles

1
F (C, D and E may have identical alleles but you cannot be certain)
A and B (C, D and E may have different alleles but you cannot be
certain)
F (C, D and E may be homozygous but you cannot be certain)
A and B (C, D and E may be heterozygous but you cannot be

certain)
Genotype and phenotype

1
Phenotype
Genotype(s)
round seeds
RR, Rr
wrinkled seeds
rr
The R gene is dominant so RR and Rr both produce round seeds; the

recessive gene is hidden in the hybrid form. The homologous
recessive gene pair, rr, only produces wrinkled seeds.
Mr Punnett and his squares

1
BB
Bb
BB
Bb
Half of the offspring have a genotype of BB and half are Bb. This
means that all the offspring will have the phenotype of brown eyes
(because B is the dominant gene).
37
Bb
Bb
Bb
Bb
The person will be brown-eyed with a genotype of Bb.

3
Bb
bb
Bb
Bb
The offspring will have either blue eyes with a genotype of bb or

have brown eyes with a genotype of Bb.
4
Two recessive genes (bb) produce the blue-eyed phenotype.

However, the dominant gene hides the recessive gene, so the hybrid
form (Bb) causes the brown-eyed phenotype. Two dominant genes
(BB) also produce the brown-eyed phenotype.
An example of a family pedigree

my parents
my mother
my father
me and my sisters
me
my niece
our children
my children
38
my sisters
my nephew
my niece
Blueprint of life
Using a pedigree to investigate a trait

my parents
my mother
my father
me and my sisters
me
my sisters
my niece
our children
my children
my nephew
my niece
Using a pedigree to make predictions

1
a) 10, 11 and 12 will have blue eyes. 3 and 4 have blue eyes so
they must both have genotypes of bb since the blue-eyed gene is
recessive. bb bb will produce all bb offspring.
b) Male 6 is brown-eyed so his genotype is either BB or Bb.
He has a blue-eyed son so 6 must be heterozygous (Bb).
a) The trait shown in the pedigree is dominant. If it were

recessive, all the people in the pedigree would have the
characteristic since 1 and 2 have the trait. However, 1 and/or 2
have hidden genes that are expressed in the pedigree so they
must be hybrids showing the dominant phenotype.
b) All of the children in F1 (4, 5, 7 and 8) have the recessive genotype.
To produce a recessive genotype, both parents (1 and 2) must be
hybrids. Thus, the chances of each person in the first generation
having the recessive genotype are one chance in four, or 25%.
c) A big chance! The expected ratio of dominant : recessive = 3 : 1.
In a large enough family, this ratio should be observed.
d) 2
Aa
aa
aa
11 Aa
Aa
Aa or
AA
Aa
15 Aa
39
a) Both parents must be heterozygous for the trait. A quarter of

their children would be homozygous dominant and half would
be heterozygous; all these children would show the dominant
phenotype. A quarter of their children would be homozygous
recessive, like 5 and 7, and exhibit the recessive phenotype.
b) Person 9 must be heterozygous. He carries the recessive gene
since he has passed it to his elder son and to his daughter. He
exhibits the dominant phenotype so he must also have the
dominant gene.
c) Person 6 displays the dominant phenotype so he could be
homozygous dominant or heterozygous. There are not enough
children in the family to be sure that one child will not display
the recessive trait.
d) Look at person 4s children. If she has any children with the
recessive trait (which she does) then she must carry the
recessive gene hidden by a dominant gene. She is heterozygous.
If she had many children and none of them had the recessive
trait, then perhaps she could be homozygous. However, she
could still be heterozygous if person 3 is homozygous dominant.
You would need to investigate person 3 to find out whether they
are homozygous or heterozygous before you could make a
decision.
40
Blueprint of life
Exercises Part 2
Name: _________________________________
Exercise 2.1: Recognition of Mendels work

a)
Outline the experiments carried out by Gregor Mendel.

Include information about each of the following in your answer.
What kind of organism, and how many of them, did he study?
What kinds of features did he study?
How many features did he study at one time?
How did he perform his investigations? (What was he

studying?)
What did he do that was similar to other researchers?
What did he do that was different?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
41
b) Mendels research was not recognised for about 35 years after it was
published. What are three reasons why this happened?
____________________________________________________
_____________________________________________________
_____________________________________________________
____________________________________________________
_____________________________________________________
_____________________________________________________
____________________________________________________
_____________________________________________________
_____________________________________________________
c)
What was the main factor that led to the rediscovery of Mendels
work?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
42
Blueprint of life
Exercise 2.2: Genes and alleles

Here is a diagram representing peas produced by pea plants with
different genetic information.
round (RR)
a)
round (Rr)
wrinkled (rr)
What trait is shown?

_____________________________________________________
_____________________________________________________
b) How many genes are responsible for this trait? What are they?
_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
Are these genes alleles? Explain.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
d) Circle the group(s) of peas above that are homozygous for this trait.
Explain why you chose these peas.
_____________________________________________________
_____________________________________________________
_____________________________________________________
43
Exercise 2.3: Mr Punnett and his squares

The trait of plant height is controlled by two genes T for tall and
t for short.
a)
Determine the possible genotypes and phenotypes for the following

crosses. Show all your working using Punnett squares.
homozygous tall
short
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
44
Blueprint of life
heterozygous tall
heterozygous tall
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Why are the pea plants either tall or short in each of these crosses?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
45
Exercise 2.4: Using a pedigree to make predictions

One form of deafness in humans is due to a dominant gene, D. Normal
hearing depends on a recessive gene, d. The D gene is very uncommon
in Australias population.
Joe, who is deaf and has the D gene, marries Sue, who has normal
hearing, and they have four children. The eldest child, John, and the
eldest daughter, Kim, are deaf. The other two daughters, Kate and Julie,
have normal hearing.
John is married to a deaf woman, Sally, and they have three sons. Julie is
married to a hearing man, Sam, and they have a daughter then a son.
a)
Draw a pedigree for this family, showing the trait of deafness.
b) What is the chance of Julie and Sam having a deaf child? Explain.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
46
Blueprint of life
c)
Would you expect John and Sallys children to be deaf or hearing?

Explain. (There are three possibilities that you need to discuss in
your answer.)
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
d) How do you think the pedigree you have drawn could help this
family?
_____________________________________________________
_____________________________________________________
_____________________________________________________
47
Biology
HSC Course
Stage 6
Blueprint of life
Part 3: Chromosomes
Contents
Introduction ............................................................................... 2
The chromosome theory of heredity.......................................... 4
Sutton and Boveri.................................................................................5
Looking at chromosomes.....................................................................6
The production of sex cells...................................................... 10

What are sex cells?............................................................................10
Meiosis................................................................................................12
Modelling meiosis...............................................................................20
Modelling crossing over .....................................................................25
When sex cells combine.......................................................... 29

Sex leads to variety............................................................................29
Two genes instead of one..................................................................30
Gene linkage ......................................................................................31
Sex linkage .........................................................................................32
Co-dominance ....................................................................................38
Nature and nurture .................................................................. 40

Exercises Part 3 ................................................................... 55
Part 3: Chromosomes
Introduction
Most people would agree that sex is a good thing. To biologists, sex
between males and females is very important because it not only makes
more of the species but it can lead to better adapted individuals.
The process of sex cell production, called meiosis, occurs in humans and
all other sexually reproducing organisms. The arrangements of the
chromosomes (and their associated genes) in the sex cells will determine
the possible formation of the next generation.
This part of the module explores how chromosomes were identified as
the carriers of inherited traits. It teaches you that the formation of sex
cells, called gametes, involves the shuffling and reshuffling of these
chromosomes.
You have already learnt how to predict the chances of certain traits
appearing in the offspring of the next generation and how some inherited
features can be carried from one generation to the next.
In this part of the module you will learn to describe and predict the
inheritance of sex-linked genes, such as colour-blindness. These are
genes found only on sex chromosomes (the chromosomes that determine
whether an individual is male or female).
In part 2 you also learnt that inherited traits are either dominant or
recessive. This simplistic view is not always the case and one section of
this part deals with co-dominance. This is where a heterozygous
individual might for some reason express the characteristics of both
alleles.
Environment may also have an effect on the expression of a gene.
You will also investigate examples of where this happens.
You will need three each of two different coloured pipe cleaners to
model chromosomes during this part of the module.
Blueprint of life
In this part you will have opportunities to learn to:
outline the roles of Sutton and Boveri in identifying the importance

of chromosomes
explain the relationship between the structure and behaviour of

chromosomes during meiosis and the inheritance of genes
explain the role of gamete formation and sexual reproduction in

variability of offspring
describe the inheritance of sex-linked genes, and genes that exhibit

co-dominance and explain why these do not produce simple
Mendelian ratios
describe the work of Morgan that led to the identification of sex

linkage
explain the relationship between homozygous and heterozygous

genotypes and the resulting phenotypes in examples of
co-dominance
outline ways in which the environment may affect the expression of

a gene in an individual.
perform a first-hand investigation or process and present information

from secondary sources to model the process of meiosis to
demonstrate crossing over, segregation of chromosomes and the
production of haploid gametes
process information from secondary sources to analyse and solve

problems involving co-dominance and sex linkage
identify data sources and perform a first-hand investigation or

process and present information from secondary sources to
investigate the effect of the environment on phenotype.

Boards website at:
Part 3: Chromosomes
The chromosome theory

of heredity
Originally, the term chromosomes was used to describe the readily

coloured cellular components observed under the microscope during cell
division. Chromo- refers to colour since these cellular components stain
easily with basic dyes.
Most chromosomes are only visible through a microscope and then only
when a cell enters a division stage of its life. This represents a small
fraction of the life of a cell.
A cell of a grasshopper photographed during cell division. The strands you can
see are chromosomes in the nucleus.
(Photograph by M Ricketts, Sydney University)
Once Mendels explanations were rediscovered, biologists immediately

recognised that the behaviour of chromosomes during the production of
sex cells (gametes) and during fertilisation matched his patterns of
inheritance. The scientists who were among the first to notice this were
Walter Sutton in the USA and Theodor Boveri in Germany, during
19021903.
Blueprint of life
Sutton and Boveri

Read the following passage about the work of Walter Sutton and Theodor
Boveri. As you read, highlight or underline information about the role of
these scientists in identifying the importance of chromosomes.
The SuttonBoveri chromosome hypothesis

In 1902 the German zoologist Theodor Boveri published a paper in
which he argued that chromosomes were not identical. His work on the
fertilisation of sea urchins led him to conclude that:
a definite set of chromosomes is required to produce normal
development, and therefore each chromosome is endowed with
different quantities.
During the same year an American microbiologist named Walter Sutton

pointed out that chromosomes were distinct separate entities. Sutton
worked with the grasshopper Brachystola magna, an ideal species
because it has large cells and clearly visible chromosomes of different
sizes. Sutton wrote:
taken as a whole, the evidence presented by the cells of Brachystola is
such as to lend great weight to the conclusion that a chromosome is a
distinct morphological individual.
This was a fundamental step towards forming the chromosome theory of

heredity. Sutton concluded that chromosomes duplicate and divide but
always remain as a whole distinct structure. He noted that the separation
of a pair of chromosomes during gamete formation and then their
unification during fertilisation constitutes the physical basis of Mendels
laws of heredity. Sutton explained that:
there is a separation of the two members of a pair of chromosomes
which while co-existing in a single nucleus may be regarded as jointly
controlling certain restricted portions of the development of the
individual.
Because there were only a few chromosomes compared with thousands

of genes, biologists concluded that each chromosome was a collection of
genes. So when chromosomes moved apart during the formation of
gametes, then came together again during fertilisation, they carried with
them the genes that were passed from parents to offspring.
Part 3: Chromosomes
The discoveries made by Sutton were independent of Boveri, as they

worked on entirely different animals in completely different countries.
Even though it was Sutton who proposed the theory, it was Boveris
assumptions that provided some of the basics.
In 1904 the term SuttonBoveri chromosome hypothesis was coined by a
well-known cell biologist named Edmund Wilson in his book, The cell.
Complete Exercise 3.1 about the work of Sutton and Boveri.
Looking at chromosomes
As you have just read, Sutton concluded that chromosomes came in
pairs, just like genes. One of the pair is inherited from the father (the
paternal chromosome) and the other from the mother (the maternal
chromosome). These pairs of chromosomes are called homologous
pairs or homologues.
Homologous chromosomes
Homologous chromosomes contain equivalent sets of genes. Because of
this, there is the potential for different combinations of alleles to exist.
This also explains how an individual has two genes for the same trait.
In genetic studies, it is useful to represent chromosomes as they appear
during a replicating stage of cell division. This is when chromosomes
can be observed as separate stained rods.
Study the homologous pair of chromosomes drawn below.
A
The alleles shown (A and a) are for the same feature but one is for the
dominant trait and the other for the recessive trait. Notice that they
occupy the same position on each chromosome.
There are many genes on each chromosome but the order and kind of
genes is the same on each because they are a homologous pair.
Blueprint of life
Here are three homologous pairs of chromosomes. They carry genes for
many traits but the three traits being studied are: seed pod colour (G for
green and g for yellow), seed shape (R for round and r for wrinkled) and
flower colour (Q for red and q for white).
G
Which allele(s) is/are homozygous? ________________________
Which is/are heterozygous? ______________________________
What is the genotype for these traits? _______________________
Describe the phenotype of this organism.

_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.
Karyotypes
Each body cell contains a complete set of chromosomes. The number
and appearance of these chromosomes is constant* for the organism and
for its species. This set of chromosomes is called the karyotype of the
organism.
The karyotype of an organism can be observed and photographed
through a microscope (photomicrograph) during some stages of body cell
division. Then the photograph is enlarged and chromosome pairs are
identified. The pairs are arranged in a systematic array from the largest
to the smallest and according to the position of the centromere. This
procedure produces a map or record of the organisms chromosomes
called a karyogram.
*
The karyotype of an organism should be the same in each body cell and should be
very similar throughout the species. However, changes can occur due to mutations
or improper cell divisions. Youll learn more about these later in this module.
Part 3: Chromosomes
Observations are made

under the light microscope
Cells undergoing
cell division are
prepared and stained
on a microscope slide
Photographic
print enlargements
are made
Cells that show all
of the individual
chromosomes are
photographed
Chromosomes that
match in size and
shape are arranged
in order of
diminishing size
Individual chromosomes
are cut out
Preparing a karyogram.
Here is a diagram that represents a photograph of chromosomes in one

human cell. How many matching pairs can you find in the picture?
(Most students can match at least ten homologous pairs.)
Blueprint of life
If you matched all the pairs of human chromosomes, you would end up
with a karyogram like the one shown below.
10
11
13
14
15
16
17
18
19
20
21
22
23
12
A representation of the karyotype of a male human.
Notice how similar each pair of chromosomes is.

But look at pair 23. They are not at all alike! These chromosomes are
the sex chromosomes. Sex chromosomes are the pair of chromosomes
that determine the sexual identity of the individual. This karyotype
belongs to a male because pair 23 contains an X chromosome and a
Y chromosome. (This is usually written as XY). If this were a female,
the two chromosomes in pair 23 would look very similar (XX).
The sex chromosomes contain genes that determine sexual features of the
organism. They also contain genes that are not associated with sexual
traits, such as colour vision. Inheritance of these other traits follow an
interesting pattern called sex linkage that you will learn about later in this
module.
Chromosomes in sex cells

The chromosomes in a sex cell can be stained and photographed too.
When this was first done, biologists discovered that each sex cell
contained only half the number of chromosomes as a body cell. There
were no homologous pairs of chromosomes every chromosome was
different.
Biologists investigated the process involved in forming sex cells and
looked for implications of gamete formation.
Part 3: Chromosomes
The production
of sex cells
An organism that reproduces sexually makes specialised cells that are

specifically designed to make new individual offspring. These cells are
called sex cells, or gametes.
What are sex cells?

Male animals make sperm and male flowering plants make pollen while
all female sex cells are generally called ova (singular ovum).
The following diagrams show a typical body cell and gamete of the same
organism. Study the two drawings and compare their structure.
nucleus
nuclear membrane
chromosome
cell membrane
Structure of a body cell.
nucleus
nuclear membrane
chromosome
cell membrane
Structure of a gamete.
10
Blueprint of life
Compare the body cell and gamete.

_____________________________________________________
_____________________________________________________
You are probably aware that new offspring are produced when a male
gamete and a female gamete of the same species fuse together in a
process called fertilisation.
When sex cells fuse, they make a new body cell. Gametes, therefore,
must have half the number of chromosomes as body cells. The number
of chromosomes in sex cells is called the haploid (half) number and the
number in body cells is called the diploid number.
2
On the diagram of the sex cycle below:

a) label the gametes
b) label the arrows that represent the formation of gametes
c) write the correct word, haploid or diploid, in the spaces provided.
number
of chromosomes
number
of chromosomes
fertilisation
body cell of new individual

number
of chromosomes
Summary of sexual reproduction.
Part 3: Chromosomes
11
Meiosis
Meiosis is the name of the process that produces gametes. The entire
process can be described using two main stages.
During the first stage of meiosis, the homologous pairs segregate
(separate) from one another to form two cells. This is what it would look
like under a microscope.
Segregation of chromosomes during the first stage of meiosis.
In the next stage, the replicated chromosomes in the nuclei of the two
cells separate to form two more cells each. This makes a total of four
gametes from every body cell.
Segregation of chromosomes during the second stage of meiosis.
The LMPC website has an animation showing the process of meiosis.

It can be accessed at:
http:// www.lmpc.edu.au/Science
Most biology books will explain this process to you if you need more
information. If you dont have Internet access or a biology textbook,
you will find the activity in this part titled Modelling meiosis
particularly useful.
12
Blueprint of life
There are a few things going on with the chromosomes during meiosis
that you need to know about. The next few pages provide a detailed
description of the process of meiosis.
The duplication of chromosomes

Chromosomes are made of a chemical called DNA. (Youll learn more
about this in the next part.) When a cell enters a division phase, the
DNA makes a complete replica of itself and a duplicate chromosome is
made. (This is the same process that you learnt about in mitosis). The
new chromosome is still attached to the original chromosome by the
centromere; the identical pair of DNA strands are called chromatids.
The diagram below shows a body cell with two homologous pairs of
chromosomes at the duplication stage.
chromatids
centromere
Paternal chromosomes
These chromosomes came
from the father when the
original body cell formed
Maternal chromosomes
These chromosomes came
from the mother when the
original body cell formed
Part 3: Chromosomes
13
The initial segregation of duplicated chromosomes

One major difference between normal cell division (mitosis) and meiosis
is that, at this early stage of meiosis, the homologous chromosomes
pair up then separate from each other. The separation of maternal and
paternal chromosomes occurs at random so each chromosome ends up in
a newly formed cell purely by chance.
The diagrams below show the possible ways that the two pairs of
chromosomes in the diagram just shown can pair up then separate.
or
So from one body cell with four chromosomes (two pairs), there are four
possibilities for the cells that will form. Imagine how many possible
combinations there are for humans with 46 chromosomes (23 pairs)!
At the end of this stage, each new cell contains a haploid number of
duplicated chromosomes.
14
Blueprint of life
The final separation of chromosomes

In the next stage, the duplicated chromosomes separate to form gametes
with a haploid number of chromosomes. The diagrams below show this.
Here are the four possible cells from the first stage. In each cell,
the duplicated chromosomes line up across the centre of the cell.
or
Then the centromeres split and the chromatids separate, forming four sex
cells with eight possible chromosome combinations.
or
Study the diagrams of dividing cells above. Look carefully at the

chromosomes going into each gamete.
How many different sex cells will be produced?
_________________________________________________________
_________________________________________________________
Part 3: Chromosomes
15
From a body cell with two pairs of chromosomes, four different types of
gametes can form. (Once again, think about how many different gametes
could form using 23 pairs of chromosomes.)
In the diagram of sperm below, there are eight sperm but only four
different types. Circle the pairs of identical sperm.
or
Now answer this question. How does the process of meiosis help to make
gametes different from each other?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
16
Blueprint of life
Increasing variation crossing over

A process called crossing over causes the reshuffling of parts of a
homologous pair of chromosomes. Crossing over occurs at the first stage
of meiosis where homologous chromosomes pair up.
When homologous pairs are very close together, crossing over may occur.
When the homologous chromosomes are close together, chromatids may

tangle together. The parts that are crossed over can actually swap, or
recombine, so that some genes change positions in the homologous pair.
chromatid
region
exchange
chromatids
centromeres
pair up and are very close
together
Part 3: Chromosomes
A region of the inner

chromatids cross over
and recombine
Once all four chromosomes

are separated, gametes
with a variety of genetic
information will be produced
17
Crossing over causes the exchange of blocks of genes between

homologous pairs. Linked traits are separated and reshuffled. This is
called making a new gene linkage. (Youll learn more about linkages
later in this part.)
Here is the series of diagrams that you studied before, to make eight
possible chromosome combinations from one body cell. This time,
notice how crossing over changes the genetic information in each gamete
formed.
crossing over
or
crossing over
After this first stage, these duplicated chromosomes separate in the

usual way.
18
Blueprint of life
or
or
The possible gametes are shown in the diagram of the sperm below.
or
Part 3: Chromosomes
19
Did you notice that there can be eight different types of gametes
produced when crossing over of just one pair of chromosomes takes
place? That is twice as many different gametes as occurs with no
crossing over.
How many different types of gametes could be produced if crossing over
took place in two places for two pairs of homologous chromosomes?
_________________________________________________________
Check your answer.
Modelling meiosis
You may find it easier to follow the meiosis process with a model to help
you to get it clear. In this course you are required to demonstrate the
process of meiosis by using a model. Follow the instructions below then
review the explanation of meiosis using your model.
Use pipe cleaners of two different colours and the templates provided in the
Additional resources section to demonstrate the process of meiosis.
Follow the instructions below.
What to do
Choose two different coloured
pipe cleaners and cut them both
in half with a pair of scissors.
Twist the two halves together

as in the photograph.
You should now have a pair of pipe cleaners looking remarkably like a
duplicated chromosome. Identify the centromere and chromatids on your
chromosome.
20
Blueprint of life
Now repeat the process above using another pair of pipe cleaners of
a different colour.
Put the duplicated chromosomes

inside the body cell template.
Which part of meiosis have you represented?

_________________________________________________________
Check your answer.
Decide which colour of chromosomes represents the maternal
chromosome and which represents the paternal chromosome. This will
help you to keep track of the chromosomes throughout meiosis.
In the next step of meiosis, the homologous pairs match up across the
middle of the cell. There are two possible ways that this can happen. So
that you can show both possibilities at the same time using your model,
you need to make another set of duplicated chromosomes. Do this now.
But remember, you are only modelling the possible segregation of
chromosomes for one body cell. It is just that you need two sets of
chromosomes to be able to study the different possibilities.
Part 3: Chromosomes
21
Arrange the duplicated

chromosomes across the middle
of the body cell.
The maternal and paternal

chromosomes can be opposite
each other or they can be on the
same side as each other.
When the homologous pairs separate, there will be two possible

outcomes. Either a maternal and a paternal chromosome will move into
each new cell or both paternal chromosomes will move into one and both
maternal chromosomes into the other.
Use the segregation of duplicated chromosomes templates to model
this step. (You need to do it twice because you are modelling the
two possibilities.)
or
Notice that each new cell contains half the number of chromosomes as a
body cell. That is, this step divides the diploid body cell into two haploid
cells that will, in turn, produce haploid sex cells.
22
Blueprint of life
In the next step, the duplicated chromosomes line up across the middle of
the new cells.
or
Then the chromatids separate and move into the forming gametes. To
demonstrate the separation of the duplicated chromosomes, you need to
untwist the pipe cleaners. Separate the chromosomes as shown below.
or
Now put the chromosomes into the gamete templates.
or
Notice that four gametes have formed from one body cell. These four
gametes display two possible combinations of chromosomes.
Because you have performed meiosis on two body cells so that you can
show all the possible combinations at the same time, you have eight sex
cells but there are still only four different combinations of chromosomes.
Part 3: Chromosomes
23
Record the results of your

modelling below. You need to
draw the chromosomes into the
nuclei of the sperm. (Use
coloured pencils if you can.)
or
24
Blueprint of life
Modelling crossing over

Now repeat the modelling of meiosis, but this time show one
chromosome crossing over.
Use the templates to go through the steps in meiosis. Tick the steps
below as you model them. (Remember that you will need to use two sets
of chromosomes to model all the possible combinations of chromosomes
when a body cell divides to make sex cells by meiosis.)
Duplication of chromosomes
Matching of duplicated chromosomes in homologous pairs
Crossing over of some genetic material
To show crossing over, cut a
small portion of pipe cleaner
of the opposite colour and
twist it on to the end of one
of the chromatids.
Repeat on the other
homologous chromosome.
Segregation of duplicated chromosomes

(halving the number of chromosomes in each cell)
Lining up of duplicated chromosomes across the middle of new cells
Separation of chromatids
Formation of gametes
You should have made eight different chromosome combinations; that is,
eight different gametes. (But remember, one body cell divides to make
four gametes. You have made eight because you used chromosomes
from two body cells so that you could see all the possible combinations.)
Record all the possible chromosome combinations for gametes on the
following page.
Part 3: Chromosomes
25
or
26
Blueprint of life
Take the challenge!

Earlier in this part, you predicted that there were 16 different possible
combinations of chromosomes in gametes formed from a body cell with
two chromosomes that crossed over twice. Can you model it? Go on!
Have a try!
Use the templates to go through all the steps in meiosis.
Tick the steps below as you model them.
Duplication of chromosomes
Matching of duplicated
chromosomes in
homologous pairs
Crossing over of some
genetic material
Segregation of duplicated
chromosomes
Lining up of duplicated
chromosomes across the
middle of new cells
Separation of chromatids
Formation of gametes
Record all the possible chromosome combinations in the diagram on the
next page.
Another challenge
You have been through the process of meiosis several times.
Check that you can explain it without referring to the instructions
or checklists. Then use your model to demonstrate and explain it to
someone you know.
You need to be able to explain and demonstrate:
the segregation of chromosomes
crossing over
the production of haploid gametes.
Part 3: Chromosomes
27
28
Blueprint of life
When sex cells

combine
You have seen how meiosis forms sex cells, called gametes, that are
haploid. This is a very important point in sexual reproduction because,
when gametes join during fertilisation, a new diploid body cell is formed.
That is, the first cell of a new organism contains half of its chromosomes
from its mother and the other half from its father.
These are not just any chromosomes; the ovum from the mother contains
one chromosome from each homologous pair, and so does the sperm
from the father. At fertilisation, these chromosomes come together so
that the offspring has homologous pairs of chromosomes.
Sex leads to variety

Sexual reproduction produces offspring that are different from each
other. This happens because:
gametes join in a random way at fertilisation

For example, millions of sperm have the opportunity to fertilise a
human egg. However, only one sperm succeeds.
chromosomes are sorted into gametes in a random way

This is what you have been studying by looking at the steps in
meiosis. You have identified all the possible combinations of
chromosomes in gametes made from a body cell with two
chromosomes. Most organisms have many chromosomes so there
are thousands or even millions of possible combinations.
crossing over can occur during meiosis

You have also seen how crossing over increases the variability of
gametes. Crossing over can occur between any homologous pair of
chromosomes during meiosis.
Part 3: Chromosomes
29
Now that you know the steps in gamete formation and can demonstrate
the process using a model, you are required to explain how meiosis and
sexual reproduction lead to variation in offspring. The best way to do
this is to use your meiosis model to identify the stages that increase
variation in the chromosomes of the gametes made. The greater the
variety among the sex cells produced, the greater the chance of variation
in the population.
Two genes instead of one

You can also see why there are two genes to control each trait. One gene
comes on the chromosome from the mother; the other gene is in the same
position on the homologous chromosome that comes from the father.
When a body cell divides in meiosis to make gametes, each gamete gets
one gene for the trait because it gets one chromosome from each
homologous pair.
Consider the homologous pair below.
A
You should now recognise that this is not an accurate representation of

the genes on these chromosomes. What is wrong?
_____________________________________________________
_____________________________________________________
Check your answer then correct the diagram.

2
Describe the step in meiosis at which you would see this

homologous pair together as shown above.
______________________________________________________
______________________________________________________
______________________________________________________
30
Blueprint of life
Predict the likelihood of genes A and a being present in a gamete.

Explain how you reached your answer.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

You have seen that chromosomes separate as entities during meiosis.
Apart from crossing over, chromosomes remain intact as they are passed
from body cells into gametes and then used to form a new cell during
fertilisation. Because genes are located on (are part of) chromosomes,
genes move with chromosomes when they separate or recombine.
Now do Exercise 3.4.
Gene linkage
The seven traits that Mendel studied were located on separate
chromosomes. Hence, his conclusions were similar to those derived
from observations of chromosome behaviour.
Mendel was very lucky! During the time when his work was being
rediscovered and repeated on different organisms using different traits,
some scientists were getting odd results. They found that the inheritance
of some traits did not support Mendels laws.
Sutton and Boveri postulated (predicted) that this is the result of the
genes for traits being located on the same chromosome. This meant that
these genes would stay together while the chromosomes were shuffled
around during meiosis and fertilisation. But they did not have evidence.
In 1906 a zoologist named Thomas Morgan discovered that two or more
genes governing the inheritance of different traits could be located on the
same chromosome. This led Morgan to conclude that genes that tend to
remain together in their groups do so because they are joined together on
the same chromosome. Furthermore, these traits are generally inherited
together. This is called gene linkage, or simply, linkage.
Part 3: Chromosomes
31
Sex linkage
Look back at the representation of the human karyotype earlier in this part.
Notice that it contains 23 pairs of chromosomes. Pairs 1 to 22 are identical
homologous pairs. Pair 23 are the sex chromosomes, which are two X
chromosomes (XX) for a female but an X and a Y chromosome (XY) for
a male.
The drawing below shows four homologous pairs of chromosomes:
Aa, BB, cc and XY.
A
B
a
B
X
Y
c
c
Identify the sex chromosomes and describe why you chose this pair.
______________________________________________________
______________________________________________________
______________________________________________________
Why do you think the identical chromosomes have been named

as shown?
______________________________________________________
______________________________________________________
______________________________________________________
32
Determine the possible gametes that could be produced from this

male body cell.
Blueprint of life
What combinations of chromosomes could occur in the gametes

made by a female of the same species? (Assume that only the
sex chromosomes differ.)
Use the Punnett square below to show that there is a 50 : 50 chance

of there being a male (or a female) offspring.
Y
+
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check all your answers before you go on.
All chromosomes, including the sex chromosomes, carry genes.
Genes on X chromosomes are said to be sex-linked. This is because
these genes cause traits to appear more frequently in one sex than the
other. For example, have you ever wondered why men tend to go bald
but women seldom do? The genes from normal hair cover (N) and
baldness (n) are carried on the human X sex chromosome.
Now lets see how sex linkage happens.
Part 3: Chromosomes
33
The following diagram represents the chromosomes of Drosophila flies.
A
B
X
Y
c
c
c
c
The chromosomes of Drosophila fruit fly.
The female Drosophila above has an affected recessive gene on the

coloured-in X sex chromosome. The male does not. Neither fly will
exhibit the trait due to the affected gene; the male does not have the gene
at all and the female has a dominant gene for the trait on its other X
chromosome that will hide the recessive gene.
What offspring would these flies produce? You can use a Punnett square
to work out the inheritance of this sex-linked gene. Notice how the
recessive gene being studied is marked on the X chromosome below.
6
Describe the phenotypes of the offspring of these two flies.
Y
+
______________________________________________________
______________________________________________________
______________________________________________________
Check your answer.
34
Blueprint of life
The inheritance of sex-linked genes does not follow Mendels laws.

The chromosomes are sorted in the same way as for Mendels
experiments but the results can be different because there is not always
an identical pair of chromosomes, with alleles of the same genes, present.
Red-green colour-blindness is an example of a sex-linked trait in
humans. It is more common in human males than females because a
female must have two affected genes to express the trait whereas a male
needs only one (on his only X chromosome).
Haemophilia is another sex-linked disorder. Look back at the pedigree of
the European royal family in Part 2. Youll see that all those affected
with the disease are male. (Females can inherit the disease but it is very
uncommon for both X chromosomes that the female receives to carry an
affected gene.)
Polydactyly (having six fingers and/or six toes) can also be a sex-linked
trait.
Polydactyly in a babys feet.
(Photograph by Dr E Klatt MD, Department of Pathology, University of Utah,

Salt Lake City, Utah, USA)
Whenever you solve problems involving sex-linked genes, you need to

think about how the sex chromosomes would be sorted into gametes then
recombine during fertilisation. That is, you need to do a Punnett square
using the genes on the sex chromosomes, and not just the genes alone.
Part 3: Chromosomes
35
Try the following problem about the inheritance of red-green

colour-blindness. In this disorder, the sufferer is unable to tell the
difference between objects that are certain shades of red and green.
These objects appear the same, brownish colour.
The gene for normal vision is V and the gene for colour-blindness is v.
7
A female who has a colour-blind father marries a man with normal

vision from a family where colour-blindness has never occurred.
What type of vision would you expect their children to have?
a) Draw a Punnett square to predict the genotype of the offspring
for this characteristic.
b) Describe the phenotype of the children.

__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
c) How is this answer different from the results that Mendel would
have predicted?
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
Check your answers.
36
Blueprint of life
Carriers
A carrier is a person who has a hidden gene for a trait. So, for example,
a heterozygous person is a carrier of the recessive gene. For human
sex-linked traits, a carrier is always female because only females can
have a hidden gene. A male only has one X chromosome so he has only
one gene; it cannot be hidden but is always expressed.
Study the pedigree for red-green colour-blindness below.
parents
F
children
F1
grand
children
F2
10
11
12
13
14
15
16
18
17
What clue does this pedigree give you that this might be a sex-linked
characteristic?
_____________________________________________________
_____________________________________________________
Is person 8 a carrier for colour-blindness? Explain.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Could person 12 be a carrier for colour-blindness? Explain.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.
Part 3: Chromosomes
37
You have seen that sex-linked traits do not always follow Mendels laws.
Co-dominance is another situation that produces results that are not
predicted by Mendels laws.
Co-dominance
So far you have learnt that if two different alleles are present in the
genotype, the dominant allele will be expressed and the recessive allele
will be carried, hidden. This is the normal pattern for most traits.
In some cases, however, neither allele is dominant. When both are
present in the genotype, both are expressed in the phenotype.
This pattern of inheritance is referred to as co-dominance.
Features that show co-dominance produce offspring with both of the
parents features expressed. A good example is blood groups in humans.
A person with blood group A has two A genes, a person with blood group
B has two B genes but a hybrid, with AB genes, has both A and B genes
expressed producing a new blood group, AB.
Another example is the roan coat colour in cattle. Red cattle and white
cattle can produce roans. These cattle have white and red hair scattered
throughout their coat.
Tail length in some cats also exhibits co-dominance. For example, a cat
with no tail breeds with a cat with a long tail. All their offspring are always
short tailed cats.
1
Explain this result.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
What outcome would Mendel have predicted?

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
38
Blueprint of life
The term incomplete dominance is sometimes used to explain

co-dominance but the meanings are slightly different. Examples of
incomplete dominance show blending or mixing of character traits rather
than of both traits being expressed.
A good example of incomplete dominance is the inheritance of flower
colour in snapdragons. If a red-flowered plant (RR) is crossed with a
white-flowered plant (WW), the offspring will have pink flowers (RW).
You only need to be able to explain and make predictions about
co-dominance. The important things to look for in co-dominance are:
the phenotype of the offspring for that trait includes features of both
parents because two different genes are being expressed
the phenotype of the offspring does not match the simple ratios
predicted by Mendels laws.
Complete Exercise 3.6 about sex-linked traits and co-dominance.
Part 3: Chromosomes
39
Nature and nurture
What causes an organisms characteristics? Are they caused by its genes

(its nature) or by things that happen to it due to its environment (its
nurture)? This argument, often called the nature-nurture debate, has
continued since the science of genetics began.
You have seen that the genes of an organism are very important in
producing its features. However, the traits that an organism displays as a
result of the expression of its genes (its phenotype) can be altered
through the interaction of the organism and its environment.
Twin studies
Twins are very useful for indicating which characteristics of a person are
determined by genetics and which ones are determined by environment.
The nature-nurture debate often revolves around studies of twins.
Identical twins share the same genetic blueprint so any differences in
how twins turn out should be due to differences in their environments.
Non-identical twins that grow up in the same environment may have
differences caused by their differing genetic information.
Researchers have collected detailed physical and psychological
information on hundreds of pairs of twins from birth to adulthood. Twin
studies such as this suggest that our genetic blueprints play a large role in
alcoholism, reading disorders and susceptibility to disease. A Swedish
twin study is finding strong evidence that genetics affects how long we
live. And twin studies are finding genetic links to obesity, personality
and intelligence.
Twin studies are very important in the investigation of diseases and other
characteristics. But there are other ways to collect information about the
impact of the environment on inherited features. Consider the example
of human height.
40
Blueprint of life
Human height
One of the impressive achievements in human growth took place among
Japanese immigrants to the United States. In a study of AmericanJapanese schoolboys conducted in 1957, it was found that they were on
average 6.4 cm taller and 11.5 kg heavier by the age of 18 years than
average native Japanese boys.
American-Japanese girls were 1.3 cm taller and 1.9 kg heavier by the
same age. It is interesting that American-Japanese girls were
significantly taller and heavier until the age of 14 and that the difference
became much smaller between 15 and 18 years.
Another interesting comparison shows that, in 1957, the average 18-yearold native Japanese boy had grown 2.6 cm taller over the 57 years (the
difference between 1900 and 1953) while the average Japanese girl grew
5.7 cm taller in the same period.
Graph of standing height of children
cm
170
160
150
140
130
Japanese-Americans
Japanese
120
110
1970
1956-57
1956
1900
100
6
10
11
12
13
14
15
16
17
18
19
20
Age (years)
These studies showed that the change in growth achieved in one

generation by Japanese boys and girls in America was greater than that
achieved in 50 years in Japan. The same study showed that AmericanJapanese boys had longer legs, which reflects better nutrition and a
healthier living environment. The study concluded that better nutrition
among the American-Japanese children enabled them to perform
relatively better in realising their genetic growth potential.
Part 3: Chromosomes
41
The interplay of genetics and the environment has also been studied in
plants. Here is an example that you can investigate.
A open-ended investigation about hydrangea flowers

Modifying the soil pH can change the colour of some hydrangea. The
soil pH refers to the amount of acid or alkali in the soil. If the pH is less
than 7 it is acid. If it is greater than 7 it is alkali.
1
Go to your nearest plant nursery and ask to have a look for some
hydrangea (Hydrangea macrophylla). If they are in flower (spring to
summer), note the colour.
______________________________________________________
______________________________________________________
Ask the nursery person about the type of soil pH that hydrangeas
require.
______________________________________________________
______________________________________________________
______________________________________________________
Write a conclusion about the relationship between soil pH and the

colour of hydrangea flowers.
______________________________________________________
______________________________________________________
______________________________________________________
How does this compare with the colour of snapdragons explained

earlier?
______________________________________________________
______________________________________________________
______________________________________________________
Finally, complete Exercise 3.7.
42
Blueprint of life
Body cell template
Part 3: Chromosomes
43
Gamete template
44
Blueprint of life
Segregation of duplicated chromosomes template
Part 3: Chromosomes
45
46
Blueprint of life
Body cell template
Part 3: Chromosomes
47
Gamete template
48
Blueprint of life
Segregation of duplicated chromosomes template
Part 3: Chromosomes
49
Morgan and his investigations of Drosophila

Thomas Hunt Morgan (18661945) is known as one of the first true
geneticists. He worked on a variety of fruit flies called Drosophila
melanogaster. You may have seen these flies buzzing around your fruit
bowl at home. Drosophila was a suitable animal because it was cheap,
easy to culture, bred quickly and had a short life cycle. It also had only
four chromosome pairs. For 17 years Morgan studied the genetics of the
fruit fly in a small musty room called the Fly Room. He established the
chromosomal theory of heredity (proposed by Sutton and Boveri),
genetic linkage and chromosomal crossing over.
Morgan and sex-linkage

Morgan tried to replicate the work of Mendel using eye colour in
Drosophila. He crossed red-eyed flies with white-eyed flies and the
progeny were all red-eyed flies. This is the expected result for a
dominant recessive cross.
In the next generation, you would expect to get a 3 : 1 ratio of red-eyed
to white-eyed. Morgan discovered that this ratio did not occur. Instead,
all of the white-eyed flies were male and none of the females were
white-eyed. He used these flies in another cross and discovered from his
results that the gene for eye colour was carried on the X chromosome.
It was the first time that sex linkage of genes was identified and
explained.
In 1933, Thomas Hunt Morgan received the Nobel Prize for Medicine for
his work in establishing the chromosomal theory of inheritance.
Investigating hydrangea colour

Here is some extra information, in case youd like an answer for part of
the open-ended investigation.
Hydrangea flowers (Hydrangea macrophylla) will turn blue if the soil is
alkaline and red if the soil is acidic. To turn flowers from pink to mauve,
the soil should be neutral to slightly alkaline.
50
Blueprint of life
Suggested answers
1
GG
Rr and Qq
GG, Rr, Qq
This organism will have green seed pods, round seeds and red
flowers.
What are sex cells?

1
Body cells and gametes are very similar in structure except that a
gamete has only one of each kind of chromosome instead of two.
2
sperm
haploid number
haploid number
of chromosomes
of chromosomes
egg/ovum
fertilisation
forming
male gamete
forming
female gamete
body cell of new individual

diploid
number
of chromosomes
Part 3: Chromosomes
51
The final separation of chromosomes

Meiosis involves a random lining up and separation of homologous pairs
so that different combinations of chromosomes can occur in gametes.
Increasing variation crossing over

With two pairs of chromosomes and crossing over in two places, there
will be 16 different combinations of chromosomes in gametes. Youll be
able to check this for yourself, later in this part.
Modelling meiosis
The first step of meiosis represented is the duplication of chromosomes
in a body cell.
Two genes instead of one

A
A a
The A or a gene would be in the same

positions on all four chromatids not
just on the outer two.
This is near the beginning of meiosis, after the chromosomes have

duplicated and homologous pairs have formed across the centre of
the body cell. This is just before the chromosomes segregate,
forming haploid cells.
Half the gametes will contain the chromosome with the A gene and
half will contain the chromosome with the a gene. This is because
each chromatid becomes a chromosome in one of the four sex cells
made from this body cell. Wherever the chromosomes are, the genes
on them are too.
Sex linkage
52
XY are the sex chromosomes because they are the only pair that are
not identical. (But note that they would be identical if this were a
human female, for example.)
The chromosomes are named using the symbols for a gene they
carry. Wherever the chromosome goes, the gene also goes so the
genes name also identifies the chromosome.
Blueprint of life
There are four possible combinations of chromosomes in male sex

cells: ABcX, ABcY, aBcX and aBcY.
There are two possible combinations of chromosomes in female sex

cells: ABcX and aBcX.
Y
+
Y
Y
Half of the offspring will have XY chromosomes and be male.

(Half of the offspring will have XX chromosomes and be female.)
6
Y
+
Y
Y
Half of the offspring will be female but they will all have a normal
phenotype. Half of the offspring will be male and half of these male
flies will exhibit the recessive trait.
7
a)
Y
+
Y
Y
Part 3: Chromosomes
53
b) Half of the children will be girls, all with normal colour vision.
Half of the children will be boys, and half of these boys will be
colour-blind.
c) Mendel would have predicted that the man was homozygous for
the dominant gene (VV) and that the woman was heterozygous
(Vv). Therefore, their children could be predicted by VV Vv
which would produce children who all have normal colour
vision. So Mendels prediction does not match the outcome for
this sex-linked cross.
Carriers
1
All those who exhibit the trait are male.

(Females can be colour-blind but it is rather uncommon.)
Yes. Person 8 must carry the gene because it is passed to her son
(person 18) who is colour-blind.
It is possible that person 12 is a carrier of colour-blindness. People 3

and 4 do not have enough children to make a firm decision.
Person 4 has a 50 : 50 chance of being a carrier. And if person 4
were a carrier, person 12 would also have a 50 : 50 chance of being a
carrier.
Co-dominance
1
The cats have a mixture of the tail lengths of the parents because
neither gene for tail length is dominant (nor is it recessive).
or
Let the gene for no tail be N. Let the gene for long tail be L.
Neither N nor L is dominant (nor is it recessive).
no tail cat long tail cat = NN LL = all NL offspring
NL cats will be short tailed because they have a mixture of their
parents features.
54
All the kittens would be expected to have the phenotype of one of

the parents. That is, Mendel would have predicted that the offspring
would be either no tailed or long tailed.
Blueprint of life
Exercises Part 3
Name: _________________________________
Exercise 3.1: The SuttonBoveri chromosome

hypothesis
Outline the roles of Sutton and Boveri in identifying the importance of
chromosomes.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Part 3: Chromosomes
55
Exercise 3.2: Take the challenge!

a)
Use your pipe cleaner models and templates to explain and

demonstrate segregation of chromosomes. Then use diagrams and
sentences to describe what you did.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) Use your pipe cleaner models and templates to explain and
demonstrate crossing over of chromosomes. Then use diagrams and
sentences to describe what you did.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
56
Blueprint of life
c)
The photographs below show various steps in meiosis.

A
(Photographs by M Ricketts, Sydney University)
Sequence the photographs (using the letters A to F) in the order

in which these steps occurred.
_________________________________________________
ii
Describe what is shown in the photograph that you put first.

_________________________________________________
_________________________________________________
iii Describe what is shown in the photograph that you put last.
_________________________________________________
_________________________________________________
iv In which photograph could crossing over occur? __________
Part 3: Chromosomes
57
Exercise 3.3: Sex leads to variety

a)
Identify the steps of meiosis that lead to variation. You can describe
each step you choose or refer to the photograph of the step in
Exercise 3.2. Then describe why you chose these steps.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) The production of gametes by meiosis is one way that sexual

reproduction ensures variation in offspring. What is another way
that sexual reproduction contributes to the variability of progeny?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Exercise 3.4: Two genes instead of one

a)
What is the relationship between a gene and a chromosome?

______________________________________________________
______________________________________________________
b) You have studied the behaviour of chromosomes during meiosis.

How does this help you to understand how genes are sorted during
meiosis and then combine during fertilisation?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
58
Blueprint of life
Exercise 3.5: Sex linkage

Describe the work of Morgan that led to the identification of sex linkage.
You can look for information about Morgans fruit fly experiments in
books or on the Internet. There is also some material about these
experiments in the Additional resources section that you can use.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 3.6: Sex linkage and co-dominance

There are three diagrams in this exercise. Your task is to identify which
kind of inheritance each diagram shows and then explain the results in
the diagram by referring to the genotypes and phenotypes represented.
Is this trait co-dominant, sex-linked or does it follow Mendels laws?

_________________________________________________________
Explain the results. _________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Part 3: Chromosomes
59
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________

_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
60
Blueprint of life

_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Part 3: Chromosomes
61
Exercise 3.7: Nature and nurture

Outline ways in which the environment may affect the expression of a
gene in an individual. (For example, describe how differing pH levels
affect the colour of hydrangea flowers.)
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
62
Blueprint of life
Biology
HSC Course
Stage 6
Blueprint of life
Part 4: How genes operate
Contents
Introduction ............................................................................... 2
What is DNA?............................................................................ 4
Isolating DNA .......................................................................................4
Determining the structure of DNA ......................................................6
The structure of DNA ...........................................................................9
The transmission of genes ...................................................... 11

DNA duplication .................................................................................12
How a gene expresses itself ................................................... 17

The one gene one enzyme theory ...............................................18
Protein production .............................................................................19
What is the role of DNA? ..................................................................26
The origin of new genes ......................................................... 27

Explaining mutations ..........................................................................27
The discovery of mutagens................................................................29
Examples of new genes.....................................................................32
Evolution and genes................................................................ 34

Exercises Part 4 ................................................................... 43
Introduction
People once explained that each embryo developed from a simple to a

complex form shaped by the hand of God. In the eighteenth century,
Charles Bonnard argued that all the complexity of the final organism
must be present from the start in the egg and sperm. But where and how
is this information stored?
What is the source of the blueprint that enables the process of inheritance
to take place with such amazing accuracy from one generation to the next
for millions of years? Watson and Cricks discovery of the structure of
DNA enabled scientists to answer these questions.
In this part you will learn about the role DNA plays in transmitting genes
from one generation to the next. You will also be shown how DNA
codes for the production of protein. This process describes how genes
are expressed in organisms.
In Part 3 you learnt that sexual reproduction leads to variety among
species because of the way chromosomes keep shuffling and
recombining genetic information during meiosis and fertilisation. You
are probably wondering if this is enough to cause the evolution of the
enormous variety of species that have ever lived on Earth. How do new
innovative adaptations arise among a population? Would adaptive
radiation occur so effectively if nature relied on these sources of
variation alone? How did organisms that reproduce asexually, such as
bacteria which make up a major percentage of life on Earth, evolve?
The blueprint contained within the genetic material, DNA, can be altered
by influences in the environment. This process is known as mutation and
there is a very slim possibility that any alterations to the blueprint may
lead to new genes. The final section of this part explores the causes,
discoveries and effects of mutations.
You may decide to perform an investigation that requires dried peas, salt,
eucalyptus wool wash and methylated spirits.
Blueprint of life
describe the chemical nature of chromosomes and genes
outline the role of DNA in the transmission of genes from one

generation to the next
describe the process of DNA replication and explain its significance
outline, using a simple model, the process by which DNA controls the
production of proteins and/or polypeptides
identify mutations as a source of new alleles in organisms
describe mutations as changes in the DNA information on a

chromosome
outline, using a simple model, how changes in DNA sequences can

result in changes in proteins produced and thus changes in cell activity
identify that environmental factors may increase the rate of mutation

using examples of mutagens
explain how an understanding of variation in organisms has provided

support for Darwins theory of evolution by natural selection
describe the concept of punctuated equilibrium in evolution and how it

differs from the gradual process proposed by Darwin.
perform a first-hand investigation of process information from

secondary sources to develop a simple model for protein synthesis
identify data sources, gather, process and analyse information from

secondary sources to outline the evidence that led to Beadle and
Tatums one gene one protein hypothesis and to explain why this
was altered to the one gene one polypeptide hypothesis
process and analyse information from secondary sources to explain how

the development of antibiotic resistance in bacteria or insecticide
resistance in insect pests are modern examples of natural selection
process information from secondary sources to describe and analyse the

relative importance of the work of:
James Watson
Francis Crick
Rosalind Franklin
Maurice Wilkins
in determining the structure of DNA and in exemplifying the role of
collaboration and effective communication in scientific research.

Boards website at:
What is DNA?
So far in this module, you have learnt about the inheritance of genes and
how this is explained by studying the behaviour of chromosomes. But
what really are genes (and chromosomes)?
Isolating DNA
The idea that DNA is somehow associated with the transfer of genes was
beginning to be explored in the 1940s. The Swedish biochemist,
Torbjrn Caspersson, developed a photographic technique that showed
the location of DNA in cells. DNA was found in chromosomes.
In 1944, three American biochemists, Oswald Avery, Colin Macleod and
Maclyn McCarty, isolated the DNA of a smooth variety of the
pneumococci bacteria and gave it to a rough variety of the same bacteria.
This transformed the rough variety to a smooth version of the bacteria.
Their conclusion that DNA alone was responsible for genetic influences
was soon substantiated by many other investigators.
This generated much excitement among biochemists, who were now able
to examine the quantity of DNA in cells. They found that the amount of
DNA in cells of organisms was always constant and that there was half
this amount in the sex cells of the organism. These discoveries were
consistent with Mendels laws discussed in previous parts of this module.
Extracting DNA in your own kitchen

Researchers separate DNA from the rest of the cell so they can find out
more about it. Extracting DNA involves three main steps:
breaking open the cell membrane and nuclear membrane
removing or dissolving cellular proteins
precipitating out the DNA.
Blueprint of life
Here is a simple set of instructions for extracting DNA in your own kitchen.
You can try this experiment yourself. If you do it, send your teacher some
comments describing how it went.
DNA in dried peas
DNA is easily extracted from cell tissue of common plant material found
around the kitchen. This is done using common household products like
detergent to help break down the membranes, salt to make proteins more
soluble and alcohol to precipitate out DNA.
Here is a method for extracting DNA from dried peas the type you use
to make pea and ham soup. Read the instructions first then write a list of
the equipment you will need. Then follow the instructions again while
you carry out the experiment.
What to do
1
Soak one quarter of a cup of dried peas in a cup of salty water.

Dissolve about half a tablespoon of salt in the water. It works better
if you leave it overnight.
Drain off about half a cup of the water then mash up the softened
peas with the back of a spoon or the end of a rolling pin. It should
be a bit lumpy so dont mash it too much.
Now add around 10 mL of wool wash detergent. (The eucalyptus

types are the best.) This should be mixed in with the peas for a
couple of minutes.
Get some methylated spirits and pour slowly over the top of the pea
mixture until you have filled one quarter of your cup. (Note: A glass
cup is better for this experiment because it makes it easier to see the
results.)
Make a list of the equipment you need.

_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Observe the DNA precipitating out of the pea mixture. It looks like
strands of phlegm, or a mucus-like substance, coming up into the
methylated spirits and floating on the top.
Comment on what you saw here.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Let your teacher know what you have found out, too.
Determining the structure of DNA

The discovery of the structure of DNA in March 1953 was one of the
most significant scientific achievements of the twentieth century.
The story of its discovery is an excellent example of how scientists
collaborate (work as a team) and how internal conflicts and personality
clashes influence effective communication in scientific research.
The main people responsible for the discovery are Rosalind Franklin and
Maurice Wilkins from a research unit at Kings College, London, and
James Watson and Francis Crick from Cambridge University, England.
Rosalind Franklin
Maurice Wilkins
Blueprint of life
The story of Rosalind Franklin would have been quite different if she
were born male. During the middle of the twentieth century, women
were not encouraged to do science. Women scientists were treated very
unfairly by the British scientific establishment.
At the age of 15, Rosalind had decided that she wanted to become a
scientist and had passed her exams to be admitted to Cambridge
University. Her father disapproved of a university education for women
and refused to support her until her aunt intervened.
Rosalind was a brilliant young woman whose early work on the nature of
carbon pioneered the field of high strength carbon fibre technology. This
work, done at Cambridge during wartime, gained her a PhD by the time
she was 26 and is still quoted today. After the war Rosalind began her
research into X-ray crystallography, a method of determining the
structure of crystals based on the use of X-rays. With this technique the
locations of atoms in any crystal can be mapped by looking at the image
of the crystal under an X-ray beam.
Rosalind contributed to the development of this technology by
pioneering its use in analysing a variety of substances, including DNA.
The Cambridge team of Watson and Crick made a failed model and were
told to stop DNA research. They had a close working relationship.
Watson and Crick were convinced that if the three-dimensional structure
of the DNA could be determined, then the way genes are passed on might
also be revealed.
James Watson
Francis Crick
Rosalind Franklin mostly worked alone because she and Maurice

Wilkins could not get along. He assumed she was to assist his
work while Franklin assumed she would be the only one working
on DNA. She worked alone most of the time using a technique
called X-ray diffraction. It showed that the DNA had all the
characteristics of a helix.
Franklin suspected that all DNA had a helix structure but did not
want to announce this finding until she had sufficient evidence.
Wilkins was frustrated and showed Franklins results to Watson
without her knowledge or consent. Crick later admitted:
Im afraid we always used to adopt lets say a patronising
attitude towards her.
The information Watson and Crick received from Wilkins was

crucial to the ultimate discovery of DNA. It was principally these
X-ray diffraction techniques developed by Franklin that allowed
Watson and Crick to suggest the double helix structure for DNA in
their famous paper, A structure for DNA Nature, April 2 1953.
The work of Wilkins and Franklin was acknowledged in this paper.
The structure so perfectly fit the experimental data that it was
accepted almost immediately.
Rosalind Franklin died of cancer in 1958 at the age of 37. In 1962
the Nobel Prize for physiology and medicine went to James
Watson, Francis Crick and Maurice Wilkins for their role in the
discovery of the structure of DNA.
Blueprint of life
The structure of DNA

DNA is a chemical substance known as a nucleic acid (because it is an
acid found in the nucleus of cells). The letters D, N and A stand for
deoxyribonucleic acid. There is another type of nucleic acid called
RNA; you will learn about it later when you study protein production.
DNA is a large molecule that exists in a shape called a double helix. A
helix is a spiralling shape, like a stretched spring. DNA is a double helix
because it is composed of two strands in this spiral shape that twist
around each other.
The double helix model for DNA.
Each strand of DNA consists of a chain of four different types of

subunits called nucleotides. Each nucleotide is made up of a sugar
molecule called deoxyribose sugar as well as a phosphate molecule and a
nitrogen base.
If you compare the DNA molecule with a ladder that has been twisted,
then the sugar and phosphate molecules make up the sides of the ladder
while the nitrogen bases make up the steps, or rungs.
sugar
nitrogen base
phosphate
Diagram of a nucleotide.
There are four different types of nitrogen bases in the nucleotides that
make up DNA. These nitrogen bases are called adenine (A), thymine (T),
guanine (G) and cytosine (C).
Observations based on chemical analysis show that there are equal
amounts of adenine and thymine, meaning that they are chemically close
to one another. It is also observed that cytosine and guanine occur in a
1 : 1 ratio and are therefore closely related.
Watson and Crick explained that this is because these nitrogen bases
form base pairs which hold the two strands together. Adenine will bond
with thymine (or thymine with adenine) and guanine bonds with cytosine
(or visa versa).
strand made of repeating phosphate and sugar units
strand made of repeating phosphate and sugar units

Matching nitrogen base pairs in DNA.
Describe the chemical structure of DNA.

_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
10
Blueprint of life
The transmission
of genes
DNA is the stuff that contains the genetic code. A series of bases
constitute the code for a gene. An average gene contains 1 000 to 2 000
base pairs.
gene code
C A
T T G
Each gene contains many base pairs.

A section of DNA showing a sequence of many nitrogen bases
which code for a gene.
Genes are passed from one cell to the next when a cell divides. This is
because DNA is duplicated during each cell division. Each time a new
body cell forms, it contains an identical copy of DNA from its parent
cell.
For the same reason, genes are passed from body cells into sex cells, and
into a new fertilised cell that forms into an offspring. Each time a new
sex cell forms, it contains an identical copy of half of the DNA from its
parent cell.
11
DNA duplication
In this course you need to understand how the structure of DNA enables
this molecule to replicate itself. This process is responsible for the
transmission of all the genes of the organism from one cell to the next.
During cell division, DNA copies itself by unzipping between the nitrogen
bases separating the two strands. The bonds that hold the bases together are
weaker than the ones that hold the strands themselves together.
When the strands separate, free nucleotides are able to join on the
exposed bases on the DNA strands. Nucleotides only join where the
nitrogen bases correspond A with T and C with G.
G
G
A
T
G
C
A
C
C
A double strand of DNA unzips so that nucleotides can match with its strands.
This process builds up a new strand on each of the unzipped strands,

forming two replicas of the original DNA.
DNA duplication showing two replicas of the original.
Hence the exact gene code is transmitted from one chromosome to the
next and so it goes on.
12
Blueprint of life
Making a summary
The next two pages show text and graphical information about DNA and
how it replicates. Cut out all the pieces then match the text with the
graphics. Explain the structure of DNA by putting them into logical order.
Check your answers then paste your summary onto your own paper.
A new DNA strand
is built up on each
existing strand,
producing two ne
w identical doub
le helix molecules
.
of
pairs mine
f
o
p
y
de u
ith th
is ma nly pair w , will only
x
i
l
e
e
o
h
tosin
uble
e will
A do . Adenin ne and cy
N
D
i
an
The n bases
o, gu
e
nitrog e other tw her.
h
ot
and t ith each
w
pair
se
en
ba
g
itro
ga
su
ate
ph
os
ph
Eac
h
two chrom
mol
oso
e
m
arou
nd e cules o e is ma
f DN
ach
d
A sp e of
othe
irall
r.
ed
C A
T T
G
T
G
A DNA molecule
is in the form
of a double helix str
ucture, which
is like a ladder th
at has been
twisted about its
long axis.
with a
ar molecule
g
su
a
f
o
p
ed to it.
e is made u
base attach
n
e
g
o
A nucleotid
itr
n
a
group and
phosphate
Cut out the
next page too.
13
14
Blueprint of life
G
G
G
A
the
cod
e fo
ra
gu er
C
an e a
in re
e, fo
th ur
ym ty
in pe
e, s
ad of
en nit
in rog
e
an en
d ba
cy se
to s
si
ne
.
Th
bas
es
is
W
ni he
t
un rog n th
zip en e
D
s
ex pai NA
r
po s m
sin sep ak
g ar es
th at a
e e re
nu an pl
cle d ica
ot the of
id D its
e
ba NA elf,
se la th
s. dd e
er
New nucleotides pair with the exposed bases.
As
et o
f
par
ticu
lar
gen
e.
The DNA mol

ecule is made
up of
a series of nu
cleotides.
15
16
Blueprint of life
How a gene
expresses itself
It wasnt until the work done by George Beadle and Edward L Tatum in
the 1940s that an understanding of how genes express themselves
became apparent.
George Beadle
Edward L Tatum
Beadle and Tatum found that when a specific gene was active, the cell
could synthesise a given substance. However, when the gene was altered
or eliminated, the cell was unable to synthesise the substance.
Beadle and Tatum succeeded in finding a relationship because they
studied enzymes. Remember, enzymes are involved in metabolic
processes. So if the particular enzyme needed to carry out a particular
step in a metabolic process is missing or defective, then the whole
metabolic process is slowed or brought to a stop. One enzyme is not
easy to see but the effect of a metabolic process can be.
17
The one gene one enzyme theory

Read about Beadle and Tatums one gene one enzyme theory below.
Underline or highlight evidence that Beadle and Tatum used to develop
their theory.
In 1941, Beadle and Tatum began a series of experiments on bread
mould (Neurospora). The wild strain of this mould could be made
to grow on a medium containing sugar and inorganic salts. The
medium included compounds that totally supported the mould.
Beadle and Tatum then subjected spores of the mould to X-rays to
induce mutations. (A mutation is a change in a gene that alters how
it functions or destroys it. Youll learn more about mutations later in
this part.)
They found that some mutated (changed) spores would not grow on
the ordinary medium. They concluded that X-rays had produced a
mutation that had changed Neurosporas nutritional requirements.
The genetic change caused the mould to stop growing because it
could not produce protein. This is a result of the mutated mould not
being able to synthesis an important amino acid from the sugar and
salts in the medium.
Beadle and Tatum set out to identify the amino acid. They tested
various nutrients by growing mould in mediums with different
nutrients missing until they narrowed it down to an amino acid
called arginine. They further concluded that the mutated spores had
lost their ability to manufacture their own amino acid arginine and
would not grow unless some ready-made arginine was added to the
medium.
They suggested that the enzyme which catalysed one of the reactions
needed to make arginine was not being formed. They assumed that
the gene responsible for manufacturing the enzyme was damaged by
the X-rays. No gene meant no enzyme.
By carrying out a long series of similar experiments, Beadle and
Tatum were able to build a case for the one gene one enzyme
theory. For their work, Beadle and Tatum shared the Nobel Prize in
medicine and physiology in 1958.
What Beadle and Tatum had actually found was the blueprint of life
contained in the chromosome for a particular feature in other words,
a gene. This is now commonly referred to as the genetic code.
Find out more about Beadle and Tatums famous experiments, and the
experiments that extended their work, in the library or on the Internet.
Youll find some places to start at:
18
Blueprint of life
Beadle and Tatums investigations centred on enzymes, which are a

special group of proteins. So, you will sometimes see their theory called
the one gene one protein theory.
Recall what you have learnt about the structure of protein. Remember, a
protein molecule is made up of a series of amino acids joined together.
More specifically, a series of amino acids joined together forms a unit
called a polypeptide. Many polypeptides bond together to form a
polypeptide chain, which is the protein.
The enzymes Beadle and Tatum studied were made up of only one
polypeptide. Later research showed that, where an enzyme is made up of
more that one polypeptide, a separate gene is involved for each
polypeptide. Thus, Beadle and Tatums theory is more commonly
known as the one gene one polypeptide theory.
How is it that a gene (a sequence of nitrogen bases in DNA) can control a
polypeptide produced by a cell? To answer this question, you need to
learn more about how proteins are produced.
Protein production
Gene expression requires a flow of information from a coded sequence of
nucleotide bases in DNA to another type of nucleic acid called RNA.
RNA stands for ribonucleic acid.
RNA
RNA is a single strand sequence of nucleotide bases. This is not the only
difference from DNA. RNA contains a ribose sugar rather than a
deoxyribose sugar and has a nitrogen base called uracil (U) instead of
thymine to pair with adenine.
Nitrogen bases in RNA.
19
There are also two types of RNA, each with a particular role in protein
production. They are:
messenger RNA (mRNA)
transfer RNA (tRNA).
Transcription
Transcription means writing across. During transcription, the code on a
DNA strand is written across onto a strand of mRNA.
For this to happen, part of the DNA in the nucleus unzips, as it would if it
were about to duplicate. But this time, ribonucleotides (RNA nucleotides)
pair up with the nitrogen bases on the exposed strands of DNA.
Uracil (U) on a ribonucleotide pairs with adenine (A) in the DNA strand.
A ribonucleotide with adenine pairs with thymine (T) in the DNA,
a ribonucleotide with guanine (G) pairs with cytosine (C) in the DNA and
a ribonucleotide with cytosine pairs with guanine in the DNA.
Write in the nitrogen bases that would match with the unzipped section of
DNA below. (You need to identify eight bases.) The first one is done for
you.
DNA
U
A
T
T G
A
C C T
mRNA
Check your answer.

In this way, the coded sequence of DNA encodes for a sequence of RNA
known as messenger RNA (mRNA). The mRNA is transported out of the
nucleus into the cytoplasm.
20
Blueprint of life
The diagram below summarises the process of transcription.
DNA
A copy of part of a DNA code is

transcripted onto mRNA
mRNA
mRNA transcript is released
mRNA moves out of nucleus

into the cytoplasm
nucl
nucleus
ear
me
mbr
ane
cytoplasm
A strand of mRNA encodes the nitrogen base sequence from DNA.
The messenger RNA (mRNA) carries the coded message from the DNA
into the cytoplasm. Then the message has to be changed into another
language, or translated, to be able to make polypeptide chains (which
are proteins). This process is called translation.
Translation
The sequence of ribonucleotides in the mRNA guides the synthesis of a
corresponding sequence of amino acids forming the polypeptides. This
is done via another intermediate RNA called transfer RNA (tRNA).
Translation is based around sequences of three nitrogen bases in RNA.
Each group of three bases is called a codon. And because it uses groups
of three nitrogen bases, this coding of information is often called the
triplet code.
21
Transcription occurs on organelles in the cytoplasm called ribosomes.

ribosome
mRNA
mRNA codon
A codon in a strand of mRNA.
The mRNA codon lines up on a ribosome, forming a template for a

corresponding tRNA anticodon. It is called an anticodon because it has
the opposite nitrogen base pairs to those in the mRNA codon.
ribosome
mRNA
tRNA anticodon
amino acid
A corresponding tRNA anticodon matches with a codon on mRNA.
Each tRNA anticodon carries a particular amino acid. So the mRNA

codon determines which tRNA anticodon will match with it and therefore
the sequence of amino acids that join together at the ribosome.
22
Blueprint of life
The diagram below summarises the process of translation.

ribosome
mRNA attaches
to a ribosome
mRNA
mRNA codons match

with tRNA anticodons
polypeptide
tRNA brings an amino acid

to a ribosome
amino acid
A polypeptide is built as amino acids
join together at the ribosome
tRNA with
amino acid
attachment
Translation of a strand of mRNA.
See an animated version of this process on LMPC science online:

The animation and the diagrams to summarise transcription and
translation are examples of models. They use drawings of objects to
represent chemicals in cells. This helps you to picture what is happening
and so to understand and remember these processes.
23
The genetic code for amino acids

The complete genetic code was first determined in 1966. It shows the
relationship between the bases on mRNA (the codons) and the
corresponding amino acids translated, using tRNA, on the ribosomes to
form polypeptides.
GU C
G
UC
GU C A G
GU C
A
A GU
C
phenylalanin
UCA
ine
eo
nin
hion
UCA
ine
AG
leuc
thr
C
GU C
CA
AG
arginine
GU C A G
U
glycine
se
rin
UCA
tyr
U G
serin
valine
ala
nin
cid
ca
rti
cid
pa
ic a
as
tam
glu
os
ine
AG
tryptophan
stop
eine
cyst
p
sto
C A
ine
lys
GU C
A
a
ar
GU C
gin
as
leucin
UC
GU C A G
ne
CA
GU
met
ine
oli
isoleuc
arginin
inin
arg
tid
his
pr
ine
The diagram below shows a simple method of determining the amino

acid that matches the triplet code on the mRNA. You do not need to
learn these codes but it will help you to understand how a nitrogen base
code can determine the kind and order of amino acids in a protein.
To determine the triplet code for an amino acid, work from the centre of the
diagram out towards the name of the amino acid. For example, the codon for
the amino acid called histidine is CAU- or CAC.
Notice that there is more than one triplet code for each amino acid.
24
Blueprint of life
Now try these questions.

1
There are eight different types of triplets that will code for the amino
acid called arginine. Write them out.
_____________________________________________________
What do the triplets UUA and UUG have in common?

_____________________________________________________
_____________________________________________________
Check your answers.

So, to summarise, a gene is a sequence of nitrogen bases on a strand of
DNA. The gene codes for a polypeptide. To make a polypeptide from
the gene:
the gene (sequence of nitrogen bases) is transcribed as mRNA
groups of three nitrogen bases on the mRNA match with groups of

three nitrogen bases on tRNA
each tRNA brings one amino acid to the mRNA at a ribosome
the amino acids join together to form a polypeptide.
Now solve this problem.

3
A polypeptide is found to contain a sequence of the following amino

acids:
serinethreonineleucineserine
a) Write a possible code for the mRNA that would be translated to
make this section of the polypeptide.
_________________________________________________
b) What would be the corresponding sequence on the DNA?
_________________________________________________
Check your answers.
How to start and stop

A cell needs to know when a polypeptide starts and stops, as well as the
amino acids within it. (The code on a strand of DNA is long and
continuous; one gene joins into another.) When to start and when to stop
is signalled by the code as well.
25
What is the role of DNA?

Hopefully, you can now explain how DNA is able to control the proteins
that are made by an organism. And the proteins that are made determine
the metabolic pathways and traits of the organism. So the chemical code
in DNA determines the features that you recognise in different living
things.
26
Blueprint of life
The origin of new genes
By now, you have probably concluded that the genetic code is essentially
a bunch of chemicals. If a molecular compound is responsible for lifes
blueprint then it will be vulnerable to all kinds of influences from the
environment.
What Beadle and Tatum effectively discovered was that mutations cause
actual defects in enzymes, preventing specific metabolic activities. Since
enzymes are manufactured according to the genetic code then it stands to
reason that a mutation is a change in the structure of a gene.
During the early decades of the twentieth century there was mounting
evidence that genes can be altered by some types of radiation, as well as
by certain chemicals.
Explaining mutations
One of the achievements of Watson and Cricks DNA model is that it
clearly explains the origin of mutation.
The simplest type of mutation can occur if a base pair, such as AT, is
replaced by a GC pair. Youve seen that so simple an alteration could
change an amino acid in a polypeptide, which may change the properties
of an essential enzyme or other protein.
Mutations may involve changes to many thousands of base pairs or the
reversal of an entire length of DNA. Changes in the nucleotide sequence
of DNA occur spontaneously in all living organisms because of the
interplay between the organism and the environment.
DNA also contains genes that look for mutations, so that damaged DNA
can be repaired or removed so that faulty genes are not used or passed to
other cells when the DNA replicates. But these control methods dont
always work. Changes to DNA can be permanent and, if the individual
lives to reproduce, it may pass on this mutated gene to its offspring.
27
Anything that causes a change to the DNA base sequence can cause a
mutation. Most mutations are derived from single nucleotide
substitutions in DNA, thus causing an amino acid substitution.
Within a gene, small deletions or insertions of a number of bases not
divisible by 3 will result in a frame shift. Remember, the code is a triplet
code, so if you take out two nitrogen bases, all the triplets from there on
will be wrong.
For example, consider the coding sequence:
AGA UCG ACG UUA AGC
The corresponding polypeptide is:
arginineserinethreonineleucineserine
The insertion of a CG base pair between bases 6 and 7 would result in a
new code:
AGA UCG CAC GUU AAG C
This would produce a different polypeptide:
arginineserinehistidinevalinelysine
which would result in a non-functional protein. Every amino acid after
the insertion will be wrong.
The frame shift might even generate a stop codon which would
prematurely end the protein. Other types of mutations include whole
segments reversing, producing a different kind of polypeptide.
A mutation may result in the formation of a tumour. If the mutation
happens to cells that produce sex cells, then the mutation may create a
new gene in a new individuals genetic code.
Now answer these questions.
1
What is a mutation?
_____________________________________________________
_____________________________________________________
Why can mutations lead to new alleles (forms of genes)?

______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
28
Blueprint of life
The discovery of mutagens

A mutagen is a substance, radiation or other condition that is capable of
causing a mutation. As you read the following information about the
discovery of mutagens, underline or highlight evidence that mutagens cause
mutation of genes.
When X-rays were discovered around the turn of the twentieth
century, they were regarded as totally harmless. X-rays were
interesting because they could penetrate solid objects. X-ray images
were a novelty and people could buy toy X-ray machines. Marie
Curie, a famous scientist of the time, carried a piece of radium
(which produces another kind of penetrating radiation called gamma
radiation) in her pocket to show that it glowed in the dark.
Marie Curie and her daughter, Irene Joliot-Curie (who also worked
with radioactive substances) died of leukemia, as did many watchdial
painters who used to paint radium onto the dials of watches to make
them glow in the dark. In fact, the incidence of leukemia among
radiologists (doctors who work with penetrating radiation) is still ten
times greater than among the normal public. Why is penetrating
radiation linked with leukemia? Leukemia is a blood disease caused
by a cancer of the leukocytes (a type of white blood cell). This type of
cancer is now known to be caused by mutation.
The fact that radiation can cause mutations was not discovered until
the 1920s when Hans J Mller discovered that genes had the ability
to mutate when exposed to X-rays. H J Mller received the Nobel
Prize in 1927 for the discovery that penetrating radiation causes
mutation.
Mller discovered that the relationship between the rate of mutation
and dose (the amount of radiation received) was linear. This means
it is like shooting bullets at a target. The chances of hitting the target
go up with the number of shots you have. He found that there is no
absolutely safe low level of X-rays because even very small doses
are dangerous if given over a long enough period of time.
Other interesting effects were discovered. For example, there were
fewer mutations than expected when males were exposed to very
high sudden doses of radiation. This was because a high dose kills
off many sperm, sterilising animals for a while, until new unmutated
gametes are made.
29
There was no increase in the rate of mutation among the descendants of

the Hiroshima nuclear explosion in 1945. However, it is estimated that
there is a 100 times increase in the mutation rate among the descendants
of the 10 million victims of the Chernobyl nuclear accident.
How would you explain these observations?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answer.

Continue to identify evidence that radiation and substances can cause
mutations.
In the early twentieth century, nothing was known about the nature
of the genetic material so physicists were amazed that such a small
amount of energy given as X-rays could have such a large biological
effect. This lead to the very first suggestion that the gene was a tiny
part of a cell.
Scientists used X-rays to help them investigate the nature of genetic
material and the kinds of biological damage that radiation could
cause. Indeed, you have just learnt that Beadle and Tatum used Xrays to purposely induce mutation. In 1938 Karl Sax extended these
observations by showing that X-rays could induce chromosomal
alterations in plant pollen cells.
In 1942 Charlotte Auerbach became aware that war gases such as
mustard gas caused burns that looked like radiation burns. She
tested these chemicals on Drosophila (fruit flies) to see whether they
caused mutations and found extensive effects. This information was
kept secret until the end of World War II.
William Russell and his colleagues developed a method of testing
the effects of mutagens on mice rather than fruit flies. This was an
important breakthrough because it opened up this field to the study
of mammals.
In 1972 Bruce Ames developed the now universally used Ames test
to check known carcinogens (cancer-causing substances). He tested
many chemicals to see if they were mutagens in bacteria. If they
were, then they were considered possible carcinogens for humans.
30
Blueprint of life
The Ames test confirmed that many chemicals already known to

damage DNA also caused mutation. This test gave insight into many
previously unsuspected mutagens (some of which have since been
declared illegal). These mutagens included: red hair dye; tris, used
for fireproofing childrens clothing; natural foodstuffs such as
caffeine (in coffee), caffeic acid (in lettuce), hydrazines (in
mushrooms), psoralens (in oil of bergamot in Early Grey Tea),
Safrole (in oil of sassafras found in natural root beer) and even
char-grilled meat.
One of the most potent chemical mutagens is aflatoxin, found in
moulds growing on stored foods, especially peanuts. This was found
to be responsible for high levels of liver cancer in Africa. Various
chemical sprays, such as insecticides and antifungal agents, were
also found to cause mutation. Ironically, one of the best places to
find mutagens can be in a health food store.
During the early days of the study of mutagens, there was great
concern that we might be damaging the genes of future generations
by accident. This damage would be due to mutagens in the
environment. That feeling is now reduced but there are equivalent
concerns that there may be an increase in mutation, leading to
increased incidence of cancer, as a result of human activity.
2
Why are people concerned about the levels of mutagens in the

environment? Use at least two examples in your answer.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answer.

Use information that you have underlined or highlighted in this section
to complete Exercise 4.4.
31
Examples of new genes

As you have learnt, mutations can be a source of new alleles within
populations. If a mutation produces a trait that assists an individual to
survive and reproduce, then the mutation may be a force in driving the
evolution of that species. Such a mutation is called advantageous.
A mutation that reduces the likelihood that an individual will survive and
reproduce is called disadvantageous. Such mutations do not persist in a
population because they are selected against. Some, however, may
reoccur in a population but they remain in very low numbers.
Some mutations do not affect an individuals ability to survive and
reproduce. These mutations are called neutral. Neutral mutations
continue in populations and at a future time, they may become
advantageous or disadvantageous because of changes in the environment.
Sickle cell anaemia

Sickle cell anaemia is an example of a mutation cause when one amino
acid is incorrectly substituted into a red blood cell protein. The mutation
changes the shape of the protein, causing a subsequent change in the
shape of a red blood cell.
Sickle cell anaemia is inherited as a recessive gene and causes death in
its homozygous form. (This is definitely disadvantageous!) However, as
a hybrid it causes the red blood cells to have a sickle shape that makes
the individual immune to an infectious disease called malaria.
Complete Exercise 4.5 using sickle cell anaemia as an example of the effect
of a mutated gene.
Antibiotic resistance
Antibiotic resistance in bacteria has become a major health issue in the
community and in hospital settings. Antibiotics are substances produced
by other microorganisms, such as fungi, to fight off or even kill bacteria.
The first antibiotic discovered was penicillin and it was produced on a
large scale by the end of the Second World War. It quickly became one
of the most important drugs in medicine. Soon afterwards many more
antibiotics were discovered.
The chief disappointment in the development of antibiotics has been the
speedy rise of resistant strains of bacteria. In 1939, for instance, all cases
of meningitis and pneumococcal pneumonia showed a favourable
32
Blueprint of life
response to the administration of antibiotics. Twenty years later, only

half the cases did. The various antibiotics also became less effective
with time. This is because resistant mutants among the bacteria
flourished and multiplied when the normal strains were killed off.
Resistant mutants are bacteria that have the ability to produce an enzyme
that effectively destroys antibiotics.
The chance of a mutation, causing bacteria to become resistant to an
effective antibiotic, is very low. The absolute numbers of such
mutations, however, is fairly high. This is explained by the fact that
bacteria multiply very quickly and are capable of transferring
information from one bacterium to another. This makes the spread of
resistance even more rapid.
The genes necessary for the production of these antibiotic-destroying
enzymes are found in plasmids. Plasmids are small DNA structures that
the bacterium duplicates then transfers to another bacterium, causing the
further spread of antibiotic resistance.
The danger of resistant strains of bacteria is greatest in hospitals, where
antibiotics are used constantly, and where the patients naturally have
below normal resistance to infection. Certain new strains of
staphylococci resist antibiotics with particular stubbornness. This
hospital staph is a serious worry in maternity wards, for instance, and
attained headline fame in 1961, when an attack of pneumonia, sparked by
such resistant bacteria, nearly ended the life of screen star Elizabeth
Taylor.
Where one antibiotic fails, another may still attack a resistant strain.
New antibiotics, and synthetic modifications of older types, are
constantly being developed. The ideal thing would be to find an
antibiotic to which no mutants are immune. Then there would be no
survivors of that particular bacterium to multiply.
A modified penicillin, called Staphcyllin, was developed in 1960. It is
partly synthetic so its structure is strange to bacteria. Therefore enzymes
that can work against ordinary penicillin do not ruin Staphcyllins
activity. Hence, Staphcyllin is death to otherwise resistant strains. It was
used to save Taylors life, for instance. Yet strains of staphylococcus,
resistant to synthetic penicillins, have also turned up. Presumably, the
merry-go-round will go on forever.
Use information about antibiotic resistance to complete Exercise 4.6.
33
Evolution and genes
You have seen that evolution occurs because environmental factors select
for organisms with genes that best enable them to survive and reproduce.
There is a variety of alleles in a population, and not all genes are
expressed all the time (for example, genes may be recessive). In
addition, new genes are produced by mutations. So when environmental
factors change, some organisms in the population may have genes that
will produce characteristics to suit the new environment and evolution of
the population will occur.
This explanation of the role of genes in evolution provides for a very
gradual change in organisms over time. And this gradual change has
been observed. This kind of evolution was explained by Charles Darwin
using his theory of natural selection and survival of the fittest. Consider
the diagram below.
TIme
Morphology
A gradual change in morphology (body features) over time.
The sloping lines of the diagram represent the gradual change in the
features of a kind of organism.
However, this is not the only way to explain how evolution occurs.
34
Blueprint of life
The fossil record contains many large jumps. These are times when
many different species suddenly appeared and times of mass extinction.
Another evolutionary theory called punctuated equilibrium has been
developed to explain these situations.
Punctuated equilibrium
During times of diversification and times of mass extinction, the normal
laws of natural selection, which constantly operate during normal times,
are overtaken by different rules for survival.
Sudden changes to the environment cause rapid evolutionary change
because vacant niches are taken over by members of the population that
are best suited. This can cause very rapid and diverse speciation.
Once a species survives and becomes established, its features
(morphology) remain constant for as long as the environment remains
unchanged. The average species survives for a few million years and
may give rise to other species before it is interrupted by an abrupt
extinction event.
During times of mass extinction, no rules or laws have yet been devised
to explain who survives. It seems, according to most scientists, that the
history of life has been shaped by these periods of random annihilation of
quite perfectly adapted species.
Consider the following diagram of punctuated equilibrium.
TIme
Morphology
A punctuated equilibrium model of changes in morphology over time.
Notice that each branch in the diagram begins with a very large change in
morphology over a very short amount of time. Then the organism
continues to exist in very much the same form as time passes.
35
According to the punctuated equilibrium theory, evolution is a sudden

and random process rather than a continuous and gradual one. The
punctuated equilibrium theory does not replace the theory of natural
selection but instead broadens it to better explain lifes history as
observed in the fossil records.
Genetic evidence for evolution

In Part 1 it was mentioned that the biomolecular technology of today is
providing scientists with new clues about the relationships between
species. The genetic revolution in particular has provided techniques that
enable biologists to determine connections between species by
comparing how closely their DNA matches.
This technique, known as DNA sequencing, simply compares the number
of matching nucleotides in a common section of DNA. For example, the
DNA sequence below compares the number of matches between an
octopus and a rat.
982 TGTTTGCTAAAGCTTCAGCTATCCACAACCCAATTGTCTAC
octopus
961 TCTTTGCTAAGACCGCCTCCATCTACAACCCAATCATCTAC
rat
Nitrogen base sequences in similar sections of DNA.
How many matches did you notice? Scientists have found that the
genetic codes of even quite different organisms or more similar than was
previously expected.
For example, the Human Genome Project, which was an international
collaboration to identify the genes in human DNA, has found that
humans have approximately 30 000 genes. Of these, more than 200 are
identical to genes found in bacteria. Many human genes have existed for
a very long time and are shared with other organisms.
The existence of identical genes in different organisms further
strengthens the theory that organisms have changed over time. While
some genes have been added or changed, others from an ancient ancestor
have remained because they control a vital, common process.
Scientists had hoped that they would be able to identify genes that differ
between very similar species. For example, they were hoping to be able
to compare human and ape genomes and identify genes responsible for
higher order thinking, speech and perhaps religious consciousness. It
now seems unlikely that this will be possible.
36
Blueprint of life
Where to from here, oh mighty genie?

So there you have it. DNA is basically responsible for life and it has
continuously evolved to produce organisms to suit different
environments. In fact, this self-replicating molecule is the only kind of
entity that needs to exist in order for life to arise.
Does it need to be encased in a body at all? After all, natural selection
would work more effectively if life were just made up of replicators.
(Is this what viruses are?)
Now that humans have discovered the structure and function of lifes
blueprint, research has rapidly moved into ways to modify it. Humans are
beginning to artificially change life forms and create new ones by
manipulating and engineering the DNA code. Read and learn about what
is happening with gene technology in Part 5.
Exercise 4.8 is a problem that will help you to bring together ideas from
throughout the module. Complete this exercise now.
37
38
Blueprint of life
Suggested answers
Structure of DNA
Each chromosome is made of two molecules of DNA spiralled
around each other. These consists of alternating sugar (deoxyribose)
and phosphate units linked by the four nitrogen base pairs of adenine
with thymine and cytosine with guanine.
Making a summary
Each chromosome is made of two molecules of DNA spiralled around

each other.
A DNA molecule is in the form of a double helix structure that is like a

ladder that has been twisted about its long axis.
The DNA molecule is made up of a series of nucleotides.
39
sugar
nitrogen base
phosphate
A nucleotide is made up of a sugar molecule with a phosphate group and

a nitrogen base attached to it.
There are four types of nitrogen bases. Guanine, thymine, adenine and
cytosine.
T
G
The DNA double helix is made up of pairs of nitrogen bases. Adenine

will only pair with thymine and the other two, guanine and cytosine will
only pair with each other.
40
Blueprint of life
gene code
C A
T T G
A set of bases is the code for a particular gene.
When the DNA makes a replica of itself the nitrogen pairs separate and
the DNA ladder unzips exposing the nucleotide bases.
C
G
G
T
A
G
G
C
C
New nucleotides pair with the exposed bases.
A new DNA is built up on each existing strand, producing two new

identical double helix molecules.
41
Transcription
DNA
U
A
A
C G G A U T
A
T G
A
C C T
mRNA
The genetic code for amino acids

1
AGG AGA CAA CAG CGU CGC CGA CGG
Both code for leucine.
There are six possible codons for serine, four for threonine, and six
for leucine. Your answer could be a combination of any of these.
Here is one suggestion.
a) UCA ACU UUA UCA
b) TCA ACT TTA TCA
Explaining mutations
1
A mutation is a change in the genetic code.
A new allele is formed because the change in code creates different

polypeptides.
The discovery of mutagens
42
The victims of Hiroshima were either killed outright or were sterilised

by the massive dose of radiation. The victims of Chernobyl received a
lower dose of radiation that was not enough to sterilise them but was
enough to cause mutations in their DNA. The mutation that occurred
in their sex cells would be passed on to their descendents.
People are concerned about the levels of mutagens in the

environment because the mutagens produce cancers that may be
fatal. Chemical sprays, such as insecticides and pesticides, have
been shown to be carcinogens. Also many food products may cause
cancer, such as caffeine, psoralens and safrole.
Blueprint of life
Exercises Part 4
Name: _________________________________
Exercise 4.1: Determining the structure of DNA

a)
Rate the following people in order of their relative importance in the

discovery of the structure of DNA. Number them from 1 for the
most important to 4.
Francis Crick
Rosalind Franklin
James Watson
Maurice Wilkins
b) The Nobel Prize for physiology and medicine can only be shared
among three people. If Rosalind Franklin had not died, do you think
that she would have received the prize? Who would not have
received it? Give reasons for your answers.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
Watson and Cricks working style was more successful that Franklin
and Wilkins. What made it more successful?
_____________________________________________________
_____________________________________________________
_____________________________________________________
43
Exercise 4.2: DNA duplication

a)
As a science writer for your school magazine, you have been given
the job of explaining the role of DNA in the transmission of genes
from one generation to the next.
You can use information from the summary you have just prepared
but your answer must be an original description. (That is, write it in
your own words; do not copy out your summary!) Use diagrams as
appropriate.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) Why is this process of DNA replication important?

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
44
Blueprint of life
Exercise 4.3: What is the role of DNA?

You have used picture and letter models in this part to represent chemicals
involved in the production of proteins from a code stored within DNA.
Using a simple model, outline how DNA controls this process.
Use the scaffold below to help organise your answer. Include a simple
labelled diagram to model what you are explaining for each point.
Simple diagram of model
Outline of step in the process
How is the code stored in DNA?

_________________________________________
_________________________________________
_________________________________________
_________________________________________
How is the code transcribed?
_________________________________________
_________________________________________
_________________________________________
_________________________________________
What is the role of tRNA?
_________________________________________
_________________________________________
_________________________________________
_________________________________________
How does a specific polypeptide form?
_________________________________________
_________________________________________
_________________________________________
_________________________________________
45
Exercise 4.4: The discovery of mutagens

You have identified historical evidence that radiation and certain
chemicals can be mutagenic. Illustrate this mounting evidence by
drawing a timeline for the identification and study of mutagens.
Use information from this part in your timeline.
46
Blueprint of life
Exercise 4.5: Sickle cell anaemia

Sickle cell anaemia is caused by the substitution of one incorrect amino
acid in a protein. Use a simple model (such as diagrams or letters) to
explain how a change to DNA produces this new shape of red blood
cells.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 4.6: Antibiotic resistance

Antibiotic resistance is a modern example of natural selection.
a)
What feature of bacteria determines whether bacteria are the fittest

in this example?
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) What is the source of this variation in bacteria?

_____________________________________________________
_____________________________________________________
47
c)
As new synthetic antibiotics have been developed, populations of

new drug-resistant bacteria have been identified. How does an
understanding of how new genes are formed help you to explain why
new kinds of bacteria have evolved?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Exercise 4.7: Punctuated equilibrium

a)
Describe the concept of punctuated equilibrium in evolution.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) How is punctuated equilibrium different from a gradual evolutionary

model?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
48
Blueprint of life
Exercise 4.8: Where to from here, oh mighty genie?

In this module, you have learnt about how sexual reproduction increases
the genetic variety of organisms, and variety is needed for evolution to
occur in changing environmental conditions.
If sexual reproduction is so valuable, how would you explain the
evolution of highly successful asexual organisms, such as bacteria?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
49
Biology
HSC Course
Stage 6
Blueprint of life
Part 5: Playing with nature
Contents
Introduction ............................................................................... 2
Artificial selection....................................................................... 4
Artificial insemination ...........................................................................5
Artificial pollination ...............................................................................8
Cloning..................................................................................................9
Transgenic species ................................................................. 12

Producing transgenic plants .............................................................12
Producing transgenic animals ..........................................................14
Examples of GM species ...................................................................15
Genetics and ethics................................................................. 18

GM products and labelling ................................................................20
The Human Genome Project and its implications for medicine ......21
Biodiversity ............................................................................. 22
What is biodiversity? ..........................................................................22
Why value biodiversity? .....................................................................23
Preserving biodiversity ......................................................................25
Exercises Part 5 ................................................................... 33
Introduction
If you are fairly confident that you understand most of the first four parts
of this module then you have learnt the basics of evolution and genetics.
In this part of the module you are going to need to use this knowledge to
understand how humans are manipulating nature.
Before humans came along, random events and natural selection had
been responsible for distributing all of the life forms throughout the
biosphere. Through selective breeding, humans have changed some
species to suit their needs. Reproductive techniques such as artificial
insemination, artificial pollination and cloning have accelerated this
selection process.
You will be shown some of the techniques used to purposely alter, or
engineer, the genetic composition of organisms. These processes are
called genetic engineering and it has the potential to alter the path of
evolution.
Biotechnology is the deliberate introduction of foreign genes into the
chromosomes of plants and animals to alter their characteristics and to
create brand new organisms. The altered or new organisms created are
called transgenic species and this part explores the ethical issues arising
from the development and use of biotechnology. You will be given
information about a genetically altered plant (Bt cotton) and animal
(OncoMouse) so that you can discuss the potential impact on genetic
diversity.
Gene science has advanced to the stage where its applications have the
potential to revolutionise life itself. The biotechnology industry is
rapidly becoming a giant. The need for public debate is greater than
ever. Issues involving the genetic engineering of crops are very topical
and genetically modified food (GM food) has quickly become a
household term.
By the time you have finished working through this part you will have
become more aware of how genetics is playing with Mother Nature and
how this is changing future evolution.
Blueprint of life
identify how the following current reproductive techniques may alter

the genetic composition of a population:
artificial insemination
artificial pollination
cloning
outline the processes used to produce transgenic species and include

examples of this process and reasons for its use
discuss the potential impact of the use of reproduction technologies

and genetic engineering on genetic diversity of species using a
named plant and animal example that have been genetically altered
explain the need to maintain biodiversity and identify and discuss a

current effort to monitor biodiversity.
process and analyse information from secondary sources to research

a methodology used in cloning organisms
process, analyse and present information from secondary sources to

identify examples of the use of transgenic species and use available
evidence to debate the ethical issues arising from the development
and use of transgenic species.

Boards website at:
Artificial selection
The first chapter of Charles Darwins On the origin of species is entitled

Variation under domestication where he presents many examples of
how domesticated plants and animals have changed over time to become
better adapted to human needs. He explains these changes as:
mans power of accumulative selection: nature gives successive
variations; man adds them up in certain directions useful to him.
In agriculture and horticulture, humans purposely choose particular

organisms from which to breed. The organisms are selected because they
have certain characteristics that people want. Productive food, champion
racehorses, colourful flowers and prize-winning pedigree dogs have all
been the result of artificial selection (selective breeding).
The first domestication of food plants probably took place between
10 000 and 13 000 BC in Southeast Asia where crops such as rice and
beans were planted and harvested. The Fertile Crescent, which includes
parts of present-day Iraq, Iran, Turkey, Lebanon, Israel and Jordan, were
other sites where crops like wheat where developed. Animals, such as
the horse, donkey, camel and sheep, were domesticated as well. Early
farmers took advantage of naturally occurring genetic differences to
produce higher percentages of desirable genes.
It was not until Gregor Mendels work concerning the genetic basis of
inheritance that plant and animal breeding would have a scientific
foundation. This foundation permitted rapid advances in breeding
techniques beginning in the 1900s.
Today biotechnology plays an important role in artificial breeding in the
laboratory. No longer do scientists have to wait for a whole generation to
pass to see the effects of artificial selection. Through cloning and genetic
engineering the whole process can be sped up.
Blueprint of life
What is artificial selection and what is the history of this process?

_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
Artificial insemination
Artificial insemination was first developed for breeding cattle and
horses and is used extensively in Australia in the dairy cattle industry.
This is an animal breeding process in which male gametes (the sperm or
spermatozoa) are collected and introduced artificially into the female
genital tract for the purpose of fertilisation.
This technique enables superior males to inseminate many more females
than would be possible by natural mating. Semen from good bulls is
used to inseminate about 1 000 to 2 000 cows a year. By natural methods
the same animal would be lucky to inseminate 100 cows.
Comment on the impact this artificial insemination practice could have
on the future genetic composition of cattle.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
Other artificial methods for achieving fertilisation have since been
devised. Many of these methods are expensive and are only used when
fertilisation is strongly desired. This may be for the production of
endangered species, valuable agricultural or pet species or to overcome
human infertility.
Human reproductive technologies

Artificial insemination techniques have been developed to help with
human fertility. About one in six couples suffer from problems of
infertility at some time in their lives. There are many different causes of
infertility. Some are always present; others are gained through life.
Human infertility has been overcome in many cases with the recent
introduction of the following kinds of reproductive technologies.
In vitro fertilisation (IVF)
A different method of artificial insemination is the mixing of sperm and
ovum in a nutrient medium outside the womans body. The term test
tube baby comes from this procedure because the gametes are usually
mixed and fertilised in a glass test tube. The name in vitro fertilisation
comes from the Latin word for glass is vitrum (hence in vitro).
The IVF technique is used when a womans fallopian tubes (oviducts)
are blocked. The procedure is summarised as follows.
Basic screening tests are performed on both partners. The results of the
tests enable the clinic to find out if the female can make sufficient
follicles (egg-containing structures) and eggs. It also checks the health
of the sperm.
All parties sign consents.
The woman is stimulated with injected medications to produce multiple

egg development. These injections continue for about 8 to 10 days.
Blood and ultrasound testing is done every 1 to 3 days to monitor the

development of the follicles in the ovaries. A minimum number of
follicles (4 to 5) are needed.
When the womans follicles are mature, a procedure is performed to

remove the eggs from the follicles.
The eggs are then fertilised in the laboratory with her partners sperm.
The embryos are cultured in the laboratory for 2 to 6 days.
One or two embryos are transferred to the womans uterus where they
hopefully implant and develop to result in a live birth.
If there are unused embryos (of sufficient quality) beyond the number
that is transferred, many couples prefer to have them frozen
(cryopreserved) for use in a future procedure if this one fails or the
couple want another child in the future.
The first baby born as a result of such a procedure was the English test
tube baby, Mary Louise Brown, in 1978. Controversies have arisen over
the legal and ethical status of some of these procedures, which have been
widely used.
Blueprint of life
Zygote intrafallopian transfer (ZIFT)

In some cases, zygote intrafallopian transfer (ZIFT) is used instead of
conventional IVF. If the male has severe infertility or if there has been
difficulty in confirming fertilisation with past procedures, ZIFT has the
advantages of allowing fertilisation to be confirmed and has a higher
success rate than IVF.
ZIFT is just a variation of traditional IVF. With this procedure the
fertilised egg at the two-cell stage, called a zygote, is transferred back
into the woman. This fertilised egg is placed directly into the fallopian
tube hence the female partner has to have at least one functioning
fallopian tube.
Gamete intrafallopian transfer (GIFT)
Gamete intrafallopian transfer (GIFT) was developed in 1984 as a
variation of in vitro fertilisation. The main difference between GIFT and
IVF is that, with GIFT, fertilisation occurs naturally within the female
partners body instead of in the laboratory.
The developing embryos remain in the fallopian tube and then move
naturally to the uterus for the natural implantation process. GIFT is
sometimes selected based on a couples religious beliefs that prohibit
conception outside the body.
These reproductive technologies have allowed many couples to have
children who would have been unable to reproduce naturally.
Comment on the future genetic composition of the human race if these
practices continue.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
Artificial pollination
In flowering plants, pollination is the transfer of pollen from the anther
to the stigma. After pollination and fertilisation, a fruit develops.
There are two types of pollination.
Self-pollination occurs when the pollen is transferred from the

anther to the stigma on the same flower or from another flower on
the same plant.
Cross-pollination is the transfer of pollen from one plant to the

flower of a genetically different plant or variety.
Artificial pollination is the deliberate selection of useful plant varieties

by breeders. It involves selection and cross-pollination to produce
varieties and hybrids with traits desired by horticulturists. Gregor
Mendel used these techniques on his famous experiments on pea plants.
The selection of more successful plant varieties dates from the beginning
of agriculture itself. The deliberate interbreeding of plants carrying
desirable characteristics has been practiced for thousands of years.
Artificial selection and breeding of plants has progressed at an
accelerated rate since the introduction of sophisticated plant breeding
techniques.
Describe how artificial pollination of certain plants may alter their genetic
composition.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answer.
Blueprint of life
Cloning
A process called vegetative propagation, or cloning, reproduces plants
like bananas, grapes, pineapples and sugarcane. This is an asexual
method of reproduction that includes budding, grafting, stem cuttings and
the growth of plant tissue in a nutrient media. The advantage of this type
of propagation is that the desired clone can be rapidly multiplied for use
as a commercial crop.
A clone is an identical organism or group of genetically identical
individuals descended from the same parent by asexual reproduction.
Many plants, such as grasses, show this by producing buds, suckers,
tubers or bulbs to colonise the area around the parent.
Some animals produce clones of themselves; for example, aphids. In the
early embryo, each of the cells has the potential to create a whole
organism. Identical twins are examples of clones.
Is that ewe Dolly?

Cloning came into the spotlight in the media in 1997 when Dr Ian
Wilmut and his team at the Roslin Institute in Scotland created a lamb
named Dolly.
A cloned animal can be produced in the laboratory by splitting early
embryos and culturing them to produce two or more from the original
egg.
Another technique called nuclear transfer works by transferring the
nucleus of a body cell into an egg that has had the nucleus removed.
Dolly was cloned by the nuclear transfer technique with her DNA
coming from a single cell taken from her mothers egg that is then fused
with a mammary cell (thus the name Dolly after Dolly Parton).
The fused cell then develops into an embryo that is implanted in a
surrogate sheep. A surrogate is one who takes the place of another, so
the surrogate is an animal that acts in the place of a mother. The
surrogate is not the mother because none the genetic material in the
embryo comes from the surrogate.
The embryo grows into a lamb that is genetically identical to the donor
sheep.
The process to clone Dolly is illustrated on the following pages.
donor
donor cell
A body cell is taken from a donor ewe and

placed in a low nutrient culture. This starves
the cell and stops it from dividing.
An unfertilised egg cell is taken from

another ewe and the nucleus with its DNA
is sucked out.
blackface ewe
egg cell
DNA
The two cells are placed next to each other and

given an electric pulse. This mimics the burst
of energy at natural fertilisation causing cell
division to begin.
fused cell
10
Blueprint of life
fused cell
4 The resulting embryo is implanted

in the uterus of another ewe.
embryo
The cloning of Dolly is the most famous example of cloning. Find out more
about how Dolly was produced or learn about other examples of cloning.
Use books, your local library or the Internet.
There are some useful sites on the Science webpage for you to start with at:
Problems with cloning Dolly

Cloning animals is not an easy task. It took more than 277 attempts
before Dolly was created. The mitochondrial DNA from the donor was
not transferred so that Dolly was not a complete clone and it now appears
that Dolly is aging prematurely. All of these problems highlight the
difficulty of cloning adult mammals.
11
Transgenic species
During the 1970s, a discovery that certain enzymes have the ability to cut
and splice hereditary material of living organisms expanded and sped up
the use of reproductive technologies. These methods, called
recombinant DNA technology or simply genetic engineering, use
special enzymes called restriction enzymes to cut the long DNA
molecules of living matter into pieces as small as one gene in length.
Once the chromosomes are split, millions of copies of the gene are made
through a polymerase chain reaction. (Polymerase is an enzyme that is
able to make this duplication reaction happen very quickly.) Then these
genes are inserted into other cells.
There is more explanation about how genetic engineering is done in the
fact sheets in the Additional resources section.
There are some useful sites on the Science webpage to help you understand
the technology better. The website is at:
Transgenic species are created by taking a gene from one species and
inserting it into another species.
Producing transgenic plants

There are four main reasons for producing transgenic plants. These are:
12
to increase yield
to increase quality
for pest and disease resistance
to produce drugs.
Blueprint of life
Transgenic plants can be produced by several methods. The four main

methods are outlined below.
Method 1: Agrobacterium tumefaciens

Agrobacterium tumefaciens is a soil bacterium that has been doing
genetic engineering of its own for millions of years. It does this by
inserting some of its genes, in the form of a structure called a TI plasmid
(a tiny ring of DNA), into the chromosomes of plant cells.
bacterial DNA
plasmid
A bacterium showing its plasmid.
In nature, Agrobacterium uses its ability to add genes to plants to help it

to survive and reproduce. The foreign DNA (in a plasmid from the
bacterium) causes some plant cells to form tumours that produce unusual
compounds (opines) that serve as food for the bacteria. That is, this
bacterium is a naturally occurring genetic engineer that has evolved the
ability to alter plant cells to provide its own food.
Agrobacterium can be manipulated to insert selected genes into
broadleafed plants such as tomato and soybean. Genetic engineers do
this by splicing desired genes into an Agrobacteriums plasmid. The
Agrobacterium inserts the plasmid into a plant cells chromosomal DNA.
The targeted plant cell is then coaxed into developing into a complete
fertile plant that will pass on the engineered DNA, with all its
accompanying genes, to its offspring.
plant cell
plant nucleus
bacterial
DNA
plasmid
Bacterium with
plasmid attaches
to plant cell
plasmid
DNA
Bacterium inserts
copy of plasmid
into plant nucleus
Plasmid with new

genetic information
now incorporated
into plant DNA
As plant cells
reproduce they
replicate the foreign
information along
with their own DNA
Genetic engineering with an Agrobacterium.
13
When a gene that produces a desired protein is removed from a plant or

animal cell and spliced into a bacteriums plasmid, the gene will continue
to produce its designated protein product in its new bacterial setting.
Provided with a nutrient-rich environment, the bacterium quickly grows
and divides, producing more cells that also contain the foreign gene.
This gene will produce the desired protein which can then be harvested
from these bacterial chemical factories. With this technique, bacteria
have been genetically engineered to produce such protein products as
insulin, human growth hormone, the antiviral drug called interferon, as
well as thousands of other important protein substances.
Method 2: The gene gun

The gene gun shoots small gold or tungsten particles that have been
coated with DNA into a plant cell. Some of these will introduce new
DNA into a cell and then these plant cells are grown into transgenic
plants.
Method 3: Electroporation
By applying short electrical pulses to plant cells that have had their cell
walls removed, it is possible to produce pores in the cell membrane that
will allow foreign DNA to enter a cell. The cells that incorporate this
foreign DNA into their genome can then be grown into plants.
Method 4: Microinjection
Microinjection is suitable for plant and animal cells. DNA is absorbed
into liposomes, which are hollow fatty molecules. These are then
injected into a cell. Some of the DNA may be incorporated into the
cells genome.
Producing transgenic animals

All animal cells can be traced back to one cell at the start of their lives.
By changing the genetic make up at this point, all future cells will carry
the genetically engineered DNA.
The main method of producing transgenic animals is through the process
described above, called microinjection. The new DNA is injected
directly into a fertilised egg cell before it starts dividing. It is a random
process and only rarely is the DNA incorporated into the cell DNA.
14
Blueprint of life
Once an embryo has been genetically altered, it is implanted into the

uterus of a surrogate mother. The resulting transgenic animal can be
used to breed by traditional methods, with each offspring containing the
altered gene. The first transgenic animal was produced in this manner in
1981 when a rabbit gene was inserted into a mouse embryo.
There are four main reasons for producing transgenic animals. These
are:
as disease models for medical research eg. OncoMouse (See below.)
for genetic research
to produce drugs
for organ donation.
Examples of GM species
Genetically modified (GM) species are those that have genes from
another species inserted into their DNA by genetic engineering. Because
the genes of all living things use the same DNA code (with a couple of
unusual exceptions), the genes from any organism can be inserted into
any other organism.
Although genetic engineering is a very young field, it has already had
some impact on food production and promises to have much more in the
future. For example, about half the cheese produced in the United States
uses an enzyme created by bacteria that have been genetically engineered
to contain a cow gene.
Extensive research is under way by firms such as Calgene, Monsanto and
DuPont to genetically engineer crops that are resistant to herbicides,
harmful insects, viruses, bacteria and fungi.
Genetic manipulations at the level of DNA have also changed long held
views as to what is considered to be animal, plant and human. For
example, how do you classify a plant that contains animal genes and
makes animal proteins? There are growing concerns about the future
applications of GM technology and how it may adversely affect
environments, our health and lifestyles.
The potential impact that gene technology will have on the diversity of
species has recently sparked a lot of debate.
As you read the GM examples below, think about advantages and
disadvantages of transgenic species. Discuss your ideas and opinions with
other people, if you can.
15
Bt cotton
Bt cotton has been genetically engineered to produce a natural insecticide
that comes from a common soil bacterium, Baccilus thuringiensis (thus
Bt). By using this type of cotton, that produces its own insecticide to kill
insect pests, farmers spend much less on pesticides and the environment
is protected as well.
The toxin made using the Bt gene is also environmentally friendly
because it kills only Heliothis (a caterpillar species) and closely related
species.
Canola
All over the world, Canola is grown for food oil. It is a preferred species
for biotechnology because it is easy to introduce genes into it using
Agrobacterium and it can be propagated from one cell
(micropropagation). In Canada, transgenic canola oil is produced from
herbicide resistant plants. There are many other trials to develop new
products using transgenic canola.
OncoMouse
OncoMouse have been developed to be used in cancer research. These
mice have been genetically engineered to always develop breast and
lymph cancer and die of these human cancers within 90 days. They are
used worldwide to test new cancer drugs and therapies.
Polly the sheep

Polly is a transgenic sheep. She has been engineered to produce a human
protein that makes blood clot. This will be useful for haemophiliacs.
The idea is that the sheeps milk will contain the clotting factor and this
can be harvested.
Xenotransplantation
Xenotransplantation is the use of other species for organ transplants
(animal to human transplants). Transgenic pigs have been developed to
possess the gene that codes for human cell-surface protein. Normally, if
you introduce a pig organ into a human, the body would reject it.
However, if the surface of the organ has a coating of human protein then
rejection may be prevented.
16
Blueprint of life
Consider the example of the OncoMouse.

1
In what way(s) is the development and use of the OncoMouse a

good thing?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
In what way(s) is its development and use a bad thing?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

Now its your turn to research some transgenic species. Use the examples
given or other examples, such as transgenic tomatoes, to identify three
transgenic species. Present arguments for and against the use of these
transgenic species.
There are some Internet addresses for you to start with on the LMPC
Science webpage at:
Once you have completed your research, do Exercise 5.2.
17
Genetics and ethics
Scrupulous members of society have principles and beliefs. Ethics are

the result of informed debate among these members of our community.
Early in 1997, Dolly the sheep was cloned from the single cell of an
adult sheep. The researchers who did this are at the Roslin Institute in
Scotland, a team led by Dr Ian Wilmut. Dolly is an identical genetic
copy of the individual animal from which she was cloned. She is the
first mammal in recorded history to be asexually reproduced.
Over the intervening months, the excitement in the popular press
about Dolly has naturally died down. But the ethical and philosophical
issues that cloning mammals raise are still there, and are of
importance to society. As citizens and as civilised people we should
all be thinking about them.
From an interview between Robyn Williams and Dr David Turner (Senior
Lecturer in the Department of Medicine at Flinders University).
As you can see from the above extract, there are many social, economic,
philosophical and ethical reasons that will arise as genetic engineering
continues. The science of genetics is proceeding at a greater rate that
society can come to grips with.
In the Additional Resources section of this part there are two articles that
deal with some of the problems that are arising out of the new technologies.
Read these now. As you read, highlight or underline the problems that are
mentioned. Add your own thoughts in the margin.
Now think more carefully about the articles you have just read.
The viewpoints in them have been presented in different ways. How do
you use information in these articles to help you to make decisions about
whether genetic engineering should occur?
18
Blueprint of life
Facts from fiction

You need to develop skills in assessing articles and judging whether
information has been presented accurately and in a balanced way.
Many articles contain information that has been selected and used to
present one viewpoint rather than a discussion of alternate views.
What is the viewpoint of the writer of the first article about cotton?
_________________________________________________________
_________________________________________________________
_________________________________________________________
What are the viewpoints raised in the second article about pigs?
_________________________________________________________
_________________________________________________________
_________________________________________________________
Now look at the information included in each article. Both articles use
quotations from experts to support their argument. But has the
information been tested in a scientific way?
Which article do you think uses more scientific evidence?
(Which evidence would be easier to test to check the viewpoint and
conclusions of the article?)
_________________________________________________________
Your decision helps you to decide which article to believe more.
Of course, you would not make a decision about genetic engineering
based on these two articles only. You need to consider more evidence
(and go on examining evidence) about this important scientific and
social issue.
There is more information in the Additional resources on unnumbered
pages from a federal agency called Biotechnology Australia. These fact
sheets give you additional information about the arguments in favour of
and against genetic engineering. Read through the debate now.
Then read and consider the following situations involving genetics and
ethics GM food, and the Human Genome Project and gene therapy.
19
GM products and labelling

The introduction of genetically modified foods continues to give rise to
debate. Many foods contain genetically modified species. Do these
products need to be labelled as genetically modified?
Some arguments against genetic modification of food
Are they safe to eat?
Do they have same nutritional value?
Will they lead to a loss of biodiversity?
The consequences of changing genes between species have not been

fully studied.
Cross-pollination could introduce the genes to the wild population

with unknown consequences.
People with allergies could eat food not knowing that the food
contains genes from another species.
Large companies could develop crops that could control the supply
of food.
New diseases may be created by modifying viral genes.
Arguments for genetic modification of food
These techniques will produce more food to feed starving people

around the world.
Fewer pesticides and herbicides need to be used, which is better for

the environment and for farm workers health.
Vaccines could be delivered through food.
Vegetables can be modified to survive transport better.
Australias soils are degraded; plants could be modified to grow in

these soils.
What is your opinion about genetic modification of food?

_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
20
Blueprint of life
The Human Genome Project (HGP) and

its implications for medicine
The medical industry is building upon the knowledge, resources and
technologies that emerge from the Human Genome Project (HGP) to
increase our understanding of genetic contributions to human health.
Genetics is playing an increasingly important role in the diagnosis,
monitoring and treatment of diseases.
All diseases have a genetic component, whether inherited or resulting
from the bodys response to environmental stresses like viruses or toxins.
The successes of the Human Genome Project have even enabled
researchers to pinpoint errors in genes.
The ultimate goal is to use this information to develop new ways to treat,
cure, or even prevent the thousands of diseases that afflict humankind.
But the road from gene identification to effective treatments is long and
fraught with challenges. With this knowledge, commercial efforts will
shift away from diagnostics and toward developing a new generation of
therapeutics based on genes.
Drug design will be revolutionised as researchers create new classes of
medicines based on a reasoned approach, using gene sequence and
protein structure/function information rather than the traditional trialand-error method. The drugs, targeted to specific sites in the body,
promise to have fewer side effects than many of todays medicines.
There is a potential for using genes themselves to treat disease. This
technique is known as gene therapy and is an exciting application of
DNA science. It has captured the imaginations of the public and the
biomedical community for good reason. This rapidly developing field
holds great potential for treating or even curing genetic and acquired
diseases. Gene therapy uses normal genes to replace or supplement a
defective gene, to bolster immunity to disease or to suppress tumour
growth.
What is your opinion about manipulating human genes?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
21
Biodiversity
The greatest effect of genetically modifying species may be in reducing

genetic diversity. For example, if all farmers grow genetically identical
crops then the variety that occurs in wild populations may be lost.
Much has been said and written about biodiversity. If you listen to the
news or read the papers there seems to be constant reference to
biodiversity. But what is it?
What is biodiversity?
Biodiversity can be defined as the variety of life forms: the plants,
animals and microorganisms found in an area. But it is more than just
the living things. According to the National Strategy for the
conservation of Australias Biological Diversity, biodiversity has been
defined as:
the variety of life forms; the different plants, animals and
microorganisms, the genes they contain, and the ecosystems they
form. It is usually considered at three levels; genetic diversity, species
diversity and ecosystem diversity.
So a definition of biodiversity should incorporate these three levels:
genetic diversity
species diversity
ecosystem diversity.
Genetic diversity
The natural variety within a population gives it a robustness to survive
changing conditions. It is important to maintain genetic diversity as a
safeguard against new pests and environmental change. Wild species of
22
Blueprint of life
domesticated crops contain a large natural gene pool which should be

maintained for the genetic diversity of the future. This natural genetic
diversity should be valued for future breeding in changing environmental
conditions.
For a population to be viable, the organisms in it must share a large gene
pool. It is possible to have many individual members of a species living
in an area but still have reduced genetic diversity. If a population were
reduced to having only a few members of a species, this would greatly
reduce the gene pool for the species. If large numbers of individuals
were then bred from just these few organisms, you would have an overall
decrease in genetic diversity. This leads to a lack of genetic vigour, or
strength.
Species diversity
This is the most common usage of the term biodiversity. Species
diversity is the number of different species in an area or ecosystem and
their abundance. This means having lots of different species, and within
each species, having many members present at a certain time.
Ecosystem diversity
Ecosystems are a combination of biotic and abiotic factors interacting
together in an environment in a self-sustaining manner. Many
ecosystems that are resistant to human impact show a high level of
biodiversity. Ecosystem diversity is having a number of different
ecosystems in an area. For example, a national park may show
biodiversity by containing rainforest, heathland and grassland.
Why value biodiversity?

As human activity continues to spread to the furthest corners of Earth,
natural areas are changed and modified, resulting in increasing and
widespread extinctions of species. Currently, many experts believe such
extinctions are occurring at the fastest rate in human history. This is
perhaps the fastest rate since the extinction of dinosaurs 65 million years
ago.
This loss of Earths biological diversity is said to be rapidly accelerating
as desertification, deforestation (especially in the tropics), degradation of
oceans and water resources, atmospheric change and other environmental
changes continue at a rapid pace.
23
Here is a summary of some of the many reasons for valuing biodiversity.
For human welfare

Biological diversity is important to human welfare for many reasons.
Agricultural crops derive from wild species and the high-yielding hybrids
of modern agriculture are continuously revitalised from wild genetic
stock. Future crop species that could be used directly or modified by
biotechnology are lost when entire ecosystems are wiped out. Plants are
the basis of about one fifth of prescription drugs. A number of plants
discovered in tropical rainforests or other wild areas have made
significant contributions to the treatment of serious diseases.
Loss of biodiversity disrupts ecosystems that support rainfall cycles,
control floods and affect basic global systems such as climate. In
addition, loss of species often signals the breakdown of ecosystems.
For ecological reasons

Our knowledge of the ecology of an area is rarely complete. We dont
know what will happen if one species is removed. A good example of
the interdependence of organisms is the relationship between the
cassowary and tropical rainforests in North Queensland.
The cassowary is a large ground-dwelling bird. Cassowaries consume
the fleshy fruit of tropical rainforest trees. The seeds of the fruit pass
through the birds digestive system unharmed. The seed is dispersed
from the parent tree by the cassowary eating the fruit and then moving
away before the seeds are passed through the digestive system.
It is thought that the cassowary is the only organism that can eat the fruit
of these trees. The cassowary is under threat because of land clearing
and the introduction of feral species. If the cassowary becomes extinct
then the whole forest faces a problem of regeneration.
This is an example of how one key species can affect the viability of an
ecosystem. There are likely to be many similar relationships that we
dont have information about.
For practical reasons

If we destroy an ecosystem through human impact we will be destroying
unstudied species. We should look to the precautionary principle when
deciding on the destruction of ecosystems. If we dont know what the
effect of an action is, we should err on the side of caution and not
continue with an action until we are more certain of the outcome.
24
Blueprint of life
For aesthetical and economic reasons

There is a human need to enjoy the beauty of the natural world. People
enjoy visiting areas of natural wilderness. Whether this is an innate
characteristic of humans is unknown.
It may be a biological need that drives people to visit wilderness areas.
The expanding industry of ecotourism has realised this need and provides
opportunities for people to visit natural areas. There is more money to be
made taking tourists to a tropical rainforest than there is from removing
the trees for timber.
For philosophical and ethical reasons

From an ethical standpoint, every species has as much right to exist as
does the human species. Therefore, if we can prevent the extinction of a
species, we should do so.
Preserving biodiversity
Over the last 200 years there have been dramatic changes to the
Australian environment. Rainforests have been reduced by 75% and
there is an extensive list of extinct mammals. Land has been degraded by
rising salt levels, erosion and the addition of fertilisers.
Many of the river systems have a greatly reduced rate of flow, increasing
siltation, formation of isolated waterholes, decreased flood plain soil
deposition and reduced native fish stocks.
Many species have been highlighted as worthy of being preserved. There
are campaigns to save the endangered bilby, Siberian tiger and the giant
panda. To be able to save these species it is necessary to save their
ecosystems. For within these ecosystems are the biotic and abiotic
factors required for these organisms to survive and reproduce.
An ecosystem does not have to be totally destroyed before there is an
effect on biodiversity. Even slight destabilisation of the system may lead
to extinction of some species.
A current effort to monitor biodiversity

In Australia there is a major effort to monitor the genetic biodiversity of
koalas. Koalas are the only living members of their family and they have
very low levels of genetic variation within and among populations.
25
Since European colonisation, koala numbers have crashed and their

populations have become fragmented to the degree that their fitness is
under threat because of inbreeding. This is especially a problem in the
south-eastern parts of Australia.
Here is a clear case for conservationists to intervene to preserve the
biodiversity of these beautiful unique animals. This current effort by
wildlife managers and conservationists has identified genetic
management as an integral part of koala management.
Various populations are being monitored by a number of management
units in different environments to collect data about their genetic
composition. Once knowledge of the koalas genetic variations among
these populations is fully documented, future breeding programs can be
planned more carefully.
These efforts should ensure more effective and long term success of
translocating koalas to breed more vigorous and adaptable stock.
Recolonisation of populations in the most affected areas is important so
that extinction does not occur among that population. So the future of
flora and fauna management in National Parks and Wilderness regions
require the extensive monitoring of genetic biodiversity.
By collecting data on the genetic make up of koalas, scientists are ensuring

genetic diversity in the animals that are translocated into new areas.
26
Blueprint of life
Thailand: Government passes up pest free

cotton
BANGKOK, (Dec. 3) IPS At first, the prospect of having a highyielding cotton plant that needed no pesticides led to rosy projections of
bumper crops and profits for farmers who grow it.
But Thais will not be seeing hundreds of thousands of hectares planted to
Bollgard cotton in the country anytime soon, after fears were raised that
the genetically altered plant may wreak environmental havoc and put
consumers of Thai traditional medicine at risk.
Last month, the Thai government announced it was calling off safety and
effectiveness tests on Bollgard cotton, developed by the U.S.-based
chemical company Monsanto. The tests, which began three years ago,
were already nearing completion when Bangkok issued the statement.
Bollgard cotton is also known as Bt cotton because it comes from plants
inserted with Bacillus thuringiensis (Bt), which kills off pests. Cotton is
among the worlds cash crops hardest hit by pests. But activists here say
there is no guarantee that Bt would not spread to other plants belonging
to the same species as Bollgard cotton and kill insects in wider areas of
the country.
Makers of Thai herbal medicine, in which cotton is an essential
ingredient, also raised concerns about the effect of using medicines with
Bt cotton. The Institute of Traditional Thai Medicine says 16 species of
the Malvacaea cotton family are used in the production of traditional
health remedies.
According to Witoon Liancharoon of the Alternative Agriculture Network
Thailand, Bt cotton is already being grown commercially in the United
States and Australia. But this is done only in restricted areas. That would
not have been the case in Thailand, if plans had pushed through.
27
Witoon notes, for instance, that the plan was to market the seeds to
agriculturists throughout the country. Some 485,000 hectares of land
were to be set aside as cotton-growing areas. Witoon says the tests here
should have been conducted differently from those in the U.S. and
Australia, because tropical Thailand obviously has different biodiversity
conditions. He adds the tests should have looked into possible risks if
someone takes herbal medicine made with Bt cotton.
As far as I know, Witoon said, the tests that have been done focused
only on impacts on useful insects in the areas and the economic potential
of growing (Bt) cotton.
Dr. Pennapa Subcharoen, director of the Institute of Traditional Thai
Medicine, says the Bollgard cotton tests records show that some 30
percent of the bee population in the test sites died. However, she told a
local newspaper, no further assessment was made to determine if the Bt
cotton was linked to the death of the bees.
The doctor says a sufficient assessment of Bt cotton is needed before it
can be grown locally in a larger scale. The Bt cotton tests are considered
Thailands first genetic engineering experiment in mass production.
Though protests forced the government to rethink the Bollgard cotton
project, Witoon says that does not mean Thailand has heard the last of
such ventures. The country has no laws that help protect its biodiversity,
he says.
Genetic engineering is something beyond the understanding of most
Thai agriculturists, he observed.
It is easy to make them welcome anything that gives quick positive
results without knowing of the much more negative impacts that may
follow. If the cotton could help them kill insects without spending
money on insecticides, they would think this cotton is perfect and the
seeds would sell out for sure, he added.
Witoon says this foolhardiness among many Thai agriculturists makes
the need for a biosafety law urgent. They have no idea what could
happen in the future, he said.
Meanwhile, Witoons group and the Thai Network on Community Rights
and Genetic Resources are using existing laws in their bid to change the
composition of the cotton testing board.
Under the new Constitution, government bodies are not allowed to have
appointees whose involvement with other groups or private businesses
may result in a conflict of interest.
28
Blueprint of life
At present, the cotton testing board has three representatives of Monsanto

as members. If the boards composition is not altered, no-government
groups here say they are ready to sue the agricultural ministry.
OTC 05.12.97 03:06.
From http://www.netlik.de/gen/Zeitung/971205.htm on 10 April, 2001.
Human-pig embryo accusation provokes

debate
Two firms seeking a patent on an embryo cloning process have denied
accusations by Greenpeace that they are creating human-pig hybrid
embryos, as the debate over therapeutic cloning continues.
Reuters reports that according to Greenpeace Germany, the European
Patent Office in Munich has received a patent application (No:
WO99/21415) US-based BioTransplant Inc. and Australian firm Stem
Cell Sciences which allows for the production of human/animal embryos.
The application shows that the firms have already transferred cell nuclei
from human foetuses to egg cells from pigs and cultivated the resulting
embryos for around a week in the laboratory, Greenpeace said in a
statement.
Society should not reward these Frankenstein scientists with patents, it
added. A US spokeswoman for the companies involved in the patent
application confirmed that laboratory cells of human origin had been
used in the experiment but denied that what resulted was a human hybrid,
and said Greenpeace had misunderstood the case.
The source of the cell was a laboratory cell line of human origin. It was
an aneuploid cell, which means it was totally incapable of creating a
human being. It was experimentally impossible to create a hybrid pighuman organism, Patricia Dimond told Reuters. Chief executive officer
of Melbourne-based Stem Cell Sciences, Peter Mountford told Reuters
that his company had indeed put a human cell nucleus into a pigs egg.
This nuclear transfer method involves scraping the nucleus out of an egg
cell and replacing it with the nucleus, which contains most of the genetic
material, from another cell. The process, if done correctly, re-programs
the nucleus and it starts to divide as if it were a fertilised egg. In effect, it
regresses back to the very first stages of life.
These cell masses could be a source of embryonic stem cells, which have
the power to become any type of cell in the body at all, including nerve
cells, blood cells or organ cells. Stem Cell Sciences said it had shown
last month that this could be done, using mice.
29
The same technique was used to create Dolly the sheep, the first cloned
adult mammal however in this latest case, Stem Cell Sciences, working
with a team at Monash University, has used a pigs egg cell and the
nucleus from a human cell. After the nuclear transfer the cells divided, 4
or 5 times, to create a mass of either 16 or 32 cells. Mountford said the
experiment proved that human and animal cells could be fused for the
purpose of therapeutic cloning.
A matter of definition. The researchers expressed aim is to find
alternatives to organ donation, however as to whether they are making
human/pig hybrid embryos, it seems to be a matter of semantics.
The application clearly asks for permission to patent a process enabling
the transfer of a nucleus from one species into another species and the
production of a transgenic embryo, and there does not appear to be any
restriction on whether the donor or recipient cell is human science legal
expert Dr Dianne Nicol from the University of Tasmania told ABC
Science Online.
It depends on what you define as a human embryo. Is it the cytoplasm
or the nucleus containing the human genes.
Another company has done similar work. In 1998, Advanced Cell
Technology, based in Worcester, Massachusetts, said its scientists had
fused human cells into cow eggs and let them grow as an embryo for a
few days. Its aim is also to produce organs and tissues for transplant.
The reason researchers use cow or pig eggs is that they are more readily
available than human eggs, which can be obtained only through difficult
and painful surgery. Farm animal eggs are available at any
slaughterhouse.
BioTransplant Inc. is also working on genetically engineered pigs as a
potential source of animal-to-human transplants, or xenotransplants.
Animals containing human genes, known as chimeras, are commonly
used in medical science -- for instance, sheep that produce human
proteins in their milk.
The US government is forbidden by law to fund scientists who engage in
cloning, therapeutic or otherwise, but privately funded scientists can
legally do as they please.
Britains chief scientific officer has proposed that therapeutic cloning be
legalised there, but the European Parliament condemned the idea in
September. Australia is debating the issue.
From ABC on-line, Monday, 9 October 2000
30
Blueprint of life
Gene Technology Information Service
1800 631 276

Email: gtis1800@hotmail.com
The Arguments For n Against Genetic Modification

This leaflet discusses some of the issues to bear in mind when thinking about biotechnology
and genetic modification, and summarises the key arguments used for and against gene
technology and its applications.
Like any other subject, this research has its technical terms. If you are not sure of the
meaning of some of the words used, consult the glossary.
Is genetic modification natural?

The Argument For
Like most of our modern agriculture,
medicine or environmental management,
genetic modification is not strictly
speaking natural because its brought
about by humans. This applies to houses,
cars and clothes as well! Nearly all the
food we eat now is the result of intensive
agriculture, using carefully created
varieties and often with pesticides and
fertilisers applied. Thats hardly natural and neither are many of the life-saving
drugs and medical procedures devised by
science. And, of course, natural doesnt
necessarily mean good. Plenty of natural
things are harmful - for example, there are
naturally-occurring toxins in many plants
including some that we eat.
Adding one new gene is a tiny change to
the overall genetic makeup of a living
thing. Many plants and animals have tens
or hundreds of thousands of genes. Of
course, the work is only successful if the
new gene is inserted where it causes no
The Argument Against

Genetic modification is not natural. The
deliberate selection of genes and their
transfer between species that are
sometimes completely unrelated does not
happen normally among plants and
animals. Its quite different from the
agricultural techniques that have gone
before, because these mainly involved
crosses within a species or between very
close-related species.
Any species has evolved with its genes
working together. Genetic modification
can arbitrarily upset a functioning group of
genes. Who knows what the result will be?
It is, in effect, tampering with complex
systems that we still dont fully
understand.
Gene maps for plants and animals are
still incomplete - often scientists know
only a few per cent of the genes and their
positions. They know even less about how
genes making substances are themselves
An Initiative Of:
Increasing the public's general awareness of biotechnology
and its uses, through the provision of factual information
explaining the technology, its applications, and regulations
to safeguard people and the environment.
The Federal Government agency Biotechnology Australia gives no warranties and make no representations whether express or implied that the information
provided is accurate, current or complete. Further advice should be obtained from the body responsible for preparing the information before taking or not taking
any action based upon it. To the maximum extent permitted by law, Biotechnology Australia excludes all liability to any person arising directly or indirectly from
any person taking or not taking any action based upon the information.
1800 631 276

disruption. This is tested for. The

genetically modified species is then
assessed carefully for any unintended
effects. If there was a mistake in the
copy of the inserted gene, that would show
up if it caused an effect.
controlled by regulator genes. All the

genes in an organism act together as an
integrated whole to produce the correct
combinations of proteins in the right
amount, as and when required. The highly
evolved and delicately balanced system of
genes in any higher plant or animal is
complex and could easily be changed in
ways that we cannot predict. Genes dont
work in isolation. Like an ecosystem, each
gene has its place and function - and taking
just one or two and moving them around
could have unforeseen effects. The inserted
gene could disrupt the functioning of other
genes nearby.
Tiny changes inside just one gene could
have huge consequences - some diseases in
humans are caused in this way. Suppose
there was a mistake, and a gene with a
small error in it was added?
Will this affect my health?

The Argument For
There are strict guidelines controlling the
manufacture, release and use of genetically
modified
organisms.
The
Federal
Government, through various regulatory
agencies, approves and monitors the use of
gene technology.
A genetically-modified species cannot be
released from the lab until it has
undergone years of rigorous testing. And
any GM foodstuff is further tested before

GM foods are no better for our health than
normal crops. How do we know that
theyre not worse? Added genes could
make safe plants produce poisonous or
allergy-causing substances that would be
bad for some people. And we cant predict
what might happen when groups of genes
are broken up by the insertion of foreign
genes into a plant. The creation of a
genetically-modified organism involves
procedures that allow selected genes to
An Initiative Of:
1800 631 276

it can be sold. The gene or genes added are

known about, and so we would be aware if
they produced toxins or allergy-causing
substances. And in any case, when
labelling is in place consumers should be
able to make themselves aware if they
want to avoid any or all GM foodstuffs.
insert themselves randomly anywhere in

the genome of the receiving organism.
There is no control over where the genes
are inserted and whether their sudden
arrival upsets a functioning group of genes,
leading to the production of too much or
too little of an important biochemical.
You can never prove that something is

completely harmless. Any new technology
has possible risks, but these need to be
weighed against its benefits. Using gene
technology has the potential to provide
produce foodstuffs that are tastier,
healthier for us, cheaper and better for the
environment. And more medicines and
vaccines could be made that could combat
disease-causing germs more effectively.
There is not enough conclusive proof that

genetically modified food is safe. This is a
new development. Can anyone be sure that
scientists wont discover problems later
on? There have been plenty of examples in
the past where scientists were unaware of
any problems until it was too late such as
the drug thalidomide.
There may be risks present - just as there

are in anything that we do - but there is
now detailed monitoring and control in
place to minimise these.
Genes for antibiotic resistance have been
used as markers- although the antibiotics
involved are not always the medically
important ones. It is still not clear how
easily these could move into bacteria. The
World Health Organization in considering
this issue has concluded that the risks of
antibiotic resistance gene transfer to be
very small. Nevertheless, as a safety
measure different marker systems are
being developed.
Several alternatives
have already been identified including
those that code for a colour change.
Another health worry comes from the fact

that scientists usually insert a marker gene
along with the target gene into the plant.
The marker gene enables them to find out
whether the target gene has been taken up
into the modified plant. Often these marker
genes actually make a substance that
destroys certain antibiotics. If such an
antibiotic resistance gene moved from a
GM plant to a bacterium that causes
human disease, then we could be in
trouble. So why bother? Food can be
improved without using gene technology.
An Initiative Of:
1800 631 276

The advantage of gene technology over

other methods of improving crops it that it
can tackle problems that traditional
breeding either cant solve or would take
too long to solve. And remember,
traditional breeding is sometimes quite hitand-miss. You end up with all sorts of
other features as well as the characteristic
that you want. Thousands of genes are
moved around in traditional breeding, so
the odds of transferring something
unintentionally (whether its a gene for a
natural toxin or for susceptibility to
disease) are much higher. Traditional
breeders then spend much time doing
further crosses of new varieties to
eliminate the unwanted characteristics.
Modern gene technology, as well as being
faster, can also be much more precise if
necessary, only changing the gene for the
desired feature and leaving everything else
alone.
Traditional breeding techniques have

already given us larger harvests and better
crops. There is still more that can be done
using these tried-and-tested methods
without
resorting
to
risky
new
technologies.
Remember, there is no such thing as zerorisk for any food. Current foodstuffs and
methods of producing them whether
organic or high-intensity farming carry
slight risks. Foods produced by
biotechnology will be expected to meet
even higher safety standards.
An Initiative Of:
1800 631 276

How will it affect the environment?

The Argument For
GM crop plants can be made so that their
cultivation has much less impact on the
environment. For example, those that carry
the gene for the production of a natural
insecticide are cutting the use of pesticides
in farms, which is good news for many
species that were previously affected by
pesticide use in the environment.
In the case of cotton plants modified to
produce the natural insecticide known as
Bt toxin, there seems to be no overall
effect on the plant from producing the
insecticide.

Concerns have been raised that genetically
modified crops could have a negative
impact on the environment. Possible
effects of the pesticide made within a GM
plant, needs to be identified. Is it stable - or
does it degrade into other products, which
are further changed by the rest of the
plants chemical reactions, turning into a
compound not normally present? We
should find out how the rest of the plant is
affected by the lost energy and materials
consumed in order to produce this extra
compound in large amounts.
Some of the major advantages of the

technology for agriculture and the
environment are that crop plants can have
genes from hardier plants added to them,
thereby allowing them to tolerate salinity,
drought or poor soil. This means that
agriculture need not always use the best
land or damage non-agricultural species in
the area.
An Initiative Of:
1800 631 276

One of the main problems of agriculture is

applying fertilisers which then find their
way into streams and others areas,
upsetting natural ecosystems. Some plants,
such as clover and legume crops, dont
need nitrogen fertiliser as they have the
special natural ability to take nitrogen
from the air. By transferring genes from
these plants, it could soon be possible to
make common crops able to do this too,
greatly reducing fertiliser use. Thats good
for farmers pockets as well as for the
environment.
The spread of inserted genes into other
closely related species is being tested for,
and so far it appears to be very rare. But
tests will continue. As for crops with
genes for substances that can kill insect
pests, we have to remember that there are
plenty of naturally-occurring plants that
are poisonous. Also, many of the
pesticides already in use kill species that
they are not intended for. Insect pests
could eventually evolve resistance to a
GM plant that makes its own pesticide.
Whats to stop genes from a GMO

spreading into other closely-related
species? If closely related weeds breed
with a crop species (and many of the worst
agricultural weeds are related to the crop in
which they appear), then the weeds could
acquire the gene for resistance to the
weedkiller which is not what we want!
And the idea of engineering pest resistance
into crops has other problems - the plant
may end up killing insects that are not
pests.
The development of resistance to

pesticides is already a common problem in
agriculture, and farmers using crops that
are not GM must still regularly change the
types of pesticide sprayed in order to get
around the problem of resistance.
If farmers will still be faced with pests

evolving resistance, and if they will still
need to change the insecticide (by
changing to another GM variety which has
the genes for a different insecticide) then
there doesnt much advantage of this over
existing ways of dealing with pests.
An Initiative Of:
1800 631 276

The idea of herbicide resistance in GM

plants is that the modified plants are made
resistant to a relatively benign chemical,
which can then be sprayed in larger doses
so that it is effective against weeds without
having to use far more toxic compounds.
A better approach would be to manage the

pest problem as part of the broader ecology
of an area, which would mean changes in
farming practices and the way in which
farming relates to the wider natural
environment rather than a technological
quick-fix.
Companies which manufacture herbicides
are in the business of making genetically
modified crops that resist their own
herbicide, which could encourage farmers
to use the herbicide in larger amounts than
before in order to kill weeds without
damaging the crop plant.
Will it help provide more food in the World?

The Argument For
One of the most exciting applications of
gene technology is the eventual
development of plant types that are more
nutritious, yield bigger harvests, but at the
same time are more resistant to disease
and to stresses like drought. Domestic
animals would also become more
productive, and make more from less. All
this would help greatly with feeding the
ever-increasing number of people in the
world. Crops able to produce harvests
even in harsh environments are being
developed. These could be of great value
in many poorer nations where climate and
poor terrain restrict crop-growing, and
would also help reduce the amount of land
being cleared for use in agriculture.

Feeding the world is more to do with
politics and economics than agriculture.
There are food surpluses in wealthy
countries. But poor countries and poor
people cant afford to buy this food.
Theyre unlikely to be able to afford GM
plant varieties or food derived from those
new varieties any more than they can
afford to buy food or crop seeds at the
moment. The much-publicised promise of
new crop varieties feeding the world in the
Green Revolution of the 1970s still hasnt
eliminated starvation.
We shouldnt forget that a lot of the work
on gene technology is coming from big
companies. Are they doing this research
more for their own profits than to benefit
the world?
An Initiative Of:
1800 631 276

Gene technology techniques

Genetic Engineering: What is it?
Genetic engineering, or gene technology, could revolutionise agriculture, food technology, medicine and environmental
management. Like the selective breeding of plants and animals, which people have been doing for thousands of years,
gene technology enables us to produce varieties of plants and animals with desirable characteristics - but in much more
precise and efficient ways.
For example, gene technology can allow us to develop plant varieties that produce larger harvests, are resistant to
particular diseases, or have better storage or handling qualities. It will even become possible to improve the nutrition
and flavour in some crops. Genetic engineering is also a powerful tool in medicine, and could help provide treatments
for many currently incurable human diseases.
Genetic engineering allows us to transfer genes between species. This can happen naturally - but only occasionally and
in haphazard fashion. In particular with genetic engineering, transfer between completely unrelated species is possible,
which occurs very rarely in nature. This could be both an advantage and a cause for concern. The strength of genetic
engineering is that it is more precise, and more cost-effective, than the methods used in the past for changing organisms.
Genetic engineering offers major benefits when used safely and with care - but as with any powerful new technology,
there are risks to consider. Careful management of these will be essential if we are to harness the benefits of our
scientific knowledge.
DNA, genes and chromosomes

Whether or not an organism develops in a particular way is determined by its genes. A gene is a section of DNA
(deoxyribonucleic acid) whose chemical structure contains coded instructions for the manufacture of a specific
protein. In turn, proteins carry out the tasks of life. Genes are passed on from one generation to the next so that
offspring inherit traits.
DNA is often called the "blueprint for life". Every living thing (apart from some viruses) contains DNA, which
has the structure of a long twisted ladder - a double helix.
Sections of DNA that contain messages are known as genes. The number of genes varies greatly between
different species, with most higher animals and plants having anywhere from ten thousand to hundreds of
thousands of genes. Genes can be switched on or off at different times and within different cells of the same
organism.
In most organisms, the long thread-like DNA molecules are organised within larger structures called
chromosomes. It is possible to cut out a particular gene and insert it into another organism, where it will be
treated like any other gene of the organism it is inserted into.
An Initiative Of
In Partnership With

and its uses, through the provision of balanced information
The Commonwealth Government agency Biotechnology Australia gives no warranties and make no representations whether express or implied that the
information provided is accurate, current or complete. Further advice should be obtained from the body responsible for preparing the information before taking or
not taking any action based upon it. To the maximum extent permitted by law, Biotechnology Australia excludes all liability to any person arising directly or
indirectly from any person taking or not taking any action based upon the information.
1800 631 276

Techniques of modern gene technology

Genetic technologies aim to make a living thing perform a specific useful task. This could be to fight disease, produce
more food or simply to make a flower blue.
Since the 1970s scientists have known how to manipulate genes, and how to transfer them from one species to another.
A gene can now be isolated, rearranged, altered and joined to a new chromosome in another organism. This involves
considerable expertise, expensive laboratory equipment and some remarkable scientific techniques, some of which are
briefly outlined below.
Polymerase Chain Reaction (PCR) produces large amounts of a specific DNA fragment, providing the supply of DNA
for insertion into another organism. The original DNA is used as a template to make many copies. DNA polymerase is
the enzyme responsible for making the copies of DNA and the technique involves a chain reaction to produce a large
amount of the copied DNA sequence.
Gel electrophoresis is a technique used to separate biochemical molecules, including proteins or fragments of DNA.
The molecules move through an electric field in a gel, much like dessert jelly, at different speeds according to their size.
Smaller molecules will move faster than large ones and so DNA segments of different sizes can be separated out. This
technique is used to produce the genetic 'fingerprint' that is often referred to in the media.
Blotting is a technique for isolating and identifying individual DNA molecules. Once the DNA molecules have been
separated by gel electrophoresis, special absorbent material is placed on top of the gel where it picks up DNA molecules
in the same way as blotting paper soaks up ink. Once the DNA molecules are on the blot, it is possible to isolate and
identify them.
Restriction enzymes and ligases are naturally-occurring enzymes used to cut and manipulate pieces of DNA. There is
a whole family of restriction enzymes and each one cuts the DNA at specific, known places. DNA ligase is used to
rejoin the DNA. By cutting and rejoining the DNA, a specific gene can be placed into an existing DNA sequence.
Gene insertion involves the insertion of modified genes into the cell's chromosome, it is achieved differently for plants
and animals. In animals, the desired gene is inserted via microinjection into the single cell embryo from which all the
cells in the adult animal's body will develop. In plants, the gene of interest can be coated onto tiny metal particles which
are then shot into the cell using a miniature gun. A second method uses bacteria, usually an agrobacterium, as they have
a natural ability to infect plant cells and incorporate its DNA into that of the recipient cell. Scientists can use a
modified bacterium, into which the desired gene has been added, to transport the gene directly into the DNA of the plant
cell. The added or foreign gene, is called a transgene. With both techniques, the place where the transgene inserts is
hard to predict.
Plants have the interesting ability - under the right conditions - to develop from a single cell taken from an adult plant.
Growing plants in this way is called regeneration and requires techniques known as tissue culture. Plant cells
containing an added transgene that is stable and functioning are grown using tissue culture until a whole plant is formed.
This plant will then produce seed containing the added gene, and the seeds can be used in the usual way.
An Initiative Of
In Partnership With

1800 631 276

For both animals and plants, the chances of added DNA becoming permanently fixed into the chromosomes are
relatively low so scientists expose many cells and then select those that have successfully taken up the new DNA.
Knowing which cells contain the inserted DNA is made easier by the use of markers, explained below.
Marker genes/proteins are used to keep track of inserted genes. A marker gene, is inserted along with the gene being
transferred to monitor success. By detecting the effects of the marker gene, scientists know when the inserted DNA has
been incorporated; marker genes may also allow selection to occur, for example by making a cell susceptible or resistant
to a particular chemical. Genes that give a cell resistance to an antibiotic chemical have often been used as markers.
Scientists can detect whether an antibiotic resistance gene is present by adding the antibiotic and seeing what effect it
has. Cells that survive contain the new genes. If the antibiotic gene is present, then usually so too is the desired gene that
was sent in with it.
Partly because of concerns about the spread of antibiotic resistance, scientists are devising other possibilities for marker
genes. An interesting one is derived from jellyfish, and manufactures a green fluorescent protein. Plant cells with the
inserted gene glow under ultraviolet light, thus identifying successful gene transfer.
The discovery of genes

The idea that there were factors controlling an organism's characteristics, and that these factors were inherited in a
predictable fashion, was first demonstrated in the 1850s by the Austrian monk Gregor Mendel. After the re-discovery of
his work in 1900, his factors were given the name genes, and shortly after it was concluded that genes were carried on
chromosomes.
In 1952 Francis Crick and James Watson at Cambridge University discovered the structure of the molecule known as
DNA, of which genes are made. They realised that the DNAs sequence of bases, and its ability to copy itself, were the
means by which genes both stored information and could be inherited. The researchers subsequently won a Nobel Prize.
Crick and Watson's discovery started a flurry of research that began to sequence the genetic code, showed how genes
work, and revealed that all living things use the same basic DNA code. This underlined the unity of life, and it was clear
that, because they are chemically the same and are read in the same way, genes of different individuals and organisms
were potentially interchangeable.
Late 1973, Dr. Stanley Cohen of Stanford University and Dr. Herbert Boyer of the University of California made the
first successful gene transfer. They used restriction enzymes to cut a small circular piece of DNA and inserted it into a
larger piece of DNA. The DNA was then taken up by bacteria and incorporated into the bacterias DNA. Cohen later
showed that inserted DNA could induce bacteria to produce proteins from another organism.
An Initiative Of
In Partnership With

1800 631 276

What is genetic engineering used for?

Pest resistant cotton
Cotton is a valuable crop in Australia, worth about $1.7 billion a year. The cotton industry is also the biggest user of
pesticides, spending up to $125 million a year to protect the crop from insect attack.
To address the problem of insects and simultaneously reduce chemical use, CSIRO and the company Monsanto
developed a genetically modified cotton variety known as Ingard. Ingard contains a gene making it resistant to one of
cotton's major enemies - the heliothis caterpillar. The inserted gene produces a protein that kills the caterpillar when it
eats the leaves.
This gene is taken from a naturally-occurring soil bacterium known as Bacillus thuringiensis or Bt for short. There are
many, slightly different, protein toxins produced by different types of Bt. These Bt toxins affect different groups of
insects. For example, one toxin affects only butterflies and moths but not other insects. This allows the best kind of Bt to
be used to protect against specific insect groups for each area or each type of crop. No Bt toxins affect vertebrates or
humans, and this is one reason why Bt pesticide sprays consisting of the bacteria - are often used by organic farmers.
In the case of Bt cotton, the cotton plant can successfully kill its pest without the need for any pesticide. It has far less
effect on non-target insects than spraying entire fields with insecticide
In 1999, Ingard cotton was planted across 90 000 hectares of Australia. According to CSIRO and the Co-operative
Research Centre for Australian Cotton, farmers growing the modified cotton used an average of 50% less chemical
insecticide than for conventional varieties (results varied between different farms).
Genetically modified food
Australia has approved the use of genetically modified yeasts and bacteria for the production of cheeses and wine for
some years. The following products from genetically modified crops are also used in foods on sale in Australia:
cotton oil, (produced from the Australian cotton) used in edible oils and margarines;
soybeans, used in soy-based products and ingredients in processed foods such as bread, pastries, snack foods and
edible oil products;
canola oil, in edible oils, fried foods and snack foods;
corn, in corn oil, flour and sugar and in snack foods, fried foods and confectionery;
potatoes, in processed products such as snack foods; and
sugar beet, used as sugar in some processed foods.
All of the above, except cotton oil, are sourced from overseas.
An Initiative Of
In Partnership With

1800 631 276

Pharmaceuticals
The story of insulin
Insulin is a hormone that is made in the pancreas to control blood sugar levels. It enables cells to take up sugar
molecules from the bloodstream, thereby providing cells with nourishment. In people suffering from diabetes, the
pancreas does not produce enough insulin. Injected insulin can help these people lead more normal lives.
In the past, scientists used pancreatic extracts from pigs to produce insulin for the treatment of human diabetes. But in
1982 genetic engineers were able to insert the DNA code for human insulin into bacteria and direct them to produce this
valuable protein. Nearly all insulin used for treating diabetes in Australia is now synthesised this way. It is cheaper and
provides a supply of insulin in quantities never before available. Importantly, it is easier to avoid contamination of the
insulin and it overcomes the problem of occasional allergies to animal insulin.
Scientists can now alter the genes of micro-organisms to produce commercial quantities of a range of other
pharmaceuticals. These include new antibiotics; plasminogen, which dissolves blood clots that can cause heart attack or
strokes; and human growth hormone to treat some forms of dwarfism as well as wounds, burns, fractures and tissue
damage.
Genetic engineering has also been used as a tool to produce vaccines against diseases, such as Hepatitis B. The use of
genetic engineering may also lead to treatments for AIDS and various forms of cancer.
Risk and new technologies

All new technologies involve risks, as do the technologies we already use. For example, electricity is delivered to our
homes in a form that is easily lethal and many deaths from its misuse have occurred. Car, train and airline travel are all
potentially dangerous, and are therefore regulated to minimise risk while keeping their benefits. Genetic engineering
involves risk too. For example, it has been argued that exchanging genes between species could have unpredictable and
potentially dangerous effects such as changing familiar species into pests.
Just as with plants and animals that were enthusiastically introduced to Australia by the early colonists, genetically
modified organisms may have unforeseen effects beyond the agricultural systems into which they are released.
However, while ensuring that risks are minimised, we must judge whether the benefits of the technology are worth the
possible risks. This decision must be made by the community and by governments. Currently genetic engineering in
Australia is scrutinised, controlled and regulated by many government and non-government bodies.
Before a genetically modified organism can be released, it is first studied extensively in the laboratory and then taken
through controlled trials. Currently, researchers plan to introduce only one or two well-studied genes into an organism
for a precise and predictable purpose.
An Initiative Of
In Partnership With

1800 631 276

Future prospects
Environmental protection
Researchers are rapidly developing genetic engineering techniques to combat the problem of industrial pollution. Oil
slicks could be controlled by genetically engineered bacteria that feed on oil efficiently and exclusively. Other microorganisms may also be used to break down pesticides, herbicides and chemical waste.
Healthy food
Genetic engineering may offer consumers healthier, tastier foods. Prospects include:
reduction of undesirable qualities such as saturated fats in cooking oils

elimination of allergens
increased nutrients that help reduce the risk of chronic disease, for example, vitamin-enriched fruits and cereals
better delivery of nutrients in commonly consumed crops.
Human applications
Somatic cell gene therapy involves the removal and genetic manipulation of some body cells (such as bone marrow
cells) and their re-implantation into the individual, in order to overcome a particular disease. This technique has exciting
possibilities for treatment of diseases such as cancer and degenerative diseases such as Parkinson's disease. The genetic
changes affect only certain cells within the individual being treated and are not passed on to succeeding generations.
Germline gene therapy is more controversial. It would involve making genetic changes that are passed on to the
person's offspring. For example, many inherited diseases - such as haemophilia - are carried through generations by a
particular family gene. These genes are now being identified. As genetic technologies advance, the prospect is
emerging that such genes could be eliminated not only from an individual's DNA, but also from the DNA passed to his
or her children.
Application of germline therapies is still many years off and will be the subject of significant public debate and review
by medical authorities before they would be put into use. In particular, many people have concerns about the safety and
ethics of changes to the human gene pool and these concerns will probably be the subject of future public enquiries by
relevant authorities.
An Initiative Of
In Partnership With

1800 631 276

Regulation and safeguards

The Australian Genetic Manipulation Advisory Committee (GMAC) critically reviews the science and the risks
before any experimental or commercial use (including release into the environment) of a genetically modified organism
(GMO). Other relevant authorities include:
Australia New Zealand Food Authority (ANZFA), which regulates food safety and labelling;
National Registration Authority for Agricultural and Veterinary Chemicals (NRA) which regulates pest
control and animal health uses;
Australian Quarantine Inspection Service (AQIS) which regulates the import and export of GMOs; and
Therapeutic Goods Administration (TGA) is responsible for licensing pharmaceutical products, including those
made using genetic engineering.
The Federal Government has also announced that it will establish, by 21 June 2001, an Office of the Gene Technology
Regulator to regulate GMOs not covered by existing agencies. In the meantime, the Interim Office of the Gene
Technology Regulator has been established to manage risks and apply safeguards. The Interim Office can be contacted
by phoning 02 6270 4 211 or at their website at http://www.health.gov.au/tga/genetech.htm
Information compiled by Biotechnology Australia

www.biotechnology.gov.au
An Initiative Of
In Partnership With

Suggested answers
Artificial selection
Artificial selection is deliberating mating organisms that have the desired
features. Humans have been doing this ever since they domesticated
animals and plants. It creates changes in a species and provides evidence
for natural selection.
Artificial insemination
The genetic material from one bull would be passed on and this would
lead to a reduction in genetic diversity.
In vitro fertilisation
People unable to produce offspring naturally may pass on infertility
genes to the next generation.
Artificial pollination
Plant breeders choose desirable qualities for the plants that they produce
but once again they reduce the genetic diversity. This may lead to
problems if new pests are encountered.
Examples of GM species
1
The OncoMouse allows scientists to test new drugs for cancer

treatment. This helps cancer sufferers and may lead to a cure for
cancer.
Is it ethical to breed an animal so that it will die from cancer?
31
32
Blueprint of life
Exercises Part 5
Name: _________________________________
Exercise 5.1: Artificial selection

a)
Today, the methods used to artificially select organisms have

advanced greatly. Describe each of the following breeding
techniques and suggest how each may alter the genetic composition
of a population.
i
artificial insemination
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
ii
artificial pollination
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
iii cloning
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
33
b) Scientists from the Australian Museum of Natural History want to

revive the Thylacine (a type of marsupial dog) which is thought to be
extinct.
The Thylacine should we clone this animal?
Many years ago, a Thylacine pup was preserved in alcohol (which

does not destroy DNA). From what you now understand about
cloning, could it be possible to recreate a Thylacine today and should
this type of research be carried out?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
34
Blueprint of life
Exercise 5.2: Transgenic species

a)
Name three transgenic species that you have researched. Give a

brief description of each.
Example 1
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Example 2
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Example 3
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
35
b) List three ways that transgenic species can be produced, and outline
each method.
____________________________________________________
_____________________________________________________
_____________________________________________________
____________________________________________________
_____________________________________________________
_____________________________________________________
____________________________________________________
_____________________________________________________
_____________________________________________________
c)
What are three reasons that transgenic species have been produced
and are being used?
____________________________________________________
_____________________________________________________
_____________________________________________________
____________________________________________________
_____________________________________________________
_____________________________________________________
____________________________________________________
_____________________________________________________
_____________________________________________________
36
Blueprint of life
Exercise 5.3: Genetics, ethics and biodiversity

a)
Do you think that the development and use of transgenic species is a

good idea? Include at least two reasons to support your opinion in
your answer.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) If someone disagreed with your opinion, what are two reasons that
would be given to refute your argument?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
What is biodiversity?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
37
d) Why is it important to maintain biodiversity?

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
e)
Discuss (including benefits and problems) an example of a current

effort to monitor biodiversity.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
f)
Name a genetically modified plant and a genetically modified

animal. Use these examples to discuss some possible impacts of
genetic engineering and reproductive technologies (artificial
insemination, artificial pollination and cloning) on genetic diversity.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
38
Blueprint of life
Biology
HSC Course
Stage 6
Blueprint of life
Part 6: What have you learnt?
Contents
Introduction ............................................................................... 2
Review your skills ..................................................................... 3
Check your skills ...................................................................... 4
Test your skills .......................................................................... 6
A standards reference approach ............................................ 19
Exercises Part 6 ................................................................... 27
Introduction
At this stage you should have worked through the first five parts of this
module. This part is designed to give you some idea about how much
you have learnt. By working through this part you will become more
skilled at reviewing the work you have just learnt and at checking that
you have covered all the course requirements.
In the section called Check your skills you can decide if you have
performed all the required investigations expected by the Board of
Studies NSW syllabus for this topic.
In the section called Test your skills you can complete exam-style
questions to check your knowledge and skills and polish your exam
technique.
In the final section, there is an example of a question and its answer, with
the answer compared with the standard that you should be able to achieve
in the HSC course. (Your teacher may also send you other examples like
this to help you to practise for the HSC exam.)
Blueprint of life
Review your skills
Now that you have completed this topic, it is a good time to review the
skills you have acquired or practised throughout the module. This will
help you to identify areas where you may need to spend some extra time.
Look through any exercises that your teacher has returned to check that
you understand any corrections.
Then complete Exercise 6.
Check your skills
How confident are you about your understanding and skills in this topic?
Here is a simple review tool that you can use. Simply read each point in
the check list below and review the knowledge or skill required. You
must have performed the skill and be able to repeat it. Tick the box only
if you are confident that you have covered it.
Part 1: Evolution
Perform an investigation to model natural selection.
Show how changes in physical and chemical conditions have led to
changes in a species.
Trace the fossil record of horses.
Observe, analyse and compare the structure of a range of
vertebrate forelimbs.
Present information about the historical development of theories
of evolution.

Construct a pedigree and trace the inheritance of a particular
character trait. Discuss the current use of pedigrees.
Solve problems involving monohybrid crosses using Punnett
squares, in particular.
Identify and describe examples of hybridisation in horticulture.
Explain the advantages and disadvantages of hybridisation in
horticulture.
Blueprint of life
Part 3: Chromosomes
Present information to model the process of meiosis, demonstrating
crossing over, segregation of chromosomes and the production of
haploid gametes.
Analyse and solve problems involving co-dominance and sex
linkage.
Investigate the effect of the environment on the phenotype of the
hydrangea plant and on height in humans.

Demonstrate how DNA replicates.
Design an activity that demonstrates protein synthesis.
Outline the evidence that led to Beadle and Tatums one gene
one enzyme theory.
Illustrate, using examples, how mounting evidence for the mutagenic
nature of radiation was collected during the twentieth century.
Explain the development of antibiotic resistance in bacteria.
Describe and analyse the relative importance of the work of James
Watson, Francis Crick, Rosalind Franklin and Maurice Wilkins in
determining the structure and function of DNA.
Explain the role of collaboration and effective communication in
scientific research, using of the work of James Watson, Francis
Crick, Rosalind Franklin and Maurice Wilkins as an example.

Describe a method used in cloning organisms.
Use examples of transgenic species to debate the ethical issues
arising from their development and use.
Identify and discuss a current effort to monitor biodiversity.
If you have done all of the above and you feel quite comfortable about
your skills then you are ready to test them so read on. If you are having
some difficulties with some of them then go back to that section of the
module and redo it. Make sure you contact your teacher if you get stuck.
Test your skills
Test your skills by doing these sample questions. Many of these questions
have been taken from past HSC examination papers.
( Board of Studies NSW)
You might like to write your answers onto your own sheet of paper so that
you can use the questions again when you are revising for a test or exam.
1
Some finches in the Galapagos Islands use cactus spines to probe the
bark of trees for insects. Woodpeckers in North America use their
long, curved beak to remove insects from tree bark.
Which of the following terms best describes the development of
these similar food-gathering methods?
A) Gradual evolution
B) Punctuated evolution
C) Convergent evolution
D) Divergent evolution
In rabbits, short hair (H) is dominant over long hair (h). The
offspring produced from a cross between a short-haired female and a
long-haired male were 1 long-haired and 7 short-haired individuals.
Which of the following combinations represents the genotypes of the
parents?
A) Hh and Hh
B) HH and hh
C) HH and Hh
D) Hh and hh
Blueprint of life
Darwin and Lamarck both formulated theories of evolution.

Which statement represents ONLY Lamarcks theory?
A) Individuals with characteristics that help them in their struggle
for existence have the best chance to survive.
B) Changes in an individual produced by the environment during
its lifetime are passed onto its offspring.
C) Successive generations become progressively better suited to
their environment.
D) Individuals of the same species differ slightly from one another.
The order of bases in a strand of DNA is ATG CGT. What would be

the order of bases in the complementary strand of mRNA?
A) AUG GCU
B) UTG CGU
C) TAC GCA
D) UAC GCA
Both parents are heterozygous carriers of a recessive gene a so that

their genotype is Aa. What is the probability that their child will
NOT inherit the a gene?
A)
7/ 8
B)
3/ 4
C)
1/ 2
D)
1/ 4
What is the end result of a cell dividing by the process of meiosis?

A) Two new cells that are genetically identical
B) Two new cells that are not genetically identical
C) Four new cells that are genetically identical
D) Four new cells that are not genetically identical
The following base sequence of DNA is the result of the replication

of a double-stranded segment of DNA.
G A A T T C
C T T A A G
Which of the base sequences below is the original DNA?
A)
C T T A A G
G A A T T C
B)
C T T A A G
C T T A A G
C)
G A A T T C
C T T A A G
D)
C A T T A C
G T A A T C
In humans, B represents the dominant eye colour, brown, and

b represents the recessive eye colour, blue. What are the genotypes
of two brown-eyed parents who produce a blue-eyed child?
A) BB and bb
B) BB and Bb
C) bb and bb
D) Bb and Bb
A wide variety of characteristics are thought to be genetically

controlled. If genes control protein synthesis, explain how the
genetic control of characteristics is possible.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Blueprint of life
10 It has been said that genes are the chemical code for life.
Using diagrams, explain how this code is translated by living cells.
Include the roles played by DNA, m-RNA, t-RNA and ribosomes.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
11 Humans have used techniques of genetic manipulation for thousands
of years. More recently, recombinant DNA techniques have become
available. How does recombinant DNA technology differ from
traditional artificial selection techniques?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
12 A virus particle consists of a core of nucleic acid enclosed in a
protein coat. When a virus attacks a cell, the nucleic acid enters the
cell while the protein coat remains outside. Then the cell produces
large numbers of viruses, which rupture the cell and escape.
What do these observations suggest about nucleic acids?
_____________________________________________________
_____________________________________________________
_____________________________________________________
13 Describe how amino acids, polypeptides and proteins are related.

______________________________________________________
______________________________________________________
______________________________________________________
14 Is the one gene one enzyme theory still applicable? Explain.
______________________________________________________
______________________________________________________
______________________________________________________
15 The graphs below compare the gradual evolution proposed by
Darwin/Wallace with the idea of evolution by punctuated
equilibrium.
A
Gradualistic model
Punctuational model
TIme
TIme
Morphology
Morphology
Explain the difference between these two models for evolution.

______________________________________________________
______________________________________________________
______________________________________________________
10
Blueprint of life
16 The major families of flora and fauna in the Australian

biogeographic region are more unique than those of other regions.
Describe a possible mechanism of evolution that could have caused
this distribution.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
17 How does the study of fossils support the theory of evolution?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
18 You have examined the fossil record of one group of organisms.
Describe, using this example, how it supports the theory of
evolution.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
11
19 There are populations of geckos (a small type of lizard) that consist

of all-female members. They reproduce asexually by a process
called parthenogenesis, in which the offspring develop from
unfertilised eggs. There are other populations that have male and
female members, which reproduce sexually.
a) What is the advantage for these geckos to reproduce asexually?
__________________________________________________
__________________________________________________
b) If the population of geckos were to experience a long period of
climate change, which population (the sexually or asexually
reproducing) would be more likely to survive? Explain your
answer.
__________________________________________________
__________________________________________________
__________________________________________________
c) Would you expect all populations of asexually reproducing
geckos to be genetically similar? Explain your answer.
__________________________________________________
__________________________________________________
__________________________________________________
20 A normal RNA sequence is shown below, together with a mutation.
Normal
AUG ACG CAG AAU UGG GAU CCU ACG
Mutation
AUG CCG CAG AAU UGG GAU CCU ACG
a) Describe TWO possible causes of the above mutation.

__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
b) Describe the possible effect of this mutation on protein synthesis.
__________________________________________________
__________________________________________________
12
Blueprint of life
21 Down syndrome is a condition in humans that results from an

abnormal change in the number of chromosomes. Study the
representation of a karyotype of a person with Down syndrome
shown below.
10
11
12
13
14
15
16
17
18
19
20
21
22
23
a) Describe the abnormality in chromosome number.

_________________________________________________
_________________________________________________
b) What effect would you predict that this could have on the
organism?
_________________________________________________
_________________________________________________
_________________________________________________
22 Explain what is meant by recombinant DNA technology.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
13
23 Histones are proteins that are essential for DNA replication in

eucaryotes. The amino acid sequence of specific plant histones is
almost, but not exactly, identical to that of whale histones.
a) What does this tell you about the relationship between the amino
acid sequence and the function of histones?
__________________________________________________
__________________________________________________
b) How does Darwins theory of evolution explain the similarity of
whale and plant histones?
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
24 Haemophilia is a sex-linked recessive disease.
a) What is the term given to an individual who has the gene for
haemophilia but does not exhibit the phenotype for the disease?
__________________________________________________
b) Haemophilia can be passed from a grandfather to his grandson
without it being expressed in the grandsons parents.
Construct a pedigree to show this.
14
Blueprint of life
25 The diagram below shows two homologous chromosomes during

cell division. One of these homologous chromosomes carries
dominant genes (A, B) and the other, recessive genes (a, b).
B
B
b
A
a
a) What type of cell division is occurring?

_________________________________________________
b) List the genotypes of the daughter cells.
_________________________________________________
_________________________________________________
_________________________________________________
c) What is the name of this process?
_________________________________________________
d) What is the significance of this process for the evolution of
species?
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
15
26 In pea pods, some pods are green and others are yellow. One of
these characteristics is dominant while the other is recessive.
A plant geneticist wanted to determine which characteristic was
dominant. Accordingly, he carried out crosses between different
plants: A, B, C and D. The results of these crosses are shown below.
Crosses
F1 generation
A (green) B (green)
all green
A (green) D (yellow)
all green
B (green) C (green)
77 green : 23 yellow
B (green) D (yellow)
102 green : 98 yellow
a) Which pod colour is dominant?

__________________________________________________
b) How can you tell that plant A is a pure-breeding plant with
green pods?
__________________________________________________
__________________________________________________
__________________________________________________
c) What is the genotype of plant D? Explain your answer.
__________________________________________________
__________________________________________________
__________________________________________________
d) What is the expected phenotypic ratio of the offspring of a cross
between plant A and plant C? Show all working.
__________________________________________________
__________________________________________________
__________________________________________________
16
Blueprint of life
e) Do the results from the cross between plants B and D confirm

Mendels ratios? Explain your answer.
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
27 Outline the steps involved in the production of a recombinant DNA
product.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
28 Describe ONE type of genetic manipulation where a transgenic
species has been used to improve an agricultural product. What are
the ethical considerations of applying this technology?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
17
29 Human blood groups A, B, AB and O are inherited the

following way.
Blood group
(phenotype of red blood cells)
Genotype
AA or AO
BB or BO
AB
AB
OO
Notice that blood groups A and B can be either homozygous (AA,

BB) or heterozygous (AO, BO). An individual that inherits an A and
a B has an AB blood group. The recessive gene O has to be
homozygous (OO) to have the O type blood group.
a) What are the possible offspring for a recessive A and recessive
B couple?
__________________________________________________
__________________________________________________
__________________________________________________
b) Mary, whose father is blood group AB and whose mother is
blood group A, marries a man called Bruce who is blood group
B. Mary and Bruce have two children, one of whom is blood
group O and the other, blood group A.
i
What is the phenotype and genotype of Mary?

_______________________________________________
_______________________________________________
ii
What is the genotype of Bruce?

_______________________________________________
iii What is the genotype of Marys mother?

_______________________________________________
Check all of your answers.
18
Blueprint of life
A standards reference
approach
Standards referencing means comparing your answers with set levels of

achievement to see how well you have performed. You will be assessed
this way in the HSC examination.
Below is an example of a question about this topic that you could be asked
in an exam. It is taken from the Board of Studies sample biology paper.
Question 30 (7 marks)
James Watson, Francis Crick, Rosalind Franklin and Maurice Wilkins
were important scientists in determining the structure of DNA.
With reference to their work, discuss the role of collaboration and
effective communication in scientific research.
Answer this question in the space below.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
How should you mark this question? What information did you need to
include to get full marks? (What areas should you learn more about to be
able to achieve full marks?)
19
The marking guidelines for the question are shown below. They reflect
the standard that is expected of you in this area of knowledge at the end
of the HSC course.
Marking guidelines
Criteria
Marks
Identifies the specific work of each of the four scientists

Clearly links their work to a discussion of their roles in
collaboration, or lack of it, giving reasons
67
Provides an explanation of how this exemplifies the benefit of

collaboration and effective communication in scientific research
Identifies the specific work of at least three of these scientists
Discusses the benefits of collaboration and effective
communication, but with little or no link to the scientists
OR
45
Presents a discussion of these scientists roles in collaboration
and effective communication, or lack of it, giving reasons
Provides an explanation of how this exemplifies the benefits of
collaboration and effective communication, without identifying the
work of the scientists
Identifies the work of one or two of the scientists
Loosely links their work to the benefits of collaboration and
effective communication
23
OR
Discusses the role of collaboration and effective communication,
with no reference to the work of these scientists
Identifies the work of one of the scientists
OR
States that collaboration and effective communication are

important
Use the marking guidelines to decide on a mark for the sample answer on
the following page.
20
Blueprint of life
Sample answer
Wilkins was attempting to prepare DNA fibres and study them using
X-ray crystallography, and Franklin had highly developed X-ray
crystallography skills and had developed new mathematical techniques
for interpreting the resulting photographs. However, professional
antagonism between the two scientists meant that they did not discuss
their findings effectively and their individual attempts were hindered.
Crick and Watson discussed the work of Wilkins, and by collaboration,
inferred the 3-D double helix properties of DNA. However, at the same
time, Franklin was coming to the same conclusion in her work. If the
scientists had worked together and all four of them had collaborated
more effectively, the structure of DNA would have been determined
much more quickly.
What mark did you give? Why?
_________________________________________________________
_________________________________________________________
_________________________________________________________
Now go back to your answer and give yourself a mark. If you dont give
yourself full marks, rewrite your answer below to cover all of the
information needed to include to demonstrate the highest standard for
this question.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
21
The standard that you need to achieve in this module is described in the
outcomes for the topic. These are listed in the Module overview and in
the Introduction section of each part for Parts 1 to 5. Or, if these seem
too daunting, you can use the shortened list provided in the Check your
skills section.
Turn back to the Test your skills section and look at each question in
turn. Can you match each question with one of the required knowledge
or skills areas? Does your answer for each question demonstrate that you
have achieved the required standard? And look again at the suggested
answer for the question. Would you give it full marks?
For example, Question 24 is an opportunity for you to demonstrate that
you can do the first investigation in Part 2: Patterns of inheritance.
(But notice that this one question does not let you show that you can do
the entire outcome.)
By thinking about what each question is testing, you will revise
knowledge and skills at the same time as you learn more about the
standards that you are trying to demonstrate.
22
Blueprint of life
Suggested answers
Test your skills

1
Proteins are the building blocks of body structures or character traits.

The type of protein determines the type of character trait that an
organism displays.
10 DNA codes for a section of mRNA.

DNA
U
A
U A
C
A
T G G G A A T
C C T
mRNA
The mRNA moves out of the nucleus to the ribosomes to guide the
sequence of amino acids that form the polypeptide. The mRNA
codes for the amino acids via tRNA as in the diagram following.
23
DNA
A copy of part of a DNA code is

transcripted onto mRNA
mRNA
mRNA transcript is released
mRNA moves out of nucleus

into the cytoplasm
nucl
nucleus
ear
me
mbr
ane
cytoplasm
11 Recombinant DNA technology inserts foreign genes into a

genome. This is called transgenesis and is a fairly immediate
process. Artificial selection increases the frequency of specified
genes in a genome by selective breeding. This may take many
generations.
12 The nucleic acid contains the information that codes for the virus.
13 Amino acids are the building blocks for polypeptides that are the
building blocks for proteins.
14 No. It has now been modified to the one gene one polypeptide
theory because not all enzymes contain only polypeptide only.
15 According to Darwin/Wallace, evolution is a moderate process with
species changing gradually over a long period of time. Punctuated
equilibrium suggests that species with a large range of differences
form suddenly whenever rapid changes in the environment occur.
16 The Australian continent was very isolated during the period when it
was moving north toward Asia. Australias flora and fauna underwent
adaptive radiation and diversified to become unique species because
there was little interbreeding with species from other regions.
17 Observations show that fossils have changed over time and there are
relationships between various groups.
24
Blueprint of life
18 Did you discuss the evolution of the horse? The fossil records of
horse groups reveal relationships showing speciation and diversity.
These are the hallmarks of evolution.
19 a) These geckos are well adapted to an unchanging environment
and variety is not necessary.
b) Sexually reproducing geckos are more likely to survive the changes
because variation increases the probability that some individuals
will have traits to enable them to survive and reproduce.
c) No. They would be genetically similar only if they have come
from the same population.
20 a) Mutations could be caused by high energy radiation such as
X-rays or gamma rays, or by chemical mutagens such as
aflatoxin.
b) A different kind of protein may be formed because of a change
in the base sequence.
21 a) Instead of a pair of chromosomes in 21, there are three. This is
called tristomy 21.
b) The organism would not be expected to develop normally
because the information in each cell is not correct. (Having too
much information is just as bad as not having enough!) Some
features associated with Downs syndrome include a protruding
tongue, an extra eyefold and a smaller stature.
22 Recombinant DNA technology means joining genetic material from
one organism into the genetic material of another.
23 a) The function is the same so the sequence similar.
b) It suggests that these very different organisms may share a
common ancestor.
24 a) carrier or heterozygous or hybrid
b) Many answers are possible. Here is one example.
parents
2
F1
3
F2
10
11
12
13
14
15
16
17
18
sex linkages
25
25 a) meiosis
b) AB, Ab, aB and ab
c) crossing over
d) Crossing over results in a greater variety of gametes.
26 a) green
b) When crossed with a yellow pod, the result was all green.
c) gg (where g is the gene for yellow colour). D must be homozygous
for the recessive gene because it expresses the recessive colour.
d) You should have drawn a Punnett square in your answer. You
would show that half the offspring will be GG and half will be
Gg so all the offspring will have green pods as their phenotype.
e) Yes. The resulting ratio is approximately 1 : 1 as predicted
using Mendel ratios.
27 Select a bacterium with the desired genetic material contained in a
plasmid (or insert the desired genes into a plasmid).
bacterial DNA
plasmid
Combine the bacterium with the organism that you want to

genetically change. The plasmid is copied and inserted into other
cells by the bacterium. The other cells now make the product coded
for by the plasmid.
28 Answers will vary. Make sure that your answer identifies the genes
that have been introduced into another species and how these have
improved an identified agricultural product. (For example, genes
from Baccilus thuringiensis that code for a natural insecticide are
placed into cotton cells so that the cotton plants [Bt cotton] make
their own insecticide and are more resistant to disease.) Then you
should discuss the ethics of the example you have described. You
need to give advantages and disadvantages (or problems and
benefits) in your answer. Dont give one side of the argument only.
29 a) A, B, AB and O
b) i
ii
blood group A, genotype AO

BO
iii AO
26
Blueprint of life
Exercises Part 6
Exercise 6
Name: _________________________________
Exercise 6
Make a summary of Blueprint of Life by working through the following
instructions based on the Biology Stage 6 syllabus.
Part 1 Evolution
1
Write an outline of the impact on the evolution of plants and animals

of:
a) changes in physical conditions in the environment
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
b) changes in chemical conditions in the environment
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
27
a) competition for resources.

__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
2
Describe, using specific examples, how the theory of evolution is

supported by the following areas of study:
a) palaeontology, including transitional forms
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
b) biogeography
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
c) comparative embryology
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
28
Blueprint of life
d) comparative anatomy
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
e) biochemistry
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
3
Explain how the theory of evolution by natural selection accounts for

adaptive radiation leading to divergent evolution and convergent
evolution.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
29
Part 2 Patterns of inheritance

1
Outline the experiments carried out by Gregor Mendel and describe

the aspects of his experimental techniques that led to his success.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Describe, using examples, the outcomes of monohybrid crosses

involving simple dominance.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Distinguish between homozygous and heterozygous genotypes in

monohybrid crosses.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Distinguish between the terms allele and gene, using examples.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
30
Blueprint of life
Explain the relationship between dominant and recessive genes and

phenotype, using examples.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Outline the reasons why the importance of Mendels work was not
recognised until some time after it was published.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 3 Chromosomes
1
Outline the roles of Sutton and Boveri in identifying the importance

of chromosomes.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Explain the relationship between the structure and behaviour of

chromosomes during meiosis and the inheritance of genes.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
31
Explain the role of gamete formation and sexual reproduction in

variability of offspring.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Describe the inheritance of:

a) sex-linked genes
__________________________________________________
__________________________________________________
__________________________________________________
b) genes that exhibit co-dominance.
__________________________________________________
__________________________________________________
__________________________________________________
Explain the relationship between homozygous and heterozygous

genotypes and the resulting phenotypes in examples of
co-dominance.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Outline ways in which the environment may affect the expression of

a gene in an individual.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
32
Blueprint of life
Describe the work of Morgan that led to the identification of sex

linkage.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Describe the chemical nature of chromosomes and genes.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Part 4 How genes operate

1
Outline the role of DNA in the transmission of genes from one

generation to the next.
_____________________________________________________
_____________________________________________________
_____________________________________________________
Describe the process of DNA replication and explain its significance.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
33
Outline, using a simple model, the process by which DNA controls

the production of proteins and/or polypeptides.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Write a paragraph about mutations. In your paragraph, describe

mutations as changes in the DNA information on a chromosome and
identify mutations as a source of new alleles in organisms.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
34
Blueprint of life
Outline, using a simple model, how changes in DNA sequences can

result in changes in proteins produced and thus changes in cell
activity.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Identify that environmental factors may increase the rate of mutation

using examples of mutagens.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
35
Explain how an understanding of the source of variation in

organisms has provided support for Darwins theory of evolution by
natural selection.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Describe the concept of punctuated equilibrium in evolution and

outline how it differs from the gradual process proposed by Darwin.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Part 5 Playing with nature

1
Identify how the following current reproductive techniques may alter

the genetic composition of a population:
a) artificial insemination
__________________________________________________
__________________________________________________
__________________________________________________
b) artificial pollination
__________________________________________________
__________________________________________________
__________________________________________________
c) cloning.
__________________________________________________
__________________________________________________
__________________________________________________
36
Blueprint of life
Outline the processes used to produce transgenic species and include

examples of this process and reasons for its use.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
3
Discuss the potential impact of the use of reproduction technologies

and genetic engineering on the genetic diversity of species. Use a
named plant and animal that have been genetically altered as an
example.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
37
Explain the need to maintain biodiversity.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Identify and discuss a current effort to monitor biodiversity.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
38
Blueprint of life
1
Name: _______________________________________________
Location: _____________________________________________

_____________________________________________________

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
39
_____________________________________________________
_____________________________________________________
Do you have access to the appropriate resources? eg a computer, the

internet, scientific equipment, chemicals, people that can provide
information and help with understanding science
_____________________________________________________
_____________________________________________________
_____________________________________________________
40

Gill Sans Bold
Biology
HSC Course
Stage 6
The search for better health
BIOHSC41286
XP005617
OTEN
Acknowledgments
good faith.
Writer:
John Johnstone
Jane West
Editor:
Julie Haeusler
Illustrators:
Cathy Grdic
Contents
Module overview
Outcomes .............................................................................................v
Indicative time...................................................................................... vi
Resources............................................................................................ vi
Icons ................................................................................................... vii
Glossary............................................................................................. viii
Part 1: Health and disease .................................................. 1-33

Part 2: The causes of disease............................................. 1-65
Part 3: The first two lines of defence ................................. 1-21
Part 4: Immunity the third line of defence............................ 1-27
Part 5: Non-infectious disease ............................................ 1-29
Part 6: Developing strategies to fight disease ..................... 1-16
Module evaluation
Introduction
ii
Module overview
During your studies you have learned how the internal workings of an
organism function. You have seen how organisms and groups of
organisms relate to each other within communities and food webs and
you have learned much about the reproductive and genetic processes
involved in continuing a species. Your studies in evolution have
provided an important unifying theme to much of your work and have
explained how species change over time. Now it is time to look at
disease.
The syllabus title for this module, The search for better health, is a little
misleading. Certainly you will investigate the health and disease aspects
of a variety of infectious and non-infectious diseases in both plants and
animals. However, you will also study some very elegant methods of
scientific research and learn much about the life cycles of disease
organisms.
Our focus is as much on the health of a diseased organism as it is on the
disease causing organism itself. A better title for the syllabus section
would have been Disease, because this section is far broader than the
health aspects of disease.
So what does the syllabus provide by way of introduction to the topic?
The contextual outline provided in the syllabus is rather good. We have
taken the liberty to reproduce the contextual outline in full below.
Physiological processes proceed without any conscious intervention.
Even when something malfunctions, the body tries to repair the
damage automatically and unnoticed. The process is the same in all
living things and it is only when the process fails to contain the
damage that disease can be recognised.
Humans have long recognised the symptoms of disease in both
themselves and in the animals and plants around them. Since the
beginnings of recorded history, they have noted the signs that reveal
that the body is malfunctioning.
Introduction
iii
Increasing the understanding of the causes of disease together with

accompanying advances in technology have changed approaches to
treatment and management of disease.
The search for measures to treat and manage diseases of humans and
other organisms continues and this search is paralleled by continued
refinements in technology.
at http://www.boardofstudies.nsw.edu.au/syllabus99/syllabus2000_list.html
This module is a brief introduction to aspects of medical, veterinary and

plant sciences. If you intend to branch into any of those fields then this
will provide a basic introduction.
Of course, the need for a basic understanding of diseases and health
extends well beyond the health profession. As far back in human history
as 3000 years ago the Chinese and Hebrews were advocating the need for
cleanliness in food, water and personal hygiene. The need for cleanliness
as a basic understanding of disease transmission has not changed.
No matter what you decide to do beyond your HSC studies we are sure
that you will take away something of use from this module.
iv
Outcomes
The main outcomes to which this module contributes are:
A student:
H1
evaluates how major advances in scientific understanding and

technology have changed the direction or nature of scientific
thinking.
H2
analyses the ways in which models, theories and laws of biology

have been tested and validated.
H4
assesses the impacts and applications of biology on society and

the environment.
H6
explains why the biochemical processes associated with cells are

related to macroscopic changes in the organism.
H8
evaluates the impact of human activity on the interactions of

organisms and their environment
H11
H12
evaluates the ways in which accuracy and reliability could be

improved in investigations.
H13

successfully to communicate information and understanding.
H14

information.
H15

by a team
H16

behaviour and a desire for a critical evaluation of the
consequences of the applications of science

Introduction
Indicative time
The search for better health should take 30 indicative hours to complete.
Each part of the module is approximately five hours work.
Resources
Here is a list of things you may like to get before you start this module.
Most of the items will probably be in the kitchen cupboard already.
You will use these items in some of the practical work for this topic.
Part 1
1 packet of jelly (any flavour/ colour you like)
1 tablespoon of Bonox, Marmite, Vegemite or AussieMite
cling wrap
4 small jars with screw cap lids to fit
2 small cans of baked beans or creamed corn.
Part 2
vi
plants
pencil
paper
hand lens or magnifying glass
access to a gardener or farmer (optional).
Icons
The following icons are used within this module. The meaning of each
icon is written beside it.

There is an exercise at the end of the part for you to
complete.
Introduction
vii
Glossary
The following glossary provides the scientific meaning for many of the
scientific terms used in your syllabus for module 9.4 The search for
better health.
The HSC examiner will expect you to understand the meaning of every
scientific term used in the module. If you find a term that you do not
understand then look it up in a scientific dictionary or ask your teacher
for assistance.
viii
Term
Meaning
aerobic
respiration
Respiration that requires the presence of oxygen.
anaerobic
respiration
Respiration that does not require the presence of

oxygen.
antibody
A substance produced by the body in response to an

antigen. Antibodies are proteins that are able to
combine with antigens to deactivate them.
antigen
A substance that causes the production of a

particular antibody.
bacteria
(singular: bacterium). Microscopic procaryotes.

There are many different types of bacteria and they
are associated with important processes such as
decay and nitrogen fixation from the atmosphere.
Some bacteria are responsible for infectious
diseases in plants and animals.
cardiovascular
disease
Disease of the heart or circulatory system.

Cholesterol deposits in arteries and faulty heart
valves are examples of cardiovascular diseases.
coagulation
For a fluid to thicken or congeal.
coliform
With reference to the bacteria of the colon (lower

intestine).
congenital
Existing at or from ones birth. Congenital diseases

are those with which you are born eg. certain
defects of the heart, lungs or circulatory system.
cyst
A protective coat often used to protect internal

parasites.
disease
Any disturbance of structure or function of the

body. Most diseases are associated with
characteristic structural changes to the body and
with characteristic symptoms.
Diseases fall into five broad categories.
Introduction
Congenital and hereditary diseases
Inflammatory diseases
Degenerative diseases
Metabolic diseases
Abnormal cell growth (neoplastic) diseases
Down syndrome
Genetic disease caused by either an additional

chromosome number 21 (3 chromosomes 21 rather
than 2) or by an additional piece of chromosome 21.
haemophilia
Genetic disease in which those suffering the disease

are unable to repair wounds. Even minor cuts can
be life threatening because the blood would not clot
to prevent further bleeding. Before modern medical
intervention haemophiliacs rarely reached puberty they bled to death. The gene for haemophilia is sex
linked.
health
A state of physical, mental and social well-being

and not merely the absence of disease or infirmity.
host
Any organism from which a parasite gains nutrition.

The life cycle of the parasite may include
intermediate as well as final (primary) hosts.
incubate
To maintain a bacterial culture at the optimum

temperature for development.
inflammation
Reddening of tissue and/or increased temperature of

tissue. Can include swelling of tissue. For
example, the flesh around a splinter is often
reddened or warmer (inflamed).
inoculate
Introduce a micro-organism that causes a disease

usually by injection.
lymphocyte
A type of white blood cell involved in the immune

response.
macrophage
Large phagocytic cell.
ix
metabolic
Referring to metabolism. Metabolism is the sum of

the processes or chemical changes in an organism.
It includes the synthesis of new compounds from
food and the breaking down of food into simpler
compounds.
microbe
A microscopic organism such as a bacterium or

protozoan.
mosaic
In reference to mosaic viruses this term refers to a

patchy variation of colour.
multicellular
Organism made of many cells. Often the cells of

multicellular organisms specialise to form tissues
and organ systems.
necrosis
Death of tissue.
parasite
An organism that obtains its nutrients from another

organism (host) without providing any benefits in
return to the host eg. tapeworm.
pathogen
A disease causing organism.
phagocyte
Cell that engulfs food by wrapping around.
prion disease
A group of diseases caused by abnormal prion

protein eg. CJD and Kuru.
procaryote
Unicellular organism without membrane bound

organelles. Procaryotes were the first cellular
organisms to evolve.
respiration
Biochemical process by which energy is released

within a cell.
saprophyte
Organism that feeds on dead organic matter. Many

bacteria and fungi are saprophytes.
sebum
Fatty secretion of sebaceous gland.
serum
Fluid often obtained from blood (human or other

animal) that contains antibodies to stimulate B-cell
and T-cell production.
spontaneous
generation
Spontaneous generation was the theory that living

things could arise from non-living things ie. that
living things could be generated without the need
for parenting organisms.
Introduction
subterranean
Existing below the surface of the ground.
tumour
A swelling caused by the growth of new tissue.

The tumorous tissue usually exhibits unrestricted
growth.
turbid
Opaque or muddy. Turbidity refers to the clarity of

a fluid.
unicellular
Organism made of a single cell such as a protozoan

or bacterium.
vector
An organism that transmits a pathogenic organism

from one place to another. For example, the
mosquito Culex annulirostris is a vector for the
Ross River fever virus.
vertebrate
An animal that has an internal skeleton with a

vertebral cord running inside the dorsal surface.
The cord is encased within a series of bones
(vertebrae). All vertebrates are also chordates
(animals that have a notochord at some stage in
their development). Vertebrata is a sub-phylum of
Chordata.
viscous
Thick or glutinous. Honey is more viscous than

water.
zoonose
Any disease that is transmitted from animals to

humans by either direct contact or through animal
products eg. food.
xi
Biology
HSC Course
Stage 6

Part 1: Health and disease
Contents
Introduction ............................................................................... 2
What is a healthy organism? ..................................................... 3
Defining health .....................................................................................3
Defining disease...................................................................................4
Genes, mitosis and cell differentiation....................................... 7

Gene function and health.....................................................................7
Mitosis and health ................................................................................8
Cell differentiation and health ..............................................................9
Gene expression ..................................................................................9
Infectious and non-infectious disease ..................................... 11

Prevention of infectious diseases......................................................12
Microbes in food and water................................................................13
Pathogens in water ............................................................................18
Exercises Part 1 ................................................................... 29
Introduction
Over 3000 years ago the Chinese and Hebrews were advocating
cleanliness in food, water and personal hygiene. It took western
civilisation a much longer time to realise that micro-organisms spread
disease. Doctors in hospitals were moving from one patient to the next
without washing their hands or changing their clothes.
In this first part of the module you will be looking at the definition of a
healthy organism and the effect of pathogens on host organisms.
discuss the difficulties of defining the terms health and disease
outline how the function of genes, mitosis, cell differentiation and

specialisation assist in the maintenance of health
distinguish between infectious and non-infectious disease
explain why cleanliness in food, water and personal hygiene

practices assist in control of disease
identify the conditions under which an organism is described as

a pathogen.

available evidence to analyse the links between gene expression and
maintenance and repair of body tissues
identify data sources, plan and choose equipment or resources to

perform a first-hand investigation using appropriate materials to
identify microbes in food or in water

describe ways in which drinking water can be treated and use
available evidence to explain how these methods reduce the risk of
infection from pathogens.

What is a healthy organism?
Defining health
The World Health Organisation defines health as:
A state of physical, mental and social well-being and not merely the
absence of disease or infirmity.
This is a fairly broad definition of health. That said, this is a suitable

definition of health for your HSC studies into disease.
Many terms used in science are also used in general conversation.
Sometimes these words have different meanings in common usage to
scientific usage. Try doing the activity below.
Look up the word health in a dictionary. Does the definition in your
dictionary agree with the definition given by the World Health Organisation
above?
Do this now, before you read further.
You probably found that your dictionary gave a definition that said that
you were healthy when you were not diseased. Here is how the Concise
Macquarie Dictionary defines health:
Soundness of body; freedom from disease or ailment.
The definition above says that you are healthy if you are not diseased.
This definition is adequate for common usage, but scientists and health
professionals need a definition that is a little more detailed. Your HSC
examiners will also require a more detailed explanation.
Defining disease
Go to your dictionary again. This time look-up the meaning of the word
disease.
Do this now, before you read any further.
You probably found that your dictionary defined disease as a sickness or
an illness. Here is how the Concise Macquarie Dictionary defines a
disease:
An illness, sickness or ailment of some organ or part of a plant or
animal body.
A previous course in HSC biology defined disease as:

Anything that impairs functioning (of an organism).
The interesting thing about most common definitions of disease is that

they are imprecise. For example, a broken arm is an ailment, but not
considered to be a disease. For that matter, a pregnant woman may, at
times, feel sick yet her pregnancy is not a disease.
Clearly we need a better working definition of disease for the purpose of
scientific study.
The best way to define disease is to use a general definition and then to
limit the use of that definition to particular circumstances. Such a
definition would exclude things like pregnancy and broken arms by the
limits placed upon the definition.
Any disturbance of structure or function of the body of an organism is a
disease. Most diseases are associated with characteristic structural
changes to the body and with characteristic symptoms.
Our definition of disease now becomes:
Any disturbance of structure or function of the body of an organism is a
disease. Most diseases are associated with characteristic structural
changes to the body and with characteristic symptoms.
Types of disease
Diseases fall into five main categories: congenital and hereditary
diseases; inflammatory diseases; degenerative diseases; metabolic
diseases and abnormal cell growth (neoplastic) diseases.
Congenital and hereditary diseases

These diseases are caused by genetic abnormalities or injuries received
within the uterus to the foetus. For example, haemophilia or congenital
heart defect in the foetus that results from the mother contracting German
measles.
Inflammatory diseases
The body can react to injury by inflammation. Insect bites, bacterial or
viral infections and even internal parasites can all cause inflammation.
Degenerative diseases
The degradation of various parts of the body can be considered as a
disease. For example, the hardening of arteries and some types of
arthritis fall into this category.
Metabolic diseases
These result in a disturbance or disruption to metabolic processes within
the body. Examples include diabetes and disorders of the thyroid gland.
Abnormal cell growth (neoplastic) diseases

When cells fail to divide normally or fail to stop dividing then cancers,
growths and tumours can result.
The World Health Organisation has an extensive web site. You can find
information about new diseases as well as diseases that have been around for
some time. The fact sheet section of the site is particularly good for
information relevant to this disease topic.
How do you find the World Health Organisation? You can search the words
World health Organisation or try this address: http://www.who.int
The question below will help you think about the definition of disease. For
each ailment in the left hand column place a tick in the middle column if it is
a disease and a cross if it is not a disease. In the right hand column give
your reason for deciding if it was or was not a disease.
Ailment
Disease?
Reason
influenza
intestinal
tapeworm
cut finger
common cold
hereditary
baldness
measles
cold sore
Check your answers.

Genes, mitosis and cell

differentiation
Genes, mitosis, cell differentiation and cell specialisation all assist in the
maintenance of health.
Lets start with definitions of the above terms to make sure you understand
them. Match the terms with their meaning.
genes
cell division that results in identical cells
mitosis
each cell has the potential code to change into

different cell types
cell differentiation
the units of inheritance that codes for inheritance.
cell specialisation
each cell type carries out different cell functions
Check your answers
Gene function and health

Genes help to maintain health by:
coding for chemicals and processes that maintain body health.
regulating the cell cycle
placing limits on mitotic division and replacement.
Chemicals and processes

Genes code for many of the body chemicals and processes. For example,
phagocytes engulf foreign matter entering the body. The digestive
enzyme used by the phagocyte to break down the foreign material is
produced as a result of genetic code.
Regulating the cell cycle

Proteins produced by genes regulate the cell cycle. You learned about
the cell cycle in the preliminary part of this course.
The cell cycle starts with mitosis producing new cells. After mitosis the
new cells are reduced in size by half so the first stage is a growth period.
This is followed by DNA synthesis and then a second growth period.
At the end of the second growth period mitosis occurs and the cycle
continues.
When a cell divides there are proteins that ensure the DNA is correctly
copied. If the copied chromosome is not accurate then mutation would
be passed on to the next generation of cells.
Limits to division and replacement

Dead and injured cells are replaced. How is this process initiated?
Chemicals produced by the genes can either switch on or switch off
cell division depending upon need. Occasionally the process may get out
of hand and cell division may not be stopped when replacement is
complete. This results in the production of a tumour.
Mitosis and health

Each day millions of cells die in your body. Many of the deaths will be
among the erythrocytes (red blood cells) which are short lived. Other
deaths will come from malfunctioning cells that are killed so they can be
replaced by healthy cells and from cells killed by diseases.
The apparent large number of deaths is a normal process. The cells that
die are replaced by the process of mitosis, which, you will remember
from previous studies, creates cells that are genetically identical to the
parent cell. Mitosis is responsible for both growth and replacement of
cells.
White blood cells that fight disease are replicated by mitosis when a
disease enters the body. This replication process increases the number of
white cells available to fight the disease. You will examine this process
in some detail later in this module.
Cell differentiation and health

Undifferentiated cells have all the information within them to form an
adult organism. When they differentiate they become specialised as
different types of cells.
Cell differentiation is the process by which cells specialise. Some
differentiated (specialised) cells have very important roles for the
maintenance of health. For example some leukocytes (a type of white
blood cell) are responsible for the production of antibodies to fight
infections. You will learn more about leukocytes later in this module.
Other cells are specialised as phagocytes. A phagocyte is a cell that
engulfs food. Some phagocytes are specialised to engulf and digest
bacteria and other foreign material that enters the body.
Of course, all cells are potentially important for an organisms health
since the malfunction of a cell can be either be disease causing or can
leave the organism open to attack.
Gene expression
What is gene expression?
The term gene expression refers to the way in which a gene exhibits
itself. A person homozygous for blue eyes has two blue eye colour
genes. The expression of these genes is to produce blue eye colouring.
During development from a fertilised egg, different stages of expression
occur. This development is called cell differentiation. Not all of the
genes are expressed at the same time. Genes are switched on and off at
various times of the life cycle.
Lets consider a minor repair.
You have a small cut. The body will repair the cut and replace the
missing skin and lost blood. Most importantly, your body will replace
the missing skin with an equivalent piece of skin. Your genetic code has
all the details required to produce a new bit of skin that exactly fits the
bit left uncovered by the cut. The genes that control skin cover express
themselves by repairing/ replacing the skin over the cut.
The genes for skin cover express themselves, in the first instance, by
giving you the total skin cover you have at birth. These genes continue
to express themselves by maintaining your skin cover during your life.
Holes in the skin are repaired, lost skin replaced and as you grow, more
skin is produced to maintain body cover.
As long as your genes remain unaltered, the genes will continue to
express themselves in the correct way during your life. Unfortunately,
genes do not always remain unchanged. For example, skin cells may
lose the ability to stop dividing when the correct amount of skin has been
replaced. When skin cells (and indeed other body cells) lose this ability
cancers and tumours result.
It would be a good idea to follow up the issue of gene expression.
If you have access to a library or the Internet, research cancers and tumours.
Find the name of two different cancers or tumours and the name of the body
organ(s) they are associated with
There are some sites for you to start with at: http://www.lmpc.edu.au
Do Exercise 1.2: Genes, mitosis and cell differentiation.
10
Infectious and non-infectious

disease
An infectious disease can be passed from one organism to another.
A non-infectious disease can not be passed from one organism to
another. A disease that you can catch by contact with another organism
or the wastes or tissues of another organism is infectious. For example:
contact with another organism that either has or carries the disease (a
mosquito bite, contact with another person, contact with blood from
an infected organism or contact with wastes such as faeces from an
infected organism).
contact with air, food or water containing a disease organism.
A disease that can not be caught by contact with an organism with the
disease is non-infectious. For example: genetic diseases and lifestyle
diseases such as obesity caused by overeating.
Try this exercise. It should help you clarify the difference between
infectious and non-infectious diseases. Complete the table, then check your
answers.
Disease
Infectious
Reason
common cold
haemophilia
mumps
chicken pox
Down syndrome
skin cancer
cardiovascular
disease
11
Do Exercise 1.3: Infectious and non-infectious diseases.
Prevention of infectious diseases

Many of your personal hygiene practices are related to preventing the
transmission of infectious diseases.
Consider the table below. The left-hand column lists the hygiene
practice and the right hand column lists the reason. Two items have been
left blank in the right-hand column so that you can write your own
answers to these.
Hygiene practice
Reason
washing hands after

going to the toilet
Removal of bacteria to prevent transmission to others or

to yourself.
cooking meat
Kills bacteria and flatworm cysts in the meat. Modern

meat inspection practices ensure that the occurrence of
parasites is far less common in meat.
bathing/ showering
Removes accumulated bacteria living in fats, oils and

moisture on skin. Interestingly there is one school of
thought that says that by not washing at all the bacteria
on the skin eventually reach a natural balance that is not
harmful to the body.
brushing teeth
boiling water when
travelling
Kills micro-organisms in the water. Those local to an

area often develop a resistance to microbes in the local
water, but travellers are frequently susceptible to the
new micro-organisms they encounter.
covering mouth and

nose when sneezing
washing a wound
and then covering
Removes bacteria by washing. Covering prevents

airborne bacteria from entering.
Cleanliness and hygiene are important to reduce the transmission of

disease. At a personal level this means washing your hands before eating
and using tongs when handling food. At a government level it includes
sewage disposal, water treatment and safe food handling laws.
12
Food preparation hygiene

The World Health Organisation states:
'The World Health Organisation regards illness due to contaminated
food as one of the most widespread health problems in the
contemporary world. In infants and the elderly, the consequences can
be fatal.'
The World Health Organisation recommends the following practices.
Use safely processed foods. For example, food exposed to ionising

radiation (which kills microbes) is preferable to food that has not
been processed this way.
Food should be cooked thoroughly to kill micro-organisms present.

All parts of the food must reach at least 70oC.
Cooked food must be eaten immediately. As food cools microorganisms invade and multiply in the warm food.
There should be careful storage of cooked foods. If stored hot, food

must be kept at least 60oC. If stored in a refrigerator it must cool
quickly. Large volumes of food cool slowly allowing bacteria to
multiply.
Wash hands repeatedly before and after food preparation.
Keep all kitchen surfaces meticulously clean.
Use only clean water to wash and cook food.
Do Exercise 1.4: Prevention of infectious diseases.
Microbes in food and water

A microbe is a microscopic organism such as a bacterium or protozoan.
Most microbes are so tiny that they can only be seen under very powerful
microscopes. Fortunately techniques exist to identify many microbes
without using a microscope at all!
So how can you identify a microbe without actually seeing it?
Lets imagine that you have one unicellular microbe and that it has
plenty of food to grow. After a short period of time the cell divides (by
mitosis) into two cells. The two cells make four, the four make eight, the
eight make 16 and so on. Before too long you have millions of these
cells, all produced from the one microbe.
13
If you have one unicellular microbe how many would you have after one
day? Assume that your microbe has plenty of food and that the microbe
divides every two hours.
_________________________________________________________
Check your answers when you have done the calculation.
Petri dish with various microbial colonies growing on nutrient agar (jelly).
You may have realised that there is a short cut to the whole process.
Instead of working the result manually, you could have expressed the
calculation as 2 to the power of 12 (212). The power of 12 is used
because there are 12, two hour periods in the day. The 2 is used because
the bacteria double each time.
How many microbes would there be in a week?
The calculation for the number of bacteria in a week becomes:
2the number of 2 hour periods in one week
There are 12 two hour periods in one day and seven days in each week.
This gives 84 two hour periods in a week. The number of bacteria after
one week is:
2the number of 2 hour periods in one week
= 284
= 19 340 000 000 000 000 000 000 000
This can be expressed as 1.934 x 1025
14
Millions of microbes in the one place make a fairly substantial colony.

The colony can be so big that you can see it easily with the naked eye.
Colonies of microbes have an interesting characteristic. The colonies
made by different types of microbes will appear different. The size,
shape and colour of these will differ from one type of microbe to the
next.
To overcome the problem of identifying a microbe that is too small to
see, we identify them by their colony characteristics rather than by trying
to view individuals under a microscope.
Identifying the presence of microbes

Lets see how easy it is to identify the presence of microbes in food.
Complete the experiment below. It can be set up now. Depending on how
warm it is when you do this experiment, this will take between three and
seven days to get a result.
What you will need:
1 packet of jelly (any flavour/ colour you like)
1 tablespoon of Bonox, Marmite, Vegemite or AussieMite
boiling water
cling wrap
4 small jars with screw cap lids to fit.
What you must do:

First you must sterilise your jars to remove any bacteria.
Be very careful when using boiling water. If you are doing this at home
make sure that young children are kept away from the experimental area
while you are sterilising your jars.
1
Thoroughly clean your jars and lids. Pour boiling water into the jars.
Tip the boiling water out after about half a minute and quickly turn
the jar upside down onto a clean sink. DO NOT dry the jar with a
tea-towel under any circumstances!
Now carefully clean your lids. Pour boiling water into the lids.
Wait half a minute and then turn upside down onto the clean sink.
15
Wash a mixing bowl with boiling water. Mix the jelly crystals with
a tablespoon of Bonox (or similar substitute) and half the water
recommended on the jelly packet into the bowl. Use boiling water
only to make the jelly. Stir the jelly-Bonox mix quickly with a
spoon and immediately cover the bowl with cling wrap.
Pour about 2-3 cm of the jelly mix into one of your jars.
Immediately cover the jar with cling wrap and place the lid on top.
Repeat for the other three jars.
Place the jars into a refrigerator or in a cool place for four hours.
Discard any jelly solution remaining in the bowl. (Do not eat the
jelly remaining it will taste truly terrible!)
Wash your hands before the next step.
Select some food you are going to eat for a meal. Perhaps some
bread, meat, salad or whatever is on your lunchtime sandwich. You
only need a very tiny sample of say four ingredients in your lunch.
Select one jar and one of your food ingredients. Use a pair of sterile
forceps or tweezers (dip them into boiling water just before you use
them) to carefully touch the surface of the jelly with the food in three
or four different places. Touch the jelly as if you were lightly
stamping the jelly with the food. You must work very quickly on
this step. The lid must be off the jar for as little time as possible.
Replace the cling wrap and the lid on the jar as soon as you have
stamped the surface. Label your jar so you will know which food
was used to stamp the surface.
10 Repeat the last two steps for each of the remaining jars. Each jar
will be used to test a different food.
11 Place your jars on a warm window sill and leave.
16
Bacteria will grow on your jelly. To avoid infection from the bacteria
follow these safety instructions.
Do not touch the bacteria.
Do not remove the cling wrap.
Do not place your nose near the open top of the jar.
Wash your hands thoroughly with soap and warm water after handling
the jars.
After you have recorded your results it would be best to leave the jars
covered and to dispose in the garbage.
Write up this experiment in Exercise 1.5: Identifying the presence of
microbes in food.
Use the headings Aim, Method, Result and Discussion. If you need help in
writing up the practical then look at the section on experiments in your
Science resource booklet.
Your aim is to determine if microbes occur in the food samples you
selected. Your method is the steps outlined above.
Your result should be four carefully drawn diagrams to show the
bacterial colonies that develop on your jelly after 3-7 days. Be very
careful to draw the colonies accurately. Each different colony should be
given a number (colony type 1, colony type 2, etc). Remember that
different colonies will appear different. If you have difficulty with this
then read the next section which will provide some examples to help you.
Your discussion will compare the types of bacteria found on each
sample. Did the same bacteria occur on each sample or did different
food samples have different bacteria?
After you have written your report, answer the questions
1 What is the purpose of adding Bonox to the jelly?

______________________________________________________
______________________________________________________
2 Why do the jars need to remain sealed during the experiment?
______________________________________________________
______________________________________________________
______________________________________________________
17
3 Why is it necessary to wash your hands in step 7?

______________________________________________________
______________________________________________________
4 Why should you not dry the freshly sterilised jar with a clean tea
towel?
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
Pathogens in water
A pathogen is an infectious agent that causes disease. Pathogens include
prions, viruses, bacteria, protozoans, fungi and macro-parasites.
You have just arrived in a new country. You are worried about the
cleanliness of the local water supply. Many of the tourists are sick from
bouts of 'Bali belly' and another more vigorous form of diarrhoea called
'Tutenkamens revenge'. You are thirsty and your only source of water is
from the tap over the sink. What do you do?
You probably decided to boil the water. Water that has been boiled for
around three minutes is reasonably safe to drink. Only a few microorganisms can survive three minutes at the boil.
Another option for the seasoned traveller is to add water 'purification'
tablets to a bottle of the water. The water needs to be left for a time
while the tablet dissolves and takes effect. The tablet releases chemicals
that are toxic to many micro-organisms (but thankfully safe for human
consumption).
Whichever option you chose you would have been involved in water
treatment. Modification of the water supply is called water treatment.
Do Exercise 1.6: Pathogens in water.
18
Water treatment for large towns and cities

The treatment outlines above is fine for your thirst in a strange location,
but what about the treatment for whole towns and cities? Clearly you
would not be in a position to boil every drop of water before putting it
into a pipe and sending it to the people living in the town.
Between July and September 1998 Sydney was unable to drink from its
water supply. This was because of two protozoans, cryptosporidium and
giardia. Both of these organisms are transmitted to water through
contamination with faeces or direct contact with infected individuals.
Cryptosporidium attached to intestine. (Photo Key Centre for Microscopy

Sydney University)
Giardia. (Photo Key Centre for Microscopy Sydney University)
19
Sydney Water in their Report Number 5 covering the period December

1999 to February 2000 state that they test for both microbiological and
physical/ chemical factors. The physical/ chemical factors relate to water
taste, colour and turbidity. The microbiological testing is mainly for
coliform bacteria.
Coliform bacteria are usually associated with faeces. Faeces can enter
water supplies from septic run off and grazing activities in the water
catchment. All water supplies naturally have these bacteria (as do the
colons of animals including humans). The presence of coliforms is an
indicator that other diseases that can be transmitted by faecal
contamination may also be present.
Escherichia coli is the bacteria that Sydney Water use as an indicator species
for faecal contamination (Photo Key Centre for Microscopy Sydney
University).
Sydney Water, like most other water suppliers, adds chlorine to the water
supply to kill the coliform bacteria. This chlorine treatment also acts
against much other disease causing organisms associated with faeces.
A similar process is used in swimming pools to prevent infection to
swimmers. Sufficient chlorine is added to the drinking water to kill the
coliforms and to retain sufficient chlorine content to keep the water safe
right to the household tap.
Other methods of water treatment are filtration, chloroamination and
ozone filtration.
20
Contact your local water supplier to ask for information about water
treatment. If you are on tank water and depend on rainfall rather than a pipe
linking you to a dam you can still contact one of the bigger water suppliers
for information.
What types of micro-organisms are treated in your water supply? Does
your water supplier also test for Cryptosporidium and Giardia? If so
why?
There are some useful sites to gain this information from the Internet.
There is also some information in the Additional Resources section of this
part.
Do Exercise 1.7: Water treatment for large towns and cities.
21
22
Giardia
Giardia is a unicellular parasite that normally inhabits the intestines of
animals and humans.
Symptoms
Diarrhoea, cramps, nausea followed by weight loss and dehydration. It is
spread by putting objects in your mouth that have been contaminated
with faeces. People working with children are particularly at risk.
Treatment
There are prescription drugs available that kill the parasite.
Prevention
To prevent Giardia infection wash your hands after you go to the toilet
and before you prepare food. Dont drink untreated water. Avoid
swimming pools if you are infected to stop the spread.
23
Cryptosporidium
Cryptosporidium is a parasite that cause the disease Cryptosporidiosis.
It appears in the warmer months and can survive chlorination. The
disease is spread when Cryptosporidium is taken in through water,
personal contact or food.
Symptoms
Symptoms of infection include:
Watery diarrhoea, cramps, fever and vomiting. It is spread by putting
objects in your mouth that have been contaminated with faeces. People
working with children are particularly at risk.
Treatment
There is no treatment and healthy people recover within two weeks.
People with weakened immune systems should take special care with the
water they drink.
Prevention
Personal hygiene practises reduce the risk of the disease. To prevent
infection wash your hands after you go to the toilet and before you
prepare food. Dont drink untreated water. If you have diarrhoea dont
prepare food for others, avoid swimming pools if you are infected to stop
the spread and keep away from people with lowered immunity.
24
Suggested answers
Types of disease
Ailment
Disease?
Reason
influenza
Body function is disturbed. Influenza has a

characteristic set of symptoms.
Inflammation and metabolism effected.
intestinal
tapeworm
Body function disturbed. Inflammation and

metabolism changes possible.
cut finger
Function disturbed but no other

characteristics of disease. The pain of the
cut does not qualify it as a disease. Any
inflammation is the result of secondary
infections ie. the result of bacteria entering
the cut.
common cold
Body function disturbed. Colds have a

Inflammation and metabolism changes
possible.
hereditary
baldness
Body function not disturbed. This is not a

disease.
measles
Body function disturbed. Measles have a

possible.
cold sore
Body function disturbed. Cold sores have a

possible.
25
Genes, mitosis and cell differentiation

genes
cell division that results in identical cells
mitosis
each cell has the potential code to change into

different cell types
the units of inheritance that codes for inheritance.
cell specialisation
each cell type carries out different cell functions
Infectious and non-infectious disease

Disease
26
Tick if
infectious
cross if noninfectious
Reason
common cold
Can be transmitted by droplets (from a

sneeze) in the air from one person to
another.
haemophilia
Is inherited. Can not be 'caught' by

association with diseased person.
mumps

another.
chicken pox

another.
Down syndrome
Is inherited. Cannot be 'caught' by

association with diseased person.
You could even accept a blood
transfusion from a Down syndrome
person without risk of catching this
disease.
skin cancer
Cannot be transmitted. Caused by a

malfunction of cell division.
cardiovascular
disease
Cannot be transmitted. Caused by

genetic predisposition and/or lifestyle
factors.
Identifying microbes in food and water

After 24 hours you would have 4096. The table below shows how you
could have calculated this manually.
Time
Number of bacteria
Start
After 2 hours
After 4 hours
After 6 hours
After 8 hours
16
After 10 hours
32
After 12 hours
64
After 14 hours
128
After 16 hours
256
After 18 hours
512
After 20 hours
1024
After 22 hours
2048
After 24 hours
4096
Identifying the presence of microbes in food
Bonox provides a food supply to the bacteria.
Bacteria are in the air. In still air they fall as a constant, invisible,
rain. The jelly would quickly become contaminated by airborne
bacteria if it were not covered. We are interested in the bacteria on
the food, not in the bacteria in the air.
To reduce the chance of bacteria on your hands contaminating the

experiment.
27
28
Even a fresh tea towel straight from the washing line will be covered
in bacteria and spores. Spores and bacteria are constantly falling like
rain from the air and will have collected on the towel. Anything left
in air gets covered in bacteria and spores and this includes you, your
pet Fido, your clothes and your food. A grim thought really.
Exercises Part 1
Name: _________________________________
Exercise 1.1: Defining health

Define the words health and disease and then discuss the difficulty of the
definition.
Health
_________________________________________________________
_________________________________________________________
Disease
_________________________________________________________
_________________________________________________________
Difficulty of definition.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
29
Exercise 1.2: Genes, mitosis and cell differentiation

Outline how the following assist in the maintenance of health:
function of genes
______________________________________________________
______________________________________________________
mitosis
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
cell specialisation
______________________________________________________
______________________________________________________
______________________________________________________
Exercise 1.3: Infectious and non-infectious diseases

Distinguish between infectious and non-infectious diseases.
Give examples of each.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
30
Exercise 1.4: Prevention of infectious diseases

Explain how cleanliness in food preparation, personal hygiene and water
assist in the control of disease.
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 1.5: Identifying the presence of microbes in

food
Record your experiment.
Aim:
_________________________________________________________
_________________________________________________________
Method:
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Result: (Draw your result)
31
Discussion:
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 1.6: Pathogens in water

What is a pathogen?
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 1.7: Water treatment for large towns and

cities
Outline some of the ways that water is treated and suggest why this
reduces the risk of infection by pathogens.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
32
Biology
HSC Course
Stage 6

Part 2: The causes of disease
Contents
Introduction .............................................................................. 2
Discovering the cause of disease.............................................. 4
The work of Pasteur .............................................................................4
The work of Koch ...............................................................................11
Types of infectious disease ..................................................... 15

Types of pathogens............................................................................15
Investigating plant pathogens............................................................26
Malaria ................................................................................... 33
What causes malaria? .......................................................................33
How is malaria transmitted? ..............................................................34
Treatment and control of malaria.......................................................37
Microflora ................................................................................ 38
Microflora imbalance ..........................................................................39
Quarantine .............................................................................. 43
Some quarantine measures...............................................................43
Exercises Part 2 ................................................................... 59
Introduction
In this second part of the module you will be looking at organisms that
cause disease. Several scientists have played a major role in uncovering
the causes of disease. During the second half of the nineteenth century,
Louis Pasteur and Robert Koch stimulated the search for disease-causing
micro-organisms.
This was followed by the work of Ronald Ross who identified that
insects could be carriers of disease to humans.
Once the cause of a disease is identified, steps can be taken to prevent
and treat the disease.
You will need two small cans of baked beans or creamed corn during this
part.
describe the role of Pasteur in identifying the causes of disease
describe the circumstances which resulted in a named microorganism being identified as the causal agent of a disease of a plant
or animal
outline Kochs postulates and explain how they can be used to

identify the causative organism of an infectious disease
identify that infectious diseases of animals and plants are caused by

pathogens that include:
prions
viruses
bacteria
protozoans
fungi
macro-parasites
identify a disease that is transmitted by an insect vector, name the

vector and the organism infected by the disease
discuss the role of quarantine in preventing the spread of disease and

plants and animals into Australia or across regions of Australia
examine one named infectious disease in detail to describe:
cause
transmission
host response
major symptoms
treatment
prevention
control.
perform an investigation to model or process information to describe

Pasteurs classic experiment to identify the role of microbes in decay
gather and process information to trace the historical development of

our understanding of the cause and prevention of a disease caused by
a micro-organism
identify data sources, gather process and analyse information from

secondary sources to describe the life cycle of one pathogen carried
by an insect vector and identify and explain when control or
prevention of the disease is most effective
perform an investigation to examine plant shoots and leaves and

gather first-hand information of evidence of pathogens, including
insect pests, viruses or fungi
process and analyse information from secondary sources to evaluate

the effectiveness of quarantine in preventing the spread of plant and
animal disease into Australia or across regions of Australia
process and analyse information to identify the role of antibiotics in

combating bacterial infections
gather, process and present information from secondary sources to

show how one disease results from an imbalance of microflora in
humans.

Discovering the cause

of disease
The idea that disease could be caused by organisms so tiny that they
could not be seen with the naked eye is comparatively recent. There
were two problems in identifying micro-organisms as the cause of some
diseases.
Micro-organisms were only discovered after the advent of

microscopes. Bacteria, for example, were discovered by
Leeuwenhoek in 1676.
Experiments using scientific method were required to identify

particular micro-organisms as the cause of particular diseases.
This was a difficult task given that not all micro-organisms cause
disease.
Most of the important work linking micro-organisms to disease was done

in the mid 1800s. At that time there existed a substantial body of
knowledge about the diversity and structure of micro-organisms.
The time was ripe for conducting controlled experiments with
micro-organisms.
You will look at some of the controlled experiments conducted by
Pasteur and Koch in this part of the module. You will also look at the
circumstances under which the tubercle bacillus (bacterium) was
identified as the causal agent of tuberculosis in cattle and Bacillus
anthracis was identified as the causal agent of anthrax in sheep.
The work of Pasteur

This historical note is optional reading and is outside the
requirements of the NSW syllabus.
Some history
Before looking at some of Pasteurs experiments you can take a quick
look at the scientist himself.
Louis Pasteur was born in 1822 and died in 1895. He studied chemistry
and in 1848 was appointed to Dion as Professor of Physics. From Dion
he moved to Strasburg where he taught chemistry and in 1867 he was
appointed Professor of Chemistry at the Sorbonne (University of Paris).
In 1888 he became Director of the Pasteur Institute which he established.
Pasteur performed considerable research in chemistry and was well
known for his work on the optical properties of tartaric acid. While at
the Sorbonne, Pasteurs attention moved from chemistry to fermentation.
Fermentation was the basis of many important industries such as
brewing, cheese making and winemaking.
Pasteur showed that fermentation has both a chemical and biological
basis. He was also able to show that the souring of milk was caused by
bacteria. These experiments put medical science onto the track of
finding the causes of many diseases that were caused by microorganisms. This is called the germ theory of diseases.
One of Pasteurs first studies into disease was to identify the bacterium
causing a silkworm disease. This disease was crippling the important
silk industry in France and the cure he developed after three years of
research certainly saved the industry at that time.
In his later years, Pasteur concentrated on diseases and did important
work on anthrax, chicken cholera, diphtheria and rabies.
Pasteurs work was highly commercial. Much of his research into microorganisms and disease was to solve problems in the food industry. Some
of his research lead to later discoveries and adaptations by other
scientists to identify and treat human and other diseases.
Some trivia
Pasteur developed a serum to treat rabies (you will learn more about this
type of treatment when you study immunity). Joseph Meister was the
first person to receive the treatment. Meister at age nine had been bitten
by a rabid dog and was treated by Pasteur. Meister later became an
employee of the Pasteur Institute.
We could leave the trivia here except there is one last, tantilising, fact.
Meister committed suicide in 1940. He had been ordered to open
Pasteurs crypt by German soldiers occupying Paris at the time. Rather
than comply, Meister committed suicide.
Want more?
There are numerous Internet sites dealing with the life and times of Pasteur
as well as a number with links to the current activities of the Pasteur
Institute. Search the terms Pasteur or Pasteur Institute and you will soon
find plenty of material.
You could also try: http://www.lmpc.edu.au/science
Micro-organisms cause decay

Pasteur discovered that micro-organisms:
were responsible for decay
came from other micro-organisms.
Baked bean experiment

What you will need:
You require two small tins of baked beans or creamed corn. You can
substitute the baked beans for any other inexpensive canned vegetable.
What you must do:
1
Place two cans of baked beans near a window and open the top of one
of the cans. The second can must remain sealed.
Leave the cans for about one week or until bacterial and mould
colonies form on the beans in the open can.
Open the unopened can of beans. Can you see mould or bacteria in
the unopened can?
Dispose of the tin of beans that has remained open during the experiment.
The bacteria and mould will make the beans unsuitable for use even as pet
food.
Do not feed the beans to Fido, Tweetie or Sooty!
When baked beans are placed into a can, high temperatures are used to
kill all micro-organisms on the interior of the can and in the baked beans.
There are no bacteria or moulds inside the unopened can of baked beans.
Answer the following questions.

1
What evidence do you have that there were no bacteria and moulds
inside the unopened tin of baked beans?
_____________________________________________________
_____________________________________________________
_____________________________________________________
Where do you think the bacteria and moulds that grew on your
opened tin of baked beans came from?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Many canned goods have warnings only to open the tin when you are
ready to use the contents. Why?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

The answers you gave to the questions will be very different to the type
of answers your ancestors would have given. You are already familiar
with the ideas that micro-organisms exist and that some micro-organisms
can cause disease and decay.
In the mid 1800s the cause of decay was unknown and the sudden
appearance of moulds on food was blamed upon spontaneous
generation. Spontaneous generation was the theory that living things
could arise from non-living things ie that living things could be generated
without the need for parenting organisms.
As you read the next section keep in mind what ground breaking stuff
this was at the time Pasteur made his discoveries. It was an era when
surgeons performed operations in their street clothes, without facemasks
and without sterilisation. Thousands died each year from microorganisms because the need for good sanitation and clean food handling
practices was unknown.
Experimental evidence
The hypothesis
Pasteur noted that broth (soup) would spoil and become contaminated
with bacteria and moulds. He hypothesised that this contamination was
caused by micro-organisms and their spores entering the broth from the
air.
How the hypothesis was tested
To test the hypothesis Pasteur placed broth into two different glass flasks.
One flask had a top that was a long S-bend (the experiment) while the
other had the S-bend broken off near the base (the control). The S-bend
allowed air to enter, but spores of bacteria and mould became trapped in
the liquid in the S bend and could not enter the flask.
micro-organisms and their
spores trapped here
broth
experimental flask
with S-bend
condensation
broth
control flask
with tube broken
near base
Pasteurs flasks.
Pasteur boiled the broth in each flask to kill any micro-organisms in the
broth. The steam from the boiling sterilised the walls of the flasks. Both
flasks were then allowed to stand in a room.
The result
The flask with the S-bend broken near the base (the control) quickly
developed bacteria and mould on the surface. The broth spoiled.
The broth in the flask with the S-bend (the experiment) did not spoil.
Bacteria and mould did not form on the broth.
How the result was interpreted

Both the experiment and control had been sterilised to kill microorganisms at the start. Micro-organisms only infected the flask that
allowed micro-organisms and their spores to enter from the air (the
control). Micro-organisms did not infect the experimental flask.
Pasteur drew two conclusions.
Micro-organisms were responsible for the spoiling of broth.

When micro-organisms were not present the broth did not spoil.
Micro-organisms did not spontaneously generate. There had to be

either micro-organisms or their spores for them to occur.
Some trivia
Pasteur performed a series of experiments over a number of years, all of
which gave the same result. There were minor differences between each
of the experiments as he tested his hypothesis under different conditions
and with slight modifications in his experimental equipment.
If you read other textbooks you may find slight differences in the way
Pasteurs experiment is described. These differences occur depending
upon which of Pasteurs experiments is described.
Pasteur performed one of his experiments on a glacier so he could use
pure mountain air for one of his tests. In another he took his flasks to
many different towns to see if the experiment worked in different
locations.
Pasteurs experiment disproving spontaneous generation is one of the more
famous experiments. It is important that you understand this experiment.
Answer the following questions to see if you have understood the
experiment then check the answers.
1
What was the difference between the set up of the experimental and
control flasks in Pasteurs experiment?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
One theory that was popular at the time of Pasteurs experiment was
that bacteria were created spontaneously from air. What aspects of
Pasteurs experiment disprove this theory?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Pasteurs experiment is similar, but not identical, to the baked bean

experiment you conducted earlier. Outline one difference between
the two experiments and explain the significance of this difference.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
Anthrax
Anthrax is a disease of cattle, sheep and horses. Pasteur performed a
classic experiment to show that anthrax was caused by a rod shaped
bacteria called Bacillus anthracis.
Pasteur took a flock of fifty sheep. He infected twenty-five of them with
a weakened form of the bacteria. This weakened form was not strong
enough to kill the animals but produced an antibody reaction in them.
Then, several days later he injected the whole herd with a lethal form of
the bacteria. The half that had the weakened form previously all
survived while the untreated animals all died.
The first inoculation with the weakened (attenuated) form of the bacteria
gave those sheep a way of fighting the disease using their natural
immune system. They were then prepared with a defence system when
they were exposed to the deadly form of the bacteria. This same method
is used today in vaccination programs when attenuated vaccines are
given for measles, rubella, poliomyelitis and rabies.
Do Exercise 2.1. Pasteur
10
The work of Koch

Robert Koch (1843-1910) was a German bacteriologist. Much of his
work was done with a microscope and a few basic kitchen utensils, but
he isolated bacteria, made pure cultures of them, and made
photomicrographs.
Kochs greatest achievement was the isolation of the tubercle bacillus
and his invention of the tuberculin test for cattle herds.
Kochs postulates
Kochs postulates refer to a procedure that identifies the causative
organism of a particular infectious disease. The procedure is impressive
because of its simplicity and because of the application of logic to solve
the problem.
To identify an organism as the cause of a particular disease the following
steps must be followed.
Step 1 - The suspect organism must be present in infected organisms.
The organism suspected of causing the disease must be present in all
organisms that have the disease.
If the organism that is thought to cause the disease is not present in some
or even all of the organisms that have the disease then it is clear that
there must be some other cause.
Step 2 - A pure culture is required.
A pure culture of the organism suspected of causing the disease must be
obtained. This can be a difficult process because all other organisms
must be excluded from the sample.
Pure cultures can be obtained by starting with a single organism in a
sterile container and allowing it to replicate. Another method is to
selectively poison so that only the suspect organism remains living in the
sample.
Step 3 - A healthy organism must be inoculated with the pure culture
and the potential host must develop the same symptoms.
Healthy organisms without the disease must then be inoculated with the
suspect organism. The pure culture is used to provide the material for the
inoculation.
11
The pure culture is important because it is used for inoculation. Imagine

that you used a culture that was not pure for inoculation. If the healthy
organisms became sick after inoculation then you would not be sure
which of the organisms in the impure culture caused the healthy
organisms to become sick.
Using Kochs postulates you test just one suspect organism at a time.
If the results are negative then you find another suspect organism and try
again.
Step 4 - The suspect organism must be re-isolated, re-cultured and
identified as the organism used for the inoculation.
The newly diseased organisms must then be sampled with the suspect
organism present. The suspect organism must be living within the
diseased organisms.
The suspect organism must be re-isolated from one of the inoculated and
newly diseased organisms. A pure culture must be developed. The new
pure culture is then compared with the previous pure culture to ensure
that they both contain exactly the same organism.
Learn Kochs postulates before going on. To help you do this here are some
suggestions.
Write them out as a chart and hang the chart on a wall somewhere that
you will see them.
Ask someone to question you on Kochs postulates.
Use the cut outs in the Additional resources to rearrange the steps in the
right order.
Past HSC questions on Kochs postulates

Kochs postulates have been included in HSC biology courses since the
early 1970s. They are very important and have attracted their fair share
of questions in HSC Biology examinations over the years. You should
learn the steps involved in Kochs postulates. In the past, many HSC
questions have expected you to know the steps, in order.
Try these past HSC questions related to Kochs postulates. The questions
relate to a previous Two Unit Biology syllabus. Answer each question in
the space provided. Think carefully about your answers before you write.
The trick is to get the correct answer, and to get your answer to fit the
limited space provided in the HSC exam! This is important preparation for
your HSC exam in Biology.
12
Question 1 (3marks)
Koch postulated that a specific micro-organism could be said to cause
a disease if several conditions were met. List THREE of these
conditions.
(Question 18 Part B 1995 HSC 2 Unit Biology Examination Paper. Board of
Studies, NSW.)
_________________________________________________________
_________________________________________________________
_________________________________________________________
Individuals in an isolated village become sick. A physician
establishes that all the sick individuals are infected with a particular
strain of bacteria. A sample of this strain is taken from a sick
individual and grown in pure culture away from the sick individual.
This strain of bacteria was not found in any healthy individuals.
What TWO other pieces of information are required to establish that
the disease was caused by the strain of bacteria?
(Question 28 (a) Part C 1996 HSC 2 Unit Biology Examination Paper. Board of
Studies, NSW.)
_________________________________________________________
A biologist took a scraping of a diseased patch on the leaf of a plant.
He cultured the scraping and found that a pure culture of bacteria
developed. The bacterial culture in the culture dish may be
responsible for the disease on the plant leaf. What steps would Koch
have followed to determine this?
(Question 19 Part B 1997 HSC 2 Unit Biology Examination Paper. Board of
Studies, NSW.)
_________________________________________________________
_________________________________________________________
_________________________________________________________
13
Do Exercise 2.2. The work of Koch
A disease causing micro-organism

If you read the historical note on Koch, you will have noticed that he
identified the tubercle bacillus in cattle. This bacterium was responsible
for tuberculoses in cattle and could be passed on to humans.
Koch came to the conclusion that the tubercle bacillus was responsible
after he noticed that:
14
healthy cattle did not have the tubercle bacillus
cattle with tuberculosis had the tubercle bacillus
if blood from infected cattle was injected into healthy cattle, the
healthy cattle developed the disease
when a pure culture of the tubercle bacillus was injected into healthy
cattle, the healthy cattle developed the disease.
Types of infectious disease
A pathogen is a disease-causing organism. Pathogens cause infectious

diseases in both plants and animals.
Different pathogens cause different diseases. For example, the protozoan
Plasmodium vivax is a pathogen that causes malaria, Myobacterium
tuberculosis is a pathogen that causes tuberculosis.
Types of pathogens
You will learn about six different types of pathogens.
Prions
Viruses
Bacteria
Protozoans
Fungi
Macro-parasites
Prions
The term prion comes from proteinaceous infectious particles prion for
short.
Prion diseases are caused by a protein produced in the brain called prion
protein. All adult vertebrates have prion protein and the normal form of
prion protein causes no harm. However, there is an abnormal form of
prion protein which causes the death of brain cells.
15
The normal and abnormal forms of the prion protein are the same
protein. The only difference is in the shape of the protein. How a small
difference in the shape of a protein can cause disease is still unknown.
The gene that codes for prion protein is on chromosome number 20 in
humans.
Why are prion diseases so interesting?
Prions are a naturally occurring protein. Because they are a natural part
of the body, the immune system (you will look more closely at immunity
later) does not attack the prion. The bodys outer barriers such as skin
are also useless in defence because prion protein is made inside the
bodys barriers.
Vaccination and antibiotics are also useless in combating prion diseases.
Unlike the other pathogens you will learn about in this section (virus,
bacteria, protozoans, fungi and macro-parasites), prion protein contains
no genetic material. Prion protein is coded for by a single gene, but prion
protein itself does not contain genes.
All known human prion diseases are fatal. Prion disease is often called
spongiform encephalopathies. The word spongiform refers to the fact
that the brain often becomes riddled with holes (just like a sponge) when
infected with a prion disease.
What does normal prion protein do?
The function of normal prion protein is unknown. At the time of writing
all that was known was that prion protein occurs in the brain and that
abnormal prion proteins cause prion disease.
Examples of human prion diseases
Prion diseases in humans include Creutzfeldt-Jakob disease (CJD) and
Kuru disease.
CJD usually only begins when a person is in their 60s or 70s. The
symptoms include memory loss that proceeds to dementia within just a
few weeks. Death usually occurs within six months of the first
symptoms of the disease. The annual rate of occurrence of CJD is about
one in a million for most human populations.
If you like trivia, then Kuru is a more interesting disease. Kuru was first
diagnosed in Papua New Guinea and is transmitted by eating human
brain. Thats right, unless you are a cannibal you have little fear of
catching this disease!
16
Do other animals have prion diseases?

Yes.
Mad cow disease (bovine spongiform encaphalopathy or BSE) is a well
known example from cattle. Other examples include scrapie in sheep,
transmissible mink encephalopathy and chronic wasting disease in deer,
elk and goats.
We will say nothing more about prion diseases in other organisms
because our focus here is on the human types of prion disease.
How can you catch a prion disease?
You have already seen that cannibalism can lead to one type of prion
disease, now it is time to look at the other ways prion diseases can be
contracted.
Injection or ingestion (eating) of brain extracts from individuals with

the disease.
Genetic susceptibility. Some people have genes that produce a

slightly different form of prion protein. This slightly different form
of the prion protein is more susceptible to changing into the
abnormal form of the prion protein. It is possible to inherit some
types of the disease.
Inadequate sterilisation of instruments used in brain surgery. This

can result in CJD being passed from one patient to another.
How common are prion diseases?

You have already seen that prion disease has an annual occurrence rate of
around one in a million. One doctor we consulted said that most
Australian doctors could work their entire medical career without ever
seeing a single prion disease case!
Answer the following questions in the spaces provided then check your
answers against those at the end of this unit. Plan your answers and try to
answer within the space provided for each question. This is good practice
for answering questions in examinations.
1
There are many types of prion diseases. Name two types of prion
disease that occur in humans.
_____________________________________________________
_____________________________________________________
17
Name two features of prion diseases that would make them difficult
to treat.
______________________________________________________
______________________________________________________
______________________________________________________
What is the cause of prion disease?

______________________________________________________
______________________________________________________
______________________________________________________
A small city has two million inhabitants. You have been asked to
develop a plan for combating prion disease. How many cases of
prion disease would there be on an annual basis?
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
Viruses
Viruses are so tiny that they can only be viewed using an electron
microscope. They have an outer protein coat that encloses genetic
material.
Protein coat
Head
Genetic material
Collar
Sheath
Tail fibres
Schematic drawing of a virus.
18
There has been some debate about whether viruses are living or nonliving. For the purpose of this module, viruses have been grouped with
the pathogens (living things that cause disease). This classification is
based upon convenience - when discussing disease, viruses are better
considered here than elsewhere.
Viruses. Australian Key Centre for Microscopy
For the purpose of your HSC you can consider viruses to be either living
or non-living. All you need to be able to do is to justify your choice!
Below are the common arguments for viruses to be considered living or
non-living. You have to make your own choice about which argument
you think is best.
Arguments for viruses to be considered living
Viruses have genetic material like other living things and are able to
reproduce their own kind.
Viral genetic material passes on hereditary information and is able to

mutate. This is a property of other living things.
Viruses have a recognisable morphology. This means that they have

a distinct recognisable structure. Other living things also have this
feature (cats look like cats, fish look like fish and so on).
19
Those in favour of viruses being living consider them to be parasites.

Like other parasites they depend on their host for many of their needs.
The argument that viruses cannot be living because they are not cellular
is countered by claims that definitions requiring all living things to be
made of cells are too narrow.
Arguments for viruses to be considered non-living
Viruses are not cellular. There is no cell membrane. By definition

living things are made of cells.
Viruses cannot reproduce independent of their host. In fact, viruses

control the DNA of the host cell and cause it to produce new viruses.
Viruses can be crystallised. No other living thing can be

crystallised.
Those supporting the idea that viruses are non-living see them as an
interesting group of chemicals. They challenge the idea that they could
be living because all the processes of life (reproduction, growth,
assimilation, respiration) are dependent upon a host cell. The virus can
perform none of the life processes by itself.
Diseases caused by viruses
Viral diseases include Ross River fever, AIDS (acquired immune
deficiency syndrome), the common cold, chicken pox, cold sores,
cowpox, glandular fever, mumps, German measles, poliomyelitis,
Sindbis virus infection, Australian encephalitis, hepatitis B and TMV
(tobacco mosaic virus - a virus that attacks plant cells).
Treatment of viral diseases
There are very few treatments for viral diseases. Prevention is the best
treatment in the form of vaccination, quarantine or removal of vectors
such as mosquitoes.
Ross River fever
Ross River fever is caused by a virus belonging to the genus
Togaviridae. The virus is known to occur in humans as well as in a
variety of domestic and wild animals.
The virus is transmitted to humans by mosquitoes. At least 12 different
species of mosquito are known to be capable of transmitting the disease.
The major vectors (both mosquitoes) are Culex annulirostris and Aedes
vigilax (Stevenson and Hughes, 1988).
20
The reference here is Stevenson, W J. and Hughes, K L. 1988. Synopsis

of Zoonoses in Australia. Australian Government. Publishing Service.
The disease is most common December to May (this corresponds to
warm moist weather associated with mosquito breeding) and has spread
over much of Australia including parts of Sydney.
Symptoms of the disease include an itchy rash, headache, lethargy,
muscle tenderness, nausea and sore joints.
Currently there is no treatment for the disease, although the symptoms
are treated with analgesics (headache tablets) and bed rest. Precaution
against mosquito bites is recommended. The disease is notifiable in all
Australian states and territories.
Zoonoses
The term zoonose refers to any disease that is transmitted from animals
to humans by either direct contact or through animal products eg. food.
The virus causing Ross River fever and Plasmodium, the cause of
malaria, are both zoonoses.
Can you find any other examples of zoonoses in these notes?
Answer the following questions in the spaces provided then check your
answers against those at the end of this unit.
1
Name one disease caused by a viral pathogen. What are the

symptoms and treatment of this disease?
_____________________________________________________
Construct a table in the space provided to summarise the arguments

both for and against virus being considered to be living.
Check your answers.
21
Bacteria
Bacteria are procaryotic organisms. Some of the earliest organisms to
appear in the fossil record are bacteria - they have been around for a very
long time!
2m
RNA
DNA
0.8 m
DNA
Cell wall
Cell membrane
Diagrammatic representation of the bacterium Escherichia coli. E. coli is a

common bacterium found in the human colon.
Although some bacteria respire aerobically (with oxygen), many respire

anaerobically (without oxygen). This has allowed anaerobic forms to
live in low oxygen habitats such as the digestive tracts of animals.
Diseases caused by bacteria
Diseases caused by bacteria include boils, tetanus, whooping cough,
syphilis, anthrax, brucellosis,listerosis, Lyme disease, melioidosis,
psittacosis, salmonellosis, tuberculosis and crown gall (a plant disease).
Treatment of bacterial diseases
Bacterial diseases are frequently treated with antibiotics and disinfectant
which kill bacteria. When antibiotics are prescribed for viral infections,
they are given to kill associated bacterial infections. Antibiotics do not
kill viruses.
22
Salmonella
Salmonella (which causes one type of food poisoning) is a disease caused
by a number of anaerobic bacteria belonging to the genus Salmonella.
The disease occurs in humans and other animals.
Salmonella is usually transmitted by ingesting (eating) food
contaminated with the bacterium. Symptoms include nausea and
diarrhoea. The toxins released by the bacteria can, in extreme cases, be
fatal.
Re-cooking food that is contaminated with salmonella kills the bacteria
but has no effect on the heat stable toxins that cause the symptoms.
Protozoans
Protozoans are single celled eucaryotes that are probably best classified
within their own phylum rather than classifying them as being either
plant or animal. Only some protozoa are pathogens. Most protozoa do
not cause disease.
flagellum
undulating membrane
Trypanosoma, the protozoan that causes African sleeping sickness.
Diseases caused by protozoans

Some diseases caused by protozoa include African sleeping sickness
(caused by the protozoan Trypanosoma gambiense), giardiasis and
amoebic dysentery. Malaria is caused by Plasmodium, a protozoan
belonging to the class Sporozoa. You will study malaria in some detail
later in this module.
23
Fungi
Fungi are a group of eucaryotes that have cell walls but no chloroplasts.
Some fungi are parasitic while others are saprophytic. Fungi are
distinguished from other organisms by the mass of hyphae (threads) that
make up the body of multicellular individuals.
Fungi include such things as mushrooms, yeast and tinea (athletes foot).
Diseases caused by fungi
Diseases caused by fungi are called mycotic diseases. Mycotic diseases
include cryptococcosis, histoplasmosis and ringworm. Mycotic diseases
of plants include mildews of grapes, apple scab, corn smut, stem rust of
wheat and potato blight.
Treatment of mycotic diseases
Fungal diseases are usually treated with fungicide. A fungicide is any
substance that kills a fungus.
Tinea
Tinea is a group of fungal infections of the skin. The common tinea of
the foot is caused by a number of fungi such as Epidermophyton
floccosum. Tinea, like other fungi, reproduce by spores. Contact with
tinea or tinea spores eg. by sharing footwear or standing on shower
floors used by a tinea sufferer, spread the disease. Tinea occurs
worldwide in human populations.
Tinea is commonly found growing in the moist areas between toes or on
the soles of feet. The skin is often flaky or reddened in areas affected by
tinea.
Tinea is not life threatening and for most is no more than an occasional
mild irritation.
Macro-parasites
The prefix macro means large. When biologists use the prefix macro it
usually refers to something able to be seen with the naked eye. Macroparasites are the large parasites such as tapeworm that can be seen with
the unaided eye.
Macro-parasites are divided into two groups - endoparasites (internal
parasites ) and ectoparasites (external parasites).
24
Examples of macro-parasites
Aphids are well known
ectoparasites of plants. They are
parasitic (they are sapsuckers).
Aphids are commonly found on
roses and fruit trees.
Animal macro-parasites include
tapeworm (an endoparasite) and
lice (an ectoparasite).
Tapeworm.
Hydatid disease
In Australia, hydatid disease is caused by the tapeworm Echinococcus
granulosus. The tapeworm is an endoparasite and can be transferred
from domestic animals to humans.
The diagram below shows how E. granulosis may get from infected
cattle and sheep to humans.
gs
do
Faeces get onto dog's

hair
and transfer to huma
ns
Inf
ec
ted
m
ea
tf
ed
to
Adult worms release e

ggs
Eggs released in dogs .
.
Cattle and sheep with

hydatid worms
How hydatid disease may infect humans.
25
When E. granulosus eggs enter a human an embryo hatches and burrows

into the surrounding tissue. The tapeworm embryo has been found in
many human organs including the liver, lungs and brain. The embryo
forms a fluid filled cyst which places pressure on surrounding organs.
If the cyst bursts then severe shock can be caused by the sudden release
of Echinococcus antigens. The cysts may need to be surgically removed
in humans.
Preventative measures include careful meat inspection in abattoirs,
proper hygiene when handling dogs and regular doses of anti-worming
solutions for dogs. The preventative measures focus on stopping the
disease reaching humans from either dogs or meat supplies. There is no
direct treatment to kill the tapeworm once it enters a human host.
Investigating plant pathogens

In this activity you will be examining plants for evidence of pathogens
(insect pests, viruses and fungus). You should read the following
information on plant pathogens and then do the practical titled Plant
pathogen practical.
Insect pathogens of plants

Pathogen
The African black beetle,
Heteronychus arator, is a pathogen of
grasses in Australia. The beetle
belongs to the order of insects known
as Coleoptera. The lava of this beetle
is as destructive as the adult.
Insect pathogens have a number of
advantages in their role as pathogens.
For example, they have wings which
allow them to fly. Wings enable
widespread distribution.
African black beetle
26
Symptoms
African black beetle is common in lawns. The major symptom is the
browning of patches of lawn. The beetles are subterranean for most of
their life and eat the roots of grasses. The browning of areas of lawn
results from the death of grass caused by root damage by the beetle.
Viral pathogens of plants

Pathogen
Broad bean wilt virus is a virus that causes wilting and necrosis in broad
bean (Vicia faba). The pathogen uses the weed lambs tongue (Plantago
lanceolata) as an intermediary host. Aphids transfer the disease from the
lambs tongue to the broad bean.
Plantago lanceolata showing mosaic pattern of the virus (left) with Vicia fabia
showing wilt from the disease (right). Campbell, K O. and Bower,J W. (ed)
(1988) The Scientific basis of Modern Agriculture Sydney University Press.
Symptoms
Necrosis and wilting. Intermediate host has mosaic pattern on leaf when
infected.
27
Fungal pathogens of plants

Pathogen
Loose smut of wheat is caused by the fungus Ustilago tritici.
Ustilago tritici infection showing healthy head of wheat (left), partially infected
head (center) and head completely destroyed by smut (right). Campbell, K O.
and Bower,J W. (ed) (1988) The Scientific basis of Modern Agriculture Sydney
University Press.
Symptoms
Destruction of wheat head. Powdery residue covering wheat head.
28
Plant pathogen practical

Read the instructions that follow for investigating plant pathogens.
You must write an experimental report when you have completed the
investigation.
If you are not able to complete this activity using first hand data then you
can use the information about plant parasites in the previous section to
complete the required report. You will gain more from this exercise if
you do the practical rather than relying on the data provided.
What you will need:
You will need access to a variety of plants. A garden, park, crop, potted
plants or even plants growing on the roadside will do.
If you can get some help for this practical you will find that it is very
easy to do. If you know any keen gardeners nearby then it would be a
good time to befriend them. Ask them if they can show you some of the
pests currently infesting their plants.
If you live in a rural area then see if you can talk to one of the local
landholders - these are the true professionals who will probably know
every plant pathogen in your area.
Besides some plants, you will need a pencil and some paper. A hand lens
(magnifying glass) would be useful, but not essential.
What you will do:
1
You need to identify three different plant pathogens. Attempt to

include a fungus, an insect and a virus. Of course, time of year and
availability of material may mean that you end up with three
pathogens from the same group eg. three insect pests. If you can only
find pathogens from a single group do not worry.
For each pathogen you will need to:
name the pathogen
provide a drawing of the pathogen and/or a drawing of the

symptoms the plant may be showing eg. wilting, spots on stem
or leaves.
name the general group to which the pathogen belongs (virus,

fungus or insect pest).
You might like to include information on the treatment for each

pathogen.
29
Record your observation in Exercise 2.4: Plant pathogen practical.
More information
If you are going to ask for help from a local gardener you may find it
useful to complete the exercise below first. It outlines an encounter with
a local gardener.
Read the following interview with an amateur gardener and then answer the
questions that follow.
Chriss garden has a mixture of fruit trees and annual vegetables in the
back yard while the front yard is devoted to an excellent rose garden
and a soft dark green lawn of Queensland Blue couch. Chris is
familiar with most of the diseases that attack plants in the area.
Interviewer: The garden looks great, but do you have any problems with pests?
Chris: Yes. Right now Im fighting African black beetles in the front
lawn and black spot on my lemons.
Interviewer: Tell me about the African black beetles.
Chris: They come in the warmer months each year. They get into the
lawn and eat the roots of the grass. If youre lucky you see one or two
walking around on top of the grass and then you know its time to
spray. But mostly the first sign of African black beetles are dead
patches in the lawn where they have eaten the roots and killed the
grass.
Interviewer: So, what do you do?
Chris: I use this stuff (Chris holds up a bottle of a spray available
from the local hardware store). All you do is mix it up according to
the directions and spray the lawn.
Interviewer: Only one spray?
Chris: No. You spray twice about two or three weeks apart. The first
spray kills the adults and the second spray kills any juveniles that
hatch after the adults are killed. Unfortunately the spray does not kill
the eggs.
Name the pathogen in Chriss lawn.

______________________________________________________
To what group does this pathogen belong (virus, fungus, insect)?

______________________________________________________
30
What effect does the pathogen have on the lawn?

_____________________________________________________
_____________________________________________________
_____________________________________________________
What treatment is possible for this pathogen?

_____________________________________________________
_____________________________________________________
_____________________________________________________
We now move to the back yard to look at the black spot on the lemon
tree. The spots are blackened powdery areas mainly on the underside of
leaves. A few leaves are almost totally covered in the black powdery
spots, but most have just a few small spots present.
Chris: As you can see the Black spot is not too bad at present, but I
need to do something before it gets much worse.
Interviewer: What does it do?
Chris: Black spot will cause the leaves to yellow and then drop. If
the leaves start dropping then the plant makes less food and this can
reduce the number of lemons I will get off the tree. In really bad cases
black spot can kill young plants.
Interviewer: What sort of disease is it?
Chris: Black spots a fungus.
Interviewer: What can you do about it?
Chris: I dust my tree with a fungicide powder. It kills the Black spot,
although you can not eat the fruit for about 2 weeks after you have
dusted the tree.
Name the pathogen on Chriss lemon tree.

_____________________________________________________
To what group does this pathogen belong (virus, fungus, insect)?

_____________________________________________________
What effect does the pathogen have on the lemon?

_____________________________________________________
_____________________________________________________
_____________________________________________________
31
What treatment is possible for this pathogen?

______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
32
Malaria
What causes malaria?

Malaria is a disease caused by a parasitic protozoan. There are four
different malarial parasites all of which belong to the genus Plasmodium.
These are:
Plasmodium falciparum
Plasmodium malariae
Plasmodium ovale
Plasmodium vivax
Nucleus
Plasmodium malariae.
Plasmodium spores enter erythrocytes. Over a 48 hour period (for most

types of malaria, although one type requires 72 hours) they reproduce
asexually within the erythrocytes. At the end of this time they burst the
erythrocyte and go to infect others.
33
Symptoms of the disease

The most notable symptoms are chills, fever, sweating, headache,
disorientation and delirium that occur each time the erythrocytes are
burst by the Plasmodium. These chills and fever are caused by toxins
produced by the Plasmodium and released by the bursting of the
erythrocytes.
So how often do the chills occur?
If you read the previous section on what Plasmodium does to the human
body carefully, you would have probably already worked out that these
chills happen at 48 hour (in one case 72 hour) intervals.
How is malaria transmitted?

The parasites that cause malaria were observed by Laveran in 1880.
The identification of the parasite did not solve the major problem - how
was malaria transmitted from person to person?
The research concentrated on a search for the method of transmission.
If it was possible to work out how malaria was spread then it was
possible to stop people from getting (contracting) the disease.
Preventing a person from contracting the disease was better than treating
those that had the disease. If it were possible to stop people getting the
disease then the problem of malaria would have been solved.
The work of Ronald Ross

Over a period of several years in the 1890s Ross researched the
transmission of malaria. His discovery of how malaria was transmitted
was the result of numerous pieces of research. Each piece of research
gave a clue and from that clue he was able to develop his next line of
enquiry.
Here is the evidence in the order of collection by Ross.
34
Mosquitoes were common in all areas where malaria was present.
Malaria could not be transmitted by ingestion. Mosquitoes that had

bitten a human with malaria were crushed into water and fed to
healthy humans. The healthy humans did not contract malaria.
After biting a bird infected with malaria, the mosquito developed

cysts in the wall of its stomach.
The cysts in the mosquitoes stomach burst releasing tiny threads (the
Plasmodium). These threads migrated to the salivary glands of the
mosquito.
Mosquitoes transmitted malaria to birds by their bite. Mosquitoes

that had bitten a bird with malaria were kept several days (to allow
the cysts in the stomach to grow and burst). The mosquitoes were
then allowed to bite healthy birds. The healthy birds developed
malaria.
When a mosquito bites, saliva enters the blood stream of the organism
being bitten. The saliva contains a chemical that prevents coagulation of
blood - a very important adaptation for species of blood sucking insects
such as the Anopholes mosquito. If Plasmodium is in the mosquitoes
salivary glands then malaria will be transmitted.
Rosss work was very important, but it did not solve the problem fully.
Ross had done most of his research on birds. The next important step
was to apply the research to humans.
The work of Giovanni Grassi

Grassi showed that human malaria is transmitted in the same manner as
malaria in birds. Most importantly he identified the particular mosquito
responsible for transmitting the disease to humans.
Grassi got numerous types of mosquitoes and allowed them to bite
people with malaria (a group of volunteers). The same mosquitoes were
then allowed to bite non-infected volunteers (being a volunteer for
medical research has its down days).
Grassi found that only the mosquito Anopheles claviger transmitted the
disease.
The life cycle of Plasmodium

Much of the work on the Plasmodium life cycle comes from the work of
Ross. The role of the mosquito in the life cycle is as intermediate host
and as a vector.
35
Sex cells
mature and fertilise.
Fertilised sex cells form
zygote which encysts on
stomach wall of mosquito.
Zygote matures and

produces sporozoites
(able to reproduce asexually)
Cyst bursts and sporozoites

move to salivary glands.
Mosquito removes blood

from person with malaria.
Cells capable of becoming
plasmodium sex cells are
included in the blood.
Mosquito bites human

and injects sporozoites
with saliva.
Cells capable of becoming
male or female gametes
produced.
Sporozoites enter red blood
cells and reproduce asexually.
Red cells burst at regular intevals.
Life cycle of malaria.
There are a couple of points that may require clarification in the figure
above. These are explained below.
Sporozoites
A spore is used by plants or animals for asexual reproduction. They are
generated by mitosis from the parent organism and have the same
number of chromosomes as the parent.
Spores grow into a new individual without the need for fertilisation to
occur. An asexual phase is common in many life cycles.
To distinguish between the spores of plants and animals, zoologists use
suffixes to show the difference. A sporozoite is an animal spore and a
sporophyte is a plant spore.
Gametes
Gametes are sex cells. They have half the number of chromosomes of
the parent. Fertilisation is required before most gametes can form a
zygote (a fertilised egg). Fertilisation results in an individual with the
same number of chromosomes as the parents.
Cyst
A protective coat formed about an organism.
36
Treatment and control of malaria

Treatment and control of a disease are two different things. Treatment is
aimed at the disease itself. Those with the disease are treated to alleviate
symptoms or to kill the pathogen. Control refers to measures that stop
the spread of the disease. For example, quarantine is a control measure.
Treatment of malaria
Malaria is treated by administering quinine. Currently visitors to
countries that still have malaria take quinine tablets during their visit.
They also need to take the tablets for a period of weeks before and after
their trip.
Control of malaria
Malaria control removes the vector (the mosquito). This prevents the
disease spreading. Measures include draining swamps (mosquito
breeding sites) and spraying insecticides. Have another careful look at
the malaria life cycle above. You will see that by removing the mosquito
that the disease cannot spread.
Lets see how well you have understood the section on malaria. Here is a
past HSC question which you can answer using malaria as your example.
Use your own paper.
Extract from 2 Unit Biology HSC Examination Paper 1996, Section C.
Question 20. Board of Studies, NSW.
Diseases may be caused by pathogenic micro-organisms.

1
Name such a disease.
Describe the route(s) of entry of the pathogenic micro-organism into

the host.
Describe the role of the environment in the transmission of the

pathogenic micro-organism.
Describe the effect of the pathogenic micro-organism on the host.
Describe any possible methods of control.
Check your answers.

Do Exercise 2.5. Malaria
37
Microflora
A large variety and number of micro-organisms live within the human

body. About 15% of your body weight consists of bacteria living in your
body. The majority of these live in the intestines, colon and mouth.
Some of these micro-organisms provide important services such as those
that provide vitamins that are used by the human body.
The majority of the micro-organisms living in the human digestive
system are bacteria. Collectively we refer to these bacteria as microflora.
Think about the following questions and jot down some answers before
reading further. You will probably be able to work out the answers by
thinking about material you have already studied elsewhere in this course.
1
Bacteria are currently classified within the procaryotes, yet we refer

to the bacteria in the human gut as microflora. The word flora refers
to plants, which are eucaryotes. Can you explain this apparent
contradiction?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
After a course of antibiotics, many doctors recommend that patients

include a little yoghurt in their diet for a few days after the last
antibiotic has been taken. Why?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
38
Microflora imbalance
Although the presence of bacteria can be beneficial to humans, too many
or two few of these bacteria can result in disease symptoms. An
imbalance of gut microflora can result in disease.
Microflora imbalance can cause symptoms such as diarrhoea,
constipation, malabsorption of nutrients by the intestine and imbalances
in the chemicals found in bile salts.
To counter an imbalance of microflora many products containing
acidophilus bacteria are available in the form of drinks and yogurts.
Malabsorption
Malabsorption means not absorbed or not absorbed correctly. The
intestine absorbs soluble material derived from the digestion of passing
food. If this absorption process is disturbed, then some nutrients will not
be absorbed and digestive juices will be altered. This can result in
disease symptoms eg. Crohns disease, radiation enteritis and
gastroenteritis.
The proximal part of the small intestine (the section of intestine
immediately after the stomach) usually has much lower quantities of
bacteria than found further down the intestine. There are three main
reasons for such low numbers of bacteria in the proximal part of the
intestine.
Acid, in the stomach, kills many bacteria so the digesting food in the
upper intestine is usually very low in bacteria numbers.
Peristalsis removes most of the bacteria.
Immunoglobulans (chemicals) secreted in this part of the intestine

kill bacteria.
The balance of microflora in the proximal intestine is achieved by very

low numbers of bacteria.
How does an imbalance develop?
If peristalsis is reduced or food with higher than normal bacterial levels is
consumed then additional bacteria can develop in the proximal intestine.
The bacteria can become so large in number that they can interfere with
the bile salts (effectively breaking down bile salts and releasing an excess
of bile acids). The alteration of the bile salts means that the bile no
longer functions correctly.
39
Can you remember from your previous studies in biology where bile is
produced? Better yet can you remember what part bile plays in
digestion?
If you have forgotten that bile is produced by the liver and assists the
digestion of fats by breaking the fats into smaller droplets then it may be
a good time to review your earlier work in this course.
In other cases bacteria use the vitamin B12 in the intestine leading to
insufficient B12 being absorbed by the human body.
1
Name one disease that results from an imbalance of microflora in

humans. ______________________________________________
Briefly outline one way a microflora imbalance can occur.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.

This activity is optional.
If you were studying this subject within a classroom your teacher would
probably have asked you to do your own research on diseases caused by
microflora imbalance or have had a local doctor as a guest in your lesson.
You might like to pursue these diseases further by interviewing your own
guest expert.
Make contact with your local doctor. You now have an expert at your
disposal (well, for at least 10 minutes) that you can interview to get
additional information.
You could ask your doctor to:
name some of the diseases that she/he has seen locally that result
from a microflora imbalance
outline the causes of one or two of these diseases and explain what
treatment is used. For example, when bacteria numbers exceed
normal amounts in the proximal intestine antibiotics may be
prescribed to kill the bacteria.
give you any pamphlets they may have about any of these diseases.
If you prefer not to visit your local doctor you could always write to one
of the doctors that provide free advice in many of the popular magazines
and papers.
40
Antibiotics
Most people at some time in their life have taken a course of antibiotics
to fight infections. When you take them you probably dont realise how
they have revolutionised modern medicine. Before the work of Fleming
in 1928, many people died of simple infections.
Antibiotics are drugs that prevent bacterial growth. They are usually
secreted by other micro-organisms to destroy competing bacteria. Since
Flemings time there have been a range of antibiotics developed.
Antibiotics work by several methods including the break down of the
membrane of bacteria and interaction with the metabolism of the
bacteria. Scientists have been able to synthesise new antibiotic
chemicals, some of which are broad spectrum antibiotics that kill a wide
range of bacteria.
This story sounds hopeful for the future of fighting disease but
unfortunately many bacteria have developed resistance to antibiotics.
This has been made possible by the overuse of antibiotics and
disinfectants. When an antibiotic kills bacteria there may be one or two
individual bacteria that have a natural resistance to the antibiotic.
Staphylococcus aurea (golden staph infection). Notice that some of the cells
are dividing. Australian Key Centre for Microscopy.
41
These individuals will be able to multiply without competing with other

bacteria that have been killed by the antibiotic. The result is strains of
bacteria that are resistant to antibiotics. These resistant bacteria have
been labelled super-bugs. The strongest antibiotic we have is
vancomycin. Staphylococcus aurea (golden staph infection) now has a
strain that is vancomycin resistant leaving us with no defence against this
strain.
The overuse of antibiotics and disinfectants is increasing the chance of
producing more super-bugs. There has been an increase in the use of
antibiotics in farm animals especially poultry and in the use of household
cleaning products that have an antibiotic effect.
Do Exercise 2.6. Antibiotics
42
Quarantine
The Concise Macquarie dictionary defines quarantine as:

1
a strict isolation designed to prevent the spread of disease.
a period, originally forty days, of detention or isolation imposed

upon ships, persons, etc., on arrival at a port or place, when liable
or suspected to be bringing some infectious or contagious disease.
a system of measures maintained by public authority at ports, on

frontiers, for preventing the spread of disease.
Australia has been in an ideal position to use quarantine as a method of

preventing the occurrence of diseases. Our isolation from other
continents means that all diseases must cross oceans to reach our shores.
By controlling the points of entry into the country then diseases can be
excluded.
Some quarantine measures

Australia has quarantine measures for both material entering the country
and for items crossing state borders or regions within the country. For
example animals and plants entering the country from some countries are
isolated for a period to ensure that they do not develop diseases after
arriving into the country.
Quarantine for the outside world

It is possible that an apparently healthy animal or plant may be
incubating a disease so the plant or animal is detained long enough for
any potential symptoms to develop. If the organism does not develop
symptoms then it can be allowed into the country. At one time all plants
and animals (including humans) were placed into quarantine after arrival
in Australia.
43
Quarantine measures often work hand-in-hand with inoculation

programs. Organisms entering the country require certificates to show
they have been inoculated and, in the case of plants, sprayed for various
diseases.
You may like to visit the Australian Quarantine Information Service on their
web site to find to the latest details of quarantine measures in Australia.
The site lists many diseases and pests quarantined from entering Australia
and outlines the industries/ species affected.
This site can be accessed at: http://www.lmpc.edu.au/science
Here are some pests/ diseases affecting species/ industries that are
targeted by the Australian Quarantine Service. The information was
obtained from the website, June 2000.
Pest/ disease
Species/ industry affected
Japanese encephalitis
horses,pigs, humans
foot and mouth disease
cattle, sheep, goats and pigs
Newcastle disease
birds
swine influenza
pigs
tracheal mite
bees
Quarantine within Australia

Within Australia, restrictions apply to the transport of fruit, vegetables
and livestock.
Fruit and vegetables are not allowed to be carried into the Murrumbidgee
Irrigation Area (MIA) to prevent the importation of fruit fly from other
areas. Bins are placed at the side of the road for motorists to dispose fruit
and vegetables before entering the MIA.
Sugar cane is also a restricted import. Cane may not be taken from
Queensland into New South Wales to prevent the distribution of cane
diseases.
Grapevines are also restricted to prevent the movement of diseases from
one grape growing area to another.
44
In this exercise you will read a number of extracts from Review of

Australian Quarantine Arrangements (1977). The document was produced
as a result of a government review of Australian Quarantine arrangements.
Read each of the extracts and then answer the questions that follow.
As has already been outlined, the human side of quarantine has
declined considerably in importance as the major diseases of the
world have been brought under control or almost eliminated. This has
allowed quarantine controls to be relaxed and our observations
suggest that controls could be relaxed even further, at some saving of
resources used.
From pp 101 Review of Australian Quarantine Arrangements (1977) Australian
Government Publishing Service.
At the turn of the century, people entering Australia were held at

quarantine stations to be observed for signs of disease. Why has this
practice been discontinued?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Under quarantine legislation, the captain of an aircraft is required to
notify the quarantine officer at the airport of entry at least three hours
before his expected arrival if there is any sickness on board and
whether the aircraft is carrying any animals or birds.
On arrival, a quarantine officer boards the aircraft, enquires from the
captain whether there are any ill passengers and collects certain
required documentation signed by the captain.
Other quarantine staff also board the aircraft and spray the passenger
compartment with insecticide.
From pp 55 Review of Australian Quarantine Arrangements (1977) Australian

Government Publishing Service.
Why do you think the quarantine officer asks if there are any sick
passengers and why is the aircraft sprayed with insecticide?
_____________________________________________________
_____________________________________________________
_____________________________________________________
45
If you have travelled overseas recently you will have noticed that
aircraft are no longer sprayed by quarantine officials. Can you think
of any reasons why the practice of spraying may have been
discontinued?
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.

Many diseases are no longer considered a threat as they have been
controlled or practically eliminated over the past 100 years. These
include bubonic plague, yellow fever, cholera and typhoid.
In the additional resources section of this part there are some fact sheets
from AQIS (Australian Quarantine Information Service) reproduced with
permission. Read these and then do Exercise 2.7: Quarantine.
46
Quarantine fact sheets (reproduced with permission of AQIS)
Fruit fly free areas

'Fruit flies damage many types of ripe fruit and vegetables by using the fruit or
vegetables as a breeding site.
The fruit fly female lays eggs and deposits bacteria in the fruit. The eggs hatch
and the developing larvae feed on the fruit.
These are true fruit flies and must not be mistaken for the small Vinegar
flies flies that are often seen around fruit bowls and ripe or rotting fruit.
Fruit flies attack melons, citrus fruit like oranges and lemons, apples, mangoes,
tomatoes, capsicums, wild and ornamental fruits. They prefer soft fleshy fruit
and vegetables.
There are more than 100 different types of fruit fly in Australia, but only about
eight of them cause problems for farmers. There are also many types of fruit fly
in other countries around the world, including in neighbouring countries such as
Papua New Guinea and Indonesia.
If an area has fruit fly, it is placed under strict quarantine and farmers cannot
sell their fruit without treating for fruit flies. Treatments for fruit flies are very
expensive and cost the growers a lot of money. The rotten fruit must be
destroyed so the pest does not spread.
Overseas countries will not buy our fruit or vegetables unless they are sure there
are no live fruit flies in the produce.
There are four farming areas in Australia that have fruit fly area freedom
status. This means the area has passed a lot of tests and is free from fruit fly.
47
Other countries will accept fruit and vegetables from farms in these special
areas.
This fact sheet will give you some information about fruit flies and tell you how
some places are able to get area freedom status. Australian fruit flies
Australia, our main worries are the Queensland fruit fly and the Mediterranean
fruit fly. The Queensland fruit fly is found along the east coast of Australia,
from the northern tip of Queensland down as far as the East Gippsland area of
Victoria. It is native to Australia.
The Mediterranean fruit fly is an exotic species that is known all over the
world. The fly was first seen here early in the 20th century in Western Australia.
Now it is found in Perth and in summer, it can travel all the way down the south
west coast of Western Australia as far as Albany.
Exotic fruit flies
The Melon fruit fly is found in Indonesia and Papua New Guinea. It is a very
dangerous pest that could destroy our crops. It likes vegetables and fruits such
as cucumbers, gourds, pumpkins, squash, beans, watermelon and tomatoes.
The Oriental fruit fly is another very destructive pest found in Indonesia and
Papua New Guinea. This fly attacks avocadoes, mangoes, citrus fruit, guava,
paw paw or papaya, bananas, tomatoes, passionfruit, pineapples, peaches, pears,
apricots, figs and coffee plants.
The Papaya fruit fly is another dangerous fruit fly. Although it is not native to
Australia, it has been found in northern Queensland and the Torres Strait
Islands. The most recent outbreak was in Cairns in 1995, but this fly was
successfully eradicated by early 1999.
How do we stop fruit fly from spreading?
AQIS and the state agricultural departments work very hard to stop fruit fly
from spreading around Australia. There area number of ways to control this
problem.
First, you may not bring fresh fruit or vegetables into Australia without a
special permit. Even if a piece of fruit seems healthy to you, it may have fruit
fly eggs inside. Any fruit or vegetables brought to Australia without the special
permit will be taken away at the airport or seaport and destroyed. The AQIS
detector dogs have the important job of making sure people obey the quarantine
laws.
Some of you may have travelled by car, bus or train across one of our state
borders. If fruit fly is a problem in that area, you will be asked to put all fruit
and vegetables in the special quarantine bins at the border. This stops fruit flies
from hitching a ride with you! Border officers destroy any fruit and vegetables
placed in the bins.
48
Fruit flies are small insects about the size of a house fly and they sometimes
manage to sneak into Australia or across state borders. AQIS sets special traps
near ports and airports or in areas where fruit flies have been found in the past
to monitor fruit fly presence. In Australia, AQIS has fruit fly traps throughout
all the farming areas including northern Queensland and in the Torres Strait
Islands. There are also regular surveys for fruit fly in Papua New Guinea and in
Irian Jaya.
The state agricultural departments monitor these traps on behalf of AQIS and
these traps and monitoring surveys help AQIS and State agricultural department
officers find out very quickly if fruit flies have sneaked into the area.
What happens when fruit flies are found in farming areas?
When fruit flies are found, all the farmers in the area are told immediately.
Special baits are laid to attract the flies. The baits attract both male and female
flies and kill them. If there is a big area to cover, the baits may be dropped
fromhelicopters.
Flies live for about four weeks, depending on how warm or cold the temperature
is. Setting traps for male flies not only kills the flies we can see, it also stops the
flies from breeding and spreading across the area.
Setting traps and baiting crops is expensive. But it stops the flies from
spreading. If fruit flies attack an orchard or farm, the farmer has to treat the crop
before it is allowed to move off the property and that can cost the industry
millions of dollars.
An outbreak in Cairns in northern Queensland caused huge problems for
farmers in the area and stopped them from sending their crops overseas and
interstate.
What is area freedom status?
Area freedom status means a place declared free from pests under Australian
and international laws. The United Nations Food and Agriculture Organisation
sets the standards for these areas. Any country that has signed the FAOs
International Plant Protection Convention will consider accepting crops from
these areas under the standards. About 90countries, including Australia, New
Zealand, the United States and many countries in Asia have signed this
convention.
Before acceptance of area freedom, each potential importing country assesses
the fruit fly trapping and monitoring information from the exporting country
requesting area freedom. Australia can use area freedom to open up new
markets for Australian produce in countries that do not want fruit flies.
Australia may also accept fruit and vegetables from places with area freedom
status in other countries.
There are many tests and checks before an area is given area freedom status. In
Australia, we have four farming areas with this special status for fruit flies.
49
They are the Riverina area of New South Wales, the Sunraysia area on the NSW
and Victorian border, the Riverlands area in South Australia and the island of
Tasmania.
Australian areas of freedom from fruit fly.
From time to time, officials from other countries visit Australia to inspect these
places with area freedom status. They check our fruit fly trapping and
monitoring programs. AQIS and the State agricultural departments can then
issuespecial phytosanitary certificates that show our produce is free from fruit
flies for international and interstate trade.
What can you do to help?
You can help keep Australia free from fruit fly and other pests in a number of
ways. If you are travelling across a state border or arriving at an Australian
airport or seaport, put fruit or vegetables in the special yellow quarantine bins.
Dontcarry fruit or vegetables from one country or state to another. Remind
your parents and friends too. If you find maggots in your fruit in South
Australia, Victoria, New South Wales or Tasmania, get in touch with the nearest
office of the state agricultural department.
50
Rabies alert!
'Rabies is a fatal disease which can kill warm-blooded animals including
humans. Australia doesnt have rabies - if it were to become established in our
wildlife it would be practically impossible to eradicate.
All animals imported into Australia are subject to strict quarantine regulations
which must be obeyed to keep Australia free of rabies.
If rabies was introduced into Australia, our pets would all have to be vaccinated,
theyd have to be walked on a leash and locked up at night so they couldnt
wander and come into contact with stray
Rabies is caused by a lyssavirus which attacks the central nervous system (brain
and spinal cord) and then spreads to the salivary glands and other organs of the
body.
Rabies is usually spread by the bite of an infected animal such as a dog, cat or
fox. The virus can also be spread if one of these body fluids touches broken skin
or a mucous membrane (in the mouth, nose, or eyes).
Humans are at risk when saliva from a rabid animal enters the body through a
bite or an open wound such as a fresh cut or scratch. Rabies is almost invariably
fatal.
Rabies usually causes changes in an animals behaviour or temperament.
Animals that are normally shy can become very friendly or aggressive.
There are two types of rabies. Furious rabies makes the animal foam and drool
at the mouth and become unpredictable. Animals with this type of rabies may
become vicious and attack without warning.
Dogs with furious rabies become unusually restless, seldom lying or sitting in
one place for more a short time, and if confined move around ceaselessly. The
pupils dilate and the animal sometimes squints and may snap at imaginary
objects.
An important sign of the disease is that the animal assumes a watchful, puzzled
or apprehensive look. The animal becomes progressively uncoordinated and
eventually paralysed and usually dies within four or five days.
The second type of rabies is dumb rabies. In the dumb form, the animal
remains quiet, is not irritable and bites only when provoked. The watchful,
apprehensive look in the eyes is also present.
51
Dumb rabies causes paralysis followed by drooling of saliva and death. The
animal is unable to eat but tries hard to drink water.
The incubation period is variable in all species and is influenced by such factors
as the strain of the virus, the amount of virus injected by the animal bite, and the
amount of nerves at the bite site.
Symptoms may appear as early as 10 days or as long as 6 months, or (rarely)
even longer.
After the onset of clinical signs, death occurs within 10 days. The only hope for
those who are bitten by a rabid animal is a course of vaccinations before
symptoms appear.
Treatment for rabies requires prompt scrubbing of the bite site and people who
have never had rabies shots are given six shots over the course of a month.
One shot is antibodies to fight the virus, and the rest are vaccinations to ensure
long-lasting protection against the disease.
To work best, the shots should begin as soon after the bite or scratch as
possible. However, if the animal has been caught and can be tested for rabies,
some doctors wait for the test results to see if the shots are really needed.
Although all warm-blooded animals are susceptible to rabies, comparatively
few species are good vectors of rabies and even fewer are reservoir hosts. A
reservoir host is an animal that is capable of harbouring, without injury to
themselves, pathogenic (disease producing) micro-organisms which may at any
time be transmitted to another animal and produce the disease.
The main reservoir species are members of the dog family, the skunk family,
raccoons and bats.
Dogs and cats may enter Australia from approved countries where rabies is
absent or well-controlled and must serve a minimum post-arrival quarantine
period of 30 days.
Pets from South Africa where dog-mediated rabies is endemic (present in that
country at all times) must serve a minimum post-arrival quarantine period of
120 days.
Before arriving in Australia, all dogs and cats must be properly vaccinated
against rabies using an approved inactivated rabies vaccine.
When an animal is given an inactivated or killed vaccine the body develops
antibodies to protect it if the animal is later exposed to that disease.
The vaccine does not give the animal the actual rabies disease and it therefore
cannot bite another animal and transfer the disease. This vaccination, called the
primo-vaccination (first vaccination given), can be given to the animal when it
is three months old, with a booster shot being given every 12 months of the
animals life.
52
To ensure that the rabies vaccination(s) is effective, blood must be drawn from
the animal. That blood sample must undergo a rabies neutralising antibody titre
test with satisfactory results.
The level of rabies antibodies must be sufficiently high in the blood to prevent
the animal from contracting the rabies infection if exposed to it, and potentially
spreading rabies to other animals.
Cats and dogs from South Africa will be subjected to a second (i.e.
confirmatory) rabies neutralising antibody titration test while the dog is in postarrival quarantine in Australia.
If there is insufficient rabies antibody in the dogs serum it will be required to
remain in quarantine for up to one hundred and eighty (180) days at the
importers expense.
URL:http://www.aqis.gov.au/docs/schools/fs/rabies.htm
Disclaimer Copyright 2000 Commonwealth of Australia Privacy Statement
AQIS HOME
53
Kochs postulates
Cut out the strips and match the steps with the procedure. Paste onto
another sheet of paper
The newly diseased organisms must then be sampled with the
suspect organism present. The suspect organism must be living
within the diseased organisms.
A pure culture of the organism suspected of causing the disease

must be obtained. This can be a difficult process because all other
organisms must be excluded from the sample.
Healthy organisms without the disease must then be inoculated

with the suspect organism. The pure culture is used to provide the
material for the inoculation.
Step 2 - A pure culture is required.
Step 3 - A healthy organism must be inoculated with the pure

culture and the potential host must develop the same symptoms.
Step 1 - The suspect organism must be present in infected

organisms.
Step 4 - The suspect organism must be re-isolated, re-cultured and

identified.
The organism suspected of causing the disease must be present in

all organisms that have the disease.
54
Suggested answers
Micro-organisms cause decay

1
No bacteria or moulds were visible when the tin was opened. When
the control (the second tin that was only opened at the end of the
experiment) was opened there was no sign of bacteria or mould in
that tin either.
From bacteria and spores in the air.
Once opened, bacteria carried in the air can enter the contents of the
tin. Decay will begin once opened.
Pasteur
1
The experimental flask stopped micro-organisms and their spores

from entering. The control allowed micro-organisms and their spores
to enter. All other factors were the same for both flasks.
Both flasks allowed air to enter, but only the control allowed both air
and micro-organisms (and their spores) to enter. When air alone
could enter the broth did not spoil. Only when the air contained
micro-organisms and spores did the broth spoil. If micro-organisms
were spontaneously generated from air then both flasks should have
contained micro-organisms at the end of the experiment.
In the baked bean experiment, air and micro-organisms were allowed

into the opened tin. Air and micro-organisms were not allowed into
the closed tin during the experiment. This is significant because it is
not possible to separate any effect of the micro-organisms from any
effect of the air.
In Pasteurs experiment air was allowed into both flasks and the only
difference was the presence of micro-organisms and their spores.
Our baked bean experiment does not discount the possibility that
bacteria spontaneously generate from air.
55
Past HSC questions on Kochs postulates

1
A good presentation tip is to list your three answers so that it is clear

to the examiner that you have answered all three.
a) The micro-organism must be present in all diseased individuals.
b) If healthy individuals are inoculated with a pure culture of the
micro-organism then they must contract the disease.
c) The micro-organism must be found living within the newly
diseased (inoculated) individuals.
You would get one mark for each of the two points you make here.
a) Healthy individuals inoculated with a pure strain of the bacteria
would become sick.
b) The bacteria would be present in sick individuals after
inoculation.
Koch would have :

a) determined if all infected individuals have the bacteria present.
b) inoculated healthy individuals with the pure bacterial culture.
c) determined if inoculated individuals contracted the disease.
d) checked that the bacteria was present in all inoculated
individuals that contracted the disease.
Prion disease
1
Two types of prion diseases include Creutzfeldt-Jakob disease (CJD)

and Kuru disease.
Prions do not respond to antibiotics or vaccination programs.
Abnormal prion protein causes prion diseases. The abnormal prion

protein destroys brain cells.
Statistically you could expect two cases of prion disease in a city of

two million as there is a one in a million chance of a prion disease.
Viral disease
1
56
Ross River fever is caused by a viral pathogen. Symptoms include

headache, rash, nausea, sore joints and muscles and lethargy. There
is no treatment for the disease, only treatment for the symptoms
eg. aspirin for pain/inflammation relief and sore joints.
Arguments for virus to be

considered living
Arguments for virus to be

considered non-living
contain genetic material
are not cellular
can replicate to make virus identical to

parent virus
can be crystallised
have a recognisable morphology

(appearance)
cannot assimilate or reproduce

independently of a host cell
Plant pathogen practical

1
African black beetle.
African black beetles are insects.
African black beetles kill lawns by eating the roots of grasses.
Treatment consists of poisoning the pathogen.
Black spot
Fungus
Leaf drop. This would reduce the amount of photosynthesis going

on in the tree. It would reduce the amount of carbohydrate that the
plant could produce.
Treat the pathogen with fungicide
Malaria
1
Malaria is a disease caused by a pathogenic micro-organism.
The micro-organims enters the blood stream after being injected by a

mosquito bite.
The environment required for malaria is both mosquitoes and

malaria sufferers for the disease to be transmitted.
The host may experience both shivering and fever.
Draining swamps and insecticides reduces mosquito population

numbers. This is a method of control for malaria.
Microflora
1
There have been many different classification schemes over time.

Currently there are many different classification schemes accepted
by the scientific community. In some classification schemes as late
as the mid 1970s, bacteria were classified as plants.
57
As a result, it was common to refer to bacteria as microflora. Even

though we no longer recognise bacteria as being plants, it is still
common in medical circles to refer to them as microflora. Old habits
die hard and it is a feature of scientific study that you will encounter
both old and new ideas being expressed at the same point in time.
Antibiotics kill bacteria. Many of the gut bacteria that provide

useful products such as vitamins are killed by antibiotics. By eating
yoghurt (which is made by bacterial culture) some of these bacterial
colonies can be re-established.
How does an imbalance develop?

1
Crohns disease or Radiation enteritis. You could also have

answered gastroenteritis.
Reduced peristalsis (the most common cause) or contaminated food.
Quarantine within Australia
58
Many human diseases have been eradicated or contained. Diseases

for which there were previously no preventative measures now have
vaccines and tablets available to prevent infection. The entry of
immunised passengers poses no risk. At the turn of the century no
such protection was available so every passenger was potentially the
carrier of a deadly disease.
Insecticide is sprayed to eliminate potential insect vectors of disease

(see the section on malaria for details). The identification of sick
passengers is to locate potential sources of infection. Sick
passengers are medically assessed before being allowed to enter the
country.
Many of the diseases previously transmitted by insects have either

been eradicated or isolated to just small areas. The risk of infection
is greatly reduced.
Exercises Part 2
Name: _________________________________
Exercise 2.1: Pasteur

Describe Pasteurs role in identifying the cause of disease. To do this
describe what was a commonly held belief before Pasteurs experiment.
Then describe his classic experiment and say what it showed.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 2.2:The work of Koch

a)
List Kochs postulates and then explain how they can be used to
identify the organism that causes a disease.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
59
b) Using Pasteur or Koch as an example, describe the circumstances

which resulted in a named organism being identified as the cause of
a disease.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Exercise 2.3: Types of infectious diseases

Fill in the table below. The first is done for you.
Type of pathogen
Animal disease
Plant disease
prion
CJD, Kuru, mad cow disease
unknown
virus
bacteria
protozoan
fungi
macro-parasites
Exercise 2.4: Plant pathogen practical

a)
Name the three plant pathogens that you studied.

______________________________________________________
______________________________________________________
______________________________________________________
60
b) Draw or place photographs of pathogens in the space below.
c)
Name the general group of each pathogen.

_____________________________________________________
_____________________________________________________
_____________________________________________________
d) (Optional) Name the treatment for each pathogen.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
61
Exercise 2.5: Malaria

a)
Malaria is a disease transmitted by an insect vector, the Anopheles

mosquito. Describe the life cycle of the mosquito using a diagram if
possible. Explain how this disease is controlled or prevented.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) You have examined an infectious disease. Name that disease and

then complete the description as outlined below. (Hint; you could
use malaria as your example)
i)
Name _____________________________________________
ii) Cause _____________________________________________

iii) Transmission _______________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
62
iv) Host response

_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
v) Major symptoms
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
vi) Treatment
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
vii) Prevention
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
viii)Control
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
63
Exercise 2.6: Antibiotics

a)
What is the role of antibiotics in fighting disease?

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) Describe how bacteria have become resistant to antibiotics.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Exercise 2.7: Quarantine

Australia is an island continent. Quarantine is a method used to prevent
the introduction of unwanted diseases. Discuss some of the methods of
quarantine:
a)
in Australia
b) between the regions of Australia.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
64
Biology
HSC Course
Stage 6

Part 3: The first two lines of defence
Contents
Introduction .............................................................................. 2
The three lines of defence......................................................... 3
The first line of defence ...............................................................................4
Skin ......................................................................................................4
Mucous membranes ............................................................................6
Cilia ......................................................................................................6
Chemical barriers ................................................................................7
Other body secretions .........................................................................8
The second line of defence ......................................................................10

Inflammation response.......................................................................10
Phagocytosis ......................................................................................11
Macrophages......................................................................................12
The lymph system ..............................................................................13
Cell death to seal off pathogens ........................................................15
Exercises Part 3 ................................................................... 19
Introduction
In your daily life your body is continually being bombarded with

diseases. Luckily you are unaware of this except when a pathogen gets
through your defence systems and you feel the symptoms of a disease.
You may have noticed that not everyone gets a disease in a family and
that when you are run down you are more likely to pick up an infection.
This is because your ability to withstand disease has been reduced.
identify first line defence barriers to prevent entry of pathogens in

humans:
skin
mucous membranes
cilia
chemical barriers
other body secretions
identify second line defence adaptations, including:
inflammation response
phagocytosis
macrophage
lymph system
cell death to seal off pathogen.

The three lines of defence
There are three lines of defence against disease. The three lines of
defence are:
barriers (unbroken skin, mucous membranes, cilia, chemical barriers

and other secretions)
adaptations to fight disease (inflammation response, phagocytosis,

macrophage, lymphatic system and cell death to seal off a pathogen
the immune system.
The first two lines of defence will be covered in this part of the module.
The immune system is examined in Part 4 of this unit. Together the three
lines of defence form an impressive defence against pathogens.
Do Exercise 3.1: The three lines of defence.
The first line of defence
The first line of defence provides barriers to stop pathogens entering the
body. For most pathogens, if they can not enter the body then they can
not cause disease. The first lines of defence include unbroken skin,
mucous membranes, cilia, chemical barriers and other body secretions.
Skin
Skin is a body organ. It has three main regions - epidermis, dermis and
subcutaneous layer.
opening of
sweat gland
hair
sebaceous gland opening
sebaceous
gland
fat cells
epidermis
muscle that
pulls on the hair
dermis
hair follicle
hair bulb
subcutaneous
layer
nerve fibre vein
artery
Cross-section view of the skin.
The stratum
The epidermis consists of a number of layers. The outer layer is made up
of dead cells while the remaining layers are made up of living cells.
The outermost layer of the epidermis is called the stratum corneum.
The stratum corneum provides a poor environment for the growth of
pathogens because it is dry and the cells present are dead. The dead cells
of the stratum corneum are sloughed off and any pathogens on the dead
skin cells are lost in the process. Active division in the deeper layers of
the epidermis produce cells that eventually take the place of cells that are
sloughed off the stratum corneum.
From what you have read about the stratum corneum so far, why do you
think bathing is often seen as important for maintaining good health?
_________________________________________________________
_________________________________________________________
Check your answer.
Sebaceous glands
Sebaceous (oil) glands can be found in the dermal layer of the skin.
Look at the diagram of the skin and find a sebaceous gland.
Sebaceous glands secrete sebum (oil). Bacteria live off the secreted oil
in the hair follicle and on any areas of skin that have sebum. These
bacteria have a mutual relationship with their host. They repel many
pathogens and produce acids that make the skin an even more unfriendly
environment for pathogens.
You have come across the word mutualism in your studies of ecology.
Many of the scientific terms you learned as part of your preliminary course
are important for the understanding of material in the HSC course.
1
Define mutualism.
_____________________________________________________
_____________________________________________________
Define host.
_____________________________________________________
_____________________________________________________
Check your answers.
Mucous membranes
Epithelium is the general name given to the tissue lining the surface of a
body and the organs within the body. There are various types of
epithelium. One type of epithelium is responsible for secreting mucus.
Epithelium responsible for secreting mucus is called a mucous
membrane.
Mucus
Mucus is a sticky and often clear fluid. If you blow your nose you can
get a sample of mucus on your handkerchief!
There are many places within the body where mucus is produced. For
example, in the nose, lungs, reproductive tract and intestines. Mucus has
two main roles, lubrication and defense against pathogens.
As a lubricant, mucus allows substances to pass more easily. In the
intestines, for instance, mucus lubricates the intestinal walls to allow
better movement of digesting food.
Elsewhere the mucus also has a disease-fighting role eg. in the nasal
passages and lungs.
Mucus is a viscous substance that is secreted on the interior linings of
organs. Pathogens can get caught in the viscous mucus. Once caught
they are prevented from reaching the surface of the organ where they
could cause infection. This process is assisted by antibodies in the
mucus that kill many pathogens. You will discuss the role of antibodies
when you look at the third line of defense.
Cilia
A cilium (plural cilia) is an extension of the protoplasm from the walls of
some cells. They are minute hairs that project from the cells lining the
mucous membrane. You have previously seen cilia as parts of
unicellular organisms where they were responsible for movement.
Cilia in multicellular organisms

Multicellular organisms can also have cilia. The cilia in multicellular
organisms are produced by ciliated epithelium. Just as one type of
epithelium produces mucus, another type has cilia.
In multicellular organisms cilia are used for the movement of particles
within the organism. For example, cilia are used to remove particles of
dust that collect in the lungs.
One of the side effects of smoking is damage to the ciliated epithelium of
the lungs. This prevents the cilia from removing the small particles that
collect in the lungs. A smokers cough results from the need to cough up
the particles that cannot be removed by the damaged cilia.
Cilia as a defense against disease

As you already know, pathogens get trapped in mucus. The cilia in the
lungs beat to move mucus out of the lungs. In doing so the cilia remove
pathogens. The mucus removed from the lungs is either swallowed or
coughed out of the body.
Why do you think that spitting is considered unhealthy?
_________________________________________________________
_________________________________________________________
Check your answers.
Chemical barriers
Earlier you learned about acids produced by the bacteria living on fats
and oils on the skin. The acid produced by these bacteria is a chemical
barrier to pathogens.
The stomach also has an acid chemical barrier. The strong hydrochloric
acid released by the stomach to aid the digestion of food provides a
formidable barrier to pathogens ingested with food.
The enzyme lysozyme is stored in lysosomes. Lysosomes release the
enzyme when they come into contact with pathogens. The enzyme
destroys the pathogens with which it comes in contact. Tears, saliva and
many other body fluids contain this chemical barrier.
Other body secretions

Tears
Tears are produced by the lachrymal glands that drain into the eyes.
Tears are released when you blink and they wash the surface of the eye to
remove bacteria and dust.
Saliva
Produced by the salivary glands, saliva washes bacteria from between
teeth. Swallowed bacteria are digested and destroyed by the acid in the
stomach. Saliva also contains the digestive enzyme, salivary amylase,
which is involved in the breakdown of food, but that is another story to
be told elsewhere in this course.
Urine
The passing of urine cleanses the urinary tract. You may be surprised
that urine produced by a healthy kidney is a sterile acid fluid. If you
think about how urine is produced you will realise that it must be sterile
(unless the kidney is infected).
The kidney filters blood and the resultant wastes are stored as urine in the
bladder. The filtering process in the kidney removes liquids from the
blood (mainly water and urea) whole cells are not removed by the
filtering process. Bacteria and other unwanted pathogens are removed by
other processes. So you can see that only sterile components are
removed from the blood.
Bile and hydrochloric acid

Alkaline bile (produced in the duodenum) and hydrochloric acid
(released into the stomach) also play a part in the killing of pathogens.
The human digestive tract varies in pH along its length. Very few
organisms can survive such changes because even if they are able to
survive the low stomach pH, it is unlikely that they would survive the
alkaline pH of parts of the intestine.
What is a secretion?
_____________________________________________________
_____________________________________________________
With the aid of examples briefly outline how secretions can assist in
the bodys defence against disease.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

Do Exercise 3.2: The first line of defence.
The second line of defence
Pathogens that manage to get through the first line of defence must face
the bodys second line of defence. The second line of defence is a group
of non-specific responses to fight disease. Because the second line of
defence acts so rapidly, most pathogens are killed before major infection
of tissues can commence.
The second line of defence includes:
phagocytosis
macrophages
lymph system
cell death to seal off a pathogen.
Inflammation response
If you have ever cut yourself you may have noticed that the tissues
around the wound become hot, red, swollen and painful. This is an
example of an inflammation response.
The inflammation response allows the body to optimise disease fighting
in areas where injury has occurred to body tissue eg. at the site of a
wound in the skin.
Tissue in the area of the injury releases bradykinin. This chemical causes
mast cells to release histamines. The combination of bradykinin and
histamines cause the capillaries to swell and become more permeable.
The enlarged capillaries cause the skin reddening that you may have
noticed about a wound. The increased permeability of the capillaries
means that more white cells and macrophages can be released to attack
pathogens. You will learn more about macrophages and white cells
shortly.
10
a
Phagocytosis
A cell that can flow about another cell and engulf it is called a phagocyte.
The process of engulfing another cell by a phagocyte is called
phagocytosis. Two examples of phagocytes are neutrophils (a type of
white blood cell) and macrophages.
Leukocytes
Leukocytes are white blood cells. There are five main types of leukocyte
which include phagocytes and lymphocytes. A neutrophil is one of the
five types of leukocyte. They are manufactured in the bone marrow.
Neutrophils are phagocytes. They can ingest bacteria. Once ingested,
enzymes are added to the bacteria and they are broken down.
1.
2.
3.
Nucleus
Lysosome
Chain of
bacteria
Leukocyte
6.
Leukocyte begins to
engulf bacteria
5.
Bacteria becomes
trapped in a vacuole
4.
a
Undigested particles
removed from cell
Bacteria digested by enzymes
Lysosomes merge with the

vacuole and release enzymes
into vacuole.
The process of phagocytosis. Leucocytes engulf bacteria.
Neutrophils are found in the blood and the lymphatic system. They are
able to pass through the walls of capillaries and move into the
surrounding body tissues. This means that they can engulf bacteria and
other foreign particles both in the blood and the tissues.
11
Pathogens such as bacteria release chemicals that attract leukocytes.

Once attracted to the area the leukocytes can then perform their tasks in
the prevention of disease.
Macrophages
Besides neutrophils, other body tissues also have specialised phagocyte
cells called macrophages. Macrophages are common in the liver and
lymph glands and are able to take up foreign particles, poisons and
micro-organisms by phagocytosis.
Macrophages are more commonly involved in fighting long-term
infections while neutrophils are more commonly found fighting shortterm infections.
The reticulo-endothelial system

Macrophages and neutrophils form the reticulo-endothelial system.
Both macrophages and neutrophils engulf pathogens by phagocytosis and
both are able to move from place to place to seek our foreign particles.
The reticulo-endothelial system is part of the second line of defense
against disease. Pathogens that have managed to get through the first
line of defense are sought out and destroyed by macrophages and
neutrophils.
1
Pus surrounding a wound contains a greater proportion of white blood

cells than blood found in the veins. Explain why this is the case.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Are neutrophils the only type of white blood cell?

______________________________________________________
______________________________________________________
12
A blood test was returned to a doctor from a pathologist. The result

showed that the blood sample contained an unusually high number
of macrophages and neutrophils. How would you interpret this
result?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

Do Exercise 3.3: The second line of defence.
The lymph system

You are familiar with the circulatory system for blood from previous
studies in biology. However, you may not realise that a second, equally
important system exists the lymphatic system.
Just as blood flows through arteries, veins and capillaries, the fluid in the
lymphatic system flows through lymph vessels.
A quick review of the circulatory system

Lets see how much you can remember about the circulatory system for
blood. Each answer requires one word for the answer.
1
Name the blood vessels that carry blood away from the heart.
_____________________________________________________
Name the blood vessels that carry blood towards the heart.
_____________________________________________________
A blood vessel has muscular walls and blood flowing under high
pressure. What type of blood vessel is it?
_____________________________________________________
Name the blood vessels that go between veins and arteries.

_____________________________________________________
Check your answers.
13
When blood moves from arteries into capillaries it is under high pressure.
Because the pressure is so high blood plasma (less the proteins) is forced
through the capillary walls into the surrounding tissue. This forms the
intercellular fluid.
Intercellular fluid baths the cells of all tissues. Gases dissolved in the
intercellular fluid are exchanged with the cells. This is how waste carbon
dioxide is lost from the cells and how oxygen that was collected by the
blood in the lungs is delivered to body cells.
Intercellular fluid is eventually returned to the circulatory system by:
re-entering the capillaries close to the veins where pressure is low
entering the lymphatic system.
What the lymphatic system does

The lymphatic system:
returns intercellular fluid to the blood circulatory system
is responsible for providing part of the second line of defense against

disease
collects much of the fat absorbed from the small intestine.
Return of intercellular fluid

There are two types of lymph vessel, lymph capillaries and lymph veins.
The lymph capillaries collect the intracellular fluid and pass it to lymph
veins. These pass the fluid to a larger set of lymph veins and eventually
into two large lymph ducts which empty into veins of the blood
circulatory system near the heart.
Fighting disease
The lymphatic system:
14
filters particles such as dead cells, cell fragments and dust from the
system
is responsible for the production of the white cells (a type of

leucocyte called a lymphocyte) responsible for the immune response
(which you will study later in the third line of defence).
Cell death to seal off pathogens

Granulomas are a cluster of cells that produce a covering to seal off a
pathogen from the rest of the body. The internal cells die and are
surrounded by layers of macrophages, lymphocytes and a hard outer
covering. The cells die to seal off the pathogens and protect the rest of
the body from infection.
Do Exercise 3.4: Defence mechanisms
15
16
Suggested answers
Skin
Bathing helps to remove any pathogens that are on the skin. It assists the
natural process of losing cells from the skin.
Sebaceous glands
1
Mutualism refers to a relationship between two organisms where

both organisms benefit from the relationship. In the example above,
the bacteria benefit from the secreted oils which are a food source.
The host benefits from added protection from pathogens.
A host is an organism that provides either a source of food or shelter

for another organism.
Cilia
The mucus that is spat contains pathogens that have become trapped. If
someone else were to come into contact with the spit they could become
infected by the pathogens.
Bile and hydrochloric acid

1
Secretion is the process by which the glands of an animal release

chemicals in solution.
Secretions can be used to poison and/or flush pathogens from the

body. For example tears produced in the lachrymal glands flush
bacteria and other pathogens from the eye. Mucus is another
secretion that can trap pathogens.
17
The reticulo-endothelial system

1
Neutrophils are attracted to areas where there are foreign particles.

They would be attracted to invading microorganisms at the wound
site. You would expect to find a higher than normal number of
white cells at the site of a wound.
No. There are at least five different types of white blood cells
(leukocytes).
There is an infection within the body. This is why the phagocytes

are so high in the blood.
A quick review of the circulatory system
18
Arteries
Veins
Artery
Capillary
Exercises Part 3
Name: _________________________________
Exercise 3.1: The three lines of defence

There are three lines of defence in the human body. Name them and for
each give two examples of defence mechanisms.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 3.2: The first line of defence

The first line of defence provides barriers to stop pathogens entering the
body. For each defence mechanisms state how the barrier prevents entry
of pathogens.
Skin
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
19
Mucous membranes
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Cilia
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Chemical barriers
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Other body secretions

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
20
Exercise 3.3: The second line of defence

Once a pathogen breaks through the first line of defence the second line
of defence becomes active.
a)
What is the inflammation response?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) Below is a diagram of the reaction that is part of the second line of

defence against disease. Name the process and in your own words
describe what is happening.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
21
c)
Name two phagocytes and describe their action on a pathogen.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Exercise 3.4: Defence mechanisms

Below is a list of defence mechanisms. Indicate with a tick whether each
is a first line of defence or a second line of defence. The first one is done
for you.
Defence mechanism
unbroken skin
First line of defence
Second line of defence
phagocytosis
body secretions
lymph system
macrophages
mucous membrane
cell death to seal off
pathogen
cilia
chemical barriers
22
Biology
HSC Course
Stage 6

Part 4: Immunity the third line of defence
Contents
Introduction ............................................................................... 2
The immune response............................................................... 3
Components of the immune system....................................................3
Immunity ...............................................................................................5
Vaccination.............................................................................. 11
Immunity from vaccination .................................................................11
Vaccination programs ........................................................................13
Suppressing immunity........................................................................16
MacFarlane Burnett ...........................................................................16
Exercises Part 4 ................................................................... 23
Introduction
You have looked at the first two lines of defence in the previous part of
the module. Now you will look at the third line of defence, the immune
response.
identify antigens as molecules that trigger the immune response
explain why organ transplants should trigger an immune response
identify components of the third line of defence as:
antibodies
T cells
B cells
describe and explain the immune response in the human body in

terms of:
interaction between B and T lymphocytes
the mechanisms that allow interaction between B and T

lymphocytes
the range of T lymphocyte types and the difference in their roles
outline the way in which vaccinations prevent infection
outline the reasons for the suppression of the immune response in

organ transplant patients.
process, analyse and present information from secondary sources to

evaluate the effectiveness of vaccination programs in preventing the
spread and occurrence of once common diseases, including small
pox, diphtheria and polio

The immune response
The body is able to recognise the difference between its own cells and
cell products from the cells and cell products of other organisms. The
body is also able to tell the difference between itself and the cells and cell
products of other organisms of the same species.
The recognition of self and non-self is carried out by the immune system.
Once non-self particles are recognised the immune system sets about the
destruction of the non-self particles.
Components of the immune system

There are three main components of the immune system:
antibodies
T-cells
B-cells.
Antibodies
An antibody is a substance produced by the body when an antigen
enters the system. Antibodies are proteins that are able to combine with
antigens to deactivate them. They are produced in the lymph nodes by B
cells.
Your body produces a different antibody for each antigen it encounters
during its life. By lifes end you will have made about one million
different types of antibody.
Antigens
An antigen is a foreign substance that triggers an immune response.
They are often part of the outer coating of a bacterium or virus.
The antigen is recognised by the body as not being part of itself, and
antibodies are released to attach to the antigen.
Antibodies are specific. Particular antibodies attack particular antigens.
An antibody for one antigen does not attack a different antigen.
Chemically, an antigen is usually a protein or polysaccharide.
B-cells
B-cells (also called B-lymphocytes) are a type of lymphocyte that come
directly from the bone marrow (hence B-cell). B-cells are responsible for
the production of antibodies.
T-cells
T-cells (also called T-lymphocytes) are a type of lymphocyte that have
passed through the thymus (hence T-cell). The thymus gland is large
during childhood but shrinks in adults. It is located in the base of the
neck.
T-cells do not produce antibodies. T-cells directly attack cells whose
antigens they recognise.
Complete the table below to summarise the function of the various
components of the immune system.
It is important to have the function of each part of the immune system clear
in your mind before you read any further.
Component
Function
Antibody
B-cell
T-cell
Check your answers.
Immunity
The immune system learns to recognise self at a very early age. In one
study, cells from one mouse embryo (A) were placed into a second
mouse embryo (B). Once the mice reached adulthood a skin graft was
made from the mouse (A) that donated the embryo cells to the mouse (B)
that had received the embryo cells. The skin graft was accepted.
Embryo mouse A
Adult mouse A
Embryo mouse B
Skin graft accepted
Adult mouse B
An identical twin (this mouse was genetically the same) of mouse (B)
was also given a skin graft. This mouse had not received any cells from
the donor mouse (A). The skin graft was rejected.
Adult mouse A
Skin graft rejected
Twin of mouse B
This shows that the immune system learns to recognise self while the
organism is still an embryo.
A point of interest about this work is that it was performed by Dr Peter
Medawar who shared the Nobel Prize with Australian scientist Sir
MacFarlane Burnett. We will hear more of MacFarlane Burnett later in
this unit.
Memory
When a new antigen enters your body the immune system produces
B-cells that make antibodies and T-cells that specifically deal with that
antigen. It takes about one week for your body to produce sufficient
antibodies and T-cells to mount a successful attack against a new antigen.
If the same antigen enters the system again, perhaps years later, the
response is much quicker. Any antigen to which you have been
previously exposed is instantly recognised and antibody and T-cell
production commences straight away.
Antibody and T-cell production and build-up is always quicker on the
second and subsequent infections.
The immune system has a memory of past infections that allows it to
respond more quickly to antigens it has previously encountered than to
new antigens.
Over the course of your life your body will encounter about 1 million
antigens and your immune system will carry the memory of each to allow
a more rapid response if the antigen is encountered again.
How does this memory work in B-cells?

The clonal selection theory explains the process of memory. This theory
says that the antigen selects the correct B-cell to produce the antibodies
that will be used against it. A cloning process replicates the cells that
will produce the antibodies. By having many cells producing the
antibodies required, sufficient antibody can be made to fight the antigen.
Receptor for
antibody
B-cell
B-cell
Antibodies
Antibodies
attach to B-cell
B-cell clones
Antigens attach to the receptor sites of the B-cell leading to a clonal response
that produces many copies of the B-cells.
Lets imagine a new antigen enters your body. The antigen will combine
with a particular B-cell that has a receptor on its surface that matches the
antigen.
Not all B-cells are the same. The antigen only combines with a matching
B-cell.
The B-cell then makes plasma cells which are clones of itself. Most of
these clones release antibodies to attack the new antigens in the system.
Some of the clones are memory cells and do not release antibodies. For
some time after an infection by an antigen, memory cell numbers remain
high. If re-infection occurs then high levels of antibody production can
be achieved in a very short time by the cloning of the memory cells to
produce more plasma cells.
B-cells
React to presence
of antigen
Clone B-cells
for particular
antrogen
Antibody
producing
B-cells
Memory
B-cells
Antibodies
Summary of activities of B-cells.
How does memory work for T-cells?

T-cells are not able to recognise an antigen without assistance.
A macrophage engulfs the antigen by phagocytosis. The macrophage
breaks down the antigen with enzymes and then displays part of a protein
fragment of the antigen on its outer surface. The protein fragment is
associated with a major histocompatability complex (MHC).
The T-cell combines with the protein displayed on the surface of the
macrophage and begins to clone just as you saw in the B-cells.
Some of the clones produced are memory cells. Memory in T-cells

works in much the same way as it does for B-cells.
For some time after the attack, memory cells remain in the system to
allow for a rapid response to reinfection.
Antigen
engulfed
Macrophage
Protein
Macrophage
engulfedProtein placed
on outer surface.
T-cell attaches and

begins to clone
Cloning of T-cells.
You will look more closely at T-cells shortly.

Now would be a good time to see what you remember about immunity and
memory.
1
List each step in the immune response of a B-lymphocyte from the time
of first exposure to a new antigen until the cloning process is underway.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Briefly explain why your bodys response to a re-infection of an

antigen is quicker than its response to a new antigen.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.
T-lymphocyte types and their differences

There are several types of T-cells and each has a specific role. They are
killer T-cells or cytotoxic T cells (Tc)
helper T-cells (TH)
memory T-cells
suppressor T-cells.
You have seen that T-cells cannot recognise antigens without help.
So how do they work?
Macrophages engulf antigens and then break them down with enzymes.
Killer T-cells attack and destroy the macrophage that has engulfed the
antigen. These cells release powerful cytotoxins like perforin which
causes holes in the membranes of infecting cells.
These cells are the main destroyer of viruses as they kill the cells that
have already been infected by the virus. Thus, preventing the spreading
of the virus. They are also the cells that make organ transplants difficult
as they attack the donor organ.
There are also two other types of T-cells.
Helper T-cells secrete lymphokines and interleukins, chemicals that
stimulate the cloning of both B-cells and T-cells. The disease AIDS
caused by the human immunodeficiency virus (HIV) disables helper Tcells. AIDS patients die of opportunistic infections that their normal
helper T-cells would help to destroy.
Suppressor T-cells stop the immune response when the antigen is

removed. Some suppressor cells remain in the system as memory T-cells
(just as you saw for B-cells).
The diagram below summarises the activities of T-cells. Compare this to the
diagram of B-cells activities on page 7.
T cells
React to presence
of antigen
Clone T cells
for particular
antrogen
Killer T-cells
(attack & destroy
macrophage)
Helper T-cells
(stimulate B-cell
and T-cell cloning)
Suppressor T-cells
(stop immune response
when antigen removed)
Summary of T-cell activities.
Interaction between B and T lymphocytes

There is a degree of interaction between B-cells and T-cells. They are
both attacking the same problem (antigens) although their action is
different.
The helper T-cells assist in the interaction by releasing chemicals to
stimulate B-cells and T-cells to clone. Because B-cells and T-cells are in
close proximity the release of chemicals (called cytokines) by helper Tcells can coordinate the immune response by both B-cells and T-cells.
10
Vaccination
Immunity from vaccination

Vaccination can produce both active and passive immunity from disease.
Active immunity from vaccination

Active immunity results from the bodys own immune system releasing
antibodies and killer T-cells to attack an antigen.
Active immunity can be imparted by injecting the body with a serum
that stimulates the B-cells and T-cells to clone. The cloning process will
result in many memory cells in the system and so allow the body to
respond rapidly to the antigen.
You are probably wondering how you could stimulate the cloning
process. An injection of the antigen would do the trick, but of course this
would give the organism the disease you are trying to prevent. Not such
a great idea!
There are a couple of methods to induce cloning.
injection with a dead antigen. The body still reacts to the antigen
even though it is dead and unable to cause harm.
injection with a safe form of the antigen (perhaps a closely related

but non-lethal form of the bacterium or virus). This is called
attenuation.
Active immunity is by far the preferred method of immunisation. Early

childhood immunisations impart active immunity so that if a child does
come in contact with particular antigens then the body will be able to
respond rapidly.
11
If you are one of our many parents studying this course you should find this
exercise fairly easy. You will probably have all the information you need at
home. If you are not a parent, then you will need to contact a community
health centre, search the Internet or simply ask a parent with young children
for assistance.
What is the recommended schedule of immunisations for children 0-5
years in Australia? For what diseases are Australian children
immunised?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
This activity does not have answers provided since immunisation
schedules may vary from time to time. Active immunisation is used
against measles, tuberculosis, polio, diphtheria and whooping cough.
Passive immunity from vaccination

Passive immunity is imparted by injecting the individual with antibodies
to combat an antigen. This is done where there is insufficient time for
the body to create antibodies to combat an antigen. The antibodies are
produced by another organism. This is short-term protection. Passive
immunity is used when a person has come in contact with a disease such
as hepatitis.
Passive immunity does not impart long-term protection, as does active
immunity.
12
Vaccination programs
Vaccination programs have been highly successful. Diseases that were
once common such as small pox, diphtheria and polio have either been
eradicated or at least reduced so that the occurrence rate is very low.
Eradicating diseases
Polio is expected to be totally eradicated in 2000 yet children in Australia
are still vaccinated against the disease. The last recorded case of polio in
Australia was 1986 and the disease had been very uncommon in
Australia for at least 10 years before that.
Write a few lines to explain why polio vaccination has continued in
Australia and then read on to see if you were accurate.
_________________________________________________________
Although polio has been eliminated in Australia, it has not been
eliminated elsewhere in the world. It is still possible for polio to enter
the country from overseas travellers who have contracted the disease.
Vaccination programs must continue until the disease has been wiped out
worldwide.
Successful immunisation programs can result in the total eradication of a
disease. Small pox is a disease that has been eradicated because of a
concerted worldwide vaccination program.
So what happens when a disease is eradicated? Health authorities stop
immunising for a disease once it is eradicated. There is no need to
continue to provide protection for a disease that no longer exists.
An important caution
The Australian Commonwealth Department of Health and Family
Services in the second edition of their publication Immunisation myths
and realities list a number of concerns about declining immunisation
rates in Australia.
A growing number of Australian parents are not immunising their
children against diseases such as measles, whooping cough and
diphtheria. The decision not to immunise poses serious risks for the
children and greatly increases the chances of exposure for the rest of the
population.
13
Looking at measles
The statistics for measles are very concerning. The Department of
Health and Family Services cite figures that show that 99.9% of all those
not immunised against measles will contract measles during their life.
Measles is a serious disease that hospitalises one in every 70 victims and
kills approximately one in every 5000 people that contract the disease.
Looking at polio
In Holland there were two polio epidemics late in the twentieth century
(1984 and 1991). All those contracting the disease had not been
immunised while none of the immunised population contracted polio.
Immunisation clearly works!
Looking at diphtheria
Like polio, the occurrence of diphtheria has been reduced worldwide.
Unfortunately, declining vaccination rates has seen a resurgence in the
disease. To completely eradicate this disease parents must continue to
have children immunised against the disease.
Now it is your turn to analyse the effectiveness of vaccination.
200
50
150
Per cent
100
% Vaccine uptake
Notifications
100
3
2
50
0
1940
Deaths
Death rate
Notification rate
250
0
50
60
70
80
90
Year
Pertussis in England and Wales 1940-1990. (McCormick, A. The notification
of infectious diseases in England and Wales. Communicable Diseases Report,

1993; 3)
14
Pertussis is better known as whooping cough and is an extremely

infectious disease. In Australia immunisation of children against
whooping cough is strongly recommended by health authorities.
Use the graph above to answer the following questions.
1
In what year did vaccination against whooping cough commence?

_____________________________________________________
What effect did vaccination have on the incidence of whooping

cough?
_____________________________________________________
_____________________________________________________
Why do you think the incidence of whooping cough increased in the

late 1970s and early 1980s?
_____________________________________________________
_____________________________________________________
Deaths from whooping cough began to decrease prior to the

introduction of vaccination. Propose a reason why this may be so?
_____________________________________________________
_____________________________________________________
Check your answers.

This activity is optional, but you may find it interesting to pursue.
Not all countries are as fortunate as Australia. Our isolation from the rest of
the world, strong quarantine laws and immunisation programs have allowed
us to eradicate many deadly diseases. It is often only when you go to travel
overseas that you realise that diseases eradicated in Australia are common in
other countries.
You are to research one of three potential travel destinations and find out
what shots you require to spend two weeks in the country chosen.
You can choose among the following: Ghana (west Africa), Nepal
(Himalayas) or Papua New Guinea.
To get the information you could contact your friendly local travel agent
or ring one of the inoculation centres for overseas travellers.
15
Suppressing immunity
You have seen that the immune system provides a powerful third level of
defense against disease. However, there are occasions when this third
line of defence can lead to problems for doctors and their patients.
In the case of organ transplants the immune system will attack
transplanted organs and reject the tissue. This can lead to the death of
the transplant recipient. As you saw in the case of the mice receiving
skin grafts previously, the transplanted tissue is not recognised as self
and so tissue rejection occurs.
Prevention of tissue rejection

The first step is to ensure that the donor organ is as close (chemically) to
the recipient as possible. The tissue from the donor must be histocompatible with the recipient. The MHC (major histocompatability
complex) that you were introduced to earlier plays a big part in tissue
rejection. If the MHC of donor and recipient are close then rejection is
far less than if these chemicals are very different.
The second step to avoid rejection is to introduce chemicals
(immunosuppressants) that reduce the activity of the immune system.
For many transplant patients this involves initial high doses immediately
after surgery with lesser doses to be taken throughout life.
There are problems with suppressing immunity.
By suppressing the immune system to reduce the chance of organ
rejection the immune system is less able to react to antigens encountered
during life. This means that the transplant patient is far more susceptible
to colds, flu and other diseases.
Do Exercise 4.3 now: Suppressing immunity
MacFarlane Burnett
Sir MacFarlane Burnetts work in the middle of the twentieth century led
to a better understanding of the immune response and the effectiveness of
immunisation programs. He was an Australian scientist who made many
important discoveries including the discovery of immunological
tolerance for which he shared the Nobel Prize for physiology.
16
Some other of Burnetts discoveries include:
The clonal selection theory (you may like to refer back to the section
dealing with the memory of B-cells.).
The development of influenza vaccine.

1
A disease in a human population has been very prevalent. Eventually a

vaccine was developed to immunise against the disease. Draw a
generalised graph to show what may be expected to happen when the
immunisation program commenced. (Hint: remember to label axes.)
Briefly outline how tissue rejection in organ transplant patients is

managed.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
You have done an exercise that asked you to identify the

immunisation program for Australian children. Do such
immunisation programs give active or passive immunity?
Explain your answer.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
17
Terri and Toni retired 10 years ago and decided to take the doctors
advice to have annual influenza vaccinations. Such vaccinations are
recommended for all Australians over the age of 60. Terri had
always been healthy and rarely suffered from colds or flu. However,
each year when Terri had the annual vaccination there were mild
symptoms of headache and a slightly raised temperature for about a
day after the injection. Terri continues not to get colds or flu.
Toni, on the other hand, had always seemed to get the flu each year.
Terri continued to get an annual dose of the flu even after
commencing the vaccination program, but the flu symptoms were
mild.
a) What is the most likely reason for Terris symptoms of headache
and raised temperature after being immunised?
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
b) Should Terri continue the annual immunisation given the
symptoms following immunisation and also considering Terris
life long good health? Explain.
__________________________________________________
__________________________________________________
__________________________________________________
c) Why is it that Toni still gets an annual dose of flu even though
immunisation has occurred? Explain your answer.
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
Check your answers.
18
Suggested answers
T-cells
Component
Function
Antibody
Produced in response to antigens. Antibodies attack

antigens.
B-cell
Part of the immune response. Responsible for

producing antibodies.
T-cell
Part of the immune response. T-cells attack antigens

directly.
How does memory work for T-cells

1
a) New antigen enters the body.

b) Antigen attaches to a particular B-cell. The B-cell has a
receptor on its surface that matches the antigen.
c) B-cell commences cloning of plasma cells. The plasma cells
produce the exact antibody required to combat the particular
antigen.
Some of the plasma cells cloned in the initial infection do not release
antibodies. These are the memory cells and they remain in the
system long after the infection has gone. If the antigen re-infects the
memory cells begin producing the correct antibodies at once.
Because there are many memory cells remaining in the system the
correct quantity of antibody is generated quickly. The response to
re-infection is quicker than the response to the initial infection.
19
Whooping cough
1
Vaccination against whooping cough commenced in 1966.
The incidence of whooping cough was greatly reduced after the

introduction of vaccination programs.
Immunisation rates decreased sharply after 1975. The greater

number of non-immunised individuals led to an increase in the
disease.
Improved nutrition and medical services after 1940 possibly

contributed to the decreasing death rate.
MacFarlane Burnett
1
Incidence of disease
Immunisation program
starts here
Time
20
Tissue rejection is minimised by first selecting a histo-compatible

donor and then introducing drugs to suppress the immune reaction in
the organ recipient.
Active immunity. These programs are designed to give long-term

immunity to diseases such as measles and whooping cough. This is
done by exposing the child to a safe form of the antigen. The mild
discomfort or fever that follows some of these immunisations is
related to the reaction of the immune system to the serum.
a) Terri experiences headache and mild fever as the immune

system reacts to the serum. Remember the purpose of the serum
is to stimulate the immune system and to cause the production
of memory B-cells and memory T-cells to the antigen.
b) Terri should continue with the annual immunisations. Although

Terri has had few colds and flu, as the body ages the ability to
withstand these diseases decreases. The elderly and very young
children are more at risk than the rest of the community. The
symptoms of the immunisation are a minor inconvenience for
Terri if compared to a serious flu infection. Despite the
symptoms Terri should continue with the program.
c) Immunisation does not prevent a person from contracting a
particular disease. Immunisation provides the body with
memory cells that can respond quickly to the antigen if it enters
the body system. In Tonis case the reduced flu symptoms are
probably due to the immunisation. The body reacts to the
infection more rapidly and so symptoms are milder. It is also
likely that the symptoms will persist for a shorter period of time.
21
22
Exercises Part 4
Name: _________________________________
Exercise 4.1: The immune response

a)
What is an antigen?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) What is the immune response?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
c)
Name the three main components of the immune system.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
23
c)
Name four types of T lymphocytes and describe their different roles.

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
d) What are memory cells and what is their role?

______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Exercise 4.2: Vaccination

a) What is vaccination?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) Some forms of vaccination are active others are called passive.
What is the difference between the two types? Give an example of
each type of vaccination.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
24
Exercise 4.3: Suppressing immunity

a)
During transplants the natural immunity of the patient is suppressed.

Why is this necessary?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
b) What are the side effects of this treatment?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Exercise 4.4 : MacFarlane Burnett

MacFarlane Burnett is a famous Australian scientist. Name two of his
discoveries.
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
25
Biology
HSC Course
Stage 6

Part 5: Non-infectious disease
Contents
Introduction ............................................................................... 2
Non-infectious diseases ............................................................ 3
Inherited disease ..................................................................................3
Nutritional disease................................................................................5
Environmental disease ........................................................................6
Epidemiology........................................................................... 10
Cardiovascular disease......................................................................11
Melanoma ...........................................................................................17
Exercises Part 5 ................................................................... 25
Part 5: Non-infectious diseases
Introduction
Epidemiological studies use careful statistical analysis of large quantities

of data to study the population wide causes of non-infectious diseases.
identify and describe the main features of epidemiology using an

identified case study as an example
identify causes of non-infectious disease using an example from

each of the following categories:
inherited diseases
nutritional deficiencies
environmental diseases.
gather, process and analyse information to identify the cause and

effect relationship of a disease, such as melanoma or lung cancer, the
cause of which was identified through careful compilation and
analysis of statistics
identify data sources, plan and perform a first-hand investigation or

gather information from secondary sources to analyse and present
information about the occurrence, symptoms, cause,
treatment/management of a named non-infectious disease.

Non-infectious diseases
A non-infectious disease cannot be transmitted from one person to

another as you have seen with the infectious diseases. Diseases caused
by such things as diet, exposure to chemicals and genetics cannot be
caught.
The causes of non-infectious diseases fall into three main categories:
genetic (inherited)
nutritional
environmental.
Inherited diseases
Inherited diseases are caused by genes that have been inherited from
parents. Two of the most well known human inherited diseases are
Down syndrome and haemophilia.
Focus on Down syndrome

Look at the diagram following. It shows a human karyotype. From your
previous study you should have learnt that a karyotype is an arrangement
of chromosomes showing the matching pairs of chromosomes.
What is unusual about the karyotype shown below?
Yes, there is an additional chromosome 21. This condition is known as
trisomy 21 and causes the inherited disease called Down syndrome.
10
13
14
12
15
16
19
11
17
18
20
21
22
In a normal meiotic division each sex cell gets a single strand of each
chromosome. Sometimes the division is abnormal and both strands end
up in the same sex cell. When fertilisation occurs the embryo receives
one strand of chromosome 21 from one parent and two from the other
parent. The result is three chromosomes 21.
Down syndrome does not have to involve a whole extra chromosome 21.
In milder cases of the disease, only a tiny extra bit of chromosome 21 is
involved. The process by which an extra part of a chromosome can be
transmitted is covered in the genetics option.
The symptoms vary according to the severity of the disease. Some
typical symptoms include:
prominent forehead
flattened nasal bridge
an habitually open mouth
projecting lower lip
skin fold at the inner corners of the eye
mental retardation.
This is a genetic disease caused by chromosomes inherited from parents.

The only preventative measure is genetic counselling of couples at risk
(it is more prevalent in babies born to older parents than in babies born to
younger parents).
Why do you think older couples have a higher risk of having a Down
syndrome child?
A woman produces all of her eggs before birth. They stop dividing after
the first meiotic division and only complete the second meiotic division
just before ovulation. The older the woman, the greater the chance that
the egg will be defective. Although men produce sperm all their adult
life, it has been shown that male sperm has a higher chance of being
defective as the male ages.
In Australia a women who is over 35 can have amniocentesis or
chorionic villus sampling. These tests will show whether the foetus has a
chromosomal abnormality and a decision can be made whether to
continue or terminate the pregnancy.
The management of Down syndrome sufferers depends upon the severity
of the disease. There have been a number of education programs for
Down syndrome children (such as the one at Macquarie University in
Sydney) that have had outstanding success in the education and
management of Down sufferers.
You cannot contract Down syndrome from a person with the disease.
Even blood transfusions from a pose no risk in catching the disease.
Nutritional diseases
Inadequate nutrition or malnutrition can also cause disease. The table
below lists some nutritional diseases and their cause.
Disease
Caused by
scurvy
lack of vitamin C
obesity
overeating and/ or inadequate exercise
coronary heart disease
some forms of this disease are related to diet

eg. high cholesterol intake.
rickets
vitamin D deficiency
pellagra
niacin (nicotinic acid) deficiency
Focus on scurvy
Scurvy is caused by insufficient intake of vitamin C. Scurvy was a
common disease on ships prior to the 1850s. The inability to carry fresh
fruit and vegetables on long ocean voyages resulted in many nutritional
diseases among ships crew.
James Cook, a British navigator who mapped the Australian East Coast,
carried out a successful experiment to reduce scurvy in his crew. Each
day each crewmember was required to drink some lime juice. The
vitamin C in the juice reduced the occurrence of scurvy in his crew.
The reference to a scurvy crew in pirate movies has some basis in fact.
Likewise the colloquial term limey to describe those of British decent.
This term was derived from the use of lime juice on British ships.
The symptoms of scurvy are bleeding gums and even the loss of teeth.
The only way to acquire scurvy is to have inadequate vitamin C intake.
The disease cannot be transmitted from one person to another.
Scurvy can be cured by giving the sufferer regular doses of vitamin C
and modifying diet to ensure that the minimum required daily intake of
vitamin C is achieved.
Environmental diseases
Environmental diseases are caused by factors in the environment that can
cause harm. The table below lists some environmental diseases and their
causes.
Disease
Caused by
industrial deafness
excessive noise in the workplace.
skin cancer
some forms of skin cancer are related to

overexposure to the suns UV rays
lung cancer
some forms are caused by smoking
heavy metal poisoning
exposure to heavy metals such as lead (in older

types of paint) and mercury
A smokers lung with a large cancer and blackening from tar from smoking.
(Photo with permission from the School of Pathology, UNSW, Sydney)
Focus on heavy metal poisoning (lead)

Heavy metals include such things as lead, cadmium and mercury.
Most heavy metals are cumulative in organisms. This means that once a
heavy metal enters the system it does not leave.
So whats the fuss you ask? Lets imagine that each year you are
exposed to a tiny, non-lethal quantity of a heavy metal. The amount is so
tiny that you show no symptoms. Each year a tiny amount is added to
the body and, each year, that adds to what is already in the system.
Eventually there is sufficient for you to show signs of heavy metal
poisoning. Because the heavy metal cannot leave the body it
accumulates.
Lead poisoning is caused by an accumulation of the element lead in the

body. There are numerous sources of lead including the older (now
banned) lead based paints, lead smelting plants and leaded petrol.
Lead attacks the central nervous system and can cause shaking and
psychological problems. There is a metallic taste in the mouth. In mild
cases there may be vomiting and diarrhoea, but in more extreme cases,
there may be coma and death.
Children who have large levels of lead in their bodies often eat dirt.
Those living in the inner city area of Sydney are at high risk of lead
poisoning.
Treatment for lead poisoning is EDTA (ethylene diamine tetra-acetic
acid). This combines with the lead and is then excreted in the urine.
To control lead the level of lead is monitored regularly, leaded petrol is
being progressively removed form sale and educational programs are
alerting people to the risk of poisoning from old paints and other sources.
You cannot catch lead poisoning by being exposed to a sufferer.
However, you can get the disease if you are exposed to lead. People
renovating older houses that still have layers of lead based paint are one
particular group at risk.
Research activity
You have just learned about a number of non-infectious diseases. Now it
is your turn to do some research in a library or on the Internet. If you do
not have access to either a library or the Internet do not panic! You can
use one of the diseases described above to answer this question. It would
also be good to perform a first hand study yourself if you or someone you
know has a non-infectious disease.
Choose a non-infectious disease. For this disease make brief notes under
the following headings:
name of disease
cause of disease
symptoms of the disease
treatment/ management of the disease.
You should restrict your answer to no more than a single A4 page.
Record your information in Exercise 5.1. Non-infectious diseases
To get you started on your research visit the site below.

http//www.lmpc.science.edu.au
Epidemiology
Epidemiology is the study of a particular disease in a particular place.

The study looks at groups of people rather than at individuals.
You would probably be familiar with the term epidemic which usually
refers to an outbreak of a particular infectious disease in a particular
place eg. the bubonic plague epidemic in the Rocks, Sydney in the early
1900s.
So, from where do these terms originate?
Epidemiology is a word derived from another word, epidemic. The
ology part of the word just means the study of. So, epidemiology
is the study of epidemics.
The Oxford English Dictionary notes the first use of the word
epidemic in 1603 by one Thomas Lodge who wrote of the London
bubonic plague at that time ...it was epidemic among the population.
The word epidemiology did not appear until 1873 when J P Parkin
titled a book Epidemiology or the remote causes of epidemic.
But lets return to Thomas Lodge. His use of the term epidemic was
hardly original in an era when all formal learning included ancient
Greek and Latin. He had simply used a variation of an ancient Greek
word epidemios which roughly translated means upon a people.
The Greek epi = upon and demios =a people. The Greeks had also
used this work for plagues (epidemics).
You may have noticed there are Latin and Greek derivations of many of
our scientific terms and, indeed, names for species.
The first epidemiologists only studied infectious diseases. However, it
has been found that many of the statistical techniques of epidemiology
have been useful for studying non-infectious diseases as well. The
current use of the term epidemiology is very broad. Epidemiologists
(people who study epidemics) can study both infectious and noninfectious diseases.
10
Epidemiology is a science for medical detectives. It is often regarded

as one of the most interesting areas of medical research. Epidemiological
studies involve the collection and careful statistical analysis of large
quantities of data. Such studies can assist in the causal identification of
non-infectious diseases.
With any study of epidemiology there has to be discussion about cause
and effect. For example, if you found that every person who suffered
from a disease also drove a car could you then claim that a car caused the
disease? Obviously not! When any disease is linked to a cause it has to
be shown that the cause is the direct reason for the disease. The tobacco
lobby has been fighting for years to show that smoking was not the cause
of lung cancer. Epidemiology has to show that the relationship is not just
by chance and is not the indirect result of another cause.
In this brief introduction to epidemiology you will investigate
cardiovascular disease.
Cardiovascular disease
You have already seen, in the case of Rosss work with malaria or
Kochs work with micro-organisms, that careful study and recording can
identify the exact cause of some infectious diseases. However, it is not
always that easy to identify some causes of non-infectious diseases. The
link between smoking and lung cancer, exposure to the sun and skin
cancer and diet and cardiovascular disease are examples of links that
have been difficult to establish.
The causes of some diseases are identified by statistics rather than direct
observation and identification of the cause.
In this activity you will look at some of the links between environmental
factors and cardiovascular disease.
The information in this activity has been derived from: National Heart
Foundation of Australia. Heart and Stroke Facts 1996 Report. Heart
Foundation of Australia, Canberra, 1996.
Background
Cardiovascular disease is a range of diseases associated with heart
malfunction. In 1994, 43.33% of all deaths in Australia were caused by
cardiovascular disease.
11
The National Heart Foundation of Australia has identified three major

risk factors associated with cardiovascular disease. These factors are:
high blood cholesterol (accounts for 30% 40% of all coronary

heart disease deaths)
high blood pressure (accounts for 20% 25% of all coronary heart
disease deaths)
smoking (accounts for about 17% of all coronary heart disease

deaths)
So, how are these factors environmental?

Anything in the surroundings of a person is, by definition,
environmental.
It is easy to see why smoking is treated as an environmental factor.
The smoker introduces smoke into her or his environment each time a
cigarette is lit (and incidentally into the environment of the passive
smokers who have the smoke added to their environment as well).
Treating cholesterol and high blood pressure as environmental factors
takes a little more thought to understand the relationship. In the case of
cholesterol it is often related to dietary intake (high animal fat foods).
Although other factors such as a family history of high cholesterol
(genetic) may play a part.
High blood pressure can be related to environmental factors such as
stress and diet. For example high salt intake is linked to high blood
pressure. Again, other factors can also play a part, but the environmental
component to many cases of high blood pressure is very important.
Changes over time

Look at the two graphs on the following page. They show the incidence
of coronary heart disease in six countries from 1950 to 1993.
Answer the following questions about the graphs and then check your
answers against those given at the end of this unit.
1
What is the general trend shown in both of these graphs?

______________________________________________________
______________________________________________________
12
Is the incidence of death by coronary heart disease higher in men or

women? ______________________________________________
Why do you think the Japanese death rate from coronary heart
disease has remained so low?
_____________________________________________________
_____________________________________________________
Which country has a coronary death rate most similar to Australia?

_____________________________________________________
Check your answers.

Death per
100 000
Men aged 25-74
450
360
Hungary
270
Finland
UK
180
Australia
USA
90
Japan
Death per
100 000
93
92
91
90
89
88
87
86
80-84
75-79
70-74
65-69
60-64
55-59
50-54
Year
Women aged 25-74
160
120
Hungary
80
UK
Finland
Australia
USA
40
92
91
90
89
88
87
86
80-84
75-79
70-74
65-69
60-64
55-59
50-54
93
Japan
Year
Legend
Hungary
Finland
Japan
Australia
UK
USA
Deaths per 1000 from coronary hear disease in six countries 1950-1993.
Source National Heart Foundation of Australia. Heart and Stroke Facts 1996
Report. Heart Foundation of Australia, Canberra, 1996 (pp 17).
13
Making some links

How is it possible to link things such as smoking, high cholesterol and
high blood pressure to cardiovascular disease?
It is known that those with high blood pressure, high cholesterol and
those that smoke make up a large percentage of the cardiovascular death
statistics. Statisticians have analysed the decreasing rates of
cardiovascular disease and related them to trends for smoking, high
cholesterol and high blood pressure to find links.
Look at the three graphs below. They outline the trends in blood
pressure, smoking and cholesterol since 1980.
Per cent
30
Men
25
20
Women
15
10
5
0
1980
1983
1989
Trends in proportion with high blood pressure (greater than 160 Hg systolic or
95 Hg diastolic) 25 to 64 year age group.
Per cent
24
Women
20
Men
16
12
8
4
0
1980
1983
1989
Trends in proportion with high blood cholesterol (6.5 mmol/L) 25 to 64 year age
group.
14
Per cent
40
Men
35
30
25
Women
20
15
ABS survey
NHF survey
10
5
0
1980
1983
1989
1989-90
1994-95
Trends in proportion of cigarette smokers 25 to 64 year age group.
Use the information in the graphs above to answer the questions that follow.
1
What is the trend in the incidence of high blood pressure since 1980?
_____________________________________________________
_____________________________________________________
_____________________________________________________
What is the trend in high cholesterol since 1980?

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
What is the trend in cigarette smoking since 1980?

_____________________________________________________
_____________________________________________________
_____________________________________________________
Take another look at the previous graphs for the death rates due to
cardiovascular disease. What are the trends for men and women in
Australia since 1980?
_____________________________________________________
_____________________________________________________
_____________________________________________________
15
Smoking, high blood pressure and high cholesterol have been

considered to be linked to cardiovascular disease. What arguments
could you make from the evidence in the graphs to support this
claim?
______________________________________________________
______________________________________________________
______________________________________________________
What other factors besides a decrease in risk factors could account

for the decreasing mortality rates for cardiovascular disease?
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
Extending the links

It has been noted that people with two or more risk factors (eg. high
blood pressure and smoking) were more likely to become part of the
cardiovascular death statistics than those who only had one risk factor.
Would you expect the numbers of people exhibiting two risk factors to
have increased or decreased in Australia since 1980?
To find the answer look at the graph below.
Per cent
16
Men
12
Women
8
0
1980
1983
1989
As you can see, those with two or more risk factors have decreased.
16
Are there any other links?

Yes. Low levels of exercise and being overweight have also been linked
to cardiovascular disease. Some of the gains made by decreasing the
number of people smoking and by providing more accessible treatment
for high blood pressure have been tempered by declines in other areas.
In 1993 over half the men over the age of 18 were overweight and one
third of women over 18 were overweight. One set of figures for the
1980s show that between 1980 and 1989 the average weight for Australia
males increased by 2 kg and females increased by 3 kg.
The following question has been designed to provoke some thought about
what you have read.
You have been given the task of creating a home environment that would
minimise the risk of cardiovascular disease. What environmental factors
would you need to control and how would you control each factor?
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Check your answers.
Melanoma
Melanoma is commonly found as a disease of the skin it is a type of
skin cancer. Below is a case study of melanoma. (Extract from
http://www.med.unsw.edu.au/pathology/Pathmus/0322093com.htm)
History of illness:
A 35 year old Caucasian male gardener from Brisbane presented to his local
doctor with a mole on his right shoulder that had increased in size over the
previous six weeks. The mole had changed colour and had become itchy, and
was clinically thought to be a melanoma. He had also notice lumps in his right
axilla (armpit), which were enlarged lymph nodes. The tumour and the axillary
nodes were removed surgically. The patient remained well for two years, but
then presented with increasing headaches. A CT Scan of the head revealed
multiple tumour deposits in the brain. He died 3 months later after lapsing into
a coma.
17
Appearance of Disease:
This is an area of hairy skin containing a malignant melanoma (skin cancer) of
the superficial spreading type. There are several irregular, black, raised areas
which are zones of vertical tumour growth deep into the dermis (skin). There is
also a large, flat, whitish (depigmented) area, which may represent destruction
of tumour cells by an immune response
Comment:
Malignant melanoma is a skin cancer derived from melanocytes, the cells in the
epidermis that produce melanin pigment. Melanoma is the most deadly form of
skin cancer, although much less common than squamous cell carcinoma and
basal cell carcinoma. It is strongly related to exposure to ultraviolet light
(sunlight), and is more common in lower latitudes in fair-skinned people.
Australia has the highest incidence of melanoma in the world. Any pigmented
lesion or mole that appears in adulthood, or increases in size, or bleeds, or
becomes itchy, or has an irregular contour or irregular edge should be regarded
as highly suspicious and removed surgically for examination by a pathologist. If
not removed early these tumours can spread to local lymph nodes (as in this
case), liver, lung, brain and many other organs.
Melanoma of the skin. (Photo with permission from the School of Pathology,
UNSW Sydney)
18
In this exercise you will be presented with some statistics on melanoma

and asked to analyse them. Having already completed the exercise on
cardio-vascular disease you should find this exercise to be easy.
The Cancer Epidemiology Research Unit (http://www.nswcc.org.au)
have noted that from 1983 to 1995 the incidence of melanoma in
Australian males increased by 4.1% while the incidence in females rose
just 0.3%. In 1991 the incidence of melanoma in males was 46.2 cases in
each 100 000 males but only 28.8 females per 100 000 females.
1
What does it mean when we say the incidence in males was 46.2 per
100 000 males?
_____________________________________________________
Males have a greater incidence of melanoma in the body trunk, but it

is more common on the legs of a female. Can you think of a reason
for this?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Why do you think that males are more prone to melanoma than
females?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

People living closer to the Equator or the coast have higher rates of
melanoma than those living inland. In NSW the incidence of melanoma
is significantly higher in coastal regions north of Sydney than in other
parts of the state. Queensland has the highest incidence rate in males and
females.
Although NSW has a melanoma rate just 70% of that for Queensland,
this rate is still higher than the rate for any other country (that publishes
figures) worldwide!
19
What risk factors do the data above suggest for melanoma?

_____________________________________________________
_____________________________________________________
_____________________________________________________
Why do you think the incidence of melanoma is higher in coastal

areas north of Sydney than for the rest of the state?
______________________________________________________
______________________________________________________
______________________________________________________
What things could be done to reduce the risk of those living in

coastal areas?
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.

Throughout your studies in biology you have been asked to gather
information from first-hand and secondary sources. A first-hand source is
one that you have investigated personally. This may be in the form of an
experiment or a field trip. It includes the values and attitudes that you
possess.
Secondary sources are ones that are external to your experience and
consist of information gathered by other people. When using secondary
information it is always necessary to check that the information is valid.
The Internet is a wonderful source of information but it comes with a price.
Anyone can put information on the Internet and there is no overall check of
the information that a webpage contains. When gathering information from
secondary sources, check to see who has written the text and also the date.
Educational institutions and government departments always have edu or
gov in the webpage address. For example:
http://www.erin.gov.au is a government department
http://www.lmpc.edu.au is an educational institution.
When using books and scientific journals, check the publisher. Scientific
articles are peer reviewed so these are usually a source of reliable
information.
20
In this activity you have to gather, process and analyse information to

identify the cause and effect relationship of a disease such as melanoma
or lung cancer. Both of these diseases have been studied using careful
compilation of statistics.
To help you with this task some information on melanoma is given on
the previous page. More information can be gained from the Internet
sites given below and your local library. Present your information as a
report. Make sure you include the following points in your report.
Name of the disease
Effects of the disease
Cause of the disease
Statistical information
The source of your information
Write your report in Exercise 5.2: Epidemiology.
21
22
Suggested answers
Cardiovascular disease
1
The trend is for a decrease in coronary heart disease death rates over
time.
The incidence is much higher in men.
This statistic has been much debated. However, the high fish intake
in the Japanese diet with little red meat may be related.
The USA has a similar coronary death rate to Australia.
Making some links

1
The trend shows a decrease in cases of high blood pressure since

1980.
High cholesterol has altered very little with the incidence in men
increasing very slightly and the incidence in women decreasing
slightly.
Cigarette smoking has decreased significantly since 1980.
The rates of cardiovascular disease related deaths have decreased for

both Australian men and women since 1980.
If cardiovascular disease were linked to particular risk factors then

the incidence of the disease would increase if the risk factors
increased. Likewise cardiovascular disease would decrease if the
risk factors decreased. Since 1980, two of the potential risk factors
(smoking and high blood pressure) have decreased and this
corresponds with a decrease in the incidence of cardiovascular
disease.
Improved medicines and surgical techniques since 1980 may also

account for the improved rates of survival.
23
Are there any other links?

You would need to control diet, exercise and smoking.
Smoking would be banned (even passive smoking is dangerous).
Those living in the household would need to exercise daily (and
preferably aerobically three times per week). Exercise would be geared
to diet so that calories taken in were used during daily activity and
exercise.
Diet would be low on saturated fats (from which much cholesterol
comes) so fatty meat, ice cream and mud cake would be rare treats rather
than daily diet. White meat (fish and chicken) with lower fat content
would be served most meals. Salt would not be used in cooking or
placed on the table.
Any members of the household that became overweight would have their
daily diet cut and exercise levels increased. Those going underweight
would have diet increased.
Melanoma
24
On average 46.2 men in every 100 000 men will get a melanoma.
Males tend to go topless more so than females. Females are more

likely to wear body covering on their trunk and to use sunscreens
than men. Women tend to leave the legs exposed and so they get
more melanomas on the legs than the trunk.
Males tend to use sunscreens less than females and bath at beaches
with less clothing than females. The females may wear small
swimsuits, but they cover up with a beach shirt more often than the
men.
Exposure to sun is the risk factor.
North of Sydney the sun is closer for longer periods than for areas
south of the city. The increased ultraviolet radiation in these areas
may be a factor. Also the coastal areas north of Sydney are popular
surfing and beach-going areas where people are more likely to be
engaged in outdoor activities.
Use of sunscreens, covering the skin with cloths, wearing hats. Slip,
Slop, Slap!
Exercises Part 5
Name: _________________________________
Exercise 5.1: Non-infectious disease

a)
Define a non-infectious disease.

_____________________________________________________
_____________________________________________________
b) Non-infectious diseases can be classified as
inherited
nutritional deficiencies
environmental diseases.
For each of the above categories identity a disease and give its cause.
i)
Inherited
_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
ii) Nutritional deficiency

_________________________________________________
_________________________________________________
_________________________________________________
_________________________________________________
25
ii) Environmental
__________________________________________________
__________________________________________________
__________________________________________________
__________________________________________________
Report on non infectious disease
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
Exercise 5.2 :Epidemiology

What is epidemiology and why is it important to study?
26
_________________________________________________________
_________________________________________________________
_________________________________________________________
Report on epidemiological study
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
_________________________________________________________
27
Biology
HSC Course
Stage 6

Part 6: Developing strategies to fight disease
Contents
Introduction ............................................................................... 2
Disease control ......................................................................... 3
Strategies for disease control ..............................................................3
Management and prevention of disease ................................... 6

Resistance ............................................................................................6
Exercises Part 6 ................................................................... 15
Student evaluation of the module ............................................ 17
Introduction
You have been looking at the different types of diseases that affect the
human body and the natural defence mechanisms that maintain health.
In this last part of the module you will look at how increasing technology
has led to the development of a wide range of strategies to prevent and
control disease.
explain how one of the following strategies has controlled and/or

prevented disease:
public health programs
pesticides
biological control
genetic engineering to produce disease resistant plants and

animals
evaluate the implications of:
genetic resistance of hosts
development of drug resistance in pathogens on the likely

spread of disease in the future
gather and process information and use available evidence to discuss

the changing methods of dealing with plant and animal diseases,
including the shift in emphasis from treatment and control to
management or prevention of disease.

Disease control
Strategies for disease control

There are four strategies for the control of preventable diseases
mentioned in your biology syllabus. These are:
pesticides
biological control
genetic engineering to produce disease resistant plants.
Your syllabus requires that you only study one of these, but you will
briefly look at each before examining one in detail.
Public health programs

Public health programs provide sanitation, safe drinking water,
immunisation programs and even the quarantine of disease sufferers
entering the country. These have all played a part in disease control.
You may accept a safe water supply as a fact of life, but that has not
always been the case in Australia and certainly is not the case in many
other countries. One of the first things aid agencies try to establish when
working in these countries is a safe water supply.
A classic epidemiological study was performed by English physician
John Snow. He found that people who suffered from cholera in the 1849
London epidemic lived mostly in the area of the Broad Street pump. You
must remember these are the days before running water in houses.
Water was collected daily from village pumps or wells.
Snow found that nearly every person with the disease had consumed
water from the Broad street pump. He had the pump closed and no
further outbreaks occurred in the area.
Pesticides
Pesticides have been important in killing vectors such as mosquitoes.
You will remember the earlier section of work on quarantine and the
previous Australian policy of spraying insecticide inside every aircraft
when it landed. Such spraying was to kill any insect vectors (and insect
pests) that may have hitched a ride on the aircraft.
Biological control
Biological control is the use of one organism to control another. You
would already be familiar with the use of Myxoma as a biological control
to kill rabbits. Biological control has also been used to control a number
of plant pathogens.
Dung beetles have been introduced into Australia to control fly
populations. The dung beetles bury dung before the flies get a chance to
lay their eggs in it.
Certain bacteria (Bacillus thuringiensis or BT) produce chemicals that
naturally kill Heliothis caterpillars. Pesticide spray containing dead BT
bacteria is effective pesticide on crops.
Genetic engineering
Genetic engineering (and plant breeding) has been used to develop crops
that are resistant to certain diseases. Rust resistance in wheat is an
example of breeding being used to develop disease resistance.
The bacteria mentioned above (Bt) has been genetically engineered to
eliminate spraying for Heliothis. The Bt genes that produce the toxin
responsible for caterpillar death has been introduced into tomatoes, corn,
potatoes and cotton. In Australia Bt, cotton was the first genetically
engineered crop grown.
Insulin is produced by recombinant DNA technology and is an example
of a strategy to fight disease by genetic engineering.
Your case study

You are required to explain how one of the strategies outlined above has
controlled and/or prevented disease. For your study you will use malaria as
your example
You will remember from the earlier section on malaria in Part 2 of this
module, that swamps were drained to remove mosquito breeding
grounds. Pesticides have also been used to kill the mosquitoes.
We provided all the information you require for your study in some of
your earlier notes. Use the information on malaria and then answer the
following questions. The questions are designed to focus you on the
disease control aspects of using pesticides to kill mosquitoes.
1
Name of the insect vector that transmits malaria.
Does the insect vector cause the disease malaria? Explain your
answer.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Why is the insect vector controlled rather than Plasmodium?

_____________________________________________________
_____________________________________________________
_____________________________________________________
With reference to the life cycle of plasmodium, explain why the use
of pesticides against mosquitoes is an effective technique for
controlling malaria.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.
Management and prevention

of disease
There has been a shift in the way we deal with diseases. Rather than wait
for an organism to become diseased before acting a more proactive
approach is being taken for many diseases.
Prevention is better than cure.
The proactive approach has been particularly evident in the rural sector
where control of breeding is possible. Wheat, for example, can be bred
so that it is genetically resistant to various diseases such as rust. Rather
than spray a crop when it becomes diseased, the farmer plants a crop that
resists the disease.
Quarantine also fits into this approach. Rather than let diseased
organisms into the country and then treat the new diseases, it is better to
exclude sick organisms to preserve the health of those already within the
country.
You will also remember from your work on immunisation in the previous
part that active immunity is a preventative measure. By preparing the
bodys immune system with memory cells the body is able to deal with
antigens rapidly itself. Often this has little effect on the organism
exposed to the antigen. When immunisation is combined with quarantine
whole diseases can be eradicated on a worldwide basis (eg smallpox).
Resistance
Both host and pathogen can become resistant. Hosts can develop (or
have developed for them by genetic modification) genetic resistance to a
pathogen. Pathogens can also develop resistance to the chemicals used to
control their numbers.
Genetic resistance of hosts implications

What do you think the implications of genetically resistant hosts may be?
Answer each of the questions below. The questions will help you to
think about the issues involved with genetically resistant hosts. The
information you need to answer the questions has already been covered
both in this unit and in other parts of the course. This is a hard task
because you will need to draw on information from several areas you
have studied, not just one.
1
If genetically resistant hosts become the major genotype, what would

you expect to happen to pathogen numbers?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
In terms of natural selection, what may happen to the pathogens when

faced with genetically resistant hosts?
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
What would be the implications of breeding genetically resistant

crops? For example, by developing corn that was insect resistant,
and then only planting corn seeds of that type.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Lets think a bit more about resistant corn. We have bred the corn to
be resistant to a particular pathogen. In ecological terms, explain
what may happen to the abundance of other pathogens that feed off
the same host.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
Check your answers.
Drug resistance of pathogens

When a new drug is used against a pathogen the initial results are usually
outstanding. Huge deaths are observed among the pathogen. However,
within a short time a resistant form of the pathogen appears. So, a
stronger version of the drug must then be used. The process repeats with
increased concentration of drugs and increasingly resistant pathogens.
For many antibiotics the pathogens they were designed to fight are now
resistant and the drugs rendered useless.
How do pathogens become resistant?

The initial treatment with the drug kills most of the pathogens. However,
natural mutations give a few resistance to low levels of the drug. These
survive and breed. Because only resistant pathogens survive this
resistance is passed to the next generation. When the drug is applied to
this generation almost none of the pathogens die.
When the drug concentration is increased there will be many pathogen
deaths. Again a few with mutations for greater than normal resistance
will survive and the following generation becomes even more resistant.
DDT a case study

DDT was used to kill many insect pathogens and insect vectors.
The initial low doses of DDT had a dramatic effect on insect pathogens.
However, over the years insects became increasingly resistant. Many
current insect populations are so resistant that DDT has absolutely no
effect on them.
What are some solutions to the problem?

A number of solutions have been tried. The first possibility is to treat
pathogens with two different drugs simultaneously. Although it is likely
that mutations will exist to resist both drugs, it is very unlikely that one
pathogen will have both mutations. So even if the pathogen is resistant
to one drug it will still be killed by the second drug.
The second method is to employ very high doses of the drug. Although
there may be mutations to survive low doses of the drug the pathogens
are unlikely to have a mutation that can survive high doses.
Why should you complete your course of prescribed

medicine?
When your doctor gives you a course of antibiotics or other medicine you
will notice that you are told you must complete the full course of
treatment even if your symptoms disappear during the treatment. Why?
The full course of the drug leaves your system with a very high dose of
the chemical. The chances of even resistant mutant pathogens surviving
is very low.
If you stop the dose when the symptoms go you are stopping too soon.
You will only have killed the non-resistant pathogens. A small number
of resistant pathogens may remain. They will then multiply and reinfect
you with a version of the disease that is resistant to the antibiotic.
The worst part of this scenario is that these resistant pathogens may then
be passed to the wider community making the drug used on you
worthless to many other patients.
Implications of drug resistant pathogens

The implications of drug resistant pathogens are serious. If the
pathogens become resistant to the medicines we use against them then
we either have to develop new medicines or the pathogens must go
untreated.
The resistance of pathogens to many antibiotics is so common that some
doctors of medicine have suggested restricting the use of antibiotics to
serious cases only while others suggest that antibiotics should only be
issued under medical supervision in hospitals.
One of the major causes of pathogen resistance to antibiotics is patients
not completing the course of antibiotics prescribed. When patients
prematurely discontinue a course of treatment, mutant resistant forms
survive to create a new generation of resistant pathogens. The call for
the medical supervision of antibiotics by hospitals would ensure that
courses of treatment were correctly administered and that pathogens did
not get the opportunity to become resistant.
A factor that has caused considerable concern is that there is a limit to the
number of antibiotics that can be produced. Once all the possible
antibiotics have been produced and pathogens have developed immunity
to all the antibiotics there will be no more antibiotics to use.
10
These questions are designed to help you link various parts of the unit.
1
Sarah has a small splinter in her finger. The finger is red and a little pus
can be seen near the splinter. In terms of the bodys defence and
reaction to disease explain what is happening in Sarahs finger.
_____________________________________________________
Many doctors prescribe antibiotics for patients suffering viral

diseases such as the flu. Antibiotics do not work against viruses.
Why are they prescribed?
_____________________________________________________
_____________________________________________________
Briefly explain why it is not possible to immunise against a prion

disease.
_____________________________________________________
_____________________________________________________
A patient attends your surgery with advanced symptoms of a disease

that is usually immunised against at childhood. The patient is very
ill. Would you give the patient an injection of deactivated pathogen
or an injection of antibodies that act against the pathogen. Explain
your answer.
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
Check your answers.

You have now completed this module. Take some time to review what
you have learnt. Read through the syllabus points at the start of each part
and make sure that you have covered each one. If you have time make
some summaries based on the syllabus points. This will be useful when
you come to study for your HSC exam.
Good health!
11
12
Suggested answers
Your case study

1
Mosquito. In particular it is a mosquito of the genus Anopheles.
No. The disease is caused by one of four species of protozoan of the

genus Plasmodium.
The insect vector is much easier to control than Plasmodium.
Plasmodium lives, for part of its life cycle, in the salivary glands of
the mosquito. The disease can only be obtained by a human from
the bite of a mosquito. If the mosquitoes are killed then there are no
mosquito bites. No mosquito bites and no Plasmodium can be
transferred.
Genetic resistance of hosts - implications

1
Pathogen numbers would be reduced.
There are two possible answers here. The first is that the pathogen
may become extinct if all hosts were resistant.
The second possibility is that many of the pathogens would die but a
few with mutant genes able to overcome the genetically resistant
hosts may survive. These would multiply to form a new strain of the
pathogen that is not effected by genetically resistant hosts.
This is a very difficult issue. One would imagine that if a particular

crop suddenly became genetically resistant (because we have only
planted resistant seeds this year) then it would be very bad news for
insect pathogens. And so it would! However, it is also very bad
news for the crop in the long term. The reduced genetic variability
resulting from planting only one type of seed makes the crop
susceptible to environmental changes in the long term.
The issue of the importance of genetic variability is dealt with
elsewhere in this course, but the issue is sufficiently important for
major research projects to be currently underway to restore genetic
variation to crop species.
13
You probably remembered the predator-prey curve. The principles

of the predator-prey curve are the same whether you have one or
more predators on the same host. If one predator is removed (in this
case the pathogen to which the corn is resistant) then there will be
more food for the other predators. You would expect other
pathogens to increase in number in response to the decrease of the
first pathogen.
14
The body is treating the splinter as a pathogen. An inflammation

reaction has started and the bodys immune system has started work
as evidenced by the pus. The pus is created by phagocytes and
lymphocytes that have collected in the area of the wound. You will
remember that the phagocytes are destroyed after engulfing antigen.
Much of the pus will be dead cells expended fighting the pathogen.
The antibiotics are prescribed to attack the bacterial infections that

often accompany a viral infection. While your bodys defences are
busy fighting one pathogen, other pathogens often take the
opportunity to multiply.
Prion diseases are caused by a defective chemical made by the body

itself. The immune system only attacks non-self and so does not
react to the defective chemical because it is manufactured by the
body itself.
An injection of antibodies is required. It is far too late to immunise

against the disease because the patient already has the disease (and
will have good levels of protection after the disease has gone from
the body). The body requires assistance. At the time you see the
patient there are insufficient B-cells and T-cells (they are still
cloning to make sufficient numbers) so provision of antibodies is the
best solution.
Exercises Part 6
Name: _________________________________
Exercise 6.1: Case study of a strategy

Choose one of the following strategies and explain how it has controlled
or prevented disease.
pesticides
biological control
genetic engineering to produce disease resistant plants and animals.

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
15
Exercise 6.2:Resistance
a)
Genetic resistance of hosts can either occur naturally or be

genetically engineered. You have seen the example of Bt engineered
crops. What are the implications of genetic resistant hosts on the
spread of disease in the future?
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
b) In the future many pathogens that are now controlled by antibiotics

may continue to develop drug resistance. What effect will this have
the spread of disease.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________
16
1
Name: _______________________________________________
Location: ____________________________________________

_____________________________________________________

_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
17
Do you have access to the appropriate resources? eg. a computer,

the Internet, scientific equipment, chemicals, people that can provide
information and help with understanding science.
______________________________________________________
______________________________________________________
______________________________________________________
18


Oten Biology

Încărcat de

Informații document

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

Oten Biology

Încărcat de

Drepturi de autor:

Formate disponibile

Gill Sans Bold

Module overview ........................................................................iii

assesses the impacts of applications of biology on society and

identifies possible future directions of biological research

explains why the biochemical processes associated with cell

justifies the appropriateness of a particular investigation plan

evaluates ways in which accuracy and reliability could be

uses terminology and reporting styles appropriately and

assesses the validity of conclusions from gathered data and

explains why an investigation is best undertaken individually or

justifies positive values about and attitudes towards both the

test tube-sized containers of the same size made of glass or

glass or heat-resistant plastic containers into which two of the

1 junket tablet (You will need to buy a packet.)

1 small container of full cream milk

1 tray of ice blocks

1 eye dropper or pipette

13 thermometers (0100C range)

stopwatch or clock with a second hand

fresh stick of celery

single sided razor blade

glass or container with water

You need to use a computer for this activity.

the energy necessary to start a chemical reaction

movement of substances across a membrane by a

environmental or surrounding (eg. ambient

main nitrogenous waste product of bony fish;

blood vessel which carries blood away from the

the capsule at the end of the vertebrate kidney

a solution of two or more chemicals which

group of cells which divide to form new xylem

microscopic blood vessel with walls one cell

smallest unit of life capable of reproducing itself

structure made up of genetic material (DNA) and

attraction between molecules of water

the amount of a substance in a specific amount of

structural change in proteins

movement of particles in gases, liquids or

part of the nephron where water is extracted

abbreviation for deoxyribonucleic acid; the

part of an organism which produces a response

organism that changes its body temperature by

the maintenance of metabolic and physiological

hormonal system that produces internal

animal that regulates its body temperature using

a highly specialised cellular protein that reduces

cells which have their genetic material

the system of glands that secretes hormones

removing heat from the body by changing liquid

the elimination of harmful and unwanted

organs involved in the removal of wastes

a unit of inheritance, usually part of a specific

a bunch of capillaries found in the vertebrate

a complex protein molecule found in red blood

Characteristic of a soft plant; having no woody

the tendency in an organism towards maintenance

maintenance of a stable body temperature

area in the brain which acts to integrate the

an organ involved in excretion and

a material which strengthens and keeps xylem

system of thin-walled vessels and groups of

excretory organ found in insects

a series of step-wise chemical reactions, each of

all of the biochemical reactions occurring in the