Sunteți pe pagina 1din 598

ISSN 1454-7406

UNIVERSITATEA DE TIINE AGRICOLE


I MEDICIN VETERINAR
ION IONESCU DE LA BRAD IAI

LUCRRI
TIINIFICE
VOL. 51(10)
MEDICIN VETERINAR
PARTEA 1/2

EDITURA ION IONESCU DE LA BRAD

IAI - 2008

Volumul a fost editat cu sprijinul financiar al


Ministerului Educaiei, Cercetrii i Tineretului

COLEGIUL DE REDACIE
Redactor responsabil:
Prof. dr. SOLCAN Gheorghe
Redactor adjunct:
Prof. dr OPREAN Octavian Zaharie
Membri:
Prof. COTEA Corneliu
Conf. dr. VULPE Vasile
Prof. CARP-CRARE Mihai
Prof. DRUGOCIU Dan
Tehnoredactor i designer:
IGNAT Andrei

COMISIA DE REFERENI TINIFICI


Prof. dr. OPREAN Octavian
Prof. dr. H.C. CRESPEAU F. L. ENV Alfort, France
Prof. dr. SOLCAN Gheorghe
Prof. dr. MIRON Liviu
Prof. dr. SVUA Gheorghe
Prof. dr. PREDOI Gabriel FMV. Bucureti
Prof. dr. GROZA Ioan tefan FMV. Cluj-Napoca
Prof. dr. DRBU Gheorghe FMV. Timioara
Prof. dr. COTEA Corneliu
Prof. dr. CARP-CRARE Mihai
Conf. dr. MOROAN erban INSERM Paris
Prof. dr. H.C. RUNCEANU Liviu
Prof. dr. H.C. COOFAN Vasile
Prof. dr. INDILAR Eusebie
Prof. dr. PERIANU Tudor
Prof. dr. COMAN Ioan
Prof. dr. VELESCU Elena

ISSN 1454-7406

CUPRINS:
1.

ABDELFATTAH Nour
EFFECTIVE TEACHING AND LEARNING STRATEGIES AND INTERNET-BASED RESOURCES
FOR VETERINARY BASIC MEDICAL SCIENCES ............................................................................................... 1

Seciunea Preclinici
2.

ALBU Aida, POPESCU O., RC Felicia, POP Cecilia, POP I.M.


CONINUTUL DE CUPRU I ZINC DIN NUTREURI FOLOSITE PENTRU HRANA VACILOR DE
LAPTE
COPPER AND ZINC CONTENT IN DAIRY COW FEEDS ....................................................................................................... 3

3.

ALBU Aida, POPESCU O, RC Felicia


CONINUTUL DE CUPRU I ZINC N MATERII PRIME FURAJERE I NUTREURI COMBINATE
DESTINATE ALIMENTAIEI PUILOR BROILER DE GIN
COPPER AND ZINC CONTENT IN FEEDSTUFFS AND BROILER MIXED FEEDS .......................................................... 7

4.

BELU C., PREDOI G., DUMITRESCU I., GEORGESCU B., EICARU Anca, ROU Petronela,
TOADER A. I., PREDOI tefania, CAZIMIR Iuliana, BIOIU Carmen
RESEARCHES REGARDING THE MORPHOLOGY OF THE ARTICULATIONS OF CERVICAL AREA
AT THE OSTRICH (STRUTHIO CAMELLUS) ...................................................................................................... 11

5.

BOISTEANU P.C., USTUROI M.G., LAZR Roxana


METABOLIC PROFIL AND SECRETORY ACTIVITY OF PINEAL GLAND, AT EGG LAYING HENS ........ 15

6.

BORCIL Cristina, PAUL. I.


PRELIMINARY DATA REGARDING EXPERIMENTAL OCHRATOXICOSIS AT BROILERS ...................... 18

7.

CAZACU P., COTEA C.


MORPHOLOGIC AND MICROMORPHOMETRIC CHARACTERISTICS OF THE THIRD EYELID AND
NICTITATING GLAND IN THE DOG ...................................................................................................................... 22

8.

CAZIMIR Iuliana, CORNIL N., PREDOI tefania, RISTEA Florica, CONSTANTINESCU Cristina
MORFOLOGIA MICROSCOPIC A COMPARTIMENTELOR CLOACALE LA PREPELIA
JAPONEZ (COTURNIX COTURNINX JAPONICA)
MICROSCOPICAL MORPHOLOGY OF THE CLOACA COMPARTMENTS IN THE JAPANESE QUAIL
(COTURNIX COTURNIX JAPONICA) ........................................................................................................................................ 27

9.

CERNEA Laura, CERNEA M., OGNEAN L., FI N., TRNC S., TRIPON S., CUCURUZAN Simona
ACIUNEA UNOR EXTRACTE VEGETALE ASUPRA MICROBIOCENOZEI INTESTINALE
ENDOSIMBIONTE LA OARECELE DE LABORATOR
THE EFFECT OF SOME PLANT EXTRACTS ON THE INTESTINAL
ENDO-SYMBIOTIC MICROBIOCENOSIS IN LABORATORY MICE ..................................................................................................................................... 33

10. CIUC Viviana, DUMITRACHE Mariana


CYTOTOXIC EFFECT OF ALUMINIUM ON CELL CULTURES ........................................................................ 38
11. CODREANU Iuliana, CONSTANTINESCU Ioana, DOJAN N., CODREANU M.D., DOJAN Rosalie
INVESTIGAII PRIVIND PROFILUL BIOCHIMIC LA IEPURELE DE CMP (LEPUS EUROPAEUS)
INVESTIGATIONS ABOUT THE BIOCHEMICAL PROFILE IN WILD RABBIT (LEPUS EUROPAEUS) ...................... 42

12. CODREANU Iuliana, CONSTANTINESCU Ioana, DOJAN N., CODREANU M.D., DOJAN Rosalie
INVESTIGAII PRIVIND NIVELUL UNOR ELEMENTE N PROBELE BIOLOGICE PROVENITE DE
LA IEPURELE DE CMP (LEPUS EUROPAEUS)
INVESTIGATIONS CONCERNING THE LEVEL OF SOME ELEMENTS IN BIOLOGICAL SAMPLES FROM
WILD RABBIT (LEPUS EUROPAEUS) ...................................................................................................................................... 45

13. COTEA C., OPREAN O.Z., SOLCAN Carmen, BOISTEANU P.C.


CITOCHIMIA GLANDELOR TECALE OVARIENE LA VACI N FAZELE CICLULUI SEXUAL
CYTOCHEMISTRY OF THE OVARIAN THECAL GLAND IN THE PHASES OF SEXUAL CYCLE IN COWS ............ 48

14. CRESPEAU F.L., ROTARU Anca


CYTOLOGIE DES CYTOPONCTIONS GANGLIONNAIRES LAIGUILLE FINE

FINE NEEDLE ASPIRATION LYMPH NODE CYTOLOGY IN VETERINARY PRACTICE ............................................. 55

15. CURC D., PANT A.


MODIFICATIONS OF BLOOD VALUES AFTER STRENUOUS EXERCISE IN WISTAR RATS FEED
WITH FODDER SUPPLEMENTED WITH SELENIUM AND L-CARNITINE ..................................................... 59
16. FLOREA Elena Ctlina, COTEA C., SOLCAN Carmen
CONTRIBUII LA MORFOLOGIA LOBULUI ALB AL GLANDEI HARDER LA IEPURELE DE CAS
(ORYCTOLAGUS CUNICULUS)
CONTRIBUTIONS CONCERNING THE WHITE LOBE MORPHOLOGY OF THE HARDERIAN GLAND IN
RABBITS (ORYCTOLAGUS CUNICULUS).............................................................................................................................. 64

17. FLOREA Elena Ctlina, COTEA C., SOLCAN Carmen


CITOCHIMIA LOBULUI ROZ AL GLANDEI HARDER LA IEPURELE DE CAS (ORYCTOLAGUS
CUNICULUS)
CYTOCHEMISTRY OF THE PINK LOBE OF THE HARDERIAN GLANDIN RABBITS (ORYCTOLAGUS
CUNICULUS)................................................................................................................................................................................... 69

18. GEORGESCU B., PREDOI G., CORNIL N., TUDOR N., BELU C., PREDOI tefania,
CAZIMIR Iuliana, NEGHIRL Ioana, PUN D., TOADER A. I., PLMARU Veroana
CERCETRI PRIVIND MORFOLOGIA DIVERTICULULUI VITELIN (MECKEL)
DOMESTIC (ANSER DOMESTICUS)

LA

GSCA

RESEARCHES REGARDING THE MORPHOLOGY OF THE DIVERTICULUM VITELLIN (MECKELS


DIVERTICULUM) AT THE DOMESTIC GOOSE (ANSER DOMESTICUS) ....................................................................... 74

19. KEVORKIAN Steliana, MANEA Maria Adina, GEORGESCU S.E., DINISCHIOTU Anca,
COSTACHE Marieta
GENOTYPING OF s1-CAZEIN GENE IN KARAKUL SHEEP BREED............................................................ 79
20. LIONIDE A., CURC D., PANT L.
EFFECT OF ORGANIC SELENIUM SUPPLEMENTATION DIET IN CALVES ON HUMORAL
IMMUNE RESPONSE ............................................................................................................................................... 82
21. MACARI V., GUDUMAC V., DONICA A.
INFLUENA REMEDIULUI BioR ASUPRA PSEUDOCOLINESTERAZEI N SERUL SANGUIN LA
TINERETUL PORCIN ALIMENTAT CU RAII CARENATE ............................................................................. 87
22. MACARI V., Putin V., MACARI Ana, POZDRC E.
MANIFESTRILE INDICILOR HEMATOLOGICI LA PUII-BROILERI TRATAI CU REMEDIULUI BIOR ... 90
23. MANEA Maria Adina, KEVORKIAN Steliana, GEORGESCU S.E., DINISCHIOTU Anca,
COSTACHE Marieta
THE -1 FUCOSYLTRANSFERASE GENE POLYMORPHISM IN CORRELATION WITH THE
SUSCEPTIBILITY OF SWINE TO ESCHERICHIA COLI INFECTION .............................................................. 93
24. MICLU V., MIHALCA A.D., DAMIAN A., OANA L., RUS V.
HISTOLOGICAL EVIDENCE FOR MIGRATION SPEED OF SPIROXYS CONTORTUS LARVAE IN
THE GASTRIC WALL OF THE EUROPEAN POND TURTLE (EMYS ORBICULARIS) ................................. 96
25. NEAGU Aritina, CRIVINEANU V., GORAN G.V.*, CODREANU M.D.
INFLUENA SUBSTANELOR AZOTATE ASUPRA UNOR PARAMETRII
METHEMOGLOBINEMIEI LA OVINE

BIOCHIMICI

NITROGEN
SUBSTANCES
INFLUENCE
ON
SOME
BIOCHEMICAL
PARAMETERS
AND
METHAEMOGLOBINAEMIA IN SHEEP .................................................................................................................................... 99

26. OGNEAN L., CERNEA Cristina, CERNEA M.


EVOLUIA SNTII MAMARE LA VACI I A PARAMETRILOR IGENICO SANITARI AI
LAPTELUI PRODUS I PROCESAT PE FILIERA CU CIRCUIT INCHIS A SOCIETII SANLACTA
EVOLUTION OF COW MAMMARY HEALTH AND THE HYGIENIC AND SANITARY PARAMETERS OF
PRODUCED AND PROCESSED MILK ON THE CLOSED CHAIN PRODUCTION FLOW OF THE SANLACTA
COMPANY ..................................................................................................................................................................................... 103

27. OLARIU Lucia, CACIG Svetlana, LUPEA Alfa Xenia, TULCAN Camelia, ARGHERIE Diana
THE EFFECT OF THE ZIZIPHUS JUJUBA EXTRACT ON THE SOME ANTIOXIDANT
ENZYMESACTIVITY IN RATS ............................................................................................................................. 109

28. OLARIU-JURCA I., COMAN M., LAZU A., STANCU A.


MODIFICRI MORFOPATOLOGICE N COLIGRANULOMATOZ LA CURC I ASPECTE LEGATE
DE DIAGNOSTICUL HISTOPATOLOGIC AL BOLII .......................................................................................... 113
29. PALL E., GROZA I., SORIU Olga, CTAN Laura, CENARIU M.
MODULAREA DIFERENIERII CARDIACE A CELULELOR STEM EMBRIONARE MURINE SUB
INFLUENA UNOR FACTORI DE CRETERE
MODULATION OF CARDIAC DIFFERENTIATION OF MOUSE EMBRYONIC STEM CELLS UNDER THE
INFLUENCE OF SOME GROWTH FACTORS ....................................................................................................................... 117

30. PACA S., MIRON L., ACATRINEI D., MIHALACHI Simona


BOTH CARDIO-VASCULARY AND SUBCUTANEOUS FORMS OF DIROFILARIOSIS IN DOG: A
CASE REPORT ....................................................................................................................................................... 123
31. PAVEL Geta, MUSTEA M., DRAGU Corina, NECULAE Irina
VALOAREA DE DIAGNOSTIC A EXAMENULUI CITOLOGIC AL LICHIDULUI CEFALORAHIDIAN LA
CINI CU AFECIUNI NEUROLOGICE
THE DIAGNOSTIC VALUE OF CEREBROSPINAL FLUID CYTOLOGY IN DOGS WITH NEUROLOGICAL
CONDITIONS ................................................................................................................................................................................ 128

32. PREDOI tefania, CORNIL N., CAZIMIR Iuliana, GEORGESCU B., BIOIU Carmen, TOADER A.I.,
ZVORISTEANU Raluca
CERCETRI MORFOLOGICE PRIVIND CAVITATEA BUCAL LA SPECIA STRUTHIO CAMELUS
MORPHOLOGICAL RESEARCHES CONCERNING ORAL CAVITY IN STRUTHIO CAMELUS ................................ 135

33. PRISCARU Cornelia, BURLACU Anca-Irina, ROTARU Liliana


MONITORIZAREA MODIFICRILOR BIOCHIMICE DIN STRESUL OXIDATIV
OCRATOXICOZEI A INDUSE PRIN ADMINISTRAREA DE APII AETHEROLEUM

SPECIFIC

EVALUATION OF BIOCHEMICAL CHANGES FROM OXIDATIVE STRESS SPECIFIC TO OCHRATOXICOSIS


INDUCED BY APII AETHEROLEUM ADMINISTRATION .................................................................................................... 140

34. PRISCARU Cornelia, BURLACU Anca-Irina


TESTAREA EFECTULUI ANTITOXIC AL UNOR PRODUSE VEGETALE CE CONIN FTALIDE
EVALUATION OF THE ANTITOXIC EFFECT OF SOME PHTHALIDE CONTAINING VEGETAL PRODUCTS ....... 144

35. RADOI I., SAPCALIU Agripina, CRENGUTA Pavel, TODIRITA Andra


THE EVOLUTION OF SOME BIOCHEMICAL PARAMETERS IN THE HONEYBEES HAEMOLYMPH
(A. M. CARPATHICA) COLLECTED IN THE ACTIVE SEASON ..................................................................... 148
36. ROTINBERG P., GHERGHEL Daniela, MIHAI C., TRU ELENA, CPRARU Gabriela,
SURDU tefania, OLTEANU Zenovia, ROTINBERG Hellen
COMPORTAMENTUL UNOR PARAMETRII HEMATOLOGICI I AL UNOR CONSTANTE
BIOCHIMICE PLASMATICE LA TRATAMENTUL CITOSTATIC EXPERIMENTAL CU PRODUSUL
GLUCANIC EGlClp
THE BEHAVIOR OF SOME HEMATOLOGICAL PARAMETERS AND PLASMATIC BIOCHEMICAL
CONSTANTS TO THE EXPERIMENTAL CYTOSTATIC TREATMENT WITH THE GLUCANIC PRODUCTS ......... 152

37. SOCACIU Antonia, DAMIAN A., CHIRILEAN Ioana, STAN F., GUDEA Al.
ASPECTE MACROSCOPICE PRIVIND VASCULARIZAIA VENOAS A GLANDEI MAMARE LA
RUMEGTOARELE MARI ..................................................................................................................................... 159
38. SOLCAN Carmen, COTEA C., SOLCAN Gh., FLOREA Elena Ctlina
MODIFICRILE HISTOLOGICE ALE PIELII IN UNELE BOLI INFECTIOASE LA PUII BROILER DE
GIN
HISTOLOGICAL LESIONS OF THE SKIN IN SOME INFECTIOUS DISEASES OF BROILER CHICKEN ................. 163

39. SOLCAN Carmen, COTEA C., SOLCAN Gh., POPESCU A.


MODIFICRILE HISTOLOGICE ALE PIELII N BOALA MAREK, UNELE BOLI PARAZITARE I DE
METABOLISM LA PUII DE GIN
HISTOLOGICAL LESIONS OF THE CHICKEN SKIN IN MAREK DISEASE AND SOME PARASITIC AND
METABOLIC DISEASES IN BROILER CHICKENS ............................................................................................................... 167

40. SPTARU Mihaela, COOFAN Otilia, SPTARU C-tin, VULPE V.


MODIFICARI MACRO I MICROSCOPICE ALE ORGANELOR LA OARECII EXPUI LA
NTUNERIC PRELUNGIT
THE MACRO AND MYCROSCOPIC MODIFICATIONS OF SOME ORGANS AT MICE THAT ARE KEPT IN
PROLONGED DARKNESS ........................................................................................................................................................ 171

41. STAN F.
ASPECTE MORFOLOGICE PRIVIND VASCULARIZAIA LIMFATIC A GLANDEI MAMARE LA
CEA ....................................................................................................................................................................... 177
42. STAN F., GUDEA Al., DAMIAN A., SOCACIU Antonia
PARTICULARITI ANATOMICE ALE LIMFOCENTRULUI AXILAR I POPLITEU LA CINE ................. 183
43. TOADER A. I., BELU C., PREDOI G., DUMITRESCU I., GEORGESCU B., ROU Petronela,
EICARU Anca, BIOIU Carmen
MORFOLOGIA COMPLEXULUI ARTICULAR QUADRATOMANDIBULAR LA STRUUL AFRICAN
(STRUTHIO CAMELLUS)
RESEARCHES REGARDING THE MORPHOLOGY OF THE QUADRATOMANDIBULARY JOINT AT THE
OSTRICH (STRUTHIO CAMELLUS) ........................................................................................................................................ 188

44. TRINC LUCIA CARMEN, VOLF MARIANA, AVARVAREI IOAN, BIANU ELISABET
Pb, Cd and Se levels in fodder plants as part of "farm to fork" food chain survey in Iasi area ..................... 192

Seciunea Clinici
45. ACATRINEI D., MIRON L.
EVALUAREA GRADULUI DE POLUARE PARAZITAR A ZONELOR DE AGREMENT DIN
MUNICIPIUL IAI
THE EVALUATION OF PARASITIC POLLUTION STATE OF PUBLIC RECREATION AREAS FROM IASI ............. 198

46. ACATRINEI D., PACA S., MIHALACHI Simona


INVESTIGAII MORFOLOGICE N INVAZIA CU DIROFILARIA IMMITIS LA CINE
MORPHOLOGICAL INVESTIGATIONS IN DIROFILARIA IMMITIS INVASIONS IN DOGS ......................................... 200

47. ANTON Alina, ROLLIN F., SOLCAN Gh.


THE IMPACT OF COPPER AND ZINC DEFICIENCY ON HEALTH IN HOLSTEIN COWS IN A FARM
FROM IASI ................................................................................................................................................................ 207
48. ARDELEAN. V., ARDELEAN A.I., BONCA Gh., CERNESCU H., MIRCU C., CZAPP Timea,
KORODI Gabriela, ZARCULA Simona
RESULTS OBTAINED DUE TO I.A. IN COWS AND HEIFERS, AND CORRELATIONS BETWEEN
FECUNDITY AND SOME ESTRAL MUCUS CHARACTERISTICS ................................................................. 211
49. BECHEA CHIRIAC I.S., HRICU Luminia Diana, BOGHIAN V.
REACTIVITATEA MUSCULATURII NETEDE ARTERIALE LA UNII AGENI VASOCONSTRICTORI
(CLORURA DE POTASIU I ANGIOTENSINA) STUDIU COMPARATIV LA UNELE SPECII DE
MAMIFERE ............................................................................................................................................................... 216
50. BOR S.I., ROCA P., RUNCEANU L.
OBSERVAII PRIVIND DIAGNOSTICUL I TRATAMENTUL HERNIEI UTERULUI GESTANT LA
CEA STUDIU DE CAZ
OBSERVATIONS REGARDING THE DIAGNOSIS AND TREATMENT OF THE PREGNANT UTERUS HERNIA
IN A BITCH CASE REPORT ................................................................................................................................................... 222

51. BOGDAN L., GROZA I., CIUPE Simona, NEAGU R., MATEI Sorana, PETREAN Anamaria,
VLASIU Teodora
CERCETRI COMPARATIVE PRIVIND TRATAMENTUL ENDOMETRITELOR CRONICE LA VACILE
DE LAPTE UTILIZND PRODUSELE NATURISTE DIN GAMA PLANTISTIM
COMPARATIVE RESEARCHES REGARDING THE TREATMENT OF CHRONIC ENDOMETRITIS IN DAIRY
COWS USING PLANTISTIM NATURAL PRODUCTS .......................................................................................................... 225

52. BOGHIAN V.
OPTIMIZAREA DIAGNOSTICULUI CLINIC I PARACLINIC LA VACI CU CETOZ CLINIC .................. 229
53. BOGHIAN V., REBEGEA Cristina, MOCANU Diana, BLEJUC Alice-Diana, TOMA Luminia
THE BIOCHEMICAL BLOOD PROFILE IN CATS WITH INFECTIOUS PERITONITIS ................................ 232
54. BRSLAU M.C., BRSLAU Daniela Elena, CIUBOTARU Emilia, SVULESCU I.M.,
COJMLEA R., PREDOI tefania
ELECTROCARDIOGRAPHIC CHANGES MADE BY DIABETES MELLITUS ............................................... 234

55. BRSLAU M.C., BRSLAU M.C., VLGIOIU C., JOIA Silvia, IONESCU S.
USE OF MEXILETIN AT DOGS WITH VENTRICULAR ARRYTHMIAS ......................................................... 238
56. BURCOVEANU Ioana Ruxandra, BURTAN I.
OBSERVAII CLINICE I TERAPEUTICE PRIVIND EVOLUIA UNUI ULCER CORNEEAN LA
PISIC STUDIU DE CAZ
CLINICAL AND THERAPEUTICAL OBSERVATIONS REGARDING THE EVOLUTION OF A CATS CORNEAL
ULCER CASE REPORT .......................................................................................................................................................... 241

57. BURTAN L.C., BURTAN I. , FNTNARU M., CIOBANU S., TOPAL Roxana
ETIOPATOGENIA I SIMPTOMATOLOGIA HERNIEI PERINEALE LA CINE
ETIOPATHOGENESIS AND CLINICAL SIGNS OF PERINEAL HERNIA AT DOG ......................................................... 245

58. CANTEMIR M.
OBSERVAII PRIVIND IMPLICAREA ENDOMERTITELOR N DESFURAREA PROCESELOR DE
REPRODUCIE LA VACI
CONSIDERATIONS CONCERNING THE INVOLVEMENT OF THE ENDOMETRITIS N THE
DEVELOPEPEMENT OF REPRODUCTIVE PROCESSES N COWS .............................................................................. 248

59. CENARIU M., GROZA I., CIUPE Simona , STEGERAN Brndua, PALL E., CTAN Laura,
BARTO A.
SEXAREA EMBRIONILOR BOVINI UTILIZND REACIA N LAN A POLIMERAZEI (PCR) .................. 252
60. CERNEA M., CERNEA Cristina, RILEANU S., GUT A., SILBERG R.,
MADEIRA DE CARVALHO L.
STABILIREA PARAMETRILOR NECESARI SI FUNCTIONALI AI MODELULUI MATEMATIC
DETERMINISTIC DE EVALUARE IN VITRO A CHIMIOREZISTENTEI IN STRONGILIDOZA LA
ECVINE
ESTABLISHING THE NECESSARY AND FUNCTIONAL PARAMETERS OF THE DETERMINISTIC
MATHEMATICAL MODEL OF IN VITRO RESISTANCE EVALUATION IN EQUINE STRONGYLS
RESISTANCE ................................................................................................................................................................................ 257

61. CERNEA M., CERNEA Cristina, RILEANU S., GUT A., SILBERG R.,
MADEIRA DE CARVALHO L.
CALCULATION OF RESISTANCE FACTOR AND EVALUATION OF RESULTS VERIDICITY FROM A
BIOMATHEMATICAL PROSPECTIVE IN EQUINE STRONGYLS RESISTANCE ....................................... 261
62. CIOBANU S., BURTAN I., FNTNARU M., BURTAN L.C., TOPAL Roxana
SURGICAL MANAGEMENT IN PALATAL DEFECTS AT CATS ..................................................................... 264
63. COIPAN Elena Claudia, VLADIMIRESCU A. F., ARSENE M., ARSENE Marinela, NASTASE S.
CLIMATE VARIABLES INFLUENCE ON THE QUESTING ACTIVITY OF IXODES RICINUS TICKS IN
TULCEA COUNTY .................................................................................................................................................. 267
64. CIORNOHAC Mona, HAGIU N., MIHE G.
ASPECTE CLINICE I PARACLINICE N EIMERIOZE LA PUII BROILER CRESCUI N SISTEM
INTENSIV ................................................................................................................................................................. 275
65. CIORNOHAC Mona, HAGIU N., CIORNOHAC G.
IDENTIFICAREA SPECIILOR DE EIMERII LA PUII BROILER CRESCUI N SISTEM INTENSIV .......... 279
66. CIUPE Simona, GROZA I., PALL E., CENARIU M., STEGERAN Brndua, VLASIU Teodora
EFECTELE STRESULUI TERMIC SCROTO - TESTICULAR ASUPRA CARACTERISTICILOR
SPERMATICE LA OARECE ............................................................................................................................... 282
67. COSMIN M., ROTINBERG P., TRU ELENA, GHERGHEL Daniela, CPRARU GABRIELA,
SURDU tefania, OLTEANU Zenovia, ROTINBERG Hellen
HIGHLIGHTING AND REPRODUCIBILITY OF THE ANTITUMORAL PHARMACODYNAMIC EFFECT
OF AN AUTOCHTHONOUS GLUCANIC BIOPREPARATION, OF FUNGAL ORIGIN ............................... 287
68. CRIVINEANU Maria , NICORESCU V., PAPUC Camelia, MUTU A.
STUDII PRIVIND SINCRONIZAREA ESTRULUI CU PROGESTINE I GONADOTROFIN SERIC
LA OVINE I CAPRINE
STUDIES REGARDING ESTRUS SYNCHRONIZATION WITH PROGESTINS AND SERUM GONADOTROPIN
IN SHEEP AND GOATS .............................................................................................................................................................. 293

69. CRIVINEANU V., GORAN G.V., CIUPERC I.A.


MODIFICRI HEMATOLOGICE LA TINERETUL TAURIN CRESCUT NTR-O ZON POLUAT CU
METALE GRELE
HEMATOLOGICAL MODIFICATIONS IN YOUNG BOVINES FARMED IN A HEAVY METALS POLLUTED
AREA .............................................................................................................................................................................................. 298

70. DRBU Gh., ILIE M., ILIE A., MORARIU S., MORAR D., BRUDIU I.
EVOLUIA UNOR PARAMETRI BIOCHIMICI N EIMERIOZA EXPERIMENTAL LA PUII BROILER ..... 305
71. DRBU Gh., IMRE K., OPRESCU I., MEDERLE Narcisa, ILIE M., HERMAN V., HOTEA Ionela
STUDII PRELIMINARE PRIVIND IMPLICAREA CRIPTOSPORIDIILOR I A ALTOR
ENTEROPATOGENI N DIAREILE VIEILOR .................................................................................................... 310
72. DOROBANU I., GALAN C., DRUGOCIU D., ROCA P., CIORNEI .
OBSERVAII ASUPRA FRECVENEI, FORMELOR CLINICE, SIMPTOMATOLOGIEI SI TERAPIEI
ENDOMETRITELOR CRONICE LA VACI
OBSERVATIONS REGARDING OCCURANCE, CLINICAL FORMS, SIMPTOMS AND ENDOMETRITES
THERAPY IN COWS.................................................................................................................................................................... 313

73. DRAGHICI Alina Karina, STURZU Simona


DE CE AVEM NEVOIE DE NOI TEHNICI DE DIAGNOSTIC A DERMATOFITOZELOR? ........................... 316
74. DRUGOCIU D., ROCA P., RUNCEANU L., SOLCAN Gh., CIORNEI ., BOR S.I.
MONITORIZAREA SUPEROVULAIEI N CADRUL TRANSFERULUI DE ZIGOI LA VAC CU
AJUTORUL ULTRASONOGRAFIEI
THE MONITORIZATION OF SUPEROVULATION IN COW DURING EMBRYONARY TRANSFER USING
ULTRASONOGRAPHY TECHNIQUE ...................................................................................................................................... 321

75. ELEFTERESCU H., GROSU F.E., MANGRU Angelica, OANCEA I., BOLOG N., BLAN L.
MAGNETIC RESONANCE IMAGING IN DOGS: THE INFLUENCE ON CLINICAL MANAGEMENT
AND TREATMENT OPTIONS ............................................................................................................................... 325
76. FNTNARU M., BURTAN I., CIOBANU S., BURTAN L.C., TOPAL Roxana
UTILIZAREA RIFAMPICINEI N PLGI ACCIDENTALE LA CARNIVORE
RIFATROL THERAPEUTIC EFFECT ON CARNIVORES WOUNDS ................................................................................ 328

77. FNTNARU M., BURTAN I., CIOBANU S., BURTAN L.C., TOPAL Roxana
UTILIZAREA RIFAMPICINEI N PLGI ACCIDENTALE LA CABALINE
USE OF RIFAMPICIN IN ACCIDENTAL WOUNDS AT HORSES ...................................................................................... 332

78. GALAN C., DOROBANU I., DRUGOCIU D., ROCA P., CIORNEI .
OBSTRUCIA TUBAR, CAUZ A INFERTILITII LA VACI
OBSTRUCTION OF THE TUBES, CAUSE OF INFERTILITY IN COWS .......................................................................... 335

79. GEORGESCU Gabriela, CODREANU M.D.


HIPOTIROIDISMUL O CAUZA A PARALIZIEI LARINGIENE LA CAINE (STUDIU DE CAZ) ................... 337
80. GHERGHEL Daniela, ROTINBERG P., MIHAI C., TRU ELENA, CPRARU GABRIELA,
SURDU tefania, OLTEANU Zenovia
THE IN VIVO ASSESSMENT OF THE PRECLINICAL ONCOCHEMOTHERAPEUTIC
EFFECTIVNESS OF THE POLYSACCHARIDIC BIOPREPARATION ........................................................... 341
81. GHI M., BRSLAU M.C., COTOR G.
VALORILE COMPONENTELOR ELECTROCARDIOGRAMEI LA CALUL DE SPORT, NAINTE I
DUP ANTRENAMENT .......................................................................................................................................... 348
82. GORAN G.V., PAPUC Camelia, CRIVINEANU Carmen Delia
INFLUENA ADMINISTRRII UNOR EXTRACTE ALCOOLICE DE CTIN ALB (HIPPOPHE
FRUCTUS) ASUPRA ACTIVITII UNOR SISTEME ENZIMATICE N HIPERCUPROZA INDUS LA
OVINE
ALCOHOLIC EXTRACTS FROM SEA BUCKTHORN FRUITS (HPPOPHAE FRUCTUS) ADMINISTRATION
INFLUENCE ON ACTIVITY OF SOME ENZYMATIC SYSTEMS IN INDUCED HYPERCUPROSIS IN SHEEP ....... 352

83. GRECU Mariana, NSTAS V., MORARU Ramona


PHARMACEUTICAL APPLICATIONS OF CYCLODEXTRINES ...................................................................... 357
84. GRECU Mariana, HRICU Luminia Diana, NSTAS V.
THERAPEUTICALLY OBSERVATIONS REGARDING NON-STEROIDIAN ANTI-INFLAMMATORY
USED IN LOCOMOTORS AFFECTIONS IN DOG ............................................................................................. 361

85. GRECU Mariana, HRICU Luminia Diana, NSTAS V.


THE BENEFICION/RISK EVALUATION OF THE PYROXICAM WITH THE -CICLODEXTRINE
COMPLEXED IN INFLAMATORY PROCESSES AT DOG .............................................................................. 365
86. GROSU F.E., ELEFTERESCU H., MANGRU Angelica, BLAN L., TUDOR N., VLGIOIU C.
DIAGNOSTICUL DEGENERRILOR I PROTRUZIILOR DISCURILOR INTERVERTEBRALE LA
CINE UTILIZND TEHNICA DE IMAGISTIC PRIN REZONAN MAGNETIC
MRI DIAGNOSIS OF THE INTERVERTEBRAL DISCS PROTUSION AND DEGENERATION IN DOGS.................. 368

87. GROZA I., BOGDAN L., MORAR I., CIUPE Simona, CENARIU M., POP R, NEAGU R.
CRIOCONSERVAREA MATERIALULUI SEMINAL LA BUBALINE
CRYOPRESERVATION OF BUFFALO SEMEN .................................................................................................................... 371

88. HRICU Luminia Diana, GRECU Mariana, NSTAS V.


CLINICAL AND PARACLINICAL ASPECTS IN THE CASE OF KETOPROFEN ADMINISTRATION TO
RADICULAR SINDROME IN DOG ....................................................................................................................... 376
89. HRICU Luminia Diana, GRECU Mariana, BECHEA CHIRIAC I.S.
ETIOLOGIC AND THERAPEUTIC COMPARATIVE STUDY IN DOGS AND CATS WITH DIABETES
MELLITUS ................................................................................................................................................................ 380
90. HRICU Luminia Diana, GRECU Mariana, SOFRON N.
GUIDELINE REGARDING DIABETIC ANIMALS MONITORIZED ................................................................... 385
91. IGNA C., STRATUL S., SERES Monica, SCHUSZLER Larisa
MINIATURE PIG A RELIABLE ANIMAL MODEL IN ORTHOPEDY ............................................................. 388
92. IGNA C.
STEM CELL THERAPY: A THERAPEUTIC ALTERNATIVE TO TREAT CARTILAGE LESIONS.............. 392
93. ILIE M.S., DRBU Gh., OPRESCU I., MORARIU S., MEDERLE Narcisa, ILIE Alina, IMRE K.
CARTAREA SPECIILOR DE HELMINI PARAZII LA PSRI N JUDEUL OLT
THE MAPPING OF HELMINTH PARASITE SPECIES IN POULTRY FROM OLT COUNTY ........................................ 397

94. IMRE K., PCURAR C.


IDENTIFICAREA OOCHISTURILOR DE CRIPTOSPORIDII DIN ETALATUL DE FECALE PRIN
IMUNOFLUORESCEN DIRECT .................................................................................................................... 405
95. IMRE K., DRBU Gh., OPRESCU I., MORARIU S., MEDERLE Narcisa, ILIE M.S., PALCA M.
STUDIU EPIDEMIOLOGIC PRIN ELISA ASUPRA PARAZITISMULUI CU CRIPTOSPORIDII I ALI
ENTEROPATOGENI, LA VIEI N JUDEUL CARA-SEVERIN ................................................................... 408
96. IONI Mariana, LYONS E.T., MITREA I.L.
SOME ASPECTS OF PARASITISM IN PINNIPEDS
(MAMMALIA: PINNIPEDIA - MARINE
MAMMALS) .............................................................................................................................................................. 411
97. IVANA Simona, BOGDAN A.T., IONI L., IPATE Iudith, POPESCU A.N.
CAT-SCRATCH DISEASE (CSD) ......................................................................................................................... 416
98. IVANA Simona, BOGDAN A.T., POPESCU A.N., IONI L., Ipate IUDITH
CHERATITA BOXERULUI
BOXER KERATITIS ..................................................................................................................................................................... 421

99. LAZR G.
OBSERVAII ASUPRA FECUNDITII VACILOR IN RAPORT CU ANTECEDENTELE
GINECOLOGICE ..................................................................................................................................................... 424
100. LAZR G.
OBSERVAII PRIVIND CONCORDANA DINTRE INDICII PRODUCTIVI I CEI DE REPRODUCIE
LA VACI (PRODUCIA DE LAPTE) ..................................................................................................................... 428
101. LAZR M., SARLI G., MOU A., LAZR Roxana, VULPE V., OPREAN O.Z.
MORPHOLOGIC OBSERVATION ABOUT DERMOCYSTIDIUM ERSCHOWI IN COMMON CARP
(CYPRINUS CARPIO) ............................................................................................................................................ 432
102. LCTU R.
EXAMENUL RADIOLOGIC AL DENTIIEI LA CABALINE ............................................................................... 435

103. LEAU T., LEAU F., MOLDOVAN Lucia


STIMULAREA PROCESULUI DE REGENERARE EPITELIALA CU AJUTORUL UNUI
FITOCOMPLEX PE SUPORT DE COLAGEN ..................................................................................................... 441
104. MLNCU R. N., TOFAN C. M.
DIAGNOSTICUL PARACLINIC AL HEPATOPATIILOR LA CARNIVORE
PARACLINICAL DIAGNOSTIC OF HEPATIC DISEASES IN CARNIVORA ..................................................................... 444

105. MIRCEAN Viorica, TITILINCU Adriana, COZMA V.


PREVALENA INFECIEI CU CRYPTOSPORIDIUM SPP. LA PISICI ASIMPTOMATICE (FELIS
CATUS) I EVALUAREA COMPARATIV A UNOR METODE DE DIAGNOSTIC
PREVALENCE OF CRYPTOSPORIDIUM SPP. INFECTION IN ASYMPTOMATIC CATS (FELIS CATUS) AND
EVALUATION OF SOME DIAGNOSTIC METHODS............................................................................................................. 447

106. MIRON L., NSTAS V., MARE M.


ANTIFUNGAL THERAPY BASED ON VECTOR TARGETED SYSTEMS...................................................... 452
107. MITREA I.L., IONI Mariana, CONSTANTINESCU F., ONOFREI O., BUZATU M.C.
INCIDENCE OF SOME PARASITIC DISEASES IN SOUTH AND NORTHEASTERN REGIONS OF
ROMANIA
INCIDENA UNOR PARAZITOZE N EFECTIVE DE TAURINE DIN DIFERITE ZONE DIN SUDUL I NORDESTUL ROMNIEI ....................................................................................................................................................................... 454

108. MORAR I., GROZA I., CIUPE Simona, PALL E., VLASIU Teodora
EVALUAREA MORFOLOGIC A OVOCITELOR DE IAP RECOLTATE DUP SACRIFICARE.............. 463
109. MORARIU Florica, MORARIU S.
DINAMICA SEZONIER A CPUEI DERMANYSSUS GALLINAE (DE GEER, 1778) (ACARI:
DERMANYSSIDAE) N FUNCIE DE TEMPERATUR I UMIDITATEA RELATIV
THE DYNAMICS OF RED POULTRY MITE DERMANYSSUS GALLINAE (DE GEER, 1778) (ACARI:
DERMANYSSIDAE) DEPENDING ON TEMPERATURE AND RELATIVE HUMIDITY .................................................. 466

110. MORARIU S., BRIL P., MORARIU Florica, COSOROAB I., DRBU Gh., OPRESCU I.,
MEDERLE Narcisa, ILIE M.
CERCETRI ASUPRA FECUNDITII FEMELELOR DE DERMANYSSUS GALLINAE (DE GEER,
1778) (ACARI: DERMANYSSIDAE) N LABORATOR
RESEARCHES ON THE IN VITRO FECUNDITY OF RED POULTRY MITE DERMANYSSUS GALLINAE (DE
GEER, 1778) (ACARI: DERMANYSSIDAE) ............................................................................................................................ 473

111. MORARU Ramona, MALIC Luminia Iuliana, NSTAS V., MARE M.


UPDATE OF ANTIMICROBIAL RESISTANCE MECHANISMS OF THE MICROORGANISMS ................. 479
112. NAGY gnes, POP Al.
ASPECTE PRACTICE N STRATEGIA PROFILACTIC I TERAPEUTIC A DERMATITEI DE
HIPERSENSIBILIZARE LA NEPTURA DE PURICE (DAPP) LA CINE I PISIC ............................... 483
113. NICULAE Mihaela
PRELIMINARY STUDIES ON THE ANTIBACTERIAL ACTIVITY OF SOME HERBAL EXTRACTIONS
AGAINST CANINE DERMATOPATHOGENS ..................................................................................................... 488
114. OBER C., MUSTE A., OANA L., MATE N., BETEG Fl., VERE S.
SOME CONSIDERATIONS ABOUT USING OF PROSTHETIC BIOMATERIALS IN REPAIR OF
ABDOMINAL WALL DEFECTS IN DOGS ........................................................................................................... 491
115. PAVLI C., ZAMBELLI D.
PROSTATE ANATOMY AND SURGICAL APPROACH IN DOG ..................................................................... 495
116. PISIC (CRIVINEANU) F.M., CODREANU M.D.
STUDIU PRIVIND INCIDENA SINDROAMELOR DE INSUFICIEN URINAR LA CINE I
PISIC
THE STUDY OF SYNDROME INCIDENCE OF RENAL FAILURE ON DOGS AND CATS .......................................... 500

117. PISIC (CRIVINEANU) F.M., PAPUC Camelia, CRIVINEANU Carmen Delia


STUDIUL PRINCIPALILOR PARAMETRII BIOCHIMICI CU VALOARE DE DIAGNOSTIC PENTRU
SINDROMUL HEPATO-URINAR LA CINE I PISIC
THE STUDY OF MAIN BIOCHEMICAL PARAMETERS WITH DIAGNOSIS VALUE FOR HEPATO-RENAL
SYNDROME ON DOGS AND CATS ........................................................................................................................................ 503

118. ROCA P., DRUGOCIU D., RUNCEANU L., CIORNEI ., HROMEI N.


RESEARCHES CONCERNING THE CORRELATIONS BETWEEN THE NUMBER OF SOMATIC
CELLS AND SOME CONSTITUENTS OF THE MILK RESULTED FROM COWS WITH CLINICAL
MAMITIS ................................................................................................................................................................... 505
119. SABU M., SALA A., SCHUSZLER Larisa, DASCLU Roxana, ERE Monica, STRATUL S. I.,
BRATU E., IGNA C.
STABILITY EVALUATION OF METALO-CERAMIC CROWNS FIXED ON DENTAL IMPLANTS IN
DOG .......................................................................................................................................................................... 508
120. SCHUSZLER Larisa, IGNA C., SALA A., SABU M., DASCLU Roxana, ERE Monica
SUBJECTIVE AND OBJECTIVE MONITORING METHODS SIGNIFICANCE, ADVANTAGES AND
LIMITS ....................................................................................................................................................................... 510
121. ERE Monica, SABU M., DASCLU Roxana, SALA A., SCHUSZLER Larisa,
SRNDAN H., IGNA C., CIOCA D., ANGHEL Simona
FULL-THICKNESS SKIN ALLOGRAFT IN IMMUNOTOLERIZED POULTRY .............................................. 515
122. SERE tefania, COZMA V.
CERCETRI PRIVIND INFESTAIA CU CESTODE LA VULPI DIN NORD-VESTUL ROMNIEI
A STUDY ON CESTODE INFECTION OF FOXES IN THE NORTHWESTERN PART OF ROMANIA ....................... 520

123. SOFRONIE Mariana, RUGINOSU Elena, PINTEA M., CREANG t.


INCIDENA I IMPLICAIILE ZOOECONOMICE ALE MAMITELOR LA VACILE DE LAPTE NALT
PRODUCTIVE
INCIDENCE AND ZOOECONOMICALY IMPLICATIONS OF
MASTITIS OF DAIRY COWS HIGH
PRODUCTIVITY............................................................................................................................................................................ 524

124. SOLCAN Gh., SOLCAN Carmen, CARP-CRARE M., ROTINBERG P., BOGHIAN V.,
HRICU Luminia Diana, BECHEA CHIRIAC I.S., ANTON Alina, MOCANU Diana,
BLEJUC Alice-Diana
EFECTUL GLUCANILOR EXTRAI DIN CLAVICEPS PURPUREA ASUPRA UNOR PARAMETRI
PRODUCTIVI I A ESUTULUI LIMFOID ASOCIAT MUCOASELOR LA PUII BROILER
EFFECT OF GLUCANS EXTRACTED FROM CLAVICEPS PURPUREA ON SOME PRODUCTIVE
PARAMETERS AND MUCOSAE ASSOCIATED LYMPHOID TISSUE IN BROILER CHICKENS ............................... 528

125. STEGERAN Brndua, GROZA I., CIUPE Simona, CENARIU M., PALL E.
CERCETRI PRIVIND PROTOCOLUL DE FERTILIZARE IN VITRO A OVOCITELOR BOVINE .......... 534
126. SZAKACS A. R., SZAKACS V. Bianca, SZANTO E., COZMA V.
THE EPIDEMIOLOGY OF PARASITE INFESTATIONS OF PIGS GROWN IN SMALL FARMS FROM
THE NORTH-WEST OF ROMANIA...................................................................................................................... 539
127. TITILINCU Adriana, MIRCEAN Viorica, COZMA V.
SEROPREVALENA INFECIEI CU TOXOPLASMA GONDII LA CAPRE N CENTRUL I NORDVESTUL ROMNIEI
SEROPREVALENCE OF TOXOPLASMA GONDII INFECTION IN GOATS FROM CENTRE AND NORD-WEST
OF ROMANIA ................................................................................................................................................................................ 544

128. TOPAL Roxana, BURTAN I., FNTNARU M., CIOBANU S., BURTAN L.C.
DIAGNOSTICUL OTITEI LA CARNIVORE
DIAGNOSIS OF OTITIS AT CARNIVORES ............................................................................................................................ 548

129. TOPAL Roxana, BURTAN I., FNTNARU M., CIOBANU S., BURTAN L.C.
OPIUNI TERAPEUTICE N OTITA LA CARNIVORE
THERAPEUTIC OPTIONS FOR OTITIS IN CARNIVORA .................................................................................................... 553

130. TUDOR N., VLGIOIU C., GEORGESCU B.


CANINE HYPERTROPHIC OSTEOPATHY ASSOCIATED WITH INTRATHORACIC LESIONS .............. 557
131. TUDOR Poliana, FERNOAG Cristina, TUDOR N.
DIROFILARIOZA CARDIO-VASCULAR LA CINE
HEARTWORM (DIROFILARIA IMMITIS) INFECTION IN DOG ........................................................................................... 560

132. VILARU B.A., OCHEA M., BADEA Ruxandra, OGOE D., ROTARU Elena, DINI D.,
DIACONESCU A., BROIU A.
REZULTATE OBINUTE N URMA TRANSFERULUI DE EMBRIONI LA VACI DIN RASA
MONTBELIARDE .................................................................................................................................................... 563

133. VULPE V., MISIL C., MISIL Elena Rada, VULPE Cristina
RESEARCH CONCERNING THE CLINIC AND PARACLINIC DIAGNOSIS IN THE PATHOLOGIC
ESTATES OF THE FARMING FISH .................................................................................................................... 570

Partea 2a :
Seciunea Producii Animaliere i Sntate Public
134. ALECU Alexandrina 1, TOGOE I.
STUDII PRIVIND IZOLAREA SI IDENTIFICAREA SPECIEI BACILLUS CEREUS DIN PROBE DE
LAPTE PRAF ............................................................................................................................................................ 574
135. AMRICI Mariana, RMBU Cristina, GUGUIANU Eleonora, VOICU Elena, CREU Carmen,
CARP-CRARE M.
ASPECTE PRIVIND CALITATEA MICROBIOLOGICA A LAPTELUI CRUD INTEGRAL, PROVENIT
DINTR-UN JUDET DIN MOLDOVA
ASPECTS REGARDING MICROBIOLOGICAL QUALITY OF INTEGRAL RAW MILK, CAME FROM A
MOLDAVIA COUNTY .................................................................................................................................................................. 580

136. ANDREI Sanda, PINTEA Adela, BUNEA Andrea


INFLUENA METODELOR DE PROCESARE ASUPRA ACTIVITII ANTIOXIDANTE A LAPTELUI
INFLUENCE OF PROCESSING METHODS ON MILK ANTIOXIDANT ACTIVITY ......................................................... 585

137. ANDREESCU Nicoleta, CAPLAN Dana Magdalena, IVANA Simona


LEPTOSPIROZA LA CAINE SI LA STAPANUL ACESTUIA
PET DOG AND OWNER LEPTOSPIROSIS: A CASE STUDY ............................................................................................ 590

138. ANI Adriana Elena


HEPATITA E O NOU ZOONOZ PREZENT N ROMNIA
HEPATITIS E A NEW ZOONOSIS PRESENT ALSO IN ROMANIA ............................................................................... 593

139. ANI D. C., MERTICARIU tefania, SAVUA Gh.


OBSERVAII DINTR-UN FOCAR DE RINOTRAHEITA INFECIOAS BOVIN DIN JUDEUL IAI
OBSERVATIONS FROM AN OUTBREAK OF INFECTIOUS BOVINE RHINOTRACHEITIS IN IAI COUNTY........ 599

140. ANI D. C.
INVESTIGAII SEROEPIDEMIOLOGICE PRIVIND RINOTRAHEITA INFECIOAS BOVIN LA
FERME ORGANIZATE DIN BAZINUL SUCEVEI
SEROEPIDEMIOLOGICAL INVESTIGATIONS REGARDING INFECTIOUS BOVINE RHINOTRACHEITIS IN
FARMS FROM SUCEAVA AREA .............................................................................................................................................. 602

141. APETREI Ingrid Cezara, DULMAN Ozana, COJOCARIU L.C., CARP-CRARE M., MIHAESCU T.
HEMOLYSIS AND CYTOTOXICITY MIGHT BE USEFUL BIOMARKERS OF HUMAN AND ANIMAL
INDOOR FUNGAL EXPOSURE ............................................................................................................................ 605
142. APETREI Ingrid Cezara, DRGNESCU Gilda Eleonora, MANTA Livia Georgiana,
CARP-CRARE M., MIHAESCU T.
FUNGAL GROWTH EVALUATION IN THE INDOOR ENVIRONMENTS OF A LENDING LIBRARIE POSSIBLE RISK FACTOR FOR HUMAN HEALTH ........................................................................................... 611
143. ARDELEAN A.I., SALAGEAN Monica, DUMA Mihaela
THE VALIDATION PROTOCOL USED IN HAEMAGGLUTINATION INHIBITION TESTS FOR AVIAN
INFLUENZA AND NEWCASTLE DISEASE DIAGNOSIS: A PRACTICAL APPROACH .............................. 619
144. ARSENE M.
STUDIU DE CAZ PRIVIND FOCARUL DE GRIPA AVIARA DIN LOCALITATEA MALIUC, JUD.
TULCEA , DIN ANUL 2005
STUDY REGARDING THE FLU BURNING POINT OF MALIUC, TULCEA, 2005 .......................................................... 625

145. ARSENE M., MAFTEI D., ARSENE Marinela


ROLUL PASARILOR MIGRATOARE IN EVOLUTIA INFLUENTEI AVIARE PE TERITORIUL
JUDETULUI TULCEA
THE ROLE OF THE BIRDS IN THE EVOLUTION OF THE INFLUENCE OF BIRDS FLU IN TULCEA ...................... 628

146. ARSENE Marinela


OBSERVATII PRIVIND DISTRIBUTIA SEROTIPULUI LEPTOSPIRA WOLFFI LA OM SI ANIMALE IN
JUDETUL TULCEA
OBSERVATIONS REGARDING THE DISTRIBUTION OF THE SEROTYPE LEPTOSPIRA WOLFFI TO
PEOPLE AND ANIMALS IN TULCEA DISTRICT ................................................................................................................... 633

147. ARSENE Marinela, ARSENE M.


STUDIUL CAZURILOR SEROLOGIC POZITIVE LA BOVINE CU TULPINA LEPTOSPIRA WOLFFI IN
LOCALITATILE DIN DELTA DUNARII
THE STUDY OF THE CASES SEROLOGIC POSITIVE ON THE BOVINE WITH THE STEM OF LEPTOSPIRA
WOLFFI IN THE LOCATIES OF DELTA OF DANUBE ........................................................................................................ 637

148. BARAITAREANU S., BRITREANU Ancua Paula, DANE Doina, BERCEA Ion
STRATEGII DE SUPRAVEGHERE A FeLV N ROMNIA
STRATEGIES OF FeLV SURVEILLANCE IN ROMANIA ..................................................................................................... 641

149. BARAITAREANU S., BRITREANU Ancua Paula, COBZARIU D., BALABAN A.,
CAMPEANU M.V., DANE Doina
MANAGEMENTUL PATOLOGIEI RESPIRATORII INFECTIOASE LA TINERETUL SUIN
YOUNG SWINE MANAGEMENT FOR INFECTIOUS RESPIRATORY PATHOLOGY ................................................... 644

150. BARAITAREANU S., STONE Carla Sydnei, DANE Doina


IMPLEMENTAREA MODELULUI DELAWARE TECH DE INSTRUIRE A TEHNICIENILOR DE
LABORATOR IN ROMANIA
IMPLEMENTATION OF DELAWARE TECH MODEL FOR TECHNICIAN LABORATORY EDUCATION IN
ROMANIA ....................................................................................................................................................................................... 648

151. CAPLAN Dana Magdalena, IVANA Simona, IPATE Iudith


DIAGNOSTIC SI TRATAMENT IN PASTEURELOZA
DIAGNOSIS AND TREATMENT IN PASTEURELOSIS ........................................................................................................ 651

152. BOGOLIN I., VASIU C.


CONTRIBUII LA STUDIUL MASTITELOR CLINICE LA OI I CAPRE ....................................................... 655
153. BOGOLIN I., VASIU C.
UTILIZAREA NUMRULUI DE CELULE SOMATICE N DIAGNOSTICUL MASTITELOR SUBCLINICE
LA OVINE ................................................................................................................................................................. 660
154. VASIU C., BOGOLIN I., CRCIUN Maria, BOLF P.
RESEARCHES ON THE CORRELATION BETWEEN SOMATIC CELLS NUMBER AND MAMMARY
GLAND INFECTION IN GOATS ........................................................................................................................... 666
155. BRIA Gabriela
OBSERVATII PRIVIND POLUAREA APEI CU HIDROXID DE SODIU IN JUDETUL TULCEA
OBSERVATIONS REGARDING THE WATER POLLUTION WITH SODIUM HYDROXYDE IN TULCEA
DISTRICT ....................................................................................................................................................................................... 672

156. BRIA Gabriela, ARSENE Marinela


DETERMINAREA PARAMETRILOR FIZICO-CHIMICI DIN APELE DE SUPRAFATA PRIN METODA
SPECTROFOTOMETRICA
THE DETERMINATION OF THE PHISIC-CHEMICAL PARAMETERS IN THE SURFACE WATERS BY THE
SPECTROFOTOMETRICA METHOD ...................................................................................................................................... 674

157. CADAR D., CSGOLA A., DM D., URSU Krisztina, SPNU Marina, KOBOLKUTI L.,
POPA Virgilia, MICLU V., TUBOLY T.
SYBR GREEN REAL-TIME PCR DETECTION OF PORCINE CIRCOVIRUS TYPE 2 (PCV2) ................. 679
158. CLINA Daniela, RPUNTEAN Gh., FI N., NAD G., CHIRIL F.
CERCETRI PRIVIND IMUNOGENITATEA DERMATOFIILOR DIN GENUL TRICHOPHYTON
RESEARCHES REGARDING IMMUNOGENITY OF DERMATOPHYTES FROM TRICHOPHYTON GENUS ........ 682

159. CTAN N., POPA Virgilia, BUCUR E., FODOR Ionica


CERCETRI EPIDEMIOLOGICE I ANATOMOCLINICE NTR-UN FOCAR DE REOVIROZ LA PUII
DE CARNE
EPIDEMIOLOGICAL AND MORPHOCLINICAL INVESTIGATIONS IN A REOVIROSIS OUTBREAK IN
BROILERS ..................................................................................................................................................................................... 685

160. CTAN R., GROZA I., MORAR I., VLASIU Teodora, CTAN Laura
APRECIEREA CLINIC I PARACLINIC A VALORII REPRODUCTIVE A ARMSARILOR
CLINICAL AND LABORATORY EVALUATION OF STALLION REPRODUCTIVE VALUE ........................................... 689

161. CHIRIL D.
INFLUENA SISTEMULUI DE NTREINERE ASUPRA UNOR INDICATORI BIOCHIMICI DIN
PLASMA SANGVN LA GINILE OUTOARE.................................................................................................. 695
162. COTOR G., GJIL G., GJIL Iuliana, GHI M., TRUA Alina
EVALUAREA INFLUENEI UNOR ADITIVI FURAJERI ASUPRA PARAMETRILOR CANTITATIVI I
CALITATIVI AI SECREIEI LACTATE, LA VAC .............................................................................................. 698
163. CREANG t., MACIUC V., LEONTE C.
CONSERVAREA GENETIC A RASEI SUR DE STEP DE LA S.C.D.C.B. DANCU, JUDEUL IAI
GENETICAL CONSERVATION FOR SURA DE STEPA BREED FROM S.C.D.C.B. DANCU, IASI COUNT ............ 702

164. CREU Carmen, FLORISTEAN V., CARP-CRARE M., BRDAN Gh., IAN Elena
INFLUENA PH-ULUI I TEMPERATURII ASUPRA SPECIEI SALMONELLA SPP. DE PE CARNEA
DE PASRE PROASPT, REFRIGERAT I CONGELAT
THE INFLUENCE OF PH AND TEMPERATURE AGAINST SALMONELLA SPP. GROWTH IN FRESH,
FROZEN AND FREEZING POULTRY CARCASSES ........................................................................................................... 707

165. CUC Cosmina, RPUNTEAN Gh., FI N., CHIRIL F., NAD G., CLINA Daniela
TESTAREA IN VITRO A EFECTULUI INHIBITOR A UNOR PRODUSE APICOLE I EXTRACTE
VEGETALE ASUPRA ALGELOR DIN GENUL PROTOTHECA
THE INHIBITORY EFFECT OF SOME BEE PRODUCTS AND VEGETAL EXTRACTS UPON PROTOTHECA
ALGAE IN VITRO GROWTH ...................................................................................................................................................... 711

166. CUMPNOIU C., TRZIU E., NICHITA Ileana, GROS R.V., SRBU Cristina
CHANGES OF THE SANGUINE PARAMETERS IN IMMUNOSUPPRESSED MICE INFECTED WITH
Y. ENTEROCOLITICA ............................................................................................................................................ 715
167. CUMPNOIU C., TRZIU E., CUMPNOIU C.E., CEAUESCU A.
INCIDENCE AND PREVALENCE OF SALMONELLA SPP. INFECTIONS IN BIRD POPULATIONS
FROM VLCEA COUNTY ...................................................................................................................................... 718
168. DAMACEANU Ani, MARCU Elena
INVESTIGAII PRIVIND MODIFICRILE PARAMETRILOR HEMATOLOGICI
DIAGNOSTICATE SEROPOZITIV PENTRU VIRUSUL LEUCOZEI BOVINE (VLB)

LA

TAURINE

INVESTIGATIONS ON HEMATOLOGICAL PARAMETERS MODIFICATION IN CATTLE POSITIVELY


DIAGNOSED WITH THE BOVINE LEUKOSIS VIRUS (BLV) .............................................................................................. 721

169. DAMIAN A., GUDEA Al., LISOVSCHI C., STAN F., TUNS M.F.
ARCHAEZOOLOGICAL STUDIES OF INFERIOR PANNONIA - A ROMAN PROVINCE NEXT TO
DACIA ..................................................................................................................................................................... 725
170. DANE Doina, BARAITAREANU S., COBZARIU D., DANE M.
ACTUALITATI IN DIAGNOSTICUL PARVOVIROZEI CANINE SI BOLII CARR
ACTUALITIES IN CANINE PARVOVIROSIS AND CANINE DISTEMPER ....................................................................... 731

171. DRGAN G., CARP-CRARE C., CARP-CRARE M.


CERCETRI BACTERIOLOGICE PRIVIND PREZENA SEROTIPULUI ESCHERICHIA COLI O157 :
H7 N CARNE I PRODUSE DE CARNE............................................................................................................. 734
172. DRGAN G.
CERCETRI PRIVIND IZOLAREA I IDENTIFICAREA SEROTIPULUI ESCHERICHIA COLI O157 : H7
DIN MATERII FECALE DE BOVINE ..................................................................................................................... 738
173. FI N., RPUNTEAN Gh., SPNU Marina, ANDRU Carmen Dana, UTEU E., NAD G.
DINAMICA UNOR FACTORI UMORALI AI IMUNITII NESPECIFICE N MIAZA CUTANAT
INDUS EXPERIMENTAL LA OVINE
HUMORAL NONSPECIFIC IMMUNITY FACTORS DYNAMIC IN EXPERIMENTALLY INDUCED FLY STRIKE
IN SHEEP....................................................................................................................................................................................... 742

174. FI N., RPUNTEAN Gh., UTEU E., NAD G., CLINA Daniela, ACHELRIEI D.
VARIAIA EFECTORILOR CELULARI DE APRARE NESPECIFIC N MIAZA CUTANAT INDUS
EXPERIMENTAL LA OVINE
VARIATION OF THE NONSPECIFIC DEFENSE CELL EFFECTORS IN EXPERIMENTALLY INDUCED
BLOWFLY STRIKE IN SHEEP ................................................................................................................................................... 746

175. GJIL G., GJIL Iuliana, COTOR G.


AMPLIFICAREA RASPUNSULUI IMUN MEDIAT CELULAR CU AJUTORUL UNUI ADJUVANT
VACCINAL CU PROPRIETATI IMUNOMODULATARE .................................................................................... 751
176. GAPAR C-tin. V., GAPAR C., GAPAR G.
THE STANDARD OF THE BUCOVINA ROMANIAN SHEPHERD DOG BREED ......................................... 755
177. GAPAR C-tin. V., GAPAR C., GAPAR G.
THE BECOMING OF THE BUCOVINA ROMANIAN SHEPHERD DOG BREED ......................................... 761
178. GONCEAROV Magdalena, TUDOR L., MITRNESCU Elena
ASPECTE LEGALE, PRINCIPII I STANDARDE
PRIVIND OBINEREA PRODUSELOR
AGROALIMENTARE ECOLOGICE, DE LA ANIMALE
LEGAL ASPECTS, PRINCIPLES AND STANDARDS REGARDING THE OBTAINING OF ECOLOGIC
PRODUCTS FROM ANIMALS ................................................................................................................................................... 769

179. GONCEAROV Magdalena, MITRNESCU Elena, TUDOR l.


CONSIDERAII PRIVIND REGLEMENTRILE VETERINARE ARMONIZATE SAU RATIFICATE DE
ROMANIA, CE PRIVESC PROTECIA ANIMALELOR
CONSIDERATIONS REGARDING THE VETERINARY REGLEMANTATIONS ARMONISED OR DEVELOPED
BY ROMANIA FOR THE ANIMALS PROTECTION ............................................................................................................... 772

180. IPATE Iudith, BOGDAN A.T., IVANA Simona, CAPLAN Magdalena, STRATEANU Amalia,
PARASCHIVESCU M., COSTACHE Delia
BIODIVERSITATEA STEREOMICROSCOPICA A BACTERIILOR DIN GENURILE LEPTOSPIRA SI
PASTEURELA ......................................................................................................................................................... 775
181. IVANA Simona, CAPLAN Dana Magdalena, BOGDAN A.T., POPESCU A.N., IONI L., IPATE Iudith
BIODIVERSITATEA PRINCIPALELOR GENURI DE DROJDII I MUCEGAIURI DIN ALIMENTE
THE BIODIVERSITY OF THE MAIN MOLDS AND YEASTS IN FOODS .......................................................................... 792

182. LENGKEY Hendronoto A. W Y., OGOE I., TABAC B. A., BALIA Rostita L.
ISOLATION AND IDENTIFICATION OF LACTOBACILLUS FROM MEAT FOR USE AS A
BIOPRESERVATIVES IN MEAT AND MEAT PRODUCTS .............................................................................. 800
183. LUDU Luanda, COURBEYRETTE Karine, SAVUA Gh., CHARNEAU Pierre
REZULTATE PRELIMINARE PRIVIND UTILIZAREA UNUI NOU VACCIN BAZAT PE VECTORI
LENTIVIRALI PENTRU PREVENIREA INFECIILOR DETERMINATE DE VIRUSUL WEST NILE LA
CABALINE
PRELIMINARY RESULTS REGARDING THE USE OF A NEW LENTIVIRAL VECTOR BASED VACCINE FOR
THE PREVENTION OF WEST NILE DISEASE IN HORSES ............................................................................................. 804

184. MACIUC V., CREANG t., NACU G.


CONTRIBUII LA STUDIUL SISTEMELOR POLIMORFE PROTEICE N SNGE I LAPTE LA O
POLUAIE DE TAURINE B.N.R.
CONTRIBUTION ON STUDY REGARDING PROTEICAL SYSTEMS FROM BLOOD AND FROM MILK TO A
BNR POPULATION ...................................................................................................................................................................... 808

185. MACIUC V., NACU G., IACOB C.


STUDIUL PRINCIPALELOR CARACTERE MORFOPRODUCTIVE LA O POPULAIE DE TAURINE
DE TIP FRIZ DIN NORDUL ROMNIEI
STUDY REGARDING THE PRINCIPAL MORPHO-PRODUCTIVE CHARACTERS TO A FRIESEN
POPULATION FROM ROMANIAN NORTH AREA ................................................................................................................ 812

186. MRCULESCU Anca, RPUNTEAN Gh., OROS N. A., CERNEA M., CHEREJ R.I.
STUDIEREA SINERGISMULUI N CAZUL ASOCIERII CEFTIOFUR-GENTAMICIN ASUPRA UNOR
GERMENI DIN GENUL ENTEROBACTER ........................................................................................................ 817
187. MRCULESCU Anca, RPUNTEAN Gh., OROS N. A., CERNEA M., NUELEANU Veturia,
CHEREJ R.I.
ANALIZA FENOMENULUI DE ANTIBIOREZISTEN A UNOR GERMENI GRAM-POZITIVI FA DE
PENICILIN ............................................................................................................................................................. 820

188. MATEI Gabriela Florina, VASILESCU Clara, POPESCU Cristina Tudoria, SEVASTRU Andreea,
ONANU Gh.
PROGRAM CADRU PRIVIND UN STUDIU PRELIMINAR PENTRU
DETERMINAREA
PREVALENEI SALMONELLA LA GINILE OUTOARE
FRAMEWORK ON BASELINE STUDY ESTABLISHING SALMONELLA PREVALENCE IN LAYING HENS............ 824

189. MIHALACHI Simona, MUSTEA M., ACATRINEI D., TNASE Irina-Oana, PERIANU T.
THE RAPID DIAGNOSIS OF CANINE DISTEMPER USING THE RAPIGEN DISTEMPER AG TEST ..... 832
190. MITRNESCU Elena, TAPALOAGA Dana, FURNARIS F., TUDOR L., ROTARU Elena,
SIMION Violeta
ASSESSMENT OF MICROBIAL DECONTAMINATION EFFICIENCY BY FINK-ANTISEPT A
PRODUCTS .............................................................................................................................................................. 835
191. NAD G., RPUNTEAN Gh., FI N., RPUNTEAN S., CHIRIL F., CUC Cosmina, CLINA Daniela
LEVURILE GENULUI MALASSEZIA: ASPECTE PRIVIND IZOLAREA I PATOGENITATEA LA
CINE
GENUS MALASSEZIA YEAST: ASPECTS REGARDING ISOLATION AND PATHOGENITY IN DOGS ................... 838

192. NECULI C., CHIRIAC Adriana Gabriela, CARP-CRARE M.


SENSIBILITATEA I SPECIFICITATEA UNOR TESTE
DIAGNOSTICUL INFECIEI CU BRUCELLA OVIS

SEROLOGICE

UTILIZATE

SENSIBILITY AND SPECIFICITY OF SOME SEROLOGIC TESTS USED FOR BRUCELLA OVIS INFECTION
DIAGNOSIS ................................................................................................................................................................................... 842

193. NECULI Elena Narcisa, FLORISTEAN V., CREU Carmen, CARP-CRARE M.


OBSERVAII PRIVIND INFLUENA CONDIIILOR DE PRELUCRARE ASUPRA MICROFLOREI
CARCASELOR DE PASRE NTR-UN ABATOR RECENT MODERNIZAT
OBSERVATIONS CONCERNING THE INFLUENCE OF PROCESSING STEPS ON POULTRY CARCASS
MICROFLORA IN A RECENTLY MODERNIZED ABATTOIR ............................................................................................. 846

194. NECULI Elena Narcisa, FLORISTEAN V., CREU Carmen, CARP-CRARE M.


OBSERVAII PRIVIND MICROFLORA AERULUI NTR-UN ABATOR DE PSARI RECENT
MODERNIZAT
OBSERVATION CONCERNING AIRBORNE MICROFLORA FROM IN A RECENTLY MODERNIZED
POULTRY ABATTOIR ................................................................................................................................................................. 851

195. OLELEU Ana-Maria, RPUNTEAN Gh., OLELEU I.


ASPECTE EPIDEMIOLOGICE PRIVIND INFECIA CU BRUCELLA OVIS N JUDEUL CLUJ
EPIDEMIOLOGICAL ASPECTS OF BRUCELLA OVIS INFECTION IN THE AREA OF CLUJ COUNTY.................. 856

196. ONAC Diana, TITILINCU Adriana, COZMA V.


DIAGNOSTICUL COMPARATIV AL HIDATIDOZEI LA BOVINE SACRIFICATE N ABATOR.................... 861
COMPARATIVE DIAGNOSTIC OF HIDATIDOSIS IN BOVINES SACRIFICED IN ABATTOIR ..................................... 861

197. PANAGACHI-T. (Gogu) Mihaela, COMAN I., MIRON L., TARU Liliana, BOMPA C., GOGU P.
CUNNINGHAMELLA SPP. MICROMICET CU POTENIAL PATOGEN IZOLAT N PREMIER N
ARA NOASTR ............................................................................................................................................................................. 865
198. PETCU Carmen Daniela, SAVU C., NEAGU Iuliana, TAPALOAGA Dana, MANTA Cristina
PARTICULARITILE UNOR PROGRAME PRELIMINARE DINTR-O UNITATE DE PRELUCRARE A
PETELUI
FEATURES OF SOME PRELIMINARY PROGRAMMES IN A FISH PROCESSING UNIT .......................................... 872

199. PVLEAN D., RPUNTEAN Gh., RPUNTEAN S.


ASPECTE EPIDEMIOLOGICE PRIVIND BOALA EDEMELOR LA SUINE N AREALUL JUDEULUI
BISTRIA NSUD
EPIDEMIOLOGICAL ASPECTS REGARDING OEDEMA DISEASE IN PIGS IN THE AREA OF BISTRIA
NSUD COUNTY ..................................................................................................................................................................... 879

200. PVLEAN D., RPUNTEAN Gh.


SENSIBILITATEA LA ANTIBIOTICE A UNOR TULPINI DE E. COLI IZOLATE DE LA PURCEI CU
BOALA EDEMELOR
SENSITIVITY TO ANTIBIOTICS OF SOME E. COLI STRAINS ISOLATED FROM PIGS WITH OEDEMA
DISEASE ........................................................................................................................................................................................ 887

201. POPESCU Raluca, HORHOGEA Cristina, PERIANU T.


ASPECTS REGARDING CLINICOPATHOLOGICAL INVESTIGATIONS OF PRIMARY MAEDI-VISNA
VIRUS INFECTION ................................................................................................................................................. 893
202. POPESCU Raluca , HORHOGEA Cristina, PERIANU T.
INVESTIGATIONS REGARDING SEROLOGICAL SURVEILLANCE FOR MAEDI-VISNA VIRUS IN
SHEEPS ................................................................................................................................................................... 897
203. RPUNTEAN S., RPUNTEAN Gh., CHIRIL F., FI N., NAD G.
CARACTERIZAREA MORFOLOGIC, CULTURAL I BIOCHIMC A UNOR TULPINI DE
NEISSERIA SP., IZOLATE DE LA ANIMALE ..................................................................................................... 902
204. RMBU Cristina, GUGUIANU Eleonora, REBEGEA Cristina, CREU Carmen, CARP-CRARE C.,
CARP-CRARE M.
RESEARCHES REGARDING THE INFLUENCE OF SOME FACTORS, INVOLVED IN THE
EMERGENCE OF DOGS AND CATS BACTERIAL STOMATITIS .................................................................. 909
205. ROTARU Elena, MITRNESCU Elena, TAPALOAGA Dana, TUDOR L., FURNARIS F., DINI I.,
IONESCU G.
RESEARCHES REGARDING THE MILKING SYSTEM INFLUENCE UPON COW MILK QUALITY......... 913
206. SLCEANU Ionela, PERIANU T., JELEA Ctlina
OBSERVAII PRIVIND INCIDENA ANEMIEI INFECIOASE ECVINE N JUDEUL IAI ....................... 917
207. SIBECHE Gabriela, CREU Carmen, RMBU Cristina, CARP-CRARE M.
IZOLAREA I IDENTIFICAREA SPECIEI CLOSTRIDIUM PERFRINGENS DE PE CARCASELE DE
BOVINE, OVINE, SUINE I PSRI
ISOLATION AND IDENTIFICATION OF CLOSTRIDIUM PERFRINGENS ON CATTLE, SHEEP, SWINE AND
POULTRY CARCASSES ............................................................................................................................................................ 920

208. SIBECHE Gabriela, CIOBANU G., CREU Carmen, RMBU Cristina, CARP-CRARE M.
ISOLATION AND IDENTIFICATION OF CLOSTRIDIUM PERFRINGENS ON RAW MILK AND
PROCESSING MILK DESTINED TO HUMAN CONSUMED ........................................................................... 924
209. SIMEANU D., GAVRILA Angela
CERCETRI PRIVIND HRNIREA BROILERILOR DE GIN CU NUREURI COMBINATE FR
BIOSTIMULATORI I EXPERIMENTAREA UNOR DENSITI DIFERITE LA POPULARE
RESEARCHES CONCERNING THE CHICKEN BROILERS FEEDING WITHOUT THE USAGE OF BIOGROWTH PROMOTERS AND THE EXPERIMENTATION OF SEVERAL BROODING DENSITIES ......................... 927

210. SIMEANU D., GAVRILA Angela


CERCETARI PRIVIND IMBUNATATIREA CALITATII GALBENUSULUI OUALOR DE CONSUM
RESEARCHES RELATED TO THE IMPROVEMENT OF CONSUMPTION EGGS YOLK QUALITY .......................... 933

211. SIMION Violeta, MITRNESCU Elena, TAPALOAGA Dana, FURNARIS F., BUSTANI S.
ASSESSMENT OF FUNGI AND MYCOTOXINS CONTAMINATION INFLUENCE ON NUTRITIVE
VALUE OF SOME CONCENTRATE FORAGES AND CORN SILAGE .......................................................... 938
212. SPNU Marina, ANDRU Carmen Dana, BRUDAC Gh. F., DUCA Gh.
EVALUAREA INFLUENEI SISTEMULUI DE EXPLOATARE ASUPRA REACTIVITII IMUNE
CELULARE NESPECIFICE ................................................................................................................................... 942
213. STARCIUC N.
MODIFICRI MORFOPATOLOGICE I HISTOPATOLOGICE SPECIFICE N CAZUL BURSITEI
INFECIOASE AVIARE ......................................................................................................................................... 947
214. TIRBU-TEOFNESCU Beatrice, MILITARU D., MILITARU Manuella, DIACONU Ioana
SUPRAVEGHEREA TOXOPLASMOZEI LA PORCINE PRIN DETECTIA ANTICORPILOR DE TIP
IgG, UTILIZAND TESTUL IMUNOENZIMATIC
SURVEILLANCE OF PORCINE TOXOPLASMOSIS THROUGH IGG TYPE ANTIBODIES DETECTION BY
IMMUNOENZYMATIC TEST ...................................................................................................................................................... 950

215. STREJA Adriana, CARP-CRARE M.


CERCETRI PRIVIND VACCINAREA CU VACCIN INACTIVAT MIPRAVAC N EFECTIVE DE GINI
DE REPRODUCIE
RESEARCHES REGARDING VACCINATION WITH INACTIVATED VACCINE MIPRAVAC IN
REPRODUCTION POULTRY EFFECTIVE ............................................................................................................................. 953

216. TNASE Irina-Oana, PAVLI C., PERIANU T.


IMPACTUL ECONOMIC AL SINDROMULUI RESPIRATOR I DE REPRODUCIE N CRETEREA
SUINELOR
PRRS ECONOMIC IMPACT IN INTENSIVE BREADING SWINE HEARDS .................................................................... 957

217. IBRU I., RDUCANU Andrada


LAMINITELE INDICATOR DE APRECIERE A BUNSTRII ........................................................................ 960
218. IBRU I., CTAN N.
PROTECIA PUILOR DE CARNE CU AJUTORUL ACIDIFIANILOR ........................................................... 963
219. TRZIU E., CUMPNOIU C., NICHITA Ileana, GROS R.V.
STUDY OF THE IMMUNOSUPPRESSIVE EFFECT OF SOME MYCOTOXINS ON BROILERS .............. 966
220. OGOE I., TUDOR L., CRCIUN GABRIELA, TUDOR ANETA LAURA
THE EVALUATION OF IMMUNOGENIC CAPACITY OF AN INACTIVATED ANTI-FUSOBACTERIUM
NECROPHORUM VACCINE ................................................................................................................................. 969
221. TOGOE I., TUDOR L., GALIS Anca Maria, CALIN Mihaela Antonina
THE PHOTODYNAMIC INACTIVATION APPLICATION FOR GRAM-POSITIVE AND GRAMNEGATIVE BACTERIA ........................................................................................................................................... 974
222. TSOMPANELLIS E., FLORISTEAN V., INDILAR E.V.
OBSERVATION CONCERNING THE DEGREE OF POLLUTION WITH ARSENIC AND HEAVY
METALS OF SHEEP AND GOAT MILK ............................................................................................................... 978
223. TSOMPANELLIS E., FLORISTEAN V., INDILAR E.V.
OBSERVATIONS CONCERNING SEASONAL VARIATION OF SOMATIC CELL COUNT IN SHEEP
AND GOAT MILK ..................................................................................................................................................... 982
224. TUDOR L., OGOE I., MITRNESCU Elena, FURNARIS F., GONCEAROV Magdalena
THE ASSESSMENT OF MICROBIOLOGICAL QUALITY OF SOME CHEESE ASSORTMENTS ............. 987
225. TUDOR L., OGOE I., MITRNESCU Elena, TUDOR Laura Aneta
YERSINIA ENTEROCOLITICA RAPID METHOD FOR ISOLATION AND IDENTIFICATION FROM
FOOD PRODUCTS ................................................................................................................................................. 992
226. TURCITU M.A., COSTE Handan, ALEXANDRU N., CODREANU Iuliana, CODREANU M.D.,
OLARU Irina, TAMBA Paula, ZYBACZYNSKI Iulia
EVALUAREA TEHNICILOR DE BIOLOGIE MOLECULAR PENTRU IDENTIFICAREA
VARIABILITII GENETICE A PROTEINEI PRIONICE LA EFECTIVELE DE OVINE
EVALUATION OF MOLECULAR BIOLOGY TECHNIQUES FOR PRIONIC PROTEIN GENETIC VARIABILITY
IDENTIFICATION IN SHEEPS ................................................................................................................................................... 998

227. TURCITU M.A., COSTE Handan, CIORANU Raluca, NICOLAE t., BRBOI Gh., ONI Iuliana,
NEAGOE Graziela, NEICU Adriana, SANDU Ana
USE OF MOLECULAR BIOLOGY TECHNIQUES FOR IDENTIFICATION AND CHARACTERIZATION
OF NEWCASTLE DISEASE VIRUS ................................................................................................................... 1003
228. VTESCU-BALCAN R.A., GEORGESCU S.E., MANEA Maria Adina, DINISCHIOTU Anca,
TESIO C.D., COSTACHE Marieta
ROMANIAN DAIRY CATTLE GENOTYPES...................................................................................................... 1007
229. VELESCU Elena, PERIANU T., TNASE Irina-Oana, PAVLI C., ANI D. C., ANI Adriana Elena,
MIHALACHI Simona
PROFILAXIA SPECIFIC A PODODERMATITEI INFECIOASE LA RUMEGTOARE, PRODUS
DE FUSOBACTERIUM NECROPHORUM, PRIN UTILIZAREA ELECTRONILOR ACCELERAI I A
MICROUNDELOR
THE SPECIFIC PROPHYLAXIS FOR THE INFECTION WITH FUSOBACTERIUM NECROPHORUM IN
BOVINES, USING ACCELERATED ELECTRONS AND MICROWAVES ....................................................................... 1010

230. VLAD-SABIE Alina, CARP-CRARE M., BRDAN Gh., CREU Carmen


CERCETRI PRIVIND PREZENA SPECIILOR E. COLI I SALMONELLA SPP. DE PE
CARCASELE DE BOVINE I SUINE
RESEARCH REGARDING THE PRESENCE OF THE E. COLI AND SALMONELLA SPP. OF THE BOVINE
AND SWINE CARCASSES....................................................................................................................................................... 1012

231. VOICU Elena, CARP-CRARE M., AMRICI Mariana, VOLOENIUC M.


APRECIEREA CALITII IGIENICE A LAPTELUI DE CAPR PRIN DETERMINAREA NUMRULUI
DE CELULE SOMATICE I A NUMRULUI TOTAL DE GERMENI
QUALITY CONTROL OF GOAT MILK USING TOTAL GERM AND SOMATIC CELL COUNT ..................................1016
232. VOICU Elena, SOLCAN Carmen, CARP-CRARE M.
RESEARCHES REGARDING CYTOMORPHOLOGY IN SHEEP MILK....................................................... 1019
233. VU V., BRBOI Gh., TURCITU M.A., OLVEDI Irina, BONCEA D., ORANU Adriana,
ALEXANDRU N., NICOLAE t.
THE EVALUATION OF EARLY METHODS OF DIAGNOSIS FOR THE BLV INFECTION ....................... 1022

Lucrri tiinifice vol. 51 seria Medicin Veterinar

EFFECTIVE TEACHING AND LEARNING STRATEGIES AND


INTERNET-BASED RESOURCES FOR VETERINARY BASIC
MEDICAL SCIENCES
ABDELFATTAH Nour
School of Veterinary Medicine, Purdue University, West Lafayette,USA
Although distance education has been around for many years in the form of correspondence
courses, videotaped lectures, and so on, its real popularity began when the Internet. The Internet
has increasingly become an effective and accessible delivery mechanism for distance education.
Apart from text-based materials, the Internet provides an easy means to transmit images, sound,
video, and other multimedia content to a global audience, thus lending itself as a medium for
establishing distance learning programs.
The growth in available online courses and their increased convenience and flexibility have
stimulated dramatic increases in enrollment in online programs. Regardless of the obvious
benefits, distance learning (DL) can be frustrating for the learners if course developers are unable
to merge their knowledge about the learners, the process of instructional design, and the
appropriate uses of technology and interactivity options into effective course designs.
This presentation describes the features of our course websites and summarizes our
experiences in designing and conducting web-based courses to distance learners. Our distance
learning courses have been designed through the collaborative work of content experts, an
instructional designer, graphic designer, and media specialist. Together, we worked to design a
course site that was easy to navigate and to access the various topics under study. For example,
the course home page includes links to the following: Getting started, Syllabus, Course goals,
Chapter learning modules (including the specific learning objectives and content for each
chapter), Assignments, Exams, Students, Feedback, Calendar, Glossary, and Bulletin Board. The
navigation bars facilitate navigation through the course site. Examples in this presentation were
largely drawn from DL physiology courses, as well as Foreign Animal Diseases web site that we
designed for the International Veterinary Medicine course.
The presentation also addresses creating opportunities for instructional interactions, defined
here as exchanges between learners and the instructional environment (including the content,
instructor, and peers) that lead to changes in students behaviors, thinking, or capabilities which
then enable them to accomplish specific learning goals. The presentation describes strategies that
we have used to increase students learning of physiology content in an online environment.
While some of these are similar, if not identical, to strategies that might be used in a face-to-face
(FTF) environment (e.g. case studies, videos, concept maps), additional strategies (e.g.
animations, virtual microscope) are needed to replace or supplement what might normally occur
in a FTF course. It describes our experience in addressing students needs for instructional
interactions, specifically in basic medical sciences. Although the teaching and learning strategies
we have used have led to increasingly high levels of interaction, there is an ongoing need to
evaluate these strategies to determine their impact on students learning of the basic medical
sciences content, the development of problem solving skills, and the retention of information.

Universitatea de tiine Agricole i Medicin Veterinar

Seciunea Clinici

Lucrri tiinifice vol. 51 seria Medicin Veterinar

CONINUTUL DE CUPRU I ZINC DIN NUTREURI FOLOSITE


PENTRU HRANA VACILOR DE LAPTE
COPPER AND ZINC CONTENT IN DAIRY COW FEEDS
ALBU Aida1, POPESCU O.1, ]RC Felicia2, POP Cecilia1, POP I.M.1
1USAMV Iai
2DSVSA Iai
Copper and zinc are two of essential nutrients for plant growth and often also for food and
feed quality. Copper and zinc are two trace metals whose high level residues in feeds are
potentially hazardous to animals and humans.
The goal of the present work was the evaluation of their feed residues in a dairy cow farm
during 2007 and of their toxic potential to animals.
Sixty samples of grass, vetch, alfalfa, Sudan grass, alfalfa hay, hay, corn silage, corn meal,
bran, sunflower meal, brewery dregs and mixed cereal meal were analyzed to evaluate the two
metal residues in feeds. Copper and zinc contents were assesed using atomic absorbtion
spectrofotometry method in flame.
The results shown that all analyzed samples contained copper and zinc residues in detectable
amounts. The mean values of the residues ranged from 0.3040.01 mg/kg in brewery dregs to
3.8950.02 mg/kg in alfalfa for copper and from 0.0890.001 mg/kg in bran to 2.8360.007
mg/kg in brewery dregs. The results are expressed in mg/kg related to dry matter.
Key words: copper, zinc, fodders, dairy cows

Microelementele sunt eseniale pentru dezvoltarea plantelor deoarece sunt consumate att
de animale ct i de oameni. Cantitatea de microelemente preluate din sol de ctre rdcinile
plantelor variaz i depinde de mai muli factori: proprietile fizico-chimice ale solului, specia
plantelor, forma anorganic sau organic sub care se gsete microelementul etc.; preluarea unei
mici cantiti de microelemente creeaz un deficit iar preluarea unei cantiti excesive cauzeaz
toxicitate (3, 4, 5).
Cupru i zincul sunt eseniale att pentru animale ct i pentru oameni; cuprul intr n
structura unor enzime din grupa oxidazelor, condiioneaz oxidarea fierului, are rol de catalizator n
formarea hemoglobinei, particip la formarea scheletului, prului etc.; zincul este component al mai
multor enzime, este necesar pentru sintetizarea acizilor nucleici, intervine n schimburile respiratorii
etc (6).
Dei sunt elemente necesare vieii, Cu i Zn prezint un grad ridicat de acumulare i
concentrare n organism. Aciunile Cu i Zn n organism, prin scderea sau creterea concentraiilor,
sunt determinate de interrelaiile pe care le au cu prezena i nivelul concentraiei celorlalte
elemente: Cu are o aciune sinergic cu Fe, antagonic cu Mo, Ca, Zn, Cd, Pb etc.; Zn are aciune
sinergic cu Fe i S, antagonic cu Ca, P, Cu (9,10).
Deficitul de cupru n hran, la rumegtoare se manifest prin simptome caracteristice:
decolorarea prului, tulburri cardiace, de reproducie, stagnri n cretere, anemie, osteopatie etc.
Ingerarea unei cantiti n exces de cupru produce apatie, anorexie, pierdere n greutate, icter
hemolitic etc., n special la oaie.
Carena Zn provoac paracheratoze, determin ncetinirea creterii, cderea prului,
inflamarea mucoaselor nazale i bucale. Rumegtoarele tolereaz concentraii mari de zinc, dar n
exces poate produce intoxicaii manifestate prin stri de oboseal, pierderea apetitului, diaree etc (1,
2).
Coninutul n minerale a nutreurilor este variabil i depinde de foarte muli factori.
Determinarea chimic a mineralelor din nutreuri duce la ntocmirea unei raii complete i corecte.
Scopul cercetrilor prezente a fost de a evalua coninutul de cupru i zinc din nutreurile
produse i folosite n anul 2007 la o ferm de vaci de lapte din judeul Iai.
MATERIAL I METOD
Cercetrile prezentate n aceast lucrare au avut drept scop evaluarea coninutului de cupru i
zinc din unele nutreuri folosite n hrana vacilor de lapte dintr-o ferm din judeul Iai.
3

Universitatea de tiine Agricole i Medicin Veterinar


Investigaiile s-au efectuat n anul 2007 pe un numr de 60 probe: pune natural, borceag,
lucern, iarb de Sudan, fn de lucern, fn natural, siloz de porumb, porumb boabe, tre de gru,
rot de floarea soarelui, borhot de bere, amestec de ferm.
Recoltarea i pregtirea probelor de nutreuri pentru analiz s-a fcut cu respectarea normelor
prevzute n standardele actuale (SR ISO 6498:1999) i a normelor sanitar-veterinare n vigoare.
Probele au fost calcinate la 500C, iar cenua rezultat, splat cu HCl i ap distilat, a fost
adus la un volum convenabil pentru a putea fi citit la aparat.
Determinarea coninutului de Cu i Zn din probe s-a fcut prin metoda spectrofotometriei de
absorbie atomic (AAS) n flacr cu arztor alimentat cu un amestec de acetilen-aer care asigur o
temperatur de max. 2250C. Pentru trasarea curbelor de etalonare s-a folosit metoda citirilor cu
substanele de referin pentru fiecare element. Din curba de etalonare s-a determinat concentraia
probei necunoscute. Lungimea de und folosit pentru determinarea prin spectrofotometrie de
absorbie atomic a Cu a fost de 324.7 nm, iar pentru Zn a fost de 213.9 nm. Rezultatele au fost
exprimate mg/kg (ppm) prin raportare la substana uscat a nutreurilor.
REZULTATE I DISCUII
Rezultatele analizelor cu privire la coninutul mediu de cupru i zinc din nutreurile analizate
sunt prezentate n tabelele 1 i 2 i reprezentate n fig.1 i 2.
Tabel 1 Coninutul mediu de cupru n nutreuri (mg/kg la s.u.)
Nr.
crt.
1
2
3
4
5
6
7
8
9
10
11
12

Proba

Nr. probe

X sx

V%

Pune natural
Borceag
Lucern
Iarb de Sudan
Fn de lucern
Fn natural
Siloz de porumb
Porumb boabe
Tre de gru
rot floarea soarelui
Borhot de bere
Amestec furaj

5
5
5
5
5
5
5
5
5
5
5
5

2.2790.017
2.0350.012
3.8950.020
1.7590.009
2.6120.010
1.8550.006
1.8480.010
1.1050.013
3.3930.012
2.2560.007
0.3040.010
2.1760.007

0.037
0.027
0.045
0.020
0.021
0.013
0.023
0.029
0.028
0.016
0.023
0.016

1.645
1.305
1.158
1.147
0.815
0.727
1.225
2.605
0.821
0.727
7.622
0.749

mg/kg

3,895
4,5
3,393
4
3,5
2,612
3 2,279
2,256
2,176
2,035
1,8551,848
2,5
1,759
2
1,105
1,5
0,304
1
0,5
0

a-Pune natural
b-Borceag
c-Lucern
d-Iarb de Sudan
e-Fn de lucern
f-Fn natural
g-Siloz de porumb
h-Porumb boabe
i-Tre de gru
j-rot floarea soarelui
k-Borhot de bere
l-Amestec furaj

Fig. 1 Coninutul mediu de cupru n nutreuri (mg/kg la s.u.)

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Tabel 2 Coninutul mediu de zinc n nutreuri (mg/kg la s.u.)
Nr.
crt.
1
2
3
4
5
6
7
8
9
10
11
12

Proba

Nr probe

X sx

V%

Pune natural
Borceag
Lucern
Iarb de Sudan
Fn de lucern
Fn natural
Siloz de porumb
Porumb boabe
Tre de gru
rot floarea soarelui
Borhot de bere
Amestec furaj

5
5
5
5
5
5
5
5
5
5
5
5

1.2460.004
2.2780.008
2.3810.013
2.6520.007
0.0960.001
0.4210.001
2.7280.005
0.9170.004
0.0890.001
1.6590.001
2.8360.007
1.5130.002

0.009
0.017
0.028
0.017
0.002
0.003
0.011
0.009
0.002
0,002
0.017
0.006

0.727
0.751
1.187
0.629
1.647
0.782
0.408
0.957
2.594
0.127
0.587
0.369

3,5

mg/kg
2,278 2,381

2,5
1,5

1,659

1,246

1,513

0,917

0,421
0,096

0,5
-0,5

2,836

2,728

2,652

0,089

a-Pune natural
b-Borceag
c-Lucern
d-Iarb de Sudan
e-Fn de lucern
f-Fn natural
g-Siloz de porumb
h-Porumb boabe
i-Tre de gru
j-rot floarea soarelui
k-Borhot de bere
l-Amestec furaj

Fig. 2 Coninutul mediu de zinc n nutreuri (mg/kg la s.u.)

Coninutul mediu de cupru din nutreurile analizate a variat ntre 0.3040.01 mg/kg la
borhotul de bere i 3.8950.02 mg/kg la lucern. Un coninut mare de cupru s-a gsit i n tre de
gru de 3.3930.012 mg/kg.
Coninutul mediu de zinc a fost cuprins ntre 0.0890.001 mg/kg la tre de gru i
2.8360.007 mg/kg la borhotul de bere. Valori mari au n coninut de zinc s-au gsit n siloz de
porumb de 2.7280.005 mg/kg i n iarba de Sudan 2.6520.007 mg/kg.
Cercetrile efectuate pn n prezent arat o variaie mare a coninutului de minerale n
nutreuri. Astfel, n Germania s-au gsit valori mai mari la porumb (Cu4.2 mg/kg; Zn32 mg/kg), fn
(Cu7.7 mg/kg; Zn42.5 mg/kg), orz-iarna (Cu3.9 mg/kg; Zn32 mg/kg), orz-vara (Cu3.4 mg/kg;
Zn27 mg/kg) (12). n Irlanda probele de nutreuri analizate prezint un coninut mai mare de Cu i
Zn (11) (tabelul 3).
Nutreul
Siloz de porumb
Siloz din iarb
Pune natural
Fn natural

Tabel 3 Cu i Zn n furalele din Irlanda (mg/kg la s.u.)


Cu
Zn
5.115
26.614
10.364
29.685
9.217
30.830
5.843
18.825

Universitatea de tiine Agricole i Medicin Veterinar


Rezultatele obinute n aceast cercetare n ceea ce privete coninutul de Cu i Zn sunt mai
mici comparativ cu rezultatele celorlalte cercetri efectuate precum i din datele literatura de
specialitate.
Echilibrarea mineral a alimentaiei animalelor este pe ct de important, pe att de dificil,
fiindc presupune cunoaterea:
nivelului pn la care elementele nu sunt toxice pentru organism, sau nivelul de
toleran,
cerinelor specifice ale animalelor n minerale,
coninutului nutreurilor n minerale i disponibilitatea acestora pentru organism (8).
Necesarul i concentraia toxic de cupru i zinc pentru vaci de lapte este redat n tabelul 4.
Tabel 4 Necesarul i concentraia toxic de cupru i zinc pentru vaci de lapte*
Elementul
Necesar (mg/kg s.u. de nutre)
Concentraia toxic (mg/kg s.u. de nutre)
Cupru
10
>40
Zinc
30 - 50
>300
*NRC. 2001. Nutrient Requirements of Dairy Cattle. 7th Revised Edition, National Academy Press. Washington,
D.C.

1.
2.
3.
4.

CONCLUZII
Coninutul mediu de cupru din nutreurile analizate a variat ntre 0.3040.01 mg/kg i 3.8950.02
mg/kg.
Coninutul mediu de zinc a fost cuprins ntre 0.0890.001 mg/kg i 2.8360.007 mg/kg.
Valorile medii ale coninutului de cupru i zinc din nutreurile analizate se gsesc n limitele
recomandate pentru hrana vacilor de lapte.
Nutreurile analizate nu au prezentat risc toxicologic pentru vacile de lapte.
BIBLIOGRAFIE

1.
2.
3.

Beasley V.,1999, IVIS Books, Ed.Veterinary Toxicology, (online), U.S.A


Clarke E.G.C., Clarke Myra L.,1975, Veterinary toxicology, Ed. Bailliere, Tindalle, London UK, pg. 57-63
Davidescu, D.,1988, Chimizarea agriculturii. Microelemente n agricultur. vol VI, Edit. Academiei RSR,
Bucureti
4. Johnston A. E.,2005, Trace elements in soil: status and management, NJF Seminar no. 370- Essential trace
elements for plants, animals and humans Reykjavk, Iceland, Agricultural Universitz of Iceland, Rit LBH nr. 3,
pg. 7-14
5. Lars Johnsson,2005, Essential trace elements and food quality, NJF Seminar no. 370- Essential trace elements
for plants, animals and humans Reykjavk, Iceland, Agricultural Universitz of Iceland, Rit LBH nr. 3, pg 15-17
6. NRC,1980, Mineral tolerance of domestic animals), National Academy Press. Washington, D.C.
7. NRC,2001, Nutrient Requirements of Dairy Cattle. 7th Revised Edition, National Academy Press. Washington,
D.C.
8. Pop I.M., Halga Petru, Avarvarei Teona,2006, Nutriia i alimentaia animalelor, Ed. TIPOMOLDOVA, vol. I,
pg.125-167
9. Popescu O., Enache, Tr.,1996, Medicina legal veterinar, vol.II, Edit. ALL, Bucureti
10. Raisbeck MF, Siemion RS, Smith MA.,2006, Modest copper supplementation blocks molybdenosis in
cattle, Journal of Veterinary Diagnostic Investigation Vol. 18 Issue 6, 566-572)
11. Phil Rogers John Murphy & Siobhan Kavanagh, Bovine Mineral,2001, Vitamin Balancers for Irish Maize
Silage, Grange Research Centre, Dunsany, Co. Meath, Ireland, (online)
12. Florian von Sothen,2001, The heavy metal input on farmland an indicator for a sustainable agricultural
system, Action for Co-operation in Economics-Seminar on Sustainable Agriculture in Central and Eastern
European Countries: The Environmental Effects of Transition and Needs for Change, Nitra/Slovakia

Lucrri tiinifice vol. 51 seria Medicin Veterinar

CONINUTUL DE CUPRU I ZINC N MATERII PRIME FURAJERE


I NUTREURI COMBINATE DESTINATE ALIMENTAIEI
PUILOR BROILER DE GIN
COPPER AND ZINC CONTENT IN FEEDSTUFFS AND BROILER MIXED
FEEDS
ALBU Aida1, POPESCU O.1, ]RC Felicia2
1USAMV Iai
2DSVSA Iai
The purpose of this work was to evaluate copper and zinc level from feedstuffs and chicken
broiler mixed feeds.
Thirty five samples of starter, grower, finishing feed, corn meal, wheat, soymeal, fullfat soya
to determine copper and zinc level were investigated. Feed samples were harvested according to
SR ISO 6498:1999 and analysed using atomic absorbtion spectrofotometry method in flame.
Mean values content ranged from 1.819 mg/kg to 3.432 mg/kg dry matter for copper and
from 1.086 mg/kg to 3.262 mg/kg dry matter for zinc.
The analytical results for copper and zinc content were under the toxic dietary level.
Key words: copper, zinc, mixed feeds, broiler chichen

Oligoelementele au un rol activ att metabolic ct i fiziologic. Toate mineralele eseniale sau
neeseniale pot avea efecte negative asupra plantelor, animalelor i oamenilor dac n raia lor se
gsesc cantiti mari.
Nutriia mineral a plantelor are loc pe parcursul ntregului ciclu biologic, dar prezint
intensiti diferite. n primele faze ale ciclului biologic, lipsa sau insuficiena unor elemente nutritive
are o influen negativ asupra dezvoltrii i creterii ulterioare. Consumul maxim cnd plantele
preiau din mediu cea mai mare cantitate de elemente minerale este perioada formrii masei
vegetative i a creterii intense, elementele preluate avnd n principal rol structural (azot, calciu,
magneziu, etc.). Carena cuprului n plante se manifest prin vestejirea i decolorarea frunzelor
tinere. Carena zincului n plante se manifest prin reducerea creterii lor, ptarea cu galben a
frunzelor etc. Via de vie, inul, hameiul, ricinul i porumbul sunt sensibile la lipsa zincului. Grul,
secara, ovzul i mazrea sunt mai puin sensibile.
Nivelul concentraiilor oligoelementelor din nutreuri este influenat de mai muli factori: de
genul, speciile sau varietile de cultur; de tipul de sol, de nivelul concentraiei microelementelor din
sol; de stadiul de vegetaie a plantelor; de condiiile climatice sau sezoniere (6).
n organismul animal, cuprul este component al unor enzime, condiioneaz oxidarea fierului,
are rol de catalizator n formarea hemoglobinei, este implicat n formarea mielinei, melaninei
(pigmentarea prului i lnii), elastinei, colagenului; zincul este component al mai multor enzime, al
insulinei, are rol n metabolism, n imunitate, n cretere, intervine n schimburile respiratorii, n
formarea cochiliei oului (9, 11). La psri, deficitul de cupru se manifest prin simptome de anemie,
decolorarea penelor, fragilitate osoas etc. iar deficitul de zinc prin slab mbrcare cu pene,
dermatoz a membrelor inferioare etc (11, 13).
Psrile sunt mai tolerante la cantiti mari de cupru. Intoxicaiile cu cupru au loc accidental i
se manifest prin scderea apetitului, diaree, apatie chiar depresie, eroziunea stomacului glandular
etc (1, 8).
Intoxicaiile cu zinc se manifest prin vom, depresie, anorexie, diaree, slbiciune, scderea
eficienei conversiei furajelor etc. La psri, pancreasul este afectat, n special cel exocrin (1, 3).
Posibile produceri de intoxicaii sunt determinate de interrelaiile pe care le au
microelementele cu prezena i nivelul concentraiei celorlalte elemente: Cu are o aciune sinergic
cu Fe i Zn, antagonic cu Mo, Ca,, Cd, Pb, Hg, sulfaii; Zn are aciune sinergic cu Fe i S, toxicitatea
crete n prezena Pb, As i aciune antagonic cu Ca, P, Cu, Cd, proteine, etc. (2, 7, 12).
Raia complet din punct de vedere al coninutului n minerale conduce la mbuntirea
performanelor zootehnice. Coninutul n minerale al nutreurilor este variabil i depinde de foarte
7

Universitatea de tiine Agricole i Medicin Veterinar


muli factori. Determinarea prin analize a coninutului mineralelor din nutreuri duce la ntocmirea
unei raii complete i corecte.
Scopul cercetrilor asociate prezentei lucrri a fost evaluarea coninutului de cupru i zinc din
materiile prime i nutreurile combinate folosite n anul 2007 pentru pui broiler.
MATERIAL I METOD
Investigaiile s-au efectuat n anul 2007 pe un numr de 35 probe: furaj demaraj, furaj
cretere, furaj finisare, porumb boabe, gru boabe, rot de soia i fullfat soia.
Recoltarea i pregtirea probelor de nutreuri pentru analiz s-a fcut cu respectarea normelor
prevzute n standardele actuale (SR ISO 6498:1999) i a normelor sanitar-veterinare n vigoare.
Determinarea coninutului de Cu i Zn din probe s-a fcut prin metoda spectrofotometriei de
absorbie atomic (AAS) n flacr. Separarea metalelor grele s-a realizat prin operaia de calcinare la
500C pentru c majoritatea produselor vegetale conin substane minerale sub form de compui
organici sau anorganici. Calcinarea este un proces complex de distrugere a materialului organic cu
trecerea metalelor prezente sub form ionic sau ionizabil. Cenua rezultat a fost splat cu HCl i
ap distilat apoi adus la un volum convenabil pentru a se citi la aparat.
Curba de calibrare pentru pentru cupru s-a trasat n 3 puncte (1, 2, 4 ppm) i pentru zinc n 4
puncte (1, 2, 3, 4 ppm). Lungimea de und folosit pentru determinarea prin spectrofotometrie de
absorbie atomic a Cu a fost de 324.7 nm iar pentru Zn 213.9 nm.
Rezultatele analizelor au fost exprimate mg/kg (ppm) prin raportare la masa uscat a
nutreurilor.
REZULTATE I DISCUII
Rezultatele analizelor cu privire la coninutul mediu de cupru i zinc din materiile prime i
nutreurile combinate sunt prezentate n tabelele 1 i 2 i reprezentate n fig.1 i 2.
Tabel 1 Coninutul mediu n cupru a nutreurilor analizate (mg/kg la s.u.)
Nr.
crt.
1
2
3
4
5
6
7

Proba

Nr. probe

X sx

V%

Porumb boabe
Gru boabe
Furaj demaraj
Furaj cretere
Furaj finisare
Fullfat soia
rot soia

5
5
5
5
5
5
5

3.2080.016
1.8190.009
2.1500.018
3.3330.010
2.7390.009
3.4320.009
2.3370.007

0.037
0.020
0.039
0.023
0.020
0.020
0.017

1. 147
1.112
1.834
0.676
0.720
0.581
0.711

3,333

3,432

mg/kg
4

3,208

1,819

2,15

2,739

2,337

a-Porumb boabe
b-Gru boabe
c-Furaj demaraj
d-Furaj cretere
e-Furaj finisare
f-Fullfat soia
g-rot soia

0
a

Fig. 1 Coninutul mediu de cupru n nutreuri (mg/kg la s.u.)

Coninutul mediu de cupru din nutreurile analizate a variat ntre 1.8190.009 mg/kg la gru
boabe i 3.4320.009 mg/kg la fullfat soia. Un coninut mare de cupru s-a gsit i n porumb boabe
de 3.2080.016 mg/kg.
8

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Tabel 2 Coninutul mediu n zinc a nutreurilor analizate (mg/kg la s.u.)
Nr.
crt.
1
2
3
4
5
6
7

Proba

Nr. probe

X sx

V%

Porumb boabe
Gru boabe
Furaj demaraj
Furaj cretere
Furaj finisare
Fullfat soia
rot soia

5
5
5
5
5
5
5

1.1650.006
1.0860.016
1.6770.008
2.7630.005
3.2620.005
2.4470.004
2.0880.004

0.013
0.036
0.018
0.012
0.012
0.009
0.010

1.118
3.303
1.065
0.439
0.376
0.360
0.475

mg/kg
4
2,763

3
2

1,165 1,086

3,262
2,447

1,677

2,088

a-Porumb boabe
b-Gru boabe
c-Furaj demaraj
d-Furaj cretere
e-Furaj finisare
f-Fullfat soia
g-rot soia

0
a

Fig. 2 Coninutul mediu de zinc n nutreuri (mg/kg la s.u.)

Coninutul mediu de zinc a fost cuprins ntre 1.0860.016 mg/kg la gru boabe i 3.2620.005
mg/kg la furaj finisare. Valori mari n coninut de zinc s-au gsit n fullfat soia de 2.4470.004 mg/kg
i n rot soia de 2.0880.004 mg/kg.
Coninutul mediu de cupru i zinc din nutreurile combinate este ridicat datorit introducerii n
reete a unor premixuri vitamino-minerale (PVM).
Cercetrile efectuate pn n prezent arat o variaie mare a coninutului de minerale n
nutreuri: pentru Zn s-au gsit valori de 25.253.3 g/g la gru, de 12.957.6 g/g la porumb (4). n
India, porumbul a avut un coninut de cupru i zinc de 7.7-18.2 ppm respectiv de 24.3-31.1 ppm (14).
Sursele folosite pentru asigurarea elementelor n hrana animalelor pot fi de natur organic
ct i anorganic. S-au fcut diferite experiene pentru mbuntirea performanelor puilor broiler
prin nlocuirea ZnSO4 cu zinc-complex de aminoacizi (5).
Cerinele animalelor n oligoelemente sunt dificil de stabilit cu exactitate; necesarul
recomandat de cupru i zinc pentru pui broiler este de 8 mg/kg, respectiv 40 mg/kg (10).
1.
2.
3.
4.

CONCLUZII
Coninutul mediu de cupru din nutreurile analizate a variat ntre 1.8190.009 mg/kg la gru
boabe i 3.4320.009 mg/kg la fullfat soia.
Coninutul mediu de zinc a fost cuprins ntre 1.0860.016 mg/kg la gru boabe i 3.2620.005
mg/kg la furaj finisare.
Valorile medii ale coninutului de cupru i zinc din materiile prime i nutreuri combinate s-au
gsit n limitele recomandate pentru hrana puilor broiler de gin.
Nutreurile analizate nu au prezentat risc toxicologic pentru animale.

Universitatea de tiine Agricole i Medicin Veterinar


BIBLIOGRAFIE
1.
2.
3.
4.
5.

6.
7.
8.
9.
10.
11.
12.
13.
14.

Beasley V.,1999, IVIS Books, Ed.Veterinary Toxicology, (online), U.S.A


Berger Larry L, 1993, Effective Copper Nutrition for Farm Animals, SALT INSTITUTE
Clarke E.G.C., Clarke Myra L., 1975, Veterinary toxicology, Ed. Bailliere, Tindalle, London UK, pg. 57-63
Gregorio Glenn B.,2002, Progress in Breeding for Trace Minerals in Staple Crops, J. Nutr. 132:500S-502S
Hudson B. P.; Dozier W. A.; Wilsonj. L.;2005, Broiler live performance response to dietary zinc source and the
influence of zinc supplementation in broiler breeder diets, Journal Animal feed science and technology, vol. 118,
n 3-4, pp. 329-335
Larry L. Berger,1995, Factors affecting the trace mineral composition of feedstuffs, Salt Institute
Milo Marin, Drnceanu Dan,1980, Nutriia mineral a animalelor, Ed.Ceres, pg 16-21
Nica Daniela, Bianu Elisabeta,2004, Un caz de intoxicaie cu cupru la psri, Lucrri tiinifice, U..A.M.V.B.,
Seria C, vol. XLVI-XLVI
NRC, 1980 , Mineral tolerance of domestic animals, National Academy Press. Washington, D.C.
NRC, 1994, Nutrient Requirements of Poultry. 9th Revised Edition, National Academy Press. Washington, D.C.
Pop I.M.,2002, Aditivi furajeri, Ed PIM, Iai, pg 16-24
Popescu O., Enache, Tr.,1996, Medicina legal veterinar, vol.II, Edit. ALL, Bucureti
Scheideler Sheila E.,2006, Trace mineral balance in poultry, WATT Poultry USA
Sunder, G. S., Gopinath, N. C. S., Sadagopan, V. R., Raju, M. V. L. N., 2004, Trace minerals in poultry feed
ingredients, Indian Journal of Animal Nutrition, (Vol. 21) (No. 2) 133-136

10

Lucrri tiinifice vol. 51 seria Medicin Veterinar

RESEARCHES REGARDING THE MORPHOLOGY OF THE


ARTICULATIONS OF CERVICAL AREA AT THE OSTRICH
(STRUTHIO CAMELLUS)
BELU C., PREDOI G., DUMITRESCU I.,
GEORGESCU B., EICARU Anca, ROU Petronela,
TOADER A. I., PREDOI tefania, CAZIMIR Iuliana, BIOIU Carmen
The investigations made on 8 individuals had the purpose of identifying the anatomics
characteristics of articulations from the cervical area and to corelate them with the functional
aspects.
The studies were made on atlantoocipital i axoatloidian articulations, intervertabrals
articulations from the middle cervical area, where the posibilities of neck movements in vertical
plan are more common , and then, the the articulations from the base of the neck, where the side
movements are more common.
It was noticed that the morfology of the articular surfaces and ligaments fully explains the
functional characteristics noticed on this species.

MATERIALE SI METODE
Disecia a fost efectuat pe 8 cadavre de stru african, diferite ca vrst i sex, provenite de la
Grdina zoologic Bucureti sau de la diferii cresctori particulari. S-a folosit stereomicroscopul SMZ2T Nikon. Formaiunile anatomice disecate au fost fotografiate, iar pentru a facilita identificarea
acestora n fotografii, s-au realizat schemele corespunztoare. Descrierea acestor formaiuni s-a
realizat conform nomenclaturii anatomice Nomina Anatomica Avium 1979.
REZULTATE I DISCUII
n urma investigaiilor efectuate, unii autori au sistematizat regiunea cervical n patru
segmente funcionale. Primul segment corespunde regiunii axo-atloidiene, responsabile de rotaia
capului. Segmentul cranial adiacent este flexibil n direciile dorso-ventral i lateral, dar aceast
regiune, n mod obinuit, este meninut dreapt chiar i n timpul hrnirii. Flexibilitatea n sens
dorsoventral este cea mai accentuat n treimea mijlocie a gtului, n timp ce la baza acestuia sunt
permise mai ales micrile de lateralitate.
Studiile efectuate de noi, au n vedere descrierea detaliat a substratului anatomic care creaz
posibilitatea acestei mobiliti, n oarecare msur, selective.
Articulaia atlantooccipital (Art. atlantooccipitalis) se realizeaz ntre condilul occipitalului
(Condylus occipitalis) i fosa condiloid a atlasului (Fossa condyloidea). Condilul este proeminent,
aproape sferic, cu excepia prii dorsale, nivel la care se observ o redus zon aplatizat, peste care
trece ligamentul apical. La pasrea adult diametrul acestei proeminene este de 10 12 mm. Fosa
condiloid este reprezentat de o suprafa semilunar cu convexitatea dispus ventral. n partea
dorsal prezint o incizur larg (Incisura fossae), zon n care este completat de un fibrocartilaj
atloidian (Fibrocartilago atlantis).
Capsula articular (Capsula articularis) este reprezentat prin membrana atlantooccipital
ventral (Membrana atlantooccipitalis ventralis) i membrana atlantooccipital dorsal (Membrana
atlantooccipitalis dorsalis). Membrana dorsal este mai bine reprezentat dect cea ventral i
conine i fibre elastice (Fig. 1). Lateral, continuitatea ntre membrane este ntrerupt prin orificiul de
pasaj al venei occipitale interne.
Articulaiile atlantoaxiale (Artc. atlantoaxiales) sunt reprezentate prin articulaia atlantodental (Artc. alantodentales), articulaia ntre corpurile vertebrelor (Artc. intercorporea) i dou
articulaii zigapofizale (Artc. zygapophisales). n cazul primelor dou articulaii exist o singur capsul
articular i o singur cavitate sinovial.
Capsula articular este prevzut cu dou ligamente colaterale. Ligamentele colaterale
atlantoaxiale (Lig. collaterale atlatoaxiale) sunt dou ligamente puternice care limiteaz micrile de
rotaie dintre atlas i axis. Ele sunt dispuse longitudinal, de la foveile ce se gsesc pe fiecare parte a
bazei procesului odontoid, ctre amprentele de pe faa intern a incizurii fosei condiloide. Cele dou

11

Universitatea de tiine Agricole i Medicin Veterinar


ligamente, n lungime de aproximativ 10 mm fuzioneaz cu suprafaa ventral a ligamentului
transvers al atlasului.

Fig. 1 Complexul articular occipitoatloaxoidian la struul african (vedere dorsal)


1-Os occipitale; 2- Atlas; 3-Axis; 4- Membrana atlantooccipitalis dorsalis; 5- Orificiul de pasaj al venei
occipitale interne.

Ligamentul transvers al atlasului (Lig. transversum atlantis) este puternic i menine procesul
odontoid n contact cu suprafaa articular dental a atlasului (Fig. 2). Fibrele sale au inserie caudal
fa de marginile dorsale ale incizurii fosei condiloide i au o lungime de aproximativ 10 mm. n sens
craniocaudal ligamentul are o grosime de aproximativ 5 mm.
Ligamentul apical (Lig. apicis dentis) se orienteaz cranial, de la vrful procesului odontoid pe
deasupra incizurii fosei condiloide i ventral de ligamentul transvers, ctre marginea ventral a gurii
occipitale.

Fig. 2 Articulaia occipitoaxoatloidian la struul african


1-Os occipital; 2- Atlas (dup secionarea arcului dorsal); 3- Axis (dup secionarea arcului); 4- Dens; 5-Lig.
apicis dentis; 6- Lig. transversum atlantis; 7- Lig. collaterale atlantoaxiale.

Mobilitatea articulaiei occipitoatloidiene este net superioar celei atloaxoidiene, ultima avnd
micrile de rotaie limitate de ligamentele colaterale, iar cele de flexie limitate de un tubercul
atloidian ventral deosebit de bine reprezentat, orientat caudal, pe sub capul axisului.
n treimea mijlocie a gtului conformaia suprafeelor articulare dintre vertebre faciliteaz
mobilitatea n sens dorsoventral a acestui segment (C7 C9).
Feele terminale craniale sunt concave dintr-o parte n alta i convexe de sus n jos. n plan
median, dimensiunea n sens dorso-ventral a acestei fee este de aproximativ 5 mm.
Limea maxim a acestei suprafee este de 20 mm. Procesele articulare craniale au
suprafeele articulare elipsoidale, foarte alungite n sens cranio-caudal i foarte uor convexe n
12

Lucrri tiinifice vol. 51 seria Medicin Veterinar


acelai sens. Raportul lime/lungime a acestor suprafee elipsoidale fiind de 1/3. Suprafeele
articulare caudale reprezint negativul celor craniale.
n partea ventral, feele terminale craniale i caudale sunt separate de meniscuri foarte
reduse (Meniscus intervertebralis), care se es cu partea ventral a capsulei articulare (Fig.3).

Fig. 3. Faa terminal caudal a celei de-a VII-a vertebre cervical


1- Lig. elasticum interlaminare;2-Proc. articularis (Zygapophisis) caudalis; 3-Facies articularis caudalis; 4Meniscus intervertebralis; 5-Medulla spinalis; 6- Membrana interlaminare

Partea lateral a acestei capsule este mai dezvoltat, sub forma ligamentelor colaterale
puternice, care limiteaz micrile de lateralitate. n cazul articulaiilor dintre procesele articulare
craniale i caudale, n aceast regiune, fibrele capsulei orientate ventrorostral, tind s formeze o serie
de ligamente colaterale (Lig. collaterale), care limiteaz micrile de extensie ale gtului (Fig. 4).
Arcurile vertebrale sunt articulate i prin ligamentul elastic interlaminar (Lig. elasticum
interlaminare), impar, puternic, circular pe seciune, cu o lungime de 30 35 mm i un diametru, la
jumtatea lungimii, de 5 mm. Mai este cunoscut sub denumirea de ligamentul galben (Lig. flavum).
Acoper membrana interlaminar (Membrana interlaminare) (Fig. 5).
Ligamentul elastic interlaminar devine din ce n ce mai gros n sens caudal, n segmentul
cervical C14-C15 avnd un diametru al suprafeei de seciune de aproximativ 10 mm. Se observ
diferene semnificative n cazul dimensiunilor suprafeelor articulare ale proceselor craniale, care tind
s devin circulare, raportul lime/lungime fiind de 2/3, mrind astfel gradul micrilor de
lateralitate a dou vertebre adiacente.

Fig. 4 Articulaie intervertebral cervical (vedere lateral)


1-condensri laterale ale capsule articulaiei zigapofizale, 2- Lig. collaterale artc. intercorporea; 3-Proc
costalis; 4- Lig. elasticum interlaminare

13

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 5 Articulaie intervertebral cervical (vedere dorsal)


1- Lig. elasticum interlaminare; 2- Proc. articularis (Zygapophisis) caudalis; 3-Membrana interlaminare.

CONCLUZII
n urma investigaiilor efectuate s-au elaborat urmtoarele concluzii:
1. Articulaiile occipitoatlantoaxoidiene sunt reprezentate n general prin mijloacele de
legtur ntlnite n mod obinuit la psrile domestice. Totui, se constat puternica
dezvoltare a ligamentului transvers al atlasului i a ligamentelor colaterale
axoatloidiene care, n oarecare msur consolideaz articulaia axoatloidian, limitn
n oarecare msur micrile de rotaie ale capului. Aceste micri sunt suplinite de
lungimea i mobilitatea mare a regiunii cervicale.
2. n treimea mijlocie a gtului conformaia suprafeelor articulare dintre vertebre
faciliteaz mobilitatea n sens dorso-ventral a acestui segment (C7 C9). Micrile de
lateralitate n acest sector sunt limitate de dezvoltarea unor ligamente colaterale ale
articulaiilor dintre corpurile a dou vertebre adiacente.
3. Ctre baza gtului (C14-C15) se constat modificarea aspectului suprafeelor, la acest
nivel fiind mai mari posibilitile micrilor de lateralitate.
4. Ligamentul elastic interlaminar crete este reprezentat de fascicule care fac legtura
ntre dou vertebre adiacente, fiind din ce n ce mai gros n sens craniocaudal.
BIBLIOGRAFIE
1.
2.

3.

4.
5.
6.
7.

8.
9.

Beattie, I. - Applied ostrich physiology and anatomy. Ostrich workshop for


veterinarians; April 11-12, 1992; Zimbabwe.
Dzemski, G, Christian, A. Flexibility along the Neck of the Ostrich (Struthio camellus) and consequences for
the reconstruction of dinosaurus with extreme neck length. Journal of Morphology, vol 268, Issue 8, p. 701-714,
2007.
Dzerzshinsky, F.- Implication of the Cranial Morphology of Paleognaths for Avian Evolution, Avian Paleontology
th
th
at the Close of the 20 Century: Proceedings of the 4 International Meeting of the Society of Avian
Paleontology and Evolution, Wasinghton,D.C., 4-7 June 1996.
Fowler, ME. Clinical anatomy of ratites. Proceedings of the Annual Conference of the Association of Avian
Veterinarians; September 1-5, 1992
George, J.C., Berger, A.J. Avian Myology, Academic Press, New York and London, 1966.
Gheie, V. i col. Atlas de anatomia de las aves domesticas, Editorial Acribia, Zaragoza, 1981
Imam, H. M. E., El-Mahdy, O. M. - Some anatomical studies on the quadratomandibular articulation of ostrich
(Struthio camelus) and flamingo (Phoenicopterus ruber), Assiut Veterinary Medical Journal, 2004 (Vol.
50) (No. 102) 1-21.
*** - Nomina Anatomica Avium, Academic Press, London Toronto New York Sidney San Francisco
1979.
Yasuda Mikio The Anatomical Atlas of Gallus, University of Tokio Press, 2002.

14

Lucrri tiinifice vol. 51 seria Medicin Veterinar

METABOLIC PROFIL AND SECRETORY ACTIVITY OF PINEAL


GLAND, AT EGG LAYING HENS
BOISTEANU P.C., USTUROI M.G. , LAZR Roxana
University of Agricultural Sciences and Veterinary Medicine Iai
In birds, the pineal gland acts as a photoreceptor territory as well as a neuroendocrine organ,
with metabolic and functional particularities involved in the regulation of reproduction function,
of biologic rhythms, acclimatization and adaptation to climatic variations.
We studied the values of metabolic indicators in egg-laying hens of different ages, raised in
different conditions of light (12L/12D, 16L/8D), compared to those of birds with photonic ablation
of the pineal gland, realized by exposure to continuous light.
The differences between analyzed parameters (glucose, proteins, lipids, cholesterol,
triglycerides, creatinphosphokinase, phospholipids, transaminase etc.) reflect functional
relationships between pineal gland and proteins, lipids, carbohydrates and minerals metabolism.
Keywords: pineal gland, metabolic profile, egg laying hens

Pineal hormones participate in reproduction modulation of animals which depend of external


environment physical factors, in photoperiodicity adjustment, in intermediary metabolism and hydroelectrolytic balance regulation as well as in modulation of nervous system excitability and of the
sleep-awake cycle.
In birds, pineal gland interferes in adjustment of reproductive status, knowing the specificity of
ovulation cycle length (a few hours).
Ovulation cycle begins at 17 weeks and is regulated by the hypothalamus-pituitary-gonads,
being also complex influenced by neuro-hormonal and epiphysis factors which are under the
incidence of environmental vibrations (photonic, thermal and seasonal).
Photonic ablation of the pineal gland reveals the intervention of pineal hormones in
antigonadotrophic sense, producing a gonadostimulative effect as a result of phasic relation
modification between circadian biological rhythms and light-dark cycle, when occurs a change of
relation between circadian rhythm of photosensibility and artificial cycle from illumination.
Effectuated studies are part of a research program dealing with correlations between
metabolic profile and secretor activity of laying hens epiphysis. This paper reveals the results
achieved during weeks 19-22 of flock age.
MATERIALS AND METHODS
Researches have been carried on using 100 egg-laying hens belonging to ALBO SL-2000 hybrid,
reared on permanent layer system. The specimens have been allocated to 3 experimental groups:
L1 photic pinealectomy realized by exposure to light of 150 Lux, during 24 hours;
L2 exposure to 12L/12D light schedule ;
L3 exposure to 16L/8D light schedule;
All 3 experimental groups have been fed with mixed fodder whose features are listed below:
ME 2700Kcal/kg; CP 14,5%; Lysine 0.65%; Methionine 0.3%; Calcium 3.5%; Phosphorus 0.55%;
Natrium 0.14%; Chloride 0.13%; Linoleic acid 0.85%; total xanthophylls 24ppm. Daily feed intake
reached 127g/hen while water was given ad-libitum.
RESULTS
Certain hematological (WBC, RBC, Hb, HCT, MCV, MCH, MCHC Table 1) and biochemical
(Glucose, total plasma protein, total lipids, cholesterol, phospholipids, triglycerides, sodium ions,
potassium ions, calcium ions, TGO, TGP, urea Table 2) indexes have been assessed.

15

Universitatea de tiine Agricole i Medicin Veterinar


Parameter
WBC
RBC
Hb
HCT
MCV
MCH
MCHC

Units
103/mm3
106/mm3
g/dl
%
m3
pg
g/dl

Table 1 Blood profile of hens


L1 group
L2 group
20.45
26.18
2.45
2.85
7.5
9.7
28.6
29.4
129.4
130.6
36.6
34.9
40.5
23.4

L3 group
25.2
2.33
9.5
27.4
126.6
38.8
44.6

Relationships between metabolic profile and secretor activity of epiphysis have been
interpreted in accordance with the values occurred for the studied indexes.
Parameter
Glucose
Total plasma protein
Total lipids
Cholesterol
Triglycerides
Sodium ions
Potassium ions
Calcium ions
TGO
TGP
Urea

Table 2 Blood parameters of hens


Units
L1 group
L2 group
mg/dl
260.4
320.2
g/dl
5.2
2.3
mg/dl
2562
2250
mg/dl
147
125
mg/dl
216
195
mg/dl
396
360
mg/dl
6
7
mg/dl
31.4
28.3
U/L
159
134
U/L
18
12
mg/dl
6.2
5.5

L3 group
200.1
5.3
2112
118
186
348
4
36.8
133
10
5.8

DISCUSSION
Numerous experimental researches have revealed main structural metabolic and functional
unbalances produced by surgical extirpation of the pineal gland at different laboratory species.
It is known that functional inhibition of epiphysis occurs at chickens reared from day 1 within
continuous light schedule.
In physiological conditions, erythrocytes number from blood presents minimal variations
thanks to continuous adaptation of erythropoiesis rate to the erythrolyse one.
The erythrocytes dimensions vary between 10/6.6 12.2 and nucleus dimensions reach
mean values of 4.1/3. Red blood cells (RBC) mean life cycle lasts for 28 days and erythrocytes
represent 2.4% of blood tissue. Oligocythemias could occur at laying hens, the erythrocytes amount
decreasing under 2.4x 103/mm3.
A decrease of RBC amount have been noticed in L3 group - 2.33x103/mm3, being associated
with low levels of erythrocytes constants. The derivate RBC constants offer relations onto their size,
shape and hemoglobin load. Hemoglobin quantity varies in accordance with laying intensity and feed
structural features.
Total lipids registered values of 2250 mg/dl at L1 group, 2562 mg/dl at L2 group and 2112 at L3
group. Poor differences, within physiological limits, have been noticed between the 3 groups. Lipids
excess could produce heptoses at laying hens, followed by increase of the hepatic lipid content till 30
%.
The cholesterol assessed in group with photic pineal gland ablation was of 125mg/dl, as
compared to 147mg/dl obtained at L1, and 118mg/dl registered at L2.
Triglycerides from L1 group hens blood had values of 195mg/dl, while values of 216mg/dl have
been found in L2 group. At L3 group, whom exposure to light was of 16L/8D type, registered value was
of 186mg/dl.
Increasing glucose level in blood at birds could not be considered an advantage for egg
production, because it ensures the energy requirements for egg synthesis. Blood hypoglycemia could
reflect a higher quality of the eggs, with straight incidence onto the day old chicks.
Low values of glycemia have been registered at L3 group, indicating a metabolism run through
carbohydrates deficiency and energetic metabolism disturbance, leading to nervous system disorders
16

Lucrri tiinifice vol. 51 seria Medicin Veterinar


and to tissue dystrophies. At L1 and L2 groups, glycemia has been found with values of 320.2mg/dl
and of 320.2mg/dl.
A deficient protein feeding leads to lower egg production, respective la hypoproteinemy.
It was found that protein quantity is more significant physiologically for egg formation than
the energetic ratio. Plasmatic proteins level is very important all over the year, but becomes critical
during laying period.
The level of plasmatic proteins during birds follicles development could be influenced by
hormones, inclusively by estrogens.
Proteins level could be also low due to the decreased of albumin and globulin concentrations.
The assessed plasma protein levels reached values of 2.3g/dl at L1 group, of 5.2g/dl at L2 group and of
5.3 g/dl at L3 group.
The analyses run for plasmatic ions quantities revealed various levels:
Sodium ions have presented a plasmatic concentration of 360mg/dl at L1, 396mg/dl at L2,
348mg/dl at L3.
Blood potassium ions have been found at plasmatic concentrations of 21.5mg/dl at L1,
20.2mg/dl at L3, 23.6mg/dl at L2.
Calcium deficiency in laying hens leads to reduced bone mass osteopathies (osteomalachy)
which, besides the demineralization processes affecting egg shell, negatively affect skeleton, through
a replacement process of mineralized tissue with osteoid and even with fibrous tissue, leading to
bones deforming and locomotors troubles.
Estrogen induction can establish increasing of calcium level during laying period, immediately
after egg deposition or during ovulation.
Laying hens presents hepatic metabolism alteration after the laying period, translated by
increasing of TGO concentration. Thus, values of 134U/L have been achieved for L1 group, of 159U/L
at L2 group, of 133U/L for L1 group, outrunning the physiological limits.
TGP values present increasing levels when muscular and hepatic disorder occur, but the
diagnostic meaning of these is limited. In case of the 3 experimental groups, the registered values
have been of 12U/L at group L1 (within physiologic limits) as compared to 10U/L (L3 group) or to
18U/L (L2 group).
REFERENCES
1.
2.
3.

Goodwin, M.A., J. Brown, K.S. Latimer and S.L. Miller [1991] Packed cell volume reference intervals to aid in the
diagnosis of anemia and polycythemia in young Leghorn chickens. Avian Dis., 35: 820-823.
Graczyk, S., A. Pliszczak-Krol, B. Kotonski, J. Wilczek, Z. Chmielak [2003] Examinations of haematological and
metabolic changes mechanisms of acute stress in turkeys. Electronic J. Polish Agri.Uni.,Vet.Med., 6:1-10
Boiteanu, P.C., Marius Giorgi Usturoi, Monica-Georgeta Bejenariu, Mioara Bejan, Ioan Vacaru-Opris, Ioan
Haulica, Cristian Mihaila [2000] Effects of pinealectomy on some blood parameters in broiler chicken, Romanian
Academy Publishing house, Romanian Journal of Biochemistry, 1-2, vol.37:pag.3-7

17

Universitatea de tiine Agricole i Medicin Veterinar

PRELIMINARY DATA REGARDING EXPERIMENTAL


OCHRATOXICOSIS AT BROILERS
BORCIL Cristina, PAUL. I.
FMV Iai
Observations were made upon 1 whitness lot and 3 lots of 3 broilers each, 19 days of age, to
which was administered A: 1 ppm , B: 7 ppm, C: 20 ppm of ochratoxin A. The broilers were under
observations for 3 weeks. Histopathological exams made after paraffin inclusion and coloration
with methods HE and HEA, revealed a small hydroprotidic hepatonephrosis at lots B and C and
inflammatory lesions of the lung and air sacks at lot C. We can conclude that ochratoxin A, in the
mentioned doses, doesn t determine lethal lesions but a decrease of the body resistance
expressed by association infections . The research continues.

Ochratoxinele A,B,C i D alturi de citrinin, acidul oxalic i viridicatumtoxina fac parte din
grupul micotoxinelor nefrotoxice. Sunt produse de micei aparinnd genurilor Penicillium verucosum
i Aspergillus. alutaceus fost ochraceus :(2)
Ochratoxinele au fost evideniate prima dat n condiii de laborator n cursul testrii toxicitii
tulpinilor de micei izolate din cereale i legume . Componentul toxic principal identificat n extractele
tulpinii de A. ochraceus a fost ochratoxina A. Sinteza ochratoxinelor este dependent de numeroi
factori ecologici cum ar fi temperatura, umiditatea, substratul, gradul de aeraie. Procesul optim de
sintez al toxinei pe substraturi are loc la o temperatur de 20-28 C dar i mai joas cnd dezvoltarea
miceliului nu este inhibat. Cultivarea fungilor productori de ochratoxine se poate face i n
laborator pe medii naturale sau sintetice. (3)
Ochratoxinele declaneaz n organismul animalelor efecte toxice foarte diferite. Cele mai
sensibile sunt suinele, psrile ( n special puii de gin ), carnasierele. Taurinele sunt rezistente la
OTA, micotoxina fiind degradat n rumen.(6) Experimental, ochratoxina A s-a dovedit a fi teratogen
i carcinogen.
Mecanismele biochimice prin care ochratoxinele i exercit efectele toxice nu sunt pe deplin
elucidate. Ptrunse n organism, ochratoxinele sunt absorbite din tractul digestiv ncepnd din stomac
i apoi n intestinul subire, procesul fiind foarte lent.(5)
Ochratoxina A este clivat parial n intestin n ochratoxin alfa i fenilalanin sub aciunea
carbopeptidazei A i a chemotripsinogenului sau a bacteriilor i a protozoarelor intestinale . Cea mai
mare parte a micotoxinei este eliminat prin fecale nemodificat. Ochratoxina B este excretat prin
urin i fecale sub forma ochratoxinei beta.. Dup absorbtie, ochratoxina A poate fi ntlnit liber n
snge sau legat de proteine acumulndu-se sub aceast form n esuturi.(9)
Ochratoxinele afecteaz echipamentul enzimatic celular, determinnd astfel tulburri
metabolice grave. La broilerii de gin s-a demonstrat c ochratoxina administrat timp de 3
sptmni a redus activitatea glicogen fosforilazei la nivelul ficatului, dozele mari anulnd chiar
aciunea acestei enzime.(1) Mrimea depozitelor de glicogen citoplasmatic din hepatocitele de la
periferia lobulilor hepatici poate constitui un criteriu de apreciere a activitii enzimatice la nivelul
acestui organ , ochratoxina A reducnd capacitatea de conversie a glucozei n glicogen.
Ochratoxinele nefrotoxice n mod deosebit ochratoxina A produc la psri stri patologice
grave. Sunt afectate funciile renale i hepatice .Puii care au primit doze subletale de micotoxine au
manifestat ntrzieri n cretere proporionale cu doza , gut visceral, nefroz acut, enterit i
hepatoz.(4)
La examenul histologic al bobocilor de ra se observ edem i necroz grav a epiteliului
tubilor uriniferi, dilatarea tubilor i acumularea n lumen a unui material proteinaceu sau hiperplazia ,
hipertrofia tubilor contori proximali i ngroarea membranelor bazale glomerulare. La toate acestea
se adaug glicogenoz exolobular hepatic, anemie i leucopenie.(7)
n literatura de specialitate se menioneaz i deosebiri ntre speciile de psri n ceea ce
privete rspunsul la aciunea ochratoxinelor. Puii de gin fac leziuni predominant hepatice n timp
ce bobocii de ra fac leziuni predominant renale exteriorizate prin distrofie lipidic, hialinoze i
necroze focale.
18

Lucrri tiinifice vol. 51 seria Medicin Veterinar


La tineret i la ginile outoare, ochratoxina A este incriminat n ntrzierea maturizrii
sexuale, defecte de pigmentare ale jaretelor la broileri, hematoame, fragilitate osoas, scderea
produciei de ou, creterea mortalitii.
Ochratoxinele au i efect imunosupresiv ducnd la diminuarea elementelor limfoide din bursa
lui Fabricius i splin. Se produce anemie hipocrom microcitar.(8)
MATERIAL I METOD
Cercetrile noastre i-au propus s evidenieze susceptibilitatea puilor de gin la diferite
cantiti de ochratoxin i s stabileasc agresiunea micotoxinelor n raport cu timpul de administrare
si doz.
Investigaiile s-au efectuat pe un lot martor i trei loturi experimentale a cte trei broileri
fiecare. Vrsta de sacrificare a puilor a fost 19 zile. Primului lot experimental i s-a administrat 1 ppm
ochratoxina A , celui de-al doilea lot 7 ppm, iar celui de-al treilea 20 ppm. Broilerii au fost inui sub
observaie timp de 3 sptmni. Fragmente de organe provenite de la cadavre, dup sacrificare, au
fost fixate n formaldehid soluie apoas 10%. Pentru colorarea preparatelor s-au utilizat metodele
HE (Hematoxilin-Eozin) i HEA (Hematoxilin-Eozin-Albastru de metil).
REZULTATE I DISCUII
Administrarea unei doze de 20 ppm ochratoxin A, timp de 3 sptmni la puii broiler de 19
zile, a produs o scdere a rezistenei organismului manifestat prin apariia unor leziuni la nivelul
principalelor organe ( cord, ficat, rinichi, bursa lui Fabricius, creier, pulmon).
La nivelul ficatului s-a constatat distrofie granular. Macroscopic ficatul prezenta o culoare
albicioas, friabiliate , iar din punct de vede histologic citoplasma hepatocitelor prezenta granulaii
foarte fine (Fig. 1). Tot la nivelul ficatului s-a observat i prezena unor focare Lollinger- focare de
hiperplazie hematopoietic extramedular (Fig.2). Distrofie granular s-a constatat i la nivelul
rinichiului . Macroscopic rinichiul era decolorat ca i ficatul, iar din punct de vedere histologic la
nivelul citoplasmei tubilor uriniferi s-au observat aceleai granulaii protidice (Fig.3). La nivelul
cordului s-a constatat o dezintegrare a miocardocitelor (cardiopatie distrofic) (Fig.4).
Leziunile de la nivelul pulmonilor au fost reprezentate de emfizem (Fig.5) cu ngroarea
pereilor parabronhiilor (Fig.6). La puii de 19 zile, n pereii parabronhiilor s-au mai observat
hiperplazii limfohistiocitare pseudofocalizate (parabronhit limfohistiocitar) (Fig. 7) i atrofia
pereilor parabronhiilor (Fig.8). Sacii aerieni att macroscopic, ct i histologic erau foarte ngroai
(aerosaculit subacut) (Fig.9).
La nivelul bursei lui Fabricius s-a constatat edem cu separarea din punct de vedere structural a
foliculilor limfoizi ntre ei datorit prezenei transsudatului (Fig.10), iar la nivelul epiteliului s-au
observat rari microchiti (Fig.11).
n ceea ce privete encefalul, macroscopic s-a constatat o scdere a consistenei acestuia, iar
structural perineuronal i perivascular s-au observat halouri ceea ce ne-a condus la orientarea
diagnosticului de edem cerebral. Submeningeal s-au constatat accentuate proliferri limfoide
foliculare (Fig.12).

Fig.1. Distrofie granular. Ficat.


Col. HEA x40

Fig.2. Focar Lollinger focar de hiperplazie


hematopoietic extramedular. Ficat
Col. HEA x40
19

Universitatea de tiine Agricole i Medicin Veterinar

Fig.3. Distrofie granular. Rinichi


Col. HEA x40

Fig.4. Cardiopatie distrofic. Dezintegrarea


miocardocitelor.
Col. HEA x40

Fig.5. Emfizem pulmonar


Col. HEA x10

Fig.6. ngroarea pereilor parabronhiilor prin


emfizem. Col. HEA x40

Fig.7. Parabronhit limfohistiocitar. (hiperplazii


limfoide n pereii parabronhiilor). Col. HEA x10

Fig.8. Atrofia pereilor parabronhiilor i infiltraii


limfohistocitare. Col. HEA x10

Fig.9. Aerosaculit subacut. (ngroarea sacilor


aerieni). Col. HEA x10

Fig.10. Edem bursal


Col. HEA x10

20

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig.11. Microchiti epiteliali. -Bursa lui Fabricius.


Col. HEA x40

1.
2.

Fig.12. Edem cerebral i meningit limfohistiocitar.


Col. HEA x40

CONCLUZII
Ochratoxina A este puin patogen pentru broilerii de gin ntruct nu produce dect
organopatii de intensitate sczut;
Prezena n doz mare (20 ppm) poate micora rezistena individual i poteneaz infeciile de
asociaie.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.

9.

Agawane S.B., Lonkar P.S. - Effect of probiotic containing Saccharomyces boulardii on experimental
ochratoxicosis in broilers: hematobiochemical studies, J.Vet Sci. 2004 dec;5(4):359-67;
Coman I., Mare M. - Micologie medical aplicat, Ed. Junimea, Iai, 2000;
Coman I., Popescu O. - Micotoxine si micotoxicoze, Ed. CERES, 1985;
Elaroussi M.A., Mohamed F.R., El Barkouky E.M., Atta A.M., Abdou A.M., Hatab M.H. - Experimental
ochratoxicosis in broiler chicken, Avian Pathology, 2006 aug, 35 (4): 263-9;
Kozaczyski W. - Experimental ochratoxicosis A in chickens. Histopathological and histochemical study, Arch
Vet Pol. 1994;34(3-4): 205-19;
Ghergariu S. - Patologia nutriional i metabolic a animalelor ,Ed. Medical Veterinar, Bucureti, 1995;
Paul I. - Etiomorfopatologia veterinar vol. II, Ed. Ion Ionescu de la Brad, Iai, 2000;
Politis I., Fegeros K., Nitsch S., Schatzmayr G., Kantas D. - Use of Trichosporon mycotoxinivorans to
suppress the effects of ochratoxicosis on the immune system of broiler chicks, Br Poult Sci., 2005 Feb: 46(1):
58-65;
Stoev S.D., Koynarsky V., Mantle P.G. - Clinicomorphological studies in chicken fed ochratoxin A while
simultaneously developing coccidiosis, Veterinary Research Communications, 26, 2002, 189-204;

21

Universitatea de tiine Agricole i Medicin Veterinar

MORPHOLOGIC AND MICROMORPHOMETRIC


CHARACTERISTICS OF THE THIRD EYELID AND NICTITATING
GLAND IN THE DOG
CAZACU P., COTEA C.
FMV Iai
cazacupetru@gmail.com
This study was conducted to determine some morphological and micromorphometric
characteristics of the third eyelid and nictitating gland in the dog.
Twenty-five dogs by different breed, seventeen males and eight females were used as the
study materials.
To determine the morphological and micromorphometric characteristics of nictitating gland in
dogs, the Hematoxylin-Eosin-Methylene blue and periodic acid Schiff (PAS) stains was used.
All the means of histologic structures of nictitating gland (lobules, acini, glandular ducts,
interlobular conjunctiv tissue and blood vessels) are greater in female and different significant
statistic, except the mean of ducts and intralobular blood vessels.
In the matter of the nictitating glands segments, the palpebral nictitating gland-PNG is
greater in female than males, the bulbar nictitating gland-BNG is greater in males than females,
but the means are not different significant statistic. The basal nictitating gland-BsNG of males is
longer, but comparatively lower in females that the ratio is inverse, being shorter but wider, and
the means are not different significant statistic.
The histologic structures of nictitating gland that record the significant statistic differences (tstudent) suggests that represents characters of sexual dimorphism in dog.
Key words: third eyelid, nictitating gland, morphologic, micromorphometric, dogs.

The third eyelid (plica semilunaris conjunctivae; palpebra tertia; membrane nictitans)
is a fold of conjunctival mucous of inferior conjunctival sac, with half moon aspect, in medial
angle of eye in the mammals and birds (3, 4, 5, 6, 10, 12).
The components of tear production are lacrimal gland, tarsal glands (Meibomius),
cilliary glands (Moll and Zeiss), goblet cells and nictitating gland. These glands form orbital
lacrimal glandular complex (OLGC) whose secretion forms the precorneal lacrimal film (PLF)
(9, 11) is composed by three layers: the outermost lipid layer, the midlle aqueous layer and
the innermost mucus layer (1, 2, 7, 8).
The aqueous layer is the most important, with thickness 7 m in the dog, secreting by
lacrimal gland (61%), nictitating gland (35%) and accessory conjunctival gland Krause and
Wolfring (3%).
Keratoconjunctivitis sicca (KCS) is a chronic inflammatory disease due to qualitative
and quantitative abnormalities of the tear film, frequently reported in dogs.
The purpose of this paper is the knowledge of micromorphometric characteristics of
the third eyelid and nictitating gland of the healthy dogs that by micromorphometric
quantification according to sex, a little known in speciality literature, contribute to better
realization of epidemiological, clinical and histopatological aspects of KCS or the other
disease of third eyelid.
MATERIAL AND METHODS
The paper was realized for 25 dogs by different breed Bichon, Chihuahua, Pekingese,
Yorkshire Terrier, mongrel, German Pointer, German Shepherd, 17 males and 8 females, between 2
months and 16 years old and body weight 2 to 40 kilograms, from the private veterinary clinics and
Morphopathology department of FMV Iasi.
Bilateral exeresis of the third eyelid and nictitating gland was realized by incision and
dissection of the bulbar and palpebral conjunctiva and the adjacent structures until the complete
isolation. The 50 nictitating membranes and glands were submitted to morphometric and histologic
studies.
22

Lucrri tiinifice vol. 51 seria Medicin Veterinar


The nictitating membranes were fixed in 10% formalin solution, dehydrated, blocked in
paraffin,cut into five-micrometer thick and stained with Hematoxylin-Eosin-Methylene blue and
Periodic Acid Shiff (PAS). This paper was realized using the Micros Austria MC 300 optic microscope
with Moticam 352 camera. The micromorphometric analysis of histologic and cytologic structures
was realized using the Motic Images Plus 2.0 ML soft.
The principal histologic structures of nictitating gland were investigated (acini, lobules, intraand interlobular ducts, interlobular conjunctival tissue, blood vessels, epithelial cells of the acini), the
principal segments of nictitating gland-NG (the palpebral nictitating gland-PNG, the bulbar nictitating
gland-BNG, the basal nictitating gland-BsNG and the difference of proximal glandular structuresDPGS) and the different histologic structures of the third eyelid in dog (the distance from the border
of eyelid to the proximal end of the cartilage (DBTE-C), the dimensions of lymphonoduls, the
thickness of cartilage).
The results were evaluated using the statistical software SPSS 10. The statistical relevance was
determinated by the use of t-student test, comparing the morphologic and morphometric data,
according to the sexual dimorphism.
RESULTS AND DISCUSSION
The statistical micromorphometric data were elaborate for determinate the dimensions of
histologic structures of nictitating gland and its segment and associated structures of the third eyelid
in the dog, according to the sex.
All the means of histologic structures of nictitating gland (lobuls, acini, glandular ducts,
interlobular conjunctiv tissue and blood vessels) are greater in female and different significant
statistic, except the mean of ducts and intralobular blood vessels. The epithelial cells of secretory
units are greater in males than females, but the distinctions are not statistic different (Table 1).
The histologic structures of nictitating gland that record the significant statistic differences (tstudent) suggests that represents characters of sexual dimorphism in dog.
In the matter of the nictitating glands segments, PNG is greater in female than males, BNG is
greater in males than females, but the means are not different significant statistic. BzNG of males is
longer, but comparatively lower in females that the ratio is inverse, being shorter but wider, and the
means are not different significant statistic. The difference between the proximal glandular structures
of the nictitating gland is greater in females than males, but the means are not significant statistic.
(Table 2; Figure 1,2).
The distance from the border of third eyelid to the proximal extremity of cartilage (DBTE-C) is
greater in males than females, but the means are not different significant statistic (Table 3; Figure 1,
2). The lymphonoduls of the third eyelid have the greater dimensions in males than females, but the
means are not different significant statistic, except the width of lymphonoduls that is different
significant statistic and constitute a condition of sexual dimorphism (Table 3; Figure 1,2). The
thickness of cartilage of the third eyelid is greater in females than males, but the means are not
different significant statistic (Table 3; Figure 1,2).

23

Universitatea de tiine Agricole i Medicin Veterinar


Table 1. Micromorphometry of histologic structures of NG in dog, according to sex
Dogs (n = 25)
M (n = 17)
F (n = 8)
Histologic structures
MSD
MSD
CI 95% (p<0,05)
CI 95% (p<0,05)
N
N
652,97285,94
907,78a 349,03
603,93-702,02
810,61-1004,95
L (m)
133
52
308,55135,84
419,47a 207,2
285,25-331,85
361,78-477,16
Lobules
w (m)
133
52
173519,8128251
290289,6a 191024,9
151521,8-195517,8
237108-343471,3
A (m2)
133
52
32,678,65
35,29a 10,61
31,75-33,6
33,6-36,98
(m)
338
154
Acini
923,68449,04
1061,84a 562,45
858,9-988,46
947,87-1175,8
A (m2)
187
96
86,3467,22
99,06b 66,81
74,62-98,05
83,58-114,54
Intralobular ducts (m)
129
74
105,1587,41
197,06a 173,09
86,94-123,35
133,56-260,55
Interlobular ducts (m)
91
31
18,1611,14
29,24a 20,79
Interlobular connective tissue
16,21-20,12
23,61-34,86
(m)
127
55
24,8416,77
30,9b 24,64
20,84-28,84
22,3-39,5
Intralobular blood vessels (m)
70
34
87,3778,39
148,32a 134,87
73,82-100,92
116,16-180,48
Interlobular blood vessels (m)
131
70

L (m)
Epithelial
cells of
secretory
units

w(m)
Nucleus(m)

12,112,57
11,66-12,55
131
6,811,79
6,49-7,13
125
3,10,62
3,02-3,19
204

12,05b 2,69
11,29-12,81
51
6,57b 1,34
6,19-6,94
51
3,09b 0,59
2,97-3,21
101

Mean (M) Standard deviation (SD);


Confidence interval (CI 95%);
Number of measured structures (N);
a
means with statistical significant of the difference (t-Student);
b
means without statistical significant of the difference (t-Student).

24

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Table 2. Micromorphometry of NG segments in dog, according to sex
Dogs (n = 25)
M (n = 17)
F (n = 8)
Histologic structures
MSD
MSD
CI 95% (p<0,05)
CI 95% (p<0,05)
N
N
5807,771574,85
7155,4 3301,82-8313,72
L (m)
4
1
PNG
840,98369,83
1034,6b 577,42
498,94-1183,02
E-6222,54
w (m)
7
2
9680,852978,47
8301,7 4941,42-14420,27
L (m)
4
1
BNG
1244,4549,29
1166,3b 68,16
736,38-1752,41
553,86-1778,73
w (m)
7
2
2710,262323,66
2605,85b 863,87
E-5595,47
E-10367,44
L (m)
5
2
BsNG
2085,38708,06
2200,9b 509,25
1430,53-2740,23
E-677,4
w (m)
7
2
33881736,39
3405,9b 3195,55
1565,76-5210,23
E-32116,84
DPGS (m)
6
2

Mean (M) Standard deviation(SD);


Confidence interval (CI 95%);
Number of measured structures (N);
b
means without statistical significant of the difference (t-Student)
Table 3. Morphometry of different histologic structures of third eyelid in dog, according to sex
Dogs(n = 25)
M (n = 17)
F (n = 8)
Histologic structures
MSD
MSD
CI 95% (p<0,05)
CI 95% (p<0,05)
N
N
971,09275,7
941,05b 466,27
811,9-1130,28
509,82-1372,28
DBTE-C (m)
14
7
575,52254,23
470,51b 158,04
513,02-556,59
396,54-544,47
L (m)
66
20
276,14165,26
197,72a 94,56
235,51-316,76
153,46-241,97
Lymphonoduls w (m)
66
20
146730,1153292,9
78501,42b 50420,06
109046-184414,2
54904,11-102098,7
A (m2)
66
20
154,6543,29
168,78b 42,24
145,19-164,1
153,55-184,01
Cartilage thickness (m)
83
32

Mean (M) Standard deviation (SD);


Confidence interval (CI 95%);
Number of measured structures (N);
a
means with statistical significant of the difference (t-Student);
b
means without statistical significant of the difference (t-Student).

25

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 1. Third eyelid in dog and nictitating gland in


male (scheme)-measured segment: A- PNG length; DPNG width; B- BNG length; E-BNG width;C- BsNG
length; D+E- BsNG width; G-Distance from border of
third eyelid to the proximal end of cartilage (DBTEC);F- Difference of proximal glandular structures
(DPGS).

1.

2.

3.
4.

Fig. 2. Third eyelid in dog and nictitating gland in


female (scheme)-measured segment: A- PNG length;
D- PNG width; B- BNG length; E-BNG width;C- BsNG
length; D+E- BsNG width; G-Distance from border of
third eyelid to the proximal end of cartilage (DBTEC);F- Difference of proximal glandular structures
(DPGS).

CONCLUSIONS
All the means of histologic structures of nictitating gland (lobuls, acini, glandular ducts,
interlobular conjunctiv tissue and blood vessels) are greater in female and different significant
statistic, except the mean of ducts and intralobular blood vessels.
GNP is greater in female than males, GNB is greater in males than females, but the means are not
different significant statistic. GNBz of males is longer, but comparatively lower in females that
the ratio is inverse, being shorter but wider, and the means are not different significant statistic.
The lymphonoduls of the third eyelid have the greater dimensions in males than females, but
the means are not different significant statistic.
The thickness of cartilage of the third eyelid is greater in females than males, but the means are
not different significant statistic.
BIBLIOGRAFIE

Chaudieu G., 1994 Lappareil lacrymal, Prat. Md. Chir. Anim. Comp., 1994,29,421- 446.
Cloef C.B., 1995 Loeil sec, Pratique mdicale et chirurgicale de lanimal de campagnie Personnel soignant. Nr. 195, Supplment au numro 1-1995 de PMCAC, p. 21-25.
3. Cornil N., Manolescu N., 1995 Structura i ultrastructura organelor la animalele domestice, Ed. Ceres, Bucureti.
4. Cotea C., 2005 Histologie special, Ed. Tehnopress, Iai.
5. Coofan V., Palicica R., Hricu Valentina, Gan Carmen, Enciu V., 2000 Anatomia animalelor domestice, Vol. III,
Ed. Orizonturi Universitare, Timioara.
6. Coofan V., Predoi G., 2003 Anatomia topografic a animalelor domestice, Ed. BIC ALL, Bucureti.
7. Davidson J. Harriet, Kuonen J. Vanessa, 2004 The tear film and ocular mucins, Veterinary Ophthalmology (2004)
7, 2, 7177.
8. Miclu I., Ionacu Iuliana, Mocanu Jacqueline, 2004 Oftalmologie veterinar-note de curs. USAMV, Bucureti.
9. Ortiz G.G., Feria-Velasco A., Falcon-Franco M.A., Bitzer Guintero O.K., Garcia J.J., Rosales S.A., Ruiz-Rizo L.,
Reiter R.J., 2001 Diferent Patterns in the Histology and Autofuorescence of the Harderian Glands of the Syrian
Hamster, Rat, Mouse, Mongolian Gerbil and Guinea Pig, Anat. Histol. Embryol. 30, 107-115.
10. Patea E., Mureianu E., Constantinescu Gh., Coofan V., 1978 Anatomia comparativ i topografic a animalelor
domestice, Ed. Didactic i Pedagogic, Bucureti.
11. Sakai T., 1981 The mammalian Harderian gland: morphology, biochemistry, function and phylogeny. Archivum
Histologicum Japonicum 44, 299-333.
12. Szymaski C., 1987 The eye, n Disease of cat-Medicine and Surgery Holzworth J., W. B. Saunders Company,
Phyladelphya, Lon

1.
2.

26

Lucrri tiinifice vol. 51 seria Medicin Veterinar

MORFOLOGIA MICROSCOPIC A COMPARTIMENTELOR


CLOACALE LA PREPELIA JAPONEZ
(COTURNIX COTURNINX JAPONICA)
MICROSCOPICAL MORPHOLOGY OF THE CLOACA COMPARTMENTS IN
THE JAPANESE QUAIL
(COTURNIX COTURNIX JAPONICA)
CAZIMIR Iuliana1, CORNIL N.1, PREDOI tefania1, RISTEA Florica2,
CONSTANTINESCU Cristina1
1FMV Bucureti
2IDSA Animal Bucureti
In this study we observed a series of histostructural aspects concerning the cloaca
comparments in the japanese quail (Coturnix coturnix japonica), approaching the dynamic of the
constituting and finishing of the characterstics of this segment after-hatching, starting from the
age of one day old until reaching adulthood, at the age of 70 days.
This work insists both on the structural details in the coprodeum, urodeum and proctodeum
and on the presence of a well represented local lymphoid population.
One can observe major differences between ages, significant for each stage of development.
Key words: quail, coprodeum, urodeum, proctodeum, lymphoid cells

Constituind segmentul terminal, comun aparatelor digestiv, urinar i genital, cloaca este
alctuit, n sens cranio-caudal din coprodeum, urodeum i proctodeum. Separarea celor trei
compartimente se efectueaz prin intermediul unor pliuri ale mucoasei. ntre rect i coprodeum pliul
este prevzut cu un sfincter, iar cel dintre urodeum i proctodeum apare ters, realiznd o separare
incomplet [8, 9, 10].
Peretele cloacal are o organizare asemntoare celei intestinale. Astfel, mucoasa n
coprodeum prezint viloziti i glande Lieberkhn reduse. Pe msur ce avansm aboral, vilozitile
i micoreaz i mai mult nlimea, iar n urodeum vor fi nlocuite de pliuri cu un epiteliu simplu
columnar srac n celule caliciforme [1, 3, 6].
La nivelul proctodeumului se face trecerea de la epiteliul simplu columnar la epiteliul
stratificat pavimentos necheratinizat, n general, i keratinizat n dreptul orificiului cloacal [2,5].
n lamina propria observm o populaie limfoid difuz, limfonoduli i glande tubulare,
aglomerate mai ales n peretele dorsal, n apropierea deschirerii canalului bursal. La masculii aduli ai
prepeliei japoneze aceste glande ating o dezvoltare maxim [1, 4, 7].
Musculara apare dezvoltat n toate compartimentele, dar la nivelul su se constat o
inversare a modului de dispunere a straturilor, n segmentul distal *3].
Material i Metod
Pentru studiul histostructural au fost utilizate 17 psri, ce aparin ordinului Galliformes,
familia Phasianidae, genul Coturnix, specia Coturnix japonica, masculi i femele, cu vrste cuprinse
ntre 1 zi i 10 sptmni.
Piesele recoltate au fost prelucrate prin tehnica histologic, realizndu-se seciuni seriate,
transversale sau longitudinale. Pentru colorarea seciunilor rezultate s-au folosit metodele
Hemalaun-Eozin, Hemalaun-Eozin-Albastru de Metil, Giemsa pentru seciuni, Albastru Alcian,
Periodic Acid Schiff.
Examinarea preparatelor histologice obinute s-a realizat cu ajutorul microscopului optic
NIKON-LABOPHOT 2, prevzut cu filtru de lumin BG-33, Exponometru Nikon AFX-DX, i un aparat
foto Nikon FX-35 DX, iar imaginile au fost prelucrate computerizat cu ajutorul programului Adobe
photoshop 6.0.
Rezultate i discuii
Seciunile transversale i longitudinale realizate prin compartimentele cloacale, la psrile n
vrst de o zi, creaz posibilitatea recepionrii unei imagini de ansamblu asupra segmentului
terminal al tubului digestiv.
27

Universitatea de tiine Agricole i Medicin Veterinar


Vilozitile intestinale se reduc considerabil n coprodeum, unde vor fi nlocuite de pliuri ale
mucoasei sau de cute mai proeminente, prevzute cu pliuri. Musculara mucoasei este foarte fin,
constituind corp comun, n anumite zone, cu musculara extern. n structura straturilor musculare se
menin nc, fibrele musculare netede. Epiteliul mucoasei coprodeumului este simplu columnar, i
conine alturi de celulele columnare, rare celule caliciforme. n lamina propria apar i glandele
tubulare simple, destul de slab reprezentate.
n imediata vecintate a coprodeumului se poate sesiza aranjamentul diferitelor segmente ce
aparin aparatului genito-urinar, n traseul lor spre zona deschiderii n urodeum (Fig.1).
La psrile adulte, mucoasa formeaz nite cute din loc n loc, pe care sunt dispuse vilozitile,
ce au o structur foarte asemntoare cu cea ntlnit n ileon. Epiteliul vilozitilor este simplu
columnar, i prezint numeroase celule caliciforme active. n axul fiecrei viloziti, alturi de esutul
conjunctiv lax, se pot observa cteva fibre musculare netede. Ele provin din musculara mucoasei, bine
reprezentat la acest nivel, care, dup ce a ptruns n cute, se continu i n viloziti. Musculara
extern apare constituit dup modelul intestinal obinuit, din stratul muscular circular intern i cel
longitudinal, extern, ambele cu fibre musculare netede (Fig.2, fig. 3). Seroasa ce nvelete
coprodeumul vine n contact cu diferite formaiuni vasculo-nervoase. De asemenea, dorsal,
coprodeumul se nvecineaz cu bursa Fabricius, iar lateral cu ureterele. Tot lateral, n funcie de sex,
se afl dispuse canalele deferente sau segmentul terminal al oviductului stng.

Fig. 1. Detaliu privind histostructura mucoasei coprodeumului, la prepelia japonez


n vrst de 1 zi/AA, ob.20x (original)
1. Epiteliu simplu columnar; 2. Celule caliciforme; 3. Glande tubulare simple; 4. Lamina propria.

Fig. 2. Prezena pliurilor n structura mucoasei coprodeumului, la prepelia japonez


n vrst de 70 de zile/PAS, ob.3x (original)
1.Lumen; 2. Vilozitate; 3.Pliuri ale mucoasei; 4.Musculara mucoasei; 5.Musculara extern.

28

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 3. Reacie Albastru-Alcian pozitiv la nivelul mucoasei coprodeumului, la prepelia japonez


n vrst de 70 de zile/AA, ob.40x (original)
1. Lamina propria; 2. Epiteliu simplu columnar; 3. Celule caliciforme.

Jonciunea dintre coprodeum i urodeum este marcat de prezena unui fald al mucoasei, n
axul creia ptrund i rare fibre musculare netede. Aboral regiunii, mucoasa formeaz pliuri reduse,
dar cu aproximativ aceleai dimensiuni, desprinzndu-se impresia de ordonare. Aceast modalitate
de aranjare specific urodeumului, se menine i la psrile adulte, cu corecia dimensional de
rigoare (Fig.4).

Fig. 4. Evidenierea regiunii joncionale dintre coprodeum i urodeum, la prepelia japonez


n vrst de 1 zi/AA, ob.3x (original)
1.Coprodeum; 2.Urodeum; 3. Fald al mucoasei; 4. Mucoas; 5. Muscular.

Urodeumul nu mai prezint modificri de structur dup vrsta de 30 de zile. La psrile


adulte, vilozitile, chiar dac sunt reduse, se menin n zonele iniiale i mijlocii ale segmentului, pn
vor fi nlocuite de pliurile mucoasei. n epiteliul simplu columnar al urodeumului, n locul celulelor
caliciforme tipice, se pot distinge o serie de celule mucogene, destul de rare. Centrul vilozitilor, i
apoi, al pliurilor, este ocupat de esutul conjunctiv lax, vascularizat i inervat, n care alturi de
fibroblaste i fibrocite putem ntlni i celule limfoide, rspndite n tot teritoriul sau cantonate n
apropierea epitelilui dorsal (Fig.5).
Aglomerri importante de limfocite i plasmocite, chiar limfonoduli, se descriu i n arealul
corespunztor orificiului prin care ureterul comunic cu urodeumul (Fig.6).

29

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 5. Seciune transversal prin urodeum, la prepelia japonez n vrst de 32 de zile/HE, ob.10x (original)
1. Viloziti; 2. Lamina propria; 3. Glande tubulare simple; 4. Musculara extern.

Fig. 6. Prezena populaiei limfoide n dreptul locaiei deschiderii ureterului n urodeum, la prepelia japonez
n vrst de 70 de zile/HEA, ob.10x (original)
1. Mucoas; 2. Limfonodul; 3. Infiltraie limfoid n lamina propria; 4. Fibre musculare.

Din zona n care fibrele musculare netede se ntreptrund cu cele striate de tip scheletic,
epiteliul simplu columnar al mucoasei urodeale se va transforma n epiteliu stratificat pavimentos
necheratinizat, punctndu-se astfel, grania dintre urodeum i proctodeum, ultimul compartiment
cloacal.
n mucoasa proctodeal nu apar att de devreme glandele tubulo-alveolare, iar celulele
limfoide sunt att de rare nct pot fi trecute cu vederea (Fig.7). Nici la psrile n vrst de 60 de zile
mucoasa proctodeumului nu prezint glande n zona n care epiteliul devine stratificat pavimentos
cheratinizat, foarte cutat, urmndu-i legtura cu epidermul orificiului cloacal. n esutul conjunctiv
din lamina propria se pot observa ns, celule limfoide cu tendin de aglomerare (Fig.8).
Deplasndu-ne din nou anterior, ctre urodeum, vom ntlni glandele
tubulo-alveolare,
aranjate ordonat n grupri paralele. Dac spre orificiul cloacal tubulo-alveolele au un diametru mai
redus, i sunt destul de rare, n apropierea urodeumului ating dezvoltarea maxim, i sunt formate
din tubulo-alveole cu numeroase plieri intraluminale. Epiteliul glandular este simplu columnar.
Celulele nu sunt foarte nalte, au o citoplasm areolar, i prezint nuclei heterocromatici sferici sau
ovalari, dispui bazal. n profunzime, glandele vin n contact cu musculatura striat a proctodeumului,
care le ofer baza de susinere. Att printre glande, ct i n apropierea lor, se ntlnesc limfonoduli
sau aglomerri limfoide difuze. Spre suprafaa mucoasei proctodeumului se disting canalele
glandulare, care se deschid n cavitatea compartimentului cloacal, dup ce au strbtut epiteliul de
acoperire stratificat pavimentos necheratinizat. Acest epiteliu este format din aproximativ 5-8 straturi
de celule, i i poate menine grosimea relativ constant, pe toat ntinderea sa (Fig.9).
30

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n dreptul zonei, n care are loc deschiderea canalului bursal, epiteliul este invadat de
numeroase celule limfoide, dezorganizndu-se. Limfonodulii de mari dimensiuni mpnzesc toat
lamina propria (Fig.10).

Fig. 7. Imaginea de ansamblu a peretelui cloacal, cu evidenierea regiunii joncionale dintre urodeum
i proctodeum, la prepelia japonez n vrst de 1 zi/PAS, ob.3x (original)
1.Coprodeum; 2.Urodeum; 3. Proctodeum; 4. Zon joncional urodeo-proctodeal.

Fig. 8. Aspectul mucoasei proctodeumului n apropierea orificiului cloacal, la prepelia japonez


n vrst de 32 de zile/HEA, ob.6x (original)
1. Epiteliu stratificat pavimentos keratinizat; 2. Lamina propria; 3.Infiltraie limfoid; 4. Fibre musculare striate.

Fig. 9. Apariia i aglomerarea limfonodulilor n structura mucoasei bogate n glande tubulo-alveolare, din
proctodeum, la prepelia japonez n vrst de 70 de zile/AA, ob.6x (original)
1. Epiteliu stratificat pavimentos keratinizat; 2. Glande tubulo-alveolare; 3.Epiteliu simplu columnar;
4. Fibre musculare striate skeletice; 5.Limfonoduli.

31

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 10. Dezorganizarea structurii mucoasei proctodeumului n apropierea regiunii n care se deschide la
nivelul su canalul bursal, la prepelia japonez n vrst de 70 de zile/HEA, ob.6x (original)
1. Epiteliu stratificat pavimentos keratinizat; 2. Limfonoduli; 3. Glande tubulo-alveolare.

Concluzii
3.1. Vilozitile intestinale se reduc considerabil n coprodeum, la vrsta de 1 zi, unde vor fi
nlocuite de pliuri ale mucoasei sau de cute mai proeminente, prevzute cu pliuri.
3.2. La psrile adulte, mucoasa coprodeumului, formeaz rare cute, pe care sunt dispuse
vilozitile.
3.3. Urodeumul prezint o structur constant dup vrsta de 30 de zile, la care, vilozitile,
chiar dac sunt reduse, se menin n zonele iniiale i mijlocii ale segmentului, pn vor fi nlocuite de
pliurile mucoasei.
3.4. n jurul orificiului prin care ureterul comunic cu urodeumul, se pot descrie aglomerri
importante de limfocite, plasmocite, i chiar limfonoduli.
3.5. La nivelul proctodeumului, n mucoas, ntlnim numeroase glande
tubuloalveolare, acompaniate de un esut limfoid abundent.
3.6. n apropierea urodeumului glandele tubulo-alveolare ating dezvoltarea maxim,
prezentnd numeroase plieri intraluminale.
3.7. Pe tot traseul cloacal n dreptul zonelor de trecere de la un segment la altul, apare o
organizare a esutului limfoid asociat mucoasei, prin constituirea unor limfonoduli stabili, doar la
psrile n vrst de peste 4 sptmni.
Bibliografie
CORNIL, N.- Morfologia microscopic a animalelor domestice (cu elemente de embriologie),Vol.II. Ed. ALL,
Bucureti, 2001.
2. DELLMANN, H.D., BROWN, E.M.- Text book of veterinary histology. Lea and Febiger, Philadelphia, 1992.
3. FITZGERALD, T.C.-The coturnix quail. Anatomy and Histology. The Iowa State University Press, Ames, Iowa,
first edition, 1969.
4. GEORGESCU, B., CIOBOTARU EMILIA, CORNIL, N., PREDOI, G., OGOE, I., MILITARU MANUELLA,
CAZIMIR IULIANA.-Aspecte macro- i microscopice ale bursei cloacale la prepelia japonez. Lucr. tiin.
USAMV, seria C, vol.XLIV-XLV, Bucureti, 2002.
5. HILL, K.J.- The structure of the alimentary tract. Physiology and Biochemistry of the Domestic Fowl. Ed. Bell,
D.J.& Freeman, B.M., Vol. I, London and New York Academic Press, 1971.
6. HODGES, R.D.- The histology of the fowl. Academic Press Inc., London-New York- San Francisco, 1974.
7. KING, A.S., MC LELLAND, J.- Birds- their structure and function. Second Edition. Ed. Baillere Tindall, LondonPhiladelphia-Toronto, 1984.
8. MCLELLAND, J.- Digestive system, in Form and Function in Birds. Ed. King A.S.& McLelland J., Vol I, London
and New York Academic Press, 1979.
9. PREDOI G., GEORGESCU B., BELU C., DANACU V., DUMITRESCU I.- .-Anatomia comparat i topografic a
animalelor domestice. Vol. I Lito. A.M.C.-USAMV, Bucureti, 1997.
10. PREDOI, G., BELU, C., GEORGESCU, B., IULIANA CAZIMIR- Research regarding the morphotopography of
the digestive tract in the Coturnix coturnix japonica. 27th World Veterinary Congress WVA, Tunis, 24-30 sept.
2002.
11. *** Nomina Anatomica Veterinaria (Fourth Edition) together with Nomina Histologica (Revised Second Edition)
and Nomina Embryologica Veterinaria. Zurich and Ithaca, New York, 1994.
1.

32

Lucrri tiinifice vol. 51 seria Medicin Veterinar

ACIUNEA UNOR EXTRACTE VEGETALE ASUPRA


MICROBIOCENOZEI INTESTINALE ENDOSIMBIONTE
LA OARECELE DE LABORATOR
THE EFFECT OF SOME PLANT EXTRACTS ON THE INTESTINAL
ENDO-SYMBIOTIC MICRO-BIOCENOSIS IN LABORATORY MICE
CERNEA Laura, CERNEA M., OGNEAN L., FI N., TR]NC S.,
TRIPON S., CUCURUZAN Simona
USAMV Cluj-Napoca
The study has been carried out between October 2006 and May 2007 on a number of 42
laboratory mice, and was meant to establish the population structure of the intestinal microbiocenosis in laboratory mice and the therapeutic effect of some essential oils (Ocimum basilicum
- basil, Thymus vulgaris - thyme, Calendula officinalis - marigold) administered orally in doses of
10 l/animal on the flagellates and intestinal bacteria.
The research highlighted the fact that the population of intestinal flagellates was made up by
Giardia muris (66,66 %), Hexamita muris (75 %), Chilomastix bettencourti (83,33 %), and
Trichomonas spp (83,33 %). Intestinal bacteria were made up mostly of Escherichia coli (100%),
Staphylococcus spp. (91,66%), Streptococcus spp. (41,66%), Bacillus spp. (25 %), Enterococcus
spp. (16,66 %) and Candida spp. (8,33 %).
The effect over the flagellate population was important for Calendula officinalis on Giardia
muris (5,12 G/l) and Trichomonas spp. (121,6 G/l) populations, and Ocimum basilicum on
Hexamita muris (30,72 G/l) and Trichomonas spp. (80,64 G/l) populations; none of the essential
oils showed any effect on Chilomastix bettencourti. The 3 essential oil employed in the study were
effective against Streptococcus spp in which the extensivity dropped from 83,33% to 16,66%
(Ocimum basilicum), from 66,66% to 50% (Calendula officinalis) and from 50% to 0% (Tymus
vulgaris).

Pe plan internaional se studiaz tot mai mult aspectele legate de poluarea chimic
medicamentoas, prin acumularea reziduurilor cu potenial activ (mutagen, teratogen, cancerigen) n
produsele i subprodusele provenite de la animalele supuse tratamentelor medicamentoase. Calea
evitrii acestor inconveniente ar putea fi utilizarea cu prioritate a produselor farmaceutice de natur
vegetal (Rpeanu i colab., 2001).
Cercetrile ntreprinse reprezint un model experimental de testare in vivo a modului n care
reacioneaz organismele la fitoterapie, fiind urmrtit totodat i eficacitatea terapeutic a unor
extracte uleioase. In acest context, obiectivele studiului efectuat au vizat stabilirea structurii
populaionale a microbiocenozei intestinale la oarecele de laborator; efectului unor uleiurilor
eseniale de Ocimum basilicum, Tymus vulgaris si Calendula officinalis. (administrate n doz unic)
asupra flagelatelor i bacteriilor intestinale la oarecele de laborator;
MATERIALE I METODE
Cercetrile au fost efectuate n perioada octombrie 2006 - mai 2007 n cadrul disciplinelor de
Fiziologie animal i Parazitologie a facultii de Medicin Veterinar Cluj-Napoca. n studiu a fost
inclus un numr de 42 de oareci de laborator n vrst de 8 sptmni. Pe parcursul experimentului
animalele au fost ntreinute n aceleai condiii de cazare i alimentaie. Extractele de plante folosite
n experiment au fost de uleiuri eseniale preparate din Ocimum basilicum (busuioc), Tymus vulgaris
(cimbru) i Calendula officinalis (glbenele). Experimentul s-a desfurat n 2 etape, fiecare dintre
acestea avnd obiective diferite.
n cadrul primei etape am utilizat un lot de 12 oareci la care a fost analizat structura
populaiei de flagelate i bacterii intestinale. Pentru identificarea speciilor de flagelate intestinale s-a
recurs la efectuarea de preparate native i frotiuri din coninutul intestinal colorate prin metoda Dia
Quick Panoptic. n cazul florei bacteriene au fost recoltate probe prin badijonare rectal, acestea fiind
nsmnate pe mediul de cultur cu agar nutritiv.
Obiectivul principal al etapei II a fost reprezentat de analiza modului n care extractele
vegetale, administrate n doz unic acioneaz asupra microflorei i microfaunei intestinale. n cadrul
33

Universitatea de tiine Agricole i Medicin Veterinar


acestei etape au fost utilizai 30 de oareci mprii n 5 loturi experimentale. Extractele uleioase de
Ocimum basilicum, Tymus vulgaris i Calendula officinalis au fost administrate n doz de
10l/oarece. Pentru a urmri comparativ rezultatele au fost constituite 2 loturi martor, unul cruia i
s-a administrat ap (martor negativ) i altul tratat per os (martor tratat) cu metronizadol n doz de
0,0012 g/oarece. nainte de administrare au fost prelevate, prin tueu rectal cu tampon steril probe
pentru examenul bacteriologic. Monitorizarea comparativ a aciunii extractelor vegetale a fost
efectuat dup 24 de ore de la administrare i a constat n: recoltarea probelor pentru examen
bacteriologic; nsmnare pe medii de cultur; stabilirea structurii microflorei bacteriene cu urmrire
ante i post-administrare; recoltarea probelor din duoden i cecum pentru identificarea i
cuantificarea microflorei intestinale. n acest caz aprecierea i cuantificarea structurii protozoariene a
fost fcut comparativ cu loturile martori negativ i pozitiv.
REZULTATE I DISCUII
Rezultatele obinute au diferite n funcie de etapa experimental i de obiectivele urmrite. n
ceea ce privete populaia de flagelate intestinale la oarecii luai n studiu (n=12), aceasta a fost
reprezentat de Giardia muris, Hexamita muris, Chilomastix bettencourti, Trichomonas spp.
Giardia muris a fost pus n eviden la 8 subieci, ceea ce reprezint o extensivitate de
66,66%, intesivitatea fiind situat la un nivel mediu de 42,22 G/l. Exemplarele puse n eviden au
prezentat dimensiuni medii de 10,5 x 7 m, indentificarea lor bazndu-se pe aspectele morfologice
caracteristce: forma corpului, aspectul flagelilor, prezena nucleilor. Identificarea i aprecierea
intesivitii au fost efectuate att prin examinarea preparatelor native ct i a amprentelor fixate i
colorate.
Hexamita muris a prezentat extensivitate de 75% cu intesivitate de 45,23 G/l. Paraziii
analizai au prezentat dimensiuni medii de 9 x 3,5m i au fost caracterizai de forma alungit,
aspectul flagelilor i poziia nucleilor. n cazul acestei specii identificarea a fost fcut n preparatele
native, bazndu-ne n special pe dimesiunile parazitului, mobilitatea foarte mare i modul
caracteristic de deplasare. Aspectele morfologice de detaliu au fost nregistrate prin examinarea
frotiurilor colorate.
Precizm faptul c Giardia muris i Hexamita muris au fost puse n eviden la nivelul
intestinului subire, respectiv n duoden. La examenul macroscopic al acestui segment intestinal, dei
numrul paraziilor era destul de important nu au fost observate leziuni.
Chilomastix bettencourti a fost pus n eviden numai la nivelul cecumului i a prezentat un
nivel al extensivitii de 83,33% cu intesivitate de 89,09 G/l. Identificarea speciei a fost fcut n
funcie de aspectele morfologice ale formelor vegetative i chistice. Formele vegetative au prezentat
dimensiuni medii aproximative de 13,01 x 8 m, identificarea fiind fcut, n principal, n funcie de
aceasta i de modul de deplasare pe suprafaa examinat microscopic. n acest sens subliniem faptul
c n preparatele native am ntmpinat dificulti n aprecierea aspectelor morfologice, respectiv a
numrului de flageli, fiind evideniabil numai cel recurent. Din punct de vedere al modului de
deplasare Chilomastix bettencourti a prezentat micri liniare. Confirmarea, n identificarea acestei
specii, a fost realizat n urma examinrii amprentelor din coninutul cecumului. n aceste preparate
au fost puse n eviden chisturile caracteristice cu dimensiuni medii de 8 x 6 m. Chisturile au
prezentat form de lmie, fiind buonate la un pol , n unele situaii a fost surprins etapa efectiv
de formare a membranei chistice, n aceast situaie chisturile au avut form oval, iar membrana
chistic n formare prezenta alt afinitate tinctorial.
In conformitate cu datele bibliografice (Bussieras i Chermette, 1992), la oarecele de
laborator poate fi ntlnit Trichomonas muris i Trichomonas hominis cu localizare preponderent la
nivelul cecumului. n cazul probelor examinate de noi, nici n preparatele native i nici n frotiuri nu
am reuit s realizm diferenierea celor 2 specii, astfel nct am fcut referire la Trichomonas spp.
Nivelul infeciei a fost caracterizat de extesivitate relativ mare (83,33 %) i intesivitate de 257,36 G/l.
Formele vegetative au prezentat dimensiuni medii aproximative de 17 x 9 m, identificarea n
preparatele native fiind fcut n special pe baza micrilor sinuoase. n preparatele fixate i colorate
dimesiunile au fost apreciate mai exact, fiind observate aspectele morfologice de detaliu: membrana
ondulant, flagelii, nucleul.
34

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n contextul studierii structurii populaiei de protozoare intestinale la oarecii de laborator,
Jalili (1989), ntr-un studiu efectuat pe 216 animale a observat c au fost pozitive 153 (70,8 %).
Speciile evideniate au fost: Trichomonas muris 31,5%. Trichomonas spp. 29,6%, Chilomastix
bettencourti 18,5%, Octomitus intestinalis 7,8%, Giardia muris 6,9%, Spironucleus muris 4,1%,
Entamoeba muris 14,8%. De asemenea, autorul precizeaz c n majoritatea cazurilor au fost
nregistrate infecii cu 2-5 specii de protozoare. n studiul ntreprins de noi s-a observat c aproape la
toi subiecii au fost evideniate infecii cu 2-4 specii.
Microflora bacterian intestinal a fost dominat din punct de vedere structural de specia
Echerichia coli cu extensivitate de 100%. Celelalte specii bacteriene evideniate au fcut parte din
genurile Staphylococcus (91,66 %), Streptococcus (41,66%), Enterococcus (16,66 %), Bacilus (25 %).
Totodat menionm identificarea unui reprezentant al grupului de levuri i anume Candida spp. cu
extensivitate de 8,33%. Genurile identificate fac parte din microbiocenoza intestinal simbiont. In
acest context precizm c la nivelul intestinului gros procesele chimice de fermentaie i de
putrefacie sunt realizate de ctre flora intestinal reprezentat de: Echerichia coli, Bacillus lactis
aerogenes, Bacillus butiricus, Lactobacillus spp., Bacteroides vulgatus (Bohn i colab., 2006),
Bacteroides ovatus (Ferrar i colab., 2005), Bacilus putrificus, Clostridium perfringens, Bacilus
aminofilus, Enterococcus faecalis, Pseudomonas fluorescens (Kim i colab., 2005), Helicobacter spp.,
Eubacterium rectale, Verrucomicrobium spinosum, Bacillus mycoides, Clostridium coccoides (Salzman
i colab., 2002).
Rezultatele obinute n cadrul etapei a doua sunt redate (comparativ cu loturile martor negativ
i martorul tratat) n tabelul 1. Precizm c analiza rezultatelor a fost efectuat comparativ n funcie
de specia de flagelat investigat. n interpretarea rezultatelor nu am eliminat posibilitatea existenei
unor diferene din punct de vedere al situaiei populaiilor de flagelate intestinale. n acest context
am pornit de la premiza variabilitii individuale, att din punct de vedere al microbiocenozei, ct i a
modului n care organismele rspund la actul terapeutic.
Tabel 1 Influena extractelor uleioase asupra flagelatelor intestinale la oarecele de laborator (etapa 2)
Chilomastix
Giardia muris
Hexamita muris
Trichomonas spp.
bettencourti
LOT 1 martor negativ (ap distilat)
Medie
39,68
46,08
47,36
290,56
Dev. st
49,395
64,986
44,628
565,248
Extensivitate ( %)
83,33
66,66
66,66
66,66
Intensivitate ( G/l)
47,616
69,12
71,04
435,84
LOT 2 martor tratat (metronidazol)
Medie
15,36
80,64
782,08
0,0025
Dev. st
18,812
152,965
1505,189
0,006
Extensivitate ( %)
50
66,66
100
16,66
Intensivitate ( G/l)
30,72
120,96125
782,08
0,015
LOT 3 Ocimum basilicum
Medie
21,76
30,72
95,06
80,64
Dev. st
46,187
47,589
169,239
197,527
Extensivitate ( %)
33,33
66,66
83,33
16,66
Intensivitate ( G/l)
65,28
46,085
114,075
483,84
LOT 4 Tymus vulgaris
Medie
33,28
61,44
341,54
404,48
Dev. st
39,659
120,945
491,703
931,514
Extensivitate ( %)
50
66,66
83,33
50
Intensivitate ( G/l)
66,56
92,16
409,849
808,96
LOT 5 Calendula officinalis
Medie
5,12
101,12
81,92
121,60
Dev. St
6,271
86,401
163,544
260,958
Extensivitate ( %)
50
100
83,33
83,33
Intensivitate ( G/l)
10,24
101,12
98,304
145,92

Giardia muris la lotul negativ extensivitatea de 83,33% a fost nsoit de un nivel mediu de
36,68 G/l i intesivitate de 47,62 G/l. La celelalte loturi aceti parametri au fost definii n funcie de
35

Universitatea de tiine Agricole i Medicin Veterinar


substana administrat. Dei extensivitatea a fost identic (50 %) la loturile tratate cu metronidazol,
Tymus vulgaris i Calendula officinalis
s-au nregistrat diferene n ceea ce privete media i
intesivitatea. Astfel, s-a constat la lotul tratat cu metronidazol un nivel mediu de 15,36 G/l (I = 30,72
G/l), iar la cel tratat cu cimbru media a fost de 33,28 G/l, n timp ce administrarea extractului de
glbenele a indus un nivel mediu de 5,12 G/l (I = 10,24 G/l). Cea mai mic extensivitate a fost
observat la lotul tratat cu Ocimum basilicum (33 %), dar intensivitatea a fost relativ mare (65,28 G/l)
cu un nivel mediu de 21,76 G/l. Apreciem c n cazul speciei Giardia muris eficacitatea cea mai bun
au avut-o Calendula officinalis i Ocimum basilicum, datorit diferenelor fa de loturile martor.
Hexamita muris extensivitatea a fost relativ apropiat la cele 5 loturi experimentale cu
meniunea c la lotul martor negativ i la loturile tratate cu metronidazol i busuioc a fost 66,66%, n
timp ce n cazul celorlalte loturi a fost de 50%. Contrar valorii extensivitii s-au nregistrat variaii
destul de largi n ceea ce privete intesivitatea i media. n acest sens s-a observat, comparativ cu
martorul negativ c cea mai redus intesivitate a fost nregistrat la lotul tratat cu Ocimum basilicum
(46,09 G/l) cu o medie de 30,20 G/l, iar cea mai ridicat valoare a fost la Calendula officinalis, 101,12
G/l; la lotul martor tratat cu metronidazol intesivitatea a fost deosebit de ridicat i anume 120,96
G/l. Aceste rezultate relev posibilitatea scderii numrului de indivizi din populaia de Hexamita
muris sub influena principiilor active din extractul de Ocimum basilicum.
Chilomastix bettencourti nivelul extensivitii a fost ridicat la toate loturile experimentale,
fiind de 100% la lotul tratat cu metronidazol, 66,66% la martorul negativ i cel tratat cu busuioc i
83,33 % la loturile tratate cu cimbru i glbenele. Din punct de vedere al intesivitii s-au observat
fluctuaii care ns nu par a fi influenate de substanele administrate datorit faptului c toate
valorile de la loturile tratate sunt mai mari dect al lotului martor negativ. Aceast situaie se poate
explica prin faptul c exist posibilitatea ca structura populaiei de flagelate s fie diferit. De
asemenea Chilomastix bettencourti poate fi o specie de flagelat rezistent la substanele pe care leam utilizat, inclusiv la metronidazol.
Trichomonas spp. n acest caz valorile extensivitii au nregistrat diferene foarte mari n
funcie de lot. n acest sens menionm c la lotul martor negativ nivelul de 66,66% a fost depit de
cel observat la lotul tratat cu glbenele (83,33 %). La lotul la care s-a administrat cimbru
extensivitatea a fost de 50%, iar la loturile tratate cu metronidazol i busuioc de numai 16,66%.
Interesant a fost evoluia intesivitii i a nivelului mediu. Comparativ cu lotul martor negativ aceti
parametri au fost mai redui n principal la lotul tratat cu metronidazol (I = 0,015 G/l; M = 0,0025
G/l), existnd o corelaie direct i cu nivelul extensivitii. La lotul tratat cu Ocimum basilicum, dei
extensivitatea a fost redus, totui nivelul infeciei a avut valori destul de mari, fiind de 483,84 G/l
pentru intensivitate i 80,64 G/l pentru medie. La lotul tratat cu Calendula officinalis a fost stabilit
corelaia indirect ntre extensivitate i intesivitate (145,92 G/l), respectiv medie (121,6 G/l).
Apreciem, n urma rezultatelor obinute c asupra speciilor din genul Trichomonas acioneaz
metronidazolul i extractele de busuioc i glbenele.
n conformitate cu dinamica extensivitii microflorei bacteriene la loturile experimentale am
putut aprecia c nici una dintre substanele utilizate nu au avut efect asupra speciei Escherichia coli,
nivelul infeciei fiind ridicat att la prima ct i la a doua determinare. Aceleai aspecte au fost
nregistrate i n cazul genului Staphylococcus. Situaia a fost ns diferit la genul Streptococcus la
care s-a constatat, n cazul lotului tratat cu metronidazol scderea post-terapeutic a extensivitii de
la 100% la 16%. Totodat s-a constatat c administrarea extractelor vegetale au determinat scderea
important a extensivitii de la 83,33% la 16,66% n cazul busuiocului, extractul de glbenele a
determinat o scdere de la 66,66% la 50%; n cazul lotului tratat cu extract de cimbru, la 24 de ore
dup administrare nu au mai fost puse n eviden colonii de Streptococcus spp. S-a observat c n
cazul lotului tratat cu metronidazol la prima determinare a fost evideniat Edwartsiella spp. cu un
nivel al extensivitii de 16,66% n timp ce la a doua determinare nu a mai fost observat. Situaie
identic a fost nregistrat i n cazul lui Streptomices spp. ns la lotul tratat cu extract uleios de
Tymus vulgaris.
In ceea ce privete efectul extractelor vegetale utilizate asupra flagelatelor i bacteriilor
intestinale, precizm c acesta a fost bun, ns sub rezerva faptului c structura populaional
individual a fost diferit. Prin comparaie cu loturile martor s-au nregistrat diferene importante,
36

Lucrri tiinifice vol. 51 seria Medicin Veterinar


mai ales asupra anumitor specii ale microbiocenozei intestinale, astfel nct extractele utilizate pot fi
o alternativ fitoterapeutic. Vorbind despre extractele utilizate menionm c aromele plantelor
sunt date de ctre fraciunea numit quinta essentia sau fraciunea de ulei esenial. Aceste uleiuri
sunt metabolii secundari bazai pe o structur isoprenoid i se numesc terpene. Terpenele pot fi
diterpene, triterpene, tetraterpene, hemiterpene i sesquiterpene, iar cnd la acestea se adaug alte
componente, n special oxigen devin terpenoide. Terpenoidele au origine comun cu acizii grai, fiind
reprezentate de mentol, camfor, farnesol, artemisin etc. Terpenele sau terpenoidele au aciune
asupra bacteriilor, fungilor, virusurilor i protozoarelor. S-a artat c 60% din derivaii uleiurilor
eseniale sunt activi asupra fungilor i 30% asupra bacteriilor. Mecanismul de aciune al terpenelor nu
este pe deplin cunoscut, presupunndu-se ns c acioneaz prin distrugerea membranelor, datorit
componentelor lipolitice (Prvu, 1997).
CONCLUZII
Cercetrile efectuate n perioada octombrie 2006 mai 2007 pe un numr de 42 oareci de
laborator, cu scopul stabilirii structurii populaionale a flagelatelor i bacteriilor intestinale i a
modului n care uleiurile eseniale (Ocimum basilicum - busuioc, Tymus vulgaris - cimbru, Calendula
officinalis - glbenele) acioneaz asupra acestora, au relevat urmtoarele:
1. Populaia de flagelate intestinale a fost reprezentat de Giardia muris (66,66 %),
Hexamita muris (75 %), Chilomastix bettencourti (83,33 %), i Trichomonas spp (83,33
%);
2. Flora bacterian intestinal a fost dominat de Echerichia coli (100%), Staphylococcus
spp. (91,66%), Streptococcus spp. (41,66%), Bacilus spp. (25 %), Enterococcus spp. (16,66
%) i Candida spp. (8,33 %).
3. Efectul asupra populaiei de flagelate intestinale a fost important pentru Calendula
officinalis asupra speciilor Giardia muris (5,12 G/l) i Trichomonas spp. (121,6 G/l), iar
pentru Ocimum basilicum asupra speciilor Hexamita muris (30,72 G/l) i Trichomonas spp.
(80,64 G/l); nici unul dintre extracte nu a prezentat efect asupra lui Chilomastix
bettencourti.
4. Cele 3 uleiuri eseniale utilizate au avut efect asupra genului Streptococcus la care
extensivitatea a sczut de 83,33% la 16,66% (Ocimum basilicum), de la 66,66% la 50%
(Calendula officinalis) i de la 50% la 0% (Tymus vulgaris).
BIBLIOGRAFIE
1.

2.
3.

4.
5.

6.
7.
8.

BOHN E., O. BECHTOLD., N. ZAHIR., J.S. FRICK., J. REIMANN., B. JILGE., I.B. AUTENRIETH. (2006) - Host
gene expression in the colon of gnotobiotic interleukin-2-deficient mice colonized with commensal colitogenic or
noncolitogenic bacterial strains: common patterns and bacteria strain specific signatures, Inflammatory Bowel
Disseases, Sep;12(9):853-862
BUSSIERAS J., R. CHERMETTE (1992) - Parasitologie Vtrinaire, Protozoologie, Service de parasitologie
cole Nationale Vtrinaire DAlfort
FERRAR M.D., T.R. WHITEHEAD, J. LAN, P. DILQER, R. THORPE, K.T. HOLLAND, S.R. CARDINQ (2005) Engineering of the gut commensal bacterium Bacteroides ovatus to produce and secrete biologically active
murine interleukin-2 in response to xylan, Journal of Applications in Microbiology 98(5):1191-1197
JALILI N.A. (1989) The occurrence of protozoa in the intestinal microflora of laboratory mice. Bratsl Lek Listy,
90(1) 42-44
KIM S.C., S.L. TONKONOQY, C.A. ALBRIGHT, J. TSANQ, E.J. BALISH, J. BRAUN, M.M. HUYCKE, R.B.
SARTOR (2005) - Variable phentypes of enterocolitis in interleukin-10-deficient mice monoassociated with two
diffrent commensal bacteria, Gastroenterology Apr;128(4):1122-1126
PRVU C. (1997) Universul plantelor. Edit. Enciclopedic, Bucureti
RAPEANU, M., I. DIDA, M. GREERE, M. CRIVINEANU, V. CRIVINEANU (2001) Plante in tratamentul bolilor
parazitare la om si animale. Edit. All, Bucuresti
SALZMAN, N.H. H. DE JONG, Y. PATERSON, H.J.M. HARMSEN, G.W.WELLING, N.A. BOS (2002) - Analysis
of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria,
Microbiology 148(11):3651-3660

37

Universitatea de tiine Agricole i Medicin Veterinar

CYTOTOXIC EFFECT OF ALUMINIUM ON CELL CULTURES


CIUC Viviana, DUMITRACHE Mariana
PASTEUR INSTITUTE Bucureti
Aluminium (in hydroxide form) was added in cultures of PK-15 cell line, at cell passage and on
formed monolayer, in concentrations of 0.05, 0.1, 0.3, 0.5, 0.7, 1, 2, 3, 4 and 5 1/ ml medium..
The cultures were incubated at 37,5C, in 5% CO2, up to
24 hours. Untreated cultures served as controls. With the decreasing concentration, the
addition of Aluminium hidroxide at cell passage has totally or partially blocked the monolayer
formation, about 70% formed monolayer being observed at concentration of 0.05 l/ml medium
(the last used concentration). Added on formed monolayer, Aluminium hidroxide has produced
total or partial detachment of cells up to the concentration of 0.11/1000. At the concentration of
0.05 1/ml, the monolayer remained normal.
Key words: Aluminium, PK-15 -pig cell line

Aluminium (or Aluminum, symbol: Al; atomic number: 13; CAS registry number: 7429-90-5) is
a silvery white and ductile metal, member of the boron group of chemical elements. It is not soluble
in water under normal circumstances. It is the most abundant metal in the Earth's crust, and the third
most abundant element therein, after oxygen and silicon. It makes up about 8% by weight of the
Earths solid surface. Aluminium is too chemically reactive to occur in nature as the free metal, being
found combined in over 270 different minerals (5), especially as bauxite ore. Aluminium is remarkable
for its ability to resist corrosion (due to the phenomenon of passivation) and its light weight.
Aluminium is widely used in transportation, packaging, construction, cooking utensils,
electrical transmission lines for power distribution, special magnets, electronics and CDs., watch
production (7), stage combat blades and as powder, in paint, pyrotechnics and cosmetics (styptic,
antiperspirant).
In medicine, Aluminium is used in antacid products (Amphogel, Maalox), in treatment against
some fish parasites and in immunology (including animal), as vaccine adjuvant (in hydroxide form).
Despite its ubiquity, Aluminium is not considered to be essential for life and it has unknown
function in living cells and unknown implication in any biologic process. (8).
The toxicity of aluminium was described. Increased amounts of dietary aluminium may
contribute to the reduced skeletal mineralization (osteopenia) observed only in preterm infants and
infants with growth retardation. Aluminium can cause neurotoxicity in very high doses which can
alter the function of the blood-brain barrier (1) and it was incriminated to induce experimental
encephalomyelopathy in rabbits (6). Excessive use of antacids and antiperspirants containing
aluminium are more likely causes of toxicity (digestive disorders and contact dermatitis, respectively).
The use of aluminium cookware has not been shown to lead to aluminium toxicity in general (8).
Aluminium is classified as a metalloestrogen (3). Aluminium is strong related with Alzheimer's
disease, but it is no clear if metal accumulation in some brain plaques is the cause or a consequence
of the Alzheimer's damage (4).
Aluminium hydroxide (AH) and aluminium phosphate hydrated gels, are used as safe adjuvants
in vaccines for more than 50 years. Their role consist in ability to adsorb soluble protein antigens that
are taken up as particulate antigens by antigen-presenting cells, to potent immune system and to
shift immune response towards Th-2 profile (antibody production).
The direct action of AH on PHA-stimulated pig lymphocytes was previously reported (2).
This work aims to objectivate/ evaluate the direct action of Aluminium (in hydroxide form) on
PK-15 cell lines. The results of this experiment are presented.
MATERIAL AND METHODS
Dosing of Al 2O3 content.
A titrimetric method (9) was used:
10 ml of AH + 10 ml nitric acid 2 N are boiled for 30 min., and brought to 100 ml with
distilled water;

38

Lucrri tiinifice vol. 51 seria Medicin Veterinar


10 ml of solution + 20 ml of EDTA O.5 M + 120 ml distilled water were mixed and
boiled for 1 min.
1g urotropin (hexamethylene tetra amine) are added and the excess EDTA is tittered
with zinc sulphate (Zn SO4) in the presence of xilenol orange indicator, until the color
turns violet. 1ml EDTA corresponds to 0.0255 mg Al2 O3 .
The Al 2O3 - content is determined according to formula:
g Al2O3 % = (20 x F1 X x F2) x 0.255
where: 20 = ml of used EDTA
F1 = Factor of EDTA solution
X = ml of Zn SO4, used for titration
F2 = Factor of ZnSO4 solution
PK-15 cell culture
A PK-15 ( porcine kidney) culture was subcultivated as following: the cell monolayer was
detached off with a 0,25% trypsin - versen solution (2 ml/ 100ml cell culture medium). The obtained
cell suspension was re-suspended in Eagle MEM, supplemented with 10% bovine fetal serum, until a
2 x 105 cells/ml concentration is reached and then distributed in a 96 well microplate, 100 l/ well,
and:
a. to see effect at cell passage, 100 l of AH-containing medium was immediately added
(4 wells for each dilution) to realize final concentrations of 0.05, 0.1, 0.3, 0.5, 0.7, 1, 2,
3, 4, 5 1/ ml medium. The cultures were incubated at 37,5C, in 5% CO2, up to 24
hours.
b. to see effects on formed monolayer, the passed cells were incubated at 37,5C, in 5%
CO2, until the monolayer is 80% formed, when the medium was discarded and replaced
with 200 l of AH-added medium in same final concentrations described as above. The
microplates were incubated for 24 h.
In both cases, the wells with untreated culture remained as control.
The culture aspects were observed at reversed microscope.

39

Universitatea de tiine Agricole i Medicin Veterinar


RESULTS AND DISCUSSIONS
The consequences of addition of Aluminium hydroxide in culture medium on PK-15 cell
development are presented in table 1.
Table nr.1.The effects of Aluminium hydroxide (AH) on PK-15 cell culture, when added in medium at cell passage
and on formed monolayer.
Concentration of AH
24 hours after addition of AH at cell
24 hours after addition of AH on formed
in MEM medium
passage
mono-layer
(l/ml)
5
No living cells. 90% of wells covered
No monolayer. Dead cells. Wellssurface
by AH particles.
covered by AH particles.
4
No living cells. Many particles of AH
No monolayer. Dead cells. Wellssurface
covered by AH particles.
3
No living cells. Many particles of AH
No monolayer. Dead cells. Wellssurface
covered by Al(OH)3 particles.
2
No living cells. Many particles of AH
No monolayer. Dead cells. Wells covered
by AH particles.
1
Rare living cells. Rounded, bloated, no
Fenestred monolayer; gaps between cells.
refringent, no adherent cells.
0.7
Rare living cells. Rounded, bloated, no
Fenestred monolayer; gaps between cells.
refringent, no adherent cells.
0.5
About 50% formed monolayer.
About 60% remained monolayer.
Particles in free spaces. Dead cells over
monolayer.
0.3
About 60% formed monolayer.
About 70% remained monolayer
Particles in free spaces. Dead cells over
monolayer
0.1
About 70% formed monolayer. Dead
About 80% remained monolayer
cells over monolayer
0.05
About 70% formed monolayer. Dead
About 90% remained, normal monolayer
cells over monolayer
Control
Complete, normal
Complete, normal
(without Aluminium
Monolayer
monolayer
hydroxide)
* According to dosing results, the doses of 0.05, 0.1, 0.3, 0.5, 0.7, 1, 2, 3, 4 and 5 l aluminum hydroxide contain
0.017, 0.034, 0.103, 0.173, 0.242, 0.346, 0.692, 1.038, 1.384, and 1,730 g Al respectively.

a.

b.

40

When AH was added at passage, the cells suffered citotoxic alterations which consist in
rounding, bloating, lost of refringence, no substrate-agglutination tendency, no
adherence to substrate and no monolayer was formed at the concentration higher
than 0.5l/ ml medium.
Monolayer patches appear at the concentration of 0.5l/ ml medium. With the
concentration decreasing, the monolayer construction increased: 60, and 70% at the
concentrations of 0.3 and 0.1 respectively. However, no complete monolayer was
observed at 0.05l AH/ ml medium, the last concentration used in experiment.
When AH was added on formed monolayer, it was observed total destruction of the
monolayer at the concentrations higher than 2 l/ ml medium.
Fenestred monolayer was observed at the concentration of 1 and 0.7 l AH/ ml. The
proportion of conserved monolayer increased with decreasing of concentration so that
at the concentration of 0,05 l AH/ ml medium, the monolayer remained complete and
relatively normal, as compared with control (without AH) culture.

Lucrri tiinifice vol. 51 seria Medicin Veterinar


CONCLUSIONS
According to experimental data, Aluminium hydroxide, added in culture medium, elicits a toxic
effect on PK-15 cells, preventing the complete forming of monolayer at final concentrations up to
0.05 l/ ml medium (last concentration used in our experiment) or destroying the formed monolayer
at concentrations of higher than 0.1 l/ ml).
The cells seem to be a little more sensitive before monolayer forming than after (about 70%
constructed monolayer vs. complete, relative normal monolayer, at concentration of 0.05 l
Aluminium hydroxide to 1ml medium).

Fig.1. Fenestred monolayer, detached


cells, rounded and modified

Fig 2. About 70% destroyed monolayer,


modified cells, AH particles present

Fig.4. Normal cell monolayer

Fig.3. Large amount of AH which


prevent cell visualisation

REFERENCES
1.
2.

3.

4.
5.
6.

7.
8.
9.

Banks, W.A.; Kastin, A.J. (1989). "Aluminum-induced neurotoxicity: alterations in membrane function at the
blood-brain barrier". Neurosci Biobehav Rev 13 (1): 47-53. http://www3.interscience.wiley.com/cgi-bin/abstract
Ciuc Viviana, Lia Creu, M. Samarineanu, 2005. The effect of aluminum hydroxide, used as vaccine adjuvant,
on in vitro swine lymphocyte mitogenesis. A note. Buletinul USAMV Cluj-Napoca, Seria Med. Vet., vol. 62, 2005,
77-79 (ISSN 1454-2382)
Darbre P.D. Metalloestrogens: an emerging class of inorganic xenoestrogens with potential to add to the
oestrogenic burden of the human breast J Appl Toxicol. 2006 May-Jun; 26(3):191-7 .
http://www3.interscience.wiley.com/cgi-bin/abstract
Alzheimer's Disease and Aluminum. National Institute of Environmental Health Sciences (October 2005).
http://www.niehs.gov/external/faq/aluminium.htm
Shakhashiri Z. Bassam. Chemical of the Week: Aluminum. http://watches.infoniac.com/index.php
Strong M.J., Yanagihara R., Wolff A.V., Shankar S.K., Garruto R.M. 1990. Experimental neurofilamentous
agregates: acute and chronic models of aluminum-induced encephalomyelopathy in rabbits. In Norris F.B., Rose
F.C., (Eds.). Amyotrofic Lateral Sclerosis: New Advances in Toxicology and Epidemilology. Smith-Gordon
Publishers, London
xxx Aluminum in Watchmaking. http:// watches.infoniac.com/index.php
xxx http://www. Wikipedia encyclopedia
European Pharmacopoeia, 2005.

41

Universitatea de tiine Agricole i Medicin Veterinar

INVESTIGAII PRIVIND PROFILUL BIOCHIMIC LA


IEPURELE DE C]MP (LEPUS EUROPAEUS)
INVESTIGATIONS ABOUT THE BIOCHEMICAL PROFILE IN WILD RABBIT
(LEPUS EUROPAEUS)
CODREANU Iuliana1, CONSTANTINESCU Ioana2, DOJAN N.1, CODREANU M.D.1,
DOJAN Rosalie1
1FMV Bucureti
2IDSA Bucureti
The neuro-endocrines fragility balance makes all the environmental changes a very important
stress factor for the rabbits, which draws allong a serial of pathological changes.
The wild rabbit (Lepus europaeus) is a wanted breed for export trade, often being hunted for
this purpose.
The main/purpose of this study is to realize some biochemical investigations on a group of 56
wild rabbits for export, originary from field area, hills and low hills of Buzau, Braila and Arges
counties.
On this ideea we followed the medium values of the energetic profile (cholesterol, glycerin),
protein profile (urea), mineral profile (calcium, magnesium, phosphorus) and the enzymatic
profile: AST,ALT,GGT and AP.

Iepurele de cmp (Lepus europaeus) este un animal cu activitate preponderent nocturn. El


este foarte ataat de locul n care s-a nscut, nendeprtndu-se de acesta la mai mult de 3-4 km.
Lepus europaeus este o ras foarte cutat la export, fiind adesea capturat n acest scop [1,5,6].
Fragilitatea echilibrului neuro-endocrin, face ca toate modificrile de mediu s constituie
pentru iepuri factori de stres foarte importani, fcnd ca sistemul nervos central s influeneze
activitatea suprarenalei care secret o cantitate sporit de adrenalin. Creterea cantitii de
adrenalin determin, la rndul ei, o serie de modificri patologice [7].
Astfel, la iepure, mai mult ca la alte specii de mamifere, reaciile psihice joac un rol foarte
important n declanarea fenomenelor patologice [2,9,12,14].
Investigaiile biochimice au fost efectuate la Institutul de Diagnostic i Sntate Animal,
Bucureti, pe un lot de iepuri de cmp pentru export, provenii din zonele de cmpie, coline i dealuri
joase ale judeelor Buzu, Brila i Arge [3,4,13].
MATERIALE I METODE
n realizarea i aprecierea profilului biochimic la iepurele de cmp (Lepus europaeus), am
considerat oportun i semnificativ dozarea constituenilor principali ai:
profilului energetic (glicemie, colesterol);
profilului mineral (Mg, P);
profilului enzimatic: transaminazele serice - GOT (transaminaza glutamic-oxalacetic),
GPT (transaminaza glutamic-piruvic), GGT (gammagluta-miltransferaza), FA
(fosfataza alcalin).
Investigaiile au fost realizate prin metodele clasice pe un lot de 56 de iepuri de cmp, n
Laboratorul de Biologie molecular i Biochimie din cadrul Institutului de Diagnostic i Sntate
Animal Bucureti.
Examenele biochimice s-au realizat pe probe de ser sanguin prin metodele titrimetrice clasice,
curent efectuate n laboratoarele de specialitate *9,11].
REZULTATE I DISCUII
Valorile medii obinute n urma dozrii principalilor constituieni ai profilului energetic, mineral
i enzimatic la lotul de iepuri de cmp (Lepus europaeus), sunt redate n tabelele 1-3. Diferenele
aprute au fost interpretate statistic folosind testul Student.

42

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Tabelul 1 Valorile medii ale magneziului, fosforului i ureei la lotul de iepuri de cmp
Nr.
Lotul de iepuri de cmp
Valori de referin
crt.
(valori medii)
Mg
4,01*
1
3,291,2
(mg/dl)
P
(mg/dl)

3,22*

5,410,8

Uree
33,33*
283
(mg/dl)
* p>0,05 diferene nesemnificative

Valorile medii ale magneziului i fosforului la lotul de iepuri slbatici, prezentau diferene
nesemnificative din punct de vedere statistic (p>0,05) fa de valorile de referin citate de literatura
de specialitate [1,5,7].
De asemenea, i valorea medii a ureei serice, dozat la acest lot, se ncadra n limitele
caracteristice speciei i rasei.
Tabelul 2 Valorile medii ale glicemiei i colesterolului la lotul de iepuri de cmp
Nr. Lotul de iepuri de camp
Valori de
(valori medii)
crt
referin
Glicemie (mg/dl)
224**
1
75-150
Colesterol (mg/dl)
30*
2
43
Lipide (mg/dl)
226,5*
3
28389
* p>0,05 diferene nesemnificative
** p<0,05 diferene semnificative

De menionat este faptul c, valoarea medie a glicemiei (224 mg/dl) a fost


semnificativ mai mare (p<0,05) fa de valorile de referin (75-150 mg/dl), cretere pus pe
seama efortului i stresului din timpul capturrii animalelor.
Valorile medii ale colesterolului i lipidelor totale prezint diferene nesemnificative
fa de valorile de referin citate de literatura de specialitate [1,7].
Tabelul 3 Valorile medii ale activitii GOT, GPT, GGT i F.A, la lotul de iepuri de cmp
Nr.
crt.
1
2
3
4

Lotul de iepuri de cmp


(valori medii)

Valori de
referin

GOT (UI)
46,66*
35-60
GPT (UI)
25,5*
20-50
GGT (U/l)
11,16*
0-7
F.A. (U/l)
5,66*
3-8
* p>0,05 diferene nesemnificative

Valorile medii ale activitii enzimelor luate n studiu, se ncadrau n general, n limitele
caracteristice speciei i rasei respective.
Activitatea medie a GGT-ului la acest lot de iepuri a nregistrat o valoare medie mai mare fa
de valorile de referin, dar nesemnificativ din punct de vedere statistic (p>0,05), fa de valorile
citate de literatura de specialitate [1,5].

43

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII
Analiznd rezultatele examenelor biochimice obinute la lotul de iepuri de cmp, s-au
constatat urmtoarele:
1. 1. Valorile medii ale magneziului (4,01 mg/dl) i fosforului seric (3,22 mg/dl) se ncadrau
n limite caracteristice speciei i rasei.
2. 2. Ureea seric, prezenta diferene nesemnificative din punct de vedere statistic
(p>0,05), fa de valorile de referin citate de literatura de specialitate.
3. 3. Valoarea medie a glicemiei a fost semnificativ mai mare (p<0,05) fa de valorile de
referin, cretere datorat, cel mai probabil, stresului i efortului din timpul capturrii.
4. 4. Valorile medii ale activitii GOT-ului i GGT-ului, nregistrate la lotul de iepuri de
cmp au prezentat diferene nesemnificative (p<0,05), comparativ cu valorile de
referin ale rasei.
5. 4. n ceea ce privete activitatea GPT-ului i a fosfatazei alcaline (ca indicatori cu
specificitate ridicat pentru evaluarea integritii funcionale a parenchimului hepatic),
acestea se ncadrau n limitele normale ale speciei i rasei.
BIBLIOGRAFIE
1.
2.
3.

4.

5.
6.
7.
8.

9.
10.
11.
12.
13.
14.

Ciudin Elena (2004) - Biologia animalelor de laborator. Ed. ALFA


Cunningham,I. (1992) Veterinary physiology; Saunders, Phyladelphia.
Dojan, N., Constantin, N., Elefterescu, H., Cotor, G., Codreanu Iuliana, Savu,C. (1999-2000) - Efectele
tratamentului cu tiroxin i insulin asupra debitului i compoziiei sucului pancreatic la iepure. Lucrri tiinifice,
U.S.A.M.V.B., Seria C, Vol. XLII-XLIII, pag. 49-56.
Dojan, N., Constantin, N. (1995) - Cercetri privind activitatea amilazei i lipazei serice i pancreatice la iepuri
hrnii cu furaje mbogite n amidon i grsime vegetal. Lucrri tiinifice, U.S.A.M.V.B., Seria C, Vol. XXXVIII,
Bucureti, pag. 31-36.
Dojan N., Manuella Militaru, D. Militaru (1997) Biologia i patologia animalelor de laborator. Ed. Coral Sanivet.
Dojan N., Doina Dane (1998) Biologia i patologia animalelor de laborator. Ed. Rotech Pro.
Dojan N., H. Elefterescu (1999) Biologia animalelor de laborator. Ed. Casa Crii de tiin.
Dojan, N., Pop Aneta, Papuc, C., Codreanu Iuliana, Cotor, G., Elefterescu, H., Rou, P., Ghi, M., erban, M.
(2001) - Efectul acizilor grai cu caten scurt asupra rspunsului secretor al pancreasului exocrin la iepure.
Fac. de Med. Vet. Bucureti. Simpozion a 140 ani ALMA MATER VETERINARIA BUCURESCENSIS. Rezumate.
Ed. ALL, Bucureti, pag. 94.
Dojan, N. (2001) - Fiziologia animalelor domestice, Ed. Printech
Ghergariu, S., Pop, L. Kadar, Marina Spnu (1999) - Manual de laborator clinic. Editura ALL, Bucureti,
Gyton,A.C. (1997) - Fiziologie. 5th Edition. W.B. Saunders
Ognean,L., Dojan,N. (2001) Fiziologia animalelor. Ed. Editura Presa Universitar Clujean.
Prvu, Gh. (1992) - Supravegherea nutriional metabolic a animalelor. Ed. Ceres, Bucureti
Reece,W.O. (1996) Physiology of domestic animals. 2nd Edition, Williams-Wilkins Ed., SUA, 1996.

44

Lucrri tiinifice vol. 51 seria Medicin Veterinar

INVESTIGAII PRIVIND NIVELUL UNOR ELEMENTE N


PROBELE BIOLOGICE PROVENITE DE LA IEPURELE DE C]MP
(LEPUS EUROPAEUS)
INVESTIGATIONS CONCERNING THE LEVEL OF SOME ELEMENTS IN
BIOLOGICAL SAMPLES FROM WILD RABBIT (LEPUS EUROPAEUS)
CODREANU Iuliana1, CONSTANTINESCU Ioana2, DOJAN N.1, CODREANU M.D.1,
DOJAN Rosalie1
1FMV Bucureti
2IDSA Bucureti
The wild rabbit (Lepus europaeus) is spread in our country from the field to the alpine area,
but the largest effectives are found in the field areas.
The main/goal of this paper/study was the identification of the cadmium, zinc and copper
values, found in some of the organs and biological samples from the wild rabbit.
For realizing the investigations for this paper we took some organ samples and biological
samples from 24 wild rabbits from landscapes, hills and low hills of the Arges, Buzu and Brila
counties.
After taking samples of liver, kidney, heart, lung, muscles, bones and hair, these were sent to
the laboratory, where they dosed the lead, cadmium, zinc and copper amount.

Iepurele de cmp (Lepus europaeus) prefera solurile uscate i fertile, ndeosebi cele n care
culturile agricole variate, alterneaz cu zone mici de pdure. Evit locurile mltinoase i umede *1,3+.
Perioada de vntoare este iarna i dureaz de la nceputul lunii noiembrie pn la sfritul
lunii ianuarie. Iepurele din aceast ras este prin excelen, singuratic el se grupeaza doar pentru
mperechere [4,5].
Datorit prezenei a numeroi dumani naturali (psri i mamifere de prad) de-a lungul
existenei multimilenare, n comportamentul iepurilor s-au fixat anumite caractere ce s-au transmis
ereditar. Astfel iepurii slbatici sunt animale cu activitate preponderent nocturn, evitnd n acest fel
o parte din dumani.
Sunt animale deosebit de fricoase i sperioase, cu reacii psihice foarte puternice.
Reacioneaz imediat, chiar violent fa de prezena cinilor de vntoare, la zgomote puternice i
neobinuite *1,4,5+.
Iepurele de cmp prezint o mare labilitate a sistemului neuro-endocrin, ceea ce face ca toate
modificrile de mediu s constituie pentru iepuri factori de stres foarte importani, fcnd ca sistemul
nervos central s influeneze activitatea suprarenalei care secret o cantitate sporit de adrenalin,
secreie ce duce la rndul ei, la o serie de modificri patologice *2,6,9].
Din aceast cauz la iepuri, reaciile psihice, joac un rol foarte important n declanarea
fenomenelor patologice, animalele fiind n permanen n stare de alarm *11+.
Iepurele de cmp (Lepus europaeus) prezint un regim alimentar erbivor, consumnd cu
aceeai plcere iarb, fucte, muguri, lstari, coaja copacilor tineri, rdcinoase, lucern i trifoi *1+.
MATERIALE I METODE
n vederea realizrii investigaiilor din aceast lucrare, am alctuit un lot format din 24 iepuri
de cmp, provenii din zonele de cmpie, coline i dealuri joase ale judeelor Arge, Buzu i Brila.
De la acetia au fost recoltate probe de organe i materiale biologice care au fost trimise la
laborator.
Investigaiile au fost realizate n Laboratorul de Biologie molecular i Biochimie din cadrul
Institutului de Diagnostic i Sntate Animal Bucureti.
Astfel, la iepurii din acest lot s-au dozat din probele de ficat, rinichi, cord, pulmon, muchi,
oase i pr, cantitile de plumb, cadmiu, zinc i cupru *7,8,10+.

45

Universitatea de tiine Agricole i Medicin Veterinar


REZULTATE I DISCUII
Valorile medii obinute n urma dozrii cantitilor de plumb, cadmiu, zinc i cupru din probele
de organe i materiale biologice, la lotul de iepuri de cmp (Lepus europaeus), sunt redate n tabelele
1-2 i graficul 1.
Tabelul 1 Valorile medii ale cuprului, zincului, plumbului i cadmiului din probele de organe provenite de la lotul
de iepuri slbatici
Cu
Zn
Pb
Cd
Organ
(ppm)
(ppm)
(ppm)
(ppm)
Ficat
1,637
38,0**
0,143*
0,205*
Rinichi
1,652
24,7
0,217*
1,636*
Cord
2,458**
15,33
0,087*
0,015*
Pulmon
0,645
14,33
0,034*
0,013*
Testicol
0,356
12,0
0,040*
*p>0,05 diferene nesemnificative
**p<0,05 diferene semnificative

n urma dozrii acestor elemente s-a constat c n toate organele, cantitatea medie de plumb
i cadmiu a fost mic, aflndu-se, n general, la limita detectabilitii (plumb: 0,034 ppm n pulmon i
0,087 ppm n cord iar cadmiu: 0,013 ppm n pulmon i 0,015 ppm n cord), aceste elemente fiind
nedetectabile n multe probe.
n urma investigaiilor efectuate, n cord s-a detectat o cantitate semnificativ mai mare de
cupru (p<0,05) fa de celelalte organe, n timp ce zincul, s-a aflat n cantitatea cea mai mare, n ficat
(38 ppm), semnificativ din punct de vedere statistic fa de celelalte organe (p<0,05).
Graficul 1. Valorile medii ale cuprului (ppm) din
probele de organe provenite de la lotul de iepuri
slbatici

2,458

1,637

1,652

0,645
0,356

ficat

rinichi

cord

pulmon

testicol

Tabelul 2 Valorile medii ale cuprului, zincului i plumbului din probele biologice provenite
de la lotul de iepuri slbatici
Cu
Zn
Pb
Probe biologice
(ppm)
(ppm)
(ppm)
Pr
0,081
127,3**
0,035*
Muchi
1,243
25,8
0,037*
Oase
0,071
90,6
0,287*
*p>0,05 diferene nesemnificative
**p<0,05 diferene semnificative

46

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n probele de oase, muschi i pr provenite de la lotul de iepuri de cmp (Lepus europaeus),
cadmiu nu a fost detectat, iar plumbul prezenta valori medii aflate la limita detectabilitii n toate
probele de material biologic.
n firele de pr, am detectat o valoare medie semnificativ mai mare de zinc (p<0,05) fa de
muchi i oase, iar cuprul se afla n cazul tuturor probelor la limita detectabilitii.
CONCLUZII
Analiznd comparativ rezultatele obinute n urma dozrii unor elemente din probele de
organe i materiale biologice provenite de la lotul de iepuri de cmp (Lepus europaeus), s-au
constatat urmtoarele:
1. Valorile medii ale plumbului i cadmiului, dozate din probele de organe, se aflau, n
general, la limita detectabilitii.
2. n urma dozrii cuprului, n cord s-a detectat o cantitate medie semnificativ mai mare
(p<0,05) comparativ cu celelalte organe.
3. Cea mai mare cantitate medie de zinc (38 ppm), semnificativ din punct de vedere
statistic (p<0,05), s-a detectat n ficat.
4. n cazul probelor de material biologic, valorile medii ale plumbului prezentau diferene
nesemnificative din punct de vedere statistic (p>0,05), aflndu-se n general la limita
detectabilitii.
5. n probele de pr, s-a detectat o cantitate medie semnificativ mai mare (p<0,05) de zinc
(127,3 ppm), fa de celelalte probe biologice.
BIBLIOGRAFIE
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.

Ciudin Elena (2004) - Biologia animalelor de laborator. Ed. ALFA


Cunningham,I. (1992) Veterinary physiology; Saunders, Phyladelphia.
Dojan N., Manuella Militaru, D. Militaru (1997) Biologia i patologia animalelor de laborator. Ed. Coral Sanivet.
Dojan N., Doina Dane (1998) Biologia i patologia animalelor de laborator. Ed. Rotech Pro.
Dojan N., H. Elefterescu (1999) Biologia animalelor de laborator. Ed. Casa Crii de tiin.
Dojan, N. (2001) - Fiziologia animalelor domestice, Ed. Printech
Ghergariu, S., Pop, L. Kadar, Marina Spnu (1999) - Manual de laborator clinic. Editura ALL, Bucureti,
Gyton,A.C. (1997) - Fiziologie. 5th Edition. W.B. Saunders
Ognean,L., Dojan,N. (2001) Fiziologia animalelor. Ed. Editura Presa Universitar Clujean.
Prvu, Gh. (1992) - Supravegherea nutriional metabolic a animalelor. Ed. Ceres, Bucureti
Reece,W.O. (1996) Physiology of domestic animals. 2nd Edition, Williams-Wilkins Ed., SUA, 1996.

47

Universitatea de tiine Agricole i Medicin Veterinar

CITOCHIMIA GLANDELOR TECALE OVARIENE LA VACI N


FAZELE CICLULUI SEXUAL
CYTOCHEMISTRY OF THE OVARIAN THECAL GLAND
IN THE PHASES OF SEXUAL CYCLE IN COWS
COTEA C., OPREAN O.Z., SOLCAN Carmen, BOISTEANU P.C.
FMV Iai
The ovarian fragments from 21 cow aged of 2-8 years, in the phases of sexual cycle, have
been fixed in Orth and Carnoy, led up to paraffin and serially sectioned at 5 m. Some fragments
from the same ovaries have been serially sectioned at the Slee cryostat for cytochemical staining,
which necessitated frozen tissue sectioning. The ovarian interstitial cells are located in the theca
of cavitary follicles and satellites to the cyclic corpus luteum, structuring the thecal gland. The
interstitial cells from the theca of the cavitary follicles have the average size of 12-14 m, are
oval, polygonal or elongated cells, polarized to the sinusoidal capillary vessels placed adjacently
to the Slawjansky membrane. For the ovarian cyclic corpus luteum, the interstitial cells are
located at a distance of 15-35 m towards the peripheral cells of the luteal glandular
parenchyma. In the cytoplasm of these cells, localised both in the ovarian follicular theca and
adjacently to the luteal parenchyma, we pointed out lipids, cholesterol, cholesterol esters,
carboxyl functions, anionic acetate and L-ascorbic acid. These inclusions appear in high quantities
in the interstitial cells from mature follicular theca in the oestrus phase. The presence of these
inclusions in variable amounts, related to the phase of sexual cycle, shows steroidogenesis
releasing estrogens hormones at different concentrations in cows.
Key words: interstitial thecal cells, ovary, cow.

Cercetri recente au demonstrat elaborarea hormonilor estrogeni (estrona, estradiol 17, 17,
estriol, epiestriol) de ctre celulele interstiiale tecale din ovarul de scroaf (3, 4,).
Pentru a demonstra substratul biochimic al procesului de steroidogeneza n celulele
interstiiale tecale din ovarul de vac s-a ntreprins prezenta lucrare.
MATERIAL I METODE
Ca material de cercetare au servit ovarele de la 21 taurine femele n fazele ciclului sexual, n
vrst de 2-8 ani, 6 n estrus, 5 n metestrus i 5 n diestrus. Ovarele au fost fixate n Orth i Carnoy,
incluse n parafin, secionate la 5 m i colorate HEA, Steedman-Mowry, PAS, PAS-albastru Alcian,
Novelli, Papanicolau pe esut i MacConaill Solcia pentru evidenierea funciilor carboxil i anionilor
acetat.
O parte din ovare s-au recoltat pe ghea, au fost secionate la criostatul Slee pentru
evidenierea lipidelor (metoda Lorrain Smith, varianta Cain), colesterolului i esterilor de colesterol
(metoda Schultz, varianta Everett). Montarea seciunilor s-a realizat ntr-un mediu sintetic
(polivinilpirolidon).
Pentru evidenierea acidului L ascorbic (metoda Cater), feliile din ovare au fost fixate n
AgNO3 10%.
Interpretarea reaciilor citochimice s-a efectuat pentru fiecare caz, n faza ciclului sexual, prin
metoda calitativ de apreciere microscopic a intensitii tinctoriale a preparatelor.
REZULTATE OBINUTE I DISCUII
Celulele tecale ale foliculului ovarian n proestrus la vac, provin din metaplazia celulelor
mezenchimale din apropierea membranei Slawjansky. Astfel, apar la distan de 5 m fa de aceasta
i sunt organizate n cuiburi (Fig. 1, 2).
Vascularizaia glandei tecale este intens, remarcat prin prezena numeroaselor capilare de
tip sinusoid.
n unii foliculi, n faza de proestrus sunt surprinse ovocitele pe cale de maturare (Fig. 3, 4).
n estrus, celulele tecale ale foliculului matur se organizeaz pe 4-5 rnduri, printre acestea
remarcndu-se numeroase capilare de tip sinusoid (Fig. 5, 6).
n metestrus, celulele tecale sunt satelite parenchimului luteal ciclic. Ele sunt organizate n
iruri paralele, printre acestea evideniindu-se capilarele de tip sinusoid (Fig. 7, 8).
48

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n diestrus, celulele interstiiale tecale sunt separate prin spaii largi i prezint aspecte de
citoliz - cariorex, carioliz i hipercromatoz cortical (Fig. 9, 10).
n citoplasma celulelor intersiiale tecale s-au evideniat lipide sub form de picturi de diferite
dimensiuni, n coloraia Lorrain Smith, varianta Cain (Fig. 11, 12).
Prin coloraia Schultz, varianta Everett, s-au evideniat colesterolul i esterii de colesterol n
cantiti diferite n funcie de faza ciclului sexual (Fig. 13). Acidul
L-ascorbic s-a remarcat n coloraia Cater, sub form de granule mici n citoplasma celulelor
intersiiale tecale ale foliculului cavitar, n proestrus la vac (Fig. 14). Aceleai granule de acid Lascorbic, se prezint n citoplasma celulelor intersiiale tecale din foliculul ovarian matur n estrus la
vac (Fig. 15) i n cele ale corpului luteal ciclic n metestrus (Fig. 16).
Rezultatele privind citochimia glandei interstiiale tecale la taurine n fazele ciclului sexual sunt
redate n tabelul 1.
Analiznd acest tabel se constat c citoplasma celulelor interstiiale prezint incluzii n
cantiti diferite, n funcie de fazele ciclului sexual. Astfel se constat cantiti crescute i foarte
crescute de incluzii implicate n steroidogenez, n estrus i metestrus, moderate n proestrus i
foarte reduse n diestrus.
n cadrul proteoglicanilor prezeni n citoplasma celulelor interstiiale n cantiti moderate n
estrus i metestrus, reduse n proestrus i foarte reduse n diestrus, substraturile glucidice sunt cele
PAS pozitive. Aceti proteoglicani ce conin o component glucidic (glucozamina, fucoza) , asigur
prin metabolizarea lor energia necesar transformrii lipidelor n procesul de steroidogenez.
Faptul c lipidele, colesterolul i esterii de colesterol, acidul L-ascorbic, funciunile carboxil i
anionii acetat se evidentiaz n cantiti crescute i foarte crescute n estrus i metestrus, ne conduce
la afirmaia c aceste incluzii sunt implicate n procesul de steroidogeneza care se desfasoar n
celulele interstiiale tecale ale foliculilor maturi i ale corpilor luteali ciclici, la un nivel ridicat n aceste
faze ale ciclului.
Evidenierea lipidelor, colesterolului i esterilor de colesterol, acidului L-ascorbic, funciunilor
carboxil i anionilor acetat n cantiti foarte reduse n citoplasma celulelor interstiiale n diestrus,
demonstraz c activitatea lor metabolic n vederea elaborrii de hormoni steroizi sexuali este
foarte scazut n aceast faz.
Corelaia pozitiv sub aspect cantitativ lipide-colesterol i esteri de colesterol, sugereaz
legtura care exist ntre metabolismul lipidelor i cel al colesterolului i esteri ai acestuia, n vederea
elaborrii de hormoni steroizi, cunoscndu-se faptul c esterii de colesterol i colesterolul reprezint
o verig n lanul metabolic al procesului de steroidogenez.
Faza de proestrus ocup o poziie intermediar n procesul elaborrilor hormonale n celulele
interstiiale tecale ale foliculilor cavitari, fapt demonstrat de prezena incluziilor implicate n
steroidogeneza n cantiti moderate.
Prezena acidului L-ascorbic n citoplasma celulelor interstiiale o atribuim interveniei sale n
procesul de steroidogenez. Astfel acidul L-ascorbic catalizeaz reacia de transformare a
progesteronei n 17 hidroxiprogesteron sub aciunea C21 steroid 17 hidroxilaza. Hidroxilarea n
poziia C17 nu ar fi posibil fr prezena acidului L-ascorbic. Prezena acestei vitamine n citoplasma
celulelor interstiiale tecale n proestrus, estrus i metestrus demonstreaz activitatea steroidogen
n aceste celule. n diestrus, acidul L-ascorbic este prezent n cantitate foarte redus, ceea ce
demonstreaz activitatea steroido-formatoare la un nivel sczut n celulele interstiiale.
Coloraia MacConaill-Solcia fiind o coloraie care indic nivelul la care se desfasoar
steroidogeneza n celulele interstiiale din ovarul de vac, demonstraz c ntre prezena incluziilor i
intensitatea acestei coloraii exist o corelaie pozitiv, aa cum se poate constata i n tabelul 1.
Pe baza rezultatelor obinute, a interpretrilor i discuiilor privind citochimia glandei
interstiiale tecale, s-a schiat axul hipotalamo-hipofizo-ovarian la vac n estrus, cu evidenierea
secreiilor crescute de hormoni la cele trei niveluri (plana I).

49

Universitatea de tiine Agricole i Medicin Veterinar

Fig.1 Celulele interstiiale tecale pe 2-3 rnduri n


foliculul cavitar din ovarul de vac n proestrus. Col.
Papanicolau ; X400

Fig.2 Glanda tecal prezent ntre 2 folicului din


ovarul de vac n proestrus. Col. Papanicolau; X400

Fig.3 Celulele interstiiale tecale organizate n teaca


folicului cavitar la vac n proestrus.
Col. Papanicolau; X400

Fig.4 Celulele interstiiale tecale pe 2-3 rnduri n


foliculul cavitar din ovarul de vac n proestrus. Col.
Papanicolau ; X400

Fig.5 Dispoziia pe 4-5 rnduri a celulelor tecale din


foliculul ovarian matur la vac
n estrus. Col. Papanicolau; X400

Fig.6 Celulele interstiiale tecale organizate intr-o


gland compact n foliculul matur
din ovarul de vac n estrus.
Col. Papanicolau; X400

50

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig.7 Celulele interstiiale tecale organizate n teaca


corpului luteal ciclic la vac
n metestrus. Col. Papanicolau; X400

Fig.8 Celulele interstiiale tecale organizate n teaca


corpului luteal ciclic la vac
n metestrus. Col. Papanicolau; X400

Fig.9 Celulele interstiiale tecale n corpul luteal


involutiv n diestrus la vac.
Col. Papanicolau; X400

Fig.10 Celulele interstiiale tecale


n teaca corpului luteal involutiv.
Col. Papanicolau; X400

Fig.11 Prezena lipidelor sub form de picturi n


celulele interstiiale tecale din foliculul ovarian matur
n estrus la vac.
Col. Lorrain Smith; X400

Fig.12 Prezena lipidelor sub form de picturi n


celulele interstiiale tecale din corpul luteal ciclic n
metestrus la vac.
Col. Lorrain Smith; X400

51

Universitatea de tiine Agricole i Medicin Veterinar

Fig.13 Prezena colesterolului i esterilor de colesterol


n celulele interstiiale tecale din foliculul matur al
ovarului de vac n estrus.
Col. Schultz varianta Everett; X400

Fig.14 Prezena acidului L-ascorbic sub form de


granule n celulele interstiiale tecale din foliculul
cavitar n proestrus la vac.
Col. Cater; X400

Fig.15 Prezena acidului L-ascorbic sub form de


granule n celulele interstiiale tecale din foliculul
ovarian matur n estrus la vac. Col.Cater; X400

Fig.16 Prezena acidului L-ascorbic sub form de


granule n celulele interstiiale tecale din corpul luteal
ciclic n metestrus la vac. Col. Cater; X400

52

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Plana I. Sistemul hipotalamo-hipofizar i epitalamo-epifizar la vac:


- Grupul anterior (1. nuc. supraopticus; 2. nuc. paraventricularis);
- Grupul lateral (3. nuc. hypotalamicus dorsomedialis; 4. nuc. hypotalamicus ventromedialis);
- Grupul mijlociu (5. nuc. infundibularis);
- Grupul posterior (6. nuc. periventricularis caudalis; 7. nuc. premamilaris; 8. nuc. corporis mamilaris)
E epifiza; MI masa intermediar; CO chiasma optic; CM corpul mamilar; FD folicul dehiscent
*
3, 4, 5, 6, 7 formeaz aria hipofizotrop a hipotalamusului la vac, cu neuroni multipolari secretori de RH i
IH

53

Universitatea de tiine Agricole i Medicin Veterinar


Tabelul 1 Intensitatea coloraiilor citochimice n celulele interstiiale tecale ale foliculilor i corpilor luteali din
ovarul de vac n fazele ciclului sexual
Vrsta
n ani

Nr.femele

Proestrus

2-7

Estrus
Metestrus
Diestrus

2-7
4-8
3-7

6
5
5

++
++

Fazele
ciclului
sexual

Proteoglicani

Colesterol i
esteri de
colesterol

Acid Lascorbic

++

++

++

+++
+++

++++
+++

+++
+++

Lipide

Funciuni
carboxil i
anioni
acetat
++
++++
+++

Novelli
(1)

++
+++
+++

Novelli (1) caracterul endocrin (intensitatea activitatii steroidogene)


*)
cantitate (intensitatea coloraiei ) foarte redus
+
cantitate (intensitatea coloraiei ) redus
++
cantitate (intensitatea coloraiei ) moderat
+++
cantitate (intensitatea coloraiei ) crescut
+ + + + cantitate (intensitatea coloraiei ) foarte crescut

1.

2.
3.

4.

5.

CONCLUZII
n citoplasma celulelor interstiiale din ovarul de vac s-au evideniat urmtoarele incluzii:
proteoglicani, lipide, colesterol i esteri de colesterol, acidul L-ascorbic, funciunile carboxil i
anionii acetat.
Aceste incluzii sunt n cantitai diferite n funcie de faza ciclului sexual: moderate n proestrus,
crescute i foarte crescute n estrus, metestrus i foarte reduse n diestrus.
Prezena acestor incluzii n citoplasma celulelor interstiiale tecale ale foliculilor ovarieni, corpilor
luteali i variaia lor sub aspect cantitativ n funcie de fazele ciclului sexual, demonstreaz
steroidogeneza la niveluri diferite.
Corelaia pozitiv sub aspect cantitativ lipide-colesterol i esteri de colesterol,
sugereaz legatura care exist ntre metabolismul lipidelor i cel al colesterolilor i esteri ai
acestuia n vederea elaborrii de hormoni steroizi, cunoscandu-se faptul c esterii de colesterol
i colesterolul reprezint o verig n lanul metabolic al procesului de steroidogenez.
Pe baza rezultatelor obinute, interpretrilor i discuiilor privind citochimia glandei interstiiale
tecale, s-a schiat axul hipotalamo-hipofizo-ovarian la vac n estrus, ce evideniaz secreiile
crescute de hormoni la cele trei niveluri.
BIBLIOGRAFIE

Cotea C., Arseni O. V., 1994 Hipotalamusul la suine. Lucr. t. Med. Vet. Iai, vol. 37, p. 25 27.
Cotea C., Carmen Solcan, Arseni O. V., 1997 Structuri foliculare n lobul anterior al hipofizei la femelele suine din
rasa Landrace. Lucr. t. Med. Vet. Iai, vol. 40, p. 20 22.
3. Cotea C., Arseni O. V., 1998 Foliculogeneza n ovarul suinelor femele. Lucr. t. Med. Vet. Iai, vol. 41, pag.
13 23.
4. Cotea C., Arseni O. V., Carmen Solcan, 1998 Glanda tecal ovarian la suinele femele. Lucr. t. Med. Vet.
Iai, vol. 41, pag. 6 12.
5. Cotea C., Arseni O. V., 1999 Hipofiza la suinele femele. Lucr. t. Med. Vet. Iai, vol. 1 (42), p. 24 31.
6. Cotea C., 2001 - Biologie celular, Embriologie general, Histologie general, Ed. Tehnopress, Iai.
7. Cotea C., Runceanu L., Carmen Solcan, Cotea I., 2002 Neurosecreia nucleilor hipotalamici la oaie. Lucr.
t. Med. Vet. Iai, vol. 45 (4), p. 16 22.
8. Cotea C., 2003 Histologie special. Ed. Tehnopress, Iai.
9. Cotea C., Oprean O. Z., Boisteanu P., Carmen Solcan, Cotea I., 2006 - The nuclei of the hypothalamus cow.
Lucr. t. Med. Vet. Iai, sub tipar.
10. Runceanu L., Cotea C., 2001 Reproducie, obstetric i ginecologie veterinar. Ed. Ion Ionescu de la Brad,
Iai.
1.
2.

54

Lucrri tiinifice vol. 51 seria Medicin Veterinar

CYTOLOGIE DES CYTOPONCTIONS GANGLIONNAIRES


[ LAIGUILLE FINE
FINE NEEDLE ASPIRATION LYMPH NODE CYTOLOGY
IN VETERINARY PRACTICE
CRESPEAU F.L., ROTARU Anca
ENVA Paris, France
FMV Iai, Romania
Lymph nodes cytological study on fine needle aspiration smears is actually a routine paraclinic
method mainly used the frequent context of hypertrophic lymphadenopathies.
Well conducted, this simple and slightly painful method of sampling gives quick results to the
clinicians and can be followed by a complementary histological investigation.
The main challenge is to recognize reactive inflammatory lesions (suppurative or not, with or
without specific pathogens), able to give quick lymph node hypertrophy, from tumorous
hypertrophy (lymphomatous or other). The paper aims to give essential information on cytological
criteria and patterns permitting to provide clinicians valuable information about these frequent
lesions.

Dans un nud lymphatique normal la trame tissulaire est occupe par un grand nombre de
macrophages rticulaires (plaqus sur un rseau de rticuline) ou bordants (le long de voies de
circulation lymphatiques nommes sinus . Le cortex est une zone prdominance de cellules
lymphodes B-dpendantes marque par la prsence de formations sphrodes trs malables - les
follicules (primaires et secondaires). Le paracortex est une zone prdominance de cellules
lymphodes T-dpendantes, non organises en follicules mais parcouru par des vaisseaux particuliers
cellules endothliales cubodales, les veinules pithliodes (ex veinules post-capillaires ) au
niveau desquelles ont lieu des changes importants de cellules entre milieu sanguin et milieu
ganglionnaire. Les cordons mdullaires sont prdominance de cellules B-dpendantes et riches en
plasmocytes migrants depuis le cortex.
La comprhension des images cytologiques observes sur cytoponction ganglionnaire
laiguille fine implique de bien connatre lhistologie topographique et la structure histologique et les
modalits ractionnelles lmentaires de ces organes lymphodes secondaires
Les principales modalits ractionnelles lmentaires du nud lymphatique sont:
1. pour les cellules B-dpendantes
a) lhyperplasie folliculaire, localise au cortex, caractrise par la multiplication trs
rapidement volutive de volumineux follicule lymphodes susceptibles denvahir
et atrophier le paracortex et la mdullaire.
b) la plasmocytose mdullaire, caractrise par lenrichissement des cordons
mdullaires en plasmocytes immatures et matures
2. pour les cellules T-dpendantes on retiendra essentiellement lhyperplasie du
paracortex, caractrise par un fort dveloppement de cette zone par prolifration
dimmunoblastes et autres cellules lymphodes T associe une hyperplasie des
veinules pithliodes. Lhyperpalsie de cette zone peut entraner la compression et
latrophie des follicules lymphodes du cortex.
3. pour les cellules macrophagique, une hyperplasie dnomme histiocytose de
localisation sinusale et/ou parenchymateuse
Au plan cytologique, le follicule lymphode cortical est constitu dune trs grande varit de
cellules sont les plus spectaculaires sont les cellules centrofolliculaires propres au centre
germinatif : Immunoblastes , centroblasteset centrocytes. Il comporte galement des lymphocytes
et des plasmocytes immatures et matures. Le paracortex est de composition moins varie et on y
observe des immunoblastes (T) et des lymphoblastes et lymphocyes. Les veinules pithliodes ne
sont pas arraches au stroma par la cytoponction et ne figurent pas sur les talements.
55

Universitatea de tiine Agricole i Medicin Veterinar


Les cordons mdullaires sont principalement forms de plasmocytes et de lymphocytes
prmatures et matures. Des cellules rticulaires (macrophages) sont frquemment prleves et
figurent parmi les cellules lymphodes (cellules rticulaires actives vacuolises et endocytaires,
sidrophages, mlanophages dans les ganglions drainant des lsions inflammatoires cutanes
chroniques). Dautres cellules peuvent tre associes en nombre varaiable :
granulocytes neutrophiles : abondants et dgnrs en cas dinflammation suppure,
des granulocytes osinophiles
des mastocytes
Techniquement, la cytoponction doit tre ralise avec une aiguille fine (cne bleu), sous une
aspiration modre (ne faisant pas clater les cellules).Le fluide recueilli doit tre tal avec
prcaution, par tirement, sans crasement.Une cytoponction ne suffit pas dfinir de faon fiable
les caractres cytologiques de la prolifration cellulaire qui conduit la lymphadnopathie; plusieurs
cytoponctions doivent tre examines pour un mme cas.
La question la plus souvent pose par les cliniciens est celle de savoir si lhypertrophie
ganglionnaire est ractionnelle (inflammatoire) et dans ce cas, si une origine tiologique peut tre
dpiste, ou tumorale
I - Caractristiques cytologiques des lsions ractionnelles
La cytoponction est rarement ralise sur un ganglion inflammatoire aigu dont
lhyperptrophie est rcente; ce sont souvent les lymphadnopathies subaigus et choniques qui sont
explores.
Dans tous les cas, les lsions ractionnelles se traduisent par la production dun grand nombre
de cellules immatures immunoblastes B et T et autres cellules centrofolliculaires pour les cellules B,
de lymphocytes et de plasmocytes immatures et matures (lymphoblastes, plasmoblastes,
lymphocytes matures, plasmocytes matures avec diverses images de cellules scrtantes). Les
macrophages sont galement souvent impliqus : ils peuvent se multiplier et tre modifis par leur
activit endocytaire exacerbe. Enfin, dautres cellules peuvent tre recrutes et se mlanger aux
population lympho-plasmocytaires : granulocytes neutrophiles et osinophiles, mastocytes Limage
cytologique qui en rsulte gnralement est une image densment cellulaire, trs polymorphe avec
un mlange de toutes les catgories cellulaires sans prdominance dun type ou dun stade de
maturation, sauf dans le cas particulier des lymphadnites suppures o les neutrophiles dgnrs
dominent. Les anomalies cellulaires cytolasmiques ou nuclaires ne font pas habituellement partie
des modifications observes.
En revanche, lactivit mitotique peut tre importante et ne doit pas, elle seule, tre prise
comme signe absolu de processus tumoral ; ces mitoses, mme nombreuses, sont dailleurs
gnralement de morphologie normale (pas dimage de mitoses multipolaires, pas dimages de
mitose chromosomes polaires, pas dimages de stathmocinse).

A) Lymphadnopathies subaigus et chroniques non spcifiques


Ltalement de fluide de cytoponction est riche en cellules lymphodes avec souvent un aspect
prolifratif (mitoses nombreuses) et prsence de cellules blastiques mais avec une population
lymphode restant trs polymorphe et quilibre (pas de prdominace nette de cellules blastiques ou
dune phase de maturation).
La raction peut tre trs plasmocytaire (niveau de ponction plus mdullaire ?) avec
conservation du polymorphisme
En phase plus chronique, laspect blastique sestompe un peu, des plasmocytes diffrencis et
souvent scrteurs apparaissent ainsi que des mastocytes et parfois des osinophiles.
On note la prsence frquente de gros macrophages de morphologie pouvant tre irrgulire dans les ganglions de drainage cutan, des mlanophores (macrophages avec grains de mlanine)
sont souvent observs ainsi que des granulocytes osinophiles.
Un cas particulier est reprsent par la lymphadnite ractionnelle de la primo-infection des
chats par le virus de limmunodficience fline (FIV) : cette forme de lymphadnopathie multifocale
dvolution rapide et intense est caractrise par un aspect trs prolifratif et blastique qui risque
56

Lucrri tiinifice vol. 51 seria Medicin Veterinar


dtre confondu avec une prolifration lymphomateuse : cette vive hyperplasie virale conserve
nanmoins un aspect polymorphe avec une proportion gale ou suprieure 50% ce cellules
lymphodes matures.

B) Les lymphadnites suppures


Les lymphadnite suppures fournissent le plus souvent des ponctions paisses, grasses
l talement, difficiles interprter au plan de la cytologie en raison de leur mauvais talement, mais
dans lesquelles on retrouve, sur les bords de ltalement, des condensations de granulocytes
neutrophiles trs dgnrs avec souvent des bactries intra et extracellulaires, aspect typiques dun
processus septique suppur.
Une coloration de Gram sur talement peut aider caractriser la population bactrienne.

C) Les lymphadnopathies ractionnelles hypertrophiantes associes un agent pathogne


figur
Le caractre ractionnel, subaigu, cytologiquement trs polymorphe, est associ la prsence
dun agent pathogne identifiable.
Le cas le plus typique est celui de la lymphadnopathie associe la leishmanniose dans
lesquelles les parasites sont typiquement observs entre et dans les cellules ; selon les cas, le
dpistage des parasites peu tre vident (beaucoup de parasites prsents) difficultueux (lorsquils
sont trs peu abondants.
II - Caractristiques cytologiques des lsions tumorales
Lhypothse tumorale est toujours pendante derrire une lymphadnopathie unique ou
multiple ne rtrocdant pas la thrapeutique symptomatique.
Plusieurs types de tumeurs sont susceptibles de provoquer des lymphadnopathies parmi
lesquelles et en premier lieu les hmatosarcomes et notamment des lymphomes; il existe galement
des lymphadnopathies mtastatiques pouvant singer une affection inflammatoire et dont le
diagnostic est souvent dlicat.

A) Les lymphadnopathies des lymphomes.


La cytoponction apparat toujours riche trs riche en cellules et caractrise, contrairement
aux images observes dans les affections ractionnelles, par un monomorphisme vident ou relatif :
la prdominance dun stade cellulaire de maturation lymphode devra tre recherche (ce qui
suppose de bien connatre la morphologie de ces stades).
On recherchera galement avec attention les anomalies cellulaires qui ne font habituellement
pas partie du contexte des lsions ractionnelles :
anisocytose et anisocaryose
basophilie anormale du cytoplasme
vacuolisations cytoplasmiques anormales
anomalies nuclaires (chromatine anormale, poches nuclaires, indentations et replis
du noyau)
anomalies de taille et de forme des nucloles
index mitotique lev et prsence de mitoses anormales (mitoses multipolaires,
chromosome polaire, images de stathmocinse

B) les lymphadnopathies des mastocytomes


Assez caractristiques dans la majorit des cas par la prsence dune proportion
anormalement leve de mastocytes le plus souvent anormaux et partiellement dgranuls ; la
prsence associe de granulocytes osinophiles est frquente.
Le diagnostic peut tre rendu difficile par la faible diffrenciation des mastocytes tumoraux
(peu ou a granuleux dans quelques cas).
On noubliera pas que le grading de ce type tumoral (gradind de Patnaik) repose en partie sur
des critres histologiques et ne peut tre prononc sur les seuls arguments cytologiques.
57

Universitatea de tiine Agricole i Medicin Veterinar

C) les lymphadnopathies mtastatiques


Assez peu frquemment observes, leur diagnostic repose sur la caractrisation, derrire un
aspect ractionnel souvent banal, de la prsence de cellules anormales, le plus souvent
carcinomateuses (les tumeurs msenchymateuses ne donnent quexceptionnellement des
mtastases ganglionnaires), en amas et lots souvent assez volumineux. Les cellules tumorales
carcinomateuses sont en gnral de forte taille (dans un rapport de volume dix ou plus de dix fois
suprieur celui des cellules sanguines toujours prsentes sur un talement) et prsentent des
atypies cyto-nuclaires souvent trs importantes.
Un type tumoral frquemment auteur de mtastase ganglionnaire est trs typique : il sagit du
mlanome malin qui est responsable de lenvahissement ganglionnaire par des cellules typiquement
mais variablement porteuses de grains de mlanine.
En conclusion : la cytoponction ganglionnaire est un examen paraclinique facile raliser, peu
douloureux pour lanimal et qui procure trs rapidement au clinicien au moins un diagnostic
dorientation et assez souvent un diagnostic spcifique; il ne dispense toutefois pas, notamment pour
le typage des lymphomes ou le grading des mastocytomes, des examens histologiques de
complment sur biopsie ou exrse ganglionnaire.
Rfrences :
1.
2.
3.
4.

Diagnostic Cytology and Hematology of the Dog and Cat, Cowell R.L., Tyler R.D. & Meinkoth J.H., 2nd ed.,
1999, Mosby editor
Atlas de Cytologie Canine et Fline, Baker R. & Lumdsen J.H., 2000, Masson editeur (version franaise du Color
Atlas of Cytology of the Dog and Cat, Baker R. & Lumdsen J.H., 2000, Mosby editor)
Atlas of Canine and Feline Cytology, Raskin R.E. & Meyer D.J., 2001, Saunders editor
Tumors in Domesti Animals 4th ed, Meuten, D.J., 2002 Iowa State Press

58

Lucrri tiinifice vol. 51 seria Medicin Veterinar

MODIFICATIONS OF BLOOD VALUES AFTER STRENUOUS


EXERCISE IN WISTAR RATS FEED WITH FODDER
SUPPLEMENTED WITH SELENIUM AND L-CARNITINE
CURC D., PANT A.
USAMV FMV Bucureti
Since literature data does not provide true information regarding the role of L-carnitine and
selenium on the adjustment capacity for physical exercise, an experimental model was conceived
by supplementing Wistar rats with Sel-Plex (500 g selenium/kg feed, which represents a daily
consumption of approximately 50 g/rat/day). The selenium-supplemented feed was fed for 15
days.
At the same time, L-carnitine was administered in rats at a rate of 1 g/kg of compound feed,
which represents a daily consumption of 25 mg/rat/day, for 15 days. All animals were kept in the
same environmental conditions, in separate cages
in the same facility. Each group had 12 rats; after the physical exercise, that is swimming in a
21C water tank for 15 minutes, 6 rats in each group were slaughtered after anesthesia with
ethylic eter and chloroform in equal dosage.
Laboratory investigations determined the hematological parameters, direct erythrocyte
indices; this was done using an automatic device, the ACT5 diff CP-Beckman analyzer. Biochemical
investigations were focused on determining ascorbinemia, proteinemia, glycemia, lypemia,
cholesterolemia, pyruvicemia, serum cholinesterase activity, using a wet biochemistry analyzer
Eppendorff ECOM 1022, with reactive chemicals supplied by Linear Chemicals Spain.
As a consequence to the 15 days Sel-Plex dietary supplementation for the rats, there has been
noticed the increase of hematological indices: RBC, Hb, PCV and leucocytemia. At the rats
supplemented with L-carnitine there has been an increased: RBC, PCV% and leucocytemia. The
hematological indices that decreased at the rats supplemented with Sel-Plex: MCV, MCH and
MCHC. At the rats supplemented with L-carnitine, hematological indices decreased: Hb, MCV,
MCH and MCHC.
Biochemical indices at rats supplemented with Sel-Plex increased: ascorbic acid, protein,
glucose and PchE; at rats supplemented with L-carnitine: ascorbic acid, protein, glucose and
PchE.The bichemical indices decreased at the rats supplemented with Sel-Plex: are lipids,
cholesterol and piruvicaemia; the same results where seen at the rats supplemented with Lcarnitine.
The above data proved the beneficial effects of Sel-Plex and L-carnitine in experimental rats,
both with regard to their behavior and resistance during the 15 minutes swimming, without
imbalance or fatigue, as compared to control rats where these phenomena were noticed after 10
minutes of physical exercise. The body temperature in control rats was over 42C in the end of the
physical exercise period, as compared to the Sel-Plex and L-carnitine rats, in which body
temperature was lower.

Key words: effort, Sel-Plex, L-carnitine, rat


Nutritional stress is the most important factor and is triggered by foods with high levels of
poly-unsaturated fatty acids, with low levels of vitamin E, selenium, zinc or manganese, or excess
levels of iron and vitamin A, or by the presence of toxins and toxic compounds (2, 10, 11, 12). Other
stress factors are environmental, bacterial, viral and parasitic diseases. Physical exercise represents a
motive challenge with well-defined characteristics depending on its parameters (4, 5, 7, 8, 9, 15).
Organisms have the capacity for effort, depending on each individual, health status or illness, which
influence the stability of internal environment homeostasis.
Intense physical exercise can lead to a 5-fold increase of the acetyl-carnitine level in bone
muscles, with a non-significant increase of plasma level. Carnitine and its long or short-chained esters
do not belong to the non-enzyme molecule category, but acetyl-carnitine and propyonil-L-carnitine
can slow down lipid peroxidation processes (6, 14, 16, 17).
The importance of selenium in animal nutrition derives from the fact that the first and the
second antioxidant defense lines are based on glutathione peroxidase GSH-Px, (Fig. 1) which, in its
turn, depends on an adequate level of selenium (1, 3, 13, 18).
59

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 1 The importance of selenium in animal nutrition derives from the fact that the first and the
second antioxidant defense lines are based on glutathione peroxidase (GSH-Px), which, in its turn,
depends on an adequate level of selenium.
Nutritional stress is the most important factor and is triggered by foods with high levels of
poly-unsaturated fatty acids, with low levels of vitamin E, selenium, zinc or manganese, or excess
levels of iron and vitamin A, or by the presence of toxins and toxic compounds. Other stress factors
are environmental, bacterial, viral and parasitic diseases (9, 18).
MATERIALS AND METHODS
Since literature data do not provide true information regarding the role of L-carnitine and
selenium on the adjustment capacity for physical exercise. An experimental model was conceived by
supplementing Wistar rats with Sel-Plex, Alltech Product, (500 g selenium/kg feed, which
represents a daily consumption of approximately 50 g/rat/day). The selenium-supplemented feed
was fed for 15 days.
At the same time, L-carnitine, Wonder Laboratories, formula 985, was administered in rats at a
rate of 1 g/kg of compound feed, which represents a daily consumption of 25 mg/rat/day, for 15
days.
The compound feed had the following composition: moisture 12.3%, crude protein 18%, crude
fat 7.64%, crude cellulose 3.5%, calcium 1.22%, phosphorus 0.8%, methionine and cysteine 0.7%,
metabolizable energy 3150 kcal/kg.
The control group had the same feed, but non-supplemented.
All animals were kept in the same environmental conditions, in separate cages in the same
facility. Each group had 12 rats; after the physical exercise, that is swimming in a 21C water tank for
15 minutes (Fig. 2), 6 rats in each group were slaughtered after anesthesia with ethylic ester and
chloroform in equal dosage.

60

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 2. Physical exercise at rats, swimming in a 21C water tank for 15 minutes

Laboratory investigations determined the following hematological parameters, direct


erythrocyte indices: erythraemia (RBC 106/l blood), hemoglobinemia (Hb g/dl blood), hematocrit
value (packed cell volume - PCV % blood); derived erythrocyte indices: mean corpuscular volume
(MCV - 3), mean corpuscular hemoglobin (MCH - pgHb/RBC), mean corpuscular hemoglobin
concentration (MCHC - gHb/dl RBC) and leukocythemia (WBC - 103/l blood); this was done using an
automatic device, the ACT5 diff CP-Beckman analyzer.
Biochemical investigations were focused on determining ascorbinemia (mg/dl blood),
proteinemia (g/dl serum), glycemia (mg/dl blood), lypemia (mg/dl serum), cholesterolemia (mg/dl
serum), pyruvicemia (mg/dl blood), serum cholinesterase activity (PchE - mUI/ml serum), using a wet
biochemistry analyzer Eppendorff ECOM 1022, with reactive chemicals supplied by Linear Chemicals
Spain.
RESULTS AND DISCUSSIONS
On the hematological level, after eating Sel-Plex treated feed for 15 days, erythraemia and
leukocythemia were shown to increase as compared to the control group.
Erythraemia increase is due to the bone marrow stimulation by selenium, which is explained
by a light increase of hemoglobin and hematocrit, as well as of the synthetic index MCHC (Table 1).
Table 1 Hematological modification in rats Wistar which feed was suplimented
with selenium and respectively L-carnitine, compared with non-suplimented rats
Derived erythrocytic
Direct erythrocytic constants
constants
Specification
RBC
Hb
MCV
MCH
MCHC
PCV %
106/l
g/dl
3
pg Hb/E g Hb/dl E

WBC
103/l

Control batch

8.13

13.45

37.71

46.38

16.54

35.67

8620

Suplimented with
Sel-Plex

8.75

14.03

38.73

44.26

16.03

36.23

9566

% change from control


> 7.63
batch

> 4.31

> 2.70

< 4.57

< 3.08

> 1.57

> 10.97

Suplimented with
L-carnitine

12.96

37.98

44.21

15.09

33.12

8970

< 3.64

> 0.72

< 4.68

< 8.77

< 4.35

> 4.06

8.59

% change from control


> 5.66
batch

61

Universitatea de tiine Agricole i Medicin Veterinar


Leukocytosis is also the consequence of white cell formation, including the bone marrow
which is the formation site for granulocyte series.
In L-carnitine treated rats, hematological changes were less obvious, and some of them even
came as a surprise, e.g. a slight reduction of hemoglobin and derivative erythrocyte constant figures:
MCV, MCH and MCHC.
On the biochemical level, after the selenium supplementation, more intense changes were
noticed: ascorbinemia, proteinemia, glicemia and serum cholinesterase increase, while lipidemia,
cholesterolemia and pyruvicemia decreased dramatically (Table 2).
Table 2Biochemical parameters values of rats Wistar which feed was suplimented
with selenium and respectively L-carnitine, compared with non-suplimented rats
Specification

A. A.
mg/dl

Protein
g/dl

Glucose
mg/dl

Lipids
mg/dl

Chol.
mg/dl

Pyruvic
acid
mg/dl

PChE
mU/ml

Control bach

1.48

6.93

71.89

354.81

94.34

2.05

426.40

Suplimented with
1.65
Sel-Plex

7.25

80.43

341.58

63.05

1.22

903.82

% control batch

> 11.49

> 4.62

> 11.88

< 3.73

< 33.17

< 40.49

> 111.96

Suplimented
with
L-carnitine

1.73

7.84

86.57

281.30

58.24

1.08

887.97

% control batch

> 16.89

> 13.13

> 20.42

< 20.72

< 38.27

< 47.32

> 108.25

Legend: A. A. = Ascorbic acid; Chol. = Cholesterol; PChE = Serum cholinesterase.

Ascorbinemia showed an obvious increase by 11.49% as compared to the control group, due
to the beneficial effect on liver biosynthesis induced by selenium supplementation, but also by the
drop in consumption of ascorbic acid due to glutathione peroxidase activity (selenium-dependent
enzyme) in the oxidative stress defense process. Glicemia level rose after a better glucide absorption
in the gut lumen and also when selenium supplemented rats avoided consumption.
Our observations regarding the beneficial role of selenium in hepatocite function stimulation
are proven by the rise in the serum cholinesterase by 111.96%, an enzyme synthesized by hepatocite.
The cholesterolemia drop by 33.17% as compared to the control group shows the fact that selenium
influences cholesterol endogenous biosynthesis, while rushing its degradation. The average
pyruvicemia was 2.05 mg/dl blood in control rats, and 1.22 mg/dl blood in selenium-treated rats.
L-carnitine rats had significant biochemical parameters changes, which translated into a better
physical resistance and a faster recovery after their retrieval from the water tank.
Ascorbinemia, glicemia, proteinemia and serum cholinesterase activity were significantly
higher.
The rise in these biochemical parameters was more evident in L-carnitine rats as compared to
selenium treated rats. This is explained by the intervention of L-carnitine in the use of long-chained
fatty acids and by saving protein and glucide reserves.
Lipidemia, cholesterolemia and pyruvicemia are lower in L-carnitine rats as compared to the
organic selenium-supplemented rats.
CONCLUSIONS
1. 1. The above data prove the beneficial effects of selenium and L-carnitine in supplemented
rats, both with regard to their behavior and their resistance during the 15 minutes of
swimming, with no moments of imbalance or fatigue, as compared to control rats where
these phenomena were noticed after 10 minutes of physical exercise.

62

Lucrri tiinifice vol. 51 seria Medicin Veterinar


2. 2. The body temperature in control rats was over 42C at the end of the physical exercise
period, as compared to the selenium and L-carnitine rats, where body temperature was
lower.
REFERENCES
1.
2.
3.
4.

5.

6.

7.

8.

9.

10.
11.

12.

13.

14.
15.
16.

17.
18.

Allan C.B., Lacourciere G.M., Stadtman T.C. Responsiveness of selenoproteins to dietary selenium. Ann. Rev.
Nutr., 1999, 19:1-16.
Arthur J.R., Beckett G.J. New metabolic roles for selenium. Proc. Nutri. Soc., 1994, 53: 615-624.
3. Combs Jr., G.F., Combs S.B. The Role of Selenium in Nutrition. Academic Press, Boca
Raton, Florida,
1986.
Curc D. Carnitina i sistemul carnitinic implicaiile metabolice, cardiovasculare i ale musculaturii scheletice,
n stri normale i n cele patologice. Simpozion tiinific jubiliar 65 ani ai Universitii Agrare de Stat din
Moldova, 7-9 octombrie 1998, Chiinu, Seciunea Medicin Veterinar, Rezumat p.74-75.
Curc D. Rolul carnitinei i esterilor si naturali n metabolismul acizilor grai din miocite, aciunea antiischemic cardiac. Simpozionul: Contribuia cercetrii tiinifice fundamentale la progresul medicinei
veterinare, 15-16 octombrie 1998, FMV Bucureti, Rezumat p.112-1134.
Curc D., Codreanu M. The carnitine system role in health maintenance and its use in the treatment of some
nd
diseases in small animals. II International Scientific and Practical Veterinary Conference about problems of
small animals, 28 30 May, 2003, Odessa, Ukraine, p. 153-158.
Curc D., Pant L., Oranu Adriana, Marinescu Renata Creterea rezistenei la efort prin suplimentarea
hranei cu Sel-Plex i L-carnitin la obolanii Wistar. Lucrri tiinifice, Seria C, Vol. 1, p. 179 186, 2005, RO
ISSN 1222-5304
Curc D., Pant L., Oranu Adriana, Marinescu Renata Creterea rezistenei la efort prin suplimentarea
hranei cu Sel-Plex i L-carnitin la obolanii Wistar. Simpozion tiinific Internaional 30 de ani de nvmnt
superior medical veterinar din Republica Moldova, 1-2 octombrie 2004, Chiinu, p. 124-126, MO ISBN 99759624-9-1.
Curc D., Pant L. - The effort resistance increase in wistar rats by Sel-Plex and l-carnitine supplemented feed,
th
Nutritional Biotechnology in the Feed and Food Industries Alltechs 24 Annual Symposium, April 21-23, 2008,
Lexington Convention Center, Lexington, Kentucky USA.
Halliwell B., Gutteridge J.M.C. Free radicals in biology and medicine. 2nd rev.ed.Oxford, Clarendon Press,
1989, 86-276.
11. Kumari S.S., Menon V.P. Effect of carnitine administration on levels of lipid peroxides and activities of
superoxide dismutase and catalase in isoproterenol induced myocardial infarction in rats. J.Biosci., 1988, 13,
p.257-262.
Mahan D.C. Selenium metabolism in animals: What role does selenium yeast have? In: Biotechnology in the
Feed Industry: Proceedings of Alltechs 11 th Annual Symposium (T.P. Lyons and K.A. Jacques, eds),
Nottingham University Press, Nottingham, Nottingham, UK, 1995, p. 257-267.
Mertz W. Selenium from a distance. In: Selenium in Biology and Medicine. Part A (G.F.Shamberger, R.J. 1983.
Selenium deficiencydiseases in animals. In: Biochemistry of Selenium. Plenum Press, New York, NY 10013,
1987, p. 31-58.
Pande S.V., Murthy M.S.R. Carnitine: vitamine for an insect, vital for man. Biochem. Cell Biol., 1989, 67, p.671673.
Rodrigues B., Xiang H, McNeill J.H. Effect of L-carnitine treatment on lipid metabolism and cardiac
performance in chronically diabetic rats. Diabetes, 1988, 37, p.1358-136412.
Sharon A. Center, Gregory D. Sunvold Investigations of the effect of L-canitine on weight reduction, body
condition, and metabolism in obese dogs and cats. Recent advances in canine and feline nutrition, Vol. III, 2000,
p.113-12214.
Siliprandi N., Sartorelli L., Ciman M., Di Lisa F. Carnitine, metabolism and clinical chemistry,Clin.Chem. Acta
1989, 183, p.3-11.
Surai P.F. Organic selenium: benefits to animals and humans, a biochemists view. In: Biotechnology in the
Feed Industry: Proceedings of Alltechs 16 th Annual Symposium (T. P. Lyons and K. A. Jacques, eds),
Nottingham University Press, Nottingham, UK, 2000, p. 205-260.

63

Universitatea de tiine Agricole i Medicin Veterinar

CONTRIBUII LA MORFOLOGIA LOBULUI ALB AL GLANDEI


HARDER LA IEPURELE DE CAS (ORYCTOLAGUS CUNICULUS)
CONTRIBUTIONS CONCERNING THE WHITE LOBE
MORPHOLOGY OF THE HARDERIAN GLAND IN RABBITS
(ORYCTOLAGUS CUNICULUS)
FLOREA Elena Ctlina, COTEA C., SOLCAN Carmen
FMV Iai
Within the Harderian gland in rabbits, two lobes are described, a white lobe and a pink lobe.
In order to elucidate its morphology, we sampled the white lobe of the Harderian gland from 5
rabbits, aged of 3-6 months. The white lobe was sagittaly and transversally sectioned into three
parts, in order to observe the main morphological aspects. The fragments were led up to paraffin,
serially sectioned at 5 m and stained through the following methods: HEA, PAS, Alcian blue-PAS,
Steedman-Mowry, Papanicolau, Novelli and Lorain-Smith, Cain variant. In the white lobe, the
glandular epithelial cells of the acini show intense vacuolar cytoplasm having the vacuolar
diameter of 1.25-2.5 m, these representing the depositing place for lipids shaped like small
drops. The thickness of the capsule is of 180-250 m, in some areas the semioriented conjunctive
tissue including unilocular adipocytes. The glandular lobules have sizes comprised between 1300
and 1950 m, separated by connective tissue septa of 60-90 m, rich in blood vessels and nerves.
The glandular acini have the diameter of 200-250 m and the interlobular ducts present inside the
lumen a secretion with a retiform aspect and have a diameter of 110-190 m. At the apical pole
of the glandular cells, in the acini lumen and in the intra- and interlobular ducts lumen, we have
noticed a PAS positive reaction, this indicating the presence of proteoglycans beside an
abundantly lipid secretion.
Key words: Harderian gland, white lobe, morphology, rabbit.

Din literatura consultat, care se refer la glanda Harder la iepure (5, 7, 8, 9, 12, 13), reiese c
aceasta este format din doi lobi, unul alb i altul roz.
Date referitoare la structura lobului alb i compoziia chimic a secreiei acestuia sunt puine i
de ordin general (5, 6, 8, 9, 12). Pentru a aprofunda morfologia i histochimia lobului alb al glandei
Harder la iepure, s-a ntreprins prezenta lucrare.
MATERIAL I METODE
Ca material de cercetare a servit lobul alb al glandei Harder de la 5 iepuri de cas cu vrste
cuprinse ntre 3 i 6 luni (Fig. 1, 2). Lobul alb a fost secionat, att sagital, ct i transversal n 3
poriuni pentru a observa principalele aspecte morfologice. Fragmentele au fost incluse n parafin,
secionate la 5 m i colorate prin metodele: HEA, PAS, albastru Alcian-PAS, Steedman-Mowry,
Papanicolau, Novelli i Lorrain-Smith, varianta Cain.

64

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig.1 Exteriorizarea pleoapei a III-a i a glandei


sale profunde Harder, din cavitatea orbital la
iepurele de cas:
la - lobul alb
lr - lobul roz
c pleoapa a III-a, cu schelet cartilaginos

Fig.2 Gland Harder detaat de pleoapa


a III-a (faa de contact cu orbita) la
iepurele de cas:
la - lobul alb
lr - lobul roz

REZULTATE OBINUTE I DISCUII


Lobul alb este ataat cartilajului pleoapei a III-a printr-un esut conjunctiv delicat, de 280-370
m, ce se continu cu capsula. Aceasta are grosimea de 180-250 m, n funcie de zon. n unele zone
capsula conine adipocite uniloculare. Fibrele de colagen grupate n fascicule, separ paniculii adipoi
ce conin 7-10 adipocite uniloculare.
Lobulii glandulari au dimensiuni de 1300-1950 m i sunt structurai din acini glandulari i
canale intralobulare cu diametrul de 100-130 m, ce conin n lumen o secreie abundent PASpozitiv. Acinii glandulari au diametrul de 200-250 m i sunt constituii din celule epiteliale
glandulare cu nlimea de 11-15 m. Aceste celule prismatice au nuclei veziculoi, cu dimensiunea de
5-7 m, situai n treimea inferioar, ce prezint nucleoli evideni de 1-2 m (Fig. 3, 4).
Epiteliul glandular acinar este structurat din celule ce se afl n diferite faze ale elaborrii
secreiei, astfel sunt surprinse n faza de acumulare, de elaborare sau de refacere (Fig. 5, 6).
Lobulii glandulari sunt delimitai de septe conjunctive cu grosimea de 60-90 m ce conin
canale interlobulare, arteriole i venule. Canalele interlobulare, cu diametrul de 110-190 m, au
lumenul larg ce conine secreia specific.
Citoplasma celulelor epiteliale glandulare este intens vacuolar, vacuolele fiind mici, cu
dimensiuni de 1,25-2,5 m (Fig. 7, 8).
n unii acini glandulari este surprins procesul de exocitoz, remarcat prin prezena secreiei
acidofile i bazofile n coloraia Novelli (Fig. 9).
Prezena vacuolelor n citoplasma celulelor epiteliale glandulare demonstreaz prezena
lipidelor sub form de picturi mici, care au fost dizolvate n solvenii organici folosii la coloraia
Papanicolau (Fig. 10, 11).
Acinii glandulari sunt delimitai de un esut conjunctiv delicat n care se remarc numeroase
vase sangvine (Fig. 12, 13).

65

Universitatea de tiine Agricole i Medicin Veterinar

Fig.3 Acini glandulari cu dimensiuni de 200-250 m,


structurai din celule epiteliale prismatice. Col. PAS;
X600

Fig.4 Secreie de proteoglicani n lumenul acinilor


glandulari. Col. PAS; X600

Fig.5 Vacuolizare intens a citoplasmei celulelor


epiteliale glandulare. Col Novelli; X600

Fig.6 Exocitoza masiv i apocrinie n celulele


glandulare. Col. Papanicolau; X1350

Fig.7 Vacuolizare intens a citoplasmei celulelor


epiteliale glandulare, vacuole de 1,25-2,5 m.
Col Novelli; X600

Fig.8 Vacuolizare intens a citoplasmei celulelor


epiteliale glandulare, vacuole de 1,25-2,5 m.
Col. Novelli; X600

66

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig.9 Vacuolizare intens a citoplasmei celulelor


epiteliale glandulare, vacuole de 1,25-2,5 m
i prezena secreiei n lumen.
Col. Novelli; X300 , X600

Fig.10 Vacuolizare intens a citoplasmei celulelor


epiteliale glandulare, vacuole de 1,25-2,5 m
i prezena secreiei n lumen.
Col. Papanicolau; X600

Fig.11 Vacuolizare intens a citoplasmei celulelor


epiteliale glandulare, vacuole de 1,25-2,5 m i
prezena secreiei n lumen.
Col. Papanicolau; X600

Fig.12 Acinii glandulari delimitai de esut conjunctiv


delicat, cu numeroase vase sangvine. Col. Novelli;
X300

Fig.13 Acinii glandulari delimitai de esut conjunctiv


delicat, cu numeroase vase sangvine.
Col. Novelli; X300

67

1.
2.
3.
4.
5.
6.
7.
8.

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII
Lobul alb al glandei Harder la iepure este acoperit de o capsul cu grosimea de 180-250 m, ce
prezint i adipocite uniloculare.
Lobulii glandulari sunt delimitai de septe conjunctive cu grosimea de 60-90 m, bogat
vascularizate.
Lobulii glandulari au dimensiuni de 1300-1950 m.
Canalele intralobulare au diametrul de 100-130 m, iar cele interlobulare de 110-190 m.
Unitile morfo-funcionale ale lobului alb al glandei Harder sunt acinii glandulari, cu un diametru
de 200-250 m.
Celulele epiteliale glandulare ale acinilor au nlimea de 11-15 m i sunt surprinse n diferite
faze: de acumulare a secreiei, de exocitoz (merocrinie) i n unele zone apocrinie.
Citoplasma conine vacuole de dimensiuni mici (1,25-2,5 m) ce apar mai frecvent n regiunea
apical a celulelor epiteliale glandulare.
Prezena vacuolelor mici n citoplasma celulelor acinilor glandulari, n coloraia Papanicolau,
demonstreaz prezena lipidelor, ceea ce sugereaz o secreie bogat n lipide, dar i n
proteoglicani, ce pot fi observai n coloraia PAS.
BIBLIOGRAFIE

1.
2.
3.
4.

5.
6.
7.
8.
9.
10.
11.

12.
13.

Buzzell G.R. The Harderian gland: perspectives, Canadian Journal of Zoology 69, 1996.
Chieffi G., Baccari G.C., Di Matteo L., Minucci S., Varriale B. Cell biology of the Harderian gland, Cell and
tissue research 270, 1996.
Cotea C. Histologie special, Ed. Tehnopress, Iai, 2003.
Hillenius W.J., Phillips D.A., Rehorek J. Susan A new lacrimal gland with an excretory duct in red and
fallow deer by Johann Jacob Harder (1694): English translation and historical perspective, Annals of Anatomy,
Elsevier, 2006.
Kazuhiko S., Satoshi O. Postnatal development of the Harderian gland in the rabbit: light and electron
microscopic observation, Microscopy research and technique 37, 572-582, 1997.
Kleckowska-Nawrot J., Dziegiel P. Morphology of Deep Gland of the Third Eyelid in Pig Foetuses, Journal
of Anatomy, Histology, Embryology 37, 36-40, 2008.
Kuhnel W. Morphology of the harderian gland in rabbit. In harderian glands, porphyrin metabolism, behavioral
and endocrine effects, Berlin: Springer, 1992.
Payne A.P. The Harderian gland: a tercentennial review, Journal of Anatomy, 1994.
Lluch S., Ventura J., Lopez-Fuster M.J. Eye Morphology in some Wild Rodents, Journal of Anatomy,
Histology, Embryology 37, 41-51, 2008.
Rehorek Susan J., Smith T. J. The primate Harderian gland: Does it really exist?, Annals of Anatomy 188,
319-327, 2006.
Rehorek Susan J., Hillenius W.J., Sanjur J., Chapman N.G. One gland, two lobes: Organogenesis of the
Harderian and nictitans glands of the Chinese muntjac (Muntiacus reevesi) and the fallow deer (Dama
dama), Annals of Anatomy 189, 434-446, 2007.
Shirama K., Satoh T., Yokoyama Y., Kano K., Kitamura T., Yamada J. Ultrastructural study on the
harderian gland of the rabbit (Oryctolagus cuniculus), Folia morphologica 55, 1996.
Werner Liliana, Chew J., Mamalis N. Experimental evaluation of ophtalmic devices and solutions using
rabbit models, Veterinary Ophtalmology, 9, 281-291, 2006.

68

Lucrri tiinifice vol. 51 seria Medicin Veterinar

CITOCHIMIA LOBULUI ROZ AL GLANDEI HARDER


LA IEPURELE DE CAS (ORYCTOLAGUS CUNICULUS)
CYTOCHEMISTRY OF THE PINK LOBE OF THE HARDERIAN
GLANDIN RABBITS (ORYCTOLAGUS CUNICULUS)
FLOREA Elena Ctlina, COTEA C., SOLCAN Carmen
FMV Iai
The pink lobe was sampled from 5 rabbits, aged of 3 to 6 months. From every lobe, 5
fragments were obtained, two of them through a median section and three through transversal
sections. The 40 samples were led up to paraffin, serially sectioned at 5 m and stained through
the following methods: HEA, PAS, Alcian blue-PAS, Steedman-Mowry, Papanicolau, Novelli and
Lorain-Smith Cain variant. Into the histological sections, the glandular acini were noticed with
glandular epithelial cells whose cytoplasm presented vacuoles having sizes between 3.75 and 5
m, fact that clearly differentiated the pink lobe from the white lobe. At the surface, the pink lobe
is delimited by a capsule with a thickness of 190-300 m and the glandular lobules have sizes of
1500-2010 m and are delimitated by 70-95 m thick connective septa. The glandular acini have
210-265 m in diameter, the intralobular ducts have a wide lumen of 90-120 m in diameter and
the interlobular ducts have 110-200 m in diameter. The intense vacuolar cytoplasm of the
glandular epithelial cells underlines an abundant lipid secretion, associated to a proteoglycans
secretion.

Din literatura consultat, care se refer la glanda Harder la iepure (5, 7, 8, 9, 12), reiese c
aceasta este format din doi lobi, unul roz i altul alb.
Date referitoare la structura lobului roz i compoziia chimic a secreiei acestuia sunt puine i
de ordin general (5, 6, 8, 9, 12). Pentru a aprofunda morfologia i histochimia lobului roz al glandei
Harder la iepure, s-a ntreprins prezenta lucrare.
MATERIAL I METODE
Materialul de cercetare a fost reprezentat de lobul roz al glandei Harder, recoltat de la 5
iepuri n vrst de 3-6 luni (Fig.1, 2). Din fiecare lob roz s-au obinut cinci fragmente, dou prin
seciune medio-sagital i trei prin seciuni transversale. Piesele obinute au fost incluse n parafin,
secionate la 5 m i colorate prin metodele: HEA, PAS, albastru Alcian-PAS, Steedman-Mowry,
Papanicolau, Novelli i Lorrain-Smith, varianta Cain.

Fig.1 Pleoapa a III-a mpreun cu glanda sa profund


- glanda Harder (faa de contact cu globul ocular) la
iepurele de cas:
lr - lobul roz
la - lobul alb
c pleoapa a III-a, cu schelet cartilaginos

Fig.2 Gland Harder detaat de pleoapa a III-a (faa


de contact cu orbita) la iepurele de cas:
lr - lobul roz
la - lobul alb

69

Universitatea de tiine Agricole i Medicin Veterinar


REZULTATE OBINUTE I DISCUII
Lobul roz este ataat cartilajului pleoapei a III-a printr-un esut conjunctiv delicat, de 300-350
m, ce se continu cu capsula. Aceasta are grosimea de 190-300 m, n funcie de zon (Fig. 3). n
unele zone capsula conine adipocite uniloculare (Fig. 4). n acest caz, fasciculele de fibre de colagen
apar dense i separate prin septe delicate, ce delimiteaz paniculi adipoi ce conin 5-9 adipocite
uniloculare.
Septele conjunctive, ce delimiteaz teritoriul glandular n lobuli cu dimensiuni de 1500-2010
m, au grosimea de 70-95 m (Fig. 5). n septele conjunctive dintre lobuli se evideniaz arteriole,
venule i canale interlobulare, cu diametrul de 110-200 m (Fig. 6). Vasculatizaia acestor septe este
bine reprezentat prin arteriole i venule (Fig. 7).
Formaiunile glandulare sunt de tip acinos, acinii avnd dimensiuni de 210-265 m (Fig. 8).
Fiecare acin glandular este delimitat de un esut conjunctiv delicat ce conine numeroase vase
sangvine (Fig. 9), iar canalele intralobulare au lumenul larg, cu diametrul de 90-120 m.
Epiteliul glandular este format din celule prismatice nalte, cu dimensiuni de 12-14 m, al cror
pol apical delimiteaz un lumen larg (Fig. 10).
Citoplasma celulelor epiteliale glandulare este intens vacuolar, coninnd vacuole cu
dimensiuni de 3,75-5 m. Prezena acestora demonstreaz o secreie bogat n lipide, care n
coloraia Papanicolau au fost dizolvate n solvenii organici. Se poate remarca desprinderea secreiei
n lumenul acinului (Fig. 11).
n unele zone, acinii glandulari sunt surprini n faza de acumulare a secreiei, care se
manifest citologic prin proeminarea polului apical al celulelor epiteliale glandulare n lumen (Fig. 12).
La baza acinilor se evideniaz numeroase venule, ceea ce demonstreaz o vascularizaie intens i a
esutului conjunctiv periacinar.
n alte zone, n acinii glandulari, este surprins procesul de exocitoz (Fig. 13).
n aceeai seciune histologic se observ acini glandulari ale cror celule epiteliale sunt n faza
de acumulare a secreiei sau de exocitoz i refacerea celulei epiteliale, ce presupune un nou nceput
de ciclu secretor (Fig. 14).

Fig.3 Lobul glandular n zona apropiat cartilajului


pleoapei a III-a,
la distan de 300-320 m.
Col. HEA; X120

70

Fig.4 Capsula, cu grosimea de 250 m, ce conine


adipocite uniloculare.
Col. PAS; X600

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig.5 Septul conjunctiv de 70 m dintre lobulii


glandulari. Col. PAS; X300

Fig.6 Arteriol i canal interlobular.


Col. PAS; X300

Fig.7 Vascularizaie intens n spaiul dintre acinii


glandulari.
Col. Papanicolau; X300

Fig.8 Acini glandulari cu dimesiuni de 210-265 m.


Col. Papanicolau; X300

Fig.9 Vascularizaie intens n zona adiacent laminei


bazale a epiteliului glandular.
Col. Papanicolau; X300

Fig.10 Acini glandulari cu lumen larg, delimitat de


celule prismatice nalte, cu dimensiuni de 12-14 m.
Col. Papanicolau; X300

71

Universitatea de tiine Agricole i Medicin Veterinar

1.
2.
3.
4.
5.
6.
7.

Fig.11 Vacuolizare intens a citoplasmei celulelor


epiteliale glandulare i prezena secreiei n lumen.
Col. Papanicolau; X1350

Fig.12 Acini glandulari n faza de acumulare a


secreiei.
Col. Papanicolau; X600

Fig.13 Exocitoz n celulele epiteliale


glandulare. Col. Papanicolau; X600

Fig.14 Celule epiteliale aflate n diferite faze: de


acumulare a secreiei, exocitoz, refacere.
Col. Novelli; X600

CONCLUZII
La suprafaa lobului roz se remarc o capsul cu grosimea de 190-300 m, care prezint i
adipocite uniloculare n unele zone.
Septele conjunctive au grosimea de 70-95 m, sunt bogat vascularizate i delimiteaz esutul
glandular n lobuli, ce au dimensiuni de 1500-2010 m.
Canalele interlobulare au diametrul de 110-200 m, iar cele intralobulare de 90-120 m.
Unitile morfo-funcionale ale lobului roz al glandei Harder sunt acinii glandulari, cu un diametru
de 210-265 m.
Celulele epiteliale glandulare ale acinilor au dimensiuni de 12-14 m i sunt surprinse n diferite
faze: de refacere dup un ciclu secretor, de exocitoz (merocrinie) i uneori apocrinie.
Citoplasma este intens vacuolar, cu vacuole de 3,75-5 m, mai mari n zona apical, unde poate
fi surprins procesul de apocrinie a lipidelor.
Vacuolizarea intens n coloraia Papanicolau a citoplasmei celulelor epiteliale glandulare,
evideniaz prezena lipidelor, ceea ce demonstreaz o secreie bogat n lipide, dar i n
proteoglicani, ce pot fi observai n coloraia PAS.

72

Lucrri tiinifice vol. 51 seria Medicin Veterinar


BIBLIOGRAFIE
1.
2.
3.
4.

5.
6.
7.
8.
9.
10.
11.

12.
13.

Buzzell G.R. The Harderian gland: perspectives, Canadian Journal of Zoology 69, 1996.
Chieffi G., Baccari G.C., Di Matteo L., Minucci S., Varriale B. Cell biology of the Harderian gland, Cell and
tissue research 270, 1996.
Cotea C. Histologie special, Ed. Tehnopress, Iai, 2003.
Hillenius W.J., Phillips D.A., Rehorek J. Susan A new lacrimal gland with an excretory duct in red and
fallow deer by Johann Jacob Harder (1694): English translation and historical perspective, Annals of Anatomy,
Elsevier, 2006.
Kazuhiko S., Satoshi O. Postnatal development of the Harderian gland in the rabbit: light and electron
microscopic observation, Microscopy research and technique 37, 572-582, 1997.
Kleckowska-Nawrot J., Dziegiel P. Morphology of Deep Gland of the Third Eyelid in Pig Foetuses, Journal
of Anatomy, Histology, Embryology 37, 36-40, 2008.
Kuhnel W. Morphology of the harderian gland in rabbit. In harderian glands, porphyrin metabolism, behavioral
and endocrine effects, Berlin: Springer, 1992.
Payne A.P. The Harderian gland: a tercentennial review, Journal of Anatomy, 1994.
Lluch S., Ventura J., Lopez-Fuster M.J. Eye Morphology in some Wild Rodents, Journal of Anatomy,
Histology, Embryology 37, 41-51, 2008.
Rehorek Susan J., Smith T. J. The primate Harderian gland: Does it really exist?, Annals of Anatomy 188,
319-327, 2006.
Rehorek Susan J., Hillenius W.J., Sanjur J., Chapman N.G. One gland, two lobes: Organogenesis of the
Harderian and nictitans glands of the Chinese muntjac (Muntiacus reevesi) and the fallow deer (Dama
dama), Annals of Anatomy 189, 434-446, 2007.
Shirama K., Satoh T., Yokoyama Y., Kano K., Kitamura T., Yamada J. Ultrastructural study on the
harderian gland of the rabbit (Oryctolagus cuniculus), Folia morphologica 55, 1996.
Werner Liliana, Chew J., Mamalis N. Experimental evaluation of ophtalmic devices and solutions using
rabbit models, Veterinary Ophtalmology, 9, 281-291, 2006.

73

Universitatea de tiine Agricole i Medicin Veterinar

CERCETRI PRIVIND MORFOLOGIA DIVERTICULULUI VITELIN


(MECKEL) LA G]SCA DOMESTIC (ANSER DOMESTICUS)
RESEARCHES REGARDING THE MORPHOLOGY OF THE DIVERTICULUM
VITELLIN (MECKELS DIVERTICULUM)
AT THE DOMESTIC GOOSE (ANSER DOMESTICUS)
GEORGESCU B.1, PREDOI G.1, CORNIL N.1, TUDOR N.1, BELU C.1,
PREDOI tefania1, CAZIMIR Iuliana1, NEGHIRL Ioana2,
PUN D.1, TOADER A. I.1, PLMARU Veroana1
1FMV Bucureti
2ANSVSA. Bucureti
The researches were done on 17 specimens of adult domestics gooses (Anser domesticus) rise
from two backyards. One flock (8 specimens) was breed in traditional way, but without access at
any water pool and the second flock was breed in the same way but having access at a water
pool. We were following the morphological features of the diverticulum vitellin at this species. We
were detected a better organisation of the lymphoid tissue at the birds which have access at the
water pool, at the majority of the specimens the lymphatic nodes were presenting a tendency of
structure of the germinating centre.

The researches were done on 17 specimens of adult domestics gooses (Anser domesticus) rise
from two backyards. One flock (8 specimens) was breed in traditional way, but without access at any
water pool and the second flock was breed in the same way but having access at a water pool. We
were following the morphological features of the diverticulum vitellin at this species. We were
detected a better organisation of the lymphoid tissue at the birds which have access at the water
pool, at the majority of the specimens the lymphatic nodes were presenting a tendency of structure
of the germinating centre.
Sistemul limfatic, prin funciile ndeplinite, are un rol deosebit de important n aprarea
organismului indiferent de specie.
Psrile domestice n general sunt crescute n mari colectiviti care implic i asigurarea unui
status de sntate corespunztor, att prin metode igienico sanitare, ct i prin profilaxie imulogic.
Acestea implic cunoaterea macro- i microscopic a aspectelor normale ale organelor limfatice (2,
3, 4, 6, 10).
Cunotinele anatomice cu privire la morfotopografia i structura formaiunilor limfatice la
speciile de palmipede domestice i la prepelia japonez sunt destul de reduse n literatura de
specialitate, aceasta abundnd mai ales n studii asupra sistemului limfatic la gina domestic (1, 2, 3,
5, 7, 8, 9, 10).
MATERIAL I METOD
Studiile au fost ntreprinse pe 17 exemplare adulte de gsc domestic (Anser domesticus).
Aceste exemplare au provenit din dou gospodrii particulare, psrile fiind crescute n condiii de
exploatare tradiional, 8 exemplare neavnd ns acces la luciu de ap. Studiile au fost efectuate pe
cadavre proaspete provenite de la aceste psri care au fost sacrificate prin injectare intrabulbar cu
Xilin sol. 4% (fr emisiune sangvin pentru pstrarea aspectului normal al formaiunilor limfoide).
Pentru a putea recolta diverticulul vitelin pasrea sacrificat este dispus n decubit dorsal. Dup
deschiderea cavitii abdominale s-a ridicat duodenul i stomacul muscular i astfel s-a putut vizualiza
jejunul. S-a abordat jejunul, iar la jumtatea acestuia a fost reperat diverticulul vitelin. Pentru
realizarea preparatelor histologice s-a recoltat diverticulul vitelin mpreun cu aproximativ 2,0 2,5
cm din jejun. Coloraiile folosite au fost hematoxilin-eozin (HE), hematoxilin-eozin-albastru de
metil (HEA) i Giemsa.
Studierea, descrierea i omologarea formaiunilor s-a fcut n concordan cu Nomina
Anatomica Avium 1979 (11) i cu Nomina Anatomica Veterinaria, Nomina Histologica i Nomina
Embryologica 1994 (12) i Nomina Anatomica Veterinaria 2005 (13).
74

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Preparatele au fost examinate, interpretate i fotografiate folosind microscopul LABOPHOT 2
NIKON dotat cu sistem de microfotografiere Canon PowerShot A640.
REZULTATE I DISCUII
Diverticulul vitelin (diverticulul Meckel) este considerat cel de-al treilea organ limfoepitelial al
psrilor. Aceast formaiune limfoid este ataat jejunului pe marea curbur. Jejunul apare sub
forma unui tub uniform calibrat, flexuos, prezentnd mai multe anse. Ansele jejunale sunt dispuse
dorsal de duoden, n plan median ntre sacii aerieni abdominali i este suspendat la plafonul cavitii
toraco-abdominale printr-un mezenter lung. Diverticulul vitelin este plasat pe marea curbur a
jejunului i marcheaz limita dintre jumtatea proximal i distal a acesteia.
Diverticulul vitelin reprezint vestigiul sacului i canalului vitelin realiznd comunicarea dintre
lumenul intestinului embrionar i cavitatea veziculei viteline. Aceast formaiune este ataat marii
curburi a jejunului printr-un scurt pedicul, iar peritoneul visceral ce-l acoper formeaz prin trecerea
pe jejun un scurt ligament de susinere.
La gin i palmipede vezicula vitelin, inclus n cavitatea abdominal dup ecloziune, ncepe
s regreseze pn n a doua sptmn de via, rmnnd ataat ca o redus formaiune la marea
curbur a jejunului i constituind diverticulul vitelin.
ncepnd cu a doua sptmn de via diverticulul vitelin i ncepe dezvoltarea i
transformarea n organ limfoepitelial, pentru a deveni funcional dup 5-7 sptmni.
La gsca domestic diverticulul are aspect vermiform (fig. 1), o lungime medie de 1,4-1,7cm i
un diametru de 0,5-0,7 cm.

Fig. 1. Aspectul diverticulului vitelin (1) la gsc (original).

La toate speciile de psri domestice artera mezenteric cranial prin arterele jejunale asigur
irigarea jejunului i implicit asigur i irigarea diverticulului vitelin. Arterele jejunale se dirijeaz
divergent ntre foiele marelui mezenter pentru ca n apropierea micii curburi fiecare arter s emit
ramuri directe i indirecte ce se anastomozeaz i realizeaz arcada arterial jejunal. Din arcada
jejunal se desprind ramuri perpendiculare ce abordeaz mica curbur a jejunului i s se distribuie
pereilor acestuia fr a se anastomoza pe marea curbur. La jumtatea arcadei arteriale jejunale se
detaeaz 2 pn la 3 ramuri ce abordeaz diverticulul vitelin i pediculul acestuia.

75

Universitatea de tiine Agricole i Medicin Veterinar


De la nivelul diverticulului vitelin, ca de altfel de la ntreg jejunul se detaeaz ramuri venoase
paralele ramurilor arteriale, ramuri care se reunesc ntr-o arcad venoas i prin venele jejunale se
dreneaz n vena mezenteric cranial care constituie una din rdcinile venei porte.
Jejunul i deci i diverticulul vitelin se afl sub controlul sistemului nervos vegetativ.
Inervaia ortosimpatic este asigurat de nervii splanchnici abdominali (mare i mic) i de
nervul intestinal. Nervul marele splanchnic abdominal se formeaz de la nivelul ganglionilor
paravertebrali toracici 3, 4, 5 i 6. Nervul micul splanchnic abdominal se formeaz de la nivelul
ganglionilor paravertebrali 6, 7, 8 i 9. Cei doi nervi abordeaz ganglionul celiac i ganglionul
mezenteric, ganglioni care emit numeroase ramuri ce formeaz plexurile celiac i mezenteric. Nervul
intestinal, caracteristic psrilor, prsete lanul paravertebral lombar la nivelul polului caudal al
rinichiului, are un traiect arciform ntre foiele marelui mezenter, se integreaz plexului celiac i emite
numeroase ramificaii intestinale.
Inervaia parasimpatic a jejunului este asigurat de nervul vag. Filetele nervului vag (fibre
preganglionare) abordeaz ganglionul celiac i nervul intestinal integrndu-se plexului celiac i
mezenteric. Pe calea plexului celio mezenteric fibrele parasimpatice se dirijeaz ctre peretele
intestinal pentru a aborda ganglionii intramurali (juxtaorganici). De la nivelul acestora se detaeaz
fibre postganglionare ce vor asigura inervaia parasimpatic a jejunului i diverticulului vitelin.
Studiul histologic s-a efectuat pe preparate obinute de la psrile sacrificate i evideniaz
diferene majore de histostructur ntre diverticulul vitelin i jejunul adiacent.
Mucoasa jejunal prezint viloziti nguste, foarte lungi, ce acoper 4/5 din grosimea
mucoasei. Glandele intestinale sunt simple, scurte, se deschid la baza vilozitilor i ocup n
totalitate spaiul dintre baza vilozitilor i musculara mucoasei.
esutul conjunctiv lax din lamina proprie (corion) este redus cantitativ i cuprinde vase
sangvine, limfatice i nervi i se continu n axul vilozitilor. Nu sunt prezente aglomerri de celule
limfoide n corion. Musculara mucoasei, foarte redus, cuprinde un strat subire de fibre musculare
netede ce marcheaz limita dintre lamina proprie i submucoas. Submucoasa este slab reprezentat,
lipsit de glande i de celule limfoide, cuprinznd un strat redus de esut conjunctiv cu fibre de
colagen elastice, neuroni i prelungiri nervoase din plexul submucos (Meissner). Musculoasa jejunului
cuprinde un redus strat longitudinal extern i un strat circular intern mai dezvoltat. ntre cele dou
straturi se interpune esut conjunctiv lax cu fibre elastice, vase sangvine i limfatice i plexul nervos
mienteric (Auerbach). Seroasa jejunal este reprezentat de mezoteliu peritoneului visceral i de un
redus strat de esut conjunctiv lax submezotelial cu vase sangvine i nervi.
Diverticulul vitelin, cu toate c este n direct comunicare cu lumenul intestinal, prezint un
aspect histologic diferit de cel al jejunului adiacent.
n structura diverticulului se remarc un abundent esut limfoid difuz sau organizat n
limfonoduli. Mucoasa diverticulului prezint pliuri groase cu aspect de falduri cu baza larg, faldurile
nlocuind vilozitile jejunale.
Tunica muscular este mai subire dect cea jejunal i apare organizat pe dou straturi
(longitudinal extern i circular intern) cu o grosime aproximativ egal. Submucoasa este delimitat de
mucoas printr-un strat subire i discontinuu de musculara mucoasei. Lamina proprie a mucoasei
este puternic infiltrat cu limfocite, plasmocite, macrofage i eozinofile. Datorit abundenei celulelor
limfoide care ocup ntregul spaiu dintre epiteliu i musculara mucoasei pliurile mucoasei au un
aspect extrem de divers, putndu-se remarca pliuri triunghiulare sau neregulate.
Celulele limfoide apar dispersate relativ uniform, putndu-se remarca o tendin de organizare
n limfonoduli la exemplarele care au avut acces la luciul de ap n urma stimulrii antigenice. Foliculii
limfatici sunt ovoidali, au diferite dimensiuni, sunt delimitai de sinusuri limfatice i prezint un sinus
central neregulat. Glandele intestinale sunt mult mai rare fa de cele din jejun. Epiteliul mucoasei
este simplu, columnar, n unele cazuri cu tendin de pseudostratificare. Sunt prezente numeroase
celule caliciforme i limfocite intraepiteliale. A fost observat tendina de organizare a limfonodulilor,
respectiv dispunerea plasmocitelor n partea central i a limfocitelor la periferie.

76

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 2. esut limfoid difuz n mucoasa diverticulului vitelin la gsc fr acces la luciu de ap (H.E.A., ob. 10)
(original).

Fig. 3. Imagine de ansamblu a diverticulului vitelin la gsc care a avut acces la luciu de ap. Viloziti lite i
pline cu limfocite (Giemsa, ob. 10x5,6) (original).

Fig. 4. Diverticul vitelin la gsc care a avut acces la luciu de ap. Nodul limfoid cu aspect reniform, cu tendin
de structurare a centrului germinativ (HE, ob. 4x5,6) (original).

77

1.

2.
3.

4.

5.

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII
Diverticulul vitelin poate fi considerat un al treilea organ limfoepitelial al psrilor prin structura
i funciile ndeplinite. Aceast formaiune reprezint vestigiul sacului i canalului vitelin
realiznd comunicarea dintre lumenul intestinului embrionar i cavitatea veziculei viteline.
Diverticulul vitelin este dispus pe marea curbur a jejunului i ataat acestuia printr-un scurt
pedicul. Aceast formaiune apare vermiform la gsca domestic.
Studiul histologic efectuat pe cele 2 loturi de gsc domestic evideniaz diferene majore de
histostructur ntre diverticulul vitelin i jejunul adiacent. Mucoasa jejunal prezint viloziti
nguste, foarte lungi, ce acoper 4/5 din grosimea mucoasei. Nu sunt prezente aglomerri de
celule limfoide n corion.
n structura diverticulului se remarc un abundent esut limfoid difuz sau organizat n limfonoduli
(mai ales la lotul care a avut acces la luciu de ap). Mucoasa prezint pliuri groase cu aspect de
falduri cu baza larg, acestea nlocuind vilozitile jejunale.
Limfonodulii apar mai numeroi la exemplarele care au avut acces la sursa natural de ap i n
acelai timp apare tendina de difereniere a centrului germinativ, probabil datorit abundenei
de stimuli antigenici la aceasta categorie de psri.
BIBLIOGRAFIE

Bacha, W.J.; Linda Wood Color Atlas of Veterinary Histology. Lea & Febiger Comp., Philadelphia London,
1990.
2. Cadenne, J.D.Ch.R. - Structures normales et pathologiques de lintestin des volailles. Thse, Ecole Nationale
Vtrinaire de Toulouse, 1981.
3. Ciobotaru, Emilia Studii morfofuncionale ale celulelor imunitare la pasre. Tez F.M.V., Bucureti, 1998.
4. Cornil, N.; Ligia Diaconescu Aspecte macro- i microscopice ale diverticulului vitelin la gin. Lucr. t.
UAMV, Seria C Medicin veterinar, Vol. XXXVIII, Bucureti, 1995.
5. Cornil, N. Morfologia microscopic a animalelor domestice (cu elemente de embriologie), Vol. I-II. Ed. BIC
ALL, Bucureti, 2000.
6. Coofan, V., Valentina Hricu, Palicica, R., Predoi, G., Damian, A., Sptaru, C., Carmen Vanda Gan, Enciu, V.
Anatomia animalelor domestice, vol. II Organologie (Viscerele). Ed. Orizonturi universitare, Timioara, 2007.
7. Georgescu, B. Cercetri morfotopografice asupra formaiunilor limfoide la psrile domestice. Tez F.M.V.,
Bucureti, 2001.
8. Gheie, V.; Patea, E.; Atanasiu, I.; Zenobia Patea Sistemul neuro-vegetativ la mamiferele i psrile
domestice. Ed. Academiei R.P.R., Bucureti, 1962.
9. Gheie, V.; Chiescu, t.; Coofan, V.; Hillebrand, A. Atlas de anatomie a psrilor domestice. Ed. Academiei
R.S.R., Bucureti, 1976.
10. King, A.S.; McLelland, J. BIRDS their structure and function. Second Edition. Ed. Baillere tindall, London
Philadelphia Toronto Mexico City Rio de Janeiro Sydney - Tokyo Hong Kong, 1984.
11. * * - Nomina Anatomica Avium. Academic Press, London Toronto New York Sydney San
1.

12.
13.

Francisco, 1979.
* * - Nomina Anatomica Veterinaria (Fourth Edition) togeter with Nomina Histologica (Revised
Second Edition) and Nomina Embryologica Veterinaria. Zrich and Ithaca, New York, 1994.
* * - Nomina Anatomica Veterinaria (Fifth Edition). Hannover, Columbia, Gent, Sapporo, 2005.

78

Lucrri tiinifice vol. 51 seria Medicin Veterinar

GENOTYPING OF s1-CAZEIN GENE IN KARAKUL SHEEP BREED


KEVORKIAN Steliana, MANEA Maria Adina, GEORGESCU S.E.,
DINISCHIOTU Anca, COSTACHE Marieta
University of Bucharest
Casein genetic polymorphisms are important and well known due to their effects on
quantitative traits and technological properties of milk. Casein s1 represents the major fraction of
milk. There have been characterised five variants of s1 : A, B, C, D and E. The differences between
variantes A, C and D are represented by minore substitutions that affects the degree of
phosphorilation of proteins. The aim of this study was to analyze the genotype distribution of s1
casein in Karakul sheep using PCR-RFLP technique. We included in these study 60 animals from
Karakul breed DNA amplification was carried out by PCR and the amplicons were digested with
restriction endonuclease MboII. The primers were designated in order to amplify a 372bp
fragment. Restricted products were analyzed by electrophoresis in agarose gel stained with
ethidium bromide. The different restriction enzyme patterns obtained were: nonA homozygous
individuals, which yield two bands 306 and 66bp, A/A individuals which yield three fragments 160,
146 and 66bp and heterozygous nonA/A individuals which have patterns for all four fragments.
The genotype we obtained in our breeds was the non-A homozygous genotype. Our results are
useful to determine shortly after birth the animals carrying economically important casein
variants.

Milk protein polymorphisms have been considered as potential tools for selection of dairy
ruminants. In dairy sheep, research on this topic is limited to s1-casein and -lactoglobulin loci, so
far.
Caseins represent a well-defined group of proteins synthesized in the mammary gland in
response to lactogenic hormones and secreted as micelles, constituting about 80% of the proteins in
ruminants milk and only 40% in human milk.
Casein is a remarkably efficient nutrient, supplying not only essential amino acids, but also
some carbohydrates and the inorganic elements calcium and phosphorus. The calcium caseinates
form an insoluble white curd when acidified by hydrochloric acid or sulfuric acid, or when milk is
soured by bacterial contaminants. Acid casein is used widely in cheese, adhesives, water paints, for
coating paper, and in printing textiles and wallpaper. In neutral solutions the enzyme rennin converts
one of the caseins to an insoluble curd; most of the protein in cheese is rennet casein curd.
The known caseins in ruminants milk are s1-Cn (CSNlSl), s2 -Cn (CSNlS2), -Cn (CSN2) and Cn (CSN3), coded by as many other closely linked and autosomal loci. Sheep caseins have been
assigned to chromosome 6 (Echard et al., 1994). DNA polymorphisms at the four casein loci, their
inheritance and linkage relationships were first described by Di Gregorio et al. (1991) and Leveziel et
al. (1991). An additional RFLP at the s2-Cn locus was recorded by Phua et al. (1992). So far for the s1
casein there have been described a five allele polymorphism (A, B, C, D, E) (Chianese, L et al., 1996) .
The primary structure of A, C, D (Welsh) variants was determined by Ferranti et al. (1995) which
showed that their different mobilities are caused by different phosphorylation levels arising from a
silent amino acid substitution in the triplet code for phosphorylation. In particular, -CN variant C
differs from variant D by the substitution SerP68 (C) - Asn68 (D), which causes the loss of both
phosphate groups in residues Ser64 and Ser66 in variant D (Ferranti et al. 1995). It has been reported in
different studies that the Welsh variant has been associated with a negative association with the fat
and protein content of milk.
The aim of this work was to analyze the genotype distribution of s1-casein variant A in Karakul
sheep. A DNA mutation characteristic to the A allele can be detected after a DNA digestion with the
Mbo II restriction enzyme (F. Pilla et al., 1998).
Materials and Methods
60 blood samples collected from Karakul breed of different colors (white, black, gray, brown,
chestnut and pink) were analyzed. The isolation of genomic DNA from fresh blood was performed
with Wizard Genomic DNA Extraction Kit (Promega).
79

Universitatea de tiine Agricole i Medicin Veterinar


The PCR conditions were optimized for the primer by varying the annealing temperature
between 51-61C on a gradient thermocycler IQCycler (BioRad).
After determining the optimum temperature of 58C, the amplification reactions were carried
out in 25 L final volume and consisted of 1X PCR Buffer, MgCl2, 200M dNTPs, DNA template, 0.5
units of AmpliTaq Gold DNA Polymerase, 0.5L of each primer (F- GGTGTCAAATTTAGCTGTTAAA and
R- GCCCTCTTCTCTAAAAAGGTTT) and nuclease free water. PCR amplifications were performed in 0.2
ml tubes using a program with 45 cycles. Denaturation was performed at 95C for 30 seconds,
anneling at 58C for 30 seconds and extension at 72C for 1 minute. The first denaturation step was of
10 minutes at 95C and the final extension was of 10 minutes at 72C.
The PCR products obtained were digested with 1U of MboII restriction endonuclease
(Promega) for 3 hours at 37C. The restriction fragments were directly analyzed by electrophoresis in
3% agarose gels in 1X TAE buffer, stained with ethidium bromide, and visualized under UV light. The
genotypes of the analyzed individuals at the s1-casein locus were established using the restriction
fragments observed in the gel.
Results and discussions
First we optimized the PCR reaction and we obtained a DNA fragment of the expected length.
The optimum temperature was obtained for 580C (Figure 1).

Figure 1: PCR reaction optimization for the s1-casein locus. 1: 51C; 2: 51,8C; 3: 53,1C; 4: 54,9C; 5:
57,4C; 6: 59,3C; 7: 60,5C; 8: Molecular weight marker (50bp DNA Step Ladder).

A 372bp fragment of the ovine s1-casein gene including exon three was amplified (Figure 2).
After PCR amplification, enzymatic digestion and agarose gel electrophoresis, we obtained the
following patterns: nonA homozygous individuals, yielded two bands 306 and 66bp, A/A individuals
yielded three fragments 160, 146 and 66bp and heterozygous nonA/A individuals which have
patterns for all four fragments. The 66bp fragment results from an MboII site present in all patterns
and are useful as a control procedure. We obtained patterns only for the nonA homozygous animals
(Figure 3).

Figure 2: PCR products amplified with specific primers for the s1-casein locus. Lane 1: Control. Lanes 2-7: PCR
products. Lane 8: Molecular weight marker (50bp DNA Step Ladder).

80

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Figure 3: Results after digestion with MboII. 1: control; 2-6: nonA homozygous individuals; 7: undigested PCR
product; 8: molecular weight marker (50 bp).

Conclusions
Studies on sheep casein polymorphisms are very scarce in Romania. Considering the
importance of this gene for chesse making it is very important to determine the possible genotypes.
DNA analyses can be carried out on both sexes independent of age, so animals carrying economically
important casein variants can be identified shortly after birth. In this sense, we have to point out the
importance that the study of CSN1S1 locus polymorphism may have in the selection of rams not
carrying the Welsh variant of s1-casein observed.
The aim of this work was to analyze the genotype distribution of s1-casein variant A in Karakul
sheep. The only pattern obtained was the one for the nonA homozygous animals. We obtained no
A/A individuals or heterozygous nonA/A individuals. For this reason we intend to continue this study
with other animals and furthermore with other breeds and to establish a correlation between our
results and the milk productivity for the studied individuals.
Bibliografy
1. Chianese, L., Garro, G., Nicolai, M.A., Mauriello, R., Laezza, P., Ferranti,P., Addeo, F., 1996. Ocurrence of five
s1 casein variants in ovine milk. Dairy Res. 63 (49), 59
2. Di Gregorio, P., Rando, A., Pieragostini, E., Masina, P., 1991. DNA polymorphism at the casein loci in sheep.
Anim. Genet. 22, 21-30.
3. Echard, G., Broad, T.E., Hill, D., Pearce, P., 1994. Present status of the ovine gene map (Ovis aries); comparison
with the bovine map (Bos taurus). Mamm. Genome 5, 324-332.
4. F. Pilla, C. Bevilacqua, C. Leroux, A. Fraghi, P. Martin, 1998 Genotyping of s1casein in sheep, Anim. Genet. 29,
460-477
5. Ferranti, P., Malorni, A., Nitti, G., Laezza, P., Pizzano, R., Chianese, L. & Addeo, F. 1995 Primary structure of
ovine s1-caseins : localization of phosphorylation sites and characterization of genetic variants A, C and D.
Journal of Dairy Research 62 281296
6. Leveziel H., Metenier L., Guerin G., Cullen P., Provot C., Bertaud M., Mercier J.C., 1991. Restriction fragment
length polymorphism of ovine casein genes: close linkage between the s1, s2, , -casein loci. Anim. Genet. 22,
l-10.

81

Universitatea de tiine Agricole i Medicin Veterinar

EFFECT OF ORGANIC SELENIUM SUPPLEMENTATION DIET IN


CALVES ON HUMORAL IMMUNE RESPONSE
1Institute

LIONIDE A.1, CURC D.2, PANT L.3


for Control of Biological Products and Drugs for Veterinary Use, Bucharest
2FMV Bucureti
3ALLTECH BIOTECHNOLOGY Romania

Organic mineral source represent, in last years, a nutritive supplement indicated in nutrition
of humans and animals, because of superior bioavailability and biological functions as compared
to anorganic sources. Favorable effects on animal immunity also were reported.
In present work it was studied the effect of feeding organic sources of selenium (as Sel-Plex) in
calves, on humoral immune response.
The results show an increased bioavailability of selenium, this heaving a positive
influence on humoral immune response.
Key words: selenium, humoral immune response, calves

Selenium is a fundamental trace mineral for maintenance of health by its antioxidant function
influencing growth, immunity, fertility, muscular and neuromuscular functions (Mcintosh and
Royle, 2002). Also, it is recognized that organic selenium plays a role in the prevention of
cancer. (Sevastre et al., 2005). The effects of selenium in organisms are accomplished by an
enzyme, called glutathione peroxidase (GSH-Px), that is present in erythrocytes, plasma, muscle,
liver, etc. (Godwin, 1983, quoted by Mihai, 1996 ; Rotruck et al. 1973, quoted by Engle, 2000).
Involvements of selenium in immunology are shown by different researchers (Mulhern et al.,
1985). It is reported that selenium has a stimulating effect on lymphocyte proliferation and therefore
augments organisms resistance to infections (Cao et al, 1992 quoted by Mihai, 1996). Previous
studies reported conflicting results regarding to lymphocyte T blastogenesis (Lionide, Curc and
Samarineanu, 2005; Sordilo et. Al, 1993 ; Spears, 2000). Selenium deficiency results in a decrease of
polymorphonuclear leukocyte functions in goats (Azizs et al., 1984) and dairy cows (Gyang et al.,
1984) and a decrease of serum immunoglobulin M concentration in calves (Reffett et al., 1988). Here
we report the effects of dietary organic selenium on postvaccinal humoral immune response in calves
with marginal Se deficiency.
MATERIALS AND METHODS
The experiment was performed on 30 calves (local breed x Holstein Friesian); the calves were
1-1.5 months old. The animals were divided into 2 groups of 15 calves each, which received the same
diet. Sel-Plex was used as an organic selenium supplement:
Group E (experimental) received 0.7 g Sel-Plex as a supplement, equivalent to 0.7 mg
Se/calf/day.
Group C (control) did not receive a mineral supplement
Two viral antigens were used for immunization: inactivated avian infectious bronchitis virus
(IBV), Massachussetts strain (0.5 ml s.c.) and inactivated Aujeszky disease virus, Bartha strain (1 ml /
i.m.). The first vaccination was performed for both groups after 22 days from the beginning of the
experiment, followed by revaccination 14 days after the first vaccination.
In order to assess the antibody concentration titres, blood samples were taken at the first
vaccination (day 22) and at 14 days after the revaccination (day 50). The serum selenium
concentration was measured at the beginning and at the end of the experiment. The duration of the
experiment was 50 days.
Determination of serum selenium concentration was made using a fluorimetric method and
quantitative determination of postvaccinal antibody titre was made using the ELISA method.
Determination of seric selenium concentration:
Selenium level was estimated by fluorimetric method, based on the principle that Se content
in serum (Se VI) on acid digestion is converted to selenous acid (reduced to the tetravalent state with
hydrochloric acid). The reaction between selenous acid and aromatic-o-diamines such as 2.3-diamino82

Lucrri tiinifice vol. 51 seria Medicin Veterinar


naphthalene (DAN) leads to the formation of 4.5-benzopiazselenol, which displays brilliant lime-green
fluorescence.
Fluorescence emission was read on fluorescence spectrophotometer using 375 nm
wavelength.
Evaluation of postvaccinal antibodies concentration:
Quantitative determination of postvaccinal antibodies was made using ELISA method.
Materials: equipment (incubator/Shaker IEMS, automatic washer Wellwash Ascent,
spectrophotometer ELISA Multiskan EX, ELISA plate antigen coated (avian infectious bronchitis virus
or Aujeszky disease virus), washing solution (mixture of PBS and Tween 20), dilution buffer for sera
(mixture of PBS and Tween 20 and yeast extract 1% or BSA 1%), bovine anti-IgG conjugate (Sigma),
substrate (mixture of citrate buffer pH 4.0 and hydrogen peroxide), chromogen (ABTS), stopping
solution (sodium fluoride1.5%), sera for testing.
Working method:
100 l diluted serum for testing was added (1/200 for determination of anti-IBV antibodies
and 1/500 for determination of anti-virus Aujeszky antibodies) in the well of the ELISA plate, coated
with the adequate antigen and incubated for one hour at 37C. After the incubation, the content of
the plate was removed and the plate was washed with 300 l washing solution/well.
Anti-IgG bovine conjugate was added (50 l/well) and incubated for 30 minutes at 37C. The
washing operation was repeated and then a mixture of substrate-chromogen (50 l/well) was added.
After the incubation for 10 minutes at room temperature, protected from light stopping solution was
added and the optical densities of the reaction at the wavelength of 405 nm were measured.
RESULTS AND DISCUTIONS
Serum selenium concentration is an indicator of its bioavailability. Most of the research
activities indicate the superior bioavailability of organic selenium, comparing to the inorganic
selenium sources.
Normally serum selenium concentration in bovine is of 0.04 0.1 ppm. At the beginning of the
experiment, both groups showed marginally selenium deficiency (0.035 ppm). It was noted that the
organic selenium supplement (Sel-Plex) increased the serum selenium concentration to the normal
values for calves. In group E (supplemented with Sel-Plex), the average selenium serum concentration
measured at the end of the experiment (0.057 ppm) was increased by 55.90 % compared to group C
(0.036 ppm) (table 1and Fig. 1).
Table 1.Serum selenium concentration (ppm) and titres of postvaccination antibody
in calves supplemented with Sel-Plex
Postvaccination antibody titre (OD)
Serum selenium
concentration (ppm)
Sample
Group
anti-IBV
anti-Aujeszky virus
Day 0
Day 50
Day 22
Day 50
Day 22
Day 50
1
C
0.032
0.036
0.105
0.576
0.513
1.025
2
C
0.037
0.033
0.082
0.441
0.514
1.270
3
C
0.038
0.036
0.090
0.483
0.487
1.112
4
C
0.034
0.039
0.082
0.274
0.402
1.105
5
C
0.034
0.040
0.011
0.452
0.701
0.998
6
C
0.035
0.035
0.088
0.377
0.565
1.234
7
C
0.030
0.038
0.099
0.258
0.521
1.033
8
C
0.034
0.033
0.093
0.399
0.660
1.056
9
C
0.036
0.034
0.088
0.277
0.483
1.317
10
C
0.038
0.035
0.092
0.341
0.699
1.102
11
C
0.039
0.030
0.085
0.379
0.550
1.015
12
C
0.040
0.039
0.079
0.298
0.574
1.203
13
C
0.037
0.040
0.089
0.468
0.663
1.340
14
C
0.036
0.039
0.081
0.396
0.530
1.210
15
C
0.039
0.039
0.079
0.524
0.590
1.018

83

Universitatea de tiine Agricole i Medicin Veterinar


Sample

Day 0
0.035
0.038
0.035
0.037
0.029
0.034
0.035
0.035
0.033
0.034
0.033
0.039
0.030
0.031
0.039
0.038
0.035

Day 50
0.036
0.041
0.052
0.064
0.065
0.054
0.049
0.049
0.042
0.053
0.069
0.059
0.055
0.077
0.055
0.067
0.057

Postvaccination antibody titre (OD)


anti-IBV
anti-Aujeszky virus
Day 22
Day 50
Day 22
Day 50
0.083
0.396
0.563
1.136
0.081
0.874
0.640
1.914
0.079
0.476
0.514
2.214
0.088
0.525
0.465
1.667
0.092
0.436
0.431
1.391
0.085
0.476
0.692
1.842
0.079
0.676
0.573
1.857
0.084
0.335
0.428
1.060
0.081
0.778
0.660
1.741
0.079
0.355
0.732
2.001
0.101
0.755
0.580
1.400
0.093
0.364
0.503
1.205
0.09
0.428
0.680
1.735
0.086
0.416
0.663
1.818
0.078
0.597
0.450
1.356
0.089
0.989
0.493
1.856
0.085
0.565
0.568
1.670

55.90

Serum selenium
concentration (ppm)

Group

Average
16
E
17
E
18
E
19
E
20
E
21
E
22
E
23
E
24
E
25
E
26
E
27
E
28
E
29
E
30
E
Average
Increase
compared to
Group C (%)

42.70

47.00

Legend: OD = optic density

0,06

0,057

0,05

Serum selenium (ppm)

Day 0
Day 50
0,04
0,035

0,036

0,035

0,03

0,02

0,01

0
C group

E group

Fig. 1. Changes in serum selenium concentration in calves fed with Sel-Plex

Concerning postvaccinal humoral immune response, Panousis et al. (2001) shown a positive
effect of selenium supplementation diet in dairy cows on humoral immune response. In

other studies, selenium supplementation diet in dairy cows did not influence on humoral
immune response postvaccinal (Ellis et al., 1997). Selenium has been found to enhance antiSRBC (sheep red blood cell) antibody titers in mice (Spallholzj et al., 1973) and chicks
(Marsh et al., 1981). Reduced antibody responses to SRBC challenge were noted in mice
supplemented with 3 mg Se/L in their drinking water, whereas 1 mg Se/L enhanced
antibody titer levels, (Shakelfordj and Martin, 1980). With respect to the postvaccinal
humoral immune response, it was found that in the case of group E, the average anti-IBV postvaccinal
84

Lucrri tiinifice vol. 51 seria Medicin Veterinar


antibodies titre (0.565) increased by 42.70% compared to group C 0.396, datas are presented in the
table 1 and Fig. 2.
0,6

0,565

Average antibody titre (OD)

0,5

0,396

0,4

Day 22
Day 50

0,3

0,2

0,1

0,085

0,083

C group

E group

Fig. 2. Changes in anti-IBV postvaccinal immune response in calves fed Sel-Plex

Although the calves initially showed Aujeszky anti-virus antibody titres, the Aujeszky anti-virus
postvaccinal immune response was enhanced in the case of the group supplemented with Sel-Plex.
The average anti-Aujeszky virus postvaccinal antibodies titre (1.670) increased by 47.00 % compared
to group C (1.136), datas are pesented in the table 1 and Fig 3.
1,8
1.670
1,6

Average Ab (OD)

1,4
1.136

1,2
1

Day 22
Day 50

0,8
0,6

0,563

0,568

0,4
0,2
0

C group

E group

Fig. 3. Changes in anti-Aujeszky virus postvaccinal immune response


in calves fed with Sel-Plex

These results indicate that the humoral immune response of calves may be depressed by
marginal selenium deficiency and enhanced by organic selenium supplements. Whether this is due to
the direct involvement of the selenium in the immune response or to a more indirect effect the
nutrient may have on metabolic processes is unknown. The exact role of selenium in immunological
mechanisms has not been defined but its effect on the humoral immune response may be secondary.
The humoral antibody response is dependent on the proper presentation of the antigen to Bcells by T-cells and/or macrophages. The organic selenium may stimulate the humoral immune
response through its direct involvement with T-cell and effector cell function. However, further

studies need to be performed to determine the actual mechanism involving selenium


with the immune response.

85

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUSIONS
1. The average serum selenium concentration in calves supplemented with Sel-Plex was
increased by 55.90 % compared to control group.
2. In the case of the group supplemented with Sel-Plex the average anti-IBV and anti-Aujeszky
virus postvaccinal antibodies titres increased by 42.70% and 47.00% respectively compared to group
C.
3. The results indicate a positive influence of the organic selenium compounds on the humoral
immune response.
REFERENCES
1.
2.

3.
4.

5.
6.
7.

8.
9.
10.
11.

12.
13.
14.
15.
16.

Azizi E.S., P.H. Klesius, J.C. Frandsen Effects of selenium on polymorphonuclear leucocyte function in
goats. American Journal of Veterinary Research 45, pp 1715-1719, 1984.
Cao J., P. R. Henry, R. Guo, R. A. Holwerda, J. P. Toth, R. C. Littell, R. D. Miles and C. B. Ammerman.
Chemical characteristics and relative bioavailability of supplemental organic zinc sources for poultry and
ruminants. J. Anim. Sci. 78, pp 20392054, 2000.
Engle T.E. The role of trace minerals in immunity and lipid metabolism in cattle, Department of Animal
Science, Colorado State University, USA, 2001.
Gyang E.O., J.B. Stevens, W.G. Olsen, S.D. Tsistsamis, E.A. Usenik Effects of selenium-vitamina E
injection on bovine polymorphonucleated leukocyte phagocytosis and killing of Staphylococcus aureus.
American Journal of Veterinary Research 45, pp 175-183, 1984.
Lionide A., D. Curc, M. Samarineanu Changes of lymphocyte reaction in cows fed with inorganic zinc and
selenium. Faculty of Veterinary Medicine Symposium, Bucharest, 2005.
Marsh,j A., Dietert, R. R. and Combs,G. F. jr Influence of dietary selenium and vitamin E on the humoral
immune response of the chick. Proc. Soc. Exp. Biol. Med. 166: 228-236,1981.
Mcintosh G.H., P.J. Royle Supplementation of cows with organic selenium and the identification of seleniumrich protein fractions in milk. Nutritional Biotechnology in the Feed and Food Industries Proceedings of Alltech's
18th Annual Symposion, 2002.
Mihai D. Nutritional and metabolic diseases, 2 edition, Ceres Publishing House, Bucharest, 1996.
Mulhern S.A, G.L. Taylor, L.E. Magruder, A.R. Vessey Deficient levels of ditary selenium suppress the
antibody response in first and second generation nice. Nutrtion Research, 5, pp 201-209, 1985.
Panousis N., N. Roubies, H. Karatzias, S. Frydas and A. Papasteriadis Effect of selenium and vitamin E
on antibody production by dairy cows vaccinated against Escherichia coli. Vet. Rec. 49, pp 643 - 646. 2001.
Reffett J.K., J.W. Spears, T.T. Brown Effect of dietary selenium on the primary and secondary immune
response in calves challenged with infectious bovine rhinotracheitis virus. Journal of Nutrition 18, pp 229-235,
1988.
Sevastre B. A.I. Baba, L. Pant Organic Selenium. Mechanisms of action and effects. Romanian Jouranal of
Veterinary Medicine 2, 2005.
Shakelford J. and Martin J. - Antibody response of mature male mice after drinking water supplemented with
selenium. Fed. Proc. 39: 339 (abs.),1980.
Sordillo L.M., C.R. Hicks, R. Wilson and J. Maddox Effects of selenium status on bovine mononuclear cell
function. J. Vet. Med. (Ser. A) 40, pp 615-623, 1993.
Spallholzj E., Martin L., Gerlachm L., Heinzerling R. H. Immunological responses of mice fed diets
supplemented with selenite selenium. Proc. Soc. Exp. Biol. Med. 143: 685-689, 1973.
Spears J.W. Micronutrients and immune function in cattle. Proc. Nutrition Society, 59, pp 1-8, 2000.

86

Lucrri tiinifice vol. 51 seria Medicin Veterinar

INFLUENA REMEDIULUI BioR ASUPRA PSEUDOCOLINESTERAZEI


N SERUL SANGUIN LA TINERETUL PORCIN ALIMENTAT CU RAII
CARENATE
MACARI V., GUDUMAC V., DONICA A.
1. Universitatea Agrar de Stat din Moldova
2. Universitatea de Stat de Medicin i Farmacie "Nicolae Testemianu"
This study's purpose is to clear up the influence of the natural remedy BioR of algal origin
obtained due to the modern technology from Spirulina platensis on the health and the
proteosynthetic function of the young pigs liver fed on insufficient rations. After the successive
administration of the remedy tested intramuscular 2,0 ml twice, has been proved that the remedy
doesn't have a negative influence on the animal's health, on contrary it has a good influence on
the improvement of the proteosynthetic function of the liver and on the improvement of the
productive performances.
Key words: Remedy BioR, Young Pigs, Fed, Algal origin, liver, Spirulina platensis, the
proteosynthetic function

Dezvoltarea zootehniei moderne este stopat n mare msur de conceptele ecologice, de


intervenia diferitor factori stresogeni i nu n ultimul rnd de insuficiena furajelor echilibrate, n
special n raia tineretului porcin (1,3,4). Studiile ntreprinse anterior au evideniat efectul
hepatoprotector al substanelor bioactive de origine algal, inclusiv i a preparatului BioR,
administrate animalelor de laborator, porcinelor de diverse vrste i stri fiziologice n condiii de
complex (5,7,10,11).
Reieind din cele relatate, prin studiul efectuat s-a urmrit influena administrrii remediului
BioR la tineretul porcin alimentat cu raii carenate, asupra funciei proteosintetice a ficatului.
MATERIALe I METODe
Cercetrile au fost efectuate pe 15 purcei n clinica Facultii de Medicin Veterinar din cadrul
UAS din Moldova. Purceii antrenai n cercetare, obinui de la ncruciarea raselor Marele Alb i
Landrace, au fost selectai conform cerinelor n vigoare (vrst, genotip, greutate corporal), crescui
n condiii zooigienice conform normelor stabilite. Principiul de organizare a acestui studiu cu
utilizarea preparatului BioR este prezentat n tabelul 1.
Tabelul 1 Schema
Loturile de
animale

Nr. de
animale

de organizare a experimentului cu preparatul BioR


Masa
medie, kg

Calea de
administrar
e

Regimul
administrri
i

Martor

17,04

I/mus

2 doze

Experi mental
1

16,44

I/mus

2 doze

Experi mental
2

16,24

I/mus

2 doze

Doza, ml/cap
2,0 ml sol.
0,9% Na Cl
2,0 ml sol.
0,9% Na Cl
2ml BioR

Raia
Echilibrat
Neechilibr at
Neechilibr at

Not: preparatul s-a administrat de 2 ori, cu interval de 1 lun.

Din tabelul 1 se observ c alimentaia loturilor de tineret porcin luai n studiu a fost diferit i
anume, lotul martor a primit nutre combinat echilibrat dup indicii nutritivi, iar loturile
experimentale 1 i 2 au beneficiat de nutre combinat, la care indicii nutritivi nu au fost echilibrai
conform cerinelor.
Pe parcursul petrecerii investigaiilor la toi purceii inclui n experiment de 3 ori la nceputul
experimentului, peste 1 lun i la finele studiului, n scopul determinrii strii de sntate au fost
determinai indicii fiziologici: temperatura corporal i frecvena respiraiei pe minut. n paralel s-a
recoltat snge, pentru a determina unii indici hematologici, biochimici, etc. Animalele au fost
cntrite n scopul elucidrii indicilor bioproductivi.

87

Universitatea de tiine Agricole i Medicin Veterinar


Activitatea pseudocolinesterazei (PCE) a fost determinat n serul sanguin la analizatorul
biochimic FP-900 (firma "Labsystems", Finlanda), prin metoda cinetic cu utilizarea seturilor de
reageni ai firmei Eliteh "Frana".
REZULTATE I DISCUII
Administrarea remediului BioR animalelor supuse cercetrilor nu a provocat reacii adverse,
careva abateri n dezvoltarea sau sntatea lor. Menionm c temperatura corporal, pe parcursul
studiului i n deosebi la finele lui, este mai mic la lotul experimental 2, cu 0,11oC, fa de lotul de
referin i, respectiv cu 0,17o, fa de lotul experimental 1, rezultate care indirect denot o aciune
antistresorie i adaptativ a remediului BioR. n paralel, s-a constatat faptul c frecvena respiraiei pe
minut, n linii generale, are analogic temperaturii corporale aceiai tendin de manifestare, fiind
stabilite n limitele normelor fiziologice i reflect o stare general normal (7,8,9).
Un loc esenial n elucidarea interveniei remediilor antistresorii i evident stimulatorii, revine
i studiului PCE, enzim care n mare msur reflect funcia proteosintetic a ficatului (2,6,7).
n condiiile cercetrilor noastre efectuate pe purcei, s-a stabilit c pn la modificarea raiei i
administrarea produsului BioR nivelul bazal al PCE n serul sanguin la animale constituie n medie
7698,29775,63 nmol/s*l. Rezultatele obinute privind evoluia PCE n serul sanguin dup
tratamentul cu remediul BioR sunt redate n tabelul 2.
Tabelul 2 Nivelul funcional al pseudocolinesterazei n serul sanguin la administrarea preparatului
BioR tineretului porcin alimentat cu raii carenate, nmol/s*l
Specificri
Loturile de animale
Martor
Experimental 1
Experimental 2
Nr. de animale
5
5
5
Nivelul bazal pn la
n=6
7698,29775,63 nmol/s*l
administrarea BioR
1 examinare
12248,351093,49
9885,54483,92
12083,221114,95
2 examinare
9394,441159,08
7724,14650,89
9271,28482,13

Datele redate n tabelul 2 atest c la 1 lun dup iniierea studiului, nivelul funcional al PCE
manifest o tendin de cretere, mai pronunat fiind la lotul martor, cu 59,1%, fa de nivelul bazal,
la debutul investigaiei. Remarcm faptul c acest indice i la loturile experimentale 1 i 2 este mai
mare cu 24,4% i respectiv 56,9% fa de nivelul bazal. Astfel, rezultatele obinute mrturisesc despre
starea metabolic normal a tineretului porcin, fiindc tendina de cretere a PCE la aceast vrst
este o particularitate fiziologic, fapt constatat n cercetrile anterioare efectuate pe purceii n
condiii de complex (7,12).
Investigaiile efectuate la acest termen denot c valoarea PCE, la purceii tratai cu BioR, este
mai mare cu 22,2% fa de lotul experimental 1 i practic nu difer de acest indice la lotul martor,
alimentat normal. Merit atenie i proprietatea preparatului BioR de a menine nivelul PCE la nivelul
lotului martor ctre a 2 examinare, termen la care se constat o diminuare a acestei enzime la toate
loturile antrenate n experiment. Totodat, s-a constatat c remediul testat nu numai c a stopat
diminuarea PCE, cu 20,0% la purceii alimentai cu raii carenate, dar a i meninut acest parametru la
nivelul lotului martor.
Rezultatele obinute i discutate mai sus pot fi confirmate i de indicii zootehnici de baz i
anume sporul mediu/zi a fost cu 2,8% mai mare comparativ cu lotul martor i cu 16,0% mai mare fa
de lotul experimental 1. Constatm c i consumul specific de furaje la 1 kg spor a fost mai favorabil
n lotul experimental 2 care a fost mai mic cu 3,2% fa de lotul martor i cu 5,0% fa de lotul
experimental 1.
n baza investigaiilor efectuate, putem concluziona c remediul BioR din spirulin, administrat
succesiv la purceii tineri, alimentai cu raii carenate, manifest proprieti adaptative i
hepatoprotectorii, care contribuie n mare msur nu numai la ameliorarea proceselor metabolice n
ficat, dar i la mbuntirea indicilor zootehnici de baz, evideniind astfel i proprieti
biostimulatorii.

88

1.
2.
3.
4.

Lucrri tiinifice vol. 51 seria Medicin Veterinar


CONCLUZII
Administrarea remediului BioR tineretului porcin nu a indus abateri de la starea general sau
fenomene de intoleran local.
Preparatul BioR contribuie esenial la ameliorarea funciei proteosintetice a ficatului la tineretul
porcin alimentat cu raii carenate.
Preparatul BioR, administrat tineretului porcin alimentat cu raii carenate, a contribuit la
creterea sporului zilnic i diminuarea consumului specific.
Studiul efectuat confirm necesitatea continurii investigaiilor mai detaliate i profunde privind
intervenia remediului din alge asupra organismului animal n diverse stri fiziologico-metabolice.
BIBLIOGRAFIE

Bajov G.M., Komlakii V.J., Biotehnologhia intensivnogo svinovodsta / M.: Gosagropromizdat, 1989. 269 s.
Baciu E. Aspecte metabolice ale proceselor reparative n ficat la regresia cirozei hepatice experimentale i
efectele administrrii trifluoracetatului de zinc cu -picolin / Autoreferatul tezei de doctor n tiine biologice.
Chiinu, 2001. 24 p.
3. Furdui F.I., tirbu E.I., Strutinschii F.A., Nadvodniuk A.I., Pavaliuc P.P. i dr. Stress i adaptaia
seliscohozeaistvennh jivotnh v usloviiah industrialinh tehnologhii / Chiinu: tiina, 1992. 223 s.
4. Georgescu Gh., Temian V., Podar C., Velea C. Tratat de cretere a bovinelor / Bucureti: Ed. Ceres, 1995.
485 p.
5. Gudumac V., Rudic V., Gulea A., Chiriac T., Bulmaga V., Macari V. Technologies dobtention de nouveaux
E
produits immuostimulateurs et hepatoprotecteurs dorigine algale // 29 Salon international des inventions des
techniques et produits nouveau. 4-8 avril 2001, Palexpo. Genve. 2001. p. 179.
6. Kolk S.A., Van Der, Wesse H., Duk S. Von. Inhibition of pseudocholinesterase activity in a 20-year old gelding
//Veterinary record. 1995. 137, N 22. P. 564-565.
7. Macari V. Aspecte fiziologo-metabolice ale aciunii preparatului BioR de origine algal asupra organismului
porcin / Autoreferatul tezei de doctor habilitat n tiine biologice. Chiinu, 2003. 49 p.
8. Martineau G.P. Maladies dlevage des porcs // Paris: Editions France Agricole, 1997. 479 p.
9. Popa V.V., Vlgoiu C. Metodologia examinrii medicale la animale / Bucureti: Ed. Ceres, 1996. 226 p.
10. Rudic V., Cojocari A., Cepoi L., Chiriac T., Rudi L., Gudumac V., Macari V., Codreanu S. .a. Ficobiotehnologie
cerectri fundamentale i realizri practice / Chiinu: Tipografia "Elena V.I. SRL), 2007. 365 p.
11. Rudic V., Gudumac V., Popovici M. Fotobiotehnologie realizri noi n biomedicin / Chiinu: Cuant, 1995.
207 p.
12. Rudic V., Macari V., Gudumac V. Influena remediului BioR-S1 asupra nivelului funcional al
pseudocolinesterazei n serul sanguin la tineretul porcin // Anale tiinifice ale Universitii de Stat din Moldova.
Seria tiine chimico-biologice. Chiinu. 2000. p. 47-49.
1.
2.

89

Universitatea de tiine Agricole i Medicin Veterinar

MANIFESTRILE INDICILOR HEMATOLOGICI LA PUIIBROILERI TRATAI CU REMEDIULUI BIOR


MACARI V., Putin V., MACARI Ana, POZD]RC E.
Universitatea Agrar de Stat din Moldova
In this study are presented the results of the influence of the natural remedy BioR of algal
origin obtained due to the modern technology from Spirulina platensis, on the health and on the
hematological indices at broiler chickens in the conditions of avicol factory. After the successive
administration of the remedy BioR at the broiler chickens from the age of two days has been
proved that this remedy doesn't affect the chickens' health, on contrary, contributes to the
stimulation of the hematopoesis and to the increase of chickens' natural resistance.
Key words: remedy BioR, Algal origin, Spirulina platensis, hematological indices, broiler chickens,
avicol factory, hematopoesis, natural resistance

Conform concepiilor actuale tot mai mult se solicit ca producia de origine animal s fie
natural, ecologic i inofensiv (1,8,15).
n ultimii ani numeroase studii se ocup de elaborarea, testarea i implementarea n zootehnie
a stimulatorilor de cretere (3,11,12), ns ca alternativ la promotorii de cretere "clasici" poate fi
numai contientizarea avantajelor privind utilizarea noilor biotehnologii (4,7,12).
n acest context se lucreaz fructuos n Academia de tiine a Republicii Moldova, unde i a
fost obinut remediul BioR prin tehnologii originale,din biomasa algei cianofite Spirulina platensis
(12,14). Acest remediu a fost studiat multiaspectual pe porcine n condiii de complex (6,7), ns cu
siguran, nc nu s-a elucidat nici o intervenie a acestui produs asupra tineretului avicol.
Experimentul efectuat a urmrit influena remediului BioR administrat puilor-broileri n
diferite doze i regiuni asupra sntii i indicilor hematologici.
MATERIALe I METODe
Studiul s-a efectuat pe 4 loturi a cte 30 pui broileri de 2 zile n condiiile fabricii avicole
"Avicola aver" or. Bucov, R. Moldova, conform schemei redate n tabelul 1.

Loturile de
Pui
Experimental 1
Experimental 2
Experimental 3
Martor

Tabelul 1 Schema administrrii preparatului BioR puilor-broileri


Nr.
Doza, ml
Regimul
de
administrrii
1 dat
2 dat
pui
30
de 2 ori:
0,1
0,4
la a 2 i 21-a, iar
30
0,2
0,8
lotul experimental 0,15
30
0,6
3 i a 3-a dat
30
0,15 ml 0,9%
0,5 ml 0,9%
la a 34-a zi
sol. Na Cl
sol. Na Cl

3 dat

1,0 ml BioR

S-a recoltat snge pe anticoagulant, pentru efectuarea examenului hematologic de la


6 pui, la a 2-a zi pn la administrarea remediului BioR i la a 43-ea zi, prealabil sacrificrii,
de la cte 5 pui din fiecare lot.
Din sngele recoltat s-a determinat:

hemoglobina prin metoda hemoglobincianidic;


numrul de eritrocite i leucocite, prin numrarea direct la microscop n camera
Goreaev;
hematocritul prin metoda uzual (10);
formula leucocitar prin examinarea la microscop, cu obiectiv de imersie, a frotiului
de snge colorat prin metode uzuale (10).

REZULTATE I DISCUII
Pe parcursul experimentului, pe o perioad de peste 40 zile, remediul BioR testat pe pui, n
condiii de producie, nu a provocat reacii adverse sau alte abateri n sntatea psrilor. Reieind
din faptul c acest produs a fost pentru prima dat testat pe psri, i n special pe puii de carne, este
important i studiul indicilor hematologici de baz, care reflect att starea de sntate, ct i
schimbrile survenite n organism n urma interveniei unor factori nocivi, stimulatorii, etc. (5,6,9).
90

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Analiza rezultatelor redate n tabelul 2 atest tendina de cretere sau meninere la acelai
nivel cu vrsta a indicilor hematologici.
Tabelul 2 Valorile indicilor hematologici la puii broileri tratai cu remediul BioR
Loturile de animale
Pn la
Indicii
adminiExperiExperiExperistrarea BioR
mental-1
mental-2
mental-3
Hemoglobin, g/l
108,852,09
131,044,79
129,364,79
128,524,09
Eritrocite,
1012/l
2,800,12
4,070,05***
4,020,04***
3,950,06***
Leucocite,
109/l
43,530,50
29,090,40*** 26,140,58*** 25,890,41***
Hematocrit, %
35,002,00
42,01,06
43,01,37
37,20,96
Neutrofile, nucleu
2,330,23
2,00,35
1,60,27
2,00,0
bastonae,
%
Neutrofile, nucleu
39,670,97
27,81,43**
31,20,96*
25,61,04***
segmentat,
%
Bazofile,
%
2,500,24
2,40,27
2,40,27
2,60,27
Eozinofile, %
2,330,23
1,80,22
1,80,22
2,40,27
Limfocite,
%
44,500,84
58,42,15**
55,01,46*
60,01,41**
Monocite,
%
8,670,23
7,60,27
8,00,35
7,40,27
Nota: * p< 0.05; ** P < 0.01; *** < 0.001

Martor
118,446,01
2,860,07
41,720,21
39,61,82
2,40,27
36,01,46
2,60,27
2,40,27
48,22,07
8,40,45

Totodat la puii tratai cu BioR la a 43 zi, prealabil sacrificrii are loc o cretere semnificativ a
hemoglobinei i a eritrocitelor cu 8,5-10,6% i respectiv 38,1-42,3% fa de lotul martor. Remarcm
c valoarea hematocritului are aceiai tendin de manifestare ca i nivelul hemoglobinei i
eritrocitelor, rezultate ce mrturisesc despre influena pozitiv a remediului BioR asupra
hematopoezei, lucru ce se explic probabil i printr-o rezisten mai bun i un metabolism mai
intens la loturile experimentale. Astfel, influena benefic a produsului testat pe puii de carne s-a
evideniat i prin meninerea leucocitelor la un nivel mai mic cu 30,3-37,9%, fa de lotul de referin
(p<0,001).
Un ir de autori estimeaz c valorile leucocitelor, mai sczute la animalele clinic sntoase, n
cazul testrii unor remedii medicamentoase, stimulatorii sau a unor procedee tehnologice,
mrturisesc despre o rezisten natural mai mare (2, 6, 8, 16).
Un rol important n realizarea efectelor pozitive ale remediului studiat la nivel celular l pot
avea i modificrile formulei leucocitare. Studiile efectuate denot absena unor modificri profunde
ale formulei leucocitare sub influena remediului BioR. n paralel, valoarea neutrofilelor cu nucleul
segmentat la finele studiului prezint o diminuare la loturile experimentale cu 13,3-28,9% fa de
lotul martor. Mai mult ca att, numrul de bazofile s-a modificat analogic subpopulaiilor de
neutrofile, fapt ce mrturisete inofensivitatea preparatului testat asupra psrilor. n plus la puii
tratai cu BioR se atest o cretere a numrului de limfocite cu 14,1-24,5% n raport cu nivelul lotului
martor.
Remarcm faptul c preparatul BioR a contribuit esenial la creterea hemoglobinei i
eritrocitelor i s-a reflectat benefic asupra competenei imunologice a tineretului avicol, deoarece ea
este determinat i de numrul limfocitelor i monocitelor circulante n sngele periferic.
1.
2.
3.

4.

CONCLUZII
Preparatul BioR, obinut prin tehnologii moderne din Spirulina platensis, administrat puilor
broileri, are o toleran general i local foarte bun.
S-a dovedit experimental, n condiii de fabric avicol, c preparatul BioR administrat paranteral
de la a 2-a zi de via are efecte benefice asupra indicilor hematologici.
Preparatul BioR, administrat puilor broileri, are efecte benefice asupra rezistenei naturale
reflectate la finele studiului prin diminuarea numrului de leucocite i schimbri n formula
leucocitar (diminuarea neutrofilelor i creterea limfocitelor), care de asemenea mrturisesc
despre o mai bun adaptare i majorare a rezistenei nespecifice a organismului.
n urma administrrii succesive a preparatului BioR de 2 ori i respectiv de 3 ori, ncepnd cu a 2a zi de via n-au fost semnalate diferene palpabile n valorile parametrilor investigai.
91

5.

Universitatea de tiine Agricole i Medicin Veterinar


Studiul efectuat ne permite s propunem continuarea cercetrilor despre influena remediului
BioR asupra puilor broileri, n scopul optimizrii regimului i dozei de administrare.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.

9.
10.
11.
12.
13.
14.

15.
16.

Decun M., Stoia M. Legislaie pentru managementul calitii produselor de origine animal / Timioara: Ed.
Mitron, 1999. 272 p.
Erhan D., Pavaliuc P., Rusu S., Potenialul adaptativ i productiv al bovinelor la aciunea factorilor stresogeni.
Chiinu: Tipografia AM, 2007. 224 p.
Georgescu Gh., Temian V., Podar C., Velea C. Tratat de cretere a bovinelor / Bucureti: Ed. Ceres, 1995.
485 p.
Grosu T., Macari V., Gudumac V., Rudic V. Procde de stimulation de la productive des porcins // 45 Salon
Mondial de Linvention, de la recherche et linnovation industrielle. Bruxelles Eureka 96. 1996. P. 267.
Karputi I.M., Gematologhiceschii atlas seliscohozeastvennh juvothh. Mn.: Uradjai, 1986. 183 c.
Macari V. Aspecte fiziologo-metabolice ale aciunii preparatului BioR de origine algal asupra organismului
porcin / Autoreferatul tezei de doctor habilitat n tiine biologice. Chiinu, 2003. 49 p.
Macari V., Buza V., Gangal N., Balan I., Vrancean V., Donea V. Bazele zooveterinriei / Chiinu: Centrul ed. al
UASM, 2002. 188 p.
Macari V., Preobrajenski S. Influena carbonatului de litiu asupra rezistenei naturale la tineretul porcin // Al
XXII-lea simpozion Actualiti n patologia animalelor domestice // Luc. tiinifice. Cluj-Napoca: Ed. Sincron,
1997. P. 302-307.
Mattova J., Buleca J. The effect of age and breed on selected parameters of the hematological and
immunological profile of pigs // Czech. Journal of Anim. Sci., 1999. 44. P. 337-342.
Menicikov V.V. Laboratorne metod issledovania v kliniche / M. 1998. 364 s.
Pliacenko S.I., Sidorov V.T., Stress u seliscohozeastvennh jivotnh / M.: Agmopromizdat, 1987. 192 s.
Rudic V., Cojocari A., Cepoi L., Chiriac T., Rudi L., Gudumac V., Macari V., Codreanu S. .a. Ficobiotehnologie
cerectri fundamentale i realizri practice / Chiinu: Tipografia "Elena V.I. SRL), 2007. 365 p.
Rudic V., Gudumac V., Popovici M. Fotobiotehnologie realizri noi n biomedicin / Chiinu: Cuant, 1995.
207 p.
Rudic V., Macari V., Bureva S., Budanev V., Rastimeina I. .a. Tehnologii de obinere i testare a
biopreparatelor din microalge i streptomicete n Zootehnie // Catalog oficial. Expoziia Internaional
specializat Infoinvent-2002 (9-12 octombrie). Chiinu: Editura AGEPI, 2002. P. 53.
Sasson A. Biotehnologii i dezvoltare / Bucureti: Editura Tehnic, 1993. 304 p.
Scripnic Iu. Influena preparatelor enzimatice porzyme asupra unor indici sanguini la tineretul porcin // Luc. t.
V. 6 Zootehnie // Chiinu, 1998. P. 17-22.

92

Lucrri tiinifice vol. 51 seria Medicin Veterinar

THE -1 FUCOSYLTRANSFERASE GENE POLYMORPHISM IN


CORRELATION WITH THE SUSCEPTIBILITY OF SWINE TO
ESCHERICHIA COLI INFECTION
MANEA Maria Adina, KEVORKIAN Steliana, GEORGESCU S.E.,
DINISCHIOTU Anca, COSTACHE Marieta
University of Bucharest, Department of Biochemistry and Molecular Biology
Adhesion of F18 fimbriated Escherichia coli (ECF18) to small intestinal brush border
membranes causes edema diseases and post-weaning diarrhea in piglets. Susceptibility to
adhesion, meaning expression of receptors mediating the binding to the bacterial fimbriae F18
has been shown to be genetically controlled by the host. It was proposed two genes involved in
the adhesion of ECF18: -1, 2 fucosyltransferase genes (FUT1 and FUT2). In FUT1 gene were
evidenced two polymorphisms (guanine /adenine) at nucleotide 307 (M307) and 857 (M857)
which may play a role in the resistance/susceptibility. In our study we tried to evidence these two
polymorphisms in pigs (Synthetic Lines Peri). We found only M307GG (susceptible) and M857GG
genotypes. Results suggest that the genetic test will be useful in identifying pigs susceptible to
ECF18 colonization.

Escherichia coli (E.coli) is a common porcine enteric pathogen, causing diarrhea in new-born
and weaned pigs, and edema disease (ED) in pigs after weaning (Bertschinger, 1999; Fairbrother,
1999). These diseases are of considerable economic significance in the pig breeding industry, and
most breeding companies would prefer to eliminate genetically susceptible pigs from their herds, due
to their negative effect on health status.
An essential step in the pathogenesis of enteric colibacillosis is the fimbria-receptor
interaction facilitating colonization of the small intestine (Imberechts et al., 1992; Bertschinger,
1999). Colonization depends on adherence of the bacteria, which is mediated by bacterial fimbriae
F18 or F4 (Sellwood et al. 1974; Bertschinger et al.1990; Rippinger et al. 1995). Susceptibility to
adhesion, meaning expression of receptors mediating the binding to the bacterial fimbriae F18 has
been shown to be genetically controlled by the host and is inherited as a dominant trait (Bertschinger
et al. 1993).
The genetic locus for this E. coli F18 receptor (ECF18R) has been shown to be closely linked to
the blood group inhibitor S and mapped to porcine Chr 6 (SSC6) (Vgeli et al., 1996). The (1,2)fucosyltransferase genes (FUT1 and FUT2) genes products are involved in the formation of blood
group antigen structures present on cell membranes and both are expressed in the pig small
intestine. Meijering et al., (1997) evidenced two polymorphisms (guanine /adenine) at nucleotide 307
(M307) and 857 (M857) in the FUT1 ORF. The M307 polymorphism has been shown to be highly
correlated with the ECF18R genotypes, with genotypes M307AA representing resistance, and
genotypes M307GG and M307GA representing susceptibility to colonization. For the other
polymorphism, M857, the researchers failed to correlate it with ECF18R genotypes.
MATERIALS AND METHODS
We used blood samples from 40 pigs (Synthetic Lines Peri) (S.C. Romsuintest Peri),
preserved in EDTA anticoagulant. The isolation of genomic DNA from fresh blood was performed with
Wizard Genomic DNA Extraction Kit (Promega).
PCR was done using a GeneAmp 9700 PCR System (AppliedBiosystems). The reactions were
carried out in 25-l final volume containing PCR Buffer, MgCl2, and 200M dNTP, 0.5M of each
primer, 0.5 units of AmpliTaq Gold DNA Polymerase, diluted DNA and nuclease-free water. PCRs were
performed in 0.2 ml tubes using 40 cycles with denaturation at 95C (30s), annealing at 57C (30s)
and extension at 72C (60s). The first denaturation step was of 10 minutes at 95C and the last
extension was of 10 minutes at 72C.

93

Universitatea de tiine Agricole i Medicin Veterinar


Table 1: The sequence of the primers used
Locus
Primers Sequence
1-fucosyltransferase gene -M307
F: ctgtcacctccatagtggactc
R: aacgagtggtttccaaagttag
1-fucosyltransferase gene M857
F: cggaagaacatcgacacctc
R: cttcaggaagctggaagtgg

PCR products were detected by electrophoresis in 2% agarose gel stained with ethidium
bromide and then purification with the Wizard System Kit (Promega). The amplified fragments were
sequenced by ABI Prism 310 Genetic Analyzer, using the ABI Prism BigDye Terminator Cycle
Sequencing Reaction Kit. The sequences were processed using DNA Sequencing Analysis 5.1 Software
(AppliedBiosytems) and the nucleotide sequences were aligned with the BioEdit program and refined
manually.
RESULTS AND DISCUSSIONS
Our goal was to identify the presence of the two polymorphisms in FUT1 gene in order to
correlate them with resistance/susceptibility to E. coli colonization. In our study we found only the
M307GG which is the one of the susceptible genotypes and M857GG genotypes.

Figure 1: A partial sequence of the region from the PCR product that may contain the single point mutation for a
M307GG genotype.

Figure 2: BioEdit fragment alignment of a fragment from FUT 1 ORF and our PCR product for a M307GG
genotype.

The profile of the region of the PCR products that could contain the point mutation M307 is
shown in figure 1 and for M857 in figure 3. The BioEdit fragment alignment of the region of FUT1 ORF
and our PCR products is presented in figure 2, for M307 and in figure 4 for M857. The GA changes
at 307bp and 857bp which were described in the literature, result in a predicted amino acid
threonine (neutral-polar) instead of alanine (neutral-nonpolar), and glutamine (neutral-polar) instead
of an arginine (basic), respectively, and may have functional consequences.

Figure 3: A partial sequence of the region from the PCR product that may contain the single point mutation for a
M857GG genotype.

94

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Figure 4: BioEdit fragment alignment of a fragment from FUT 1 ORF and our PCR product for a M857GG
genotype.

CONCLUSIONS
The major focus of this study has been to identify the polymorphism in FUT1 gene in order to
correlate them with resistance/susceptibility to E. coli colonization in Romanian swine breeds.
Taking into account that the pigs that we have tested were from Synthetic Lines we identified
only the M307GG genotype which is considered one of the susceptible genotype.
The reason that we have not identify the M307AA genotype could be the result of the fact that
these Lines are obtained after crossbreeding between different swine breeds and therefore these
pigs tend to have an increase in the morpho-productive traits and a loss in resistance to different
diseases.
Results suggest that this genetic test will be useful in identifying pigs susceptible to ECF18
colonization and in excluding these animals for forward breeding programs.
BIBLIOGRAPHY
1.
2.

3.
4.
5.
6.

7.

8.
9.

Bertschinger HU (1999). Postweaning Escherichia coli diarrhea and edema disease. In: Straw, B.E., DAllaire,
S., Mengeling, W.L., Taylor, D.J. (Eds.), Diseases of Swine. Iowa State University Press, Ames, IA, pp.441-454.
Bertschinger HU, Bachmann M, Mettler C, Pospischil A, Schraner EM, Stamm M, Sydler T, Wild P (1990)
Adhesive fimbriae produced in vivo by Escherichia coli O139:K12(B):H1 associated with enterotoxaemia in pigs.
Vet Microbiol 25, 265281.
Bertschinger HU, Stamm M, Vogeli P (1993) Inheritance of resistance to oedema disease in the pig:
experiments with an Escherichia coli strain expressing fimbriae 107. Vet Microbiol 35, 7989
Fairbrother, J.M. (1999). Neonatal Escherichia coli diarrhea. In: Straw, B.E., DAllaire, S., Mengeling, W.L.,
Taylor, D.J. (Eds.), Diseases of Swine. Iowa State University Press, Ames, IA, pp.433-441.
Imberechts, H., de Greve, H., Lintermans, P., (1992). The pathogenesis of edema disease in pigs: a review.
Vet. Microbiol. 31, 221-233.
Meijerink E., Neuenschwander S., Fries R., Dinter A., Bertschinger HU, Stranzinger G. (1997). Two (1,2)
fucosyltransferase genes on porcine Chromosome 6q11 are closely linked to the blood group inhibitor (S) and
Escherichia coli F18 receptor (ECF18R) loci. Mamm. Genome 8, 736-741.
Rippinger P, Bertschinger HU, Imberechts H, Nagy B, Sorg I, Stamm M, Wild P, Wittig W (1995) Comparison of
recently described adhesive fimbriae of Escherichia coli isolated from postweaning diarrhea and from edema
disease: proposed designations F18ab and F18ac for the antigenic variants. Vet Microbiol 45, 281295.
Sellwood R, Gibbons RA, Jones GW, Rutter JM ,(1974) A possible basis for the breeding of pigs relatively
resistant to neonatal diarrhea. Vet. Rec. 95, 574575.
Vgeli, P., Bertschinger, H.U. Stamn M., Stricker C., Hagger C., Fries R., Rapacz J., Stranzinger G., (1996).
Genes specifying receptors for F18 fimbriated E. coli, causing edema disease and postweaning diarihea in pigs,
map to chromosome 6. Anim. Genet. 27, 321-328.

95

Universitatea de tiine Agricole i Medicin Veterinar

HISTOLOGICAL EVIDENCE FOR MIGRATION SPEED OF


SPIROXYS CONTORTUS LARVAE IN THE GASTRIC WALL OF THE
EUROPEAN POND TURTLE (EMYS ORBICULARIS)
MICLU V., MIHALCA A.D., DAMIAN A., OANA L., RUS V.
FMV Cluj-Napoca
Adults Spiroxys contortus nematodes are parasitic in the stomach of aquatic turtles
worldwide. Larval stages migrate seasonally through the stomach wall. Our paper presents the
results regarding the migration speed of these larval forms. Investigation was done in samples
from one adult male turtle, collected in july. The number of larvae was small in the lumen and
lesions were chronical. This is proof that migration took place some weeks before. Migration is
fast through the mucosa and slow through the other three stomach layers.
Key words: Spiroxys contortus larvae, migration speed, Emys orbicularis

Spyroxis contortus face parte din familia Gnathostomatidae i paraziteaz la nivel gastric i
intestinal la diferite specii de estoase acvatice (Baker, 1987; Ciudin i Burtan, 2002). Este ntlnit n
Europa de vest i fosta URSS, Tunisia, Cuba i America de Nord, ca parazit al mucoasei gastrice la
estoase: Chelydra serpentina, Chrysemys picta, Deirochelys reticularia, Emydoidea blandingii,
Graptemys geographica, Kinosternon subrubrum, Pseudemys scripta, Sternotherus odoratus,
Terrapene carolina i Trionyx spiniferus (Anderson, 2000), Apalone spinifera pallida (McAllister i col.,
1993) i Emys orbicularis (Edwards i col., 1974; Baker, 1987). n Romnia, prima semnalare i
aparine lui Rdulescu (1961). A mai fost semnalat ca parazit al stomacului, intestinului subire i
seroasei intestinale la Chrysemys picta marginata n SUA (Platt, 2000). Femelele depun ou aflate n
stadiu de morulare (1-2 celule). Ele evolueaz pe durata tranzitului intestinal, iar cnd sunt eliminate
prin fecale ajung la 4-16 celule. Ajunse n mediul exterior, n ap la 23-25C, eclozioneaz. Larvele
sunt ingerate de Cyclops albidus, Cyclops brevispinosus, Cyclops serrulatus i Mesocyclops leuckarti, n
hemocelul crora devin infestante. Prin consumul ciclopilor de ctre estoas, larvele sunt eliberate n
stomacul acesteia. n condiii naturale, prezena larvelor la nivel gastric este maxim primvara
(Rdulescu (1961; Mihalca i col. 2003).
Material i metode
Investigaia a fost efectuat la nceputul lunii iulie, pe un mascul, adult, de estoas european
(Emys orbicularis), provenit din mediu natural. ntreg stomacul a fost recoltat i pregtit pentru
investigaii histologice. Stomacul a fost mprit n mai multe fragmente, care au fost introduse
pentru fixare prin imersie n soluie Stieve pentru 24 de ore. Dup includere n parafin, piesele au
fost debitate n seciuni cu grosimea de 6 , iar seciunile au fost colorate dup metoda tricomic
Goldner (Gabe, 1968 ). Seciuni seriate, din fiecare pies prelucrat, au fost examinate la microscop
pentru evidenierea paraziilor i a leziunilor provocate de acetia.
Rezultate i discuii
n lumenul stomacului au fost evideniai parazii din categoria nematodelor, de la larve de
dimensiuni mici pn la aduli. Numrul larvelor nu era foarte mare, iar ca localizare, predominau la
nivelul corpului stomacului.
La nivelul mucoasei gastrice, leziunile datorate prezenei sau produse n cursul migrrii sunt
foarte discrete i prezente doar n unele zone, n care exist grupuri mici de celule afectate. Singurele
dovezi ale trecerii paraziilor prin mucoas sunt reprezentate de infiltrate celulare cu mononucleare i
eozinofile, mai ales n imediata vecintate a muscularei mucoasei, care prezint mici discontinuiti.
n puine locuri, infiltratul este dispus pe 80-90% din grosimea mucoasei i conine i cteva celule
gigante multinucleate.
Submucoasa apare mai reacionat dect mucoasa, fiind prezente infiltrate cu mononucleare,
mai pronunate perivascular, dar numai pe zone circumscrise. De asemenea sunt prezente
granuloame de dimensiuni mici, medii, mari sau grupuri de 2-4 granuloame. De remarcat tulburrile
vasculare reprezentate de congestie, edem i staz venoas, care sugereaz c paraziii, produii
96

Lucrri tiinifice vol. 51 seria Medicin Veterinar


secretai de acetia precum i compresia exercitat de granuloamele existente aici, ngreuneaz
vascularizaia unor zone, cel puin pentru o perioad de timp.
Musculara apare mai reacionat dect submucoasa. Apar i aici congestie, staz, edem
perivascular i interfibrilar, infiltrate celulare perivasculare sau interfibrilare, pe zone mici, mari sau
foarte mari. Sunt prezente granuloame mici, medii, mari i foarte mari, unele ocupnd mai mult de
jumtate grosimea muscularei Ele se afl n diferite stadii de organizare, n unele dintre ele mai
poate fi observat larva aflat n diferite stadii de degradare. n zonele cu infiltrat interfibrilar masiv
se constat proliferare de colagen, care tinde s umple golurile rezultate n urma proceselor de
mioliz care s-au derulat aici sub aciunea paraziilor.
Seroasa este foarte reacionat, congestia, staza i edemul apar mai pronunate dect la
nivelul celorlalte componente. i granuloamele sunt mai multe aici dect n toate celelalte
componente la un loc. Se constat tulburri vasculare ce merg de la modificarea permeabilitii pn
la alterri structurale. Zona cea mai reacionat este originea ligamentelor gastrice care apare foarte
mult ngroat i cuprins de procese patologice ce par a fi n multe locuri, nc n plin derulare.
Infiltratele celulare sunt n unele cazuri impresionante. Exist granuloame aflate n plin proces de
organizare, cu resturi de larv n zona central, iar infiltratul ncepe s se organizeze sub form de
barier limfohistiocitar n zona periferic a granulomului. Reacia conjunctiv este deosebit aa
nct n unele locuri poriunea iniial a ligamentelor apare mai groas dect musculara i
submucoasa la un loc. Sunt prezente granuloame numeroase i foarte polimorfe, de la mici la mari i
foarte mari, sau chiar conglomerate de granuloame rezultate din alturarea granuloamelor
nvecinate. Ligamentele seroase apar reacionate pn la o distan relativ mare de la locul lor de
origine, dar amploarea modificrilor scade pe msur ce ele se ndeprteaz de stomac.
Numrul relativ mic al larvelor din lumenul stomacului sugereaz c noi nu am surprins
perioada cu infestaia cea mai masiv, dar leziunile din profunzimea peretelui gastric sugereaz c la
un anumit moment procesele de migrare larvar au fost destul de intense. Numrul mic al larvelor
din lumen i aspectul leziunilor din toate tunicile stomacului, care au n marea lor majoritate evoluie
cronic, demonstreaz c migraia masiv a avut loc ntr-o perioad anterioar momentului recoltrii
i anume cu cteva sptmni nainte. n felul acesta noi am surprins practic urmele trecerii larvelor
prin componentele peretelui gastric i reacia organismului la agresiunea parazitar. Dac apreciem
urmele migraiei larvare pe la nivelul tunicilor gastrice, constatm c procesul de migrare este diferit
de la o tunic la alta. Numrul mic de leziuni de la nivelul mucoasei i aspectul lor cu caracter
infiltrativ, fr tendin de organizare de granuloame tipice parazitare, demonstreaz c prin
mucoas larvele migreaz mai rapid dect prin oricare din celelalte tunici i n nici un caz nu
staioneaz la acest nivel. Un motiv al migraiei rapide ar putea fi existena la nivelul mucoasei a unor
condiii neprielnice dezvoltrii larvelor, ele grbindu-se s ajung n straturile care le ofer condiii
avantajoase de hrnire i dezvoltare. n acest context, leziunile produse de larvele n migrare nu
apuc s se cronicizeze, repararea lor derulndu-se rapid cu refacerea structural a mucoasei, fr s
rmn sechele. n toate celelalte componente, pot fi evideniate leziuni cauzate de trecerea i
staionarea larvelor o anumit perioad, cu diferene de la o tunic la alta. Viteza de migrare este
sigur mai lent dect prin mucoas, prin toate celelalte tunici. Afirmaia este susinut de caracterul
cronic, sau cu tendin de cronicizare, al leziunilor evideniate n celelalte trei tunici. Organizarea de
granuloame i proliferrile conjunctive cu tendin de fibrozare zonal, au n cea mai mare parte
caracter ireversibil.
Amploarea diferit a modificrilor constatate la nivelul celor patru tunici ale stomacului se
datoreaz vitezei de migrare a larvelor prin fiecare dintre ele. Cu ct migraia larvelor este mai lent
cu att leziunile sunt mai pronunate, iar acolo unde stagneaz o perioad mai lung (seroas)
amploarea leziunilor este maxim.
Concluzii
Numrul relativ mic al larvelor din lumenul stomacului i caracterul cronic al leziunilor,
demonstreaz c migraia larvar masiv a avut loc cu cteva sptmni nainte de momentul
recoltrii.

97

Universitatea de tiine Agricole i Medicin Veterinar


Amploarea i caracterul leziunilor sunt n relaie direct cu viteza de migrare a larvelor prin
fiecare din cele patru tunici ale stomacului, ea fiind rapid prin mucoas i din ce n ce mai lent prin
celelalte trei tunici.

Fig. 1 Larve de Spyroxis contortus n lumenul


stomacului
(Col. Goldner, 10X)

Fig. 3 Granulom intramuscular cu resturi de larv


(Col. Goldner, 10X)

Bibliografie
1.
2.
3.
4.

5.
6.
7.

8.

9.

Fig. 2 Granulom n submucoas


(Col. Goldner, 10X)

Fig. 4 Granuloame n poriunea iniial


a ligamentului gastric (Col. Goldner, 4X)
nd

Anderson R.C. 2000- Nematode parasites of vertebrates: their development and transmission 2 ed., CABI
Publishing
Baker M.R. 1987- Synopsis of the nematoda parasitic in amphibians and reptile, Memorial University of
Newfoundland, Occasional Papers in Biology nr. 11
Ciudin, Elena, Burtan, LC. 2002- Broatele estoase biologie, cretere i patologie, Ed. Alfa, Iai
Edwards S.J., Kirby M.D., Crawley L.R., Rayburn J.D., Shaw J.H., Walker M.L. 1974- Index-catalogue of
Medical and Veterinary Zoology, Animal Parasitology Institute, Agricultural Research Service, U.S. Government
Printing Office, Washington
Gabe M. 1968- Techniques Histologiques, Ed. Masson et C-ie, Paris.
McAllister C.T., Goldberg S.R., Holshuh H.J. 1993- Spiroxys contorta (Nematoda: Spirurida) in gastric
granulomas of Apalone spinifera pallida (Reptilia: Testudines), J Wild Dis 29(3):509-511
Mihalca A.D., Gherman C., Achelriei D., Popescu P. 2003-Epidemiology of parasitic infections in Emys
orbicularis in Romania, 4th International Conference for PhD Students, University of Miskolc, Hungary, 11-17
August 2003, Natural Science Section, p. 75-79
Platt T.R. 2000- Helminth parasites of the western painted turtle, Chrysemys picta belii (Gray), including
Neopolystoma elizabethae n. sp. (Monogenea: Polystomatidae), a parasite of the conjunctival sac, J Parasitol
86(4):815-818
Rdulescu I. 1961- Contribuii la cunoaterea helminilor broatei estoase de ap Emys orbicularia L. din
R.P.R., Studii i cercetri biologice, seria biologie animal, 13:325-333

98

Lucrri tiinifice vol. 51 seria Medicin Veterinar

INFLUENA SUBSTANELOR AZOTATE ASUPRA UNOR


PARAMETRII BIOCHIMICI I METHEMOGLOBINEMIEI LA
OVINE
NITROGEN SUBSTANCES INFLUENCE ON SOME BIOCHEMICAL
PARAMETERS AND METHAEMOGLOBINAEMIA IN SHEEP
NEAGU Aritina, CRIVINEANU V., GORAN G.V.*, CODREANU M.D.
FMV Bucureti
The main goal of this study was monitoring the influence of nitrogen substances on some
blood biochemical parameters (total proteins, albumin, globulins, AST, GGT, carotene, vitamin A,
vitamin E) and methaemoglobinaemia in sheep, and also these substances levels in feed and
water samples.
Methaemoglobinaemia average values was proportionally to Lucerne level in feed (that
contained important levels of nitrates and nitrites), showing that clinical methaemoglobinaemia
status was dependent on animals age, the adults tolerating nitrogen substances levels three
times higher then new born lambs and youth.
These observations show that potential methaemoglobinizant substances intake and
pathological status are correlated, both by direct action and secondary by metabolic
disturbances.

Dezvoltarea, diversificarea i intensificarea chimizrii agriculturii n toate sectoarele ei,


imprima noi valene toxicologiei veterinare, presupunnd n acelai timp cunoaterea intima a aciunii
substanelor toxice, inclusiv a avantajelor i dezavantajelor consecutive acestora.
Diversificarea gamei de substane folosite n agricultur, presupune, de asemenea, o
permanent actualizare a cunotinelor privind utilizarea acestora.
Nerespectarea strict a tehnologiei de folosire i gama larg a substanelor medicamentoase,
pesticide i fertilizante, folosite n agricultur, medicin sau alte domenii, determin apariia unor
stri toxice la organismele vii, de importan i gravitate diferit i unele dintre acestea imprim o
stare de methemoglobinemie direct proporional cu cantitatea de substane ingerate.
Lucrarea de fata ncearc sa completeze datele de ordin toxicologic acumulate pana n prezent
cu aspecte privind methemoglobinemia i modificrile de ordin clinic i lezional n toxicoza indusa de
fertilizantele azotate la ovine.
MATERIAL I METODE
Surprinderea modificrilor de ordin clinic i biochimic induse de nitrai-nitrii, a fost realizat la
ovinele crescute n circumscripia sanitar-veterinar Roata, judeul Giurgiu, n perioada octombrie
2007-aprilie 2008. n perioada efecturii studiului, n cadrul circumscripiei, erau luate n eviden 563
ovine, din care 517 femele, majoritatea din rasa igaie, crescute n sistem gospodresc (iarna n
stabulaie, vara pe pune).
Alimentaia ovinelor a constat n fn (lucern), iar pentru echilibrarea raiilor s-au folosit
concentrate i tre de gru, iar adparea animalelor s-a fcu cu apa din fntnile din gospodarii.
Pe toat perioada studiului, ovinele au fost urmrite din punct de vedere clinic, de la care s-au
recoltat probe de snge la anumite intervale de timp pentru determinri biochimice (proteine totale,
albumine, globuline, AST, GGT, caroten, vitamina A i vitamina E) i pentru dozarea methemoglobinei,
n acelai timp fiind urmrii i mieii rezultai. De asemenea, s-au recoltat probe de furaj din diferite
locuri (nutre concentrat, fn de lucern, tre) i ap, n vederea determinrii nivelurilor de nitrai i
nitrii din furaje i ap.
REZULTATE I DISCUII
n cadrul investigaiilor clinice efectuate la animalele adulte, ct i la mieii nou nscui, s-au
putut observa urmtoarele:
ovinele adulte prezentau, n general, o stare de ntreinere corespunztoare,
acompaniat, ns, de afeciuni ale ongloanelor i tulburri de natur reproductiv;
99

Universitatea de tiine Agricole i Medicin Veterinar


tulburri reproductive s-au constatat la 105 femele, induse de diferite stri de
infecunditate;
dintr-un numr total de 325 femele gestante s-au nregistrat 24 de avorturi i 45 de
ftri de miei neviabili. Numrul ftrilor de miei mori a fost redus, nregistrndu-se
doar dou cazuri.
frecvena mare a diareii neonatale i ale afeciunilor cilor respiratorii i ale
pulmonului au atins 30% (154 miei). La ftare, mieii erau, n general, subponderali i
cu rezistena sczut, contractnd uor boli intercurente respiratorii i digestive. n
cadrul acestei categorii, cei mai muli prezentau respiraie intens dispneic, refuzul
suptului, tent evident cianotic a mucoaselor, n special la nivelul gingivo-labial i
conjunctival i prezentau diaree neonatal, curmat ntr-un procent sczut prin
metodele curative, bazate pe o antibioterapie nejudicioas, realizat fr efectuarea
n prealabil a antibiogramei.
afeciunile inflamatorii digestive i respiratorii nregistrate au fost surprinse la
aproximativ 20% din mieii nou nscui, nregistrndu-se o repartiie de 5-8% n cazul
diareii neo- i perinatale i respectiv, 10-12%, n cazul afeciunilor respiratorii.
Afeciunile respiratorii mai frecvente ntlnite la tineret au fost n principal
reprezentate de laringo-traheite, bronhopneumonii i, n special, bronite, remediate,
n cea mai mare parte, prin mijloace curative bazate, aproape invariabil, pe terapia cu
antibiotice cu spectru larg.
Rezultatele privind determinrile nitrailor i nitriilor din ap i furaje, a methemoglobinemiei,
precum i a rezultatelor determinrilor privind parametrii biochimici sangvini sunt prezentate n
tabelele nr. 1-5 i n fig. 1.
Tabelul nr. 1 Nivelul nitrailor i nitriilor n probele de furaje i ap
Produs/parametru
Nivel nitrii (mg %)
Nivel nitrai (mg %)
Nutre concentrat
0,19
Tre de gru
0,14
Fn lucern
2,94
35
Proba apa 1
0,15
Proba apa 2
0,17
Proba apa 3
0,20
-

Valorile nitriilor n ap au fost relativ reduse, media fiind de 0,17 mg%.


n ceea ce privete concentraia nitrailor n ap, nivelurile lor nu au fost decelabile. Trebuie
menionat faptul c, n momentul prelevrii probelor de ap, fertilizrile pe terenurile din
mprejurimile puurilor fusese terminat cu patru luni nainte, ceea ce explic, ntr-o oarecare
msur, valorile att de mici nregistrate.
n ceea ce privete valorile nitriilor i nitrailor din furaje, se poate constata c nivelul cel mai
ridicat a fost nregistrat n fnul de lucern (35 mg %), iar nivelul nitriilor a fost de 2,94 mg %, care
alturi de nitriii din ap i din restul furajelor care intr n componena raiilor, au putut atinge valori
periculoase, capabile s induc stri de toxicoz subclinic sau clinic la animale.
De consemnat este faptul c, lucerna pentru fn a fost recoltat i n stadiul de plant tnr,
care a beneficiat de un regim pluviometric mai bogat n perioada de primvar, suprapunndu-se i
cu fertilizrile care s-au fcut n aceast perioad.
Concentraiile cele mai mici s-au nregistrat n trele de gru i nutreul concentrat (0,14 i
respectiv, 0,19 mg %).
Determinarea valorii methemoglobinei s-a realizat pe patru loturi reprezentate de:
Lotul A:
Lotul B:
Lotul C:
Lotul D:

100

Miei n vrsta de 1-7 zile


Ovine adulte
Tineret
Ovine n lactaie

Methemoglobi
n (%)

Lucrri tiinifice vol. 51 seria Medicin Veterinar


2,59

2,35

2,5
2

1,54
1,19

1,5
1
0,5
0
Lotul A

Lotul B

Lotul C

Lotul D

Fig. 1. Valorile medii ale methemoglobinei pe loturi de ovine

Aa cum se observ n Fig. 1, nivelul maxim pe lot este atins de lotul B, format din ovine adulte
(2,59), n a cror raie, cea mai mare pondere a avut-o fnul de lucern, alturi de nutreul
concentrat, care conine 0,19 mg% nitrii.
n ordine descresctoare, ca valoare a methemoglobinei se afl categoria de tineret - lotul C,
cu un nivel de 2,25, care, de asemenea, a beneficiat de o cantitate substanial de lucern. Urmeaz
lotul D (ovine n lactaie), iar lotul A, format din miei cu vrsta de 1-7 zile i care nu consum furaje au
un nivel al methemoglobinei de 1,1%, adic aproape de trei ori mai puin dect lotul B, care este
reprezentat de mamele lor.
Mieii nou nscui sunt cei mai sensibili, dei valorile methemoglobinei sunt moderate, indicnd
tulburri ale oxigenrii tisulare, manifestate prin cianoza mucoaselor aparente.
Odat cu naintarea n vrst, sensibilitatea la hipoxie scade, astfel nct, la ovinele din lotul B,
la care s-a constatat concentraia maxim de methemoglobin, simptomele sunt aproape absente.
Analiznd valorile rezultatelor examenului biochimic sangvin, se poate observa corelaia dintre
valorile methemoglobinei i evidenierea hipoalbuminemiei (1,45 g/dl), hipovitaminozei A i E (3,5
g/dl) i o cretere important a Gt-ului (110 UI). Prezena hipovitaminozelor A i E este ilustrat prin
apariia diareilor neonatale, iar hipoxia s-a manifestat prin cianoza mucoaselor aparente, n special a
gingiilor, precum i prin dispnee accentuat la miei.
La lotul B, hipoproteinemia (6,67 g/dl) i hipoalbuminemia (1,9 g/dl) arat o posibil disfuncie
hepatic. La aceast categorie de animale, carenele vitaminice s-au exprimat clinic prin retenii
placentare i endometrite puerperale. Deficiena vitaminei A, care rspunde de troficitatea epiteliilor,
a condus la slbirea rezistenei local i a permis grefarea germenilor oportuniti.
Nr.
crt
1
2
3
4
5
6

Tabelul nr. 2 Valorile parametrilor biochimici investigai la miei de 1-7 zile (Lotul A)
Proteine
Albumine
Globuline
AST
GT
caroten Vitamina A
total g/dl
g/dl
g/dl
g/dl
UI
/L
/dl
4,81
1,41
4,61
33
51
84
32
6,50
1,74
4,58
35
130
72
29
6,02
1,41
4,67
25
110
46
37
5,77
1,38
4,56
31
90
50
22
7,13
1,28
4,63
39
123
89
18
6,80
1,25
4,60
37
110
78
20

Vitamina E
UI
3,07
3,52
3,85
3,48
3,97
3,67

Nr.
crt
1
2
3
4
5
6

Tabelul nr. 3 Valorile parametrilor biochimici investigai la ovinele adulte (Lotul B)


GT
caroten Vitamina A
Proteine
Albumine
Globuline
AST
total g/dl
g/dl
g/dl
g/dl
UI
/L
/dl
6,63
2,16
4,92
29
25
72
31
5,80
1,95
4,43
47
32
89
27
7,13
1,56
5,01
51
34
64
18
6,71
2,08
4,38
63
27
38
36
7,11
1,76
4,83
54,4
33
45
29
6,67
1,90
4,76
48
29
63,9
32,7

Vitamina E
UI
5,10
5,40
4,70
3,80
4,10
4,60

101

Universitatea de tiine Agricole i Medicin Veterinar


Nr.
crt
1
2
3
4
5
6

Proteine
total g/dl
7,88
7,30
7,24
7,75
7,53
7,54

Tabelul nr. 4 Valorile parametrilor biochimici investigai la tineret (Lotul C)


Albumine
Globuline
AST
GT
caroten Vitamina A
g/dl
g/dl
g/dl
UI
/L
/dl
2,06
4,93
67
26
340
36
2,66
4,43
55
32
414
34
2,22
5,01
33
34
357
29
2,00
4,38
41
27
318
31
2,74
4,83
66
27
411
35
2,33
4,61
54
28
366
33,6

Vitamina E
UI
5,77
5,45
5,86
5,62
5,65
5,70

La lotul C se observ hipoproteinemia, hipoalbuminemia, precum i hipovitaminoza A i E.


Acestea se rsfrng asupra animalelor, predispunndu-le la complexul bolilor respiratorii, precum i
apariia gastroenteritelor cu evoluia insidioas.
In tabelul ce monitorizeaz parametrii sangvini ai oilor n lactaie abaterile pstreaz aceeai
caracteristic: hipoproteinemie, hipoalbuminemie i hipovitaminoz A i E. Acestea pot explica
prezena pododermatitelor septice, vaginitelor i endometritelor cronice.
Nr.
crt
1
2
3
4
5
6
1.

2.
3.

4.

Tabelul nr. 5 Valorile parametrilor biochimici investigai la ovine n lactaie (Lotul D)


Proteine
Albumine
Globuline
AST
GT
caroten Vitamina A
total g/dl
g/dl
g/dl
g/dl
UI
/L
/dl
7,58
2,07
4,93
35
39
235
23,0
7,14
2,01
4,43
55
32
252
24,0
5,59
1,69
5,01
28
34
246
23,0
6,67
1,73
4,38
45
27
218
22,0
6,41
2,09
4,83
36
90
239
23,0
6,37
1,91
4,35
39
47,3
243
23,8

Vitamina E
UI
5,69
5,83
6,06
4,97
5,20
5,90

CONCLUZII
Media valorilor methemoglobinemiei este direct proporional cu cantitatea de lucern (care
coninea o cantitate apreciabil de nitrai i nitrii), care intr n componena raiei animalelor. Se
constat c, dei mieii au o methemoglobinemie de trei ori mai mic dect ovinele adulte,
manifest o sensibilitate deosebit, exprimnd semne evidente de hipoxie tisular, manifestat
prin cianoz la nivelul mucoaselor aparente. Se dovedete astfel, c vrsta influeneaz
manifestarea clinic a strii de methemoglobinemie, adultele tolernd nivele de trei ori mai mari
dect nou nscuii i tineretul;
Determinarea methemoglobinemiei poate constitui un element de diagnostic, pentru toate
categoriile de ovine, indiferent de vrsta i starea fiziologic;
Toate aceste rezultate i observaii scot n eviden existena unei corelaii ntre aportul de
substane potenial methemoglobinizante i strile patologice prezente n efective, att prin
aciunea lor direct, ct i secundar, prin tulburri metabolice.
Rezultatele pun n eviden necesitatea, meninerii sub control strict a concentraiilor nitrailor i
nitriilor din ap i hran, att prin controale periodice, ct i prin respectarea msurilor
profilactice.
BIBLIOGRAFIE

1. Codreanu M.D.,Manolescu N., Adriana Oranu, Iuliana Codreanu - Ultrastructural changes induced by sodium
th
th
th
nitrite n sheep. 5 ESVCN Conference, 13 14 September- 2001, Sursee, Switzerland.
2. Codreanu, M.D. Contribuii la farmacotoxicologia unor substane methemoglobinizante implicate n patologia
ovinelor, Tez de doctorat, Bucureti, 2 iulie, 1999.
3. Crivineanu V. Goran G.V. Toxicologie veterinar, Editura Printech, Bucureti, 2004
4. Goran G.V., Crivineanu V., M.D. Codreanu A study about induced methaemoglobinaemia by copper based
products n sheep, Buletinul USAMV Cluj-Napoca, Seria Medicin Veterinar, volumul 62/2005 (-), ISSN 14542382
5. G.V. Goran, M.D. Codreanu, V.Crivineanu, Manuella Militaru, Iuliana Codreanu, Emilia Ciobotaru Modificri
histopatologice i electronomicroscopice induse de nitratul de sodiu n experiment acut i cronic la oaie, 2006,

Lucrri tiinifice Medicin Veterinar Iai, Vol. 49, ISSN 1457-7406


6. Osweiller, G.D. Toxicology, The National Veterinary Medical Series for Independent Study, Williams and
Wilkins, 93, Iowa, USA.

102

Lucrri tiinifice vol. 51 seria Medicin Veterinar

EVOLUIA SNTII MAMARE LA VACI I A PARAMETRILOR


IGENICO SANITARI AI LAPTELUI PRODUS I PROCESAT PE
FILIERA CU CIRCUIT INCHIS A SOCIETII SANLACTA
EVOLUTION OF COW MAMMARY HEALTH AND THE HYGIENIC AND
SANITARY PARAMETERS OF PRODUCED AND PROCESSED MILK ON THE
CLOSED CHAIN PRODUCTION FLOW OF THE SANLACTA COMPANY
OGNEAN L., CERNEA Cristina, CERNEA M.
FMV Cluj-Napoca
The increase in food safety and security as well as the traceability of dairy products necessary
for the integration in the processing flow and consumer usage, lead to the formation of a real
dairy chain of exploitation. The objectives of this study done at the Sanlacta company regard
supervising mammary health in the dairy cow population in correlation to the safety and security
of the produced dairy products. Following comparatively the results obtained from a closed circuit
chain of production and the traditional system, based on routes and collection centers. For this
purpose we monitored a period, between 2006-2007, the comparative evolution of the results
from the mammary health supervising programs in the farms and the auto-control tests, done on
processing milk samples and the final product.
The overall statistical values of the registered data showed an increased level of cellular and
microbial content in the milk collected by the Sanlacta company, the trust ratio in the suitable
category being of 56,3% for NTG and of 74,2% for NCS. The individual tests done in the farms
integrated in the closed production chain showed much lower average values in the
microbiological and cytological parameters (77.000 -85.500 for NTG and 37.400 - 48.700 for NCS),
associated with a lower level of mammary infection in the population (5-10%). According to the
obtained data the milk collected by the Sanlacta company comes from two sources, regarding the
level of trust of the European standards. One unreliable or with an inconstant degree of
suitability (collection centers supplying processing milk for the Sanlacta company) and a reliable
with a constant degree of suitability (Sanlactas own farms integrated in the closed circuit
production chain).
Key words: milk production chain, processing milk, dairy products, standards of suitability

Creterea nivelului de siguran, securitate alimentar i trasabilitate a produselor lactate


necesit integrarea fluxurilor de producere, procesare i valorificare, conturnd o adevrat filier a
laptelui. Organizarea acestor forme manageriale complexe prevd i implementarea unor sisteme
funcionale de supraveghere a sntii pe fluxul animal-produs lactat- consumator. Majoritatea
cercettorilor n domeniu recomand monitorizarea automat a strii de sntate prin integrarea n
astfel de filiere a unor sisteme bazate pe monitorizarea coninutului celular sau conductibilitii
electrice a laptelui (Carey, 2001; Farnworth, 1993 ; Harmon, 1994; Ognean i col. 2003, Nielen i col.,
1995 ). Privind gradul de ncadrare n standardele europene, laptele produs n ara noastr poate
proveni din surse, n general, nencadrabile sau cu grad inconstant de conformitate i surse
ncadrabile n categoria laptele conform.
MATERIALE I METODE
Pentru supravegherea sntii mamare n efective de vaci i corelarea ei cu nivelul securitii
alimentare al produselor comercializate, au fost efectuate investigaii n dou ferme de vaci de lapte,
respectiv pe eantioane de lapte marf i produse lactate testate n cadrul programelui de
autocontrol al Societii Sanlacta, n perioada 2006 - 2007. Cele mai mari cantiti de lapte marf
recepionate de aceast societate nu se ncadreaz nc n standardele europene, avnd ca
provenien centrele tradiionale de colectare. Sanlacta a nfiinat ns i o filier cu circuit nchis,
integrnd 2 ferme care produc lapte ncadrabil n normele de conformitate (laptele conform).
Societatea Sanlacta se aprovizioneaz din 12 centre de colectare, care asigur procesarea a
70. 000 l lapte/zi i comercializarea a 31 de produse lactate. Securitatea i sigurana alimentar a
acestor produse este conferit de implementarea unor sisteme de mare actualitate (HACCP
reglementat prin Codex Alimentarius i EN ISO 9001: 2000).
103

Universitatea de tiine Agricole i Medicin Veterinar


Unul dintre centrele de colectare aparine societii Sanagra, situate n zona Trnavelor, i este
parte component a filierei Sanlacta de producere, procesare i valorificare a laptelui, realiznd un
circuit nchis de funcionare.
Fermele acestei filiere (Seuca i Botorca) grupeaz 400 de vaci: 331 din rasa Blat
Romneasc (BR) i 69 din rasa Holstein Friz (HF). n aceste ferme, structura de baz a raiei furajere
a fost constituit din furaj unic pe baz de semifn i concentrate, iar nivelul mediu al produciei de
lapte/vac muls a fost de 6500 litri pentru rasa BR, respectiv de 6700 litri pentru rasa HF. Cele 2
ferme sunt construite i utilate dup modele europene, incluznd: adposturi tip stabulaie liber cu
perei sandwich, cuete individuale pe aternut permanent din paie i alee central pentru furajare;
sisteme naturale de ventilaie i iluminare; dou sli centralizate de muls tip Stranco (cu platforme
brdule 2 x 20), echipate cu sisteme automate deosebit de performante i cu asistare
computerizat; utilaje tehnologice de ultim generaie; microlaborator pentru controlul laptelui;
materniti i cree pentru viei; cabinet veterinar; izolator pentru animalele bolnave cu instalaii
separate pentru mulsul vacilor cu mamite (IMB-3); vestiare i alte anexe.
Ca elemente de baz ale tehnologiei de cretere i de supraveghere a strii de sntate se
disting: lotizarea vacilor n funcie de stadiul lactaiei i starea fiziologic, rezultnd vaci n prima, a
doua i a treia sut de zile de lactaie, vaci nrcate i vaci periparturiente (ultima sptmn de
gestaie i primele dou de lactaie); mulsul n sli centralizate fr administrarea concomitent de
concentrate i pe un fond muzical; nrcarea brusc, bazat pe diet alb timp de 24 ore nainte de
ultimul muls; tratamentul de nrcare, constnd n infuzarea intramamar de suspensii cu antibiotice
retard i obstruarea canalului mamelonar cu un dezinfectant tip gel.
Tehnologia de muls a inclus urmtoarea succesiune: ndeprtarea primelor jeturi n vasul
special i examenul lor prin contrast pe fond negru; masajul mamar asociat cu igienizarea i
dezinfecia mamelei (cu lavete individuale mbibate n dezinfectant); ataarea aparatelor i
supravegherea derulrii mulsului, urmrind pe monitoarele individuale datele privind evoluia
produciei de lapte, conductibilitii electrice a laptelui (mS), cldurilor i nrcrii; detectarea
sfritului de muls i detaarea automat a aparatulului; imersarea mameloanelor n soluia
dezinfectant care formeaz o pelicul protectoare. n cursul mulsului, laptele se acumuleaz ntr-un
tanc de colectare, cu capacitate de 10.000 litri i programare automat n privina omogenizrii, rcirii
la 4oC, splrii i dezinfeciei ntregului sistem colector.
Pentru depistarea vacilor cu mamite, am utilizat datele oferite de sistemul de muls Stranco,
bazate pe monitorizarea computerizat a evoluiei conductibilitii electrice a laptelui, cu
semnalizarea automat a mamitelor, cldurilor i datei nrcrii. La cea mai mic incertitudine am
recurs i la examenul pe sferturi, utiliznd testul de Contrast i R-Mastitest (Ognean i col, 2002;
Rotaru i Ognean, 1998.). Am recurs, de asemenea, la identificarea lunar a mamitelor subclinice cu
detectorul Waikato.
Tratamentul mamitelor n cursul lactaiei s-a bazat pe suspensii de antibiotice aplicate
intramamar (Mastiject, Sinulox), iar mulsul separat s-a continuat timp de 6 zile dup ultimul
tratament. Conform strategiilor implementate pentru supravegherea sntii animalelor i
produselor obinute, au fost evaluai periodic (n microlaboratoarele fermelor cu aparatur tip
Ecomilk) principalii parametrii cantitativi i calitativi ai laptelui individual (grsime, protein, SU,
densitate, punct crioscopic, aciditate titrabil), precum i nivelul corpilor cetonici (cu benzi de tip
Ketostiks).

Evoluia efectivelor n cursul anului 2006, a conturat succesiunea a 4 loturi de vaci


lactante, difereniate pe baza stadiilor lactaiei i strii fiziologice.
Lotul 1, corespunztor primului stadiu de lactaie (prima sut de zile), a coninut n
medie 80 vaci/lun, numrul lor variind de la 60 la 100. Rezultatele depistrii mamitelor,
monitorizrilor automate din timpul mulsului i examenelor clinice efectuate la vacile din
acest lot au fost predominant negative, dei ele au trecut prin stri fiziologice critice n
aceast perioad (puerperium, estrus i gestaie timpurie).
Lotul 2, a inclus vacile aflate n al doilea stadiu de lactaie (a doua sut de zile), media
lunar (78) i fluctuaiile numerice (55- 93) fiind asemntoare cu ale primului lot. n cursul
104

Lucrri tiinifice vol. 51 seria Medicin Veterinar

acestui stadiu, la majoritatea vacilor a fost confirmat gestaia, proporia celor care au
repetat cldurile fiind de doar 12%.
Lotul 3, alctuit din vaci n al treilea stadiu de lactaie (a treia sut de zile), a prezentat
o evoluie numeric corelat cu a primelor 2 loturi (56-95 vaci), avnd media lunar de 76
de vaci. Odat cu trecerea n acest stagiu, majoritatea vacilor au intrat n a doua perioad de
gestaie, la sfritul creia a urmat nrcarea. Cu toate c riscul de mamit se menine
ridicat la sfritul de lactaie, practicarea unei metode sigure de nrcare a redus la
minimum frecvena infeciilor mamare n acest stadiu.
Lotul 4, format din vacile periparturiente (perioada de maternitate o sptmn
antepartum i dou postpartum), al cror numr a prezentat variaii largi de la o lun la alta
(58-98) cu o medie de 75/lun. Asigurarea de standarde tehnologice i igienico-sanitare
ridicate a redus semnificativ frecvena mamitelor n aceast perioad deosebit de critic
pentru vacile lactante nalt productive.
Probele de lapte individual, lapte marf i produse lactate finite au fost recoltate
conform standardelor actuale, iar testrile au fost efectuate imediat dup recoltare, fr ca
probele s necesite conservare (Ognean, 2002; Rotaru, 2006). Au fost utilizate metode
automate pentru numrarea celulelor din lapte (cu sistemele de tip SomaScoper MKII i
Fossomatic) i metode standardizate pentru investigaiile microbiologice (Rotaru, 2006).
Pentru efectuarea testelor de supraveghere a sntii mamare la vaci i a siguranei
produselor procesate, societatea Sanlacta a apeleat i la serviciile unor laboratoare
specializate, cu care realizeaz un program de autocontrol viznd indicii citologici i
microbiologici de baz, respectiv principali parametrii compoziionali ai produselor
comercializate.
REZULTATE I DISCUII
Valorile parametrilor fizico-chimici ai laptelui colectat de Sanlacta au variat de la o rut la alta,
fiind foarte puine eantioanele de lapte care nu s-au ncadrat n standardele admise. n aceast
privin sunt relevante urmtoarele valori medii nregistrate la verificarea unei cantiti totale de
11,8317 litri lapte: grsime 3,6%, aciditate 16,8 0T, temperatur 5,7 0C, densitate 1,0269, grad de
impurificare 1,8. Cumularea i analiza valorilor nregistrate la aceti parametrii arat c, laptele
colectat de societatea Sanlacta se ncadreaz n limitele normale n privina marilor componenii, iar
variaiile nesemnificative privind temperatura la colectare i gradul de impurificare permit procesarea
lui.
Spre deosebire, evoluia parametrilor igienico-sanitari ai laptelui ca materie prim a prezentat
diferene eseniale n cadrul celor dou categorii de surse, fr a fi influenate de rasa sau lotul de
vaci. Astfel, n cazul filierei cu circuit nchis, la investigarea unui lot de vaci din rasa BR (n=22), n plin
lactaie (cu producie medie de 20,7 litri lapte pe zi) au fost nregistrate valori de 85.5 x 103/ml pentru
NTG i 48.7 x 103/ml pentru NCS. Evoluia comparativ a acelorai parametrii la un lot de vaci
primipare HF (n=18), aflate n plin lactaie (cu producie medie de 33 litri lapte pe zi), a indicat valori
apropiate: 77 x 103/ml pentru NTG i 37.4 x 103/ml pentru NCS.
Analizat comparativ, evoluia parametrilor microbiologici i citologici testai la cele dou
loturi de vaci indic nivele foarte sczute ale NTG i NCS (fig. 1 A i B), confirmnd condiiile deosebite
de igien, ntreinere i furajare asigurate n cele dou ferme, precum i eficiena sistemului Stranco
implementat, respectiv a programului de supraveghere computerizat. Valoarea deosebit a acestui
program a fost asigurat de semnalizarea automat a produciei de lapte, mamitelor, cldurilor i
momentului nrcrii. Valoarea filierei cu circuit nchis implementate, este dat i de nivelul tehnic
deosebit al aparaturii i echipamentelor utilizate pentru colectarea centralizat i rcirea laptelui
muls, analiza sumar la nivel de ferm, splarea i dezinfecia instalaiei de muls i colectare a
laptelui.

105

Universitatea de tiine Agricole i Medicin Veterinar


A

B
NTG = 37,4
x103/ml

NTCL =
77 x103/ml

NTCL =
85,5 x103/ml

Baltata Romaneasca - productie medie de lapte = 20,7 l/zi


Holstein Friza - productie medie de lapte = 33 l/zi

NTG = 48,7
x103/ml

Baltata Romaneasca - productie medie de lapte = 20,7 l/zi


Holstein Friza - productie medie de lapte = 33 l/zi

Fig. 1. Valorile medii ale numrului total de celule din lapte (cel./ml)
(A) i numrului total de germeni (germeni/ml) (B) la dou loturi de vaci investigate.

Frecvena mamitelor n efectivele celor dou ferme investigate s-a meninut la cote sczute
att n cursul anului 2004 (10%), ct i al anilor 2005-2006 (5%), numrul vacilor reformate datorit
mamitelor fiind de asemenea redus (una la 3-4 luni). Nivelul infeciei mamare n efectiv a prezentat
mici variaii legate de stadiul lactaiei. Astfel, n cursul anului 2006 n prima sut de zile de lactaie, au
fost diagnosticate cu mamite 16 vaci (4%), dintre care 9 cu forme subclinice i 7 cu forme clinice. n al
doilea stadiu de lactaie numrul vacilor cu mamit a sczut la 9 (2,2%), iar n al treilea i al patrulea la
5 (1,2%), proporia dintre cele dou forme de mamit fiind aproape egal. Pe tot parcursul anului
doar la 4 vaci (1%) au fost diagnosticate mamite n perioada colostral, toate fiind clinice i cu
caracter hemoragic, pus pe seama permeabilitii crescute a structurilor lactifere dup ftare,
asociat n 2 cazuri i cu traumatisme mamare. Trebuie menionat totodat c, nici una dintre vacile
cu infecii mamare nu au prezentat modificri ale strii generale, dei la unele au evoluat infecii
mamare clinice.
Reducerea frecvenei mamitelor de la 10%, ct era n 2004, la 5% n 2006 i 2007, confirm
eficiena programului complex de supraveghere a sntii mamare i a msurilor implementate n
depistarea i combaterea mamitelor n efectiv. Importan deosebit a revenit n aceast privin
testrii periodice individuale a unor parametrii igienico-sanitari (NCS i NTG), dezinfeciei
mameloanelor dup muls, tratamentului la nrcare i reformrii vacilor cu mamite cronice
recidivante.
Analiza de fa se refer n principal, la datele i valorile nregistrate la testele de autocontrol,
confirmate ns n bun parte de rezultatele controalelor oficiale efectuate de ctre Direcia Sanitar
Veterinar Mure. n aceast privin, relevan deosebit trebuie atribuit ncadrrii n standardele
admise la principalii indici microbiologici: NTG, cu variaii de la 2.400 n cazul laptelui de consum 3,5%
la 22. x 103/ml n cazul laptelui de consum 1,8%; nivelul bacteriilor coliforme, cuprins ntre 0 i 100 i
al E.coli, variind ntre 0 i 10.
O imagine de ansamblu asupra gradului de ncadrare n clasele de conformitate a laptelui crud
colectat de Sanlacta este conturat de reprezentarea grafic a valorilor la principali parametrii testai
n cadrul programului de autocontrol (punct crioscopic, grad de impurificare, NTG i NTCL) (fig. 2 i 3).
Conform acestor date, laptele preluat din centrele de colectare, grupate n 3 surse (fermele Sanagra,
centrele de colectare i rutele de recepie), este ncadrat n categoria conform sau neconform pentru
fiecare dintre parametrii urmrii. Astfel, ncadrarea n categoria conform pentru punctul crioscopic i
gradul de impurificare, pe un numr total de 20.336 probe, a atins nivele foarte ridicate: 99,67%,
respectiv 100% (fig. 2 A i B). Aceast evoluie arat c n pofida drumurilor precare i prelungirii
timpului de colectare, datorit numrului mare de puncte de colectare de pe majoritatea rutelor, au
fost respectate cerinele privind rcirea i durata de transport a laptelui.
106

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Spre deosebire, nivelul de ncadrare n standardele de conformitate la cei doi parametrii igienico-sanitari de baz
(NTG i NCS), a prezentat variaii semnificative n funcie de proveniena laptelui. Aa cum reiese din graficele
(fig. 3 A i B), laptele colectat din fermele Sanagra, s-a ncadrat n categoria conform n proporie de 95,3%
pentru NTG i de 95% pentru NCS. Spre deosebire, n cazul celorlalte dou surse asistm la o scdere
considerabil a gradului de conformitate. Astfel, ncadrarea n categoria conform pentru NTG este doar de 30,3%
n cazul a 85 eantioane de lapte colectat de pe rute i de 43,4% n cazul a 77 eantioane de lapte provenit din
centrele de colectare, iar pentru NCS (pe 38, respectiv, 52 eantioane) de 54,2% respectiv 73,3% (fig. 3 A i B).
Mai relevant este ns, situaia rezultat prin prelucrarea datelor pe cele 3 surse nsumnd 212 probe (fig. 3 A i
B), care arat c 56,3% din probele de lapte investigate s-au ncadrat n categoria conform pentru NTG i 74,2%
pentru NTCL (n=131).
A
B
conform
99,68

99,37

99,96

conform

neconform

99,67

100

100

100

100

100

neconform

100

90
90

80
80

70

70

60

60

% 50

50

40

40

30

30

20

20

0,32

0,63

0,04

0,33

Ferme (n=10.452)

Centre de
colectare (n=7.465)

Rute recepie n

TOTAL (n=20.336)

unitate (n=2.419)

10

10
0

Ferme (n=10.452) Centre de colectare


(n=7.465)

Rute recepie n

TOTAL (n=20.336)

unitate (n=2.419)

PUNCT CRIOSCOPIC

GRAD DE IMPURIFICARE

Fig. 2. Nivelul de ncadrare n standardele de conformitate pentru punctul crioscopic


(A) i gradul de impurificare (B) a laptelui colectat de societatea Sanlacta
A

B
conform

95,38

neconform

100

100

90

90

80

80

conform

95,00

73,34

neconform

74,21

70

70

56,60

56,60

56,37

54,28

60

60

43,40

% 50

45,72

43,63

43,40

% 50

40

40

30

30

20

25,79

26,66

20

4,62
10

10

5,00

0
Ferme (n=50)

Centre de colectare
(n=77)

Rute recepie n

TOTAL

Ferme (n=50)

unitate (n=85)

Centre de colectare
(n=77)

Rute recepie n

TOTAL

unitate (n=85)

NTG

NCS

Fig. 3. Nivelul de ncadrare n standardele de conformitate pentru NTG


(A) i NCS (B) a laptelui colectat de societatea Sanlacta

1.

2.

CONCLUZII
Valorile medii ale principalilor parametrii compoziionali i igenico-sanitari obinute de societatea
Sanlacta la testele de autocontrol, efectuate pe 11.8317 litri lapte, s-au ncadrat n limitele
admise pentru laptele crud colectat n vederea procesrii: grsime (3,6%), aciditate (16,8 0T),
densitate (1,0269), temperatur (5,7 0C), grad de impurificare (1,8), bacterii coliforme (0 -100) i
E.coli (0 -10).
n cazul fermelor integrate n filiera cu circuit nchis, testele individuale au relevat valori medii de
85.5 x 103/ml pentru NTG i de 48.7 x 103/ml pentru NCS la un lot de vaci BR cu producie de 20,7
litri lapte/zi, respectiv de 77.000 germeni/ml pentru NTG i de 37.400 cel/ml pentru NCS la un lot
de vaci primipare HFcu producie de 33 litri lapte/zi.
107

3.

4.

5.

Universitatea de tiine Agricole i Medicin Veterinar


Nivelul sczut i descresctor al infeciei mamare n efectiv, de la 10% n 2004 la 5% n 2006 2007, reflect eficiena programului utilizat n supravegherea sntii mamare, bazat pe
depistarea lunar a mamitelor (cu detectorul Waikato i prin testri periodice individuale ale
NCS i NTG), dezinfecia mameloanelor dup muls, tratamentul de nrcare i reformarea vacilor
cu mamite cronice recidivante.
n cursul anului 2006, evoluia de ansamblu a parametrilor testai n cadrul programul de
autocontrol al societii Sanlacta, a indicat nivele foarte ridicate de conformitate pentru punctul
crioscopic (99,67%) i gradul de impurificare (100%) la laptele colectat. Gradul de ncadrare n
conformitate la parametrii igienico-sanitari ai laptelui a prezentat n schimb variaii legate de
sursa de colectare, fiind net superior n cazul fermelor Sanagra (filierei cu circuit nchis) - 95,3%
pentru NTG i 95% pentru NCS, fa de cel recepionat de pe rute i centre de colectare -43,4 %
pentru NTG respectiv 54,28 - 73,34% pentru NCS.
Pe baza nivelului crescut al coninutului celular i microbian, laptele de amestec procesat de
societatea Sanlacta are un grad redus de ncadrare n categoria conform la cei 2 parametrii
igenico-sanitari, fiind situat doar la 56,3% pentru NTG i 74,2% pentru NCS.
BIBLIOGRAFIE

1. CAREY,NR. (2001) Identification and characterization of elevated microbial counts in bulk tank milk. J. Dairy
Sci. 84: 292 298.
2. FARNWORTH, RJ. (1993) Microbiologic examination of bulk tank milk. Vet. Cl. N. Am, Food An. Pract., 9: 469
474.
3. HARMON, R. D. and C. W.HEALD (1994) Psyology of mastitis and factors affecting somatic cell counts. J.
Dairy Sci. 77: 2103.
4. NIELEN, M., BRAND A., HARRING, S . (1995) Comparison of analysis technique for on line detection of
clinical mastitis. J. Dairy Sci. 78: 1050 1061.
5. OGNEAN L. (2002). Aspecte morfofiziologice caracteristice populaiilor celulare din lapte i particularitile
lactocitogramei. Rev. Rom. Med. Vet. Vol 12, nr. 1-2, 2.
6. OGNEAN L., I.GROZA, MARIA PRV, L., M.CENARIU, I.ILIE (2003). The variaton of electric conductivity of
milk in healthy and from mastitis suffering cows. Bul. USAMVCN nr. 60, ISSN 1454-2382, p. 118-12
7. QUINN, P. J., M. E. CARTER, B. MARKEY, G. R. CARTER (1994) Clinical Veternary Microbiology. M.Wolfe
8. ROTARU O., OGNEAN L.(1998) Morfologia i fiziologia populaiei celulare din lapte. Ed. Casa Crii de
tiin Cluj Napoca.
9. ROTARU O., MIHAIU M., (2006), SORIN DANIEL DAN (2006) Controlul sntii produselor de origine
animal. Ed. Risoprint cluj-Napoca.

108

Lucrri tiinifice vol. 51 seria Medicin Veterinar

THE EFFECT OF THE ZIZIPHUS JUJUBA EXTRACT ON THE SOME


ANTIOXIDANT ENZYMESACTIVITY IN RATS
OLARIU Lucia 1 , CACIG Svetlana 2, LUPEA Alfa Xenia 2, TULCAN Camelia 1,
ARGHERIE Diana 1
1FMV Timisoara
2Faculty of Industrial Chemistry and Environment Engineering,Timisoara
In the last years, the numerous environment effects on the living organisms were studied. A
lot of diseases and metabolic disorders were associated with oxidative stress. Part of the
antioxidant defense system against the disastrous effects on the whole organism are the natural
vegetal antioxidants, as some pigments and vegetal extracts. Both pigments and extracts have in
their composition polyphenols, flavones and flavonoids, compounds with antioxidant properties.
OBJECTIVES: This paper presents the studies concerning the antioxidant effect of an Ziziphus
jujuba fruits aqueous extract on the mammalian organisms. As the extract contains flavonoides,
their oxidoreductive reactions are triggered by the erythrocytes protective systems which are
activated when hydrogen peroxide is obtained. METHODS: Some specific blood parameters in
Ziziphus jujuba extract treated rats were determined. Malondialdehide (MDA) and glutathione
(GSH), the activities of oxidoreductase as: glutathione peroxidase, glutathione reductase,
erythrocitary catalase (CAT) and superoxid dismutase (SOD), as well as the activities of alkaline
phosphatase (PA), alanin aminotransferase (ALT) and aspartat aminotransferase (AST) were
studied. Histological modifications of liver. kidney and spleen were determined. RESULTS: After
the administration of the Ziziphus jujuba extract, the oxidative stress was installed. High values
of MDA, a decrease of the GSH level and modifications of oxidoreductase activities were
registered. No negative effect on the liver function (normal ALAT, ASAT and PA activities) was
observed. Histological observations did not reveal important modifications on studied organs.
Keywords: Ziziphus jujuba, flavonoides, oxidative stress, oxidoreductase, rats

The oxidative stress (SO) is installed when the amount of the reactive oxygen species (ROS) are
higher than the antioxidants (AO) concentrations. The main body damages, when increasing the ROS
concentration, are: lipid peroxidation, the dividing into fragments of the hyaluronic acid belonging to
the cellular membranes, the modification of the synovial fluid viscosity as well as the attack on the
nucleic acids, proteins, etc. (1)
One of the methods of fighting against the noxious effects of the free radicals upon the
organisms is the administration of antioxidant compounds, such as the flavonoids.
Besides the flavonoides ability to pigmentate various plants, the flavonoide-metal complexes
are of biological interest and have therapeutic properties, especially in reactions in which cooper and
iron are involved. The free iron and the cooper have the intense potential for ROS forming by means
of both the Fenton reaction and the Haber-Weiss reaction, which generate very aggressive hydroxil
radicals. (2, 3)
The formation of heavy metal ions complexes takes place in many biological systems, as for
example in haemoproteins, cobalamines and other numerous enzymes. There are metals ions,
essential in the biochemical systems as: Fe2+, Cu2+, Zn2+, Co1+, Mn2+ and Ni2+, but there also exist
other metals ions, which operate as strong inhibitors of the sulphidril group (in the active anabolic
system) and of organisms` protective enzymes (ex: the -levulinic acid syntetase, ferochelatase,
kinases, dehidrogenases, GSH reductase) (4).
Ziziphus jujuba (Rhamnaceae) is a plant originating in China having many usages. In medicine it
is used for invigorating vital energy, for promoting the secretion of body fluids, for regulating body
nutritional balance and defence, for invigorating the blood and for tranquilizing and neutralizing drug
toxicities. It is also used in treating the lack of appetite, fatigue and diarrhoea, hysteria, and more
recently anaemia, hypertension and purpura. In the cosmetic industry, water and hydroalchoolic
extracts of jujuba are to be found in skin care products due to its anti-inflammatory and traditional
moisturizing, smoothing, antiwrinkle and sunburn-relieving properties. The food industry uses it as an
ingredient in herbal tonic formula in form of capsules, tablets.etc. It is also used in different candies
and jams because both fruit and leaves, seeds, roots and bark contains the active principles. (5,6, 7,
8)
109

Universitatea de tiine Agricole i Medicin Veterinar


The fruits of Ziziphus jujuba (common jujube) contain vitamins such as vitamin A (70UI/100g),
vitamin B2, vitamin C (136-360 mg/100g); amino acids, sugars, proteins, fatty acids and -caroten
(81,2 g-76.8g/100g). Other constituents are organic acids (malic, tartric), sterols, cumarins and
flavonoids (kaempferol, miricetin, rutin (0.8523mg/100g)). (8)
Materials and methods
The experiment was carried out on two batches (12 healty rats each) of one year old Wistar
female rats having a body weight of 230 250 g, and that were maintained in good physiological
conditions. The administrations took place during a 30 days period, as follows: M ( the control batch)
received i.m. 2.0 ml/ kg body weight of physiological serum and L (the experimental batch) which
received i.m. 2.0 ml/ kg body weight of Ziziphus jujuba aqueous extract (0.8523 mg rutin/100g).
At the end of the experiment (after 30 day), under anaesthesia with diethyl ether, blood
samples were taken (on heparine) by cardiac puncture and thereafter decapitated. Liver, kidney and
spleen were collected. The rats were treated according to the Romanian law 205 /2004, art.7, 18, 22
concerning the protection of vertebrate animals used for experimental and other scientific purposes .
The amounts of malondialdehide (MDA) and glutathione (GSH) were determined
colorimetrically with a UV-VIS photometer (Shimadzu model 2001). The activities of oxidoreductase:
catalase (CAT) (EC.1.11.1.6.), superoxid dismutase (SOD) (EC.1.15.1.1.) glutathione peroxidase (GSHpx) (EC.1.11.1.9.), glutathione reductase (GSH-red) (EC. 1.6.4.2.), and the activity of transaminases:
alanin aminotransferase (ALT) (2.6.1.2.), aspartat aminotransferase (AST) (2.6.1.1.) and alkaline
phosphatase (PA) (EC. 3.1.3.1) by means of the colorimetric methods. (9, 10). Merck and Sigma
reagents were purcheased.
Histological modifications of the collected organs were determined. The results were
statistically evaluated by using ANOVA program. Differences were considered significant if p <0.05.
Results
Simple substances and some enzymes, that are components of the antioxidant defence body
system, have been investigated.
The results are expressed as the mean standard error of the mean.
The content of MDA in the experimental rats serum was determined and is presented in
figure 1.

35
30
25
MDA
20
[um ol/m g
15
prote ine ]
10
5
0
M

Figure 1. The MDA mean values for the Ziziphus jujuba extract treated rats

After the administration of the extract an increase of the MDA values has been observed,
namely 30,20 2,80 mol/mg at the experimental batch (L) as 19,07 1,19 mol/mg for the control
batch, (an increanse with 63% at L), that indicated the installation of the oxidative stress which is
provoked by the administration of the extract. Simple antioxidant substances (GSH) and
oxidoreductase activities (CAT, SOD, GSH-px, GSH-red) are presented in figure 2.

110

Lucrri tiinifice vol. 51 seria Medicin Veterinar

60

50
40
UI

30
CAT
20

GSH-px
SOD

10

GSH-red
0

GSH
M

GSH
SOD
CAT

GSH-red
GSH-px

Figure 2. The GSH, GSH-px, GSH-red, CAT i SOD average activities in rats treated
with the Ziziphus jujuba extract

G-SH may act in small concentrations as a prooxidant, that leads to the formation of O2 and
peroxides, having as consequence the liberation of the GSH-px from the membranes. A slightly
decrease at the L batch (6,21 0,48 mol / ml) as the control batch (7,03 0,10 mol / ml), with
8,88% has been registered, decrease that may due to the extract antioxidant components.
CAT activity presented a significant increase: 3, 87 times higher for the L batch (50,34 2,88
U/g protein) against the M batch (12,98 4,58 U/g protein). The increase at this level of the
eritrocitare CAT is explained by the role of this enzyme in the detoxification obtained from the
reaction catalyzed by the SOD upon H2O2. CAT reduces very high quantities of the H2O2, being
controlled by the NADPH, that has protective effects on it, during the oxidative stress. CAT also acts
as a protector on the modification induced by the superoxid radical on the AND. This very high CAT
activity is a result of the Ziziphus jujuba extract components action, such as the antioxidant and
detoxifiant compounds (rutin, kaemferol, miricetin).
SOD, determined as EC-SOD which contains Cu, Zn and a glycoproteine, is an enzyme which is
part of the SOD activity in plasma, lymph and sinovial fluids. The substrate can present lower
concentrations because of the slightly increasing of the SOD activity.
Glutathion peroxidases are enzymes that play the major protective role in the maintenance of
the RBC membranes integrity and function, in oxidative stress. This enzyme acts at very low
concentration of H2O2, being the principal enzyme which is used by the cells for detoxification and
may neutralize lipid peroxides resulted from the mitochondrial respiration. In this experiment we
observed an increase of the GSH-px activity at the L batch as at the M batch.
Glutathione reductase activity corresponds with the CAT activity. It was observed an increase
of 21 % of the GSH-red activity at the L batch (8,32 0,04 U/g protein) against the enzymes activity
(6,65 0.32 U/g protein) at the M batch. The glutathione reductase acts together with CAT and SOD
to remove the peroxides that are in excess.
In order to see if hepatic functions are affected by administrating the Ziziphus jujuba extract,
the activities of the ALT and AST enzymes were also determined.
The ALT activities from the
hepatocites were not significantly altered after the administration of the extract (23,88 0,74 UI) for
M and 24,81 4,88 UI for L, but the AST activities registered a decrease for L (13,19 6,74 UI) with
18.7 % against the mean values of the AST activities for the M batch (17,08 6,80 UI). The activity
of both enzymes appears to be under the normal values of this enzymes: 32 8 UI for ALT and 71
15 UI for AST (12). The ALT, AST and PA activities values are presented in figure 3.

111

Universitatea de tiine Agricole i Medicin Veterinar

30
25
20

UI 15
10

ALT

PA

AST

M
L
AST

PA

ALT

Figure 3. The comparative effects of the Ziziphus jujuba extract on the ALT, AST and PA activity

The alkaline phosphatase activity presented 35.4 % lower values in L as M and 3.2% lower than
literature data; modifications are not significant. (13).
The administration of the Ziziphus jujuba extract does not affect the function of the liver
activity; that was revealed by lower activities of AST and PA, indicators for the function and the
damaging of the hepatocites
The histological observations did not reveal significant modifications on studied organs (liver,
kidney, spleen).
Discussion
The administration of the Ziziphus jujuba extract (at a range of 2 ml/kg body weight) indicates
an oxidative stress generative action, revealed by high MDA values, by the decrease of GSH amounts
and by the CAT and SOD enzymes activities. All involved antioxidant defence system enzymes
activities suffer alterations.
The liver activity was not negatively influenced. The ALT, AST and PA activities are situated
within normal values, as indicates normal functioning and no damaging of the hepatocites. The
histological observations did not present significant modifications in the studied organs level (liver,
kidney, spleen).
References
1.

Andersen, H.R., Nielsen, J.B., Nielsen, F., et al, Antioxidative enzymes activities in human erythrocytes, Clin.
Chem., 1997, 43, 562-568.
2. Dejica, D., Antioxidani i terapie antioxidant, Ed. Casa Crii de tiin, Cluj Napoca, 2001, 132- 134.
3. Dejica,D., Stresul oxidativ n bolile interne, Ed. Casa Crii de tiin, Cluj Napoca,, 2000, 18-24.
4. Havsteen, BH., The biochemistry and medical significance of the flavonoids, Pharmacology & Therapeutics,
2002, 96, 67-202.
5. Leung,YA., Steven, AF., Encyclopedia of common natural ingredients, A Willey Interscience Publication, New
York, 1996, 324-326.
6. Cotelle,M., Role of flavonoids in oxidative stress, Curent Topics in Medicinal Chemistry, 2001, 1, 569-590.
7. Cheng, G. Yanjing, B., Flavonoids from Ziziphus jujuba Mill var. spinosa, Tetrahedron, 2000, 56(45), 89158920.
8. Martinez-Florez, S., Gonzales-Gallego, J.,Culebras, J.M., et al, Los flavonoides: propiedades y acciones
antioxidantes, Nutr. Hosp, 2002, XVII, 6, 271- 273.
9. Beutler, E., Red Cell Metabolism- A Manual of Biochemical Methods, Ed. Grune & Stratton, New York, 1985,
69-89.
10. Meingassner, JG., Schok FP., Refesences values for crl: CD RATS, Charles River Laboratories,
Massachusetls, U.S., 1990, 8-9.

112

Lucrri tiinifice vol. 51 seria Medicin Veterinar

MODIFICRI MORFOPATOLOGICE N COLIGRANULOMATOZ


LA CURC I ASPECTE LEGATE DE DIAGNOSTICUL
HISTOPATOLOGIC AL BOLII
OLARIU-JURCA I., COMAN M., LAZU A., STANCU A.
FMV Timioara
The coligranulomatosis was morphopathological diagnosticated on five turkey corpses,
growed in extensive system.
Hystopathological there were identified coligranulomatosis specific lesions, in liver and splin,
characterized by gigant cells with a spongions aspect. By emphasized there cells, we made a
differential diagnosis from tuberculous granulome, mycotic and uric granulome.
Key words: morphophatological, modifications in turkey coligranulomatosis

Coligranulomatoza sau granulomul lui Hyrre este o form cronic a colibacilozei sistemice,
frecvent la gini i curci, n care predomin rspunsul imun mediat celular (2,3,6), leziunile
constatate n aceast form fiind de tip granulomatos, asemntoare celor din tuberculoz
(1,4,5,6,7). Din punct de vedere histologic, granulomul colibacilar se deosebete de cel tuberculos
prin celulele gigante, care n cazul colibacilozei au aspect spongios (1,4,6). Granuloamele vechi i
pierd specificitatea, aprnd ca teritorii necrotice nconjurate de esut limfohistiocitar sau fibros (1,6).
Scopul prezentei lucrri const n evidenierea hisatopatologic a structurii granulomului
colibacilar n vederea stabilirii diagnosticului de coligranulomatoz la curc.
MATERIALE I METODE
Cercetrile s-au efectuat la Disciplina de medicin legal, la cinci cadavre de curc, cu vrsta
cuprins ntre 4 luni 2 ani, n vederea stabilirii cauzei morii prin examen macroscopic i
microscopic.
Suspiciunea de coligranulomatoz a aprut n timpul necropsiei, cnd la examenul intern
cadavrele au prezentat hepatit i splenit granulomatoas. Dup examinarea macroscopic,
amnunit a fiecrui esut i organ s-au prelevat probe (2/5 cm de form prismatic), fragmente din
ficat i splin, n vederea efecturii examenului histopatologic. n vederea studiului microscopic au
fost recoltate probe de la toate cele cinic cadavre de curc, la care examenul bacteriologic efectuat la
disciplina de Boli infecioase, a confirmat diagnosticul de colibaciloz. Probele au fost fixate n
formaldehid soluie 10 %, incluse n parafin, secionate la 6 micrometri, colorate prin
metodele:HEA pentru studiul de ansamblu al structurilor i Giemsa pentru detalii celulare.
Preparatele histopaotlogice obinute au fost examinate la un microscop de cercetare MC 5, cu
grosismente crescnde (x6, x10, x20, x40), iar leziunile cele mai semnificative au fost
microfotografiate.
REZULTATE I DISCUII
Examenul exterior, al cadavrelor, a evideniat starea de caexie, deshidratare, lipsa elasticitii
pielii, paliditatea mucoaselor aparente i enoftalmie. esutul conjunctiv subcutanat era infiltrat cu
lichid glbui-citrin (edeme seroase).
Examenul interior al cavitii toraco-abdominale, a relevat prezena unui lichid citrin-roietic
cu numeroase depozite cenuii-glbui, de fibrin, n masa de exsudat peritonit sero-fibrinoas.
Plmnii prezentau zone de culoare roie-maronie. La secionare parenchimul pulmonar era umed,
iar din parabronhii se scurgea un lichid cenuiu. Docimazia era pozitiv. Acest aspect morfopatologic
corespunde bronhopneumoniei catarale.
Ficatul, pe suprafa i n profunzimea parenchimului hepatic erau prezeni numeroi noduli
(granuloame) cenuii albicioi, de diverse dimensiuni (bob de orez alun), care pe seciune
prezentau o zon central, de necroz de cazeificare, de culoare galben, friabil, delimitat de o
capsul conjunctiv bine delimitat. Zona central de necroz se detaa uor de capsula conjunctiv.
Aceste particulariti fizico-structurale definesc diagnosticul morfopatologic de hepatit
granulomatoas (Fig. 1).

113

Universitatea de tiine Agricole i Medicin Veterinar


Splina prezenta la suprafa i pe seciune noduli, granuloame, cenuii albicioase, de
mrimea unui bob de piper, cu o zon central de necroz de cazeificare, delimitat de o capsul
subire de esut conjunctiv splenita granulomatoas.
Examenul microscopic
Ficatul, structura hepatic este dominat de procese congestive care afecteaz vasele de
diverse calibre, de la marile vase pn la capilarele sinusoide. Toate sunt dilatate i pline cu elemente
figurate. Predomin eritrocitele, dar sunt remarcate i leucocitele, cordoanele hepatice sunt
dislocate, iar celulele hepatice din zonele superficiale au o tent coloristic mai palid. La un examen
amnunit se remarc c hipocromiile hepatice sunt teritorii n care celulele sufer procese
degenerative, unele reversibile, iar altele ireversibile. Cele reversibile sunt reprezentate de
degenerescene granulare manifestate prin tumefiere celular i citoplasma intens granular.
Granulele sunt uniforme ca mrime, dar dispuse neuniform pe suprafaa citoplasmei. Nucleul n
majoritatea cazurilor este viabil i dispus central sau paracentral. Granulaiile reprezint serum
albuminele i serum glomulinele acumulate n mitocondrii, determinnd hipertrofia acestora
megamitocondrii.
n zona distrofic a ficatului se constat i microfocare de necroz manifestate morfologic prin
apariia unor spaii optic goale n care orice urm de esut hepatic este disprut. Uneori se remarc
un reticul format n special din citomembrane care sunt mai rezistente. Zonele necrotice
hipocrome, alterneaz cu zone congestivo-hemoragice de culoare roietic.
Aceste aspecte sugereaz faptul c prima reacie a ficatului n colibaciloza aviar este o reacie
vascular congestivo-hemoragic. Procesul s-ar explica prin aciunea toxinelor colibacilare asupra
dispozitivelor sfincteriene ale capilarelor sinusoide, determinnd constricii i dilataii sinusoidale de
sector. Ulterior acestor procese urmeaz migrarea mai mult sau mai puin accentuat a eozinofilelor,
elemente cu funcie pinocitar.
Hepatocitele prinse n focarul congestiv exsudativ sufer fenomene distructive, iar acizii
nucleici pui n libertate sau ali factori biochimici stimuleaz reacia sistemului reticulo endotelial.
Pe msur ce procesul evolueaz eozinofilele se degranuleaz total i necroza se extinde,
predominnd ca aspect lezional. Procesul de necroz este nsoit de un numr mare de germeni, care
uneori formeaz tromboze ale capilarelor sinusoide, punct de plecare posibil al unor noi focare de
necroz.
Se poate concluziona c focarele necrotice pot fi urmarea unor fenomene citolitice, toxice sau
consecina unor hipoxii posttrombotice.
Fenomenelor exsudativ necrotice le urmeaz procesele proliferative manifestate prin
hiperplazie reticulo-endotelial, ea este urmat de o accentuat hiperplazie epitelioido-gigant, baza
morfologic a coligranulomatozei.
n multe cmpuri microscopice s-a evideniat prezena granuloamelor colibacilare.
Examinnd cu atenie preparatele histopatologice din ficat, cu granuloame, am sesizat
morfogeneza granulomului infecios colibacilar hepatita granulomatoas colibacilar:
pregranuloam sau granulomul macrofagic constituit dintr-un cuib de monocite,
provenite din circulaia sanguin, dispuse n jurul unui focar de necroz;
granulomul epitelioid sau proaspt, este rezultatul transformrii macrofagelor n celule
epitelioide, care se unesc prin jonciuni scurte, alctuind o barier n jurul focarului de
necroz lund natere, astfel granulomul epitelioid (Fig. 2);
granulomul epitelioidogigant constituit din celule epitelioide i celule gigante cu aspect
spongios (Fig. 3);
granulomul matur prezenta trei zone distincte: zona central de necroz de cazeificare;
median epitelioid-gigant, dispus pe dou straturi intern, constituit din celule
gigante care prezenta un aspect spongios, vacuolar (caracteristic granulomului
colibacilar), extern, format din celule epitelioide, zona periferic este constituit din
esut limfohistiocitar i/sau fibros (Fig. 4, 5).
Zona epitelioido-gigant dispare n granuloamele vechi, ele fiind constituit numai din zone
necrobiotice i de necroz delimitate de o reacie limfohistiocitar sau fibroconjunctiv (Fig. 6).
114

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Splina, la examenul de ansamblu i de detaliu se remarc prezena granuloamelor colibacilare
n diferite faze: pregramulom, granulom epitelioid, epitelioidogigant i respectiv matur (Fig. 7).

Fig. 1. Coligranulomatoz curc - hepatit


granulomatoas

Fig. 3. Ficat (coligranulomatoz curc) granulom


epitelioidogigant Col. HEA, x 200

Fig. 5. Hepatita granulomatoas (coligranulomatoz


curc) granulom matur - celule gigante cu aspect
spongios, caracteristice granulomului colibacilar
Col. HEA, x 200

Fig. 2. Ficat (coligranulomatoz curc) - granulom


epitelioid sau proaspt Col. HEA, x 200

Fig. 4. Hepatit granulomatoas (coligranulomatoz


curc) granulom matur Col. HEA, x 200

Fig. 6. Hepatit granulomatoas (coligranulomatoz


curc) granulom n curs de ramoliie i cu
sechestrare mezenchimal
Col. HEA, x 100

Fig. 7. Splenit granulomatoas (coligranulomatoz


curc) granuloame mature. Col. HEA, x 200

115

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII
Coligranulomatoza aviar, cu localizare hepatic i splenic, a fost diagnosticat necropsic i
histopatologic la cinci cadavre de curc, n vrst de 4 luni 2 ani, provenite din sistemul extensiv de
cretere.
Macro- i microscopic s-au evideniat:
leziuni specifice: granuloame cu celule gigante cu aspect spongios, caracteristice
coligranulomatozei, n ficat i splin;
leziuni necaracteristice: modificri circulatorii (ectazii, congestii i hemoragii) i procese
distrofice cardiace; necrobioz i necroz hepatic i splenic; congestie activ i
bronhopneumonie cataral n focare; enterita cataral.
BIBLIOGRAFIE
1.
2.
3.
4.
5.
6.
7.

BABA, A. I. (1996) - Diagnostic necropsic veterinar, Ed. Ceres, Bucureti.


BARNES, H.J., VAILLANCOURT, and GROSS, W.B.(2003) - Colibacillosis. In Diseases of Poultry, 11 th
Edition, Editor in Chief Y.M. Saif, Blackwell Publishing, Iowa State Press, P. 631-637.
ISHII, E., GORYO, M., KIKUCHI, S., OKADA, K. (1997) Pathology of swollen head syndrome in broiler
chickens. J Japan Vet. Med Assoc 50:214-219.
JUBB, K.V.F., KENNEDY, P.C., PALMER, N. (1993) - Pathology of Domestic Animals, Fourth Edition, Vol. 2,
Academic Press, San Diego, California, USA.
MOGAT MNZAT, R. (2001) - Bolile infecioase ale animalelor, Ed. Brumar, Timioara.
PAUL, I. (2005) . Etiomorfopatologie veterinar, Ed. All Bucureti.
PERIANU, T. (1996) - Boli infecioase ale animalelor, Bacterioze, vol. I, Ed. Fundaia Chemarea, Iai.

116

Lucrri tiinifice vol. 51 seria Medicin Veterinar

MODULAREA DIFERENIERII CARDIACE A CELULELOR STEM


EMBRIONARE MURINE SUB INFLUENA UNOR FACTORI DE
CRETERE
MODULATION OF CARDIAC DIFFERENTIATION OF MOUSE
EMBRYONIC STEM CELLS UNDER THE INFLUENCE OF SOME
GROWTH FACTORS
PALL E.1, GROZA I.1, SORIU Olga2, CTAN Laura1, CENARIU M.1
1USAMV Cluj-Napoca
2Institutul Oncologic Ioan Chiricu
The present study was designed to evaluate the effect of growth factors involved in
differentiation of mouse embryonic stem cells (ES )to cardiomyocyte. Cardiac differentiation was
initiated by embryoid bodies (EBs) formation in hanging drop, transfer of EBs to suspension
culture and then planting onto gelatin-coated tissue culture plates. Growth factors was added to
culture medium throughout the suspension period. Culture was observed daily with inverted
microscope for the
apparance of contracting clusters. Immunohistochemical examination was aimed to identify
tissue-restricted: titin as a cell-specific antigen for cardiac and skeletal muscle alfa smooth muscle
actin, cytokeratin Endo-A (TROMA) for the presence of mesenchymal progenitor cells.

Liniile de celule stem embrionare (ES) sunt derivate din masa celular intern a embrionului n
stadiu de blastocist, sunt celule pluripotente avnd capacitatea de a se autorennoi i diferenia n
toate tipurile de celule proprii embrionului n dezvoltare (Anna M. Wobus i col., 2005).
Liniile celulare Es se dezvolt dintr-un stadiu nedifereniat fiind asemntoare cu celulele
embrionului timpuriu, cu capacitate de difereniere pe linie cardiogenic, miogenic, neurogenic,
hematopoetic, adipogenic, condrogenic precum i n celule epiteliale, endoteliale i celule
musculare netede (VSM) (Kaomei Guan i col. 1999). n faza final, celulele Es difereniate prezint
proprietile farmacologice, fiziologice ale celulelor specializate: cardiomiocitele difereniate in vitro
au caracteristici tipice celulelor atriale, ventriculare, Purkinje i pacemaker-like, iar celulele neuronale
sunt caracterizate prin sinapse inhibitoare i excitatoare (Gocza Elen 2004, Anna M. Wobus i col
2005). Celulele neuronale, cardiace i VSM prezint receptori funcionali tipici pentru fiecare tip de
celul (Hescheler J. i col.,1997).
Celulele Es cultivate sub form de agregate celulare de tip embrionar numite i corpusculi
embrionari (Ebs), au capacitatea de a se diferenia n derivate ale celor trei straturi embrionare
germinale: endoderm, ectoderm i mezoderm (Nagy A. i col. 1993).
Etapele diferenierii celulelor stem embrionare depind de un complex de factori de cretere,
molecule semnal i matricea extracelular (ECM). Prin adugarea unor factori de cretere n mediul
de cultur, anumite gene speciale sunt activate care duc la diferenierea direcionat cu obinerea
controlat a diferitelor celule in vitro ( Groza I. i col., 2006).
Studii multiple descriu obinerea de cardiomiocite prin utilizarea de factori de cretere i alte
substane chimice dintre care: transforming growth factor (TGF- ), insulin-like growth factor (IGF),
fibroblast growth factor (FGF), eritropoetin, ocitocin, acid retinoic, dimetilsulfoxid (DMSO), acid
ascorbic (Robert P i col., 2005). Obinerea de cardiomiocite in vitro prin difereniere controlat este
un obiectiv important pentru obinerea unui stoc de celule cardiace utilizabil n terapia infarctului
miocardic.
Studiul urmrete obinerea controlat a cardiomiocitelor in vitro, prin utilizarea unor factori
de cretere i caracterizarea stocului de cardiomiocite provenite din celule stem embrionare n
vederea utilizrii lor n terapia tisular a infarctului miocardic.
MATERIALE I METOD
Pentru experiment s-a utilizat linia celular stem embrionar murin R1 (Fig.1). Linia a fost
obinut din embrioni n stadiu de blastocist (E3,5) din generaia F1 (129/Svx129/Sv-CP). Linia celular
s-a pstrat pe un strat de fibroblati embrionari murini primari (CD1-MEF). Mediul de cultur utilizat
117

Universitatea de tiine Agricole i Medicin Veterinar


este Knock-out DMEM (Gibco) suplimentat cu glutamax 1%, 50g/ml streptomicin (Sigma), 50U/ml
penicilin (Sigma), 50mM-mercaptoetanol (ME), 0,1 mM aminoacizi neeseniali (Gibco) 1000U/ml
de LIF (Esgro), 20% FCS (Hyclone).

Fig.1. Colonii de ES din linia R1

Cu dou zile nainte de difereniere, celulele ES sunt transferate n plci Petri (Greiner)
pretratate cu gelatin 0,1% (Sigma) n mediul de cultur ES. Pentru inducerea formrii corpusculilor
embrionari s-a utilizat agregarea celulelor n pictur suspendat (hanging drop) pe capacul plcii
Petri prevzut cu PBS steril pentru meninerea umiditii constante impiedicnd astfel uscarea
picturilor.
Mediul de difereniere este compus din mediul IMDM (Gibco) suplimentat cu 1% glutamax
100x (Gibco) 50g/ml streptomicin (Sigma), 50U/ml penicilin (Sigma), 50mM-mercaptoetanol
(ME), 0,1 mM aminoacizi neeseniali (Gibco), 15% FCS (Hyclone).
Splarea corpusculilor embrionari formai s-a realizat dup 48 de ore cu mediu de difereniere
n plci Petri bacteriologice (5 bucai) de 10 cm diametru (Fig.3.).
La mediul de cultur s-a adugat factorii de cretere BMP-2 6ng/ml, FGF 5ng/ml, IGF 10 ng/ml.
Deasemenea s-a utilizat i dou amestecuri din aceti factori de cretere primul fiind compus din
BMP-2, BMP-4, FGF, IGF iar al doilea din BMP-2 i BMP-4.

Fig.3. Corpusculi embrionari: A- n pictur 24 h, B, C- n suspensie

n a cincea zi, corpusculii embrionari au fost mutai n plci gelatinizate, compartimentate, n


fiecare compartiment existnd cte o lam histologic necesar colorrii imune la finalul
experimentului. Dup nceperea pulsailor, mediul de cultur a fost schimbat din 2 n 2 zile. n urma
examinrii zilnice a plcuelor au fost ntocmite tabele i s-a calculat procentajul corpusculilor
embrionari care pulseaz. Desemenea s-a efectuat msurarea ariei de pulsaie a acestor corpusculi
embrionari i frecvena pulsaiilor.
Pentru identificarea potenialului cardiogenic al corpusculilor embrionari, n ziua a 18 a
diferenierii s-a efectuat fixarea corpusculilor cu paraformaldehid 4%. Identificarea celulelor
precursoare cardiace s-a realizat cu ajutorul anticorpului anti-titin, i anti alfa smooth muscle actin,
iar pentru identificarea celulelor precursoare mezenchimale timpurii s-a utilizat anticorpul anti
cytokeratina endo.
118

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Permeabilizarea celulelor pentru antigene intracelulare s-a efectuat prin adugarea soluiei
TRITON X-100, 0,1% timp de 5 minute, iar blocarea permeablizrii s-a efectuat cu BSA 10%. Pentru
colorarea nuclear s-a adugat colorantul Hochst (Sigma) la temperatura camerei, contactul
meninndu-se 10 minute. Dup colorare, splarea s-a efectuat de dou ori cu soluie de PBS i o dat
cu ap MQ. Pe lamele SuperFrost tratate cu acid sulfuric crom s-au adugat cte 2 picturi de
Vectofluor Mounting Medium (Sigma) pentru o mai bun vizualizare, iar pe aceste picturi s-au plasat
lamelele histologice. Microscopul cu fluorescen a permis vizualizarea preparatelor. Pentru
identificarea coloniilor alcalino-fosfataz pozitive s-a utilizat coloraia propus de Anna Wobus i col.
REZULTATE I DISCUII
Identificarea cardiomiocitelelor s-a realizat relativ uor, deoarece n a 8 zi de diferenire i
cretere n dimensiuni a corpusculilor embrionari, s-a observat pulsaii caracteristice spontane, fr
utilizarea vreunui stimul, n cazul corpusculilor embrionari la care s-a adugat amestecul I i FGF. Cu
naintarea perioadei de difereniere s-a constatat creterea numrului pulsaiilor spontane i la restul
corpusculior, dar de asemenea se pot observa i zone contractile localizate ncercuite de un halou de
celule mai strlucitoare, mai ales la corpusculii embrionari tratai cu BMP2 i BMP4.
n cazul acestor corpusculi, contaciile apar tardiv, n ziua 15-a diferenierii, BMP-4 avnd efect
inhibitor asupra diferenierii cardiace. Rezultate din literatura de specialitate arat faptul c BMP4
cauzeaz o scdere drastic a procentajului de colonii pulsatile, fapt dovedit i de cercetrile noastre
(Grafic.1 i Grafic 2).
De asemenea, n cazul corpusculilor embrionari pretratai cu IGF, contraciile caracteristice
apar cel mai tardiv, doar n 17- a zi a diferenierii. Rata de contracie n fiecare arie de pulsaie crete
rapid, cu naintarea diferenierii celulelor urmat n mod general de o descretere a ratei btilor cu
ocazia maturrii acestora. Depinznd foarte mult de numrul iniial de celule din etapele iniiale ale
agregrii, aceste pulsaii pot continua de la aproximativ cteva zile pn la o lun. Dei se poate
observa stoparea pulsaiilor celulelor, acestea pot fi meninute n cultur mai multe sptmni cu
fixarea acestora pentru investigaii ulterioare. n timpul etapelor de difereniere timpurie, celulele din
EB sunt tipice mici i rotunde. Miofibrilele neoformate sunt mprtiate i organizate neregulat sau
nici nu exist, n timp ce altele conin fascicule paralele de miofibrile. Odat cu maturarea,
cardiomiocitele provenite din celule ES devin alungite, cu miofibrile bine dezvoltate i cu observarea
sarcomerelor. Celulele contractile sunt mononucleate n form bacilar i au jonciuni intracelulare
solide. n timpul etapelor de difereniere terminale, pot fi vizualizate fascicule bine organizate de
miofibrile i sarcomerele, fapt dovedit i prin colorri imunohistochimice speciale. Cardiomiocitele
derivate din celulele ES exprim gene cardiace ntr-o manier controlat de dezvoltare, iar pentru
identificarea acestora sunt necesare tehnici mai avansate de examinare. Proteinele sarcomerice ale
cardiomiocitelor provenite din celulele ES se pot detecta n urmtoarea ordine: titin (z disck), actin, miomezin, M protein.

62185,91

IGF

5d+12

104173,05

Amestec I

5d+3

22362,56

Amestec
II

5d+10

14752,67

Media ariei de
pulsaie (m)

5d+10

5d+3

100000
90000
80000
70000
60000
50000
40000
30000
20000
10000
0
5d+3

FGF

Media ariei de pulsaie (m)

5d+12

5d+8

Media ariei
de pulsaie
(m)
53859,17

5d+3

nceperea
pulsaiilor

5d+8

Factorii de
cretere
utilizat
BMP-2

BMP- FGF IGF


2

AI

A II

Grafic.1. Reprezentarea grafic a mediilor arilor de percuie i momentul nceperii pulsaiilor

119

Universitatea de tiine Agricole i Medicin Veterinar

5d
+
5d 1
+
5d 2
+
5d 3
+
5d 4
+
5d 5
+
5d 6
+
5d 7
+
5d 8
5d +9
+
5d 10
+
5d 11
+1
2

100
80
60
40
20
0

Pulsing EBs (%) BMP -2


Pulsing EBs (%) FGF
Pulsing EBs (%) IGF
Pulsing EBs (%) A I
Pulsing EBs (%) A II

Grafic 2. Procentajul corpusculiilor embrionari care pulseaz

Fig.4. Colonii fosfataz alcalina pozitiv

Evidenierea coloniilor alcalino-fosfataz pozitive (Fig.4.), arat faptul c printre celule


difereniate n corpusculi embrionari exist i celule nedifereniate, deoarece nu toate celulele au
aceeai ritm de difereniere. Identificarea coloniilor cytokeratina endo pozitive (Fig.6) indic prezena
celulelor mezenchimale timpurii.

Fig.5. Evidenierea imunohistochimic a titinului sau connectinului

Titinul sau connectinul este o protein cu rol foarte important n elasticitatea sarcomerelor
(Fig.5), fiind constituentul principal al filamentelor longitudinale care asigur meninerea arhitecturii
miofibrilelor. Este o protein care apare mai timpuriu n timpul diferenierii celulelor stem
embrionare spre linie cardiac, urmnd factorul de transcripie GATA -4.

120

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig.6. Evidenierea imunohistochimic a coloniilor cytokeratina endo pozitive

Fig.7. Evidenierea imunohistochimic a coloniilor actin pozitive

Schimbarea morfologiei celulare din corpusculii embrionari poate fi corelat cu cele trei stadii
de dezvolatare i difereniere ale celulelor: timpuriu (pacemaker- like sau celule miocardale primare),
intermediar i terminal (artial, ventricular, nodal , His, i celulele Purkinge).

1.
2.
3.

4.

CONCLUZII I RECOMANDRI
n urma cercetrilor noastre putem s concuzionm urmtoarele:
se poate observa c, pentru diferenierea spre esut cardiac cu efecte favorabile, se pot utiliza
corpusculii embrionari obinui din agregare sub form de pictur suspendat;
la corpusculii embrionari pretratai cu amestecul I i FGF, pulsaiile caracteristice spontane apar
fr utilizarea vreunui stimul n a 8 zi de difereniere;
utilizarea factorilor de cretere BMP2 i BMP4 duce la apariia tardiv a contraciilor
caracteristice, aria de pulsaie este de asemenea mult mai redus (14752,67 m) comparativ cu
ali corpusculi meninui n diferite condiii de cultur;
BMP4 are efect inhibitor asupra diferenierii celulelor stem pe linie cardiac;

121

5.

6.
7.

Universitatea de tiine Agricole i Medicin Veterinar


la corpusculii embrionari meninui n mediu de difereniere la care s-a adugat IGF, contraciile
apar cel mai tardiv, numai dup 17 zile, iar aria de pulsaie este mult superioar (104173,05 m)
comparativ cu ali corpusculi embrionari;
utilizarea metodelor imunohistochimice ne permite identificarea coloniilor actin, titin,
cytokeratina endo A pozitive;
preocuprile cercetrilor ulterioare sunt: identificarea miARN implicat n difereniere cardiac,
recoltarea de celule stem adulte din mduva hematogen i diferenierea direcionat a acestora
pe linie cardiac, recoltarea celulelor pulsatile i injectatea intramiocardic i intravenoas la
oareci cu infarct miocardic indus prin ligatura arterei coronariene.
BIBLIOGRAFIE

1.
2.
3.

4.
5.

6.

7.

Anna M. Wobus, Kenneth R.B., 2005, Prospects for developmental biology and cell terapy, Physiol Rev.
Bethseda 85:635-678;
Gocza Elen, 2004, Embrionalis ossejtek es ossejt vonalak, Magyar Tudomany, Budapest, 4/285-292;
Groza I., D.D. Ciupercescu, Emke Pll, Elen Gocza, 2006, In vitro production embryoid bodies from a mouse
embryonic stem cell line and differentiation protocols towards cardiomyocyte and neuron lineages, Buletin
Medicina Veterinar, Vol. 63, pag 264-269;
Nagy A., Janet Rossant, Nagy Reka ,Wanda Abramow-Neverly, Roder J.C., 1993, Derivation of completely cell
culture-derived mice from early-passage embryonic stem cells, Proc. Natl. Acad,Sci.USA, 90/8424-8428;
Hescheler J., .K. Fleischmann, S. Lentini, V.A. Maltsev, J. Rohwedel, A.M. Wobus, K. Addicks, 1997 ;
Embrionic stem cells: a model to study structural and functional properties in cardyomiogenesis; Elsevier
Science - Cardiovascular Research 36, pag. 149 162;
Kaomei Guan, Jurgen Rohwedel, Anna M. Wobus, 1999; Embryonic stem cell differentiation models:
cardiogenesis, myogenesis, neurogenesis, epithelial and vascular smooth muscle cell differentiation "in vitro";
Cytotechnology nr. 30; pag. 211 226;
Robert Passier, Christine Mummery, 2005; Cardiomyocite differentiation from embrionic and adult stem cells;
Current Opinion in Biotechnology nr.16; pag. 498 502.

122

Lucrri tiinifice vol. 51 seria Medicin Veterinar

BOTH CARDIO-VASCULARY AND SUBCUTANEOUS FORMS OF


DIROFILARIOSIS IN DOG: A CASE REPORT
PACA S., MIRON L., ACATRINEI D., MIHALACHI Simona
FMV Iai
A crossbreed dog female 8 years old was diagnosed with caval syndrome. Blood samples
investigated by light microscopy or circulating antigen test (DiroCheck) confirmed the suspicion
of dirofilariosis. The dog died during the treatment and the forensic examination revealed both
cardio-vasculary and subcutaneous forms of dirofilariosis. This could be the first case-report of
combined forms of dirofilariosis in Romania.
Key words: Dirofilaria immitis, Dirofilaria repens, heartworm disease,
subcutaneous dirofilariosis

Filariid family of nematodes harbor genus Dirofilaria. This genus is composed by 32 valid
species and many species still in validation process. Four species have zoonotic potential (Dirofilaria
immitis, D. repens, D. tenuis and D. ursi). The last three species are enrolled in the sub-genus
Nochtiella and live in subcutaneous connective tissue of definitive hosts.
Cardiovascular dirofilariosis (or heartworm disease) is produced in dog, cat and other
carnivores (1, 11, 12) by Dirofilaria immitis (Leidy, 1856), wich live in pulmonary artery, right ventricle
and atrium (1, 12). The life-cycle of this worm is accomplish with the complicity of many species of
mosquitoes belonging mainly to genus Culex, Culisetta, Anopheles and Aedes from Culicidae, a great
family of dipterans (25,27). The bloodsucking mosquito females receive the first stage larva when
feed with blood from infected dogs and cats. In mosquitoes the first stage microfilaria (L1) molt twice,
reaching the infective stage L3 in 7-10 days in optimal conditions (22-25C) and could be delivered to
an infected or healthy definitive host when mosquito take another blood meal (1, 27). If the
temperature of environnement is under the optimal range, the evolution inside intermediate host
could be much longer than mosquitos life and if temperature is under 14,5 C microfilaria die (1) or
stop the developpement process until the environmental temperature rise to 26,5C (27).
In definitive hosts D. immitis conquest pulmonary artery first and when the worm burden
reach a big density they could be found in right heart, vena cava, aorta and his splenic, mesenteric
and iliac branches (1,22). The dimensions of adult worms may vary between 16 and 32 cm in long and
up to 1,5mm wide in females and 14 cm in long and up to 0,9 mm wide in males. Microfilaria measure
220-232 x 5,0-7,5m (1). Adults live in right heart and pulmonary artery for 5 years and microfilaria
can be infective for the intermediate host 2 years (1). Dunsmore and Shaw (1998) appreciate life
expectancy of microflaria as no more than 6 months. Sometimes, microfilaria could be found in joints
(7).
The ratio of infected male to female dog was found to be as high as 4:1 because males spend
more time in outdoor areas than females because its mating and territorial behavior. Large breeds
are more infected than small breeds (27).
In heartworm disease the worm burden may vary in a wide range, could be just few but could
reach hundred of individuals and in this case, according to Strickland (1998), the main cause of death
in dogs and cats with heartworm disease is the caval syndrome wich consist in tricuspid regurgitation
caused by lesions induced to valvular apparatus by worms in migration from pulmonary artery to
right heart. Wang et al. (2005) has seen alterations of the extracellular collagen matrix in the
myocardium of canines infected with Dirofilaria immitis (8).
Heartworm disease is endemic in southern areas of Europe like Greece, Italy, France and Spain
and is not a threat in northern areas like Iceland, Norway, Holland, etc (5).
According to Olteanu (1998), in Romania, the first case-report of heartworm disease in
humans was communicated to scientific world by Victor Babes and the first case of the same disease
in dog by Motas in1903. Many other scientists like Popovici (1916), Popescu (1935), Gherman and
Nitzulescu (1986), was interested in this subject (14).
Human been can be infected but microfilaria doesnt reach the adult stage, the main lesion
which can be found in humans is coin shaped pulmonary granuloma (1, 3, 4, 15, 18, 20). Some
123

Universitatea de tiine Agricole i Medicin Veterinar


scientists report the parasitism with preadult stages in heart, cave vein and pulmonary artery in
humans (1).
Dirofilaria repens infection was reported for the first time in human in 1887 in Brazil by
Magalhaes. This worm lives in subcutaneous connective tissue, related to blood vessels where the
female spread microfilaria. The longevity of microfilaria is ranged in 5-9 months (6). The intermediate
hosts are the same like in heartworm disease and the life cycle too. In blood smears made from
peripheric blood the morphology of microfilaria are the same in both Dirofilaria worms but Knotts
modified method could differentiate species (1). Subcutaneous dirofilariosis could be asymptomatic
or with clinical signs related to skin area like nodules and lesions of dermatitis (12, 23).
In human been infections with D. repens occur but are not common. Infections were reported
in Italy, Greece, Spain, France, Tunis, Marocco, Turkey, Iran, and Sri Lanka (10, 17, 19, 21, 24, and 26).
Most common areas affected were breast, eyes and scrotum (6, 15, 19). In the last century was
reported at least 800 cases (20) of human dirofilariosis produced by D. repens with main mammary
and ocular localization but the number of case reports have an ascending course in last ten years
(6,17). In Romania was reported a case of human subcutaneous dirofilariosis in Buzu county and two
in Slatina by Nitzulescu and Gherman (cited by 14).
MATERIALS AND METHODS
A crossbreed dog female aged 8 years was diagnosed with caval syndrome. Blood samples
investigated by light microscopy and circulating antigen test (DiroCheck) confirmed the suspicion of
dirofilariosis. The dog died during the treatment and the forensic examination revealed both cardiovascular and subcutaneous forms of dirofilariosis. Worms were investigated in light microscopy using
a stereomicroscope and the main features like long, wide of whole body and esophagus were
determined for both species and both sexes.
RESULTS AND DISCUSSIONS
Dirofilaria immitis was found in right ventricle and pulmonary artery, lapped in by a thrombus.
The right heart (picture 1) and pulmonary artery was found enlarged and with flask wall. Right
ventricle harbored 18 adults of D. immitis and 7 were found in pulmonary artery (picture 2) and his
branches. Four worms were arrested in a giant thrombus which occupies half of intra-ventricular
space (picture 3). The dimensions of the worms harvested from right heart and pulmonary artery are
shown in table 1 and picture 4. In males, the posterior end is convoluted like a pigtail (picture 5), this
morphologic feature is needed for mating because the vulva is placed in post-esophageal area and
the male need a firm embracement in this very motile environment.
In the subcutaneous connective tissue of the same dog were found 32 worms packed in
connective membranes related each ones to a blood vessel (picture 6). This kind of connection allows
the worm to feed and to spread microfilaria in the blood flow.

Picture 1. Right heart dilatation in dog with heartworm disease.

124

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Picture 2. Dirofilaria immitis in pulmonary artery. Heartworm disease in dog.

Picture 3. Dirofilaria immitis in right ventricle. Heartworm disease.

Picture 4. Adult females and males of D. immitis harvested from a dog heart.

125

Universitatea de tiine Agricole i Medicin Veterinar

Picture. Convoluted tails in males of Dirofilaria immitis. Detail.

Picture 6. Dirofilaria repens in subcutaneus conective tissue in dog. The worm is packed in a membrane whick
seems to be derived from the blood vessel wall.

From the same dog were harvested 32 adult worms of D. repens, harboured in subcutaneous
connective tissue (picture 6). The sex ratio was found 1:4,5 male-to-female (six males to twenty-six
females).
The morphological features of worms (no lips, esophagus divided in two parts, muscular and
glandular, the cuticular ridges, postesophageal vulva, pigtail in males and a big number of papilla,
inequal spicules), the place of parasitism and the dimensions of males and females (table 1) enroll the
parasites in genus Dirofilaria, species Dirofilaria immitis and Dirofilaria repens. The former species is
included in sub-genus Nochtiella.
Table no. 1 A short morphometric study about Dirofilaria immitis and D. repens harvested from dog
Measured features
D. immitis
D. repens
Variation range in :
Variation range in:
Male
Female
Male
Female
Whole body length 4-16 cm
12-34 cm
5-7 cm
7-15 cm
Whole body width 0,6-0,8 mm
0,9-1,6mm
0,3-0,5 mm 0,4-0,8mm
Esophagus lenght
1,22-1,28mm 1,75-1,78mm 0,9-1mm
1,1-1,2mm

126

Lucrri tiinifice vol. 51 seria Medicin Veterinar


REFERENCES
1.
2.
3.

4.
5.
6.

7.
8.

9.
10.
11.
12.
13.
14.
15.
16.

17.
18.
19.
20.

Dulceanu, N., Terinte Cristina Parazitologie veterinara. Ed. Moldova, Iasi, 1994.
Dunsmore, J.D., Shaw, S.F. 1990. Clinical Parasitology of Dogs. Veterinary Review No. 31. University of
Sydney Post Graduate Foundation in Veterinary Science, Sydney, Australia.
Estran, Christelle, Marty, P., Blanc, Vronique, Faure Odile, Leccia Marie-Thrse, Pelloux Herv,
Diebolt Evelyne, Ambrosetti, D., Cardot-Leccia Nathalie - Dirofilariose humaine : 3 cas autochtones
dans le sud de la France. La Presse Mdicale, Volume 36, Issue 5, Part 1, May 2007, 799-803
Flieder D.B., Moran Sara - Pulmonary Dirofilariasis: A Clinicopathologic Study of 41 Lesions in 39 Patients.
HUMAN PATHOLOGY Volume 30, No. 3 (March 1999
Genchi, C., Rinaldi, L., Cascone,C., Mortarino, M., Cringoli, G., - Is heartworm disease really spreading in
Europe?. Veterinary Parasitology 133 (2005) 137148
Hannachi Sassi, S., L., Dhouib A.R., Mrad, Bouguila, K.H., Abbes I., Driss, M., Ghorbel, R., Ben,
Romdhane, K. Ben - Dirofilariose conjonctivale Dirofilaria repens. propos dun nouveau cas
tunisien. Journal Franais d'Ophtalmologie, Volume 29, Issue 2, February 2006, 197.e1-197.e4
Hodges, S., Rishniw, M. - Intraarticular Dirofilaria immitis microfilariae in two dogs. Veterinary
Parasitology, Volume 152, Issues 1-2, March 2008, Pages 167-170 (in process)
Jiunn-Shiow Wang , Kwong-Chung Tung, Chiu-Chen Huang, Cheng-Hung Lai, - Alteration of extracellular
collagen matrix in the myocardium of canines infected with Dirofilaria immitis. Veterinary Parasitology 131
(2005) 261265
Kaiser Lana, Williams, J. F. - Dirofilaria immitis: worm burden and pulmonary artery proliferation in dogs from
Michigan (United States). Veterinary Parasitology 124 (2004) 125129
Marty P. Human dirofilariasis due to Dirofilaria repens in France. A review of reported cases. Parasitologia
1997; 39: 383386.
McCall J. W., - Dirofilariasis in the Domestic Ferret. Chemical Techniques in SmallAnlmal Practice, Vol 13,
No 2 (May), 1998: pp 109-112
Mitrea, I.L., - Parazitologie veterinara. Ed. Ceres, Bucuresti, 2003.
Muro A, Genchi C, Cordero M, Simon F. Human dirofilariasis in the European Union. Parasitology Today
1999; 15: 386389.
Olteanu, Gh., 1998 Zoonoze. Ed. Ceres, Bucuresti.
Orihel, T. C., Eberhard, M. L., 1998 - Zoonotic Filariasis Clin Microbiol Rev. 1998 April; 11(2): 366381.
Paes-de-Almeida, E.C. , Ferreira, A.M.R., Labarthe, N.V., Caldas, M.L.R., McCall, J.W., - Kidney
ultrastructural lesions in dogs experimentally infected with Dirofilaria immitis (Leidy, 1856). Vet Parasitol. 2003
Apr 18;113(2):157-68.
Pampiglione, S., Di-Palma, S., Bono, A., Bartoli, C., Pilotti, S. Breast infection due to Dirofilaria repens:
report of two new Italian cases and revision of the literature. Parasitologia 1998; 40: 269273.
Rena, O., Leutner Monica, Casadio Caterina - Human pulmonary dirofilariasis: uncommon cause of
pulmonary coin-lesion. European Journal of Cardio-thoracic Surgery 22 (2002) 157159
Scaramozzino P, Gabrielli S, Di Paolo M, Sala M, Scholl F, Cancrini G. - Dog filariosis in the Lazio region
(Central Italy): first report on the presence of Dirofilaria repens. BMC Infect Dis. 2005 Sep 26;5:75.
Sabu L, Devada K, Subramanian H. Dirofilariosis in dogs and humans in Kerala. Indian J Med Res. 2005

May;121(5):691-3.
21. Solano-Gallego L, Llull J, Osso M, Hegarty B, Breitschwerdt E. - A serological study of exposure to
arthropod-borne pathogens in dogs from northeastern Spain. Vet Res. 2006 Mar-Apr;37(2):231-44.
22. Strickland, K.N., - Canine and Feline Caval Syndrome. Clinical Techniques in Small Animal Practice, Vol 13,
No 2 (May), 1998: pp 88-95
23. Tarello, W., - Dermatitis associated with Dirofilaria repens Microfilariae in a Dog from Rome. The Veterinary
Journal, 2003, 165, 175177
24. Valcalis, N. C., Kounelis, S. D., Karaiosifidou, H. K., Vassilaros, S. D., Kouri,E. M. - Breast nodule caused
by Dirofilaria repens . The Breast (1998) 7, 345-346
25. Yildirim, A., Ica, A., Atalay, O., Duzlu, O., Inci, A. - Prevalence and epidemiological aspects of
Dirofilaria immitis in dogs from Kayseri Province, Turkey Research in Veterinary Science, Volume 82,
Issue 3, June 2007, Pages 358-363
26. Weill, F.X.I, Accoceberry I.l, Montane, V., Le Moine, J.J. , Couprie, B., Djosso, I.F., Malvy, D., Le Bras, M. Dirofilariose orbitaire a Dirofilaria repens en France.Un cas humain contracte sur le littoral atlantique. Med. Mal.
Infect 1999 ; 29 : 642-5

127

Universitatea de tiine Agricole i Medicin Veterinar

VALOAREA DE DIAGNOSTIC A EXAMENULUI CITOLOGIC AL


LICHIDULUI CEFALORAHIDIAN LA C]INI CU AFECIUNI
NEUROLOGICE
THE DIAGNOSTIC VALUE OF CEREBROSPINAL FLUID CYTOLOGY IN DOGS
WITH NEUROLOGICAL CONDITIONS
PAVEL Geta, MUSTEA M., DRAGU Corina, NECULAE Irina
FMV Iai
Afeciunile intracraniene i spinale la cine au cauze extrem de variate fiind ncadrate n
neuroinfecii bacteriene sau virale, rareori parazitare sau micotice, neoplazii primare sau
metastatice i tulburri ischemice sau degenerative.
Examenul citologic al lichidului cefalorahidian (LCR) constituie singurul mijloc de diagnostic
general acceptat pentru diferenierea proceselor inflamatorii de cele non-inflamatorii ale SNC.
In prezentul studiu s-au investigat din punct de vedere citologic 21 probe de lichid
cefalorahidian obinute prin puncie occipitoatloidian de la cini cu diferite afeciuni neurologice.
Un numr redus de probe a prezentat oligocitoz (14,3 %), n timp ce restul probelor de LCR - 85,7
%, au prezentat diferite grade de pleiocitoz.
Studiul tabloului citologic al fiecrei probe de LCR ne-a permis ncadrarea acestora ntr-un
anumit sindrom citologic, avnd drept criterii de difereniere tipul celular prevalent, activarea
celular limfo-plasmocitar sau monocito-macrofagic i prezena unor celule atipice, izolate sau
sub form de placarde celulare mari.
Rezultatele noastre ne-au condus la orientarea ctre tipul lezional al afeciunii neurologice
(hemoragie, ischemie, inflamaie, neoplazie), precum i la stabilirea stadiului de evoluie al
procesului patologic.
Key words: cytology, cerebrospinal fluid, dog, neurological conditions

Variaia cantitativ i calitativ a componentei celulare a lichidului cefalorahidian (LCR)


prezint importan pentru stabilirea diagnosticului tulburrilor neurologice. Neuropatologia
veterinar a carnivorelor de companie prevede modificri citologice ale LCR n variate maladii
inflamatorii i noninflamatorii la cine: maladiile traumatice i compresive medulare, mielopatia
ischemic a cinilor de talie mare, meningoencefalomielita granulomatoas, meningoenecefalita
necrozant, meningitele virale (cea mai frecvent, boala lui Carr), sindromul meningit-arterit
sensibil la steroizi, vasculite sistemice de tip imun, boli micotice (criptococoza canin), parazitare
(neosporidioza, toxoplasmoza) i neoplazii ale SNC (primare sau metastatice) (5, 6, 8).
Examenul citologic al LCR permite ncadrarea unei afeciuni neurologice n una din categoriile:
boal ischemic primar, cu sau fr asocierea unui proces inflamator; proces inflamator (seros, serohemoragic, purulent) aflat ntr-un anumit stadiu de evoluie; proces neoplazic cu sau fr asocierea
unui proces inflamator (1, 4). Studiile anterioare (Cristopher Lamb i colab., 2004) efectuate la cini
cu afeciuni neurologice au stabilit c aspectele normale ale MRI (Magnetic Resonance Imaging) nu
exclud boala inflamatorie intracranian, iar evidenierea neoplasmului prin MRI nu exclude asocierea
sa cu un proces inflamator (6). Aceste date din literatura de specialitate, alturi de prezentul studiu
efectuat la cini cu manifestri clinice neurologice arat c analiza LCR, inclusiv citologia exfoliativ,
constituie alturi de examenul clinic i alte examene complementare o verig important n
diagnosticul etiopatogenetic al bolilor SNC.
MATERIAL I METOD
S-au investigat 21 de probe de lichid cefalorahidian, provenite de la cini diagnosticai clinic cu
afeciuni neurologice. Lichidul cefalorahidian s-a recoltat n tuburi cu EDTA, prin puncie occipitoatloidian, din cisterna cerebelo-medular (cisterna magna). Examenul citologic cantitativ i calitativ
s-a efectuat n cadrul Laboratorului clinic al Facultii de Medicin Veterinar din Iai, imediat dup
recoltare. Pentru determinarea numrului total de celule nucleate (NTCN/l LCR) s-a utilizat metoda
hemocitometric (camera de numrat Brker-Trk i lichidul Trk n diluia 1:1). Examenul citologic
calitativ s-a efectuat dintr-un citoconcentrat obinut prin sedimentare n camer (camera de tip Zayk)
i colorat prin metoda May-Grnwald-Giemsa (3).
128

Lucrri tiinifice vol. 51 seria Medicin Veterinar


REZULTATE I DISCUII
Rezultatatele privind NTCN/l LCR i raportul ntre tipurile celulare identificate n LCR sunt
prezentate n tabelul 1.
Din analiza rezultatelor obinute, se constat c la trei dintre cazuri (14,3 %) NTCN/l LCR se
ncadreaz n limite normale (sub 5 cel.nucleate/l LCR), ncadrarea citologic fiind de oligocitoz
patologic, datorit modificrii formulei celulare a LCR. La restul cazurilor (86,7 %), NTCN/l LCR a
depit limita superioar considerat fiziologic, probele fiind ncadrate n diferite grade de
pleiocitoz: redus la 42,8 % din cazuri, medie la 33,3 % i pronunat la 9,5 % din cazuri.
Oligocitoza patologic, dup tipul celular prevalent n LCR, a fost de tip mononuclear
monocitar la cazurile 1 i 20 i mixt la cazul 14 (tabel 1).
In condiii fiziologice, raportul Lf/Mo n formula citologic a LCR este obinuit 2/1, cu un
procent redus de neutrofile (sub 1 %) i fr hematii, eozinofile i bazofile. Predominana monocitelor
n LCR la cazurile luate n studiu (raportul Lf/Mo fiind 2/3) i prezena neutrofilelor i eozinofilelor,
alturi de monocite, macrofage, hematii aglutinate i eritrofagocite se evideniaz n figurile 1-6.
Datele din literatura de specialitate prevd o prevalen numeric a elementelor liniei
monocitare i semne ale activrii lor n bolile noninflamatorii ischemice sau tumorale, ca i n stadiul
final al procesului inflamator. Exist i neuroinfecii intracraniene la care oligocitoza de tip monocitar
persist timp ndelungat dup dispariia agentului infecios, constituind aa-numitul stadiu monocitar
rezidual (1, 4, 6). La cazurile 1 i 20 luate n studiu, LCR oligocitic, cu reacie de tip monocitar, n
absena neutrofilelor i prezena unor aglomerri celulare atipice (fig.3 i 4), pledeaz pentru
diagnosticul de neoplasm intracranian. Oligocitoza mixt (caracterizat prin prezena neutrofilelor,
eozinofilelor i a unei proporii mari de monocite i macrofage tabel 2) pledeaz la cazul 14 pentru
ischemie de compresiune, asociat cu un proces inflamator serohemoragic, stadiul final.
Tabel 1
Numrul total de celule nucleate (NTCN/l) i tipul celular prevalent n probele de lichid cefalorahidian (LCR) la
cinii cu manifestri clinice neurologice investigai n perioada 2007-2008.
Nr.
Caz clinic
Examen citologic LCR
crt.
NTCN/l
Rap.PMN/MN
Rap. Lf/Mo
1.
Metis, 7 luni, crize epileptiforme
4,4
2/3
2.
Bichon, 9 luni, crize epileptiforme, sindrom
14,8
6/1
vestibular
3.
Metis, 5 luni, suspiciune clinic maladia lui
26,3
1/3
Carr
4.
Labrador, 7 luni, suspiciune clinic maladia
28,3
2/1
lui Carr
5,5 a
1/1 a
5.
Ras comun, 4 ani, suspiciune clinic
18,3
4/1
maladia lui Carr
6.
Ras comun, 2 ani, suspiciune clinic
25,4
1/2,2
1,3/1
maladia lui Carr
7.
Ciobnesc german, 3 ani, suspiciune clinic
31,7
2,8/1
maladia lui Carr
8.
Ras comun, 1 an, suspiciune clinic
101,0
2,3/1
maladia lui Carr
9.
Ciobnesc german, compresiune medular
31,2
2/1
traumatic
10.
Metis, compresiune medular traumatic
13,0
2/1
11.
Metis, 9 ani, compresiune medular
30,0
1/1
1/1,7
atraumatic
12.
Ciobnesc german, 1 an, luxaie T13-L1,
200,0
3,3/1
1/1,6
LCR hemoragic
136,1 b
1/1,1b
1/43,1b
13.
Metis, sindrom filum terminale
18,5
1,2/1

14.
Metis, 3 luni, anomalie congenital T12
4,5
1/1,9
1/2,5
(mielografie)
15.
Doberman, tumori mamare, compresiune
10,0
2/1
medular
16.
Canish, 16 ani, sindrom vestibular
10,0
3,3/1
17.
Metis, sindrom vestibular
20,0
2,7/1

129

Universitatea de tiine Agricole i Medicin Veterinar


Nr.
crt.
18.
19.

Caz clinic
Ciobnesc german, 14 ani, sindrom vestibular
Boxer, 6 ani, meningit cervical

Examen citologic LCR


15,4
1/1,8
70,0
2/2,3
39,0 c
20
Setter, 8 ani, orbire central
4,0
21
Amstaff, 9 ani, paralizie n.facial
13,5
2/3
a, b, c repetarea examenului LCR; PMN polimorfonucleare; MN mononucleare.

1/3
1/1,7
2/3
1,4/1

Fig.1. LCR, oligocitoz mononuclear (cine


metis, 7 luni, crize epileptiforme): un monocit
activat i un limfocit. MGG, x1000.

Fig.2. LCR, oligocitoz monocitar (Setter, 8


ani, orbire): un monocit activat i un
macrofag cu microvacuole. MGG, x 1000

Fig.3. LCR, acelai caz de la fig.1: placard


celular, reprezentat de mononucleare.
MGG, x 1000.

Fig.4. LCR, acelai caz de la fig.2: grup de


celule atipice caracterizate prin polimorfism
celular, MGG, x 1000.

Fig.5. LCR, oligocitoz mixt (cine metis, 3


luni, anomalie congenital T12):
eritrofagocitoz. MGG, x1000.

Fig.6. LCR, oligocitoz mixt (acelai caz de


la fig.5): hematii aglutinate n jurul unui
neutrofil. MGG, x1000.

Pleiocitoza (creterea numrului de celule nucleate din LCR) la cazurile luate n studiu s-a
caracterizat prin prevalena n formula celular a limfocitelor pleiocitoz limfocitar (7 cazuri), a
monocitelor pleiocitoz monocitar (1 caz), n egal msur a limfocitelor i monocitelor
pleiocitoz mononuclear (3 cazuri), a neutrofilelor (1 caz) pleiocitoz neutrofilic i a neutrofilelor
alturi de moncite i macrofage pleiocitoz mixt (6 cazuri) (tabel 1 i tabel 2).
130

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Nr.
crt.
1
2
3
4
5
6
7

Tabel 2
Formula citologic a LCR la cazurile de oligocitoz i pleiocitoz neutrofilic i mixt
Identificar Pleiocitoz/ oligocitoz
Nf.
Eo.
Mo
Mfg.
e caz clinic
%
%
%
%
Caz nr.6
Pleiocitoz medie, mixt
31,6
0
23,7
6,1
Caz nr.11
Pleiocitoz medie, mixt
37,0
13,0
21,0
11,0
Cazul 12
Pleiocitoz pronunat, Nf
76,6
0
10,4
3,9
b
Pleiocitoz pronunat mixt
47,0
0
48,1
3,7
Cazul 13
Pleiocitoz redus, mixt
56,6
2,4
27,7
0
Cazul 14
Oligocitoz mixt
18,7
15,6
21,8
25,0
Cazul 19
Pleiocitoz medie, mixt
37,0
1,8
29,6
9,3
Cazul 21
Pleiocitoz redus, mixt
28,0
12,0
8,0
0

Lf.
%
38,6
18,0
9,1
1,2
13,3
18,8
22,2
52,0

Pleiocitoza limfocitar, caracterizat n studiul nostru printr-un raport Lf/Mo variabil de 2,26/1 s-a ntlnit la 4 dintre cazurile suspicionate de maladia lui Carr, la un caz cu manifestri
epileptiforme i la 2 cazuri de sindrom vestibular. Predominana n LCR a limfocitelor mici mature i a
unui numr suficient de mare de limfocite activate este n mod caracteristic asociat de citopatologii
umani i veterinari cu bolile inflamatorii nesupurative (inflamaiile seroase), a cror ageni patogeni
sunt n principal virusurile (1, 2, 5, 7, 8). Nu se exclud ns la cine erlichioza, toxoplasmoza,
neosporidioza sau meningita bacterian dup terapia cu antibiotice (5, 7). Transformrile blastice
limfocitare pn la stadiul de plasmocite caracterizeaz evoluia unui proces inflamator cronic (1). La
cazurile luate n studiu, examenul microscopic al LCR a relevat prezena limfocitelor mici, a
limfoplasmocitelor i a plasmocitelor (fig.7, 8). La unul dintre cazuri (nr.4, tabel1), alturi de reacia
limfoplasmocitar se evideniaz n LCR aglomerri celulare mixte, reprezentate de numeroase
plasmocite, monocite i macrofage (fig.9).
Pleiocitoza monocitar, evideniat la un caz de suspiciune a maladiei Carr printr-un raport
Lf/Mo de 1/3 i a unor aglomerri de monocite activate (fig.10), n absena neutrofilelor, indic
stadiul final al unui proces inflamator nesupurativ. Absena unui material celular fagocitat i
evidenierea picturilor lipidice n macrofage caracterizeaz, conform datelor din literatura de
specialitate, ischemia sau degenerescena tisular a SNC, iar lipofagele n numr mare sunt
caracteristice fenomenelor de necroz cerebral (1, 4).
Pleiocitoza mononuclear, caracterizat printr-un raport Lf/Mo de 1,5-1,8/1, cu o reducere a
procentului de limfocite n favoarea monocitelor, dar fr ca acestea din urm s devin
predominante, s-a ntlnit la 3 cazuri de compresiune medular, dou traumatice i unul n cursul
evoluiei bolii tumorale. Dei se dezvolt procese ischemice locale prin compresiune medular,
modificarea formulei citologice a LCR nu este evident, deoarece proba de LCR s-a recoltat dintr-o
zon superioar leziunii. La cazul cu tumori mamare, s-au evideniat n preparatul citologic aglomerri
celulare mixte, limfo-monocitare (fig.11).
Pleiocitoza neutrofilic, ncadrat astfel datorit unui procent crescut de neutrofile n formula
celular a LCR, raportul PMN/MN fiind de 3,3/1 (Nf 76,6 %; Mo-Mfg 14,3 %; Lf 9,1 %), s-a ntlnit la un
singur caz cu diagnostic clinic i radiologic de luxaie T13-L1. Microscopic se observ un cmp bogat
neutrofilic, cu cteva monocite activate, macrofage, hematii aglutinate, material digerat acidofil,
uneori resturi de nuclei fagocitai. Nu se evideniaz microorganisme fagocitate (fig.12). Literatura de
specialitate consider pleiocitoza neutrofilic specific meningitei bacteriene. La cine ns, mai ales
sub vrsta de 1 an, s-a diagnosticat o meningit corticosensibil, la care neutrofilele din LCR nu
prezint degenerare hidropic, iar examenul microbiologic al LCR este negativ (5, 8). La cazul
investigat, pleiocitoza a devenit mixt, neutrofilic monocitar, iar diagnosticul etiopatogenetic a
fost de proces inflamator supurativ, cu evoluie rapid ctre stadiul final de reparaie monocitomacrofagic.

131

Universitatea de tiine Agricole i Medicin Veterinar

A
C
Fig.7. LCR, pleiocitoz limfocitar (cine, suspiciune maladia lui Carr, caz 5): A. 3 limfocite, 2
macrofage, fond hemoragic. B. 2 limfoplasmocite. C. Plasmocit MGG, x1000.

B
Fig.8. LCR, pleiocitoz limfocitar (Bichon, crize
epileptiforme, caz 2): A. Limfo-plasmocite. B.
Plasmocit. MGG, x1000.

Fig.10 LCR, pleiocitoz monocitar (cine,


suspiciune maladia lui Carr, caz 3): aglomerare
de monocite i macrofage. MGG. X 1000.

132

Fig.9. LCR. Limfocitoz limfoplasmocitar


(Labrador, 7 luni, suspiciune maladia lui Carr, caz
4): aglomerare de celule mononucleare: limfocite,
plasmocite, monocite, macrofage. MGG, x 1000.

Fig.11. LCR, pleiocitoz mononuclear (Doberman,


boal tumoral, compresiune medular, caz 15):
aglomerare de celule mononucleare limfocite
nconjurate de monocite i macrofage. MGG, x1000.

Lucrri tiinifice vol. 51 seria Medicin Veterinar

A
B
Fig.12. LCR, pleiocitoz neutrofilic (cine, luxaie, T13-L1, caz 12): A.Cmp de neutrofile pe un fond
hemoragic. B. Neutrofile normale i degenerate, eritrofagocitoz (faz intermediar de digestie a
hematiilor nglobate n macrofage) MGG, x 1000.

Fig.13. LCR, pleiocitoz mixt (caz 12, acelai de la


fig.12): Neutrofile i monocite activate pe un fond de
hematii aglutinate. MGG, x 1000.

Fig.14. LCR. Pleiocitoz mixt (metis, 9 ani,


compresiune medular atraumatic, caz 11):
Neutrofile i monocite n jurul unei placarde
celulare (celule atipice, de tip neoplazic). MGG,
x1000.

Pleiocitoza mixt, caracterizat printr-un raport PMN/MN variabil 1-2/1-3, cu o populaie


celular mixt, reprezentat preponderent de polimorfonucleare i monocite, s-a ntlnit la cazuri cu
patologie divers (suspiciune jigodie, compresiune medular atraumatic, sindrom filum terminale,
sindrom vestibular, meningit cervical, paralizie de nerv facial). Aspectele microscopice ale
celularitii LCR la dou dintre cazurile studiate sunt prezentate n figurile 13 i 14.
Conform datelor din literatura de specialitate, bolile infecioase de natur bacterian sau
micotic care se caracterizeaz prin pleiocitoz neutrofilic n mod obinuit, pot genera uneori
pleiocitoz mixt marcat. Dac pleiocitoza mixt este redus sau medie, ea se datoreaz unui proces
inflamator sau unei necroze cauzate de neoplasme, hernii discale, traumatisme, mielomalacii
hemoragice sau infarcte (1, 5, 8).
Prezena neutrofilelor n LCR ntr-un procent de 31,6 % la cazul nr.6 cu suspiciune de maladia
lui Carr relev existena unor zone de encefalomalacie asociate leziunii primare. La cazurile de
compresiune medular, cu sau fr traumatism (caz 11, 12, 13), ca i la cazul de meningit cervical
(cazul 19) i de paralizie a n.VII (cazul 21), pleiocitoza mixt - Nf, Eo, Mo, Mfg i Lf n procente
variabile n LCR (tabel 2), alturi de eritrofagocitoz, atipii celulare, indic prezena unei inflamaii
primare cu evoluie ctre stadiul final reparator (caz 19) sau a unor leziuni acute, grave, de tip
inflamator care nsoesc fie un traumatism (cazurile 12, 13), fie un neoplasm (cazurile 11 i 21).
Rezultatele privind ncadrarea probelor de LCR ntr-unul din sindroamele citologice cunoscute
i orientarea diagnosticului etiopatogenetic n funcie de aceast ncadrare, confirm importana
examenului citologic al LCR n diagnosticul bolilor neurologice la cine.

133

1.

2.

3.

4.

5.

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII
Examenul citologic cantitativ i calitativ al LCR la cinii cu manifestri clinice neurologice ne-a
condus la ncadrarea probelor examinate ntr-unul din sindroamele citologice cunoscute:
oligocitoz patologic (14,3 %) sau pleiocitoz redus (42,8 %), medie (33,3 %), pronunat (9,5
%), cu stabilirea concomitent a tipului celular prevalent (limfocite, monocite, neutrofile sau
populaie celular mixt) i orientarea diagnosticului etiopatogenetic.
Oligocitoza patologic monocitar i prezena n LCR a celulelor atipice a orientat diagnosticul
ctre neoplazie, n timp ce tipul mixt de oligocitoz, evideniat la un caz de anomalie congenital
n regiunea medular L12, a relevat un proces inflamator sero-hemoragic n stadiul final, asociat
ischemiei de compresiune.
Pleiocitoza limfocitar de grad redus, mediu i pronunat, evideniat la 4 cazuri de suspiciune a
maladiei Carr, la unul din cazurile cu manifestri epileptiforme i la 2 cazuri de sindrom
vestibular, a orientat diagnosticul etiopatogenetic ctre o inflamaie nesupurativ, subacutcronic a SNC. Evoluia ctre faza reparatorie final a procesului inflamator a fost relevat de
prezena la unul din aceste cazuri a pleiocitozei monocitare.
Pleiocitoza neutrofilic, pronunat (NTCN 200/l) urmat la interval de 2 zile de pleiocitoz
mixt, la un caz de compresiune medular posttraumatic, a permis orientarea diagnosticului
ctre inflamaie supurativ acut, cu evoluie rapid ctre stadiul reparator monocitar.
Pleiocitoza mixt (Nf, Mo, Mfg), ntlnit la 6 cazuri cu manifestri neurologice variate, a orientat
diagnosticul fie ctre encefalomalacie, asociat bolii Carr, fie ctre stadiul final al unei inflamaii
supurative, fie ctre un proces inflamator asociat unei leziuni primare de tip ischemic sau
neoplazic.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.

Adam, P. et. al., Cerebrospinal fluid cytology, Rev.Med.Lab.-JLM, 3 (2): 46-51, 2002.
Amude, A.M. et. al., Cerebrospinal fluid from a 7-month-old dog with seizure-like episodes, Vet.Clin.Pathol., 35
(1): 119-122, 2006.
Arseni, C., D. Chimion, Lichidul cefalo-rahidian, Ed.Didactic i Pedagogic, Bucureti, 1979.
Bell, J.E., Update on central nervous system cytopathology. I. Cerebrospinal fluid, J.Clin.Pathol, 47: 573-573,
1994.
Cowell, R.L., R.D. Tyler, J.H. Meinkoth, Ghide pratique de cytologie et hmatologie du chien et du chat,
Elservier Ink, New York, Edition MedCom, Paris, 2006.
Lamb, C.R., P.J. Croson, R. Cappello, Magnetic resonance imaging findings in 25 dogs with inflammatory
cerebrospinal fluid, Vet.Radiology-Ultrasound, 46 (1): 17-22, 2005.
Tipold, A., Diagnosis of inflammatory and infectious diseases of the central nervous system in dogs: a
retrospective study, J.Vet. Intern Med., 9: 304-314, 1995.
Wamsley H. and A.R. Alleman, Clinical pathology in Canine and Feline Neurology, pg.35-52, BSVA, 2004.

134

Lucrri tiinifice vol. 51 seria Medicin Veterinar

CERCETRI MORFOLOGICE PRIVIND CAVITATEA BUCAL


LA SPECIA STRUTHIO CAMELUS
MORPHOLOGICAL RESEARCHES CONCERNING ORAL CAVITY
IN STRUTHIO CAMELUS
PREDOI tefania1, CORNIL N.1, CAZIMIR Iuliana1, GEORGESCU B.1,
BIOIU Carmen2, TOADER A. I.1, ZVORISTEANU Raluca3
1FMV Bucureti
2ANSVSA. Bucuresti
3DSVSA Ilfov
In the speciality literature, the informaton about oral cavity morphology in ostrich (Struthio
camelus) are extremely rare, many of them referring to the Gallus domesticus species.
The tongue is an narrow organ which has its root towards the pharynx and has pharyngeal
origin although, most of it can be found in the oral cavity. [1,3,5] It has very little mobility (only
movements of propulsion and retropultion), the apex sharp in Galliformes and rounded in
Anseriformes and Strutioniforme. All its surface is crossed by entoglossal bone. The musculature
of the tongue appears to be reduced
than in mammals, and the mucosa has keratinized epithelium, with numerous filiform
papillae. The apex is keratinized in Galliformes and softly in Anseriformes and
Strutioniforme.[2,4,6]
Key words: ostrich, oral cavity, tongue, histostructure

Cunoaterea n detaliu a elementelor la nivel celular, tisular sau de organ la anumite specii i
vrste permite explicarea i interpretarea corect a diverselor aspecte fiziologice sau patologice
legate de structurile studiate.
Datele existente n literatura de specialitate privind morfologia cavitii bucale la psri sunt
relativ rare i se refer mai ales la specia Gallus domesticus. Preluarea unor date morfologice de la o
specie i transpunerea lor la alt specie apare inadecvat, fiind cunoscut faptul c structura i funcia
unor organe prezint accentuate particulariti de specie.
1. MATERIAL I METOD
Cercetrile au urmrit studiul morfologic al cavitii bucale la strui n vrst de 17 zile. Studiul
s-a efectuat pe un numr de 3 subieci, sacrificai experimental, provenii de la o cresctorie din
judeul Constana.
Investigaiile macroscopice au avut ca modalitate de studiu disectia si s-au efectuat la
disciplina de Anatomie Comparat, iar cele histologice au fost efectuate la disciplina Biologie celular,
Histologie, Embriologie. Piesele recoltate din limb i fixate n formol neutru salin, au fost prelucrate
pentru includerea n parafin. Blocurile de parafin au fost secionate la 6 microni i colorate prin
metodele hematoxilin-eozin, hematoxilin-eozina- albastru de metil i Giemsa.
Examinarea preparatelor histologice s-a realizat cu ajutorul microscopului optic NIKONLABOPHOT 2, prevazut cu filtru de lumina BG. 33, Exponometru Nikon AFX-DX, i un aparat foto
digital Canon 640, iar imaginile au fost prelucrate computerizat cu ajutorul programului Adobe
photoshop 6.0.
2. REZULTATE I DISCUII
Cavitatea bucal este foarte larg, ciocul fiind format de cele dou valve, relativ scurte, cu
extremitile rotunjite (Fig. 1). Tavanul cavitii bucale este larg, mai scurt dect la nandu, baza
anatomic fiind reprezentat n cea mai mare parte de oasele incisive i maxilare (Fig. 2). Suprafaa
acestuia este neted, fiind absente papilele palatine. Deschiderile celor dou choane sunt largi,
separate n profunzime de septul nazal, ansamblul acestora avnd un aspect triunghiular. n plan
median, imediat napoia choanelor se observ un infundibul pe pereii cruia se deschid tubele
auditive.
Limita aboral a tavanului este marcat de marginea liber a dou falduri palatine, ce amintesc
prin aspectul lor de vlul palatin al mamiferelor (Fig. 3). De o parte i de alta a choanelor, ca de altfel
135

Universitatea de tiine Agricole i Medicin Veterinar


i pe partea ventral a faldurilor palatine se observ numeroase deschideri ale glandelor salivare
palatine diseminate.
Podeaua cavitii bucale este acoperit de limb doar n sfertul posterior, ntruct la aceast
pasre limba este scurt, neted, de forma unui triunghi echilateral. Entoglosul, baza anatomic a
limbii, este scurt i lat (Fig. 4).
napoia bazei limbii se observ fanta laringian, uor ngustat n partea caudal, delimitat
lateral de aritenoide. Datorit existenei unor incizuri la jumtatea marginii laterale a cartilajelor
aritenoide, i datorit procricoidului situat napoia fantei laringiene, n jurul ultimei apar cinci
proeminene caracteristice (Fig. 4). Lipsesc papilele laringiene ntlnite la speciile domestice
(galinacee i palmipede).
In urma studiilor histologice efecutuate s-a observat ca la struul n vrst de 17 zile limba are
un schelet cartilaginos, reprezentat de entoglosul hiodian. Condroplastele, distanate datorit
interpunerii matricei cartilaginoase, prezint cte una, maxim dou condroblaste sau rare condrocite.
Grupele izogenice coronare i cele axiale nu sunt schiate n acest stadiu al dezvoltrii (fig.5).
Musculatura limbii este de tip striat scheletic. Printre fasciculele musculare, n esutul
conjunctiv apar vase de snge i nervi (fig.6).
Epiteliul mucoasei linguale la stru apare stratificat pavimentos cu slabe tendine de
cornificare, comparativ cu galinaceele, la care procesul cornificrii se accentueaz (fig. 7 ).
Pe faa dorsal, grosimea epiteliului este aproape dubl fa de cea de pe faa ventral.
Membrana bazal apare puternic ondulat, datorit numeroaselor papile ale corionului, foarte adnci
i nguste, la aceast specie. ntregul esut conjunctiv al corionului papilar este mpnzit de capilare
dilatate, ordonate, datorit modalittii de aranjare n pliurile epiteliale, ce le creeaz un paralelism
moderat ( fig.8).
Formaiunile glandulare se ncadreaz n tipul glandelor compuse mucoase, tubulo-alveolare,
aparnd formate din numeroi lobuli delimitai ntre ei prin septe conjunctive, ctre regiunea bazal a
limbii, n zona dorso-lateral. Fiecare lobul cuprinde tubulo-alveole largi, globuloase, deschise ntr-o
cavitate central, de unde pornete un canal excretor. La nivelul feei dorsale a limbii predomin
glandele tubulo-alveolare mucoase simple, foarte bine ataate de epiteliu, n condiiile formrii
pliurilor specifice descrise anterior (fig.9 ).

Fig. 1. Cavitatea bucal la stru (original)


Fig. 1. Oral cavity in the ostrich (authentic)

136

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 2. Faa ventral a craniului la stru (original)


Fig. 2. Ventral surface of the head in the ostrich (authentic)

Fig. 3 Tavanul cavitii bucale la stru (original)


Fig.. 3. Oral cavity roof in the ostrich (authentic)

Fig. 4 Podeaua cavitii bucale la stru (original)


Fig. 4. Oral cavity floor in the ostrich (authentic)

137

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 5. Stru 2,5 sptmni, cartilaj hialin, Col. HE; Ob. 20x.
Fig. 5. Two and a half weeks old ostrich; hyalin cartilage; HE. col.; 20x Ob.

Fig. 6. Stru 2,5 sptmni; ; esut muscular striat scheletic; Col. HE; Ob. 40x.
Fig. 6. Two and a half weeks old ostrich; scheletal muscle tissue; HE col.; 40x Ob.

Fig. 7. Stru 2,5 sptmni; epiteliu stratificat pavimentos - faa dorsal; Col. Giemsa; Ob. 20x.
Fig. 7. Two and a half weeks old ostrich; stratified squamous epithelium dorsal surface Giemsa col.; 20x Ob.

138

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 8. Stru 2,5 sptmni; epiteliu stratificat pavimentos faa dorsal; Col. Giemsa; Ob. 40x.
Fig. 8. Two and a half weeks old ostrich; detail epitelium dorsal surface; Giemsa col.; 40x Ob.

Fig. 9. Stru 2,5 sptmni; glande tubulo-alveolare mucoase; Col. HE; Ob. 20x
Fig. 9. Two and a half weeks old ostrich; tubulo-alveolar mucous glands HE col.; 20x Ob.

3. CONCLUZII
3.1. Limba este scurt, neted, de forma unui triunghi echilateral, aspect datorat, n mare
parte entoglosului redus i lat, ce-i servete drept baz anatomic.
3.2. La nivelul plafonului cavitii bucale se constat lipsa papilelor palatine.
3.3. napoia fantei laringiene apar cinci proeminene caracteristice.
3.4. Mucoasa limbii la stru prezint un epiteliu stratificat pavimentos cu slabe tendine de
cornificare.
3.5. Membrana bazal a epiteliului mucoasei linguale este puternic ondulat, datorit
numeroaselor papile ale corionului, foarte adnci i nguste, intens vascularizate.
BIBLIOGRAFIE
1.
2.
3.
4.
5.
6.

Cornila, N., N. Manolescu Structura i ultrastructura organelor la animalele domestice, Ed. Ceres,
Bucureti,1996.
2.Delhmann, H., E.M. Brown Textbook of Veterinary Histology, Ed. Philadelphia, Lea & Febinger, 1992.
Gheie, V., t. Chiescu, V. Coofan, A. Hillebrand - Atlas de anatomie a psrilor domestice, Ed. Academiei
R.S.R., Bucureti, 1976.
Harrison, J.G. Tonque in a New Dictionary of Birds, Ed. Thomson. A.L.London, Nelson, 1964.
King, A.S., J. Mc Lelland - Birds their structure an function, Second edition, Ed. Baillere Tindall, London
Philadelphia Toronto, 1984.
King, A.S Form and Function in Birds, Vol.2, Ed. King,A.S.&McLellandJ. London& New York, Academis
Press, 1980.

139

Universitatea de tiine Agricole i Medicin Veterinar

MONITORIZAREA MODIFICRILOR BIOCHIMICE DIN STRESUL


OXIDATIV SPECIFIC OCRATOXICOZEI A INDUSE PRIN
ADMINISTRAREA DE APII AETHEROLEUM
EVALUATION OF BIOCHEMICAL CHANGES FROM
OXIDATIVE STRESS SPECIFIC TO OCHRATOXICOSIS
INDUCED BY APII AETHEROLEUM ADMINISTRATION
PRISCARU Cornelia1, BURLACU Anca-Irina2, ROTARU Liliana 3
1FMV Iai
2Universitatea de Medicin i Farmacie Iai, Facultatea de Farmacie
3Facultatea de Horticultur, Iai
corneliapris@yahoo.com
Ochratoxin A is the secondary metabolite of some Aspergillus and Penicillium mycets. Its
structure includes a rest of phenylalanine and an isocumarinic nucleus, structural fragments
linked by an amidic bond. Ochratoxin A expresses its acute toxic, teratogenic, carcinogenic and
immunosuppressive effect due to the amino acid part from its structure that inhibits the proteic
synthesis. This mycotoxin lives on different vegetal foods from temperate areas and is the
etiologic agent of swine nephropathy and Balkan endemic nephropathy (BEN). The present
experiment consisted of four groups of rats that were treated in order to emphasize a possible
way of diminishing the oxidative stress in the intoxication with ochratoxin A. One group of
animals was given a dose of 8 ppm of ochratoxin A in order to distinguish the control of oxidative
stress. In order to emphasize the antitoxic potential of the phtalides from Apii aetheroleum, a
second group of animals was concomitantly given the dose of mycotoxin and volatile oil extracted
from Apium graveolens. The evaluation of the antioxidant effect of the active principles from the
tested vegetal product has been achieved in correlation with the antitoxic decreasing effect
exerted by phenylalanine administered concomitantly with the ochratoxin. The biochemical
investigation consisted of establishing some oxidative stress markers and emphasizes the
antitoxic effect of phthalides from Apium graveolens regarding phenylalanine.
Key words: Ochratoxin A, Apii aetheroleum, oxidative stress, superoxide dismutase, catalase,
glutathion peroxidase

Ocratoxina A este reprezentantul unei clase de micotoxine elaborate de micei din genul
Aspergillus, prevalent A. ochraceus i din genul Penicillium (P. verrucosum) (1). Posesoarea unei
structuri generate de condensarea amidic a unui rest de L-fenilalanin cu un nucleu izocumarinic,
ocratoxina A manifest aciune nefrotoxic, hepatotoxic, imunosupresiv, teratogen i carcinogen
(2). Este implicat n provocarea nefropatiei endemice balcanice i nefropatiei porcine, toxicodinamia
la nivel molecular a ocratoxinei fiind consecina inhibrii fosfoenolpiruvatcarboxi-kinazei, fenilalanilARNt-sintetazei i fenilalanil-hidroxilazei.
Ftalidele, substane elaborate de unele plante din familia Apiaceae (Apium graveolens,
Levisticum officinale, Ligusticum acutilobum), sunt lactone pentaatomice substituite i condensate pe
una din laturi cu un hexaciclu nesaturat. Fie c sunt alchil-ftalide sau alchiliden-ftalide, aceste
substane posed, printre altele, aciune detoxifiant hepatocitar i renal (3,4). Plecnd de la
argumentul c uleiul volatil obinut din Apii folium (Apii aetheroleum) conine 25 % ftalide,
reprezentate de sedanolid i n-butilftalid (fig. 1), s-a considerat oportun testarea efectului
antitoxic al acestuia (5) n intoxicaia cu ocratoxin A i compararea efectului antitoxic al uleiului
volatil de Apium graveolens cu cel al fenilalaninei.

140

Lucrri tiinifice vol. 51 seria Medicin Veterinar

O
O
Sedanolida

O
n-Butilftalida

Fig. 1- Structura chimic a unor ftalide din Apii aetheroleum

MATERIAL SI METOD
Modelul experimental a fost imaginat astfel nct s surprind modificrile biochimice ale unor
parametri cu valoare de markeri ai stresului oxidativ. Monitorizarea a fost efetuat pe fundalul
intoxicaiei cu ocratoxina A, micotoxin care, datorit restului de fenilalanin din structura sa,
blocheaz sinteza de proteine prin inhibarea competitiv a fenilalanil-ARNt-sintetaza. Pentru controlul
efectului antitoxic al ftalidelor din Levistici aetheroleum s-a recurs la strategia similitudinii structurale
administrndu-se unui lot de animale fenilalanin, aminoacid esenial care a constiuit obiectul unor
experimente ce au vizat diminuarea toxicitii micotoxinei. Experimentul a cuprins 4 loturi de cte 5
obolani albi, linia Wistar n vrst de 6 luni cu o mas ponderal medie de 156,6 g. Primul lot a
constituit lotul de referin, lot meninut n condiii de habitat standard. Cel de al doilea lot este lotul
martor al stresului oxidativ, lot menit s furnizeze informaii despre modificrile markerilor de stres
oxidativ, modificri provocate de impactul organismului cu ocratoxina A. n acest scop animalele
acestui lot au fost tratate cu o doz pro die de 8 ppm ocratoxin A. Cel de al treilea lot urma s redea
imaginea evoluiei parametrilor biochimici dup administrarea de fenilalanin, aminoacid esenial
regsit n structura chimic a micotoxinei investigate. Animalele acestui lot au primit concomitant
ocratoxin A n doz de 8 ppm i fenilalanin n doz pro die de 4 ppm. Ultimul lot, considerat lotul
experimental, a primit pe lng doza zilnic de ocratoxin i Apii aetheroleum n vederea testrii
aciunii antitoxice a ftalidelor din componena aceastui produs. Uleiul de elin a fost administrat
intern n doz pro die de 10 ppm. Experimentul s-a derulat pe o perioad de 6 sptmni, timp n care
animalele au fost tratate conform schemei de tratament din tabelul 1. La finalul experimentului s-a
recoltat snge pentru investigarea biochimic ce a constat n evaluarea unor markeri enzimatici ai
stresului oxidativ: catalaza (CAT), superoxid dismutaza (SOD) i glutation peroxidaza (G-Px).
LOTURI

Tabel 1 Modelul experimental


Ocratoxina A
Fenilalanin
[ppm]
-

Apii
aetheroleum
-

Lot 1
(lot de referin)
Lot 2
8
(lot martor SO)
Lot 3
8
4 ppm
(lot control SO)
Lot 4
8
10 ppm
(lot experimental)
Legend: CAT = Catalaza; SOD = superoxid dismutaza; G-Px = glutation peroxidaza

Parametrii
biochimici
CAT, SOD,
G-Px

REZULTATE I DISCUII
Rezultatele investigaiei catalazei serice sunt reprezentate n tabelul 2 i fig. 2. Studiul datelor
inserate n acest tabel i diagrama corespunztoare evideniaz faptul c activitatea acestei enzime
heminice localizat prevalent n peroxizomii hepatici nregistreaz o scdere dramatic pentru lotul
tratat exclusiv cu micotoxin. Astfel, dac pentru lotul de referin valoarea ei este de 6885 U/ml,
valoarea coboar pn la 5185 U/ml pentru lotul al doilea, brusca scdere fiind expresia consumului
141

Universitatea de tiine Agricole i Medicin Veterinar


enzimei n urma atacului micotoxinei, generatoare de stres oxidativ. n cazul celui de al treilea lot
activitatea catalazei se cifreaz la 6651 U/ml, ceea ce sugereaz efectul direct antitoxic, indirect
antioxidant al fenilalaninei exogene. O valoare superioar, apropiat de a lotului de referin (6853
U/ml), nregistrat pentru lotul tratat cu Apii aetheroleum, sugereaz un eficient efect antitoxic al
ftalidelor din produsul vegetal testat.
Tabel 2 Activitatea catalazei plasmatice
CATALAZA [U/ml]
minima
media
5900
6885
4566
5185
5990
6651
5651
6853

Loturi
Lot 1
Lot 2
Lot 3
Lot 4

Maxima
7751
6010
7015
7605

Catalaza [U/ml]
8000
7000
6000

minima

5000

MEDIA

4000
maxima

3000
2000
1000
0
lot 1

lot 2

lot 3

lot 4

Fig. 2 Activitatea catalazei serice

Traseul celei de a doua enzime (tabel 2, fig. 2), superoxid dismutaza, metaloenzim ce
acioneaz n tandem cu catalaza este similar traseului parcurs de catalaz, enzima pereche. Astfel,
activitatea superoxid dismutazei din sngele animalelor lotului de referin se cifreaz la 365 U/ml. n
sngele animalelor cuprinse n lotul al doilea valoarea enzimei scade la jumtate, adic la 185,3 U/ml,
scdere perceput ca o consecin a agresiunii ocrotoxinei A. Protecia cu fenilalanin exogen
conduce la o ameliorare a activitii enzimei pentru lotul al treilea care nregistreaz valoarea de
270,1 U/ml. Superoxid dismutaza atinge o valoare net superioar celei precedente pentru lotul ce a
beneficita de aport exogen de ulei volatil de Apium graveolens, aceast valore de 325 U/ml sugernd
puternicul efect antitoxic exercitat de produsul vegetal.
Loturi
Lot 1
Lot 2
Lot 3
Lot 4

Tabel 3 Activitatea superoxid dismutazei plasmatice


SUPEROXID DISMUTAZA [U/ml]
minima
media
maxima
330
365
385
128
185,3
290
211
270,1
301,5
285
325
371

Oscilaia glutation peroxidazei, aa cum reiese din tabel 3 i fig. 3, confirm evoluiile primilor
doi markeri de stres oxidativ, dei contribuia acesteia nu este la fel de spectaculoas. Dac pentru
lotul de referin activitatea enzimei se situeaz n jurul valorii de 88,1 moli/min/ml, pentru lotul
agresat de prezena micotoxinei se nregistreaz o diminuare de pn 46,3 moli/min/ml. Efectul
antitoxic al fenilalaninei exogene se concretizeaz n nregistrarea unei valori de 57,8 moli/min/ml a
glutation peroxidazei pentru lotul tratat cu aminoacidul ce se regsete n structura micotoxinei.

142

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Superoxid dismutaza [U/ml]


400
300

minima

200

MEDIA

100

maxima

0
lot 1 lot 2 lot 3 lot 4
Fig. 3 Activitatea superoxid dismutazei

O valoare augmentat, 69,66 moli/min/ml, atinge enzima n sngele animalelor lotului ce a


beneficiat de aport exogen de Apii aetheroleum, ceea ce sugereaz superioritatea potenialului
antitoxic/antioxidant al ftalidelor din compoziia uleiului volatil cercetat.
Loturi
Lot 1
Lot 2
Lot 3
Lot 4

Tabel 4 Activitatea glutation peroxidazei


GLUTATION PEROXIDAZA (moli/min/ml)
minima
media
69
88,1
38
46,3
48,3
57,8
58
69,66

maxima
93,6
58
66
81

Glutation peroxidaza
[moli/min/ml]
100
80
60
40
20
0

minima
MEDIA
maxima

lot 1 lot 2 lot 3 lot 4


Fig. 4 Activitatea glutation peroxidazei

CONCLUZII
Activitatea tuturor markerilor de stres oxidativ scade dramatic pentru lotul agresat de
prezena ocratoxinei A;
Evoluia catalazei serice evideniaz ameliorarea activitii acesteia pentru lotul tratat cu
fenilalanin;
Valoarea activitii catalazei pentru lotul protejat cu ulei volatil de Apii graveolens sugereaz
existena unui bun potenial antitoxic al ftalidelor din produsul vegetal;
Oscilaia valoric a superoxid dismutazei confirm existena unui efect antitoxic/antioxidant al
principiilor active din Apii aetheroleum;
Traseul nscris de glutation peroxideaz se coreleaz cu evoluiile celorlali doi markeri de stres
oxidativ.
BIBLIOGRAFIE
1.
2.
3.
4.
5.

Scudamore, K. A.,Nawaz, S., Hetmanski, M. T. (1998) Mycotoxins in ingredients of animal feeding stuffs:
Determination of mycotoxins in maize products, Food Addit. Contam, 15, 185-194;
Priscaru, C. (1998) Tez de doctorat, UMF Gr. T. Popa Iai;
Istudor, V. (2001) - Farmacognozie, Fitochimie, Fitoterapie, Vol II, Editura Medical, Bucureti, 223-226;
Stnescu, U.; Hncianu, M.; Miron, A.; Aprotosoaie, C. (2004) Plantele medicinale de la A la Z: Monografii ale
produselor de interes terapeutic, Vol II, Editura Gr.T.Popa, Iai, 348-350;
Priscaru, C., Rotaru, L. (2008) Monitorizarea efectului antitoxic al unor uleiuri volatile ce conin ftalide (Apii
aetheroleum i Levistici aetheroleum), Revista Medico-Chir. Soc. Med. Nat. Iai, vol II2, nr 2, Suplim. Nr 1, 412416;

143

Universitatea de tiine Agricole i Medicin Veterinar

TESTAREA EFECTULUI ANTITOXIC AL UNOR PRODUSE


VEGETALE CE CONIN FTALIDE
EVALUATION OF THE ANTITOXIC EFFECT OF
SOME PHTHALIDE CONTAINING VEGETAL PRODUCTS
PRISCARU Cornelia1, BURLACU Anca-Irina2
1FMV Iai
2Universitatea de Medicin i Farmacie Iai, Facultatea de Farmacie
corneliapris@yahoo.com
The constant presence of fumonisisns in Romanian cereals represents a risk factor for
consumers. Fumonisisns are esters of 2-amino and 2-acetamido-12,16-dimethyl-3,5,10,14,15pentahydroxy eicosan and represent the main etiological agent of equine leukoencephalomalacia,
pulmonary edema in swine, hepatocellular carcinoma in rats and has certain implications in
human esophageal cancer. The present paper aims to evaluate the antitoxic effects of some
vegetal products containing significant amounts of phthalides (Levistici folium i Levistici
aetheroleum) in the intoxication with fumonisin B1. The experiment was conducted using four
groups of Wistar rats, five animals per group. The first group was the control group. The animals
of the second group were given doses of 10 ppm fumonisin B1 pro die and represented the control
group for the fumonisin B1 toxicity. Besides the fumonisin dose, animals of the third group were
given Levistici folium phytopreparation, while the fourth group was protected with Levisticum
officinale volatile oil. In the end, the activities of some enzymes were tested: superoxide
dismutase (SOD), catalase (CAT), glutathion peroxidase (G-Px). The biochemical evaluation of
these oxidative stress markers emphasized the antitoxic effect of the active principles from
Levistici aetheroleum.
Key words: fumonisin B1, Levistici folium, Levistici aetheroleum, oxidative stress

Fumonizinele reprezint o clas de micotoxine elaborate de specii fungice aparinnd genului


Fusarium (F. proliferatum, F. anthophilium, F. dlamani, F. napiforme etc.). Din punct de vedere
structural, fumonizinele sunt esteri de 2-amino sau 2-acetamido-12,16-dimetil-3,5,10,14,15pentahidroxieicosan, avnd structur analog cu sfingozina i toxinele AAL produse de Alternaria
alternata f. sp. Lycopersici (1,2). Fumonizina B1 este considerat agentul etiologic al
leucoencefalomalaciei cailor, edemului pulmonar al suinelor, carcinomului hepatocelular al
obolanilor, avnd totodat implicaii certe n carcinogeneza esofagian uman (3,4). Incidena
crescut a acestor micotoxine n produse alimentare pe baz de cereale din zona temperatcontinental constituie un factor de risc pentru consumatori, ceea ce reclam necesitatea gsirii unor
ci de diminuare a toxicitii acestora. n acest context sunt testate calitile antitoxice/antioxidante
ale unor produse vegetale coninnd ftalide, substane care sunt apreciate pentru efectele antitoxice
la nivelul a dou dintre organele int ale fumonizinelor: ficat i rinichi. Ftalidele, lactone
pentaatomice substituite i condensate pe una din laturi cu un hexaciclu nesaturat, atribuie valoare
terapeutic unor plante din familia Apiaceae (Apium graveolens, Levisticum officinale, Ligusticum
acutilobum) (5). Att ca alchil-ftalide ct i ca alchiliden-ftalide, aceste substane posed, printre
altele, aciune detoxifiant hepatocitar i renal. Coninutul n ftalide ntr-o proporie de 50% a
uleiului volatil obinut din rdcina de Levisticum officinale (Levistici aetheroleum) constituie
argumentul pentru care acesta a fost folosit pentru testarea cilor de reducere a toxicitii
fumonizinelor. Ftalidele din Levisticum officinale sunt reprezentate de acidul sedanonic, n-butilftalid, butiliden ftalid i ligustilid (fig.1) (6,7).

144

Lucrri tiinifice vol. 51 seria Medicin Veterinar

OH
COOH

O
O
Ligustilida

Acid sedanonic

Fig. 1 Structura chimic a ftalidelor din Levistici aetheroleum

MATERIAL I METOD
Experimentul a urmrit evoluia unor parametri biochimici prin intermediul crora s se
evalueze comparativ efectele antitoxice ale unui fitopreparat obinut din frunze de Levisticum
officinale i ale uleiului volatil obinut din rdcina de Levisticum officinale (Levisticum aetheroleum).
Modelul experimental, aa cum este redat n tabelul 1, cuprinde 4 loturi a cte 5 obolani albi, linia
Wistar, avnd o mas ponderal medie de 156,6 g i o vrst de 6 luni. Primul lot a fost considerat
lotul de referin, evoluiile parametrilor biochimici testai raportndu-se la valorile obinute pentru
acest lot. Cel de al doilea lot a constituit lotul de control al stresului oxidativ provocat de
administrarea de fumonizin B1. Animalelor acestui lot li s-a administrat pe cale oral 10 ppm
fumonizin B1, doz pro die. Lotul al treilea a fost lotul experimental 1, lot ce urma s furnizeze
informaii despre eventualele efecte antitoxice ale fitopreparatului obinut din Levistici folium. n
acest scop celor 5 obolani din acest lot li s-a administrat o doz pro die de 10 ppm extract din frunze
de Levisticum officinale i aceeai doz de fumonizin B1. Ultimul lot, lotul experimental 2, a fost
tratat concomitent cu doza obinuit de micotoxin i cu 10 ppm Levistici aetheroleum. Experimentul,
derulat pe o perioad de 6 sptmni, s-a finalizat cu recoltarea de snge pentru investigaia
biochimic ce a constat n cuantificarea a 3 markeri de stres oxidativ: catalaza (CAT), superoxida
dismutaza (SOD) i glutation peroxidaza (G-Px).
LOTURI

Tabel 1 Modelul experimental


Fumonizina
Levistici folium
B1
3%
[ppm]
-

Levistici
aetheroleum

Parametrii
biochimici

Lot 1
CAT, SOD,
(Lot de referin)
G-Px
Lot 2
10
(Lot martor SO)
Lot 3
10
10 ppm
(Lot experimental 1)
Lot 4
10
10 ppm
(Lot experimental 2)
Legend:
SO = stres oxidativ; CAT = catalaza; SOD = superoxid dismutaza; G-Px = glutation peroxidaza

REZULTATE I DISCUII
Cuantificarea activitii catalazei serice, enzim ce are menirea de a scinda H2O2 rezultat din
aciunea dehidrogenazelor aerobe, a condus la rezultate ce se regsesc n tabelul 2 i diagrama din
fig. 2. Din studiul acestor date se observ o scdere semnificativ, previzibil a activitii acestei
enzime heminice pentru lotul supus impactului cu doza zilnic de fumonizin B1, scderea cifrndu-se
la 5993 U/ml fa de 7786 U/ml, valoarea lotului de referin. Aceast diminuare este justificat prin
consumarea enzimei n urma catalizrii reaciilor degradative ale peroxidului de hidrogen format n
urma accelerrii unor procese redox din mitocondrii i microzomi ca urmare a interveniei agresive a
micotoxinei. O accentuat i nejustificat diminuare a activitii catalazei se nregistreaz n sngele
animalelor din lotul experimental 1. Valoarea catalazei acestui lot este inferioar lotului de control a
stresului oxidativ, ea cifrndu-se la 5296 U/ml. Aceast evoluie a enzimei nu numai c infirm
145

Universitatea de tiine Agricole i Medicin Veterinar


existena unui potenial antitoxic al principiilor active din frunza de Levisticum officinale, care se
gsesc n concentraii mai mici n acest produs vegetal i care s-ar putea datora unei erori de dozaj,
dar ridic i alte semen de ntrebare. Aa cum se putea preconiza activitatea enzimei este ameliorat
(7296 U/ml) pentru lotul protejat cu Levistici aetheroleum.
Tabel 2 Activitatea catalazei serice
CATALAZA (U/ml)
minima
media
6650
7786
4900
5993
4400
52906
6980
7296

Loturi
Lot 1
Lot 2
Lot 3
Lot 4

maxima
8600
6600
6200
7900

Rezultatele obinute n urma determinrii activitii superoxid dismutazei sunt prezentate n


tabelul 3 i diagrama din fig. 3. Studiul acestor rezultate evideniaz o scdere previzibil pentru lotul
de control a intoxicaiei (335,33 fa de 516 U/ml a lotului de referin) i o diminuare semnificativ,
neateptat, pentru lotul experimental 1 (354 U/ml). Aceast diminuare se coreleaz cu evoluia
catalazei pentru acelai lot, anulnd posibilitatea existenei capacitii antitoxice a frunzelor de
Levisticum officinale. Activitatea enzimei este semnificativ ameliorat (476,33 U/ml) n sngele
animalelor ce au beneficiat de aport exogen de ulei voltil de Levistium officinale, ceea ce sugereaz
existena efectului antitoxic al ftalidelor din acest produs.
Catalaza [U/ml]
900
800
700
600
500
400
300
200
100
0

Minima
Media
Maxima

Lot 1 Lot 2 Lot 3 Lot 4


Fig. 2 Activitatea catalazei
Loturi
Lot 1
Lot 2
Lot 3
Lot 4

Tabel 3 Activitatea superoxid dismutazei plasmatice


SUPEROXID DISMUTAZA (U/ml)
minima
media
maxima
467
516
550
243
335,33
418
286
354
499
423,8
476,33
511,3

Superoxid dismutaza [U/ml]


600
500
400

Minima

300

Media

200

Maxima

100
0
Lot 1 Lot 2 Lot 3 Lot 4
Fig. 3 Activitatea superoxid dismutazei

146

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Studiul rezultatelor cuprinse n tabelul 4 i fig. 4 n care sunt redate rezultatele cuantificrii
celui de al treilea marker de stres oxidativ, glutation peroxidaza, evideniaz un traseu asemntor cu
al primului parametru cercetat. Astfel, dac pentru al doilea lot se remarc o scdere (79,5 U/ml) a
activitii G-Px fa de lotul de referin (88,13 U/ml), pentru lotul experimental 1 se nregistreaz o
scdere sub nivelul precedent (77,03 U/ml). Aceast evoluie aleatorie a acestor doi parametri pentru
lotul tratat cu fumonizin B1 i fitopreparat de Levistici folium rmne neelucidat. n schimb,
evoluia G-Px pentru lotul experimental 2 (88,6 U/ml) se aliniaz evoluiilor celorlali markeri de SO
confirmnd existena unui puternic potenial antitoxic al produsului Levistici aetheroleum.
Loturi
Lot 1
Lot 2
Lot 3
Lot 4

Tabel 4 Activitatea glutation peroxidazei


GLUTATION PEROXIDAZA [moli/min/ml]
minima
media
83
88,13
69,9
79,5
65,9
77,03
82
88,6

maxima
92,8
88
89
91,5

Glutation peroxidaza
[moli/min/ml]
100
80
Minima

60

Media

40

Maxima

20
0
Lot 1 Lot 2 Lot 3 Lot 4
Fig. 4 Activitatea glutation peroxidazei

CONCLUZII
Activitatea celor 3 enzime nregistreaz scderi semnificative pentru lotul tratat exclusiv cu
fumonizina B1;
Evoluiile CAT, SOD i G-Px infirm existena unui potenial antitoxic al produsului Levistici
folium, oscilaiile aleatorii atingnd valori inferioare lotului de martor al SO;
Oscilaia celor 3 markeri de SO pentru lotul experimental 2 susine existena unui puternic
potenial antitoxic/antioxidant al celuilalt produs vegetal provenit de la aceeai plant, Levistici
aetheroleum.
BIBLIOGRAFIE
1.
2.
3.
4.
5.
6.
7.

Badria, F. A.; LI, S.; Shier, W. T.(1996) Fumonisins as potential causes of kidney disease, J. Toxicol, 273292;
Shier, W. T.; Abbas, H. K.; Badria, F. A. (2005) Complete structures of the sphingosine analog mycotoxins
Fumonisin B1 and AAL Toxin TA, Tetrahedron Lett, 1571;
Bucci, T.J.; Howard, P.C.; Tolleson, W.H.; Laborde, J. B.; Hansen, D. K. (1998) Renal effects of fumonisin
mycotoxins in animals, Toxicol Pathol., 160-164;
Priscaru, C.; Cotru, M.; Duda, G.D. (1999) New in micotoxicology: Fumonisins, The Journal of Preventive
Medicine, Vol. 7, Nr 2/1999, 46-58;
Nedelcheva, A. M.; Dogan, Y.; Guarrera, P.M.; (2007) - Plants traditionally used to make brooms in several
European countries, Journal of Ethnobiology and Ethnomedicine, 2007, 3:20;
Istudor, V. (2001) - Farmacognozie, Fitochimie, Fitoterapie, Vol II, Editura Medical, Bucureti, 223-226;
Stnescu, U.; Hncianu, M.; Miron, A.; Aprotosoaie, C. (2004) Plantele medicinale de la A la Z: Monografii ale
produselor de interes therapeutic, Vol II, Editura Gr.T.Popa, Iai, 348-350.

147

Universitatea de tiine Agricole i Medicin Veterinar

THE EVOLUTION OF SOME BIOCHEMICAL PARAMETERS


IN THE HONEYBEES HAEMOLYMPH (A. M. CARPATHICA)
COLLECTED IN THE ACTIVE SEASON
RADOI I.1, SAPCALIU Agripina2, CRENGUTA Pavel2, TODIRITA Andra1
1FMV Bucuresti
2Institute for Beekeeping Research & Development Bucharest
The biochemical analyses of the blood are largely used for the routine diagnosis and especially
for the metabolic survey in farm animals. These facts conduct us to the idea that similar analyses,
applied on honeybee hemolymph, could be used in monitoring the healthy state of honeybee
colonies. The present studies represent preliminary researches, which aimed to investigate the
variability of the main biochemical parameters in the hemolymph of the healthy honeybees (Apis
mellifera) in active season. The researches were carried out on honeybee samples collected from 5
honeybee colonies belonging to a breeding apiary of the Institute for Beekeeping Research and
Development from Bucharest. In order to perform the biochemical analyses, the honeybees
samples, consisting in 50 individuals on sample (10 individuals/colony) were randomly collected
and their haemolimph collected, (300l/analized sample/determination), at different time
intervals, in active season (spring-summer). Totally, there were collected 250 haemolymph
samples in a 2 years interval and the following 20 biochemical parameters were analysed: GLU
(mg/dl), HDL-c (mg/dl), ALP (UI/l), T-cho (mg/dl), Tprot (mg/dl), Alb. (g/dl), BUN (mg/dl), LDH
(UI/l), CPK (UI/l), Mg (mg/dl), IP (mg/dl), GGT (UI/l), AST (UI/l), ALT (UI/l), Ca (mg/dl), Cre (mg/dl),
Amy (UI/l), TBIL (mg/dl), TG (mg/dl), UA (mg/dl). The test was carried out after the collection
and processing of the samples using the SPOTCHEM EZSP4430, equipment with dry kits, the slides
technique, respectively. During the 2nd part of the active season, the values of most biochemical
parameters decrease in different proportions, their levels being maintained also in the first part of
the inactive seasons (October, November,December).The values obtained for the main studied
biochemical parameters in the haemolymph of the healthy honeybees collected from honeybee
colonies kept in natural conditions show a highly variable evolution in the two consecutive years
of experiments during the active season.
Key words: Apis mellifera carpathica honeybees, haemolymph, biochemical parameters,
active season

The haemolymph is the body insects fluid comparable with the blood of the vertebrates, but
unlike haemolymph, the blood carries not only the nutritive substances to the cells but also a
complex protein substance, called haemoglobin, which forms the colorant material of the blood and
transports the oxygen. The haemolymph has only a nutritive role, the respiratory function being
negligible [6]. The haemolymph is transparent, uncoloured (or light yellowish) but the quantity
represents about 25-30% from the total weight of the bee at the hatching stage and decreases as the
bee becomes older. The haemolymph contains proteins, amino acids, sugars, hormones, enzymes
and many other substances in different concentration as compared with vertebrate blood [2, 4, 8].
At the international level, most part of the already carried out researches have focused on
biochemical analyses connected with the sugars (fructose, trehalose and glucose), proteins
(vitellogen), amino acids (proline), hormones (juvenile hormone) contents and the activity of some
enzymes. For example, a series of data shows that the total sugars level from honeybees`
haemolymph is the highest from all the insect species, being used as the main energetic supply in the
flight activity which requires a very high energetic consumption [3]. Some researches focused on the
determination of proteins level in haemolymph in varroa infested colonies [7]. Although the
biochemical parameters from vertebrate blood or blood plasma from farm animals have a greater
constancy being very informative on healthy and metabolic state it was considered that similar
analyses could be done also on honeybees` haemolymph in the frame of paraclinical examination.
The goal of this experimental study was to determine the variability of the main biochemical
parameters from healthy honeybees in order to establish the evolution curve of these in the active
season.

148

Lucrri tiinifice vol. 51 seria Medicin Veterinar


MATERIALS AND METHODS
The researches were carried out on honeybees samples collected from 5 honeybee colonies
belonging to a breeding apiary of the Institute for Beekeeping Research and Development from
Bucharest. In order to perform the biochemical analyses, samples of 50 honeybees (10individuals/honey-bee colony) were taken out from hives and their haemolymph collected from the
abdominal part. From a sample of honey bees (50 individuals) a quantity of 300l haemolymph
(according with the method described by Lensky), was collected and was freshly prepared for
biochemical analyses. [6]The samples were collected at different time intervals in active (springsummer) seasons. Totally, a number of 250 haemolymph samples in the 2 years interval, were
collected, the following 20 biochemical parameters being determined: glucose - GLU (mg/dl),
cholesterol-lipoproteins of high density-HDL-c (mg/dl), alkaline phosphatase -ALP (UI/l), total
cholesterol-T-cho (mg/dl), total proteins-T Pro (mg/dl), albumin-Alb. (g/dl), urea-BUN (mg/dl), lactatdehydrogenase LDH (UI/l), creatinphosphokinase-CPK(UI/l), magnesium-Mg(mg/dl), inorganic
phosphorus IP (mg/dl), gamma glutamyl transpeptidase-GGT(UI/l), aspartat amino transferase GOT/AST (UI/l), alanin amino transferase - GPT/ALT (UI/l), Calcium - Ca (mg/dl), Creatinine-Cre
(mg/dl), Amilase-Amy (UI/l), total billirubine-TBIL (mg/dl), triglycerides-TG (mg/dl), Acid Uric -UA
(mg/dl). The tests were carried out after the collection and processing of the haemolymph samples,
the biochemical parameters being determined using the - SpotChem EZ SP analyzer -4430, with dry
kits, the slides technique, respectively.

The experimental stages:


Formation (organization) of the experimental group consisting of 5 healthy honeybee colonies,
sanitary-veterinary surveyed.
Collection of the required quantity of fresh haemolymph (300 l/determination) by means of a
glass capillary introduced between 3 and 4 tergites and the collection of the haemolymph from
capillary in a special syringe.
Biochemical analyses on the fresh and undiluted haemolymph with the SpotChem apparatus.
Processing and interpretation of the obtained data.

RESULTS AND DISCUSSIONS


The values of the biochemical parameters of the haemolymph were summarised and
presented as the interval between the minimum and maximum values depending on the period of
the year. These data are shown in table 1.
From the data, and their graphic presentation, it is very obvious that the biochemical
parameters are very different in their values and according to the season and the activity of bee
colony (active season). Important differences during the active season are also to be noted. Thus, the
values were structured in 2 periods:
Active season 1 AS 1 (April, May, June)
Active season 2 AS 2 (July, August, September)

149

Universitatea de tiine Agricole i Medicin Veterinar


Table 1 The reference values for the main biochemical parameters of the honeybee haemolymph during the active
season
Parameter /UM
AS 1
AS 2
GLU (mg/dl) glucose
152-550
140-385
CPK (UI/l) creatininphosphokinase
115-460
68-797
GGT (UI/l) - gamma glutamil transpeptidase
5-135
1.6-31
GOT/ AST (UI/l) - aspartat amino transferase

50-323

181-270

GPT/ALT (UI/l) alanin amino transferase

115-448

240-551

Amy (UI/l) amylase

1.2-144

1-40

LDH (UI/l) - lactat-dehydrogenase

1.3-512

1.0-51

ALP (UI/l) alcalin phosphatise

24-144

32-67

TG (mg/dl) - triglycerides

55-167

90-200

Cho (mg/dl) - cholesterol

10-78

3-85

HDL-c (mg/dl) - cholesterol-lipoproteins of high density

10-49

22-80

T-prot (mg/dl) - total proteins

1.4-4.5

0.8-1.2

Alb (mg/dl) albumin

0.1-1.2

0.1-0.3

BUN -Urea (mg/dl)-ureic nitrogen

3-12

2-7

UA (mg/dl) -acid Eric

3.7-23.5

2.1-18.4

Cre (mg/dl) creatinine

0.1-2.7

0.1

T BIL (mg/dl) total bilirubine

0.9-8.6

0.8-1.2

IP (mg/dl) -inorganic phosphorus

10.3-28.8

11.1-28.9

Ca total (mg/dl)- calcium


Mg (mg/dl)- magnesium

0.1
0.1-2.5

0.1
0.1-1.7

From the resulted data it was noticed that there are some differences between the
biochemical values, both in the first and the second period of active season, and also in the frame of
the same period. A great variability of the studied parameters was noticed between the two years of
experiments may be as a result of a different physiological condition of the bee colonies as well as
various weather and flora condition. All the occurred differences in biochemical parameters suggest
that the metabolism of the honeybee colony is radically changing during the first period compared
with the second one. A series of very important modifications are to be seen during the second part
of the active season, the months of July, August and September, respectively. It is important to note
that during the active season AS-1 (April, May, June) most part of the investigated biochemical
parameters shows high levels, the data being quite similar during the two years of experiments.
Beginning with the second part of the active season (AS-2), July, August and September respectively,
a very spectacular increase of the biochemical levels of: GLU, enzymes AST, ALT, PAL, CPK, GGT, HDL,
but also T-cho, HDL, triglicerides and uric acid was noticed. All these reflect important modifications
of the physiological condition of the honeybee colonies, probably related to the intensification of the
activity of the honeybee colony once that nectar gathering activity began. The glucose values show an
important evolution to be noted during the second part of the active season in both testing years. In
spring and especially in summer, the energetic metabolism increase dramatically and in parallel it is
registered a increase of the enzymatic activity. Regarding the total protein values and comparing the
two years of analyses, the table no 1 show a very asymmetric evolution and some similarities with the
levels of albumin. Bilirubinemia presents great variations between the two testing years with
constant minimum levels in the second part of the active season of the each year. The lipids
metabolism is characterised by average values of the TG, T chol and HDL-chol, in the first part of the
active season and high levels in the second part of the same season (July, August, and September).
The total cholesterol has maximum values in August and minimum values in the months June, July,
September of the two years of experiments. The monthly evolution of the HDL cholesterol variation
levels shows some similarities with total cholesterol levels in the both years. The enzymes CPK, ALT,
AST have higher values in second period as compared with the first period of active season. It was
150

Lucrri tiinifice vol. 51 seria Medicin Veterinar


also noticed that in the second period of the active season the uric acid is in a high concentration,
especially in July and August. That may be as a result of the modification of nucleoproteins
metabolism but also due to the accumulation inside the rectum following the periods of intense
gathering. The phosphorus has relatively high levels, which oscillate all along the two years,
magnesium was detected at certain values but only during the active season of the first year and
calcium detection was very difficult in both two years of experiments. During the 2nd part of the
active season, the values of most biochemical parameters decrease in different proportions. The end
of the active season is generally marked by the decreasing of the levels of the analysed parameters
from haemolymph.
CONCLUSIONS
3.1. The values obtained for the main studied biochemical parameters in the haemolymph of
the healthy honeybees collected from honeybee colonies kept in natural conditions show a highly
variable evolution in the two consecutive years of experiments.
3.2. Regarding a series of biochemical parameters as CPK (68-797), AST (50-223), ALT (115551), ALP (24-144), LDH (1,3-512), TG (55-200), GLU (22-414), Amy (1.2-144), GGT (1.6-135) very large
intervals of values, both in the in the 1st and 2nd period of the active season were identified.
3.3. According to the evolution, these monthly mean values are related to the intensification
of the sugars, protein and lipids metabolisms, which occur in the first part of the active season, when
the activity of the honeybee colony is intensified, the brood rearing begun and the consumption of
honey and pollen is increased.
3.4. The values related to the level of glucose and total proteins are comparable with those
reported in the literature.
3.5. The AST, ALT, GGT, CPK enzymes, glucose and uric acid levels in haemolymph registered
very high values comparing with those found in the blood plasma of the mammals, the creatinine
values are close to those from the blood plasma and the bilirubin values are 2-3 times higher than
those detected in the blood plasma.
3.6. The parameters of the mineral metabolism are characterised by low detectable values for
Ca (in active season) and some very fluctuant values for Mg and IP (inorganic phosphorus).
3.7. In order to establish the limits of the reference values of the main biochemical
parameters, using the described method with dry kits, further investigations are necessary, under
standardised conditions, a fact that could highlight the factors involved in the variability of the
parameters levels which to be also applied under pathological conditions.
BIBLIOGRAPHY
1.

Blatt, J., F. Roces (2001)- Haemolimph sugars levels in foraging honeybees (A.m. carnica: dependence on
metabolic rate and in vivo measurement of maximal rates of trehalose synthesis). The journal of experimental
Biology 204, pp 2709-2716.
2. Bozic, J., J. Woodring (1997)- Effect of activity on the haemolimph sugar titres in honeybees. J.A. Res 36, pp
33-39.
3. Fell, R.D. (1990)- The qualitative and quantitative analysis of insect haemolimph sugars by high performance
thin layer chromatography. Comp. Biochemistry Physiology 95A, pp 539-544.
4. Leonhard B., K. Crailsheim (1989)- Amino acids and osmolarity in honeybee drone haemolymph, AminoAcids
17 (2), pp 195-205.
5. Leta, M., A. Gilbert, R. Morse (1996)- Levels of haemolimph sugars and body glycogen of honeybees
(A.Mellifera) from colonies preparing to swarm, J. Insect Phisyol 42, pp 239-245.
6. Milani, N. (1988)- Propriet fisiche e composizione chimica dell'emolinfa in Apis mellifera L.: una rassegna
bibliografica. Apicoltura 4.
7. Mikulecky, M Bounias M (1997)- Worker honeybee hemolymph lipid composition and synodic lunar cycle
periodicities, Brazilian Journal of Medical and Biological Research, 30, pp 275-279.
8. Queenie W Chan, Charles GH, Leonard F. (2006)- Quantitative Comparison of caste differences in honeybee
hemolymph, Molecular & Cellular Proteomics 5, pp 2252-2262.
9. Rdoi I., M. Cornil (2001)- Terapii neconvenionale, Ed. Material didactic USAMV, Bucureti.
10. Agripina apcaliu, A. Siceanu, Cristina Mateescu, Eliza Cuia, Crengua Pavel, I. Rdoi, D. Condur
(2008)- Seasonal variations of the main biochemical parameters of the hemolymph of Apis mellifera carpathica
in Romania, XLV Naukowa Konferrencja Pszczelarska Pulawy, 11-12

151

Universitatea de tiine Agricole i Medicin Veterinar

COMPORTAMENTUL UNOR PARAMETRII HEMATOLOGICI I AL


UNOR CONSTANTE BIOCHIMICE PLASMATICE LA
TRATAMENTUL CITOSTATIC EXPERIMENTAL CU PRODUSUL
GLUCANIC EGlClp
THE BEHAVIOR OF SOME HEMATOLOGICAL PARAMETERS
AND PLASMATIC BIOCHEMICAL CONSTANTS TO THE EXPERIMENTAL
CYTOSTATIC TREATMENT WITH THE GLUCANIC PRODUCTS
ROTINBERG P.1, GHERGHEL Daniela1, MIHAI C.1, TRU ELENA1, CPRARU
Gabriela1
1
2
SURDU tefania , OLTEANU Zenovia , ROTINBERG Hellen3
1Biological Research Institute Iai
2Universitatea Alexandru Ioan Cuza Iai
3UMF Iai
pincu.rotinberg@uaic.ro
Aprecierea biocompatibilitii intre desfurarea proceselor fiziologice ale organismului
animal sntos i tratamentul glucanic s-a realizat in vivo, pe modele experimentale adecvate
cercetrilor preliminare de farmacotoxicologie. Valorile DL50 nregistrate amplaseaz
biopreparatul exopolizaharidic EGlClp, de origine fungal, n categoria substanelor cu grad
moderat de toxicitate. Variaiile minore ale greutii corporale medii i ale sporurilor n greutate
ale obolanilor sntoi supui chimioterapiei glucanice fa de valorile martor, dovedesc
funionalitatea normal a mecanismelor de reglare a ponderostatului. Uoarele scderi ale
numrului total de hematii circulante corelate, n acelai sens i amplitudine cu cele ale
hemoglobinemiei i hematocritului , gradul redus de leucocitoz i trombocitoz reflect un
impact moderat al extractului EGlClp asupra organelor hemo- i leuco-trombopoietice.
nregistrarea unor hiperproteinemii plasmatice, asociate cu normoalbuminemii i
hiperglobulinemii plasmatice, unor uoare hipoglicemii asociate cu hipolactacidemii, unei
hipolipemii, corelat cu hipocolesterolemia plasmatic i cu nivele uor sczute ale concentraiilor
acizilor grai liberi plasmatici, sugereaz o interferen a agentului bioactiv cu procesele
metabolice tisulare, ce se concretizeaz prin modificarea, in limitele normalului i nu
patologicului, ale unor parametrii biochimici plasmatici. Ansamblul rezultatelor prin prisma unor
criterii de referin in stabilirea gradului de toxicitate a unor noi poteniali ageni medicamentoi
argumenteaz gradul moderat de toxicitate a biopreparatului glucanic autohton
farmacodinamic activ asupra celulelor normale ale organismului animal i, n special, asupra
organelor direct implicate n meninerea homeostaziei mediului intern.

Un deziderat major al oncochimioterapiei actuale este lezarea i/sau omorrea celulelor


maligne din structura tumorilor depistate ntr-o faz incipient, sau a celor remanente
postchirurgical fr afectarea funciilor celulelor normale i de a permite aprarea imunitar
normal a gazdei fa de celulele tumorale reziduale. ns, cei mai muli ageni chimioterapici utilizai
n tratamentul antineoplazic sunt toxici la dozele eficiente, sunt imunosupresori i nu pot fi folosii la
concentraii nalte fr afectarea gazdei, ei perturbnd funciile vitale nu numai a celulelor maligne
agresoare ci i cele ale celulelor normale din organismul invadat.
n general, administrarea diferitelor medicamente anticanceroase conduce la apariia unor
efecte secundare, reaciile toxice aprnd la nivelul diferitelor esuturi i organe i mbrcnd cele
mai variate forme i grade de intensitate, de la inaparente clinic pn la mortale. De aici i
obligativitatea realizrii unor studii preclinice de farmacotoxicologie asupra unor noi ageni dovedii a
fi citostatic activi, necesare evalurii potenialelor efecte secundare induse de acestea (2-11, 13, 1820, 23, 30, 32).
n acest context informaional, aminitim c investigri anterioare in vitro i in vivo ale grupului
nostru, pe modele experimentale adecvate evidenierii i cuantificrii efectului antineoplazic al unor
biopreparate glucanice, au asigurat evaluarea calitativ i cantitativ a aciunii farmacodinamice
specifice a unui biopreparat autohton EglClp, de natur glucanic i de origine fungic (12, 21, 22, 28,
152

Lucrri tiinifice vol. 51 seria Medicin Veterinar


29). Astfel s-au creat premizele abordrii unor studii preliminare de farmacotoxicologie, care s
sublinieze compatibilitatea sau nu a desfurrii, n limitele normalului, a proceselor fiziologice ale
organismului animal sntos cu tratamentul antitumoral glucanic.
Astfel, prezenta lucrare include parte din rezultatele nregistrate n cadrul unei investigri
preliminare i pariale a toxicitii tratamentului glucanic cu doza eficient din punct de vedere
citostatic asupra celulelor normale ale organismului animal.
MATERIALE I METODE
Bioprodusul glucanic farmacodinamic activ EGlClp a fost separat i purificat parial, prin
precipitare cu etanol, prin centrifugare, prin resuspendarea sedimentului n ap distilat, prin
dializare, reprecipitare etanolic i centrifugare final, din supernatantele mediilor de cultivare a unei
tulpini submerse a microfungului Claviceps purpurea ( T37-1 ) cu randament glucanosintetic optimizat
.
Testarea in vivo a citotoxicitii chimioterapiei glucanice asupra proceselor fiziologice ale
animalelor sntoase s-a realizat pe obolani femele din rasa Wistar, n greutate de 165 180 g.
Animalele de experien sntoase, au fost inute n cuti individuale, ntr-un ciclu normal lumin/
ntuneric, la o temperatur ambiant de 22-23o C, avnd acces liber, ad libidum, la hran standard i
ap.
n vederea stabilirii valorii dozei letale DL50 doza ce determin decesul a 50% din totalul
obolanilor crora li s-a injectat ip extractul exopolizaharidic s-a urmrit consecina efectelor
secundare asupra capacitii de supravieuire a animalelor experimentale n decursul a 24-48 ore de
la administrarea unic a dozei.
La 24 de ore de la realizarea loturilor experimentale, a fost iniiat tratamentul experimental cu
EGlClp, acesta continundu-se 19 zile, perioad in care se urmrete procesul de carcinogenez supus
tratamentului citostatic experimental. Acesta a constat din injectarea zilnic intraperitoneal a
bioprodusului glucanic n doz de 20 mg / kcorp, doza fiind eficient antitumoral. Un volum
echivalent de ser fiziologic a fost administrat animalelor din componena lotului martor.
Pe durata testrii animalele au fost cntrite, cu o periodicitate de 5 zile.
La expirarea intervalului de tratament, acestea au fost sacrificate prin decapitare, sngele
prelevat n prezena sau absena antiocoagulantului EDTA fiind necesar stabilirii tabloului
hematologic sangvin (numrul total de eritrocite, hemoglobinemia, hematocritul, numrul total de
leucocite, numr total trombocite ) i biochimic plasmatic glicemia, lactacidemia, proteinemia,
albuminemia, globulinemia, lipemia, colesterolemia i nivelul acizilor grai liberi.
Stabilirea tabloului hematologic sangvin s-a fcut cu ajutorul analizorului hematologic
veterinar Melet Schloesing MS9, n timp ce dozrile biochimice ale glicemiei, lactacidemiei,
proteinemiei, albuminemiei, globulinemiei, lipemiei colesterolemiei plasmatice i a acizilor grai liberi
plasmatici s-au fcut prin metode spectrofotocolorimetrice specifice, uneori adaptate (1, 9, 17, 26)
Aprecierea toxicitii biopreparatului glucanic s-a bazat pe analiza statistic a valorilor indicilor
de evaluare a efectului farmacotoxicologic, prin prisma testului t a lui Student (31) i pe analiza
comparativ a rezultatelor noastre cu valorile standard stipulate de Organizaia Mondial a Sntii,
de Voicu (35) i Gossel (14), pentru clasificarea efectelor toxice acute i subacute ale unui tratament
medicamentos, n grade de toxicitate (27, 33).
REZULTATE
Efectul in vivo al extractului glucanic EGlClp, administrat singular, n diferite doze unice
obolanilor sntoi, asupra gradului de supravieuire al animalelor criteriu pentru estimarea DL 50
a acestui extract este evideniat de rezultatele incluse n tabelul I privind valoarea dozelor
administrate, numrul animalelor decedate ntr-un interval de 48 de ore i procentul total al
animalelor sucombate.

153

Universitatea de tiine Agricole i Medicin Veterinar


Tabel I. Compatibilitatea gradului de supravieuire (DL50) a obolanilor sntoi la tratamentul unic cu extractul
polizaharidic EGlClp, injectat i.p., in diferite doze. Numrul animalelor din fiecare lot experimental a fost de 10.
Doz
Animale decedate n:
% total
unic
animale
24 ore
48 ore
g/kcorp
sucombate
0,50

1,00
2
1
30
1,50
3
1
40
2,00
4
1
50

Se constat c mrirea progresiv a dozelor de EGlClp se coreleaz cu o scdere gradat a


duratei de via, numrul cel mai mare de animale moarte nregistrndu-se n cazul dozei de 2.0 g /
kcorp., valoare ce reprezint DL50 pentru extractul glucanic.

190

grame

180
170
160
150
0 zile

5 zile

10 zile

15 zile

20
zile
Martor

Fig. 1 Dinamica ponderostatului obolanilor sntoi nregistrat n condiiile terapiei experimentale


intraperitoneale cu extractul glucanic EGlClp.

Aprecierea obiectiv a eventualui impact negativ al tratamentului glucanic asupra celulelor


normale ale organismului animal, s-a bazat i pe urmrirea temporal a dinamicii ponderostatului
animalelor sntoase, evoluia greutii corporale medii a animalelor de experien putnd fi
urmrit din fig. 1
Dinamica ponderostatului obolanilor sntoi supui tratamentului cu EGlClp, relev,
comparativ curbei ponderostatului martor, uoare i nesemnificative scderi n greutate, care se
menin i la finalul perioadei experimentale. Diferenele de greutate dintre lotul tratat i cel martor
nu ating, totui, valoarea de 6 grame, considerat prag de toxicitate de datele din literatura de
specialitate. De asemenea, constatm i variaii minore ale sporurilor n greutate ale animalelor de
experien supuse tratamentului glucanic, sugernd o perturbare neglijabil a derulrii normale a
procesului de cretere i dezvoltare a organismului animal.
100

4,6

5,9

4,7

80
60

100

94,1

100

95,4

100

95,3

Martor

EGlClp

Martor

EGlClp

Martor

EGlClp

40

20
0

Eritrocite

Hematocrit
% scadere

154

Hemoglobina

Lucrri tiinifice vol. 51 seria Medicin Veterinar


140
120

27,8

10,9

100
80
60
%

40
20

100

100

100

100

Martor

EGlClp

Martor

Leucocite

EGlClp

Trombocite
%

Fig. 2 Variaiile procentuale ale numrului mediu de eritrocite, leucocite i trombocite circulante, ale
hematocritului i hemoglobinemiei, nregistrate n urma tratamentului intraperitoneal zilnic cu biopreparatul
glucanic fungal.

Efectele biopolizaharidului fungal citostatic activ asupra unor parametrii hematologici sangvini
(fig. 2) expresie a toxicitii hematologice a acestuia s-au concretizat, comparativ cu martorul, prin
reducerea minor a numrului de eritrocite circulante (5,9%), a hematocritului (4,6%) i a
hemoglobinei (4,7%) indici ce se coreleaz ca sens i amplitudine cu variaiile numerice ale
eritrocitelor , prin creterea moderat a numrului total de leucocite (27,8%) i de trombocite
circulante (10,9%), variaiile semnalate argumentnd impactul toxic minor al extractului polizaharidic
de origine fungal asupra funcionalitii sistemului reticulo-histiocitar i viabilitii elementelor
figurate circulante.
Tratamentul i.p. al animalelor sntoase cu extractul glucanic EGlClp a indus , comparativ cu
loturile netratate:
creteri semnificative statistic ale proteinemiei (cu 33,9%) i ale globulinemiei plasmatice (cu
29,1%) , corelate cu o relativ normoalbuminemie, ce sugereaz o influena neglijabil asupra
biosintezei albuminelor plasmtice (o cretere de doar 4,8%);
uoare hipoglicemii i respectiv hipolactacidemii ( de doar 2,4% i respectiv 1,3%);
minore hipolipemii i hipocolesterolemii asociate cu nivele sczute de acizi grai liberi plasmatici
(de 2,6%, 3,8% i 9,6%).

140
120
100
80
60
40
20
0

33,9

100

100

Martor EGlClp
Proteine totale

29,1

4,8
100

100

Martor EGlClp
Albumine
%

100

100

Martor EGlClp
Globuline

155

Universitatea de tiine Agricole i Medicin Veterinar


1,3

2,4

100
80
60
40

97,6

100

98,7

100

20
0
Martor

EGlClp

Martor

Glicemie

EGlClp

Acid lactic
% %

2,6

100

3,8

9,6

80
60
40

100

97,4

100

96,2

100

Martor

EGlClp

Martor

EGlClp

Martor

90,4

20
0

Lipide totale

AGL

EGlClp

Colesterol total

% %

Fig. 3 Sensul i amplitudinea variaiilor plasmatice ale proteinemiei, albuminemiei, globulinemiei, ale glicemiei i
lactacidemiei, ale lipemiei, colesterolemiei i ale acizilor grai liberi , nregistrate n urma tratamentului
intraperitoneal cu EGlClp.

DISCUII
Evaluarea calitativ i cantitativ a aciunii farmacodinamice antitumorale a unui nou agent
chimic nu este suficient pentru caracterizarea sa ca potenial oncochimioterapic, aceasta impunnd
i aprecierea toxicitii noului candidat la mbogirea arsenalului de lupt contra bolii canceroase,
pentru a putea stabili superioritatea valenei biomedicale n detrimentul proprietii toxice a
posibilului agent medicamentos. Deoarece tratamentul cu citostatice, de cele mai multe ori,
presupune utilizarea de doze mari singurele capabile s determine un impact antineoplazic eficient
exist riscul afectrii celulelor normale din organismul agresat de neoplasm, deci a inducerii unor
periculoase efecte secundare toxice, care diminueaz semnificaia chimioterapeuticp.
Evaluarea gradului de toxicitate, condiie indispensabil n aprecierea semnificaiei terapeutice
a unui agent dovedit oncostatic, presupune, printre altele i: nregistrarea valorii DL50, necesar
aprecierii preliminare a toxicitii bioproduilor testai prin prisma capacitii organismului animal de
a supravieui la o administrare unic a acestora; urmrirea dinamicii ponderostatului animalelor
supuse tratamentului experimental; realizarea unor studii de organotropie; nregistrarea
comportamentului unor indici hematologici, alterarea fa de normal a acestora sugernd diferite
grade de toxicitate asupra sistemului reticulohistiocitar, precum i stabilirea profilului cantitativ i
calitativ al unor indici biochimici plasmatici modificarea valoric a acestora sugernd perturbri mai
mult sau mai puin profunde ale proceselor metabolice celulare ale organismului supus tratamentului
cu agentul luat n studiu (10, 24, 25, 34, 35).
156

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n acest context experimental s-au ncadrat i cercetrile noastre, acestea viznd evaluarea
impactului biopreparatului glucanic EGlClp asupra desfurrii normale a diferitelor procese
fiziologice ale animalelor de experien sntoase, date necesare completrii caracterizrii preclinice
a extractului glucanic ca potenial agent antineoplazic i sub aspect toxicologic.
Estimarea unei valori a DL50 de 2,0 g / kg corp, n urma administrrii biopreparatului glucanic,
asigur plasarea sa n cea de a patra categorie din cele ase stabilite de literatura de specialitate
pentru clasificarea substanelor toxice ( 14, 35) ce includer substanele cu grad moderat de toxicitate
(0,5 - 5 g/kcorp). Aceast apreciere confer extractului glucanic ansa de a accede in etapele
ulterioare ale screeningului clinic pentru stabilirea semnificaiei biomedicale a acestuia pentru
oncochimioterapia uman sau clinic veterinar.
Semnalarea unor diferene mici ntre sporurile n greutate sau ntre greutile medii corporale
ale obolanilor sntoi supui tratamentului cu extractul glucanic fa de cele ale martorilor
netratai, dovedete funcionalitatea normal a mecanismelor de reglare a ponderostatului
argumentnd,totodat, toxicitatea moderat a bioprodusului glucanic EglClp. Aceast apreciere este
i mai credibil dac amintim c programele chimioterapeutice de screening preclinic, menionate n
literatura de specialitate, consider c un agent terapeutic are un potenial toxic ridicat atunci cnd
scderea n greutate indus de acesta fa de martor atinge valoare de aproximativ 6 grame (14,
35).
Unul din esuturile extrem de vulnerabile la citotoxicitatea agenilor xenobiotici de diferite
naturi este i cel reticulohistiocitar, esut ce reprezint elementul structural de baz al organelor
hemato- ,leuco- i trombopoietice, al rezervoarelor i cimitirelorde elemente figurate ale sngelui.
De aceea, urmrirea efectelor unor ageni biologic activi asupra parametrilor hematologici este un
model experimental adecvat pentru aprecierea preliminar a toxicitii acestora asupra celulelor
normale din componena organelor hemato- i leucoformatoare, hemato- i leucolitice ale animalelor
sntoase. Astfel, nregistrarea unei diminuri minore (5,9%) a numrului total al eritrocitelor
circulante, a unei scderi neglijabile a ncrcrii n hemoglobin (4,6%) a celulelor roii, a unei
reduceri nesemnificative a valorii hematocritului (4,7%), precum i a unei creteri moderate a
numrului mediu de leucocite (27,8%) i trombocite (10,9%) circulante, relev un impact toxic
moderat al extractului polizaharidic fungal att asupra liniei roii, ct i a celei albe de elemente
figurate ale sngelui Mai mult, analiza rezultatelor nregistrate n acest cadru experimental, prin
prisma valorilor stabilite de OMS n evaluarea toxicitii hematologice a unui agent medicamentos, ne
permite ncadrarea bioprodusului EGlClp n grupa 1 de toxicitate hematologic i leucocitar, aceasta
incluznd agenii medicamentoi ce modific cu circa 7% valorile numrului mediu de eritrocite
circulante, a hemoglobinemiei i a hematocritului i cu circa 13,8% valorile numrului mediu de
leucocite circulante (14, 35).
Modificarea homeostaziei mediului intern dup introducerea n organism a unui agent
xenobiotic funcie de sensul i durata perturbrii induse d indicaii asupra toxicitii unui drog. n
acest sens, ne-am propus ca n aprecierea preliminar a toxicitii biopolizaharidului EGlClp, s lum
n considerare i efectul acestuia asupra unor constante biochimice sanguine la obolanii sntoi. n
acest sens, modificrile cantitative moderate ale diverselor constante biochimice plasmatice
hiperproteinemii, asociate cu hiperglobulinemie i normoalbuminemie, uoare hipoglicemii nsoite
de hipolactacidemii, hipolipemii corelate cu hipocolesterolemii i cu nivele moderat sczute ale
concentraiilor acizilor grai liberi plasmatici sugereaz un grad redus de alterare celular a
proceselor metabolismului intermediar protidic, glucidic i lipidic, cu importan pentru calitatea
vieii organismului animal dat fiind rolul structural, funcional i energetic al acestor constitueni
biochimici.
Ansamblul rezultatelor nregistrate pledeaz n favoarea unui moderat impact toxic al
biopreparatului glucanic autohton farmacodinamic activ asupra celulelor normale ale organismului
animal i, n special, asupra organelor direct implicate n meninerea homeostaziei mediului intern.

157

1.

2.

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII
Modificrile moderate ale ponderostatului, tabloului hematologic i biochimic plasmati permite
acordarea atributului de potenial agent chioterapeutic cu toxicitatea redus biopreparatului
glucanic autohton de origine fungal EGlClp, acesta permitnd desfurarea normal a
proceselor fiziologice ale organsimului animal sntos.
Hiperproteinemia i hiperglobulinemie, hipolipemia i hipocolesterolemie plasmatic, decelate
consecutiv tratamentului glucanic, contureaz dou noi efecte farmacodinamice ale
biopreparatului exopolizaharidic fungal, acesta prnd a se comporta ca agent imunostimulator,
normolipemiant i hipocolesterolemiant, proprietile semnalate deschiznd perspectiva unor
noi direcii de cercetare.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.

8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.

Artenie, V., Tnase, Elvira, 1981., Ed. Universitii Al. I. Cuza, Iai, 128-133
Balls M. Bridges J.W., 1984, The FRAME Research Programme on in vitro Citotoxicology. In: Alternative
Methods in Toxicology. Ed by A.M. Goldberg. Mary Ann Liebert, Vol. 2, 61.
Bedeleanu D., Kory M., 1976, Metabolismul medicamentelor, Ed. Dacia, Cluj-Napoca, 210.
Bonta I.L., Devos C.J., LA DU B.N., 1985, Drug metabolism and enzymes, Ann.Rev. Biochem., 27: 427-434.
Borenfreund R. Puerner J.A., 1985, Toxicology Lett., 24, 119-126.
Borsos T., Bast R., Chanian S. H., Zbar B., Rapp H., 1976, Secondary effects of antineoplastic agents, Ann.
New York Acad. Sci., 276: 565-573.
Calabresi P., Parks R.E. Jr., 1985, Chemotherapy of Neoplastic Diseases, n: The Pharmacological Basis of
Therapeutics, Gilman A.G., Goodman L.S., Rall Th. W., Murad F., eds. N.Y., Mac Millan Publishing Company,
1240-1308.
Chiricu I., 1988, Cancerologie vol. I i II, Ed. Med. Bucureti.
Ciudin E., Marinescu D., 1996, Animale de laborator, Ed. ALL, Bucureti.
Cotru M., 1978, Toxicologie, principii generale, Ed. Junimea, Iai.
Devita V.T. Jr., 1991, Principles of chemotherapy, Cancer: Principles and Practice of Oncolology, Third Edition,
De Vita Jr. et al, (eds.), Philadelpia, Lippincott, po. 276-300.
Gherghel D., Rotinberg P., Mihai C., Tru E., Cpraru G., Surdu ., Olteanu Z., Rotinberg H., 2008, Lucr. St.
USAMV Iai, seria Medicin veterinar, 51 (in press)

th
Goodman & Gilman s, The Pharmacological Basis of Therapeutics,1985, 7 edition, Chemotherapy of
Neoplastic Diseases, Macmillan Publishing Company, New York, 10022, 1240-1308
Gossel Th. A. Douglas B.J., 1994, Principles of clinical toxicology, Raven-Press.
Hamburger A.W., 1981, J. Natl. Cancer Inst., 66, 981-989.
Koller, L.D., Julie A.Brauner, 1977, Toxic. Appl. Pharmac, 42, 621-624.
Kondi V., 1981, Laboratorul clinic Hematologie, Edit. Medical, Bucureti.
Ludlum D. B., Tong W. P., 1985, Cancer Chemotherapy, II, (Muggia E. M., Nishoff M. , eds.), Martinus Nishoff,
141-154
Medoff G., Valeriote F., Lynch D., 1974, Cancer Rep., 34, 974-980.
Mellet L. B., 1969, in Programes of Drug Research (Jucker E. ed.), Birkhuser-Basel, Stuttgart, 136-169
Mihai C., Rotinberg P., Gherghel D., Capraru G., Truta E., Surdu S., Olteanu Z., Rotinberg H., 2008, Analele
tiinifice ale Universitii Al. I. Cuza Iai, Secia II Genetic i Biologie molecular, IX (1), 133 138
Mihai C., Rotinberg P., Tru E., Gherghel D., Cpraru G., Surdu ., Olteanu Z., Rotinberg H., 2008, Lucr. St.
USAMV Iai, seria Medicin veterinar, 51 (in press)
Miron L., 2000, Oncologie general Edit. Egal, Bacu.
Mogo G., Sitcai N., 1988, Toxicologie clinic, vol. I, Ed. Medical, Bucureti
Ninomiya Y., Miwa M., Eda H., 1990, Jpn. J. Cancer Res., 81(2):188-195.
Nu Gh., Buneag C., 1977, Investigaii biochimice, Ed. Did. Ped., Bucureti.
Punescu-Podeanu A., 1962, Ghid de date biologice normale i patologice, Ed. Medical, Bucureti.
Rotinberg P., Gherghel D., Mihai C., Capraru G., Truta E., Surdu S., Olteanu Z., Neacu I, Rotinberg H.,
2008, Bul. Soc. Biol. Cel., 36, 66.
Rotinberg P., Gherghel D., Mihai C., Capraru G., Truta E., Surdu S., Olteanu Z., Rotinberg H., 2008, Analele
tiinifice ale Universitii Al. I. Cuza Iai, Secia II Genetic i Biologie molecular, IX(1), 139-146
Salmon S. E., Sartorelli A. C., 1995, n: Basic and Clinical Pharmacology, Katzung R. G. (ed.), Lange, Prentis
Hall., London.
Snedecor G.W., 1968, n: Metode statistice aplicate n agricultur i biologieEd. Did. Ped., Bucureti.
Stroescu V., 1998, Bazele farmacologice ale practicii medicale, Ed. Med. Bucureti.
Traian A., et al., 1991, Oncologie Veterinar, Coordonatori: N. Manolescu, S. Bolte, Ed. Ceres, Bucureti, 999.
Valeriote F., Medoff G., Tolen S., Dieckman J., 1984, J. Natl. Cancer Inst., 475-483.
Voicu V., 1997, Toxicologie clinic, Edit. Albatros, Bucureti.

158

Lucrri tiinifice vol. 51 seria Medicin Veterinar

ASPECTE MACROSCOPICE PRIVIND VASCULARIZAIA


VENOAS A GLANDEI MAMARE LA RUMEGTOARELE MARI
SOCACIU Antonia, DAMIAN A., CHIRILEAN Ioana, STAN F., GUDEA Al.
FMV Cluj-Napoca
The study was carried out on the mammary glands taken from 23 bovine (the Blat
Romneasc breed and buffalo cows), all adults. The distribution of the venous vascular system of
the mammary glands was emphasised by injecting into the venous system a solution obtained by
mixing the commercial product Palux with blue dye, then keeping the glands in 5%
formaldehyde for 24 hours, and finally dissecting them. Due to its highly specific function the
production of milk, the mammary gland is endowed with a vascular system extremely complex
from a morphological point of view. Given its complexity, our research and observations
regarding the venous circulatory system of the mammary gland may be performed by taking into
account the state of the mammary gland, namely whether it is functionally active or not. The
deep mammary veins have many tributary streams forming real trunks of vasculary veins which
have an ascending trajectory, crossing the mammary parenchyma to reach the base of the
corresponding mammary quarter. The venous blood is collected from the entire udder by veins
that join to form the left and right basal veins, which, in turn, form the great basal venous circle of
the udder.

Collin (1976), menioneaz prezena unui plex i cerc venos situat la nivelul bazei
mamelonului. Acest plex se descarc prin urmtoarele vene:
1.
vena subcutanat abdominal care preia sngele din plexul venos bazal al ugerului
prin venele bazale craniale i prsete glanda la nivelul segmentului cranial al
sferturilor
anterioare
(http://classes.aces.uiuc.edu/AnSci308/Mamstructure/Anatomy_7.html);
2.
vena pudend extern sau vena accesorie care este satelita arterei omonime;
3.
vena pudend intern prin venele perineale (Popovici i col, 1994; Patea, 1990;
Constantinescu, 1982; Damian, 2001). Turner specific prezena unei vene perineal
care dreneaz jumtatea superioar a sferturilor posterioare, aspect susinut i de
Bray i Constantin (http://edis.ifas.ufl.edu/DS116, Constantin, 2003)
MATERIALE I METOD
n scopul evidenierii sistemului vascular venos al glandei mamare la rumegtoarele mari,
bovine i bubaline, au fost recoltate glandele mamare de la un numr de 17 vaci i 6 bivolie, de
diferite vrste, cuprinse ntre 1,5 i 12 ani. Menionm faptul c, din punct de vedere funcional la
unele subiecte luate n observaie, glanda mamar era n stare de lactaie iar la altele n stadiu de
repaus funcional. Bovinele i bubalinele au fost sacrificate n scop comercial de la care s-au recoltat
glandele mamare prin izolarea lor de trunchi, respectiv secionarea pielii ugerului, a vaselor de snge
i a ligamentului suspensor.
Dup o minuioas pregtire a materialului a urmat faza evidenierii vaselor de snge ale
glandei mamare, prin tehnica injectrii acestora cu material plastic colorat. Injectarea vaselor de
snge s-a fcut printr-un tub introdus n lumenul vaselor. Tubul a fost fixat printr-o ligatur de esutul
mamar. n acest procedeu materialul de injectat a fost produsul industrial Palux, la care i s-a adugat
ntritor i pigment albastru. Prin injectarea materialului au fost umplute mai nti vasele de calibru
mare, umplere realizat de presiunea exercitat manual prin seringa de injectat. Apoi, treptat, s-a
realizat i umplerea vaselor de calibru mai mic pn la nivel de capilare. Glanda mamar injectat a
fost apoi meninut ntr-o soluie de formol 2%, timp de 24 ore.
Disecia i urmrirea vaselor sanguine s-a fcut cu ochiul liber. Vasele disecate au fost
fotografiate i s-au efectuat i schie.
REZULTATE I DISCUII
Prin specificul su funcional elaborarea laptelui, explic din punct de vedere morfologic
complexitatea sistemului vascular propriu. Din acest punct de vedere, cercetrile i observaiile
noastre asupra sistemului circulator venos al acestor glande, se pot face inndu-se seama de starea
de repaus sau de activitatea funcional a acestor glande.
159

Universitatea de tiine Agricole i Medicin Veterinar


Venulele reelei mamelonare dau natere unui aspect particular conferit de faptul c, nspre
canalul papilar, aceste vase prezint traiecte etajate n sens circular, pentru ca nspre baza
mamelonului s rezulte dou sau trei vene mamelonare. La baza mamelonului, respectivele venule
iau o direcie ascendent pentru a se continua fie cu venele mamare profunde, fie cu venele
superficiale aparintoare sfertului mamar respectiv. n ugerele disecate de noi, numai la ase cazuri
am observat o diferen a conflurii venelor mamelonare n reeaua vascular venoas superficial
sau profund. La dou din cele ase glande, venulele mamelonare conflueaz cu venele mamare
profunde, iar la celelalte 4 glande, confluarea se realizeaz cu venele mamare superficiale. n celelalte
17 cazuri, venele mamelonare s-au continuat att cu sistemul venos mamar profund ct i cu cel
superficial (fig 1). Apreciem c aceste particulariti au o semnificaie pe care o putem raporta la rolul
factorilor compresivi privind circulaia de ntoarcere a sngelui mamelonar n timpul suptului sau a
compresiei mecanice din timpul mulsului. Din acest punct de vedere este necesar a fi luate n
considerare ndeosebi afeciunile post-traumatice mamelonare, situaii n care sunt n mod inevitabil
implicate i vasele acestor segmente mamare.

Fig. 1 Complexul anastomotic venos superficial mamelonar al ugerului, la vac (vedere lateral stng)
1 Sfertul anterior stng, 2 Sfertul posterior stng, 3 Mamelonul anterior stng, 4 Mamelonul posterior
stng, 5 Vascularizaia venoas superficial a jumtii stngi a ugerului, 6 Venulele complexului
anastomotic mamelonar

Venele mamare profunde prezint numeroi aflueni din care rezult adevrate trunchiuri
vasculare venoase care au un traiect ascendent, strbtnd parenchimul mamar ajungnd la baza
sfertului mamar corespunztor. Particular este faptul c la toate cele 23 ugere disecate au fost puse
n eviden vene aparintoare unui sfert care conflueaz cu vene care provin din sfertul aparintor
aceleai pri a ugerului, formnd trunchiuri comune. Acest aspect gsit de noi nu este semnalat n
literatura de specialitate consultat (fig. 2).

160

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 2 Jumtatea lateral stng a ugerului, la vac


1 Sfertul anterior stng, 2 Sfertul posterior stng, 3 Mamelonul sfertului anterior stng, 4 Mamelonul
sfertului posterior stng, 5 Limfocentrul retromamar stng, 6 Venulele complexului anastomotic mamelonar,
7 Confluarea venelor aparintoare celor dou sferturi homolaterale stngi

O alt particularitate a sistemului venos mamar const n faptul c din venele mamare
profunde se desprind adevrate ramuri venoase perforante care strbat prin orificii proprii
septumul median intramamar (fig. 3). n acest mod se realizeaz un alt sistem vascular comun celor
dou jumti ale ugerului. Acest aspect, de asemenea nesemnalat n literatura de specialitate,
infirm concepia de vascularizaie independent a celor dou jumti ale ugerului. Aceste
particulariti sunt necesare a fi luate n considerare ntr-o nou concepie cu implicaii practice
privind patologia mamar cu referire la netransmisibilitatea dect pe calea circulatorie general a
proceselor septice mamare de la un sfert la altul sau de la o jumtate la cealalt a ugerului.

Fig. 3 Aspectul ramurilor venoase perforante


1 Ligamentul suspensor median, 2 Ramur venoas profund dreapt, 3 Ramur venoas profund stng,
4 Ramuri venoase perforante

De semnalat este i faptul c ntre sistemul vascular venos al celor dou sferturi mamare de pe
aceeai parte exist diferene marcante. n acest sens ne referim la faptul c sferturile posterioare
prezint o vascularizaie mult mai bogat n comparaie cu sferturile anterioare. Venulele provenite
din zona papilar i parenchimatoas ale sferturilor posterioare, n marea lor majoritate, conflueaz
realizndu-se un cerc venos propriu al acestor sferturi care la rndul lui se deschide n partea caudal
a marelui cerc venos situat la baza ugerului. Aceste aspecte au fost puse n eviden la 11 din glandele
luate n studiu, provenite att de la vaci ct i de la bivolie.
161

Universitatea de tiine Agricole i Medicin Veterinar


Sngele venos colectat din tot ugerul realizeaz prin confluare venele bazale stngi i drepte
care la rndul lor vor da natere marelui cerc venos bazal al ugerului. Confluarea venelor bazale
stngi i drepte pentru formarea respectivului cerc bazal se realizeaz n sens cranial i caudal. n
cercul venos bazal conflueaz numeroase venule care dreneaz sngele att din esutul cutanat
mamar ct i din limfocentrul retromamar (Lc. inghinal superficial).
Cu privire la descrcarea sngelui venos din glanda mamar, aceasta se realizeaz prin cele trei
ci venoase cunoscute: vena subcutanat abdominal, vena pudend extern i prin vena pudend
intern. Cu referire la vena pudend intern menionm faptul c rdcina ei n marele cerc venos
bazal se prezint sub aspectul unui trunchi comun, dup care se bifurc n cele dou vene pudende
interne, dreapt i respectiv stng (fig. 4).

Fig. 4 Aspectul trunchiului comun al venelor pudende interne, la bivoli


1 Ligamentul median intramamar, 2 Limfocentrul retromamar stng, 3 Sfertul caudal stng, 4 Sfertul
caudal drept, 5 Originea venelor pudende interne, 6 Venele pudende interne

Spre deosebire de cele menionate mai sus, de remarcat este faptul c la 9 subiecte a fost
semnalat lipsa trunchiului pudend intern comun, situaie n care cele dou vene pudende interne
prezint rdcini separate, direct din cercul venos mamar bazal.
1.
2.
3.
4.
5.

CONCLUZII
La toate glandele disecate au fost prezente trunchiurile comune venoase homolaterale.
Toate piesele luate n studiu au prezentat ramuri venoase perforante, facnd astfel legtura
venoas ntre cele dou jumti ale glandei.
La 73, 91% din cazuri, sistemul venos mamelonar se descarc att n sistemul venos mamar
superficial ct i n cel profund.
La 11 (47,82%) din glandele luate n studiu, provenite att de la vaci ct i de la bivolie au fost
puse n eviden cercuri venoase proprii sferturilor posterioare.
La 39,13% din glandele disecate s-a semnalat lipsa trunchiului venos pudend intern comun.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.

BRAY, D. R., J. K. SHEARER, 2003 [1993] Milking Management I The Udder disponibil la
http://edis.ifas.ufl.edu/DS116
COLLIN, B., 1976 Atlas dAnatomie Cheval Bete Bovine Porc Lapine Oiseaux, Universit de Lige, Facult de
Mdicine Vtrinaire, Laboratoire dAnatomie, Bruxelles
CONSTANTIN, N., G. COTOR, 2003 Tratat de Medicin Veterinar, vol. III, pag. 686, Editura Tehnic,
Bucureti
CONSTANTINESCU, GH. M., C. RADU, R. PALICICA, 1982 Anatomia Topografic a Mamiferelor Domestice,
pag. 127, Editura Facla, Timioara
DAMIAN, A., 2001 Anatomie Comparat. Sistemul Cardiovascular, pag. 112-179, Editura AcademicPres,
Cluj-Napoca
PATEA, E., 1990 Anatomia topografic a taurinelor, pag. 260-263, Editura Ceres, Bucureti
POPOVICI, I., A. DAMIAN, N. POPOVICI, 1994 Anatomia Animalelor Domestice. Angiologia, Editura
Genesis, Cluj-Napoca
www.classes.aces.uiuc.edu/AnSci308/anatomycattle.htm, accesat n 2005

162

Lucrri tiinifice vol. 51 seria Medicin Veterinar

MODIFICRILE HISTOLOGICE ALE PIELII IN UNELE BOLI


INFECTIOASE LA PUII BROILER DE GIN 1
HISTOLOGICAL LESIONS OF THE SKIN IN SOME INFECTIOUS DISEASES OF
BROILER CHICKEN
SOLCAN Carmen, COTEA C., SOLCAN Gh., FLOREA Elena Ctlina
FMV IAI
Skin lesions were studied in broiler chickens with: colibacilosis, salmonelosis, pasteurelosis,
infectious bursitis (Gumboro disease) and Newcastle disease. The epidermis was thickened in
colibacilosis and pasteurelosis and thinner in salmonelosis, Gumboro disease and Newcastle
disease, showing some ulcerations in colibacilosis. Diffuse lymphoid infiltrations were observed in
all diseases, excepting salmonelosis, where diffuse intravascular coagulation, with hyaline
microtrombi and fibrinous embolia were observed. Degeneration of plumiferous follicles were
observed in all the diseases. In Newcastle diseases and pasteurelosis, PAS positive deposits into
the dermis and hypertrophied fibroblasts were observed.

Pielea este considerata avanpostul sistemului imun. Celulele Langerhans i celulele Granstein
(prezentatoare de antigeni), impreuna cu cheratinocitele, limfocitele T epidermotropice i
limfonodurile regionale la mamifere, formeaza un sistem integrat, tesutul limfoid asociat pielii
(skin associated lymphoid tissue= SALT), care asigura imunosupravegherea cutanata (9).
Lucrarea ii propune descrierea leziunilor histologice ale pielii puilor de gin, surprinse n
unele boli infecioase: colibaciloza, salmoneloza, pasteureloza, bursita infecioas i pseudopesta.
MATERIAL I METODE
Piesele recoltate au provenit de la 60 pui de vrste diferite, la care prin examene
bacteriologice i virusologice s-au diagnosticat: colibaciloza, salmoneloza, pasteureloza, bursita
infecioas i pseudopesta.
Pielea recoltat a fost fixat cu formaldehid 10%, inclus la parafin, secionat la 5m i
colorat prin coloraiile HEA, PAS, Giemsa.
REZULTATE I DISCUII
Pielea, provenit de la pui cu colibaciloz, prezint leziuni caracterizate prin hipercheratoz,
ngroarea dermului i infiltraie cu heterofile, celule mononucleare i exudat fibrinos. n regiunea
sternului stratul cornos este ingroat, celulele epiteliale modificate (fig.1a). n derm se pot observa
infiltraii cu heterofile, limfocite, difuze la unele psri, la altele apar aglomerri limfoide mari.La
unele psri apar ulcere la nivelul epidermei, iar dermul i musculatura subcutanat prezint infiltraii
cu heterofile i limfocite. Pielea din regiunea capului n derm se pot observa capilare dilatate, pline
cu eritrocite. n unele cazuri apare un infiltrat fibrinos, PAS pozitiv (fig. 2a). Unii foliculi plumiferi sunt
degenerai, alii prezint o colecie PAS pozitiv. Pielea din regiunea aripii prezint un infiltrat
fibrinos, PAS pozitiv n derm. n dermul din regiunea coccigien se evideniaz aglomerri limfoide
mari (fig. 2b, 1c)

a
b
c
Fig.1. Piele de la pui cu colibaciloz din regiunea sternului. Ulcer la nivelul epidermei (a) i infiltraii cu
heterofile printre fibrele musculareCol. HEA x100.

Cercetri finanate din grantul CNCSIS 732/2007


163

Universitatea de tiine Agricole i Medicin Veterinar

a
b
c
Fig. 2. Piele de la pui cu colibaciloz din regiunea capului (a), coccigien(b). Col. HEA x100.

Bacteriologic a fost izolat Escherichia coli. In literatura de specialitate se menioneaz cel mai
frecvent serogrupul O2 i O78 (1, 2). Aderena E.coli la celulele epiteliale ale psrilor poate expresa
dou grupe de fimbrie F1 (tipI) i P care mediaz colonizarea bacterian. Cercetrile sugereaz c n
celulit se izoleaz F1A i P(F11). Se sugereaz c E.coli F1 a fost izolat de la pui cu septicemie i
fimbriile joac rol important n patogeneza bolii E. coli O78 posed fimbrie F1 i se asociaz cu
virulena. Grupul O este asociat cu septicemia i bolile respiratorii (3, 4). n infeciile experimentale
endotoxinele colibacilare produc la locul de inoculare o cretere a permeabilitii venulelor i a
venelor mici cu acumularea unui numr mare de bazofile (7)
Pielea provenit de la pui cu salmoneloz prezint urmtoarele modificri histologice: n
regiunea sternului epiteliul pavimentos stratificat cheratinizat este integru, dermul cu rare limfocite,
capilare dilatate, cu elemente figurate. Pielea din regiunea capului are dermul srac in fibre
conjunctive, cu capilare largi pline cu eritrocite, unii foliculi degenerai. n zona aripii epiderma este
mai ngroat, cu capilare dilatate n derm, pline cu eritrocite. Caplilare ectaziate pot fi observate n
hypoderm. La unele cazuri apar i eritrocite extravazate. In regiunea coccigien n derm se pot
observa eritrocite extravazate i capilare largi pline cu eritrocite (fig. 3).

a
b
c
Fig.3. Pielea provenit de la pui cu salmoneloz, din regiunea sternului (a) i aripii (b). Capilare dilatate, pline
cu eritrocite. Col. PAS x100.

n literatur se menioneaz c n formele acute se constat focare de infiltrie hemoragic i


intens heterofilie. n evoluia subacut i cronic, heterofilia i infiltraia hemoragic sunt reduse.
Reaciile limfoide pot fi dominante n cazul unor tulpini puin virulente (7).
n pasteureloz epiderma este format din epiteliu pavimentos stratificat cheratinizat cu mai
multe straturi intermediare, un strat cornos gros. n dermul modificat se pot observa granuloame n
pielea din regiunea capului, foliculi plumiferi necrozai n toate regiunile luate n studiu, cu un
coninut PAS pozitiv, fibroblaste modificate secretoare de glicozoaminoglicani. Capilarele din derm
sunt ectaziate, n numr mare sub epiderm, cu depuneri PAS pozitive n jur (fig. 4). n regiunea
sternului i coccigien apar infiltraii limfoide difuze n derm.

164

Lucrri tiinifice vol. 51 seria Medicin Veterinar

a
b
c
Fig. 4. Piele de pui cu pasteureloz din regiunea sternului, coccigien i a aripii. Col. HEA, PAS x100.

n formele supraacute se constat stare congestiv hemoragic generalizat. Procesul s-ar


explica prin aciunea toxinelor asupra dispozitivelor sfincteriene ale capilarelor urmate de constricii
i dilataii de sector. Urmeaz migrarea mai mult sau mai puin accentuat a granulocitelor eozinofile
cu rol de pinocitoz. Capilarele se trombozeaz prin germeni i prin exotoxine, pe de alt parte prin
hypoxie (3, 7). Se produc mici focare de necroz de coagulare. Tulpinile pasteurelice cu virulen
foarte mare induc moartea prin leziuni oprite n aceast faz. Leziuni invizibile macroscopic. Tulpinile
cu patogenitate moderat permit desfurarea mai lent a procesului infecios. La nivelul focarelor
necrotice eozinofilele sunt nlocuite cu monocite i limfocite, demonstrndu-se intrarea n joc a
imunitii celulare i umorale. Sub influena acestor celule focarele necrotice cresc n dimensiune i i
sporesc celularitatea n paralel cu neogeneza fibrilar, elemente care la imprim caracter
predominant productiv (7).
n bursita infecioas microscopic, seciunile din piele prezinta epiderma format din epiteliu
pavimentos stratificat cheratinizat cu un diametru mic. Foliculii plumiferi sunt mprtiai n derm.
Arhitectura dermului prezint infiltrate limfocitare multifocale perivasculare. Unele infiltrate apar sub
forma unor noduli de mrimi variabile. Populaia limfoid celular a inclus limfoblaste, limfocite de la
mrime medie la mare, inconstant plasmocite. Limfocitele T sunt strns legate de limfocitele B, care
sunt dispuse difuz. n capilarele din piele se pot observa microtrombi hialini, PAS pozitivi (fig 5)
Leziunile menionate apar n toate zonele luate n studiu (stern, cap, arip, regiunea coccigien). n
toate organele se relev aspectele sindromului de coagulare intravascular diseminat, respectiv
prezena de microtrombi hialini i embolii fibrinoase (7).

Fig. 5. Piele de la pui cu bursit infecioas, din regiunea capului i aripii. Infiltraii limfoide difuze i aglomerri
limfoide difuze n derm. Col PAS x100.

In pseudopest, la psri adulte, n pielea din toate regiunile recoltate se evideniaz o


membran bazal ngroat, frecvent nedelimit, PAS pozitiv. Dermul are un diametru mult mai
mare, cu un numr mare de capilare, nconjurate de suprafee intens PAS pozitive (fig. 6). La unele
psri apar infiltraii limfoide difuze n derm i aglomerri limfoide mari n jurul foliculilor piloi.
Infectivitatea, invazivitatea i patogenitatea virusurilor pseudopestoase depind de clivajul
glicoproteinei virale F la nivelul celulelor gazde. Glicoproteina F prezent n tulpinile patogene este
recunoscut de ctre proteazele membranare ale multor tipuri celulare, la nivelul crora poate fi
clivat. Dimpotriv, glicoproteina F a virusurilor nepatogene sau lentogene este recunoscut doar de
enterocite, deci probabilitatea de invazie i multiplicare viral a acestor virusuri este mult mai redus
i ca atare procesele lezionale determinate sunt limitate (7).

165

Universitatea de tiine Agricole i Medicin Veterinar

a
b
c
Fig. 6. Piele pui cu pseudopest din regiunea capului. Suprafee intens PAS pozitive n derm (b). Aglomerri
limfoide n derm (a). Col. PAS x100(a); x200(b).

1.
2.

3.
4.

CONCLUZII
Epiderma are un diametru mare n unele boli infecioase ca pasteureloz, colibaciloz, mai mici
n pseudopest, bursit infecioas, salmoneloz i uneori ulcere n colibaciloz.
Infiltraii limfoide difuze i aglomerri limfoide se nregistreaz n toate bolile luate n studiu cu
excepia salmonelozei n care apar, aspectele sindromului de coagulare intravascular
diseminat, respectiv prezena de microtrombi hialini i embolii fibrinoase.
Foliculii plumiferi sufer fenomene de degenerescen n toate bolile studiate.
In pseudopest i pasteureloz apar depozite PAS pozitive n derm i fibroblaste hipertrofiate.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.

9.

Boulianne M. Cellulitis in broiler chickens. Avian diseases. 2002. Vol. 4. nr1


CHITTY BVETMED CERTZOOMED JR AVIAN BACTERIAL AND VIRAL SKIN DISEASE. 2001
A. R. Ghanbarpour.Derakhshanfar A study on avian cellulitis in broiler chickens. Veterinarski arhiv 72 (5),
277-284, 2002
R. Ghanbarpour1*, A. Derakhshanfar1, Ali Pourbakhsh, Determination of P (F11) and F1 fimbriae of
Escherichia coli isolated from avian cellulites. VETERINARSKI ARHIV 73 2003(4), 227-236
B.Z Igyarto , et. col. Characterization of chicken epidermal dendritic cells. 2006 Blackwell Publishing Ltd,
Immunology
J. S. Jeffrey,A et col. Virulence Factors of Escherichia coli from Cellulitis or Colisepticemia Lesions in
Chickens. AVIAN DISEASES 46:4852, 2002
Paul I. Morfopatologia aparatelor i sistemelor organice. Ed.Soc.Med.Vet. Bucureti 1990
S. M. Peighambari, R. J. Julian, J.-P. Vaillancourt and C. L. Gyles. Escherichia coli Cellulitis: Experimental
Infections in Broiler Chickens . Avian Diseases, Vol. 39, No. 1 (Jan. - Mar., 1995), pp. 125-134 (article
consists of 10 pages)
Solcan Gh., Mitrea I.L., Miron L., Solcan Carmen, - Dermatopatologia animalelor de companie Ed. "Ion
Ionescu de la Brad", Iasi, 2003

166

Lucrri tiinifice vol. 51 seria Medicin Veterinar

MODIFICRILE HISTOLOGICE ALE PIELII N BOALA MAREK,


UNELE BOLI PARAZITARE I DE METABOLISM
LA PUII DE GIN
2

HISTOLOGICAL LESIONS OF THE CHICKEN SKIN IN MAREK DISEASE AND


SOME PARASITIC AND METABOLIC DISEASES IN BROILER CHICKENS
SOLCAN Carmen, COTEA C., SOLCAN Gh., POPESCU A.
FMV IAI,
The skin lesions were studied in chicken with Marek disease, cnemidocoptic mange,
coccidiosis associated with ochratoxicosis, hypovitaminosis A, hypovitaminosis E and
hyposelenosis. In Marek diseases the plumiferous follicles were modified, with adjacent
lymphonodulae and perifollicular lymphoid agglomerations. In cnemidocoptic mange
hyperkeratosis, sclerodermia and perivascular infiltrations with T cells were observed. In
coccidiosis associated with ochratoxicosis, hyperkeratosis, degeneration of plumiferous follicles
and subcutaneous hemorhages were noted. In hippovitaminosis A marked hyperkeratosis,
descuamation, pododermatitis and aeroftalmic was observed. In hypovitaminosis E and
hipposelenosis chronic ulcerative dermatitis was observed.

Imunizarea experimental transcutanat demonstreaz c pielea prin celulele dendritice


epidermale (EDC) i esutul limfoid asociat pielii rspunde la diferii antigeni care migreaz prin
epiderm. Numeroase afeciuni sistemice se reflect prin leziuni ale pielii.
Boala Marek este un limfom contagios a puilor cauzat de virusul bolii Marek (MDV). Replicarea
acestui virus n limfocitele de pui determin transformarea LTCD4+ care poate fi observat n
limfomele organelor i pielii. n perioada de laten virusul supreseaz expresia genei litice care este
implicat n mecanisme pentru blocarea apoptozei limfocitelor LTCD4+ infectate, i exprimarea genei
transactivate. La dou sptmni dup infecie sunt afectate i epiteliul foliculilor plumiferi, care va
servi ca situs prin care ies din celulele gazd virusurile care vor infecta mediul nconjurtor. (6).
Lucrarea ii propune s surprind modificrile histologice ale pielii n boala Marek, unele boli,
parazitare i de metabolism la puii de gin.
MATERIAL I METODE
S-au studiat leziunile histologice ale pielii la cadavre de pui de gin, de 18-40 zile cu diverse
afeciuni:
boala Marek-15 pui ;
rie cnemidocoptic-7pui ;
coccidioz asociat cu ochratoxicoz experimental- 6pui ;
hypovitaminoz A-5pui ;
Hypovitaminoz E i hyposelenoz-12pui.
Pielea recoltat a fost fixat cu formaldehid 10%, inclus la parafin, secionat la 5m i
colorat prin coloraiile HEA, PAS, Giemsa.
REZULTATE I DISCUII
Pielea provenit de la puii cu boala lui Marek n vrst de 24 zile prezint foliculi plumiferi
modificai cu limfonoduli adiaceni sau cu aglomerri limfoide perifoliculare n derm.
Alterarea permeabilitii vasculare poate cauza ischemia n esuturile care nconjur tumorile.
Aceasta la rndul ei cauzeaz alterarea transportului fluidelor i poate cauza necroza limfoblastelor
din limfonodurile pielii (fig.1). Endoteliul vascular joac un rol important n microcirculaie i injuriile
endoteliale ale vaselor pot induce creterea permeabilitii vasculare ce conduce la extravazarea
proteinelor plasmatice, incluznd fibrinogenul, n aria perivascular i subendotelial. Depozitele
vasculare pot contribui la hialinoza vascular. Injuriile vasculare pot fi induse prin infiltrarea

Cercetri finanate din grantul CNCSIS 732/2007


167

Universitatea de tiine Agricole i Medicin Veterinar


limfocitelor T n peretele vascular, iar celulele endoteliale afectate apar neregulate. Aceleai
modificri se pot observa i la nivelul sistemului nervos.

a
b
c
Fig.1.Piele pui de 24 zile cu boal Marek. Necroza limfoblastelor din limfonodurile pielii. Col. PAS(a), HEA(b,c)

Experimente realizate pe pui prin inocularea virusului Marek Md/5 relateaz dou tipuri de
leziuni cutanate distincte : tumori asociate i tumori neasociate. Tumorile asociate pot fi progresive i
se caracterizeaz printr-o cretere continu a agregatelor de celule limfoide, rezultnd tumori ce se
dezvolt n grosimea pielii asociate cu dezvoltarea tumorilor n organe. Tipul netumoral se
caracterizeaz prin formarea de agregate de celule limfoide mici n derm naintea formrii tumorilor
(1).
Particulele virale au fost identificate n diverse celule epiteliale incluznd epiteliul foliculilor
plumiferi, epiteliul tubilor uriniferi i limfocitele din bursa Fabricius. In derm are loc necroza celulelor
endoteliale ale capilarelor sanguine, care determin ischemie i necroza limfoblastelor din nodurile
limfatice dermale. Stresul ischemic poate induce replicarea activ a virusului, i formarea
subsecvenelor virale n limfoblaste (3).
Ria cnemidocoptic a fost diagnosticat la psrile crescute n sistem gospodresc.
Debuteaz la baza ciocului, determinnd deformarea acestuia, hipercheratoz, tradus prin
constituirea de depozite crustoase albe-vroase, buretoase, jen n prehensiune i respiraie (8).
Leziunile se pot generaliza cuprinznd faa, regiunea cloacal, aripile, picioarele i regiunea
pectoral, zone pe care se observ deplumaie, hipercheratoz (scuame, cruste aderente) i leziuni
determinate de grataj sau ciupire. Prin examenul microscopic al raclatului din zonele afectate au fost
identificai acarieni Cnemidocoptes pilae (sin. Cenmidocoptes mutans forma mutans) (fig.2).
Acarianul este de talie mic (170-220/98-150m masculul i 280-360/242-300m femela), considerat
corespondentul aviar al sarcopilor de la mamifere (8),

Fig.2. Pui de gin cu rie cnemidocoptic a picioarelor. Cenmidocoptes mutansx900.

La examenul histologic n regiunea sternului epiderma are un diametru mare, cu stratul


intermediar multistratificat. Dermul prezint o acumulare excesiv de fibre de colagen de tip I, III, IV,
infiltraie perivascular sever, mai ales cu LT, n aria perivascular a dermului profund i esutului
subcutanat. n stratul cornos se evideniaz galeriile realizate de acarieni (fig.3).

168

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig.3. Piele de pui cu sclerodermie, din regiunea dermului. Aglomerare limfoid, fibre conjunctive i un numr
mare de capilare n derm. Col. HEA x100.

La puii infestai cu coccidioz i alimentai cu furaje care conin ochratoxina A n doz de


5ppm/kg, se pot observa urmtoarele modificri ale pielii: hipercheratoz, degenerarea foliculilor
plumiferi, capilare ectaziate, hemoragii subcutanate i musculare. Micotoxinele hepatotoxice
(aflatoxinele, ochratoxinele, fumonizinele etc.) determin dermatoz secundar hepatopatiei (5).

Fig. 4 Piele de pui infestai cu coccidioz i alimentai cu furaje care conin ochratoxina A. Col. PAS x200.

Deficienele de metabolism
Hypovitaminoza A este una dintre cele mai cunoscute deficiene nutriionale.
Se manifest prin aspect uscat al pielii, descuamare intens, pododermatit, hipercheratoz
local n regiunea plantar ("coarne cutanate"), xeroftalmie (aspect uscat al ochilor), ngroarea
pleoapei a treia, ngroarea papilelor cloacale, penaj deteriorat (fig. 5a).
Hypovitaminoza A alturi de hypovitaminoze din grupul B (carena n riboflavin, biotin, acid
folic), carena n aminoacizii cu sulf, arginin, zinc i clorur de sodiu, este implicat n etiologia
picajului. (1)
Hypovitaminoza E i hyposelenoza induce dermatita ulcerativ cronic: edem, hiperemie,
ulceraii i exsudaie (fig 5b,c).

Fig. 5. Piele provenit de la pui cu deficiene de metabolism; hypovitaminoz A (a), hypovitaminoza E i


hyposelenoza. Col PAS x100.

Carena n zinc, seleniu, mangan, claciu i magneziu determin fragilitatea i ruperea penelor.

169

1.
2.

3.

4.

5.

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII
Pielea provenit de la puii cu boal Marek n vrst de 24 zile prezint foliculi plumiferi modificai
cu limfonoduli adiaceni sau cu aglomerri limfoide perifoliculare n derm.
n ria cnemidocoptic pielea din regiunea sternului, epiderma are un diametru mare, dermul
prezint o acumulare excesiv de fibre de colagen, infiltraie perivascular cu LT.. n stratul
cornos se evideniaz galeriile realizate de acarieni.
La puii infestai cu coccidioz i alimentai cu furaje care conin ochratoxina A se pot observa
urmtoarele modificri ale pielii: hipercheratoz, degenerarea foliculilor plumiferi, capilare
ectaziate, hemoragii subcutanate i musculare.
n hypovitaminoza A pielea are aspect uscat, prezint descuamare intens, pododermatit,
hipercheratoz local n regiunea plantar, xeroftalmie (aspect uscat al ochilor), ngroarea
pleoapei a treia, ngroarea papilelor cloacale, penaj deteriorat.
Hypovitaminoza E i hyposelenoza induce dermatita ulcerativ cronic: edem, hiperemie,
ulceraii i exsudaie.
BIBLIOGRAFIE

1.
2.
3.
4.
5.

6.
7.
8.

Boulianne M. Cellulitis in broiler chickens. Avian diseases. 2002. Vol. 4. nr1


CHITTY, J.R (2000) ECTOPARASITES OF RAPTORS. PROC BRIT VET ZOO SOC SPRING MEETING 2000
(COTSWOLD WILDL PK) PP30-31
K.-O. CHO et col- Electron microscop and imunohistochemical localization of Marek Diseases Herpesvirus
particle in MD Skin Lymphomas Vet. Pathol 36:314-320 (1999)
Cole, BH (1997) Appendix 7: Parasitic Diseases of Birds: Arthropod Ectoparasites in: Avian Medicine and
nd
Surgery; 2 Ed , Blackwell
Koynarski V, Stoev S, Grozeva N, Mirtcheva T, Daskalov H, Mitev J, Mantle P. Experimental coccidiosis
provoked by Eimeria acervulina in chicks simultaneously fed on ochratoxin A contaminated diet.
Res.Vet.Sci.2007Apr;82(2):225-31.
M.S. Parcells, et col. Mareks Disease Virus Reactivation from Latency: Changes in Gene Expression at the
Origin of Replication Poultry Science, 2003; 82: 893-898
Paul I. Morfopatologia aparatelor i sistemelor organice. Ed.Soc.Med.Vet. Bucureti 1990
Solcan Gh., Mitrea I.L., Miron L., Solcan Carmen, - Dermatopatologia animalelor de companie Ed. "Ion
Ionescu de la Brad", Iasi, 2003

170

Lucrri tiinifice vol. 51 seria Medicin Veterinar

MODIFICARI MACRO I MICROSCOPICE ALE ORGANELOR LA


OARECII EXPUI LA NTUNERIC PRELUNGIT
THE MACRO AND MYCROSCOPIC MODIFICATIONS OF SOME ORGANS AT
MICE THAT ARE KEPT IN PROLONGED DARKNESS
SPTARU Mihaela, COOFAN Otilia, SPTARU C-tin, VULPE V.
FMV Iai
oarecii albi sunt roztoare cu activitate predominant nocturn. Alternarea perioadelor
lumin (70-100 luci) 10-12 ore i ntuneric are o importan esenial n funcionarea normal a
aparatelor i sistemelor, lumina avnd un rol predominant n fiziologia aparatului reproductor i
n imunitate. Studiul efectuat arat c la oarecii meninui n condiii de ntuneric total timp de
120 zile se instaleaz unele procese degenerative att la nivelul aparatului vizual dar i la nivelul
aparatelor i sistemelor organismului. Acestea au fost produse ca urmare a ncercrii
organismului de a se adapta stresului cronic produs de lipsa luminii i au constat n reducerea cu
aproximativ 10-15% a greutii corporale prin reducerea consumului alimentar urmare a
ncetinirii metabolismului, anse intestinale goale i dilatate, splenomegalie, uoar mrire n
volum a ficatului i culoare lutoas. La nivelul aparatului vizual se observ scderea semnificativ
a secreiei lacrimale prin reducerea la jumtate a glandei lacrimale, ochi nfundai n orbite,
metaplazia epiteliului cornean anterior i reducerea grosimii retinei. Minimalizarea implicrii
aparatului vizual n orientarea individului duce la atrofia fiziologic a acestuia prin diminuarea
funciei i la creterea implicrii celorlaltor simuri, n principal olfactiv i auditiv n ncercarea de
a se adapta noilor condiii impuse de mediu.
Key words:mice, darkness, eye boll, liver, spleen

oarecii albi sunt roztoare cu activitate predominant nocturn. Alternarea perioadelor lumin
(70-100 luci) 10-12 ore i ntuneric are o importan esenial n funcionarea normal a aparatelor
i sistemelor, lumina avnd un rol predominant n fiziologia aparatului reproductor i n imunitate.
Vederea la oarece i obolan are o form de sensibilitate specializat pentru recepia i analiza
undelor electromagnetice cu lungime de und de 400-800 nanometri (5). Att expunerea oarecilor la
lumin ct i meninerea acestora n condiii de obscuritate total reprezint factori de stres la care
organismul reacioneaz imediat. Meninerea timp ndelungat a factorului stresant determin reacii
de adaptare a organismului n mod compensator pentru a menine statusul vital n condiii de
supravieuire (2). Minimizarea implicrii aparatului vizual n orientarea individului duce la reducia
morfologic (1, 4) a acestuia prin diminuarea funciei i la creterea implicrii celorlaltor simuri, n
principal olfactiv i auditiv n ncercarea de a se adapta noilor condiii impuse de mediu (2, 3).
MATERIAL I METODA DE LUCRU
Pentru efectuarea acestui experiment s-au utilizat dou loturi a cte 4 oareci, femele i
masculi: lotul martor i al doilea lot care a fost meninut timp de 120 de zile n condiii de ntuneric
total ntr-o camer special amenajat. Cele dou loturi de oareci au beneficiat de hran i ap la
discreie. Pe parcursul experimentului s-a urmrit comportamentul, starea de sntate i greutatea
fiecrui individ. Dup 120 de zile, att de la lotul martor ct i de la lotul supus experimentului s-au
prelevat probe de snge i organe care au fost prelucrate prin tehnica histologic specific i colorate
HEA.. Rezultatele obinute, difereniate pe loturi au fost comparate cu informaiile din literatura de
specialitate.
REZULTATE I DISCUII
Studiul efectuat arat c la oarecii meninui n condiii de ntuneric total timp de 120 zile se
instaleaz unele procese degenerative att la nivelul aparatului vizual ct i al altor aparate i sisteme
organice.

171

Universitatea de tiine Agricole i Medicin Veterinar

A.
B.
Fig. 1. A. Soarece lot martor, B. Soarece meninut la ntuneric timp de 120 zile
T- timus, C, cord, P- pulmon, F- ficat, G- stomac, S, L- splina, D- duoden, J, Jj- anse jejunale, Ig- intestin gros,
Cc- cecum, Cd- colon descendent, Ts- testicol

Acestea au fost produse ca urmare a ncercrii organismului de a se adapta stresului cronic


produs de lipsa luminii i au constat n reducerea cu aproximativ 10-15% a greutii corporale,
asociat cu atrofia i distensia pereilor intestinaliprin reducerea consumului alimentar, urmare a
ncetinirii metabolismului, anse intestinale goale i dilatate.
La lotul martor, ficatul are aspect general caracteristic speciei (fig.2): lobulaia normal,
puintatea esutului conjunctiv cu hepatocite mono- i mai rar binucleate exprimnd moderat
anizocitoz (cele mai mari fiind i mai intens bazofile) i anizocarie.
Ficatul oarecilor meninui n
condiii de ntuneric total are culoare lutoas (fig. 1B), este uor mrit n volum iar la examenul
microscopic se observ accentuarea anizocitozei i anizocariei cu frecvente aspecte de megalocitoz,
anizocromie nuclear i citoplasmatic, imagini de degenerescen granular mergnd pn la
necroz exprimat prin picnoze, cariorexe, cromatoliz i carioliz, asociate cu ectazii vasculare
centrolobulare i aglomerri limfoide mici i rare (fig. 3 B).

Fig.2 Ficat de oarece din lotul martor. Col HE x200

172

Lucrri tiinifice vol. 51 seria Medicin Veterinar

A.
B.
Fig. 3. Ficat de oarece meninut la ntuneric timp de 120 zile, A, B - col HEA x 400

A
B
Fig. 4. A- Splina la oarece din lotul martor B. Splina la oarecii din lotul experimental.

Splina la oarecii din lotul supus experimentului este mrit n volum i uor bombat avnd
capsula tensionat i culoare roie nchis (fig. 4).
Examenul histologic relev prezena megacariocitelor, caracteristic a speciei (fig. 5C). La lotul
supus experimentului se observ hiperplazia numeric a foliculilor limfoizi (fig. 5 B) nsoit de
congestie i hemosideroz (fig. 5, C). Hiperplazia nodular din splin i nodulii limfoizi din ficat
contravin ideii de imunosupresie lansat n literatura de specialitate i sugereaz asocierea unei
afeciuni concurente.

173

Universitatea de tiine Agricole i Medicin Veterinar

C
Fig. 5
A- splina oarece lot martor, col HEA, X 100
B- splina la oarece lot experimental, col HEA x100
C- Splin de oarece, lot experimental, folicul limfoid, megacariocite, hemosideroz, col HEA x 200

Dei ambelor loturi le-a fost administrat hran i ap la discreie i au fost meninute n
condiii optime de microclimat, oarecii lotului expus la ntuneric au manifestat scderea consumului
alimentar i hidric pe fondul reducerii activitii fizice. La examinarea periodic a oarecilor din lotul
experimental acetia manifestau o stare de somnolen permanent i stteau mai mult n cuib.
Reducerea consumului de ap a dus la oligurie i concentrarea urinei observate n principal prin
reducerea frecvenei nlocuirii talajului din cuc.
La nivel renal, examenul histologic pune n eviden glomerulita proliferativ mezangial i
modificri degenerative n special n tubii contori proximali (fig. 7 A), dar i focare de tubulonecroz
cu decolarea epiteliului de pe membrana bazal, clarificarea citoplasmei i dispariia nucleilor (fig. 7
B).

Fig.6 Rinichi de oarece, lot martor, col HEA x 200

174

Lucrri tiinifice vol. 51 seria Medicin Veterinar

A
B
Fig. 7. Rinichi de oarece, lot experimental, A- glomerulit mezangial, HEA x 400B- tubulonecroz, col HEA x
400

La nivelul aparatului vizual se observ regresia morfo-clinic manifestat n principal prin


reducerea secreiei lacrimale, enoftalmie i reducerea fantei palpebrale Pentru orientarea n spaiu
ne folosesc n principal de celelalte simuri: olfactiv, tactil i auditiv. Aceste simuri se dezvolt
progresiv ncepnd din a 25-30-a zi de experiment astfel nct individul recupereaz n timp decalajul
de greutate care era mai accentuat (20% greutate mai mic la cntrire) n prima perioad a
experimentului.
Att macroscopic ct i la examenul microscopic se observ atrofia cu reducerea cu pn la
70% a glandei lacrimale (fig. 8, A i B) i atrofia musculaturii pleoapelor.
La oarecii din lotul experimental se observ fenomenul de atrofie a retinei cu reducerea
neuniform a grosimii acesteia (fig. 9, A, B), i hemoragii retrobulbare (fig. 8, A, B).

A
B
Fig. 8. Aparatul vizual: glob ocular, glanda lacrimal i anexele acestuia
A- oarece lot martor, col HEA x 100
B- oarece expus la ntuneric timp de 120 zile, col HEA x 100

175

Universitatea de tiine Agricole i Medicin Veterinar

A
B
Fig. 9. Aspectul retinei la oarece A. lot martor, col HEA x 200 B- lot experimental, col HEA x 200

n urma experimentului efectuat pe oareci albi de laborator s-a putut evidenia c factorii
abiotici, n acest caz lipsa luminii, constituie factori stresani majori care afecteaz att aparatul
vizual ca organ de percepie a luminii ct i ntregul organism prin perturbarea funcionrii normale a
aparatelor i sistemelor organice subsecvente tulburrilor de metabolism.
1.

2.

3.

4.
5.

CONCLUZII:
La oarecii din lotul supus experimentului se nregistreaz reducerea cu aproximativ 10-15% a
greutii corporale prin reducerea consumului alimentar i hidric, urmare a ncetinirii
metabolismului.
Ficatul oarecilor supui experimentului este uor mrit n volum, examenul microscopic
relevnd vasodilataie centrolobular, anizocitoz, anizocarie i anizocromie accentuate i
alterri ale hepatocitelor care evolueaz spre necrobioz la care se adaug mici proliferri
limfoide intralobulare.
La oarecii din lotul supus experimentului s-a constatat splenomegalia prin hiperplazia numeric
a foliculilor limfoizi i congestie cu hemosideroz pe fondul de megacariocitoz caracteristic
speciei.
La nivel renal examenul histologic pune n eviden glomerulita proliferativ mezangial i
modificri degenerative i necrobiotice n special n tubii contori proximali.
La lotul experimental, att macroscopic ct i la examenul microscopic se observ atrofia cu
reducerea cu pn la 70% a glandei lacrimale, atrofia musculaturii pleoapelor i reducerea n
grosime a retinei.
BIBLIOGRAFIE:

1.
2.
3.

4.
5.

Wu, M.L. / Chiao, C.C. Light deprivation delays morphological differentiation of bipolar cells in the rabbit
retina - , Brain Research, 1170, p.13-19, Sep 2007
Gonzlez, Mnica M C / Aston-Jones, Gary , Circadian regulation of arousal: role of the noradrenergic locus
coeruleus system and light exposure. Sleep, 29 (10), p.1327-1336, Oct 2006
Ucar, T / Ozkaya, G / Demir, N / Gurer, I / Akyuz, M / Onal, M Z, The effects of environmental light-dark
changes on experimental mild traumatic brain injury, Acta neurologica Scandinavica, 112 (3), p.163-172, Sep
2005
Tinghuai Wu, James T. Handa, and John D. Gottsch, Light-Induced Oxidative Stress in Choroidal
Endothelial Cells in Mice Investigative Ophthalmology and Visual Science. 2005;46:1117-1123.
Cotea C- Histologie special, 2003, Ed.Tehnopress, ISBN 973-8377-10-2, p. 94-112

176

Lucrri tiinifice vol. 51 seria Medicin Veterinar

ASPECTE MORFOLOGICE PRIVIND VASCULARIZAIA


LIMFATIC A GLANDEI MAMARE LA CEA
STAN F.
FMV CLUJ-NAPOCA
The purpose of this research was to study the mammary lymphatic network and lymphatic
drainage in the bitch using blue Evans as a vital colorant material for lymphatic system. This
paper demonstrate that the results are good when is using a solution with a concentration of 1%,
and 2,5% of active substance in physiologic serum, wich is administrated subcutaneous,
intradermic and in mammary parenchyma. This study shows that the lymphatic drainage is
different for every mammary gland and includes at least 2 lymphonodal groups and two ways to
drainage. More than that, this study shows the individual variability of lymphatic system in this
species, meaning the posibilities of presence or absence of some lymphonodes.

Sistemul limfatic este o entitate anatomic distinct care joac un rol important n controlul
local al tumorilor, precum i n transportul celulelor tumorale, reprezentnd totodat calea cea mai
obisnuita pentru metastazarea acestora (8, 9, 10, 13, 14, 16, 20).
Circulaia limfatic mamar cuprinde vasele limfatice ce rezult din reeaua cutanat
superficial i cea profund perilobular, iar limfa drenat de la nivelul lanului mamar este recoltat
i direcionat ctre limfonodurile axilare i limfonodurile inghinale superficiale, limfonoduri care sunt
considerate santinel pentru glandele mamare (5,6).
ntruct exist puine informaii n literatura de specialitate n cea ce privete vascularizaia
limfatic a glandei mamare de la cea, acestea ar putea servi ca model animal pentru studiul
modelului vascular limfatic la femeie, tiut fiind faptul c cele dou specii se aseamn din cel putin
trei puncte de vedere, si anume: frecvena ridicat tumorilor mamare, vrsta apariiei acestora,
precum i statusul hormonal, bineneles toate corelate cu durata medie de via a celor dou specii
(12).
n aceasta lucrare am analizat drenajul limfatic normal pentru fiecare gland mamar
sntoas i am descris modelele vasculare diferite care au fost gsite n aceast direcie,
neimplicnd glanda mamar neoplazic.
Studiul drenajului limfatic al glandelor mamare la cea, a fost efectuat pe fiecare gland
mamar n parte. Unii autori susin c, glanda mamar toracic cranial (prima gland) are un drenaj
propriu care ajunge n limfonodurile sternale iar glandele de pe fiecare parte sunt complet
independente n ceea ce privete drenajul limfatic (16).
Alii arat c glanda mamar toracic cranial este drenat fie numai de limfocentrul axilar, fie
simultan de limfocentrul axilar i de cel cervical superficial (13). Tot ei susin c glanda mamar
toracic caudal (a doua gland) este drenat de limfocentrul axilar, iar glanda mamar abdominal
cranial (a treia gland) are un drenaj dublu: o parte din vase converg spre limfonodurile axilare, iar
cealalt parte nspre limfonodurile inghinale superficiale, sau n anumite situaii drenarea se poate
face numai n unul dintre acestea (14). Unii autori susin c primele trei glande mamare (T1,T2,A1)
sunt drenate de ctre limfonodurile sternale craniale (1, 3, 19), iar alii susin c exist conexiuni
limfatice ntre toate glandele de pe acelai rnd (7, 15, 17).
De asemenea, glanda mamar abdominal caudal (a patra gland) este drenat de
limfonodurile inghinale superficiale sau simultan de limfonodurile inghinale superficiale i de cele
iliace mediale, iar glanda mamar inghinal (a cincea gland) este drenat numai de limfonodurile
inghinale superficiale. . De asemenea, nu a putut fi demonstrat nca faptul ca exist o legtur ntre
numrul limfonodurilor mamare i greutatea corporal (14).
MATERIAL SI METODA
n lucrarea de fa, materialul a fost reprezentat de 15 cele de ras comun, avnd vrste i
greuti diferite. Dup o prealabil anestezie general cu acepromazin 0,5mg/kg i ketamin 20
mg/kg i toaleta regional, precum i o anestezie local cu xilin s-a trecut la injectarea substanei
colorate.
177

Universitatea de tiine Agricole i Medicin Veterinar


Substana colorant a fost reprezentat de albastru Evans care este o soluie de culoare
albastr, nchis, foarte solubil i care ajunge cu predilecie n esutul limfatic. Este uor penetrant,
fiind reinut cu uurin de limf permind astfel evidenierea limfonodurilor i a vaselor limfatice
din organismul animal. Nu induce efect toxic i poate fi injectat pe animalul n via. Aceast soluie a
fost diluat n ser fiziologic n condiii sterile i de asepsie local, pentru a evita infeciile care ar
produce modificri de volum a limfonodurilor, ce ar induce rezultate incorecte
Injectarea substanei colorate s-a efectuat subcutan, intradermic i n parenhimul mamar, al
glandei mamare luate n studiu, n patru puncte (cranial, caudal, lateral i medial). Concentraia a fost
de 1% i respectiv 2,5% substan activ, iar cantitatea de substan folosit a fost de 0,1 ml pentru
fiecare punct injectat, n total fiind injectat 0,4 ml soluie.
Citirea rezultatelor s-a fcut la 24 de ore de la ultima administrare, care a coincis cu
eutanasierea celelor i trecerea la disecia stratigrafic i regional, ncepnd cu regiunea injectat
i continund att n sens cranial ct i n sens caudal, urmrind pe ct posibil traiectele limfatice.
REZULTATE SI DISCUTII
Avnd n vedere c s-a lucrat pe un numr de 15 cele, de vrste i greuti diferite, precum i
pe glande mamare diferite n sensul injectrii la un singur subiect doar a unei singure glande mamare,
fr a ine cont de o anumit parte a coprului, adic partea stng sau dreapt. n tabelul de mai jos
am prezentat distribuia i numrul glandelor mamare injectate.
Tabel nr 1. Distribuia i numrul glandelor mamare sntoase injectate
Glanda mamar injectat Numr de glande (cele)
T1 (toracic cranial)
2
T2 (toracic caudal)
2
A1 (abdominal cranial) 8
A2 (abdominal caudal) 2
I (inghinal)
1
Total
15

Fig. 1 Aspectul limfonodului axilar propriu

Referitor la drenajul limfatic al fiecrei glande mamare, se observ c fiecare dintre acestea va
avea un drenaj particular cuprinznd gruparea limfonodal cea mai apropiat, care este considerat
ca i grupare santinel. n ce privete sensul drenajului limfatic al glandei mamare toracice craniale
(T1), am observat c aceasta este drenat n principal de limfocentrul axilar dar i de cel toracic
ventral. Limfocentrul azilar este reprezentat la aceast specie de limfonodul axilar propriu i
limfonodul axilar accesoriu, ns noi nu am gsit constant prezente aceste limfonoduri. n 8 din 15
cazuri lipseau limfonodurile axilare accesorii, situaie n care limfonodurile axilare proprii erau mai
mari comparativ cu cazurile n care cele accesorii erau prezente.
178

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Ca i situaie topografic limfonodul axilar propriu apare n mod costant mai cranial fa de
limfonodul axilar accesoriu, plasat caudal de poriunea distal a muchiului mare rotund, ventral de
originea arterei toracice dorsale. Limfonodul axilar accesoriu, este mai mic atunci cnd exist, se
gsete mai caudal de limfonodul axilar propriu, i anume la marginea dorsal a muchiului pectoral
ascendent

Fig. 2 Limfonodurile axilare proprii (stnga) i accesorii (dreapta)

Limfonodurile sternale craniale, apar constant plasate caudal de cel de-al 2-lea cartilaj costal i
anume n al 2-lea spaiu intercostal, ventral de vasele toracice interne i sunt prezente numai pe o
singur parte, cele caudale lipsind cu desvrire.

Fig. 3 Limfonodul sternal cranial

Surprinztor apare colorarea limfonodurile cervicale profunde caudale la 4 din 15 cazuri, care
apar mai puin dezvoltate dect limfonodurile sternale craniale, fiind situai ventral de trahee, sub
muchii sternotiroidian i sternohioidian, la civa cm de intrarea n torace.
Tot n sens cranial au fost drenate i glandele T2 i A1, astfel c n tabelul de mai jos vom
prezenta limfonodurile santinel al acestora.

179

Universitatea de tiine Agricole i Medicin Veterinar


Tabel 2. Limfonodurile santinel ale glandelor mamare sntoase la caele
Glande mamare Limfocentru
Axilar Inghinal superficial Popliteu
T1
+
T2
+
A1
+
+
A2
+
+?
I
+
+?

Referitor la glanda mamar abdominal cranial A1 rezultatele noastre demonstreaz c exist


dou direcii de drenaj limfatic i anume: unul cranial i altul caudal. n studiul nostru, glanda A1 este
drenat n sens cranial pe lng limfocentrul axilar, de cel sternal cranial precum i de cel cervical
profund caudal.
In ce privete drenajul limfatic al glandelor A2 i I, acesta este predominant caudal, i anume
cuprinznd n principal limfonodurile inghinale superficiale, care pot fi considerate ca limfonoduri
santinel, dar i colorarea celor ileofemurali, iliaci mediali precum i a celor lomboaortici. Menionm
ca limfonodurile polpitei nu au fost bine impregnate i nici vasele limfatice regionale aferente sau
eferente acestora, dei acestea sunt considerate ca i limfonoduri santinel.

Fig. 4 Limfonodurile inghinale superficiale

Limfonodurile mamare au dimensiuni destul de mari, plasai la marginea dorsolateral a


ultimei mamele, aproape de marginea cranial a osului pubis. Limfonodurile ileofemurale erau destul
de mici (sub 1 cm), situate aproape de terminarea arterei iliace externe, caudal de inseria tendonului
muchiului micul psoas, ele lipsind la 7 din 15 indivizi. Celelalte limfonoduri (iliace mediale, sacrale i
lomboaortice) au fost constant ntlnite i colorate la toate cazurile.
Limfonodurile iliace mediale erau plasate la marginea lateral a aortei sau a venei cave
caudale. Extremitatea lor caudal nsoete originea arterei iliace externe, n timp ce extremitatea sa
cranial atinge artera circumflex iliac profund pe care o chiar depete.
Limfonodurile sacrale, apar situate ntre artera sacral median i originea arterei iliace
interne. Cele lomboaortice sunt mici (sub 0,5 cm), destul de dificil de gsit n grsimea ambiant,
plasai sub muchii psoai, de o parte i alta a aortei i a venei cave caudale.

180

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Limfonodurile
lomboaortice

Limfonodurile iliace
mediale

Limfonodurile
ileofemurale

Limfonodurile
sacrale

Fig. 5 Aspectul limfonodurilor iliace mediale, sacrale i lomboaortice


Tabel 3. Lista limfonodurilor analizate n acest studiu
Limfocentru
Limfonodurile
Axilar
Axilare proprii i accesorii
Toracic ventral
Sternale caudale i craniale
Cervical profund
Cervicale profunde caudale, mijlocii i craniale
Cervical superficial
Cervicale superficiale dorsale i ventrale
Inghinal superficial sau inghino-femural Inghinale superficiale sau mamare
Inghinal profund sau ileofemurale
Femurale
Iliosacral
Iliace laterale, iliace mediale i sacrale
Lombar
Lomboaortice i renale
Popliteu
Popliteu superficial

Glanda mamar este locul unde se ntlnesc cel mai frecvent neoplaziile la cine. Cele mai
frecvente tipuri de tumori maligne sunt carcinoamele, sarcoamele i tumori mixte. Toate aceste
tumori metastazeaz pe o poriune mai mult sau mai puin extins prin intermediul sistemului
limfatic. Acest lucru demonstreaz importana sistemului limatic n procesele neoplazice ale glandei
mamare.(2)
Cunoscnd toate acestea acestea, ajutorul vizeaz conduita terapeutic, dar putem intui
eventualele metastaze ale acestora i mai mult putem lua o decizie referitor la tehnica interveniei
chirurgicale.
Tehnicile chirurgicale includ ndeprtarea glandei mamare afectate de tumor mpreun cu
conexiunile sale limfatice cu alte glande , cu limfonodurile care dreneaz aceste glande i alte glande
cu care acetia sunt conectai. (1; 11) Diferenele anatomice ale sistemului limfatic nu permit
dezvoltarea unei tehnici chirurgicale standard.
1.
2.

3.

CONCLUZII
Colorantul albastru Evans folosit n aceste studiu, a vizualizat traiectele vaselor limfatice ale
glandelor mamare i ale limfonodurilor adiaceni acestora.
La subiecii cercetai de noi, n 8 din 15 cazuri lipseau limfonodurile axilare accesorii, cu
meniunea c limfonodurile axilare erau mai mari comparativ cu cazurile n care cele accesorii
erau prezente.
Toate limfonodurile sternale craniale erau localizate caudal de cel de al doilea cartilaj costal, fiind
situate n spaiul al doilea intercostal i prezente doar de o singur parte.
181

4.
5.

6.
7.

Universitatea de tiine Agricole i Medicin Veterinar


Limfonodurile iliace mediale, sacrale si lomboaortice au fost constant ntlnite si colorate la toate
cazurile
Toate acestea, demonstreaz cu certitudine c exist dou direcii de drenaj limfatic pentru
glanda mamar abdominal cranial (A1) i anume: unul cranial cuprinznd limfonodurile axilare,
sternale i cervicale profunde caudale, iar cel caudal cuprinznd limfonodurile inghinale
superficiale, ileofemurale, iliace mediale, sacrale i lomboaortice.
Mai mult, rezultatele arat variabilitatea sistemului limfatic, n sensul prezenei sau absenei
anumitor limfonoduri n funcie de individ.
Pe baza acestui studiu, recomandm n cazul ablaiei mamelelor cu neoplasme, s se fac i
extirparea limfonodurilor care dreneaz limfa din acestea.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.

15.
16.
17.

18.
19.

20.

Apostoleano EC, 1925, Contribution a letude du Systeme Lymphatique Mammaire chez les Carnivores
Domestiques in These pour le Doctorat Veterinaire. Paris, Vigot & Freres
Baba, A. I., 2002 Oncologie comparat, Ed. Academiei Romne, Bucureti.
Baum H, 1918, Das Lymphgefassystem des Hundes in Arch wiss Prakt Tierheilk- 44: 521-650
Brodey Rs, Goldschmidt MH, Roszel JR, 1983, Canin Mammary Gland Neoplasm in JAAHA- 19:61-90
Coofan V., Palicica R., Hricu V., Carmen G., Valeriu E., 2000,Anatomia animalelor domestice,vol.III.,
Ed.Orizonturi Universitare, Timioara, 126-160
Damian, A,. 2001, Sistemul cardiovascular, Edit. Genesis Cluj-Napoca, 156 191
Habel RE, 1978, Mammary Gland in Applied Veterinary Anatomy. Ithaca, NY, Robert E. Habel pp 271-276
Haigh, P. I. and A. E. Giuliano, 2000: Role of sentinel lymph node dissection in breast cancer. Ann. Med. 32.,
51-56
Hartveit, F., 1990: Attenuated cells in breast stroma: the missing lymphatic system of the breast.
Histopathology 16, 533-543
Liu, N. F., and L. R. Zhang, 1998: Changes of tissue fluid hyaluronam (hyaluronic acid) in peripheral
lymphedema. Lymphology 31, 173-179
Mann FA, 1984, Canine Mammary Gland Neoplasia in Canine Pract- 11(4).22-26
Nerurkar, V., A. R. Chitale, B. V. Jalnapurkar, S. N. Naok, V. S. Lalitha, 1989: Comparative pathology of
canine mammary tumors. J. Comp. Pathol. 101, 389-397
Patsikas M.N., A. Dessiris, 1996, The lymf drainage of the mammary glands in the bitch: a limfografic study.
Part II: The 3-rd mammary gland, Anat Histol. Embriol. 1996 Jun.; 25(2): 139-143.
Patsikas MN, Dessiris A., Iunie 1996, The lymph drainage of the mammary glands in the bitch: a
st
nd
th
th
lymphographic study. Part 1: The 1 , 2 , 4 and 5 mammary glands in Anatomy Histology Embriology-25
(2):131-138
Pierard J, 1972, Paroi Abdominale en Anatomie Appliquee des Carnivores Domestiques, Chien et Chat. Paris,
Maloine SA- pp 180-181
Ruberte J, Sautet JY, Gine JM, Lopez C, Rodriguez A. (Decembrie 1990, Collecteurs Lymphatiques
Mammaries de la Chienne en Anat Histol Embryol- 19: 347-358
Sautet, J. Y., J. Rubert, C. Lopez, J. M. Gine, G. Ordonez, and A. Cingia, 1992: Lymphatic System of
Mammary Glands in the Dog: An approach to the surgical treatment of Malignance Tumors. Canine Pract. 17,
30-33
Schrenk, P., R. Rieger, A. Shamiyeh, and W. Wayand, 2000: Morbidity Following Sentinel Lymph Node
Biopsy versus Axilary Lymph node Dissection for Patients with Breast Carcinoma. Cancer 88, 608-614
Stalker LK, Schlotthauer CF, 1936, Neoplasm of the Mammary Gland in the Dog. The Surgical Treatment of
Mammary Tumors. Report of Two Case and Study of the Lymphatic Drainage of the Mammary Glands in North
American Veterinarian- 17: 33-43
Stewart, K. C., and D. M. Lyster, 1997: Lymphocintigraphy for morphology and functional information about the
lymphatic system. J. Invest. Surg. 10, 249-262

182

Lucrri tiinifice vol. 51 seria Medicin Veterinar

PARTICULARITI ANATOMICE ALE LIMFOCENTRULUI


AXILAR I POPLITEU LA C]INE
STAN F., GUDEA Al., DAMIAN A., SOCACIU Antonia
FMV CLUJ-NAPOCA
The purpose of this study was to emphasised the axilary and popliteus limphonodes in dogs
using the blue Evans as the intravital coloration substance. The study was done on a number of 15
mongrel dogs, all female, in which the axilarylimphonodes were emphasised, as well as the
popliteus limphonodes. As a result of this research we noticed that in what concerns the
lymphatic system this species displays a surprisingly large variation from one individual to
another, as compared to the common norm, given the presence or absence of certain
lymphonodes. Moreover, we have pointed out both the location and the number of these
lymphonodes which in this species are seen as a kind of wardens, as they are always clinically
investigated in any routine check-up exam of the animal.

Se tie c sistemul circulator limfatic este alctuit din dou componente principale: vase
limfatice i noduri limfatice. n ce privete vasele limfatice, reprezentate de capilare, venule i vene,
alctuiesc o reea de conducte cu perei transpareni i cu valvule n interior, asemntor venelor. Ele
sunt situate superficial, n esutul subcutanat, sau profund, de obicei ntre muchi, mai ales la
extremiti. Vasele superficiale nu urmresc traiectul arterelor sau venelor superficiale, ci urmeaz o
traiectorie bazat pe direcia de deformare, de ntindere maxim a tegumentului n timpul micrilor
(1, 3, 4, 6).
Vasele limfatice au rolul de a conduce n circulaia venoas, o parte din plasma interstiial
transudat din capilarele sanguine, mpreun cu mononuclearele i limfocitele provenite din nodurile
limfatice, ntlnite pe traiectul lor. Vasele au originea n reeaua capilar limfatic, situat n spaiile
conjunctive, de unde conflueaz succesiv, n venule i vene limfatice, care se unesc n trunchiuri
colectoare mari. Vasele mari, colectoare, nsoesc de obicei, venele superficiale sau profunde, trecnd
prin aceleai orificii vasculare.
Circulaia limfei se realizeaz centripet, ca i a sngelui n vene, cu deosebirea c aceasta se
scurge mult mai lent. Datorit existenei valvulelor cu deschidere centripetal, circulaia limfei este
influenat i determinat de aceeai factori ca i circulaia venoas (1, 3, 4, 6). Punerea n eviden a
sistemului limfatic se realizeaz prin mai multe metode, printre care i metoda injectrii substanelor
colorate care au afinitate pentru vasele limfatice. Aceast metod a fost utilizat de numeroi
cercettori, iar substanele colorate pot fi vitale sau nevitale (10).
Dintre coloranii vitali sunt citate: albastru cresyl (14), carmin indigo(2), albastru patente violet
n soluie izotonic de 11% (9), le bleu ciel pontamine (15), albastru Evens (7, 11), Alfafurine care este
un colorant albastru, (5), apoi tu de China (8) sau carbon activ (12). n toate cazurile problema
rmne concentraia substanei, cantitatea i numrul injectrilor.
MATERIAL I METOD
Materialul a fost reprezentat de 12 cele de ras comunitar, care au fost anesteziate cu
Acepromazin 0,5mg/kg greutate coerporal i Ketamin 20 mg/kg greutate corporal, administrat
intramuscular, iar dup instalarea anesteziei s-a trecut la injectarea substanei colorate, adic
albastru Evans.
Substana colorant (albastru Evans) a avut o concentraie de 1%, iar administrarea substanei
s-a fcut att subcutanat i n parenchimul mamar al glandei mamare toracale craniale i respectiv
cea inghinal. Cantitatea de colorant a fost de 0,4 ml, iar repetarea s-a fcut tot la 24 de ore, timp de
5 zile consecutiv. Citirea rezultatelor s-a fcut la 24 de ore de la ultima administrare, fcndu-se
disecia stratigrafic i regional a fiecrui caz n parte, folosind ca metode complementare
observaia i fotografia.
REZULTATE I DISCUII
Limfocentrul axilar i cel popliteu cele mai reprezentative limfocentre n ceea ce privete
practica medical i semiologic, mai ales n medicina omului, dar nu este deloc de neglijat nici n
183

Universitatea de tiine Agricole i Medicin Veterinar


medicina animalelor, mai ales la speciile mici, cum este cazul animalele de companie, cu precdere
specia canin.
Dac n medicina omului acest limfocentru axilar reprezint oglinda strii de sntate a glandei
mamare, fiind considerat ca limfonod santinel, putem afirma ca i la specia canin, acesta nu este cu
nimic mai nensemnat, cu att mai mult cu ct acest limfocentru este responsabil de vascularizaia
att a membrului toracic ct, i a unor glande mamare, respectiv a primelor 3 glande mamare, lucru
unanim acceptat de ctre muli autori. De asemenea, limfocentru popliteu este considerat tot un
limfocentru santinel deoarece la specia canin acesta intotdeauna ofer date preioase asupra strii
de sntate a animalului, i chiar a glandei mamare.
La specia canin limfocentru axilar cuprinde dou mari grupri limfonodale, i anume,
limfonodurile axilare proprii i limfonodurile axilare accesorii, astfel c noi am urmrit la acesta,
situaia topografic, care are mare importan n practicarea medicinii cinelui, deoarece acest
limfocentru, sau mai precis o parte dintre limfonodurile care-l alctuiesc pot fi palpate clinic, dnd
indicii preioase asupra strii de sntate a individului, iar mai cu seam n cazul femelelor, n special
asupra strii de sntate a primelor glande mamare.
Aceste limfonoduri se palpeaz atunci cnd membrul toracic este tras nainte, caz n care
palpm doar limfonodurile axilare accesorii. Investigaiile asupra morfologiei limfocentrului axilar au
importan major n ce privete numrul limfodurilor care-l alctuiesc, precum i poziia topografic
a acestora, toate concurnd la o imagine ct mai complet asupra animalului. n ce privete numrul
limfodurilor care alctuiesc acest limfocentru, noi am intlnit 3 situaii, i anume:
n prima situaie, ntlnit la un numr de 4 indivizi la care se observ colorarea destul de
evident a limfonodului axilar propriu, care apare unic, iar limfonodul axilar accesoriu lipsete.
Limfonodul axilar propriu este de dimensiuni relativ mari, aproximativ 2,5 cm, fiind plasat caudal de
poriunea distal a muchiului mare rotund, ventral de originea arterei toraco dorsale, i la civa
centimetri dorsal de muchiul pectoral ascendent.
Mai mult, la acest nivel putem observa existena unor vase care nu converg ctre hilul
acestuia, ci se continu mai departe, fie n spre limfonodurile sternale craniale, fie n spre cele
cervicale profunde caudale sau chiar n spre cele cervicale superficiale (Fig 1).

Fig. 1 Limfonodurile axilare proprii

A doua situaie a fost ntlnit la un numr de 6 indivizi la care se observ colorarea destul de
evident att a limfonodului axilar propriu, ct i a limfonodului axilar accesoriu. Limfonodul axilar
184

Lucrri tiinifice vol. 51 seria Medicin Veterinar


propriu este de dimensiuni relativ mai mari dect cel accesoriu, aproximativ 2 cm, fiind plasat caudal
de poriunea distal a muchiului mare rotund, ventral de originea arterei toraco-dorsale, i la civa
centimetri dorsal de muchiul pectoral ascendent i cranial de limfonodul axilar accesoriu. Limfonodul
axilar accesoriu este de dimensiuni relativ mai mici dect precedentul, aproximativ 1,5 cm, plasat
caudal de acesta, i anume la marginea dorsal a muchiului pectoral ascendent, ntre acesta i
muchiul marele dorsal, caudal de olecran, fiind separat de piele att de esutul conjunctiv
subcutanat ct i de muchiul pielos al trunchiului(Fig 2).

Fig. 2 Limfonodurile axilare proprii (stnga) i accesorii (dreapta)

Ambele limfonoduri axilare, att propriu ct i cel accesoriu sunt situate la faa medial a
regiunii braului, respectiv a regiunii spetei, ei putnd fi palpai chiar prin transversul pielii i a
esutului conjunctiv subcutanat, atunci cnd membrul este tras nainte.
A treia situaie a fost ntlnit la un numr de 2 indivizi, la care au fost prezente att
limfonodul axilar propriu ct i limfonodul axilar accesoriu, dar n plus apare un al treilea limfonod
situat ntre acetia, dar de dimensiuni mai mici (Fig 3). Menionm c nu am ntlnit la celelalte cazuri
studiate de noi, prezena celor trei limfonoduri, lucru care demonstreaz i aici plasticitatea mare a
sistemului limfatic la aceast specie.
Limfonodul axilar propriu apare dublu la unul din cei doi indivizi la care este prezent
limfonodul suplimentar, n senul c exist dou limfonoduri proprii, unul situat dorsal iar cellalt
ventral. Dimensiunea fiecruia este de aproximativ egal cu cea a limfonodului axilar accesoriu, cel
ventral fiind puin mai redus, avnd n jur de 2 cm cel dorsal i circa 1,8 cm cel ventral. Acetia sunt
plasai la faa intern a poriunii distale a muchiului mare rotund, n apropierea inseriei sale
humerale.
Limfonodul axilar accesoriu este de dimensiuni aproximativ egale cu a limfonodului axilar
propriu, i anume cel dorsal, adic n jur de 2 cm, plasat caudal de acesta, la circa 2 3 cm de
marginea ventral a muchiul marele dorsal, fiind separat de piele att de esutul conjunctiv
subcutanat ct i de muchiul pielos al trunchiului.

185

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 3 Limfonodurile axilare proprii (stnga sus), accesorii (dreapta) i cel suplimentar (stnga jos)

Limfonodul axilar suplimentar este de dimensiuni relativ mai mici dect precedenii,
aproximativ 0,5 cm, plasat la circa 2 3 cm ventral de linia ce unete de linia ce i unete, aproximativ
la jumtatea distanei dintre ei. Ca i topografie acest limfonod se gsete caudal de olecran, i
anume la marginea dorsal a muchiului pectoral ascendent, care-l acoper parial.
n ce privete limfocentrul popliteu, acesta este situat n spaiul conjunctiv popliteu, ntre
muchiul biceps femural i m. semitendinos, dorsal fa de inseria proximal a m. gastrocnemian, pe
traiectul arterei femurale caudale. Considerm necesar s facem precizarea c, conform normei
comune, la aceast specie, limfocentrul polpiteu cuprinde doar o singur grupare limfonodal i
anume cea superficial, i care are un singur limfonod.

Fig. 4 Aspectul limfonodurilor poplitei

n toate cazurile, se observ prezena a cte dou limfonoduri de fiecare parte care sunt unite
printr-o capsul fin, aezate unul dorsal i cellalt ventral. Dimensiunea acestora este n jur de circa
3 cm, adic aproximativ 1,5 cm fiecare, dei difer n funcie de talia animalului, au form ovoid,
uor alungit, nconjurai de o bogat mas de esut adipos (Fig 4).
Aceste limfonoduri pot fi palpate cu uurin n partea superioar a regiunii caudale a gambei,
la marginea caudal a muchilor gastrocnemieni, fiind totodat considerai ca limfonoduri santinel la
aceast specie.

186

1.
2.

3.
4.

5.

6.

Lucrri tiinifice vol. 51 seria Medicin Veterinar


CONCLUZII
Colorantul albastru Evans, folosit n experimentele noastre, a vizualizat vasele limfatice i
limfonodurile adiaceni acestora.
La subiecii cercetai de noi, n 4 din 12 cazuri lipseau limfonodurile axilare accesorii, cu
meniunea c limfonodurile axilare erau mai mari comparativ cu cazurile n care cele accesorii
erau prezente.
La 2 cazuri din 12, a fost prezent n plus un limfonod aparinnd limfocentrului axilar, n timp ce
erau prezente ambele grupri limfonodale (axilari proprii i axilari accesorii).
Cunoaterea zonelor de localizare topografic a limfocentrilor, precum i numrul limfonodurilor
are importan major, deoarece n anumite procese neoplazice, acestea s nu fie confundate cu
limfonodurile regionale.
Pe baza descrierii noastre anatomice, susinem c n cazul anumitor afeciuni tumorale maligne,
noi susinem cu certitudine c efectuarea tratamentului chirurgical este obligatorie i extirparea
limfonodurilor adiacente.
Ca o concluzie general, referitoare la studiul nostru este c pe baza acestor rezultate, am artat
c n cadrul sistemului limfantic exist o mare variabilitate individual, att n ce privete
topografia limfocentrilor, ct i numrul limfonodurilor care le alctuiesc, precum i cea a vaselor
limfatice.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.

13.
14.
15.

Barone, R., 1996,- Anatomie comparee des mamiferes domestrique, Tome 5 Angiologie, Ed. Vigot, Paris, 687878
Braithwaite LR., 1923, Flow of lymph from ileocecal angle in Br. J. Surg- 7: 11-13
Coofan V., Palicica R., Hricu V., Carmen G., Valeriu E., 2000. Anatomia animalelor domestice,vol.III.,
Ed.Orizonturi Universitare, Timioara, 126-160
Damian, A. 2001, Sistemul cardiovascular, Edit. Genesis Cluj-Napoca, 156 191.
Doss L. L., et al., 1980., Fluorescein-aided isolation of lymphatic vessels for lymphangiography, Am. J.
Roentgenol, 134, 603-604.
Dunoguiez S.J-M., 1994. Contribution a l'exploration du systeme lymphatique chez le chien par imagerie par
resonance magnetique (I.R.M.). These pour doctorat veterinaire.
Gallico E, Giacomelli V, Pricolo V., 1954, La colorazione vitale dei limfatici nella chirurgia dei tumori in
Chirurgia- 9:303-306
Isozaki H., 1985, Clinical studies on perigastric lymphatic flow and lymph node metastasis of gastric cancer in J
Osaka ed. Coll - 44:103-126
McMaster PD, Parsons RJ., 1939, Physiological conditions existing in connective tissue : methods of
interstitial spread of vital dyes in J. Exp. Med. - 69:247-256
Patsikas Mn, Dessiris A., 1996, The lymph drainage of the mammary glands in the bitch: a lymphographic
st
nd
th
th
study. Part 1: The 1 , 2 , 4 and 5 mammary glands in Anatomy Histology Embriology-25 (2):131-138
Sauer I, Bacon H., 1952, A new approach excision of carcinoma of the lower rectum and anal canal in Surg.
Gyn. Obst.- 95:229
Seiki K, Takahashi T, Sawai K, Hagiwara A, Taniguchi H, Shioaki Y, Yoneyama C., 1990, A new treatment
for metastatic lymph nodes of cancer using carbon particles (CH40) adsorbing ethanol. Progress in lymphology
XII, ICS 887 607-608
Veronesi U, Paganelli G, Galimberti V, Viale G, Zurrida S, Bedoni M., 1997. Sentinel node biopsy to avoid
axillary dissection in breast cancer with clinically negative lymph nodes in Lancet - 349:1864-1867.,
VonWiller P., 1923, Observation sur le system lymphatique en CR de Ass des Abat - p 515
Weinberg JA, Greaney EM., 1950, Identification of regional node by means of vital staining durinh surgery of
gastric cancer in Surg. Gyn. Obst.- 90:561-565

187

Universitatea de tiine Agricole i Medicin Veterinar

MORFOLOGIA COMPLEXULUI ARTICULAR


QUADRATOMANDIBULAR LA STRUUL AFRICAN
(STRUTHIO CAMELLUS)
RESEARCHES REGARDING THE MORPHOLOGY OF THE
QUADRATOMANDIBULARY JOINT AT THE OSTRICH
(STRUTHIO CAMELLUS)
TOADER A. I.1, BELU C.1, PREDOI G.1, DUMITRESCU I.1,
GEORGESCU B.1, ROU Petronela1, EICARU Anca1, BIOIU Carmen2
1FMV Bucureti
2ANSVSA. Bucureti
The study has been accomplished on 8 african ostrich (Struthio camellus), different in age and
sex.
The quadratomandibulary joint, very mobile (moveble), includes a sinovial joint and a serial of
long interbony ligaments (sindesmoses). The sinoval joint is achieved by the condils of the squared
bone and the cotiloid cavities of the mandibule. Usually there are three condils and three
glenoidal cavities. In Struthio, accordingly to the fact that the lateral condilium is attached to the
caudal one, there are only two cotiloid cavities. The articulary capsula contains many elastic
fibres, but also two condensations, a cranial one (the quadromandibular ligament) and a
caudomedial one.
Among the sindesmoses, the postorbitary and jugoprefrontal ligaments are well illustrated,
but only occipitomandibulary ligament (the strongest one), the lateral and medial
jugomandibulary ligament have insertion on the mandibule.

MATERIALE SI METODE
Disecia a fost efectuat pe 8 exemplare de stru african, diferite ca vrst i sex, provenite de
la Grdina zoologic Bucureti sau de la diferii cresctori particulari. S-a folosit stereomicroscopul
SMZ-2T Nikon. Formaiunile anatomice disecate au fost fotografiate, iar fotografiile au fost prelucrate
pe computer. Descrierea acestor formaiuni s-a realizat conform nomenclaturii anatomice Nomina
Anatomica Avium 1979.
REZULTATE I DISCUII
Legtura ntre mandibul i craniu se realizeaz, pe de o parte, prin articulaia sinovial
quadratomandibular (Artic. quadratomandibulare) (Fig. 1), iar pe de alt parte, printr-o serie de
sindesmoze caracteristice.
Suprafeele articulare sunt reprezentate de condilii osului ptrat (Quadratum) i caviti
articulare aparinnd mandibulei (Mandibula). Osul ptrat particip la realizarea articulaiei
quadratojugale prin intermediul condililor (Condylus medialis, Condylus lateralis, Condylus caudalis)
aparinnd procesului mandibular al acestuia (Processus mandibularis quadrati) (Fig. 2A). La aceast
specie condilul lateral este unit cu cel caudal, dnd natere unei suprafee alungite, convex-concave
oro-aboral i convex pe toat lungimea dintr-o parte in alta, ce lefuiete marginea ventral a
procesului orbital al osului ptrat (Processus orbitalis quadrati). Condilul medial este mai lat i foarte
proeminent. Cei doi condili sunt separai de un an intercondilar larg (Sulcus intercondilaris).
Suprafeele articulare ale mandibulei sunt reprezentate de o cavitate medial (Cotyla medialis)
mai larg, ce lefuiete i partea medial a tuberculului intercotiloid (Tuberculum intercotylar) i una
lateral, alungit rostro-aboral, convex dintr-o parte n alta, rezultat n urma fuziunii cavitilor
lateral i caudal (Cotyla lateralis et caudalis). Fosa articular a osului ptrat (Fossa articularis
quadratica) este relativ larg. Procesul mandibular medial (Processus mandibulae medialis) este
proeminent, prevzut pe partea dorsal cu o gaura pneumatic (Foramen pneumaticum) (Fig 2-B) cu
diametrul de 1-1,5 mm.
Procesul retroarticular (Processus retroarticularis) este alungit dorso-ventral.
Vrful
procesului mandibular medial este unit prin cte o creast cu extremitatea dorsal i respectiv
ventral a procesului retroarticular.
188

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 1 Articulaia quadratomandibular


1-Quadratum; 2-Mandibula; 3-Processus oticus quadrati; 4-Processus orbitalis qudrati; 5-Processus
mandibularis quadrati; 6- Processus retroarticularis

La faa medial a procesului retroarticular se afl fosa caudal (Fossa caudalis), care are un
contur aproape triunghiular, reprezentnd locul de inserie al muchiului depresor al mandibulei (M.
depressor mandibulae).
La partea medial a extremitii caudale a ramurii mandibulare, naintea cavitii cotiloide
medial, se observ gaura mandibular aboral (Fenestra mandibulae caudalis), iar ventral de
aceasta, un redus tubercul pseudotemporal (Tuberculum pseudotemporalis superficialis), loc de
inserie pentru muchiul pseudotemporal superficial (M. pseudotemporalis superficialis).

Fig. 2 A - vedere ventral a osului ptrat 1-Condylus lateralis + Condylus caudalis; 2- Condylus medialis; 3Sulcus intercondilaris; 4- Processus orbitalis qudrati;
B vedere dorsal a suprafeelor articulare ale mandibulei 1- Cotyla medialis; 2- Cotyla lateralis et caudalis; 3Tuberculum intercotylar; 4- Processus mandibulae medialis; 5- Foramen pneumaticum

189

Universitatea de tiine Agricole i Medicin Veterinar


Capsula articular (Capsula articularis) a articulaiei quadratomandibular conine numeroase
fibre elastice. O parte a acesteia se condenseaz n partea rostral, formnd ligamentul
quadratomandibular (Lig. quadratomandibularae), ce se detaeaz de pe partea lateral a procesului
pterigoid al osului ptrat (Proccessus pterygoideus) ctre partea rostral a tuberculului intercotiloid.
Se ntinde n timpul deschiderii ciocului, iar n momentul relaxrii muchiului depresor al mandibulei
contribuie la nchiderea brusc a celor dou valve (Fig. 3).
n afara ligamentului menionat, mai exist o condensare caudomedial, dispus n partea
caudal a procesului mandibular. Fibrele se prind pe mandibul, caudal de cavitatea cotiloid
medial. Nu exist menisc articular (Meniscus articularis).
n afara acestei articulaii sinoviale, articulaia este consolidat i printr-o serie de sindesmoze.
Unul dintre cele mai puternice ligamente este ligamentul occipitomandibular (Lig.
occipitomandibulare). Inseria la nivelul craniului corespunde aripii timpanice (Ala tympanica) a
exoccipitalului (Os exoccipitale). Ligamentul formeaz peretele caudal al cavitii timpanice (Fig. 4).
Are inserie ventral pe partea caudal a procesului medial al mandibulei. Marginea caudal a
ligamentului servete ca origine pentru poriunea profund a muchiului depresor al mandibulei.

Fig. 3 Articulatia quadratojugal vedere anterioar


1-Quadratum; 2- Condylus lateralis + Condylus caudalis; 3-Condylus medialis; 4-Os quadratojugal; 5Mandibula; 6- Tuberculum intercotylar; 7- Lig. quadratomandibularae

Ligamentul postorbital (Lig. postorbitale) i are originea pe vrful procesului postorbital (Proc.
postorbitalis) a osului orbitosfenoidal (Os orbitosphenoidale). La Struthio camellus ajunge s se insere
pe partea latero-dorsal a osului quadratojugal, deasupra ligamentului jugulomandibular lateral. La
aceast specie nu ajunge la procesul lateral al mandibulei.
Un grup de fibre desprinse tot de pe procesul postorbital, rostral de originea ligamentului
postorbital, se vor dirija ventro-rostral, unindu-se pe partea dorsal a osului jugal cu cele mai caudale
fibre ale ligamentului jugoprefrontal (Lig. jugoprefrontale) i formnd ligamentul suborbital (Lig.
suborbitale).
De pe extremitatea caudolateral a arcului jugal, imediat naintea articulaiei
ptratojugoptrate (Artic. quadratoquadratojugalis) se desprinde ligamentul jugomandibular lateral
(Lig. jugomandibularis laterale), care se dirijeaz ventro-rostral i, dup aproximativ 1,5 cm, se inser
pe procesul lateral al mandibulei.
Ligamentul jugomandibular medial (Lig. jugomandibularis mediale) se ntinde ntre
extremitatea caudal a osului ptratojugal, de la faa profund a ligamentului jugulomandibular
lateral, la partea caudal a procesului medial al mandibulei.

190

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 4 Articulaia quadratojugal


1- Lig. occipitomandibulare; 2- Ala tympanica; 3- Lig. postorbitale; 4-Lig. suborbitale; 5-Proc. postorbitalis; 6Lig. jugoprefrontale; 7- Lig. jugomandibularis laterale; 8-Capsula articularis- art. quadratojugalis; 9- M.
pseudotemporalis superficialis; 10-Cavitas tympanica.

CONCLUZII
n urma investigaiilor efectuate s-au elaborat urmtoarele concluzii:
1.
Complexul articular este reprezentat de o articulaie principal sinovial i de o
serie de sindesmoze caracteristice;
2.
In cazul articulaiei sinoviale quadratomandibulare, osul ptrat particip cu dou
suprafee cu aspect condiloid separate de un an, iar mandibula particip cu dou
caviti separate de un relief sau tubercul intercotiloid;
3.
Capsula articular conine numeroase fibre elastice, dintre care unele dau natere
rostral unui ligament quadratomandibular iar altele unui licament caudomedial,
ambele implicate n mecanismul de inchidere si deschidere a celor dou valve;
4.
Articulaiile fibroase sunt reprezentate prin ligamente lungi precum: lig.
occipitomandibular, lig. postorbital, lig. jugulomandibular lateral i
jugulomandibular medial;
5.
Cu toate c exist sindesmozele mai sus amintite, dispoziia acestora permite
posibilitatea deschiderii ample a celor dou valve, controlat totui de ligamentul
quadratomandibular.
BIBLIOGRAFIE
1.
2.

3.
4.
5.
6.

7.
8.

Beattie, I. - Applied ostrich physiology and anatomy. Ostrich workshop for veterinarians; April 11-12, 1992;
Zimbabwe.
Dzerzshinsky, F.- Implication of the Cranial Morphology of Paleognaths for Avian Evolution, Avian Paleontology
th
th
at the Close of the 20 Century: Proceedings of the 4 International Meeting of the Society of Avian
Paleontology and Evolution, Wasinghton,D.C., 4-7 June 1996.
Fowler, ME. Clinical anatomy of ratites. Proceedings of the Annual Conference of the Association of Avian
Veterinarians; September 1-5, 1992
George, J.C., Berger, A.J. Avian Myology, Academic Press, New York and London, 1966.
Gheie, V. i col. Atlas de anatomia de las aves domesticas, Editorial Acribia, Zaragoza, 1981
Imam, H. M. E., El-Mahdy, O. M. - Some anatomical studies on the quadratomandibular articulation of ostrich
(Struthio camelus) and flamingo (Phoenicopterus ruber), Assiut Veterinary Medical Journal, 2004 (Vol.
50) (No. 102) 1-21.
*** - Nomina Anatomica Avium, Academic Press, London Toronto New York Sidney San Francisco
1979.
Yasuda Mikio The Anatomical Atlas of Gallus, University of Tokio Press, 2002.

191

Universitatea de tiine Agricole i Medicin Veterinar

Pb, Cd and Se levels in fodder plants as part of "farm to fork"


food chain survey in Iasi area
TRINC LUCIA CARMEN1, VOLF MARIANA1, AVARVAREI IOAN1, BIANU ELISABETA2
1 FMV Iai
2 IDSA Bucuresti
Pollution of agricultural soils and waters is considered as main cause that triger critical limits
and turn danger on risk in the food safety analysis. Pb, Cd and Se are of the greatest concern in
the term of terrestrial food contamination.
This work evaluate Pb, Cd and Se content in different fodder plants and derivates forrages
(corn seeds, corn green sillage and corn prepared sillage, Sudan herb, soy-green plant, green
alfalfa, mown grass alfalfa, haw mowing, straw alfalfa and different mixt sillages) by AAS method
analysis as part of " farm to fork" food chain survey in Iasi area.
For all fodder plants samples, Pb concentration was below 10 000ppb (Maximum Allowed
Limits Concentration set by Romanian Sanitar Veterinary Norme/ 2002) as Pb content ranged
between 304,06-893,78 ppb. Also Cd concentrations ranged between 15,76-270,38 ppb, being
below 1000ppb, Maximum Allowed Limits Concentration set by Romanian Sanitar Veterinary
Norme/ 2002. Se concentration ranged (158,62-259,28 ppb) between normal limit for 52,17 %
samples, 34,78% of the fodder plants samples had Se content lower, while 17,39% exceed the
optimum Se concentration set as 150-300 ppb Se.
The forrage plants capacity to translocate and accumulate these contaminants depends
largely on soil and climatic factors, plant genotype and distance from industrial activity that
generate pollution.

Poluarea solurilor agricole i a apelor este principala cauz care induce acumularea diverselor
metale toxice i determin transformarea pericolului n risc pentru sigurana alimentului.
Lucrarea i-a propus determinarea concentraiei Pb, Cd i Se n diverse plante furajere i furaje
derivate prin metoda SAA ca parte component a monitorizrii lanului alimentar "de la furc la
furculi" n zona Iaului.
MATERIAL I METOD
Au fost recoltate probe de furaje din dou ferme agricole, unitatea D(ferm de vaci pentru
lapte) situat la periferia Iaului, n vecintatea centralei ce furnizeaz agentul termic pentru ora,
respectiv unitatea R(ferm de ovine) situat la aproximativ 70 km de Iai. Probele de la 1-12 provin
din ferma D, iar probele de la 13-23 provin din ferma R.
REZULTATE I DISCUII
Coninutul n Cd, Pb i Se din probele de furaje analizate este redat n tabelul 1.
Nr
crt
1
2
3
4
5
6
7
8
9

192

Tabel 1 Coninutul n Cd, Pb i Se din probele de furaje


Cd
Pb
max1000ppb
max 10000ppb
Porumb siloz verde
24.25
572.86
sola Aron Vod
Porumb siloz verde
15.76
607.73
sola Securitate
Iarb Sudan
83.25
430.32
sola Chiria
Soia plant verde
46.39
378.46
sola Securitate
Siloz porumb pregtit
67.88
517.93
Ferm, platform
Lucern, coasa 3
40.47
536.63
Aron Vod
Lucern verde
45.88
503.04
Sola Bazin
Porumb boabe
99.45
415.05
Siloz
60.55
511.44
graminee 20%
Proba

Se
optim 150-300ppb
55.03
138.49
504.63
73.47
70.50
173.39
317.35
158.42
183.38

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Nr
crt
10
11
12
13

Proba
leguminoase80%
Lucern fn baloi
Fn natural baloi
Paie de orz
Porumb siloz verde
Sola canal 2
Porum siloz verde
Sola cotul belegii
Lucern verde coasa 3
Sola 22ha staia de pompare
Lucern verde coasa 1
Sola staia de pompare
Fn lucern
Botoani, 2007
Fn lucern proprie 2007
Fn natural , 2007
Fn natural, 2006
Fn de Bramus, 2007
Siloz porumb, 2006
Complex
Fin+tr +rot floare

14
15
16
17
18
19
20
21
22
23

Cd

Pb

Se

45.72
130.98
171.63
33.00

433.47
572.37
893.78
403.15

131.28
344.4
259.28
329.06

36.78

393.93

205.08

103.71

289.44

191.1

88.27

347.97

148.21

95.42

304.06

152.5

80.50
56.58
234.65
37.24
149.35
270.38

481.68
483.54
382.12
428.63
560.26
861.55

135.68
306.99
164.37
339.2
190.74
134.8

Analiza datelor prezentate n tabelul 1 a evideniat concentraii de Cd sub limita maxim


(1000ppb) admis conform legislaiei n vigoare (6) cu variaii cuprinse ntre 15,76-270,38 ppb.
Coninutul n Pb din probele de furaje analizate a variat ntre 304,06-893,78 ppb, fiind conform
normelor legale (6) ce admit un nivel maxim de 10 000ppb Pb.
52,17 % din probele de furaje analizate au prezentat o concentraie adecvat de Se cu variaii
cuprinse ntre 158,62-259,28 ppb n timp ce 34,78% din probe au prezentat un coninut deficitar de
Se iar pentru 17,39% din probe coninutul n Se a depit concentraia optim stabilit la 150300ppb.
1000
900

893,78

800
700
600
500
400
300
200
100
0

504,63

270,38

304,06

55,03

15,76
Cd

Pb

Se

Fig.1 Limitele de variaie a concentraiei Cd, Pb i Se(ppb) n probele de furaje


Interpretarea rezultatelor obinute evideniaz o acumulare de maxim 30% Cd i maxim 8%
Pb din limita maxim admis conform legislaiei n vigoare.
Nr.
crt.
1

Metal

Pb

Cd

Tabel2 Probele de furaje cu un coninut ridicat de Cd i Pb


Nivelul
Procentul de probe Tipul furajului
Concentraiei
furajere
Concentrare Cd
13%
Paie de orz
15-30% LMA
Fn natural 2006
(1000ppb)
Complex (fin, tare,srot floare)
Concentrare Pb
8.7%
Paie de orz,
8-10%LMA
Complex (fin, tare,srot floare)
(10000ppb)

193

Universitatea de tiine Agricole i Medicin Veterinar

Rezultatele din tabelul 2 evideniaz c 87% din probele de furaje analizate prezint o
concentraie de Cd sub 15% din limita maxim admis, iar 13% din probele de furaje
analizate prezint o concentraie de Cd ntre 15- 30% din limita maxim admis. n cazul
plumbului, 91,3% din probe prezint o concentrare de pn la 6% din limita maxim admis,
iar 8.7% din probele de furaje analizate prezint o concentraie de Pb ntre 6-8% din limita
maxim admis. Se remarc prin concentrarea simultan semnificativ a Cd i a Pb(fig.2).
probele de paie de orz i complex fin(amestec tare, rot, floare) .
1000
900
800
700
600
500
400
300
200
100
0

893,78
861,55

270,38
171,63

Pb (ppb)
Paie de orz

Cd (ppb)
Complex ,Fin+tr +rot floare

Fig 2. Nivelul de concentrare n probele de furaje cu un coninut ridicat de Cd i Pb


Concentaia Cd i Pb n probele furajere
Diversitatea probelor de furaje recoltate i analizate a indus un numr mare de factori variabili
dificil de considerat pentru efectuarea analizei statistice. Pentru o asigura interpretarea corect a
datelor, calculul statistic prin testul t Student a luat n considerare furajele, recoltate din cele dou
ferme, derivate din porumb i lucern.
Conform datelor din tabelul 3 se remarc o concentrare semnificativ statistic (p<0.01) a Cd i
Pb n probele(porumb siloz verde i siloz porumb) provenind din ferma D ca urmare a noxelor
poluante rezultate prin arderea combustibililor necesari producerii agentului termic, concluzie
susinut de studii similare (4,8,9),

2
3

Tabel3 Concentraia Cd, Pb i Se n furaje derivate din porumb


Cd
Pb
Se
max1000ppb
max10000ppb
optim
150-300ppb
Porumb siloz verde,D
34,891.33
590,2924.65
96,7659.01
Porumb siloz verde,R
20,006.00
398,546.51
267,0787.66
Siloz porumb,D
149.3510.2
560.26117.4
70.508.5

4
5
6

Siloz porumb, R
Porumb boabe, D
Porumb boabe, R

Nr
crt
1

Proba

67.884.4
99.459.0
72.216.6

517.9362.0
415.0532.2
464.5240.4

190.7447.3
158.424.7
179.8016.6

Concentraii crescute (tabel 4) au prezentat i furajele derivate din lucern (lucerna verde,
fnul lucern i fnul natural) foarte semnificative statistic (p<0.001) pentru Cd i respectiv
semnificative statistic pntru Pb( lucerna verde i fnul natural) n cazul probelor recoltate din ferma D
comparativ cu probele provenind din ferma R.

194

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Nr
crt
1
2
3
4
5
6

Tabel4 Concentraia Cd, Pb i Se n furaje derivate din lucern


Cd
Pb
Se
max1000ppb
max10000ppb
optim
150-300ppb
Lucern verde,D
95,9910.91
519,83523.75
245,37101.79
Lucern verde,R
43,1751.91
318,70541.38
169,65530.32
Fn lucern,D
80.506.2
481.6837.4
131.288.5
Fn lucern, R
45.724.0
433.4732.2
135.6817.5
Fn natural, D
130.987.3
572.3734.0
344.448.7
Fn natural, R
46,914.4
456,0840.2
323,09016.6
Proba

n ceea ce privete concentraia Se n probele de furaje analizate au fost identificate dou


cazuri distincte prin raportare la coninutul optim recomandat (150-300)ppb Se i anume: deficiena
critic(10-100) ppb Se i marginal(100-150) ppb Se i respectiv nivelul toxic corespunztor
concentraiilor de Se superioare a 300 ppb Se
Tabel5 Coninutul de Se n probele de furaje
Procentul de
Tipul furajului
probe furajere
identificate
13.04%
Porumb siloz verde, Soia plant verde,
Siloz porumb pregtit

Nr
crt

Nivelul
Concentraiei

Deficien critic :
10-100 ppb Se

Deficien marginal :
100-150 ppb Se

13.04%

Lucern fn baloi, Fan lucerna proprie2007,


Complex (fin, tare, rot floare)

Nivel optim:
150-300ppb Se

52,17 %

Lucern verde,Porumb boabe,


Siloz (graminee 20% leguminoase80%),
Paie de orz, Fn lucern, Fn natural, 2006
Siloz porumb 2006

Nivel toxic:
>300 ppb Se

21.73%

Iarba Sudan, Lucern verde, Fan natural baloti, Fn


natural 2007,Fn de bramus 2007

52,17 % din probele de furaje analizate au prezentat o concentraie adecvat de Se cu variaii


cuprinse ntre 158,62-259,28 ppb n timp ce 34,78% din probe au prezentat un coninut deficitar de
Se iar pentru 17,39% din probe coninutul n Se a depit concentraia optim stabilit la 150300ppb.
Datele din tabelul 5 evideniaz difene ntre probele de furaje funcie de soi fnuri porumb ,
respectiv ntre probele provenind din anul 20072006.
Fnurile valorific solurile srace n azot i concentrate n elemente minerale. Porumbul,
dimpotriv se seamn pe solurile cele mai fertile. Probele de lucern se remarc prin diferene
semnificative ale coninutului n Se, funcie de situl de recoltare.
Diferena de concentraie ar putea fi nterpretat nu prin capacitatea diferit de fixare a Se ci
prin gradul diferit de disponibilitate a acestui element n sol (1,2,3,8), fapt confirmat i de
determinrile morfogeostructurale care susin caracterul selenogen al solului n diverse zone de
recoltare din arealul fermei D. Pe de alt parte coninutul de Se din plante este direct proporional cu
cantitatea de proteine (5), iar lucerna este considerat o important surs de proteine pe cnd
porumbul o surs important de glucide.
Concentrarea semnificativ peste nivelul optim n Se, n furajele fibroase (probele de fnuri ce
provin din ierburi conservate prin uscare) poate fi explicat considernd condiiile secetoase ale
anului 2007 comparativ cu cele din anul 2006.
CONCLUZII
Analiza solului i a furajelor introduse n hran ofer informaii prezumtive privind eventualele
carene sau tulburri metabolice posibil a fi detectate la efectivul de animale (carenele primare
generate de variaiile nivelului aportului nutriional real fa de cel recomandat) utile la stabilirea
concluziilor finale pentru aprecierea strii de sntate a organismului animal (7)
195

Universitatea de tiine Agricole i Medicin Veterinar


Avnd n vedere circuitul biologic sol-plant-animal, investigaiile realizate i-au propus
determinarea coninutului n Se, Cd i Pb n diverse plante furajere pentru a putea aprecia capacitatea
plantelor furajere de a transloca i acumula contaminanii n funcie de soi, tipul de sol, factorii
climatici respectiv distana fa de zona industiala care genereaz poluare, Astfel:
1. Concentraia Cd n probele de furaje analizate a fost sub limita maxim (1000ppb)
admis conform legislaiei n vigoare cu variaii cuprinse ntre 15,76-270,38 ppb.
2. Coninutul n Pb din probele de furaje analizate a variat ntre 304,06-893,78 ppb, fiind
conform prevederilor normelor legale ce admit un nivel maxim de 10 000ppb Pb.
3. Un procent de 52,17 % din probele de furaje analizate au prezentat o concentraie
adecvat de Se, cu variaii cuprinse ntre 158,62-259,28 ppb n timp ce 34,78% din
probe au prezentat un coninut deficitar de Se iar pentru 17,39% din probe
coninutul n Se a depit concentraia optim stabilit la 150-300ppb.
BIBLIOGRAFIE
1.
2.

3.
4.
5.
6.
7.
8.

9.

C.D. Gomes, J.B.P.. Silva, 2007, Minerals and clay minerals in medical geology , Applied Clay Science,
36 (1), p.4-21, Apr 2007
Haug, , R.D. Christophersen, O.A. Lyons, Graham H. , 2007, How to use the world's scarce selenium
resources efficiently to increase the selenium concentration in food , Microbial Ecology in Health &
Disease,; 19 (4):209-228
K. Kaklewski, J. Nowak, M. Ligocki ,2008, Effects of selenium content in green parts of plants on the amount of
ATP and ascorbate-glutathione cycle enzyme, Journal of Plant Physiology, 165 (10), p.1011-1022,
M.B. Kirkham, 2006, Cadmium in plants on polluted soils: Effects of soil factors, hyperaccumulation,
and amendments , Geoderma, 137 (1), p.19-32, Dec 2006
Miron L., Maria Serdaru, Acatrinei D., 2007 - Managementul deficitului de seleniu in lantul trofic planta-animalom. Editura Pim, Iasi, 164 p, ISBN 10:973-716-469-5, ISBN 13:978-973-716-469-8
NORMA SANITARA VETERINARA din 11 iulie 2002 privind limitele maxime admise pentru unele substante si
produse in furaje
Prvu Gh., 1992, Supravegherea nutriional metabolic a animalelor, Ed. Ceres, 1992, 390 pag
G.J. Reinds, J.E. Groenenberg, W. Vries,, 2006, Critical loads of copper, nickel, zinc, arsenic, chromium and
selenium for terrestrial ecosystems at a European scale; a preliminary assessment , Alterra, 2006 (Alterrarapport 1355) - p. 45.
W. Vries, W. Lofts, S. Tipping Groenenberg, J.E. Schutze , 2007, Impact of soil properties on critical
concentrations of cadmium, lead, copper, zinc and mercury in soil and soil solution in view of ecotoxicological
effects , Reviews of Environmental Contamination and Toxicology 191 - ISSN 0179-5953 - p. 47 - 89.

196

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Seciunea Clinici

197

Universitatea de tiine Agricole i Medicin Veterinar

EVALUAREA GRADULUI DE POLUARE PARAZITAR A


ZONELOR DE AGREMENT DIN MUNICIPIUL IAI
THE EVALUATION OF PARASITIC POLLUTION STATE OF PUBLIC
RECREATION AREAS FROM IASI
ACATRINEI D., MIRON L.
FMV IAI
The parasitic zoonoses are dog and cat borne diseases that are difficult to control in vagrant
dogs. We began our investigations 2 years ago, in order to evaluate the parasitic pollution of
different recreational areas in town ( parks, the Botanical Garden, picnic areas). The results
showed that the most polluted areas were the public parks and the less polutted were the
playgrounds.
Keywords : vagrant dog, parasites, larva migrans.

MATERIALE I METODE
Studiul a fost efectuat n perioada 2006-2007 i a cuprins un numr de 6 parcuri i baze de
agrement: baza de agrement Ciric, parcurile publice Podu Ro i Gradina Copou, Grdina Botanic i
dou spaii de joac situate n cartierele Ttrai i Alexandru cel Bun. De pe teritoriul acestora au
fost recoltate trimestrial cte 5 probe de materii fecale de cine ce au fost investigate prin metode
coproscopice de mbogire prin flotaie (Willis), sedimentare (Teleman-Rivas) i prin metoda
larvoscopic Baermann. Evaluarea coproparazitologic din punct de vedere cantitativ a fost efectuat
prin metoda McMaster (2,4).
REZULTATE I DISCUII
Principalele grupe de parazii identificai n mod constant prin metodele amintite au fost
cestodele (Taenia sp. i Dipylidium caninum) i nematodele (Toxocara canis, Toxascaris leonina,
Trichuris vulpis, i cele dou Ancylostomidae, Uncinaria stenocephala i Ancylostoma caninum). Mai
rar, au fost identificate protozoare din familia Eimeriidae sau chiti de Giardia sp., motiv pentru care
nu vom insista asupra lor. n linii generale, portajul parazitar a fost similar cu cel gsit n 2005 la
necropsierea cinilor comunitari eutanasiai de serviciul de ecarisaj al municipalitii (1).
Dintre paraziii identificai, cel mai mare risc zoonotic l prezint cestodele crora omul le
poate sluji drept gazd intermediar, adpostind n organe i/sau sistemul nervos stadii larvare ca
hidatide, cisticerci, cenuri, etc. Dintre nematode, Toxocara canis este la originea sindromului larva
migrans visceralis iar ancilostomidele produc larva migrans cutanat (3,5).
Gradul de poluare a zonelor de agrement din Municipiul Iai luate n studiu a fost diferit de la o
zon la alta dar constant pentru fiecare zon n parte pe parcursul celor doi ani. Astfel, din baza de
agrement de la Ciric au fost recoltate probe infestate cu nematodele amintite anterior pe toat
durata studiului (tabelele 1 i 2) iar cestodele au fost identificate n jumtate din probe. Poluarea cu
elementele infestante specifice cestodelor (proglote ovigere i ou) a fost atribuit n urma
examenelor coproparazitologice parcurilor publice din Podu Ro i Copou i Grdinii Botanice.
Tabelul 1. Rezultatele examenelor coproparazitologice efectuate n 2006
Zona de
Trimestrul I 2006
Trimestrul II 2006
Trimestrul III 2006
recoltare
C Tox Tri Anc C Tox Tri Anc C Tox Tri Anc
+ +
+
+
+
+
+
+
+
Ciric
+
+
+
Ttrai
+ Alexandru cel
Bun
+ +
+
+ +
+
+ +
+
Podu Ro
+ +
+
+
+ +
+
+
+ +
+
+
Grdina
Copou
+ +
+
+
+ +
+
+
+ +
+
+
Grdina
Botanic
Legend
C= cestode
Tox= Toxocara canis i Toxascaris leonina
Tri = Trichuris vulpis
Anc= Ancylostoma i Uncinaria

198

Trimestrul IV 2006
C Tox Tri Anc
+ +
+
+
+
+
+

++
+

+
+

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Tabelul 2. Rezultatele examenelor coproparazitologice efectuate n 2007
Zona de
Trimestrul I 2007
Trimestrul II 2007
Trimestrul III 2007
Trimestrul IV 2007
recoltare
C Tox Tri Anc C Tox Tri Anc C Tox Tri Anc C Tox Tri Anc
+
+
+ +
+
+
+
+
+
+ +
+
+
Ciric
+
+
+
Ttrai
+ +
Alexandru cel Bun
+ ++
+
+ +
+
+
+
+ +
+
Podu Ro
+
+
+
+
+
+
+ +
+
+
+ +
+
+
Grdina
Copou
+ +
+
+
+ +
+
+
+
+
+
+
+
+
Grdina
Botanic
Legend
C= cestode
Tox= Toxocara canis i Toxascaris leonina
Tri = Trichuris vulpis
Anc= Ancylostoma i Uncinaria

Locurile de joac pentru copii amenajate n vecintatea blocurilor de locuine au un potenial


parazitar sczut, probe infestate fiind recoltate rar i chiar i atunci cu infestaii slabe cu ascarizi sau
tricocefali.
n ceea ce privete poluarea cu materii fecale a zonelor de agrement din Municipiul Iai, cele
mai puin poluate sunt Gradina Botanic, Grdina Copou, parcul Podu Ro, cu o poluare apreciat ca
medie mprejurimile bazei de agrement Ciric i foarte poluate spaiile de joac pentru copii din
cartierele Ttrai i Alexandru cel Bun.
Se observ un paradox: zonele cu cele mai multe probe pozitive recoltate au o poluare cu
fecale redus iar cele n care probele sunt frecvent negative sunt extrem de poluate cu materii fecale.
Explicaia e c n bazele de agrement i parcurile publice fauna este reprezentat de cini comunitari
a cror status parazitar nu poate fi controlat iar spaiile dintre blocuri sunt poluate cu materii fecale
provenite de la cinii de apartament sau ale celor adoptai i ngrijii de locatari. n plus, cinii
adoptai, prin comportamentul teritorial controleaz accesul altor cini n arealul lor. Poluarea slab
cu materii fecale a Grdinii Botanice i a Grdinii Copou se datoreaz probabil, pe de o parte
suprafeei mult mai mari a acestor zone de agrement iar pe de alt parte mprejmuirilor care
limiteaz accesul poluatorilor. Baza de agrement de la Ciric atrage cinii fr stpn prin resturile de
alimente rmase dup petrecerile la iarb verde.
1.
2.
3.

CONCLUZII
Zonele verzi de utilitate public sunt poluate parazitar i constituie un factor de risc pentru
sntatea public.
Poluarea parazitar a zonelor vezi de utilitate public se realizeaz diferit i din pcate cele mai
frecventate sunt i cele mai intens poluate.
Diminuarea riscului parazitar se poate realiza, n lipsa mijloacelor eficiente de control a
parazitofaunei cinilor comunitari, doar prin diminuarea numrului de poluatori.
BIBLIOGRAFIE

1.
2.
3.
4.
5.

Acatrinei, D., Miron, L., Mitrea, L., 2005 Helmintofauna cinilor comunitari din municipiul Iai i impactul
acesteia asupra sntii publice. Lucr. t. USAMV Iai, 48 (7) : 450-454. ISSN 1454-7406
Ash, L.R., Orihel T.C., 1987 Parasites: A Guide to Laboratory Procedures and Identification. ASCP Press.
Boussieras, J., Chermette, R., 1991 Parasitologie Veterinaire, Editee par Service de Parasitologie, Ecole
Nationale Veterinaire dAlfort.
Cosoroab, I., Drbu, Gh., Oprescu, I., Morariu, S., 2002 Diagnostic paraclinic i tehnici experimentale n
parazitologie. Ed. Mirton, Timioara.
Euzeby, J. , 1961 Maladies vermineuses des animaux et leurs incidence sur la pathologie humaine. Ed. Vigot
Freres.

199

Universitatea de tiine Agricole i Medicin Veterinar

INVESTIGAII MORFOLOGICE N INVAZIA CU


DIROFILARIA IMMITIS LA C]INE
MORPHOLOGICAL INVESTIGATIONS IN DIROFILARIA IMMITIS INVASIONS
IN DOGS
ACATRINEI D., PACA S., MIHALACHI Simona
FMV Iai
dacatrinei@yahoo.com
The investigations were made on 4 dog bodies from Tulcea, serologically diagnosed positive
for dirofilariosis.
Necropsic examination showed in one of the individuals, in the cardiovascular system (right
ventricle and pulmonary arthery), a number of 25 adult parasites with a body length of 8 33 cm.
The constant lesion in all four cases was the dilatation of the right ventricle and a diffuse
thichening in the wall of the pulmonary arthery. Secondary lesions in the lungs, liver and kidneys
were also observed (cardiac and vascular lesions).
Histological examination revealed miocardic, vascular (dystrophic), pulmonary (inflammatory
and circulatory), hepatic (degenerative) and renal (degenerative and inflammatory) lesions.

MATERIAL I METODE
Perioada investigaiilor s-a desfurat n perioada octombrie 2007-ianuarie 2008, pe patru
cadavre de cini eutanasiai cu T-61. Cinii au provenit din oraul Tulcea, fiind diagnosticai serologic
pozitivi la infestaia cu Dirofilaria immitis.
S-au efectuat examene necropsice i histopatologice. Dup recoltare, piesele au fost fixate n
soluie de formaldehid 10%, incluse n parafin i secionate la grosimea de 5m. S-au utilizat
coloraia Hematoxilin-Eozin - Albastru de metil ( Tricromic Masson), coloraia Acid Periodic- Fuxin
Schiff (PAS) i coloraia cu Albastru Alcian.
REZULTATE I DISCU
La nivelul cordului s-a evideniat o dilataie ventricular dreapt, indus de prezena paraziilor
aduli incavitatea ventricular. Peretele ventriculului se prezenta uor subiat i extreme de flasc (Fig.
1).
Secionarea arterei pulmonare i a ramurilor lobare a evideniat prezena unui numr mare de
dirofilarii (aprox. 6-7 viermi) (Fig. 2, 4).
Dup deschiderea ventriculului drept printr-o incizie n peretele acestuia paralel cu anul
paraconal, s-a evideniat n interior un ghem de 4 dirofilarii inclus ntr-un tromb ce ocupa aproape
ntreaga cavitate ventricular (Fig. 3).
La toate cadavrele examinate staza hepatic a fost prezent chiar i n forma cronic. Ficatul
era mrit n volum, de culoare roie negricioas, indurat i cu desenul lobular evident (Fig. 5)
Rinichii erau uor mrii n volum, de culoare brun-cenuie i presrai cu focare mici, alb
cenuii, cu diametrul de 1mm. (Fig.6).
La examenul histologic modificrile cele mai ample au fost sesizate la nivelul arterei
pulmonare i a pulmonului.
n media arterei pulmonare s-a observat prezena unor depozite de mucopolizaharide acide
ntre fibrele musculare netede, cu aspect fibrilar, slab bazofile i n coloraia HEA, PAS-pozitive i
Alcian-pozitive. Acumularea MPZA a condus la disocierea mediei i la fragmentarea fibrelor musculare
netede (Fig. 7, 8, 9, 10).
Acumularea subendotelial a MPZA a produs pe alocuri apariia anevrism disecant cu clivare
endoteliului i a prii interne a mediei (Fig. 8)
n jumtatea extern a mediei s-a observat hialinizarea fibrelor musculare i colagenizarea
(Fig. 11)
n ramurile arterei pulmonare, histologic s-a remarcat erodarea endoteliului ca urmare a
aciunii mecanice a paraziilor luminali i migraia subendotelial a miofibroblastelor (Fig. 12, 13, 14).
n pulmon leziunile au fost mult mai diversificate, fiind o produse de insuficiena cardiac i de
localizarea intrapulmonar a microfilariilor. La nivelul bronhiilor intrapulmonare s-a observat
200

Lucrri tiinifice vol. 51 seria Medicin Veterinar


prezena unui infiltrat hemoragic intraluminal cauzat de migraiile parazitare, proliferarea epiteliului
pseudostratificat ciliat i hiperplazie conjunctiv peribronic (Fig. 15, 16).
De asemenea au fost constatate emfizemul pulmonar subpleural i fibrozarea pleurei pe
anumite poriuni din suprafa (Fig. 17, 18).
La nivelul esutului pulmonar propriu-zis s-a semnalat congestie i pneumonie interstiial
subacut-cronic urmat de colagenizri interstiiale i de scleroza vaselor interstiiale (Fig 19, 20,)
Au fost remarcate i microfilarii n alveolele pulmonare, interstiiu i capilarele septale (Fig. 21,
22, 23)
Ficatul a prezentat n mod constant la cele 4 cadavre modificri distrofice datorate probabil
toxinelor parazitare eliberate n circulaie constnd hepatoz hidropic cu hepatocite hiperhidratate,
cu nuclei picnotici i dispui central,, Staz venoas cronic i staza limfatic, edemul perivenos au
fost observate la toate cazurile examinate, fiind o consecin a insuficienei cordului drept. (Fig. 24,
25, 25, 27, 28)
La nivelul rinichilor examinai s-a remarcat n cortical congestie i distrofie granular n tubii
uriniferi. Leziunile glomerulare au constat n glomerulit membranoas i membrano-proliferativ
(Fig. 29, 30, 31).
n medulara renal, leziunile au constat n infiltrarea cu limfocite i plasmocite a interstiiului
(Fig. 32).

Fig.1 Dilataie ventricular dreapt

Fig.2 Arter pulmonar cu dirofilarii

Fig. 3 Dirofilarii i tromboz n ventriculul drept.

Fig. 4 Dirofilarii n ramurile lobare ale arterei


pulmonare

201

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 5 Ficat de staz

Fig. 6 Nefrit interstiial limfohistiocitar

Fig. 7 Depunerea MPZA n jumtatea intern a media.


Arter pulmonar. Col. HEA, x 400

Fig. 8 Anevrism disecant (clivare a endoteliului i a


prii interne a mediei)
Tromboz. Col. HEA, x 400

Fig. 9 Hipersecreie i acumulare de mucopolizaharide


acide n medie (GAG)
Col. PAS, x400

Fig. 10 Fisuri ale intimei, hipersecreie i acumulare


de mucopolizaharide acide. Vacuolizarea mediei i
evoluie spre anevrism disecant. Col. albastru Alcian,
x100

202

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 11 Colagenizare n jumtatea extern a mediei,


hialinizarea leiocitelor. Arter pulmonar. Col. HEA; x
400

Fig. 12 Dirofilaria n lumenul unei ramuri a arterei


pulmonare. Col. HEA, x 60

Fig. 13 Erodarea endoteliului vascular.


Col. HEA, x 400

Fig. 14 Hiperplazia miofibroblastelor


Migraia miofibroblastelor subendotelial
Col. HEA, x 400

Fig. 15 Hiperplazie conjunctiv peribronhic. Col.


HEA, x 100;

Fig. 16 Hemoragie bronic.


Col. HEA, x 400

203

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 17 Colagenizarea pleurei visceral. Pulmon de


cine. Col. HEA, x 200

Fig. 18 Enfizem alveolar subpleral. Pulmon de cine.


Col. HEA, x 100

Fig. 19 Congestie i hemoragii pulmonare


Pneumonie interstiial. Emfizem alveolar
Col. HEA, x 400

Fig. 20 Colagenizarea vaselor interstiiale.


Pneumonie interstiial
Col. HEA, x 400

Fig. 21 Larve de Dirofilaria n alveola pulmonar.


Fibroz interstiial
Col. HEA, x 1000

Fig. 22 Larve de Dirofilaria n capilar


Fibroz interstiial Col. HEA, x 1000

204

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 23 Larve de Dirofilaria n interstiiu


Fibroz interstiial. Col. HEA, x 1000

Fig. 24 Staz venoas i limfatic. Edem perivenos.


Col. HEA, x100

Fig. 25 Ectazie venoas i edem perivenos


Spaiul Port. Col. HEA, x 400

Fig. 26 Staz capilar. Hepatoz hidric


Colagenizare n spaiile Diss
Col. HEA, x400

Fig. 27 Ectazie capilar


Hiperplazie conjunctiv centrolobular
Hepatoz hidric. Col. HEA, x 400

Fig. 28 Hepatoz hidropic


Col. HEA, x 400

205

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 29 Glomerulit membranoas


Col. HEA, x 400

Fig. 30 Glomerulit membrano-proliferativ. Col.


HEA, x 400

Fig. 31 Cortical renal: congestie renal, nefroz


granular.
Col. HEA, x400

Fig. 32 Nefrit interstiial limfoplasmocitar. Col.


HEA, x 1000

CONCLUZII
Examinarea celor 4 cazuri a scos n eviden urmtoarele concluzii:
leziunile congestive acute i cronice ale organelor datorate insuficienei cordului drept
ca urmare a parazitismului cu Dirofilaria immitis;
leziunile parietale arteriale au fost reprezentate de eroziunile secundare aciunii
mecanice a paraziilor, de hiperplazia miofibroblastelor i migraia lor subendotelial,
de depunerea mucopolizaharidelor acide preponderent n jumtatea intern a mediei
cu fragmentarea leiocitelor i apariia anevrismelor disecante;
leziuni pulmonare reprezentate n mod constant de hemoragii, pneumonie
interstiial, scleroza interstiial i vascular;
leziuni datorate toxicitii paraziilor manifestate la nivel hepatic prin distrofie
hidrolitic;
prezena glomerulitelor membranoase i membrano-proliferative (produse de
depunerile complexelor imune datorate parazitismului sistemic);
BIBLIOGRAFIE
1.
2.
3.

Bowman, D., Lynn, R.C., Eberhard, M. 2003 - Georgys parasitology for veterinarians;
Dulceanu N., Terinte Cristina, 1994 - Parazitologie veterinar, vol. II. Ed. Moldova, Iai;
McGavin D.M., Zachary J.F., 2007 Pathologic Basis of Veterinary Disease fourth edition, Ed. Mosby Inc., St.
Louis, Missouri;

206

Lucrri tiinifice vol. 51 seria Medicin Veterinar

THE IMPACT OF COPPER AND ZINC DEFICIENCY ON HEALTH IN


HOLSTEIN COWS IN A FARM FROM IASI 3
ANTON Alina1, ROLLIN F2., SOLCAN Gh.1
1FMV Iai
2Universit de Liege, Belgium
antonclaraalina@yahoo.com
Copper and zinc deficiencies in cattle have an unknown incidence in Romania. A 20 weeks
follow-up was undertaken in a farm of Iai in Romania, on four equal groups of ten Holstein cows
(copper, zinc, copper-zinc and control groups) 10 to 50 days in milk, with the aim of evaluating the
zinc and copper status according administration of these trace elements in the form of sulphates
(2 versus 8,5 ppm copper and 9 versus 42 ppm zinc), and of correlating these status with their
performances of health. As suspected, 60% of the cows at t0 were copper and zinc deficient. The
supplementation of copper and/or zinc made it possible to increase significantly their plasmatic
concentrations, although control cows also improved their copper and zinc status in this study.
During the protocol, copper and/or zinc supplementation showed no favourable impact on health.
Nevertheless, the serious errors of management concerning housing and feeding of the animals
probably masked the potential benefit of the copper and/or zinc supplementation in this farm.
Key words: dairy cow, copper sulphate, zinc sulphate, mastitis

Carenele n cupru i zinc la vaci au o inciden puin cunoscut la nivelul populaiei de bovine
din Romnia. Carena primar n Cu la taurinele adulte se manifest prin pierdere n greutate,
acromotrichie i anemie microcitar i hipocrom (Radostis, 2007). Carena secundar se manifest
prin aceleai semne ale carenei primare, cu excepia anemiei, care este considerat un semn tardiv
al carenei primare (Radostis, 2007). Principalele semne clinice ale carenei n Zn sunt paracheratoza
(Brisson, 2003) i alopecia care poate atinge 40% din suprafaa pielii (Radostits, 2007). Alte simptome
determinate de carena n Zn sunt scderea apetitului, a greutaii corporale, fragilizarea cutiei de corn
(Puls, 1994) i eczema la baza cozii (Prvu, 1999). Carena n Cu i/sau Zn a fost asociat cu reducerea
funciilor imunitare i creterii susceptibilitii la maladii (Stabel i Spears, 1990; Xin i col., 1991;
Cook-Mills i Fracker, 1993 ; Kidd i col., 1996; Wellinghausen i col., 1997 Smith, 2002).
Scopul studiului a fost evaluarea statutului n Cu i Zn n funcie de aportul acestor oligoelemente sub form de sulfat i a corelaiei acestora cu performanele de sntate la taurinele de
ras Blat cu Negru Romneasc (B.N.R.).
MATERIAL I METODE
La ferma A, 40 de vaci B.N.R. n lactaie, 10-50 zile post-partum, negestante, vrst (4-10 ani),
sntoase clinic au fost repartizate n 4 loturi a cte 10 vaci fiecare (loturi Cupru, Zinc, Cupru-Zinc i
Martor). Timp de 20 de sptmni vacile au primit 2 g CuSO4/vac/sptmn (lotul Cupru), 2 g
CuSO4 i 10 g ZnSO4/vac/sptmn (lotul Cupru-Zinc) i 10 g ZnSO4/vac/sptmn (lotul Zinc).
Aceste sruri de Cu i Zn au fost dizolvate n ap nainte de a fi administrate per os vacilor. Un
examen clinic detaliat a fost realizat la cele 40 de vaci ncepnd cu prima zi de studiu insistnd asupra
scorurilor: corporal, leziunilor de la nivelul jaretelor o dat/lun i a scorurilor de reumplere a
rumenului, de consisten a materiilor fecale, a fraciunii fecale nedigerat o dat/sptmn. Pentru
a evalua profilul hematologic, Cu i Zn plasmatic, s-a recoltat snge de la nivelul venei coccigiene n
tuburi cu EDTA i heparin o dat pe lun. Probe de lapte de la vaci au fost analizate n vederea
dozrii numrul total de celule somatice cu Somatoscopul MK II.
REZULTATE I DISCUII
n regiunea Iai, solul prezint o concentraie sczut n Cu (10-20 ppm) i Zn (< 50 ppm)
(Andar i col., 2006). Valorile normale ale Cu n sol sunt 18-22 ppm (Radostits, 2007) i 50-100 ppm Zn
(Paris i Lucianer, 1986). ngrmintele chimice pe baza de N, P i K ce se utilizeaz pe suprafatele
agricole, favorizeaza carena n oligo-elemente. n Ferma A principalul furaj administrat vacilor este

Cercetri finanate din grantul PN2 50-004/2007


207

Universitatea de tiine Agricole i Medicin Veterinar


silozul de porumb care este carenat n toate oligo-elementele. Analiza furajelor i calcularea raiei
vacilor de lapte a confirmat c aportul PBD (1316), a Cu (2 ppm) i a Zn (9 ppm) a fost insuficient.
Vacile din loturile suplimentate cu Zn i/sau Cu au avut un aport zilnic de 8,5 ppm Cu i 42 ppm Zn.
n ferma A, pe perioada studiului 5 vaci/40 au fost sacrificate de necesitate ramnnd doar 35
vaci pn la sfrsitul protocolului (una din lotul Cupru, 2 n lotul Zinc, una n lotul Martor i una n
lotul Cupru-Zinc). La cele 5 vaci (12,5%) s-a observat slabire accentuat, anemie i periartrit la nivelul
jaretului. La vacile sacrificate din lotul Zinc s-a observat i metrit purulent iar la una dintre ele i
mamit clinic. n mod normal mortalitatea la vacile adulte nu trebuie s depseasc 3% pe an. Vacile
rmase pna la sfaritul protocolului au prezentat un numr total de celule somatice mult mai crescut
dect numrul maxim de celule somatice provenit dintr-o gland mamar sntoas (200.000
celule/ml) (Harmon, 1994 ; Burvenich i col., 2004). 7 vaci/35 (20%) au prezentat mamit clinic : 4
vaci n lotul Martor, 2 n lotul Cupru i una n lotul Cupru-Zinc pe o perioad de 5 luni. ntr-o ferm
sntoas se consider c maximul de animale cu mamit clinic trebuie s fie de 3%/lun. Pe toat
perioada de studiu, 3 vaci au prezentat un numr de celule mai mic de 300.000 celule/ml lapte (1/lot
Cupru, 1/lot Zinc et 1/lot Martor), 27 un numr de celule cuprins ntre 300.000 et 800.000 celule/ml
lapte (7/lot Zinc, 7/lot Cupru-Zinc, 7/lot martor i 6/lot Cupru) i 5 vaci peste 800.000 celule/ml (2/lot
Cupru, 2/lot Cupru-Zinc i 1/lot Martor) (figura 1). Pe timpul studiului nu au fost nregistrate diferene
semnificative ale numrului de celule la vacile suplimentate cu minerale fa de vacile din lotul
Martor. Testul Pearson nu a artat nici o corelaie ntre Cu i Zn plasmatic i numrul total de celule
somatice la vacile din cele 4 loturi.

(log) Celule somatice/ml lapte

Lot Cupru

Lot Zinc

Lot Cupru-Zinc

Lot Martor

6,5
6,2
5,9
5,6
5,3
5
t0

t1

t2

t3

t4

t5

Timp
Figura 1. Evoluia numrului total de celule somatice (log10) la vacile de lapte
t0= prima zi de studiu; t1= a 28-a zi de studiu; t2= a 56-a zi de studiu; t3= a 84a zi de studiu; t4= a 112 -a zi de
studiu; t5= a 140 a zi de studiu

n ceea ce privete scorul corporal (SC) diferene semnificative (P<0,01) n cadrul fiecrui lot au
fost constatate la t5 raportat la t0. La t0, mediile SC la vaci au variat ntre 2,32 (lot Martor) i 2,5 (lot
Zinc) iar la finalul studiului ntre 2,87 (lot Zinc) i 3 (lot Cupru i lot Cupru-Zinc); idealul SC la vacile de
lapte n timpul lactaiei este de 3. Pe timpul studiului nu au fost observate diferene semnificative
ntre vacile suplimentate cu minerale i vacile din lotul Martor.
Scorurile de reumplere a rumenului (RR), de consisten a materiilor fecale (CMF) i al
fraciunii fecale nedigerate (FFND) reprezint un instrument suplimentar alaturi de SC, pentru a
gestiona sntatea taurinelor (Zaaijer, 2001). Aceste scoruri pot detecta rapid erorile de
management, de raie datorit faptului c intervalul ntre cantitatea de substana uscat ingerat i
producia de materii fecale este de 1,5 -4 zile (Skidmore i col., 1996). ncepnd cu a unsprezecea
saptmn de studiu, fnul de lucern a fost nlocuit cu iarb proaspt pe timpul a 4 sptmni.
208

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n studiul nostru, mediile scorului de RR nu au prezentat modificri semnificative statistic ntre
prima i ultima saptamn de studiu, cu excepia lotului Cupru, unde a fost constatat o ameliorare
semnificativ (P < 0,05) pe timpul celor 4 sptmni n care au primit iarba proaspt. Pe intreaga
perioad de studiu, toate vacile au avut mediile scorului de RR sub 3 (idealul de scor de RR la vacile de
lapte). Raia insuficient cantitativ poate determina un scor de reumplere a rumenului inferior de 3.
Pierderea apetitului este adesea unul din semnele carenei n Zn i/sau Cu (Puls, 1994). Examenul
materiilor fecale (consistena i compozitie) reflect natura raiei, funcionalitatea tubului digestiv,
dar i calitatea adpatului. n perioada n care vacile au primit iarb proaspt, scorul CMF i scorul
FFND au nregistrat ameliorri dar fr a atinge idealul de 3 (scorul CMF) i 1 (scorul FFND). Tot n
timpul perioadei de furajare cu iarba proaspt, mediile scorul FFND, la vacile din loturile ce au primit
minerale se reduce semnificativ (P<0,05) n raport cu vacile din lotul Martor. De exemplu n a 12 a
sptmn de studiu, mediile scorului FFND au fost de 2,250,46 la vacile din lotul Zinc, 2,330,5 lotul
Cupru, 2,440,52 lotul Cupru-Zinc i 2,880,33 lotul Martor.
Afeciunile podale reprezint o alta problem major din aceasta ferm. Dintre cele 40 de vaci
examinate, 22 (55%) au prezentat periartrit la nivelul jaretelor din care 21 pluripare i o primipar
(Lotul Cupru-Zinc). Un procent crescut de periartrite la nivelul jaretelor ntr-o ferm, semnific o
stabulaie eronat conceput, un pat de culcare prea scurt, prea ingust i o cantitate sczut de
aternut. n ciuda faptului c scorul leziunilor de la nivelul jaretelor s-a agravat semnificativ (P<0,05)
la vacile din loturile Cupru-Zinc i Martor, ntre inceputul i sfritul studiului, nu au fost observate
repercusiuni semnificative asupra Cu i Zn plasmatic.
n ceea ce privete Rbc (nunrul total de eritrocite), la vacile din lotul Cupru-Zinc a fost
observat o diferen semnificativ la t5 (6,370,46 x 106/mm3) fa de t0 (5,630,53 x 106/mm3). Pe
timpul ntregului studiu nu au fost notate diferene semnificative ale Rbc (P>0,05) la vacile ce au
primit minerale faa de vacile din lotul Martor. Hemoglobina i hematocritul vacilor suplimentate cu
minerale nu au fost diferite semnificativ (P>0,05) fa de vacile din lotul Martor. Wbc (numrul total
de leucocite) la vacile din lotul Martor a avut valori mai crescute (11,33,2 103/mm3) dect la vacile
din celelalte loturi, dar diferenele nu au fost semnificative. Conform testului statistic Pearson nu au
fost stabilite corelaii ntre Cu i Zn plasmatic i Rbc, Hb, Htc i Wbc.
Vem (volum eritrocitar mediu) a relevat diferene semnificative ntre t0 i t5 la vacile din lotul
Cupru i de asemenea la cele din lotul Zinc (P<0,05). Vacile din lotul Cupru la t0 au prezenat Vem mai
crescut (48,42,5 m3) raportat la t5 (44,63,3 m3), dar valorile au ramas n limitele normale 40-60
m3 (Radostits, 2007, Merck, 2008).
Hem (hemoglobina eritrocitar medie) i Chem (concentraia n hemoglobin eritrocitar
medie), nu au prezentat diferene semnificative ntre vacile suplimentate cu minerale i vacile din
lotul Martor, dar n cadrul fiecrui lot, au existat diferene semnificativ statistic ntre t0 i t5 (P<0,05).
Nu au fost notate corelaii ntre Cu i Zn plasmatic pe de o parte i Vem, Hem i Chem pe de alta
parte.
In ceea ce privete Cu plasmatic, la t0, 15 vaci/40 au fost foarte carenate avnd valorile ntre
0,36 i 0,56 mg/l , 15 vaci/40 au prezenat valori cuprinse ntre 0,57 i 0,76 mg/l (cupremie
marginal), iar 10 vaci/40 au variat de la 0,77 la 1,43 mg/l (cupremie adecvat). Pe timpul celor 140
de zile de studiu a fost notat o evoluie semnificativ a Cu plasmatic n cadrul fiecrui lot, dar
ncepnd cu a doua luna de suplimentare a raiei, vacile au ajuns n limitele normale ale cupremiei
(0,95-1,57 mg/L) (Radostits, 2007). ncepnd cu t4, s-a observat o diferen semnificativ ntre vacile
din lotul Cupru (1,310,16 mg/L) pe de o parte i vacile din loturile Martor (0,920,31 mg/L) (P<0,01)
i Zinc (1,040,14 mg/L) (P<0,05) pe de alt parte. Vacile din lotul Martor au nregistrat de asemenea
o evoluie semnificativ a Cu i Zn plasmatic, dar ele au ajuns n parametrii de normalitate o lun mai
trziu n comparaie cu vacile ce au fost suplimentate cu minerale.
Referitor la Zn plasmatic, nainte de nceperea suplimentrii raiei, 11 vaci/40 au fost
diagnosticate cu caren avnd valorile cuprinse ntre 0,39 i 0,56 mg/l, 14 vaci/40 prezenau Zn
plasmatic cuprins ntre 0,57 i 0,77 mg/l (Zn plasmatic marginal) i 15 vaci/40 aveau Zn plasmatic ntre
0,78 i 1,23 mg/l (Zn plasmatic adecvat). Incepnd cu t1, au fost constatate diferene semnificative
(P<0,01) la vacile celor 2 loturi ce au primit 10 g ZnSO4/sptmn (loturile Zinc i Cupru-Zinc),
comparativ cu vacile din loturile ce nu au primit acest mineral. Aceeai situaie la t2, t3 i t5, vacile ce
209

Universitatea de tiine Agricole i Medicin Veterinar


au primit suplimentul ZnSO4 au prezenat concentraii semnificativ crescute faa de vacile din loturile
Martor i Cupru. Pe timpul ntregului studiu, a fost notat o evoluie semnificativ a Zn plasmatic n
cadrul fiecrui lot (P<0,01). Loturile suplimentate cu ZnSO4 au ajuns n parametrii normali ai Zn
plasmatic (0,8-1,2 mg/L) (Suttle 2004), dup o lun de administrare a ZnSO4, pe cnd celelalte loturi,
2 luni mai trziu. Numeroi factori pot influena concentraiile sanguine n oligo-elemente. De
exemplu inflamaiile (Milanino i col., 1986), stresul (Herdt i col., 2000) i infeciile (Orr i col., 1990)
pot determina o cretere a Cu plasmatic i o diminuare a Zn plasmatic. n studiul nostru, testul
Pearson nu a artat corelaii ntre afeciunile inflamatorii i Cu i Zn plasmatic la vacile din cele 4
loturi.
CONCLUZII
n studiul nostru, suplimentarea raiei n cupru i zinc sub form de sulfat, a permis o cretere
semnificativ a concentraiilor plasmatice inclusiv la vacile din lotul Martor, astfel vacile atingnd un
statut corect.
Cu i Zn plasmatic la vacile ce au primit CuSO4 i/ori ZnSO4 a fost superior n comparaie cu
animalele ce nu au consumat acest supliment. Vacile din lotul Cupru-Zinc care au primit cele dou
minerale nu au avut rezultate mai bune la indicatorii de sntate.
Gravele erori de management n ceea ce privete stabulaia i alimentaia taurinelor, au
mascat probabil potenialele beneficii ale suplimentrii raiei n Cu i/ori Zn.
Este oportun s se revad aporturile n Cu i Zn, dar i a celorlalte minerale la toate vacile din
ferma A.
BIBLIOGRAFIE SELECTIV
1.
2.
3.
4.
5.
6.
7.

ANDAR P., ROBU I.N., NICOLESCU R., SIEWERS U., LARENZ H. Geochemical atlas of Romania. Geological
Institute of Romania-IGR: Bucharest, Hannover, 2006.
BRISSON J. Nutrition, alimentation et reproduction n: Symposium sur les bovins laitiers, Saint-Hyacinthe :
Qubec, 2003, 1-66.
HERDT H.T. Variability characteristics and test selection n herd-level nutritional and metabolic profile testing.
Vet. Clin. N. Am.-Food A., 2000, 16, 387-383.
RADOSTITS O.M., GAY C.C., BLOOD D.C., HINCHCLIFF K.W. Veterinary Medicine. A textbook of the
th
diseases of cattle, sheep, pigs, goats and horses 10 ed. Saunders W.B. Co.,Philadelphia, 2007, 1707-1732.
th.
SMITH B.P. Large animal internal medicine 3 ed. Mosby, London, Philadelphia, Sydney, Toronto, 2002, 783786.
SUTTLE N.F. Trace element disorder. In: Andrews A.H., Blowey R.W., Boyd H., Eddy R.G. (Eds.), Diseases
and husbandry of cattle. Blackwell Publishing: Oxford, Iowa, 2004, 294-308.
ZAAIJER D., Contrle des effets de la nutrition sur les caractristiques de la vache. n : Journe dtude de la
Socit Belge Francophone de Buiatrie, 13 octobre 2001, 27-30.

210

Lucrri tiinifice vol. 51 seria Medicin Veterinar

RESULTS OBTAINED DUE TO I.A. IN COWS AND HEIFERS, AND


CORRELATIONS BETWEEN FECUNDITY AND SOME ESTRAL
MUCUS CHARACTERISTICS
ARDELEAN. V., ARDELEAN A.I., BONCA Gh., CERNESCU H.,
MIRCU C., CZAPP Timea, KORODI Gabriela, ZARCULA Simona
FMV Timioara
During this study it was artificially inseminated a number of 694 cows and heifers, owned by
Timi county farmers, from Baltata Romaneasca, Holstein Friz, Red Holstein breeds and
crossbreeds between this breeds.
All the inseminations was made by the same person, using the same technique to all cows and
heifers that was inseminated.
After artificial insemination was made in the last tree years, in this period remain pregnant at
first heat cycle 62,39% cows and heifers, and 8,06% after the second heat cycle.
The fecundity obtained at first two estral cycles was between 73,29% in 2004, 74,05% in 2005,
58,36% in 2006 and 57,81% in the first part of 2007.
It was obtained an insemination index of 1.47, 1.56 and 1.63 to cows and 1.14, 1.12 and 1.35
to heifers.
To 105 inseminated cows it was appreciated also the correlations between the cervico-vaginal
physics properties and fecundity obtained at cows from two breds and their crossbreds.
The significant decrease of fecundity index, particularly in the last two years, is due to low
quality frozen semen used.
It wasnt determined significant differences regarding fecundity and the place where frozen
seminal material was placed, in uterus body or/and in uterine horns.
It was determined a estrus manifestation dynamics higher in spring months, in the beginning
of summer and in autumn months.
There is a positive correlation between the vestibule-vaginal mucosa resistance, the pH, the
expansion capacity (elasticity), the estral mucus crystallization quality and the registered
fecundity due to artificial insemination in cows and heifers.
It wasnt determined correlations between the heats mucus characteristics and fecundity
regarding the breeds of the cows and heifers.

Estral mucus is made from secretions of sectretor cells from cervix mucosa (1) and consist of
liquids of endometrial origin, of fallopian tube, folicular and peritoneum, and also from leucocytes
and cellular detritus from uterus, cervical and vaginal epithelium (3).
Physical propertys are represented from: viscozity, elasticity (twisting capacity), cristalization,
pH and expansion capacity (3).
The fuctions of cervical mucus are:
to ensure the ascension of spermatozoa in theyr transit from female genital track;
capacity of them in female genital track;
local bacteriostatic property (3, 4).
In the matter of sperm transportation the estral mucus fulfill the furthers functions:
receptive to sperm entry close to ovulation moment and stop migration in other cycle
phases;
act as a sperm reservoir;
protect the sperm from the hostile vagina background and from phagocytosis;
assure the energy level for spermatozoa;
retain the abnormal and motionless spermatozoa (3).
After Hafez, 1987 (7), the cervix and its secretions play an important role in the mammals
reproductive process.
Tsiligianni et all, 2000 (10), made some studys on mucus samples from cows that was on the
first tree heat cycles after parturition. Its showed that the physic property of the cervical mucus
remain unchanged after the first, the second and the third estrus.
After Kruif, quote by Bogdan et all (6), the factors that influence the fertility of a cow effective
are: genital tonus, insemination method, reproduction cow, management terms of the farm.
211

Universitatea de tiine Agricole i Medicin Veterinar


Within the management an particularly attention must be given to: climate, season, number
of cows, housing system, bull election, hygiene during parturition, heating tracking and insemination
time, rational alimentation, cow reform and selection.
The main factors that can have an effect on fertility of an cow effective are: the sire, the
quality of the seminal material, insemination method, the cow for reproduction, housing conditions
and some incidentally factors.
After the same author it was shown a 15% difference of conception rate after first I.A.
between the bull with the optimal fecundity capacity and the bull with the minimal one.
The I.A. method is essential for a high fecundity rate. The difference between the results
obtained by using different insemination techniques touch 5 10% from fecundity obtained rates.
The fecundity drop with 5% to primiparous cows and with more to those older than 7 years.
The fecundity is lower in the winter period.
The hygiene from parturition time may influence with 5 10% the gestation index.
Materials and methods
The researchs of this paper are the result of artificial insemination made between 2004 and
May 2007, on farmers cows from Timis county.
The majority of the authors recommend I.A. to be made not earlier than 45 50 days after
parturition.
Usually, we made the insemination near the end or after heat period.
To determine the electric impedance of vestibule-vaginal mucosa we used a device made by
HAUPTNER company, named BRUNSTMESSGERAT for cows.
The device function on the rule that the electric resistance, in terms of ohmi, vary on the basis
of the sexual cycle stage and the physiologically state of the female (2).
According to the company producer the values shown by the device mean the next situations:
until 30 ohmi proestrus stadium;
30 40 ohmi estrus stadium;
over 45 ohmi metestrus stadium.
We obtain the pH values of cervico-vaginal mucus by using pH-Box reaction paper from
MERCK company.
The pH values of cervico-vaginal mucus during estrus time vary from 6,5 to 6,7 and the in vitro
values are with 0,6 0,7 points bigger.
The elasticity have maximum values before or during ovulation time in cows and womens.
We appreciated the expansion capacity with the help of two blades.
To appreciate the crystallization quality of cervico-vaginal mucus we used an arbitrary scale
made by Bishnoi et all, 1982 (5), which show:
0 lack of crystallization;
1 formatting of a single atypical crystal;
2 formatting of more than one atypical crystals and also a few normal ones (ferny
aspect);
3 formatting of a few normal crystals and only to a one atypical crystal;
4 formatting only the normal crystals.
We mention that during the entire observations time the artificial insemination method was
made by the same person in point of the insemination time, thawing the seminal material, place to
put the seminal material in female genital organs.
Results and discussions
Cow fertility is determined from a multitude of internal and external factors, from witch the
more important are: the functional integrity of the reproduction system, concordance between the
optimal insemination time and ovulation, functional capacity or biological value of seminal material.
Results obtained after I.A. in cows and fecundity obtained at first two sexual cycles on the
research period time are presented in table 1.

212

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Table 1. CENTRALISATION results obtained after I.A. in cows and heifers
in the first two sexual cycles between 2004 2007
Nr.
Pregnant after
Pregnant after
Total pregnant
Month
Cows
first I.A. %
second I.A. %
%
I.A.
29
6
35
1
51
56,86
11,76
68,62
32
4
36
2
50
64,00
8,00
72,00
54
11
65
3
86
62,79
12,79
75,58
51
7
58
4
84
60,71
8,33
69,04
75
5
80
5
125
60,00
4,00
64,00
36
6
42
6
59
61,01
10,16
71,18
36
2
38
7
43
83,72
4,65
88,37
31
3
34
8
51
60,78
5,88
66,66
35
8
43
9
62
56,45
12,90
69,35
29
3
32
10
35
82,85
8,57
91,42
16
1
17
11
31
51,61
3,22
54,83
9
9
12
16
56,25
56,25
433
56
489
Total
694
62,39
8,06
70,46

It was artificially inseminated a number of 694 cows and heifers from breeds Baltata
Romaneasca, Holstein Friza, Red Holstein and crossbreeds between this breeds.
After artificial insemination was made in this period remain pregnant at first heat cycle 62,39%
cows and heifers, and 8,06% after the second heat cycle.
After I.A. was made it was obtained in 2004, 2005, 2006 and 2007 an insemination index of
1.47, 1.56 and 1.63 to cows and 1.14, 1.12 and 1.35 to heifers.
Seeing that the ideal insemination index is 1.00, we consider that the one obtained by us is
good.
The fecundity obtained in 2004 at the first two estrus cycle was 73.29%, with variations of
50.00% in November and December months and 90.90% in January month. It was discovered a
fecundity decrease in June month.
The fecundity obtained in 2005 at the first two estrus cycle was 74,05% in cows and heifers.
The installation of gestation rate vary from 87,09% in March month to 58,33 69,56% in July
August months. The explanation for the low fecundity rate in July August months is the high
temperature from this two months, temperatures witch have a negative influence on fecundity.
In 2006 it was obtained an average gestation rate of 58,36% at the first two estral cycles.
In 2007 it was obtained an average gestation rate of 57,81% at the first two estral cycles.
It wasnt showed significantly differences on I.A. period in cows and heifers in terms of getting
pregnant rate and insemination index.
Given to a 85% admitted index as an optimum value of inseminated cows and heifers
fecundity, we obtained values between 73,29% in 2004, 74,05% in 2005, 58,36% in 2006 and 57,81%
in the first part of 2007.
The fecundity index value of 58,36% and 57,81% obtained in 2006 and 2007 is because of the
poor quality of the seminal material used in this period of time.
213

Universitatea de tiine Agricole i Medicin Veterinar


Due to dynamic per year of estrus manifestation, on the total period of this study, its shown a
significantly increase in spring and early summer and a smaller increase in August September
period.
The results concerning the correlations between four physic properties of cervico-vaginal
mucus and the fecundity obtained to cows and heifers from two breeds and their crossbreeds are in
table 2.
Table 2.CENTRALISATION
concerning the correlations between four physic properties of cervico-vaginal mucus and the fecundity obtained
to cows and heifers from two breeds and their crossbreeds
Breed and
Average
Nr. of
Average
Average
Average
Graining
Nr.
cathegory
age
animals
resistance
pH
expansion
(0-4)

BR
pregnants
BR
pregnants
HF
pregnants
HF
pregnants

1
2
3
4

4,2

25

48,91

6,64

7,46

6,1

28

69,87

6,33

4,95

3,5

32

49,25

6,73

8,04

3,8

20

75,30

5,96

4,46

60,86%=
+++
34,78%=
0,+,++
54,54%=
+++
45,45%=
0,+,++

Average resistance of BR pregnant cows mucus, after artificial insemination was made, it was
48,91 ohmi and for the group with cows not pregnant 69,87 ohmi. Approximative equal values was
registered also in pregnant cows group of HF breed but with the specification that average resistance
of cervico-vaginal mucus from non pregnant cows from the same breed it was with 5% higher
(75,30%).
As regards the pH registered to the entire four category of cows, it reached values next to
neutral pH (6,64 and 6,73)and with acidity lean to non pregnant cows from both two breeds (6,33
5,96).
Average extension or registered elasticity to females with estrus, which ulterior were found as
pregnant, it was registered as superior compared with the other two non pregnant category (7,46 cm
and 8,04 cm for the pregnant ones, respectively 4,95 cm and 4,46 cm for non pregnant ones).
The higher fecundity was obtained in the moment when, after making the test for the
crystallization of cervico-vaginal mucus, he reach the rank 4 after Bishnoi et all, 1982, (7), scale.
After Tsiligianni et all, 2000, (10), the viscosity of the cervical mucus is lower to pregnant cows
compared with those non pregnant. In this study the extension capacity of the cervical mucus was
demonstrated to be insignificant at pregnant cows or non pregnant cows. Pregnant cows presented a
typical crystallization of the cervical mucus, and those non pregnant presented an atypical
crystallization.
Kruip and Dieleman, 1985, (onea et all) (9) observe a positive correlation between
progesterone and viscosity and a negative correlation between progesterone concentration and
crystallization. In conclusion, after this authors, the optimal time for artificial insemination is when
the viscosity is 20 mm water and the crystallization is at least 3 (to a scale from 0 to 4).
Conclusions
After artificial inseminations made in the research period and in mentioned conditions we
draw many conclusions.
In first two estral cycles it was obtained a superior fecundity index compared with the one
obtained in farms with a high number of cows and with a good reproduction activity, respectively
73,29% in 2004, 74,05% in 2005, 58,36% in 2006 and 57,81% in the beginning of year 2007.
The significant decrease of fecundity and insemination index, particularly in the last two years,
is due to low quality frozen semen used.
It wasnt determined significant differences regarding fecundity and the place where frozen
seminal material was placed, in uterus body or/and in uterine horns.
214

Lucrri tiinifice vol. 51 seria Medicin Veterinar


It was determined a estrus manifestation dynamics higher in spring months, in the beginning
of summer and in autumn months.
There is a positive correlation between the vestibule-vaginal mucosa resistance, the pH, the
expansion capacity (elasticity), the estral mucus crystallization quality and the registered fecundity
due to artificial insemination in cows and heifers.
It wasnt determined correlations between the heats mucus characteristics and fecundity
regarding the breeds of the cows and heifers.
References
1.

ARCH, M., (1989) - Bovine cervical mucus penetration by human spermatozoa: lack of association with
conception. Androl. 22(1) pp: 29-34.
2. ARDELEAN V. (1997) - Cercetri privind combaterea anestrului la vaci. Tez doctorat, Timioara.
3. BERGMAN,A., AMIT,A., YEDWAB, G., DAVID, M.P., HOMONNAI, Z.T., PAZ, G.F., (1981) - Filtering capacity
of bovine cervical mucus towards abnormal forms of human-ejaculated spermatozoa. Int J of Androl., 4(6) pp:
675-84.
4. BHUSHANA RAO, K.S.P., VAN ROOST, E., MASSON, P.L., HEREMANS, J.F., ANDRE, F., (1973) - Studies
on bovine cervical mucin I, The amino acid composition and N-terminal amino acid of bovine oestrus cervical
mucus. Biochimica et Biophysica Acta (BBA) - Protein Structure, Volume 317, Issue 2, pp: 286-302.
5. BISHNOI, B.L., VYAS, K.K., DWARAKNATH, P.K., (1982) - Note of spinnbarkeit and crystallization pattern of
bovine cervical mucus during oestrus. Indian J Anim Sci, 52 pp: 438-440.
6. BOGDAN, A.T., BISTRICEANU, M., MJIN, C. (1981) Reproducia animalelor de ferm. Ed. Scrisul
Romnesc, Craiova.
7. HAFEZ, E.S.E., (1987) - Reproduction in farm animals. Lea and Febiger. Philadelphia Functional histology of
reproduction pp: 65-82.
8. RUTLLANT, J., LPEZ-GATIUS, F., CAMN, J., LOPEZ-BEJAR, M., LOPEZ-PLANA, C. A., (1999) - Structural
study of the bovine vaginal fluid at estrus. Scanning. J. Vet. Med. A. 21 pp: 204211.
9. ONEA AL., DORINA BOGDAN, BROIU A., MARIA VASILE, DIACONESCU AL. (2001) -Tehnologia
nsmnrilor artificiale la animale.Ed. Universitas Company, Bucureti
10. TSILIGIANNI, T., KARAGIANNIDIS, A., BRIKAS, P., SARATSIS, P., (2000) - Relationship between certain
physical properties of cervical mucus and fertility in cows. Dtsch Tierarztl Wochenschr. 107(1) pp: 28-31.

215

Universitatea de tiine Agricole i Medicin Veterinar

REACTIVITATEA MUSCULATURII NETEDE ARTERIALE LA UNII


AGENI VASOCONSTRICTORI (CLORURA DE POTASIU I
ANGIOTENSINA)
STUDIU COMPARATIV LA UNELE SPECII DE MAMIFERE
BECHEA CHIRIAC I.S., HRICU Luminia Diana, BOGHIAN V.
FMV Iai
Vascular reactivity is one of the three pillars on which lies the regulation of arterial pressure in
living organisms. Arterial pressure is one of the main determinants of the activity state of various
organs and systems both in healthy and in pathologically-altered states. The present study aims
toward identifying similarities and differences between the resistance arteries belonging from
various mammal species that are most involved in veterinary practice: rats, cats, dogs and horses.
The arterial fragments prelevated from animals dead due to various clinical and traumatic
conditions unrelated to vascular pathology were normalized using a newly-introduced system of
quantification, the force index system. This has been calculated using the wet-weight parameter
and the force generated after administration of various pharmacological agents that cause
vasoconstriction. The artery fragments were fitted in organ baths using the Krebs-Henseleit
saline, thermostated at 37 C and bubbled with a mixture of 95% O2 and 5%CO2. Vascular
endothelium was either kept or removed using gentle rubbing with moist filter paper. Control of
endothelial removal was made both functionally, using carbachol (synthetic derivative of
acetylcholine) and microscopically, after testing. The force generated was measured using
isometric force transducers coupled to a computerized acquisition system. The pharmacological
vasoconstricting agents used were phenylephrine (synthetic derivative of epinephrine), KCl
(potassium chloride 40-80 mM, as depolarizing agent) angiotensin II, and vasopressin. The results
were statistically investigated using the t-test and ANOVA testing. The preliminary results show a
dependence of the force generated an the amount of muscle present in the various species from
which the arteries were taken, a specifically increased response of feline-derived arteries to
angiotensin and a specifically increased response of
canine-derived arteries to vasopressin. These results will be used as controls for further testing
in various pathological conditions and for various other pharmacological agents used in the
therapy of vascularly-induced pathological states.
Key words: vascular, reactivity, arterial, vasoconstrictor agent

Studiul de fa dorete s investigheze modificrile de reactivitate vascular arterial care ar


putea fi implicate n patogenia diverselor specii de animale ntlnite mai frecvent n practica
veterinar. S-a urmrit realizarea unei investigaii comparative a reactivitii vasculare la segmente
arteriale similare din punct de vedere histologic i funcional, recoltate de la diverse specii de
mamifere ntlnite mai des n patologia veterinar.
Investigarea mecanismelor ce stau la baza reglrii tonusului arterial i a metabolismului fibrei
musculare netede arteriale s-a bazat n ultimele dou decenii pe foarte cunoscutul model al
traductorilor izometrici i al preparatului inelar de diverse artere. Vasul arterial de elecie folosit
pentru astfel de investigaii este aorta de obolan, deoarece ntrunete majoritatea condiiilor de
stabilitate, accesibilitate, disponibilitate i control unor investigaii de ncredere. La aceasta se adaug
criteriul de pre, care nu este deloc un element de pierdut din vedere.
Totui, dei acest model este arhicunoscut, obolanul nu este un model perfect din punct de
vedere al modelrii cardiovasculare, care s fie similar cu omul i cu att mai puin cu alte mamifere.
Perioada de-a lungul creia se ntind aceste studii ce au implicat acest model experimental ncepe
acum jumtate de secol *2].
Astfel, s-au folosit fragmente de artere recoltate de la cini, pisici i cai, care au fost supuse
investigrii experimentale comparativ cu inele de aort toracic standardizate, recoltate de la
obolani Wistar.
MATERIAL I METOD
Reactivitatea inelelor arteriale a fost msurat att n termeni de for absolut, msurat ca
indice de for (fora n mN dezvoltat de preparat raportat la greutatea acesteia n mg) ct i ca
216

Lucrri tiinifice vol. 51 seria Medicin Veterinar


reacie relativ, fa de un martor standardizat. De asemeni, acolo unde a fost posibil (n funcie de
disponibilitatea preparatelor) s-au efectuat curbe doz/efect ce au implicat majoritatea substanelor
vasorelaxante i vasoconstrictoare cunoscute i bine caracterizate farmacologic.
Studiul comparativ a fost fcut pe artere similare din punct de vedere a dimensiunilor, care s
fac parte din segmentul de rezisten, n spe ramuri din artera coronar gastric sau mezenterica
superioar, care au avut dimensiuni similare: lungime maxim: 2 mm, = 1 mm, greutate 10-15 mg.
Cuantificarea forei de contracie a fost realizat n N/mg greutate umed *3]. Piesele de organ au
fost prelevate de la Clinica Medical i de la Clinica Chirurgie a Facultii de Medicin Veterinar de la
animale moarte n urma unor afeciuni fr implicare vascular sau supus eutanasiei n condiiile legii
[8].
Dup disecie, vasele au fost exsanguinate, splate n soluie de ser fiziologic, secionate n
fragmente de 5-10 cm i apoi au fost plasate n ser Krebs-Henseleit (preparat conform formulei) i
transportate in timp maxim, 30 minute la locul experimentului.
Fragmentele de aort au fost fixate prin intermediul unei serfine metalice pe fundul bailor de
organ izolat, inelul tensionndu-se prin intermediul vernierelor mrcilor tensiometrice la o tensiune
iniial de 100 mN.
Atunci cnd caracteristicile experimentale au cerut-o, endoteliul vascular a fost ndeprtat prin
frecare blnd cu hrtie de filtru umed. Prezena endoteliului vascular funcional a fost verificat
farmacologic (folosind carbachol) i prin microscopie direct.
Inelele de arter au fost montate n bi de organ coninnd 4 ml de ser fiziologic KrebsHenseleit (compoziie (mM): NaCl 118; KCl 4.7; CaCl2 2.52; MgSO4 1.64; NaHCO3 24.88; KH2PO4 1.18;
glucoz 5.55), termostatate la 37C i barbotate cu carbogen (amestec de oxigen 95% i CO2 5%).
Pentru nregistrarea contraciilor musculaturii netede vasculare s-au folosit traductori
izometrici de for conectai la un sistem computerizat de achiziie a datelor.
Preparatele au fost lsate la echilibrat timp de 60-90 minute, sub o tensiune de repaos de 100
mN.
Inele de arter au fost apoi precontractate cu fenilefrin (10-7 10-6)M i K+ (40-70 mM) i
tratate cu carbachol (10-6M) pentru eliberarea de NO endotelial [6+. Magnitudinea absolut a
contraciilor a fost de 175 25 mN pentru fenilefrin (10-6 M) i K+ (40-70 mM).
REZULTATE I DISCUII

1. Efectul contraciei potasice asupra reactivitii musculaturii netede a arterelor


Administrarea de potasiu ionizat sub form de clorur de potasiu 80 mM (miliMoli/Litru)
produce o contracie sub form de platou, stabil i reproductibil, ce poate fi folosit drept
contracie de control a reactivitii vasculare la diversele tipuri de artere (figura nr. 1 i tabel 1).
Tonusul muchiului neted vascular, cel mai important determinant al rezistenei vasculare
periferice i a presiunii arteriale, este determinat n principal de concentraia intracelular de Ca2+.
Domeniul de variaie al potenialului membranar al celulelor musculare netede este de 45
pn la 60 mV. Creterea concentraiei K+ extracelular duce la efecte depolarizante, care produc
deschiderea canalelor de Ca2+ voltaj dependente, ceea ce produce contracia muchiului neted
vascular (3).

217

Universitatea de tiine Agricole i Medicin Veterinar


2400
2200

Forta (mgF)

2000
1800
1600
1400
1200
1000
2200

2400

2600

2800

3000

3200

Timp (secunde)

Figura nr. 1 - Aspectul contraciei tipice la KCl n aorta de obolan (w splare)


Tabelul nr. 1 Efectul contractil la administrarea de KCL
40mM KCl
80mM KCl
2,7
4,9
3,1
7,0
3,0
7,2
4,1
11,1

obolan
pisic
cine
cal

Dup cum se observ n figura nr 2, administrarea de doz medie de KCl (40 mM-L) a produs
un efect contractil relativ similar la toate tipurile de preparat luate n studiu.
Pe de alt parte, administrarea unei concentraii maximale de KCl (80 mM/L) a indus o
contracie foarte puternic, a crei indice de for a crescut cu 59% la obolan, 132-133% la cine i
pisic, obinndu-se un maxim de 170% la arterele de cal. Dup cum se observ din figura nr. 3, cu ct
cantitatea de muchi neted prezent la arterele luate n studiu este mai mare, cu att efectul
potasiului este mai puternic.
14

IF (mN/mg tesut umed)

12
10
40 mM
8

80 mM
Linear (80 mM)

Linear (40 mM)


4
2
0
sobolan

pisica

caine

cal

Figura nr. 2 - Variaia contractilitii (determinat prin variaia IF)


la administrarea de KCl

218

Lucrri tiinifice vol. 51 seria Medicin Veterinar


200

% contractia KCl 40 mM

180
160
140
120
%

100

Linear (%)

80
60
40
20
0
sobolan

pisica

caine

cal

Figura nr. 3 Variaia procentual a creterii IF la administrarea de K+ supramaximal

2. Rezultatele administrrii de angiotensin asupra contractilitii preparatelor arteriale


Protocolul de administrare a fost similar cu cel prezentat la capitolele anterioare.
Contracia angiotensinic are nite caracteristici aparte, care o difereniaz de contracia adrenergic sau de contracia potasic.
Efectele ang II la nivelul muchiului neted vascular sunt mediate de cuplarea la receptorul
specific de tip AT-1, ceea ce induce o cascad a semnalizrii intracelulare care duce la creterea
calciului citosolic cu efecte de contracie a muchiului, precum i activarea sistemului protein-kinazei
C (PKC), i a sistemului MAP-Kinazei (Mitogen-Activated Kinase) (4).
Contracia angiotensinergic are alte caracteristici temporale fa de cea adrenergic.
Administrarea de angiotensin II produce o contracie de scurt durat, cu o amplitudine maximal
situat n jurul a 80% din contracia de 10-6 fenilefrin, la o concentraie de 10-6 M angiotensin II.
Contracia este de tip fazic, i nu tonic, cu durate variabile, care merg de la 5 pn la maximum
15 minute. Dup aceast durat, tonusul muscular revine la normal (figura nr. 4).
O nou aplicare de angiotensin II nu mai are efectul primei administrri dect dac este
administrat la maximum 90 de minute de la prima administrare, precum i dup minimum 6 splri
cu ndeprtarea integral a lichidului de perfuzie. Acest fenomen se numete tahifilaxie i
reprezint reducerea efectului unei administrri suplimentare dintr-o substan datorit legrii
acesteia de receptori membranari cu afinitate mare. Aceast constant mare de legare face ca
decuplarea ligandului de pe receptor s se fac lent, n cursul mai multor minute, sau dup
ndeprtarea foarte rapid i frecvent a serului de perfuzie. Asfel, o a doua administrare de
substan activ nu va mai avea efectul scontat, deoarece siturile de legare sunt deja ocupate de la
administrarea iniial.

Figura nr. 4 Aspectul tipic al contraciei angiotensinice (B), fa de contracia fenilefrinic (A)

219

Universitatea de tiine Agricole i Medicin Veterinar


Administrarea de angiotensin sub form de angiotensin-amidat (Hypertensin) n doz de 106
M/L la preparatele de animale fr leziuni vasculare a produs urmtoarele rezultate (indice de
for)care sunt redate n tabelul nr. 2 i figura nr.5.

indice de forta la administrarea de Ang II 10-5M

Tabelul nr. 2 Indicele de for la administrarea de angiotensin 10-6 M


n preparate de inele arteriale
obolan
2,1 0,67
Pisic
4,9 1,1
Cine
2,3 0,8
Cal
3,6 1,2

70
60
50
40
30
20
10
0
sobolan

pisica

caine

cal

Figura nr. 5 Indicele de for la administrarea de angiotensina II 10-6 M

Observndu-se aceast deviere statistic important de la norm n cazul reactivitii


vasculare angiotensinergice la pisic, s-a efectuat curba doz-efect cumulativ, pentru a se observa
eventuale diferene ntre specii.
Rezultatele obinute au demonstrat o reactivitate intrinsec foarte semnificativ n cazul
preparatelor de pisic care au dat rezultate semnificative, curba doz-efect fiind deplasat ctre
stnga, ceea ce nseamn o sensibilitate crescut a specii la respectivul preparat. Preparatele de
obolan, cine i cal au prezentat reactiviti similare ntre ele la administrarea de angiotensin.
Un element important al acestei investigaii este rezultatul interesant i nemenionat n
literatur, ce merit luat n studiu pentru investigaii ulterioare. Reactivitatea la angiotensin a
preparatelor feline s-a dovedit a fi mult mai mare dect media reactivitii la preparatele obinute
dect la celelalte animale. Curba doz-efect este deplasat ctre valori mai mari ale indicilor de for
obinui la preparatele feline dect la celelalte specii, chiar dac volumul efectiv al stratului muscular
s-a dovedit a fi mai mic dect cel obinut de la caninele mari sau de la cal (figura nr. 6).

220

Lucrri tiinifice vol. 51 seria Medicin Veterinar


70
60

IF (mgF/mg gu)

50
sobolan
40

pisica

30

caine
cal

20
10
0
-10

-9

-8

-7

-6

-5

-4

doza molara Ang II

Figura nr. 6 Curba doz-efect la angiotensin

Reactivitatea potasic a fost similar cu cea adrenergic, demonstrndu-se o dependen


direct ntre efectul contractil al KCl i cantitatea de muchi prezent la nivelul arterelor luate n
studiu. Administrarea unei doze moderate de KCl (40mM) a produs o cretere similar a indicelui de
for calculat la diversele preparate, n timp ce administrarea unei doze maximale de KCl (80mM) a
produs o cretere foarte puternic a IF, direct proporional cu masa de muchi, fapt demonstrat de
orientarea ascendent a liniilor de tendin
1.
2.

3.

4.

CONCLUZII
Reactivitatea potasic a fost similar cu cea adrenergic, demonstrndu-se o dependen direct
ntre efectul contractil al KCl i cantitatea de muchi prezent la nivelul arterelor luate n studiu.
Administrarea unei doze maximale de KCl (80mM) a produs o cretere foarte puternic a IF,
direct proporional cu masa de muchi, fapt demonstrat de orientarea ascendent a liniilor de
tendin.
Curbele doz-efect n cazul reactivitii angiotensinergice au avut o configuraie similar, cu
excepia reaciei vaselor de rezisten feline, unde s-a obinut un efect foarte puternic
comparativ cu cel obinut la vasele altor animale.
Densitatea receptorilor angiotensinici de tip AT1 este mai mare la nivelul musculaturii arteriale
de pisic. Rezultatele prezentate sunt corelate cu rezultatele obinute cu inhibitorii de contracie
de tip blocani ai canalelor de calciu (D600-galopamil), care de asemeni au prezentat efecte
deosebit de puternice la preparatele feline.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.

Bechea Chiriac Sorin, Serban DN., 2001 - Mechanisms involved in the vascular action of phenamyl, Lucr. St.
vol. 44., USAMV Iai, p. 151-159;
Beznak M., 1956 - Hemodynamic changes following aortic constriction in normal and in hypophysectomized
rats. - Can J Biochem Physiol., 34(4):791-8.
Doi S., Damron D. S., Ogawa K., Tanaka S., Horibe M., Murray A. P., 2000 - K+ channel inhibition, calcium
signaling, and vasomotor tone in canine pulmonary artery smooth muscle - AJP - Lung 279:242-251
Haller H., Lindschau C., Erdmann Bettina, Quass P., Luft F. C., 1996 - Effects of Intracellular Angiotensin II
in Vascular Smooth Muscle Cells - (Circulation Research. 79:765-772.)
Haulica I, Bild W, Mihaila CN, Ionita T, Boisteanu CP, Neagu B., 2003 - Biphasic effects of angiotensin (1-7)
and its interactions with angiotensin II in rat aorta. - J Renin Angiotensin Aldosterone Syst. 4(2):124-8
Jiang H, Halayko AJ, Rao K, Cunningham P, Stephens NL., 1991 - Normalization of force generated by
canine airway smooth muscles. - Am J Physiol. 260(6 Pt 1):L522-9.
Moncada S., Palmer R.M.J., Higgs E.A., 1991 - Nitric oxide: physiology, pathophysiology, and pharmacology.
Pharmacol. Rev., 43: 109-142

* - LEGE nr.471 din 9 iulie 2002 Buletinul Oficial al Romniei, privind aprobarea Ordonantei
Guvernului nr. 37/2002 pentru protectia animalelor folosite n scopuri stiintifice sau n alte
scopuri experimentale.
221

Universitatea de tiine Agricole i Medicin Veterinar

OBSERVAII PRIVIND DIAGNOSTICUL I TRATAMENTUL


HERNIEI UTERULUI GESTANT LA CEA STUDIU DE CAZ
OBSERVATIONS REGARDING THE DIAGNOSIS AND TREATMENT OF THE
PREGNANT UTERUS HERNIA IN A BITCH CASE REPORT
BOR S.I., ROCA P., RUNCEANU L.
FMV Iai
A 2.5 year-old Peckinese female dog was brought in to consultations accusing a round shaped
formation, situated in the ventral abdominal area, that had a constant and rapid evolution during
the past 4 weeks. The pregnant uterus hernia was presumed after the physical examination, and
was confirmed through ultrasonography. Three live foetuses were present in the herniated
portion of the uterus, and another live foetus was found in the other horn situated in the
abdominal cavity. Thus, we concluded that only one uterine horn had herniated. Due to the
agravation of the females general condition, a new ultrasound examination confirmed the death
of the three foetuses in the herniated horn. Ovariohysterectomy was decided to be performed, in
order to save the dogs life.
Key words: bitch, pregnant uterus hernia, diagnosis, treatment

Hernia uterului gestant (HUG) este o modificare topografic caracterizat prin angajarea
uterului gestant printr-o bre a peretelui abdominal. Este un accident rar ntlnit n patologia
afeciunilor de reproducie la carnivore, fiind favorizat de unii factori legai de vrsta naintat a
femelei, carenele nutriionale, atonia general a organismului datorat sedentarismului, la care
concur i unii factori uterini: hidropizia anexelor fetale, alturi de traumatismele peretelui
abdominal (1,4,5).
La cea accidentul se poate produce pe traiectul ingvinal putnd hernia i n caz de piometru
sau chiar uterul negestant. De obicei, la carnivore herniaz numai un corn uterin, dar n gestaia
avansat, expulzia fetuilor pe cale natural nu mai este posibil (2, 5, 4).
Simptomatologia este caracterizat prin prezena semnelor locale i generale.
La inspecia local se observ prezena unei deformri n zona infero-lateral stng sau
dreapt, aceasta putnd avea la nceput dimensiuni mici, ca apoi s creasc n volum pe msura
dezvoltrii gestaiei (3,6).
Palpaia evideniaz un corp dur, uor fluctuent, uneori identificndu-se chiar pri din corpul
fetal (gestaie n faz avansat) (6).
Simptomatologia general const n agitaie, deplasare greoaie, prezena uneori a decubitului
cu ndreptarea capului spre zona unde se afl organul herniat, tahicardie i tahipnee.
Studiul de caz reprezint hernia uterului gestant la o cea rasa Peckinez, diagnosticul clinic
fiind confirmat prin examen ecografic. Afeciunea a fost remediat chirurgical, prin realizarea
operaiei de ovario-histerectomie.
MATERIAL I METOD
Pacientul, o cea din rasa Peckinez, n vrst de 2,5 ani, prezentat la consultaie dup 4
sptmni de la debutul afeciunii, care a coincis cu apariia la nivelul regiunii abdominale (zona
infero-lateral stng) a unei formaiuni globuloase de mici dimensiuni.
Proprietarii afirm faptul c debutul afeciunii este situat cu mai multe luni n urm ns au
observat modificarea considerabil a dimensiunilor formaiunii, mai ales n ultimele 4 sptmni.
Pacientul a fost examinat clinic prin inspecie i palpaie, constatndu-se prezena unei dilataii
de aspect globulos, de consisten crnoas, uor fluctuent, localizat n regiunea infero-lateral a
abdomenului (fig. 1, 2).

222

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Fig. 1, 2. Hernia uterului gestant aspect clinic

n urma acestui examen s-a suspicionat hernia uterului, a vezicii urinare sau a unor anse
intestinale.
Pentru a afla identitatea organului herniat, s-a recurs, ca i examen complementar de
confirmare, la examenul ecografic.
Examenul ecografic, efectuat cu o sond convex de 7,5 MHz, a relevat prezena n sacul
herniar a 3 caviti pline cu lichid care conineau trei fetui vii. Diametrul sacului gestaional al unui
fetus avea aproximativ 1,57 cm i conform programului ecografului corespundea unei gestaii de 4
sptmni i 1 zi (fig. 3). Dup efectuarea ecografiei i la nivelul cavitii abdominale, s-a constatat
prezena n cornul uterin neherniat a unui alt fetus, care avea diametrul sacului gestaional de
aproximativ 2,23 cm, ceea ce corespundea unei gestai de 4 sptmni i 5 zile (fig. 4). Pentru a avea
o imagine clar a ntregului sac herniar, s-a efectuat i o examinare ecografic a acestuia cu sonda
liniar de 8,0 MHz, obinndu-se, astfel, imaginea celor trei saci gestaionali (fig. 5).

Fig.3. Sac gestaional uter herniat


-aspectc ecografic, sonda 7,5 MHz

Fig.4. Sac gestaional uter neherniat


- aspect ecografic, sonda 7,5 MHz

Fig. 5. Hernia uterului gestant -aspect ecografic, sonda 8,0 MHz

Corelnd datele anamnetice cu cele ale examenelor clinic i ecografic, s-a ajuns la concluzia c
diagnosticul cert este cel de hernie a uterului gestant, n perioada de mijloc a gestaiei.
223

Universitatea de tiine Agricole i Medicin Veterinar


REZULTATE I DISCUII
ntruct starea general a pacientei s-a nrutit n urmtoarele 4 zile, proprietarii au decis s
prezinte femela la un nou examen ginecologic.
Primul lucru care a interesat a fost stabilirea viabilitii fetuilor, att a celui din cornul uterin
neherniat, ct i a celorlali 3 din cornul uterin herniat.
Astfel, s-a realizat un nou examen ecografic ce a confirmat faptul c fetusul din cornul uterin
aflat n cavitatea abdominal era viu, iar cei din cornul uterin herniat erau mori. Acest lucru s-a
datorat tulburrii circulaiei sanguine, ca urmare a dimensiunilor prea mici ale inelului herniar
corelat cu creterea presiunii pe zona respectiv datorat dezvoltrii fetuilor.
Observnd starea general modificat a femelei i existnd riscul apariiei unor complicaii
imediate datorate morii fetuilor din zona herniar (mumifierea fetuilor, putrefacia lor etc.),
singura indicaie terapeutic a fost intervenia chirurgical prin practicarea operaiei de ovariohisterectomie pe cale ingvinal.
S-a utilizat neuroleptanalgezia prin administrarea injectabil i.m. a Xilazinei n timpul I i
Ketaminei n timpul II ( la 15 minute interval ).
Femela a fost contenionat n decubit dorsal, cu membrele posterioare plasate caudal i
fixate n abducie, astfel expunerea zonei operatorii fiind mai convenabil i mai comod pentru
chirurg.
Dup aceast etap, s-a procedat la efectuarea operaiei de ovario-histerectomie, realizat pe
la nivelul inelului herniar.
nchiderea cavitii abdominale s-a efectuat prin realizarea unei suturi bietajate la nivelul plgii
abdominale: musculo-peritoneal cu catgut nr.1, n fir continuu la nivelul inelului herniar i sutura
pielii cu mtase chirurgical nr. 5, n fire separate.
Tratamentul postoperator a constat n reechilibrarea hidroelectrolitic i volemic,
antibioterapie postoperatorie iar local aspersarea plgii cu un spray cicatrizant.
1.

2.

3.

4.

5.

COCLUZII:
Hernia uterului s-a produs la femela luat n studiu nainte de instalarea strii de gestaie i doar
dezvoltarea gestaiei a fost cea care i-a determinat pe proprietari s prezinte femela la
consultaie, ntruct fomaiunea herniat a nceput s i mreasc volumul n mod constant i
continuu.
Stabilirea diagnosticului de gestaie s-a realizat prin utilizarea marilor metode semiologice, dar
confirmarea s-a realizat prin examen ecografic, ocazie cu care a putut fi identificat att numrul
fetuilor sau lojelor fetale herniate, ct i viabilitatea produilor de concepie.
Datorit inelului herniar de dimensiuni mici i datorit mririi n volum a uterului herniat, s-a
realizat o compresiune asupra uterului gestant, soldat cu hipoxie fetal accentuat i moartea
fetuilor din poriunea de uter herniat.
Ca urmare a opririi n evoluie a gestaiei din lojele fetale herniate (moartea fetuilor) i a riscului
apariiei unor complicaii ce pot pune n pericol viaa femelei, s-a hotrt efectuarea ovariohisterectomiei pe cale ingvinal.
Ovario-histerectomia pe cale ingvinal a reprezentat soluia optim pentru remedierea afeciunii
i salvarea vieii femelei.
BIBLIOGRAFIE:

1.
2.
3.
4.
5.
6.

Jubb, K.V.F., Kennedy, P.C., Palmer., 1993 Pathology of Domestic Animals, vol. III, Academic Press. Inc.,
California.
Mialot, J.P., 1989 Pathologie de la Reproduction chez les carnivores domestiques. Ed. du Point Vtrinaire.
Noakes, D.E., Parkinson, T.J., England., G.C.W., Arthur, G.H., 2001 - Arthur s Veterinary Reproduction and
Obstetrics. W.B. Sannders, London.
Runceanu, L., Cotea, C., Drugociu D., Roca P., 2007 Reproducie, Obstetric i Ginecologie Veterinar,
Ediia a-II-a, Ed. Ion Ionescu De La Brad Iai
Roca, P., 1996 Afeciunile chirurgicale ale aparatului reproductor la femelele carnivorelor domestice.
Abordarea chirurgical a diferitelor segmente genitale. Tez de doctorat U.S.A.M.V. Iai
Roca P., 2004 Reproducia animalelor domestice, Fiziologie i Patologie, Ed. Tehnopress, Iai.

224

Lucrri tiinifice vol. 51 seria Medicin Veterinar

CERCETRI COMPARATIVE PRIVIND TRATAMENTUL


ENDOMETRITELOR CRONICE LA VACILE DE LAPTE UTILIZ]ND
PRODUSELE NATURISTE DIN GAMA PLANTISTIM
COMPARATIVE RESEARCHES REGARDING THE TREATMENT OF CHRONIC
ENDOMETRITIS IN DAIRY COWS USING PLANTISTIM NATURAL
PRODUCTS
BOGDAN L., GROZA I., CIUPE Simona, NEAGU R., MATEI Sorana,
PETREAN Anamaria, VLASIU Teodora
USAMV Cluj-Napoca
The research has been performed at S.C. Fer-Agro SRL from July to December 2007 on a batch
of 40 Holstein Dairy cows, imported from Germany, aged between 3-4 years, with an average
production of 20 l/day, all of them being over 45 days from parturition.
Four batches of 10 cows each have been made, that suffered from chronic endometritis (that
is over 45 days from parturition), that have been treated by intra-uterine administration of the
following products: batch 1 Plantistim, batch 2 Plantistim + Betadine, batch 3 Plantistim +
boric acid, batch 4 Plantistim + Borax.
The purpose of this paper was to perform a comparative test between the four solutions, the
objective being to treat the chronic endometritis and to avoid, or at least to reduce the loses that
follow. The main advantages of these solutions are that they have no waiting time for milk or
meat and have no irritant effect on the endometrium. Using the intrauterine instillations, healing
of the chronic endometritis has been achieved, proving the efficacy of the plant extracts.
The treatment of the chronic endometritis using Plantistim natural products leads to great
savings, as they are ecological products and do not pollute the milk or meat of the animals in
which they are administered.

Este cunoscut faptul c tratamentul endometritelor cu antibiotice, sulfamide sau


chimioterapice, administrate intrauterin are ca i consecin trecerea acestora prin endometru n
circulaia sangvin, ducnd astfel la apariia n lapte a antibioticelor i a produilor din metabolizarea
acestora, ceea ce implic reinerea i degradarea laptelui contaminat, aceasta cauznd pierderi
economice nsemnate pentru proprietar. n cazul endometritelor cronice pierderile determinate de
confiscarea laptelui sunt accentuate i de durat mai mare a tratamentului. Pe de alt parte este
cunoscut efectul iritant asupra mucoasei uterine al majoritii soluiilor medicamentoase pe baz de
antibiotice, sulfamide i chimioterapice utilizate n tratamentul endometritelor cronice, acest fapt
determinnd creterea service period-ului, deci alte pierderi pentru proprietar.
Din cauza acestor dezavantaje date de utilizarea antibioticelor, sulfamidelor i
chimioterapicelor n tratamentul endometritelor cronice, s-a ncercat gsirea unor soluii pentru
evitarea acestor neajunsuri. Una dintre aceste soluii este tratamentul endometritelor cu extracte de
plante, cu sau fr adaos de sunstane antiseptice. Aceste soluii au cteva mari avantaje dintre care
cele mai importante sunt c timpul de ateptare pentru lapte i carne este de 0 zile i c aceste
produse sunt complet neiritante pentru mucoasa uterin. n aceasta categorie intr i gama de
produse pe baz de plante PLANTISTIM, care face obiectul de studiu.
Scopul acestei lucrri este de a face un test comparativ ntre cele 4 soluii: PLANTISTIM,
PLANTISTIM + BETADIN, PLANTISTIM + ACID BORIC, PLANTISTIM + BORAX, obiectul fiind tratarea
vacilor cu endometrite cronice i evitarea sau mcar reducerea pierderilor care le nsoesc.
MATERIALE I METODE
Cercetrile au fost efectuate la S.C. FER-AGRO S.R.L. n perioada iulie-decembrie 2007, pe in lot
de 40 vaci de lapte din rasa Holstein, importate din Germania, cu vrste cuprinse ntre 3 i 4 ani, cu o
producie medie de 20 l pe cap i zi, toate avnd peste 45 de zile de la ftare.
Au fost formate 4 loturi a cte 10 vaci diagnosticate cu endometrit cronic, adic la peste 45
de zile de la ftare, care au fost tratate prin administrarea intrauterin a urmtoarelor produse: lotul I
PLANTISTIM, lotul II PLANTISTIM + BETADIN, lotul III PLANTISTIM + ACID BORIC, lotul IV
PLANTISTIM + BORAX
225

Universitatea de tiine Agricole i Medicin Veterinar


Produsele din gama PLANTISTIM preparate de S.C PROPLANTA S.A., se prezint sub form de
suspensii concentrate obinute din extract de plante (30% extract alcoholic de calendula, 30% extract
alcoholic de lmi, 15% extract alcoholic de mghiran, 15% extract alcoholic de ment, 10% ulei de
eucalipt). Se administreaz la bovine, pe cale intrauterin, 20-50 ml din soluie, la interval de 48 ore
primele dou administrri, apoi din 3 n 3 zile pn la dispariia urmelor de puroi din mucusul uterin,
perioada de ateptare fiind de 0 zile att pentru carne ct i pentru lapte.
Protocolul administrrii produselor din gama PLANTISTIM a fost urmtorul:
nainte de administrare soluia se nclzete la aproximativ 40 0C;
se face toaleta zonei vulvare i perianale;
se maseaz uterul bolnav transrectal, n vederea eliminrii unei cantiti ct maimari
din coninutul uterin;
se introduce cateterul pentru tratamentul endometritelor prin cervix n uter, tehnica
fiind aceeai ca i n cazul inseminrii artificiale;
odat cu prima administrare intrauterin se administreaz i intramuscular o doz de
prostaglandin F2 (Dinolytic 5 ml i.m. n acest caz);
primele 2 administrri au fost la interval de 48 ore iar urmtoarele la interval de 72
ore, numrul acestora variind n funcie de evoluia procesului de vindecare,
administarrea continund pn la dispariia puroiului din mucusul uterin i revenirea
uterului la dimensiunile normale;
n cazul nostru s-a ncercat o standardizare a protocolului de tratament n sensul c n toate
cazurile, soluiile din gama Plantistim au fost administrate n doz de 50 ml la primele dou
administrri i n doz de 30 ml la urmtoarele, intervalul ntre administri fiind de 2 zile ntre primele
dou administrri i de 3 zile ntre urmtoarele. De asemenea am inclus n fiacare lot un caz foarte
grav iar cellalte au fost cazuri moderate sau uoare ca gravitate. Toate cazurile au fost cronice,
tratamentele fiind incepute n jurul zilei 45 post partum.
Rspunsul la tratamentul cu soluiile din gama PLANTISTIM a cazurilor de endometrit cronic
cu diferite grade de gravitate a leziunilor vor fi prezentate n tabelele care urmeaz:
Tab.1 Componenta lotului I i numrul de administrri pn la vindecare n cazul utilizrii produsului Plantistim
Nr.
Nr.
Nr.
crt.
matricol Caracteristicile secreiilor uterine
adm./tratam.
1
2
3
4
5
6
7
8
9
10

17349
00185
54465
00455
08724
06876
52811
04100
17880
16800

Nr.
crt.
1
2
3
4
5
6
7
8
9
10

Tab.2 Componenta lotului II i numrul de administrri pn la vindecare


n cazul utilizrii produsului Plantistim+Betadin
Nr.
Caracteristicile secreiilor uterine
Nr.
matricol
adm./tratam
29023
Secreie purulent abundent cu puroi gros-cremos
6
32539
Mucus cu flocoane de puroi
4
51445
Mucus cu flocoane de puroi n cantitate mare
5
21753
Mucus cu flocoane de puroi reduse cantitativ
3
31111
Secreie purulent abundent
4
25881
Secreie purulent
4
00351
Secreie purulent redus cantitativ
3
08891
Secreie purulent
4
15320
Secreie purulent
4
21749
Mucus cu flocoane de puroi n cantitate mare
4

226

Mucus cu flocoane de puroi


Secreie purulent abundent cu puroi gros-cremos
Secreie purulent redus cantitativ
Secreie purulent
Mucus cu flocoane de puroi
Secreie purulent
Secreie purulent abundent
Secreie purulent
Secreie purulent
Secreie purulent redus cantitativ

4
7
4
5
4
5
6
5
5
4

Lucrri tiinifice vol. 51 seria Medicin Veterinar

Nr.
crt.

Tab.3 Componenta lotului III i numrul de administrri pn la vindecare


n cazul utilizrii produsului Plantistim+Acid Boric
Nr.
Caracteristicile secreiilor uterine
Nr.
matricol
adm./tratam

1
2
3
4
5
6
7
8
9
10

15251
00325
23437
16277
27897
35295
39667
51222
25654
23232

Nr.
crt.
1
2
3
4
5
6
7
8
9
10

Tab.4 Componenta lotului IV i numrul de administrri pn la vindecare


n cazul utilizrii produsului Plantistim+Borax
Nr.
Caracteristicile secreiilor uterine
Nr. adm./tratam.
matricol
00357
Mucus cu flocoane de puroi
3
05327
Secreie purulent abundent
5
25151
Secreie purulent abundent cu puroi gros cremos
5
17245
Secreie purulent
4
15311
Mucus cu flocoane de puroi n cantitate mare
4
21977
Secreie purulent
4
37819
Secreie purulent
4
37538
Mucus cu flocoane de puroi
3
23135
Secreie purulent
4
13555
Mucus cu flocoane de puroi reduse cantitativ
3

Mucus cu flocoane de puroi


Secreie purulent abundent
Secreie purulent abundent cu puroi gros cremos
Secreie purulent
Mucus cu flocoane de puroi
Mucus cu flocoane de puroi n cantitate mare
Secreie purulent
Secreie purulent
Secreie purulent abundent
Mucus cu flocoane de puroi

3
4
5
4
3
4
4
4
4
3

REZULTATE I DISCUII
Pentru fiecare lot n parte, dinamica vindecrii vacilor de lapte cu endometrit sunt
urmtoarele:
n ceea ce privete lotul I se observ c n cazul endometritelor cronice tratate cu
PLANTISTIM numrul maxim de administrri n cazul cel mai grav este de 7 i c nici
un caz nu a fost rezolvat cu mai puin de 4 administrri, media de administrri pe tot
lotul fiind de 4,9 iar media necesarului de soluie pe animal este de 187 ml/animal;
n cazul lotului II se observ c utilizarea soluiei de PLANTISTIM + BETADIN, n cazul
cel mai grav sunt necesare 6 administrri iar n cele mai uoare cazuri sunt necesare 3
administrri, media de administrari pe ntreg lotul fiind de 4,1, iar media necesarului
de soluie este de 163 ml/ animal;
n cazul lotului III, la tratatre cruia s-a utilizat PLANTISTIM + ACID BORIC am constatat
c cel mai grav caz a fost vindecat dup 5 administrri iar cazurile cele mai uoare au
avut nevoie de 3 administri pn la vindecare. Media administrrilor pe lot a fost de
3,8 iar cantitatea medie de soluie pe animal tratat a fost de 154 ml;
n ceea ce privete lotul IV la care s-a folosit pentru tratarea endometritelor cronice
PLANTISTIM + BORAX se constat c cel mai grav caz a cedat dup 5 administrri iar
cel mai uor dup 3 administrri, la fel ca i n cazul utilizrii PLANTISTIM + ACID
BORIC. Media necesarului de soluie pe animal este de 157 ml fiind necesare n medie
3,9 administrri pe animal pentru vindecare.

227

Universitatea de tiine Agricole i Medicin Veterinar


100%
90%
80%
70%
60%
50%
40%
30%
20%
10%
0%

Plantistim
Plantistim+B
etadina
Plantistim+A
c.boric
dup 3
administrri

dupa 4
administrri

dup 5
administrri

dup 6
administrri

dup 7
administrri

Plantistim+B
orax

Grafic 1. Dinamica vindecrii vacilor de lapte cu endometrit cronic n cazul administrrii intrauterine a
produselor din gama PLANTISTIM

CONCLUZII
Analiznd rezultatele obinute dup utilizarea produselor din gama PLANTISTIM n tratamentul
endometritelor cronice la vacile de lapte, putem concluziona urmtoarele:
1. Utilizarea acestor produse duce la vindecarea n 100 % din cazuri.
2. Urmrind dinamica vindecrii observm c cele mai multe cazuri se vindec dup 4
administrri (21 cazuri, reprezentnd 52,5 % din total).
3. n nici unul din cele 40 de cazuri nu a fost depit service-periodul optim de 90 zile.
4. Avnd n vedere c media produciei de lapte a efectivului este de 20l/cap, iar media
zilelor de tratament/animal tratat a fost de 8,5, cantitatea de lapte care a fost obinut
pe parcursul tratamentului de la fiecare vac a fost de 170 l. Aceasta ar fi trebuit
depreciat i aruncat, constituind pierdere n cazul tratamentului cu antibiotice, lucru
care nu s-a ntmplat n cazul utilizrii produselor din gama PLANTISTIM.
5. De asemenea n cazul sacrificrilor de necesitate fcute pe parcursul tratamentului,
carnea poate fi dat n consum, neexistnd timp de ateptare.
Utiliznd n tratamentul endometritelor cronice produsele din gama PLANTISTIM se realizeaz
economii importante, acestea fiind produse ecologice, nepolund laptele sau carnea animalelor la
care sunt administrate.
BIBLIOGRAFIE
1.
2.
3.
4.
5.
6.
7.
8.
9.

10.
11.
12.
13.

Bogdan L., 2000, Biotehnici n reproducia animalelor domestice, Ed. Academic Pres, Cluj-Napoca,
Bogdan L., 2001, Reproducie, Obstetric, Terapie i nsmnri artificiale la animale, Ed. Academic Pres,
Cluj-Napoca;
Bogdan L., Groza I., Morar I., Simona Ciupe, Pop A., Petean C., 2004, Cercetri privind controlul
puerperiumului la vac, Simpozion USAMV Timioara, vol. XXXVI, 696;
Boitor I., 1984, purperiumul normal i patologic la animalele de ferm, Ed. Ceres, Bucureti,
Boitor I., Groza I., Muntean M., 1988, ndrumtor de activiti practice la patologia reproduciei i clinic
obstetrical, Ed. Tipo Agronomia, Cluj-Napoca;
Boitor I., Muntean M., 1988, Patologia reproduciei i clinic obstetrical, Curs integrat, Ed. Tipo Agronomia,
Cluj-Napoca;
Bonca G., 1999, Etiopatogenia, terapia endometritelor la vac, Ed. Mirton, Timioara;
Chaffaux M., uterine involution in primiparus cows with retained placenta and post-partum endometritis, Reprod.
Dom. Anim., 34:43-51;
Groza I., Bogdan L., Muntean M., Morar I., Simona Ciupe, Pop A., 1998, profilaxia i combaterea infeciilor
puerperale localizate la vac prin aplicarea suspensiei Nevaginal spray, Al 24-lea simpozion USAMV ClujNapoca, 895;
Groza I., Muntean M., 2002, Elemente de fiziologia reproduciei la animale, Ed. Academic Pres, Cluj-Napoca;
Gustafsson H., Kormmatitsuk B., Koniggson K., Kindahl H., 2004, Peripartum and early post-partum in the cow
phisiology and patology, Proceedings 23rd World Buiatrics Congress, Quebec, Canada;
Lewis G. S., 1997, Health problems at the post-partum cow, uterine health and disorders, J. Diary Sci. 80: 984994;
Velea C., 1999, Producia, reproducia i ameliorarea taurinelor, vol. 1, Ed. Tehnica Agricol Bucureti;

228

Lucrri tiinifice vol. 51 seria Medicin Veterinar

OPTIMIZAREA DIAGNOSTICULUI CLINIC I PARACLINIC LA


VACI CU CETOZ CLINIC
BOGHIAN V.
FMV Iai
For conforming the diagnose of clinic ketosis it was used methods of clinical examination,
paraclinical exams for evaluating the keton bodies in urine, milk and blood, echographic exam,
specific functional test for the liver and hystopathological exam.
The most simple methods used to confirm the diagnose of clinic ketosis is by colorimetric tests
to determine the keton bodies in urine and in milk. And also we can add the determination the
value in serum of betahydroxibutirate. In our case these parameters had very high values. The
average of Kenton bodies in urine is between 80-150 mg/dl, in milk medium values were over 2
mg/dl and bethahydroxibutirate in serum was found with the values between 2782 moli/L (28,6
mg/dl) i 4320 moli/L (44,4 mg/dl).
The echocardigraphic exam showed liver congestion and fat liver, confirmed also by positive
hepatic functional tests (AST=202,48,3 UI/L i ALT=56,84,5 UI/L) and hystopathological exam.
Key words: cow, clinical ketosis, diagnosis

n mod surprinztor, cetoza clinic este mai greu de definit din punct de vedere clinic i
implicit de diagnosticat n comparaie cu cetoza subclinic. Acest fapt este o consecin a
manifestrilor numeroase i necaracteristice care predomin n tabloul clinic. Totui cetoza clinic
poate fi descris ca o tulburare care afecteaz vacile la nceputul perioadei de lactaie. Acestea au
apetitul diminuat, producia de lapte sczut, pierd rapid n greutate i se produce pozitivarea
testelor de evideniere a corpilor cetonici din urin, lapte, snge sau aerul expirat.
Semnele clinice amintite nu sunt att de alarmante nct s impun necesitatea efecturii
imediate a unui examen amnunit, mai ales paraclinic n vederea diagnosticului cetozei. De aceea i
incidena acestei boli este menionat n mod diferit de la un efectiv de vaci la altul.
Din aceste motive ne-am propus optimizarea diagnosticului clinic i paraclinic n cazul cetozei
clinice la vacile pentru lapte.
MATHERIALS AND METHODS
Pentru diagnosticul cetozei clinice s-au utilizat metodele examenului clinic. Ulterior boala era
confirmat la vacile suspecte printr-un examen paraclinic la care se urmrea determinarea corpilor
cetonici din urin, lapte i snge. Aceste determinri pentru confirmarea cetozei clinice s-au efectuat
la 5 vaci din rasa Holstein Friz, folosind stripurile Uric 10 CF, Ketolac BHB i analizatorul biochimic
semiautomat EOS 880 Plus i chit specific pentru -hidroxibutiratul seric.
Ulterior s-a efectuat examenul ecografic, examenul biochimic al sngelui i examenul
histopatologic. n cadrul examenului biochimic al sngelui s-au determinat parametrii profilului
hepatic (aspartataminotransferaza AST, alaninaminotransferaza ALT, fosfataza alcalin ALP i
azotul ureic sanguin BUN). Aceste investigaii s-au folosit ca metode complementare de diagnostic
pentru a aprecia morfostructura i funcia hepatic, modificate n starea de cetoz ca urmare a
suprasolicitrilor metabolice induse de hipoglicemie.
RESULTS AND DISCUSSIONS
Printre semnele clinice care pun problema suspicionrii cetozei sunt refuzul concentratelor i
scderea inexplicabil a secreiei lactate. n efectivele mari de vaci, hrnite la jgheab, nu se poate
verifica n mod corespunztor apetitul ceea ce face ca refuzul concentratelor s treac de cele mai
multe ori neobservat, sau nu i se acord importana cuvenit. Ca urmare cetoza clinic trece
nediagnosticat n acest stadiu. Scderea inexplicabil a secreiei lactate nu trebuie absolutizat, fiind
necesar o analiz complex a acestui fenomen. Randamentul productiv se reduce, se produce
slbire progresiv i apar complicaii ce conduc uneori la moartea animalelor (fig.nr.1).

229

Universitatea de tiine Agricole i Medicin Veterinar

Fig. nr. 1.
Inhibiie cortical profund i slbire

Rezultatele determinrii cetonuriei cetolactiei i -hidroxibutiratului seric la 5 vaci din rasa


Holstein Friz care prezentau semne clinice de cetoz sunt redate n tabelul 1.
Nr crt

Tabelul 1. Valoarea medie a cetonuriei, cetolactiei i -hidroxibutiratului seric


Cetonuria (mg/dl)
Cetolactia (mg/dl)
BHB seric

80 mg/dl

2 mg/dl

28,6 mg/dl (2782 moli/L)

peste 150 mg/dl

2 mg/dl

30,6 mg/dl (2970 moli/L)

peste 150 mg/dl

5 mg/dl

32,4 mg/dl (3145 moli/L)

peste 150 mg/dl

5 mg/dl

37,7 mg/dl (3660 moli/L)

peste 150 mg/dl

10 mg/dl

44,4 mg/dl (4320 moli/L)

La vacile cu cetoz clinic testele colorimetrice pentru cetonurie i cetolactie sunt intens
pozitive; cetonuria a avut valori cuprinse ntre 80 mg/dl i 150 mg/dl, iar cetolactia a avut valori medii
de peste 2 mg/dl. -hidroxibutiratul seric a avut valori cuprinse ntre 2782 moli/L (28,6 mg/dl) i
4320 moli/L (44,4 mg/dl), respectiv de peste 2600 moli/L (26,7 mg/dl), putnd ajunge chiar i la
6000 moli/L (61,8 mg/dl). Efectuarea cel puia a unuia din aceste teste paraclinice permite
confirmarea diagnosticului de cetoz la vacile suspecte.
Cele mai simple procedee de diagnostic al cetozei sunt depistarea mirosului de aceton al
aerului expirat i verificarea corpilor cetonici n urin cu ajutorul stripurilor cu hrtie indicator. n lipsa
unor aparate speciale care s msoare obiectiv cantitatea de corpi cetonici din aerul expirat,
existena lor se apreciaz calitativ folosindu-se simul olfactiv. Pentru aceasta este nevoie de un
personal instruit n acest sens, capabil s fie atent la mirosurile din adposturile vacilor pentru lapte.
n acesate condiii importana metodei este relativ avnd n vedere subiectivismul persoanelor, cu
toate c procedeul este simplu i rapid. Acolo unde nu se fac aceste determinri se raporteaz o
inciden redus a cetozei, vacile cu aceast dismetabolie fiind diagnosticate cu alte boli asociate sau
secundare cetozei.
Examenul histopatologic al ficatului este redat n fig. 2. Se observ hepatosteatoza i congestia
hepatic.

Fig. nr. 2.Hepatosteatoz i congestie hepatic (HEAx100 i PASx200)

Rezultatul unor teste de explorare funcional hepatic la vacile cu cetoz clinic primar sunt
redate n tabelul 2.
230

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Tabelul 2.Teste de explorare funcional a ficatului la vaci cu cetoz clinic primar
Parametru funcional hepatic AST
ALT
ALP
BUN
Uniti de msur
UI/L
UI/L
UI/L
UI/L
Vaci clinic sntoase (n=10) 130,85,2 34,91,4 77,33,4 19,42,2
Vaci cu cetoz clinic
202,48,3 56,84,5 83,96,2 26,82,8

Se constat creterea activitii serice a transaminazelor (AST=202,48,3 UI/L i ALT=56,84,5


UI/L). Creterea activitii serice enzimatice presupune distrugeri ale hepatocitelor i trecerea
enzimelor n circulaia sangvin. Prin epuizarea rezervelor energetice, transporturile
transmembranare active sunt nlocuite cu difuziunea simpl ceea ce contureaz sindromul
fiziopatologic de hepatocitoliz, n care se nregistreaz o activitate seric enzimatic crescut.
Fosfataza alcalin a avut valori medii de 83,96,2 UI/L, iar azotul ureic sangvin de 26,82,8
UI/L. Creterea acestor enzime a fost cu puin peste limita valorilor medii de referin, ceea ce
presupune existena unui asinergism funcional al ficatului, prin neafectarea n egal msur a tuturor
funciilor metabolice hepatice.
EXAMENUL ECOGRAFIC AL FICATULUI ESTE REDAT N FIG. NR. 3. SE OBSERV CONGESTIA
HEPATIC I HEPATOSTEATOZA.

Fig. nr. 3. Hepatosteatoz i congestie hepatic

1.

2.

3.
4.

Concluzii
Semnele clinice care duc la suspiciunea de cetoz sunt apetitul diminuat, producia de lapte
sczut, pierderea rapid n greutate, refuzul concentratelor i scderea inexplicabil a secreiei
lactate.
Diagnosticul de cetoz se confirm atunci cnd are loc pozitivarea testelor de evideniere a
corpilor cetonici din urin, lapte, snge sau aerul expirat. Cetonuria a avut valori cuprinse ntre 80
mg/dl i 150 mg/dl, cetolactia a avut valori medii de peste 2 mg/dl iar -hidroxibutiratul seric a
avut valori cuprinse ntre 2782 moli/L (28,6 mg/dl) i 4320 moli/L (44,4 mg/dl).
n cetoza clinic a avut loc pozitivarea testelor de explorare funcional a ficatului iar examenul
ecografic i examenul histopatologic confirm hepatomegalia i steatoza hepatic.
Examenul histopatologic este util pentru confirmarea diagnosticului de cetoz, ns utilizarea lui
este costisitoare, traumatizant, necesit efectuarea de biopsii i un timp de lucru mai
ndelungat.
BIBLIOGRAFIE

1.
2.
3.
4.
5.

6.

BOGHIAN V., SOLCAN GH., HAGIU N., 2005, Paraclinical and ultrasonographical observation in dairy cow
ketosis, Scientific works, C series, vol.I, p. 530-538, FMV Bucureti.
DUFFIELD T. F., KELTON D. F., LESLIE K. E., LISSEMORE K. D., LUMSDEN J. H., 1997, Use of test day milk
fat and milk protein to detect subclinical ketosis in dairy cattle in Ontario, Can. Vet. J., vol. 38 (11), p. 713-718.
LARK R. M., NIELSEN B. L., MOTTRAM T.T., 1999, A time series model of daily milk yields and its possible
use for detection of a disease (ketosis), Animal Science, vol. 69, p. 573582.
MILLS S. E., D. C. BEITZ, J. W. YOUNG, 1986, Evidence for impaired metabolism in the liver during induced
lactation ketosis of dairy cows, J. Dairy Sci., vol. 69 (2), p. 362370.
OETZEL G. R., 2001, Ketosis and hepatic lipidosis in dairy herds, Preconvention Seminar 8: Dairy herd
problem investigations strategies, American Association of Bovine Practitioners 34 th, Annual Convention,
sept. 1112, Vancouver BC.
SEVINC M., A. BASOGLU, FM. BIRDANE, M. BOYDAK, 2001, Liver Function in Dairy Cows with Fatty Liver,
Revue Md. Vt., vol. 152 (4), p. 297-300.

231

Universitatea de tiine Agricole i Medicin Veterinar

THE BIOCHEMICAL BLOOD PROFILE IN CATS WITH


INFECTIOUS PERITONITIS
BOGHIAN V., REBEGEA Cristina,MOCANU Diana, BLEJUC Alice-Diana,
TOMA Luminia
FMV Iai
lboghian@yahoo.com
The biochemical blood profile in cats diagnosed with feline infectious peritonitis showed the
existence of a syndrome of hepatocytolysis characterized by an increase of the mean values of
serum transaminases (AST=294,24,2 UI/L, ALT=72,23,1 UI/L), while other parameters of the
hepatic profile had mean values situated at the upper limit of mean reference values
(ALP=96,63,0 UI/L, TBIL=0,50,2 mg/dl, BUN=38,52,6 mg/dl).
In addition, an increased tissue catabolism was demonstrated by the high mean values of
plasmatic triglycerides (TGL=243,21,9 mg/dl), a tendency towards metabolic acidosis
(RA=21,00,5 mEq/L) and hemolytic anemia (Fe=244,92,5 g/d having high mean values, in
association to mean values of total bilirubin close to the upper value of the mean values of
reference TBIL=0,50,2 mg/dl).
The hydroelectrolitical equilibrium was unchanged, the ionic profile having mean values
similar to the mean values of reference (Ca=10,60,5 mg/dl, P=5,10,4 mg/dl, Mg=2,50,1 mg/dl,
Cl=113,10,9 mmol/L). We can say the same thing about the renal profile (CRTN=1,60,2 mg/dl)
and the energetic one (GLU=67,61,2 mg/dl, CHOL=146,52,8 mg/dl).
Key words: cats, feline infectious peritonitis, biochemical blood profile

MATHERIALS AND METHODS


The research was made on 15 animals, males and females, of different ages and breeds,
diagnosed with feline infectious peritonitis (FIP). After ultrasonography, peritoneal punction, revealed
the presence of inflammatory fluid and blood samples were collected to establish the biochemical
blood profile. The confirmation of diagnosis was made using virusological isolation (extraction of virus
and RT-PCR) and the putting in evidence of antibodies using indirect immunofluorescence.
For this purpose we used the semi-automatic biochemical analyzer EOS-880 Plus and kits
specific for each parameter. We determined the blood values of : total proteins (TP), aspartate
aminotransferase (AST), alanin aminotransferase (ALT), alkaline phosphatase (ALP), gamma-glutamyl
transferase (GGT), total bilirubin (TBIL) and direct bilirubin (DBIL), blood ureic nitrogen (BUN),
creatinine (CRTN), glycemia (GLU), triglycerides (TGL), total cholesterol (CHOL), alkaline reserve (RA),
calcium (Ca), phosphorus (P), magnesium (Mg), iron (Fe) and chlorine (Cl). These parameters were
grouped for interpretation in four partial profiles: hepatic, renal, ionic and energetic.
The results obtained were processed statistically by calculating the arithmetic mean (x) and
the standard deviation of the arithmetic mean (Sx) as compared to the mean values of reference in
literature.
RESULTS AND DISCUSSIONS
The results of the hepatic and renal profile are presented in table 1.
Table 1 Hepatic and renal profile in cats with infectious peritonitis
Hepatic profile
TP
AST
ALT
ALP
GGT
TBIL DBIL
Measurement units
g/dl
UI/L
UI/L
UI/L
UI/L
mg/dl mg/dl
Mean reference values 5,7-8,0 9,2-39,5 8,3-52,5 12,0-65,1 1,8-12,0 0,1-0,5 6,8
72,2 96,6
Mean values obtained
294,24,2
1,91,1 0,50,2 0,20,1
0,3
3,1
3,0

Renal profile
BUN
CRTN
mg/dl
mg/dl
15,4-31,2 0,5-1,9
38,5
1,60,2
2,6

In cats with infectious peritonitis we obtained mean values higher than those of reference for
AST (294,24,2 UI/L), ALT (72,23,1 UI/L), ALP (96,63,0 UI/L) and BUN (38,52,6 mg/dl). At the same
time, TP (6,80,3 g/dl), DBIL (0,20,1 mg/dl) and CRTN (1,60,2 mg/dl) had values within the limits of
the mean values of reference. On the other hand, GGT (1,91,1 UI/L) had mean values close to the
232

Lucrri tiinifice vol. 51 seria Medicin Veterinar


lower limit of the mean values of reference and TBIL (0,50,2 mg/dl) had mean values close to the
upper limit of the mean values of reference.
These results prove the existence of a syndrome of lysis of hepatic cells, characterized by an
increase of serum transaminases specially ,while other parameters of the hepatic profile have mean
values situated either at the upper limit of the mean values of reference (ALP, TBIL and BUN), or at
the lower limit of the mean values of reference (GGT).
The renal profile proves the integrity of the renal function, the creatinine having mean values
similar to those of reference.
The results of the mineral and energetic profile are shown in table 2.
Table 2 The mineral and energetic profile in cats with infectious peritonitis
Mineral profile
Energetic profile
Ca
P
Mg
Fe
Cl
GLU
CHOL
Units of measurement mg/dl
mg/dl mg/dl g/dl
mmol/L
mg/dl
mg/dl
Mean values of
4,0107,560,871,37,9-10,9
1,9-2,8 110-170
reference
7,3
129,6
124,2
161,2
5,1
113,1
67,6
Mean values obtained 10,60,5
2,50,1 244,92,5
146,52,8
0,4
0,9
1,2

TGL
mg/dl

RA
mEq/L

50-110

243,21,9

21,0
0,5

In cats with infectious peritonitis, Ca (10,60,5 mg/dl), P (5,10,4 mg/dl), Mg (2,50,1 mg/dl),
Cl (113,10,9 mmol/L), GLU (67,61,2 mg/dl) and CHOL (146,52,8 mg/dl) had mean values within
the limits of mean values of reference. At the same time, Fe (244,92,5 g/dl) and TGL (243,21,9
mg/dl) had mean values higher than the upper limit of the values of reference. On the other hand RA
(21,00,5 mEq/L) had mean values situated towards the lower limit of the mean values of reference.
These results suggest that the hydroelectrolitical equilibrium is kept, with a tendency towards
metabolic acidosis.
In addition, the increased mean values of the serum iron associated to the mean values of
total bilirubin close to the upper limit of the mean values of reference, as well as the presence of
direct bilirubin show the beginning of a process of hemolytic anemia.
We also noticed an increased tissue metabolism, showed by the increased mean values of
plasmatic triglycerids.
1.

2.
3.
4.

5.

CONCLUSIONS
In cats with infectious peritonitis, we noticed the existence of a syndrome of hepatic cell lysis
characterized by the increase of the mean values for serum transaminases (AST, ALT), while
other parameters of the hepatic profile have mean values situated at the upper limit of mean
values of reference (ALP, TBIL, BUN).
The renal profile is unchanged in feline infectious peritonitis, the creatinine having mean values
similar to those of reference.
In cats with infectious peritonitis the hydroelectrolytical balance, but with a tendency towards
metabolic acidosis.
The high mean values of serum iron, associated to the mean values of total bilirubin close to the
upper level of the mean values of reference, as well as the presence of direct bilirubin show the
beginning of a process of hemolytic anemia.
Tissue cathabolism is increased in feline infectious peritonitis, showed by the high mean values
of plasmatic triglycerids.
BIBLIOGRAPHY

1.
2.
3.
4.
5.
6.

BOGHIAN V., SOLCAN G., GETA PAVEL, MUSTA M., SAUCIUC R. M., 2006, Clinical, ultrasonographical and
cytologic aspects of peritoneal effusion in feline suspected of infectious peritonitis, USAMV Iai, Lucr. t., vol. 49, p.
237-240.
BOGHIAN V., HAGIU N., HRICU Luminia Diana, Mocanu Diana, 2007, The hemathological profile in cats with
infectious peritonitis, USAMV Iai, Lucr. t., vol 50, p. 275-277.
HORZINEK M., 2001, Unravelling the Secrets of Feline infectious peritonitis-Sotal, World Small Animal Veterinary
Association World Congress Proceedings.
MOGA MNZAT R., 2005, Boli virotice i prionice, Ed. Brumar, Timioara.
PERIANU T., 1997, Boli infecioase ale animalelor, viroze (vol. II), Ed. Fundaiei Chemarea, Iai, p. 150-151.
REBEGEA CRISTINA ELENA, 2007, Cercetri privind bolile autoimmune la cine i pisic, Tez de doctorat, USAMV
Iai.

233

Universitatea de tiine Agricole i Medicin Veterinar

ELECTROCARDIOGRAPHIC CHANGES MADE BY


DIABETES MELLITUS
BRSLAU M.C.1, BRSLAU Daniela Elena1, CIUBOTARU Emilia1
SVULESCU I.M.2, COJMLEA R.2, PREDOI tefania1
1FMV Bucuresti
2Universitatea de Medicina si Farmacie "Carol Davila" Bucuresti
Cardiologie_Veterinara@yahoo.com
Diabetes mellitus is a complex metabolic disorder who can affect disorders at coronary artery
and determine a specific cardiomyopathy.
Two lots were made, first the lot with streptozocin administration (60 mg/kg - 50 Mm
citrate buffer) and the second lot standard lot.
Diabetic animals (n.38) presented an acute course (15 animals) or a chronic course (23 rats).
In the first situation, the rats had died in the first 10 days since diabetes mellitus has been induced
and the animals presented: inappetence, emaciation, deep deviation hyperglycemic coma,
haematuria (one case) and bloody diarrhea (one case). Blood glucose value was 600mg/dl.
The rats with a chronic course initially presented inappetence, then they started to feed
themselves and the body weight started to be almost the same with the standard lot weight.
Blood glucose value was 406,22+24,85 mg/dl.
The rats with a acute course presented electrocardiographic changes: bradycardia, left bundle
branch block, ST segment depression, atrial standstill, first, second and third degree AV block and
ventricular fibrillation.
In diabetic rats with a chronic course the electrocardiographic diagnosis was: left ventricular
enlargement, right ventricular enlargement and ST segment depression. In conclusion, we think
that in rats with acute course the ECGs changes followed diabetic cetoacidosis (blood exams
confirmed), but in rats with chronic course the changes were induced by cardiac and coronary
artery changes (histologic confirmed).

MATERIAL AND METHOD


45 adult Wistar male rats, weighing 200-220gr were used in the experiment.
They were divided in 2 groups:
the control group (n=7)
the group with induced diabetes mellitus by streptozocine administration (n=38)
Diabetes mellitus was induced by one administration of streptozocine, intraperitoneally, in a
dose of 60mg/kg in 50 Mm buffer citrate.
A clinical and paraclinical diagnosis determination of blood sugar with the Accu-Check Go
(Roche) glucometer- of diabetes mellitus was realized.
The blood samples were taken from the coccygeal arteries.
The electrocardiograms were realized on awake and right lateral decubitus animals (manual
setting of the animals).
The EKG parameters were: standard leads; amplitude=1Mv=10mm; 25 and 50mm/sec.
Animal breeding, examination and euthanasia were realized according to the Romanian
legislation of animal protection.
The time-points for the sacrifice were at 14, 30 and 60 days. The euthanasia was realised after
animals anesthesia. Samples from heart, aorta, pancreas and liver were collected for the histological
exam.
RESULTS AND DEBATES
The diabetes mellitus was diagnosed in 38 Wistar white rats after the administration of
streptozocine, which means 60% of the animals receiving a streptozocine administration.
15 rats developed the acute form of Diabetes melitus and 23 the chronic form of Diabetes.

Clinical diagnosis
The clinical syptoms in the acute form of diabetes were represented by anorexia, cahexia,
deep depression hyperglicemic coma, haematuria (1 case) and bloody diarrhea ( 1 case). The rats
died in the first 10 days from the administration of streptozocine. The glycemia level was over
406,22+/-24,85mg/ml.
234

Lucrri tiinifice vol. 51 seria Medicin Veterinar


In the first stages of the chronic form, the symptoms were represented by anorexia and
weakness. Afterwards, the animals begin to eat their meal and the body weigh became comparable
with the control group. The animals were more weakened comparing to the control group which
allowed multiple blood samples and EKG exams in very good conditions.
The blood glucose level was 406,22+/-24,85mg/dl.

Electrocardiographic diagnosis
The electrocardiograms were realized in awake, right lateral decubitus animals by manual
setting.
In the acute form, ECG changes were represented by: bradycadia, left bundle branch block, ST
segment depression, nodal rhythm, first, second and third AV block and ventricular fibrillation (as
terminal arrhythmia) (Figure 1-3)
In the chronic form, ECG changes were left ventricular hypertrophy, right ventricular
hypertrophy and ST segment depression.
We consider that these changes are due:
A. in the acute form, to the diabetic ketoacidosis;
B. in the chronic form, to the changes of the cardiac musculature
The histolological lesions revealed (Figure 5):
strong vasodilatation, dystrophy and necrosis in the case of rats with a fast
evolution
vasodilatation and fibrosis in atrium and myocardium, particularly in the papilar
muscles and interventricular septum

Figure 1 Left bundle branch block, Synusal bradycardia - 130 beats/min

Figure 2 Ventricular fibrillation terminal fase

Figure 3 Second degree AV block. Mobitz II. ST segment supradenivelation

235

Universitatea de tiine Agricole i Medicin Veterinar


Figure 5 The histolological lesions

Myocardium. Arteriole and venule blocked by hematic


thrombi

Partial thrombosis of an arteriole lumen.

Dystrophia and microfocus of miofibrilar necrosis

Degenerative and necrotic areas due to the partial


obstruction (+85%) of arteriole lumen mixt thrombus

Intense fixation area of myofibrilla postinfarct

Section through the aorta. Distrophic and


micronecrotic lesions of endotelial areas

1.

2.

3.

CONCLUSIONS
Diabetes mellitus was induced by streptozocine administration (60mg/kg) intraperitoneally, in an
unique dose. From the total number of male rats, only 60% (38 rats) has developed diabetes
mellitus. 15 rats (39,47%) have had a fast evolution and 23 (60,52%) a chronic form.
The clinical signs in the acute form were: anorexia, fast and advanced weakening, deep
depression (hyperglicemic coma), hematuria, bloody diarrhea and death in the first 10 days from
the administration of streptozocin. The level of glycemia was 600 mg/dl.
The symptoms of the chronic form were initial anorexia and decreased liveliness. The level of
glycemia was 406,22+/-24,85mg/dl.

236

4.

5.

6.

7.

Lucrri tiinifice vol. 51 seria Medicin Veterinar


The EKG changes in the acute form were represented by: bradycardia, left bundle branch block,
ST segment depression, nodal rhythm, first, second and third AV block and ventricular fibrillation
(as terminal arithmia). These changes are the consequence of the diabetic ketoacidosis.
In the chronic form, EKG changes were: left ventricular hypertrophy,
right ventricular
hypertrophy and ST segment depression, which demonstrates myocardial changes, as a
consequence of long term hyperglycemia.
Histologic changes were represented by strong vasodilatation, dystrophy and necrosis in the
case of rats with a fast evolution and vasodilatation and fibrosis in atrium and myocardium,
particularly in the papilar muscles and interventricular septum.
The injuries observed in these experimental studies are similar with the lesions of human
patients (and also in dog), which represents a strong reason to continue the research and to
transpose the results in the field of dogs cardiology.
REFERENCES

1.

2.
3.
4.
5.
6.

Braslasu C.M., Ciobotaru Emilia, Militaru Manuella, Sonea Al., Braslasu Elena Daniela, Dinescu Georgeta,
Diaconescu Al. Il., Soare Teodoru, Stanciulescu Cornelia, 2005 - Corelatia dintre disfunctia endoteliala si
afectarea miocardica la pacientii cu diabet zaharat. Contract cercetare CEEX, 55/2005. Contract VIASAN.
Director de contract. Prof. I. Bruckner.
Cheta D., 2002 - New Insights into experimental diabetes. Editura Academiei Romne, Bucuresti.
Ding Y., Zou R., Judd R.L., Zhong J., 2006 - Effects of gender difference on cardiac myocyte dysfunction in
streptozotocin-induced diabetic rats. Endocrine., 29, 1, 135 - 141.
Kloting I., Vogt L., 1993 - Influence of sex and phenotype of parents on the incidence of diabetes in BB/OK rat
litters. Diabete Metab., 19, (1 Pt 2), 178-182.
Kohn D.F., Clifford C.B., 2002 - Biology and diseases of rats. In: J..G Fox, L.C. Anderson, F.M. Lowe, et al.,
eds. Laboratory Animal Medicine, 2nd ed. New York: Academic Press, 121-167.
Nogueira F.N., Santos M.F., Nicolau J., 2005 - Influence of streptozotocin-induced diabetes on hexokinase
activity of rat salivary glands. J. Physiol. Biochem., 61, 3, 421 - 427.

237

Universitatea de tiine Agricole i Medicin Veterinar

USE OF MEXILETIN AT DOGS WITH VENTRICULAR


ARRYTHMIAS
BRSLAU M.C., BRSLAU M.C., VLGIOIU C., JOIA Silvia, IONESCU S.
FMV Bucureti
Cardiologie_Veterinara@yahoo.com
Mexiletin is an antiarrhythmic from I b class (Vaughan-Williams) indicated in multiple and
multifocal premature ventricular beats and ventricular tachycardia.
A number of 24 dogs from mid and large breed were diagnosed with ventricular arrhythmia:
multifocal premature beats and ventricular tachycardia.
Ventricular tachycardia with a high frequency caused syncope and this case we used first,
lidocaina in dose of 2-4 mg/kg in continue rate infusion; then we used Mexiletin in dose of 5-8
mg/kg p.o. bid-tid to prevent ventricular arrhythmias.
After administration of doses 2-5 mg there weren't stopped the ventricular arrhythmia. High
doses of 8 or 10 mg/kg p.o. bid determined a total disappearance of ventricular arrhytmias.
Biochemical blood exams didn't show an increase of blood values, creatinine and
transaminase levels. There weren't observed decrease either cardiac frequency or blood pressure.
Also a adverse reaction wasn't observed.
In conclusion, Mexiletin administration in dog determined the end of ventricular arrhythmias,
the drug being well tolerate by animal.

Mexiletine is used to supress frequent ventricular ectopy and to reduce the frequency and
duration of abrupt self-limiting ventricular tachycardia.
As their major action, class IB antiarrhythmics decrease the action potential duration and to a
lesser extent the effective refractory period. The drugs especially affect the Purkinje fibers and
myocardial cells in the ventricles. By shortening the effective refractory period, class IB
antiarrhythmics eliminate unidirectional block, which can trigger a reentry arrhythmia. The drugs
also decrease ventricular ectopy by blocking the slow influx of sodium during plateau (phase 2) and
by decreasing the slope of phase 4 depolarization. Class IB antiarrhythmics neither block nor mimic
autonomic control of the heart. (Richard K. Gibson and Douglas R. Geraets, 1996).
Usual dosage: 5 - 8 mg/kg PO BID-TID.
Curative approach of premature ventricular beats/ventricular tachycardia
Internal Medicine Clinic, Faculty of Veterinary Medicine
A. Rare premature ventricular beats: Angiotensin - converting enzyme inhibitors, cardiac glycoside,
Pimobendan, coronarian vasodilators (Trimetazidinum).
B. Multiple premature beats. Syncope absence: Vasodilatator therapy, cardiac glycoside,
Pimobendan, coronary vasodilators. (Trimetazidinum) - Mexiletin p.o
C. Multiple premature beats or Ventricular tachycardia - Syncope: Lidocaina i.v.; Mexiletin p.o.

238

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Patient
1.
5.
6.
7.
10.
11.
12.
13.
14.
18.
19.
20.
23.
24.

Table 1. Clinical cases with Mexiletin administration


Patient: Breed, age, sex
Clinical diagnosis
Schnauzer, male, 9.6 years old
Dilated cardiomyopathy
German shepard, male, 5.6 years old
Myocarditis (?)
Boxer, male, 8.6 years old
Multiple, multifocal ventricular premature
beats
German shepard, male, 6 years old
Tumoral pericarditis
Great dane, female, 10 years old
Pyometra
Boxer, male, 10 years old
Dilated cardiomyopathy
Dog, medium size, male, 10 years old
Cardiac failure, Ventricular tachycardia
Cocker, male, 14 years old
Right ventricular hypertrophyDirophilariosis
Boxer, female, 11.6 years old
Ventricular tachycardia
Vijla, female, 3.6 years old
Congenital ventricular arrhythmia
Russian greyhound, female, 12 years old
Tumoral pericarditis and pleuresia
Schnauzer, male, 9 yeras old
Myocardial infarction
Great dane, male, 5 years old
Dilated cardiomyopathy
Greyhound, mascul, 9 ani
Multiple ventricular premature beats Heart failure. Pleurisy

The conclusions of table 1 are:


ventricular premature beats which required specific therapy were diagnosed in large
breed dogs;
a higher incidence of these ventricular premature beats are recorded in males
(70.9%);
the diseases with ventricular premature beats in their evolution are: dilated
cardiomyipathy (in most of the cases), idiopathic ventricular premature beats and
rarely congenital heart disease, myocardial infarction, dirophilariosis (Heartworm
disease), malignant congenital ventricular premature beats.
Table 2. ECG changes after Mexiletin administration A. - Initial ECG; B - ECG after the adm. of Mexletin
Patient no.
1.
2.
5.
10.
P-T
A.
0,32
0,30
0,28
0,28
interval
B.
0,30
0,30
0,28
0,28
Q-T
A.
0,20
0,20
0,20
0,16
Interval
B.
0,18
0,20
0,20
0,16
Heart rate
A.
150
148,8
166,6
187,5
Beats/min.
B.
100
125
150
136,36
Observations
Bradycardia
Bradycardia
Bradycardia
Bradycardia

Observations regarding Mexiletin therapy in dog


Mexiletin was administered in multiple ventricular premature beats with different origins
(multifocal)
Lidocain i.v. (2-4mg/kg) was used until remission of ventricular premature beats in cases with
diagnosed multiple ventricular premature beats or ventricular tachycardia, with clinical signs of
syncope or heart failure (III Class - ISACHC, 1992)
At low doses of Mexiletin, 3-4mg/kg, no clinical signs were observed (persistence of ventricular
premature beats)
At high doses of Mexiletin (6-8mg/kg), the ventricular premature beats and ventricular
tachycardia disappeared and there was an improvement of clinical status (remission of
pulmonary edema)
Animals receiving Mexiletin were ECG monitored (from 1-2 to 7 days, depending on the
diagnosis and clinical status). Mexiletin doses were decreased when the ventricular premature
beats were remised and the clinical status was improved. In many cases, after using Mexiletin
for 3-4 weeks (together with the therapy for the principal disease), the interruption in Mexiletin
administration wasn't follow by reappearance of ventricular premature beats
239

1.

2.

3.

4.
5.

Universitatea de tiine Agricole i Medicin Veterinar


By monitoring hepatic, renal function and blood glucose, no increase in creatinine, BUN, SGPT,
SGOT were observed. In some cases (Boxer, 10 years, male - Dilatative cardiomyopathy) a
decrease in the value of these parameters was observed (creatinine decreased from 1mg/dl to
0.85mg/dl; BUN decreased from 59,15mg/dl to 40.8mg/dl).
Except one case, in which during Mexiletin therapy a sinusal bradicardia was diagnosed
(Mexiletin administration was interrupted), no other adverse reactions were observed.
It can be inferred from the table 2 that there are no significant modifications of the period of
heart activity determined by Mexiletine, which causes in most of the cases the decrease of heart
frequency. Bradycardia is noticed during the increase of general diastole (TP segment).
CONCLUSIONS
Mexiletin is an IB class anti-arrhythmic used in the treatment of ventricular arrhythmia
(ventricular premature beats and ventricular tachycardia). The dosage in dog is 5-8mg/kg BIDTID.
After the administration of low doses of Mexiletin there was no improvement of ventricular
premature beats, on the contrary, high doses (6-8mg/kg) determined the remission of ventricular
premature beats/ventricular tachycardia.
No adverse reactions were observed during Mexiletin administration. The creatinine, BUN and
glycemia were in normal limits when the biochemical blood exam was performed. In the
situations when these parameters were improved, the explanation was due to the decrease of
hemostasis, consecutive to the ventricular arrhythmia.
No significant changes in the length of ventricular and general electric systole were observed on
the ECG; instead, a decrease of heart frequency has been shown.
The examination of cases in which Mexiletin was administered has shown: most of the clinical
cases were large size males (70,90%). Ventricular arrhythmia were diagnosed in most of
the
cases in dilated cardiomyopathy; other cases were represented by myocardial infarction,
congenital ventricular arrhythmia, congenital heart disease, etc. Mexiletin can be called, because
of its rapid clinical effects and its low adverse reactions, the oral Lidocaine, which can be given
PO.
BIBLIOGRAPHY

1.

2.

3.

4.
5.
6.

7.
8.
9.

Bonaduce D., Ferrara N., Abete P., Longobardi G., Leosco D., Canonico V., Morgano G., Rengo F., 1986 Effect of mexiletine on reperfusion-induced ventricular arrhythmias: comparison with lidocaine. Arch. Int.
Pharmacodyn. Ther., 284, 1, 19 - 29.
Brslau M.C., E.D. Brslau, C. Brdan, E.F. Balint, M. Budai, 2007 Use of Mexiletine in dogs with
th
ventricular arrhythmias. The European College of Veterinary Internal Medicine Companion Animals. 17
th
th
th
ECVIM-CA Congress & 9 ESVCP Congress. 13 15 September 2007 Budapest Hungary. P. 228.
Chinushi M., Tagawa M., Sugiura H., Komura S., Hosaka Y., Washizuka T., Aizawa Y., 2003 - Ventricular
tachyarrhythmias in a canine model of LQT3: arrhythmogenic effects of sympathetic activity and therapeutic
effects of mexiletine. Circ. J., 67, 3, 263 - 268.
Crivineanu Maria, Elena Daniela Brslau, M.C. Brslau, 2004 Treatment of ventricular tachycardia in
dogs. Buletinul USAMV-CN, 61/2004, 267.
Duff H.J., 1989 - Mexiletine-quinidine combination: enhanced antiarrhythmic and electrophysiologic activity in
the dog. J. Pharmacol. Exp. Ther., 249, 2, 617 - 622.
Meurs K.M., Spier A.W., Wright N.A., Atkins C.E., DeFrancesco T.C., Gordon S.G., Hamlin R.L., Keene B.W.,
Miller M.W., Moise N.S., 2002 - Comparison of the effects of four antiarrhythmic treatments for familial
ventricular arrhythmias in Boxer. JAVMA, 221, 4, 522 - 527.
Takahara A., Sugiyama A., Satoh Y., Hashimoto K., 2003 - Effects of mexiletine on the canine model of
sparfloxacin-induced long QT syndrome. Eur. J. Pharmacol., 22, 476, 1-2, 115 - 122.
Tilley L.P., Goodwin J.K., 2001 - Manual of Canine and Feline Cardiology. Third ed. Saunders. An Imprint of
Elsevier Science.
Yoshida H., Sugiyama A., Satoh Y., Ishida Y., Kugiyama K., Hashimoto K., 2002 - Effects of disopyramide and
mexiletine on the terminal repolarization process of the in situ heart assessed using the halothaneanesthetized in vivo canine model. Circ. J., 66, 9, 857 - 862.

240

Lucrri tiinifice vol. 51 seria Medicin Veterinar

OBSERVAII CLINICE I TERAPEUTICE PRIVIND EVOLUIA


UNUI ULCER CORNEEAN LA PISIC STUDIU DE CAZ
CLINICAL AND THERAPEUTICAL OBSERVATIONS REGARDING
THE EVOLUTION OF A CATS CORNEAL ULCER CASE REPORT
BURCOVEANU Ioana Ruxandra, BURTAN I.
FMV Iai
The evolution as well as the treatment of a corneal ulcer, secondary to a traumatic injury (cat
scratch), are detalied in the present paper.
The diagnosis was made after a thorough examination of the globe and adnexa.The
treatment aimed to avoid the septical endophthalmic complications and to stimulate corneal
regeneration. Antibiotics and local trophic substances have been applied during a two-week
period.
The evolution was favorable. The cornea regained its transparency, but an anterior synechiea
appeared at the innitial trauma site, corresponding to focal opacities on the surface of the cornea.

Plgile corneene nregistreaz frecven crescut, n special datorit conflictului dintre indivizi
i accidentelor rutiere. Pot fi localizate pe toat suprafaa corneei, manifestndu-se prin epifor,
fotofobie i blefarospasm (2). n cazul celor penetrante se observ scurgerea umorii apoase, iar
oftalmotonusul scade.
Soluiile de continuitate nepenetrante se pot finaliza prin procese cicatriceale neectatice,
uneori complicndu-se cu ulcer corneean (3). Mecanismele cicatrizrii corneei trebuie avute n vedere
cnd avem de-a face cu un ulcer corneean. Astfel, n cazul unei ulceraii superficiale, celulele bazale
ale epiteliului anterior, situate n apropierea leziunii, se vor aplatiza i vor acoperi zona respectiv.
Apoi, celulele se vor multiplica pentru a reface grosimea normal a epiteliului. n cazul ulceraiilor mai
profunde, cavitatea format este acoperit cu fibrin. Resturile celulare sunt digerate mai nti de
polimorfonuclearele din secreia lacrimal i apoi de cele din esutul propriu corneean; keratocitele
vor secreta fibrilele de colagen care vor reconstitui corneea. Dac ulcerul se complic bacterian,
procesul de reparare va fi ncetinit. n cazul afectrii esutului propriu corneean n totalitate, n
cavitatea ulcerului apare membrana Descmet, leziunea purtnd numele de descemetocel (4, 5).
Principiile tratamentului ulcerului corneean sunt suprimarea durerii, limitarea infeciei,
favorizarea cicatrizrii i evitarea neovascularizaiei n exces. n caz de nereuit, se poate apela la
tratamentul chirurgical (1, 4).
Prezenta lucrare detaliaz evoluia leziunii corneene i medicaia utilizat n acest scop.
MATERIAL I METOD
n cadrul Clinicii de Chirurgie a Facultii de Medicin Veterinar Iai a fost prezentat la
consultaie un cotoi de ras European, n vrst de 1 an i 7 luni.
Motivele consultaiei le-au constituit blefarospasmul drept, nsoit de o secreie ocular de
consisten seroas, care apruser n urm cu cteva zile. Din anamneza amnunit, s-a tras
concluzia c pisoiul suferise un traumatism ocular (o zgrietur cu gheara provocat de alt pisic).
La examenul ochiului din deprtare, pisoiul prezenta blefarospasm, fotofobie i epifor.
Leziunea evoluase n timp, astfel nct, n momentul prezentrii la consultaie, prin fanta palpebral
ntredeschis, se putea observa o formaiune de culoare roie, preominent la suprafaa corneean
(fig. 1).

241

Universitatea de tiine Agricole i Medicin Veterinar

Fig. 1 Aspectul la prima consultaie

La examenul globului ocular din apropiere s-a observat chemosis pronunat, mai ales al
pleoapei a treia, conjunctiva hiperemiat, edem corneean, vase de neoformaie.
Formaiunea corneean, rotund, bine vascularizat era situat n unghiul lateral al corneei i
delimita o excavaie central n grosimea acesteia (fig. 2, 3).

Edem conjunctival i corneean


Fig. 3 detaliu

Fig. 2 - ansamblu

Vasele de neoformaie, lungi i arborizate, aveau aspectul caracteristic al vaselor ce nsoesc


leziunile superficiale corneene. Ele porneau de la nivel scleral (fiind, de fapt, continuarea arterelor
episclerale i conjunctivale), pe toat circumferina ochiului, ajungnd pn la marginea leziunii (fig.
4).

Fig. 4 Faza de vascularizaie prin


invadarea de neovase din conjunctiv

Reflexul palpebral era prezent, dar cel pupilar i rspunsul la ameninare nu au putut fi
evaluate datorit edemului corneean.
Diagnosticul stabilit n urma examenului clinic a fost cel de ulcer corneean superficial,
secundar unui traumatism corneean.
Tratamentul instituit a urmrit tratarea infeciei i favorizarea cicatrizrii.
242

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n acest scop s-a administrarea o soluie oftalmic pe baz de cloramfenicol, aplicat local, prin
instilaii de 3 ori pe zi, timp de dou sptmni, fiind activ att asupra bacteriilor Gram negative, ct
i a celor pozitive. S-a hotrt ca, pe timpul nopii, s se aplice un unguent cu kanamicin. Unguentul
ales nu conine hidrocortizon, substanele antiinflamatoare fiind contraindicate n cazul ulcerelor
corneene, indiferent de dimensiunile acestora.
Cicatrizarea epiteliului corneean a fost stimulat prin aplicarea local a unui gel oftalmic de uz
uman. Acesta conine o substan trofic local dexpantenol, ce favorizeaz refacerea epiteliului
corneei. Gelul a fost aplicat o dat pe zi, la interval de dou zile, fiind necesare trei aplicri.
REZULTATE I DISCUII
Utilizarea antibioticelor este indispensabil n toate cazurile de ulceraii corneene, deoarece
lipsa epiteliului ofer posibiliti de dezvoltare a unei infecii oculare. Antibioticele au fost alese
pentru spectrul larg de aciune. Avantajele colirului lichid sunt: uurina aplicrii, controlul dozajului,
permiterea oxigenrii corneei, dar timpul de contact cu suprafaa corneean este scurt, substana
activ fiind rapid eliberat. Unguentul are un timp de contact prelungit cu suprafaa corneean,
eliberarea principiului activ fcndu-se pe o perioad mai mare de timp. Inconvenientele ar fi
aplicarea mai dificil i lipsa dozrii certe la fiecare utilizare.
Dup prima sptmn de tratament, chemosisul i blefarospasmul au disprut, la fel ca
hiperemia conjunctivei i secreia ocular (fig. 5).

Fig. 5 Aspectul ochiului dup prima sptmn


de tratament

Reflexele fotomotorii, directe i indirecte, precum i rspunsul la ameninare, prin care se


evalueaz funcia vizual, erau pozitive.
La examenul globului ocular din apropiere, s-a putut observa clarificarea corneei, infiltraia
rmnnd localizat doar la nivelul leziunii unde se evideniau vasele de neoformaie, care confluau
n centrul fostei formaiuni corneene (fig. 6, 7).

Fig. 6, 7 Faza de vascularizaie- detaliu

Odat cu recptarea transparenei de ctre cornee, s-au evaluat clinic irisul, pupila i aspectul
camerei anterioare. Lipsa depozitelor i a lichidelor patologice n camera anterioar, precum i
243

Universitatea de tiine Agricole i Medicin Veterinar


nemodificarea formei pupilei confirm faptul c traumatismul nu a suferit complicaii endoftalmice
septice.
Tratamentul local cu antibiotic a fost continuat nc o sptmn.
La a treia consultaie, pisoiul inea amndoi ochii deschii, pupilele fiind egale la verificarea
reflexului fotomotor (reflex rapid, complet, stabil). Corneea i-a recptat transparena n totalitate
(fig. 8).

Fig. 8 Dispariia secreiei oculare, redresarea


fantei palpebrale, nceputul fazei de resorbie

Prin transparena corneei se observ la unghiul temporal al ochiului, o zon de dimensiuni


reduse pe locul leziunii primare, cu centrul de culoare albicioas, fibre din periferia irisului fiind lipite
de epiteliul posterior al corneei. Aceast leziune, denumit leucom aderent sau sinechie anterioar,
reprezint cicatrizarea prin aderarea irisului, consecutiv fenomenului inflamator profund (fig. 9).

Fig. 9 Recptarea transparenei i formarea


cicatricelor extern (leucom) i intern (sinechie anterioar)

1.
2.
3.

CONCLUZII
Evoluia traumelor nepenetrante ale corneei invit la o analiz atent a posibilitilor de
intervenie medicamentoas pentru a preveni complicaia cu ulcer corneean.
n terapia ulcerului corneean evolutiv, medicaia trebuie s fie drastic prin accelerarea
cicatrizrii corneei i combaterea complicaiei septice endoftalmice.
Colirul, cu substana activ cloramfenicolul, combate complicaia septic a ulcerului grbind faza
de resorbie, iar gelul oftalmic, prin efectul su trofic, stimuleaz refacerea epiteliului corneean.
BIBLIOGRAFIE

Bouhanna L., 2005 Vademecum dophtalmologie vtrinaire; 2e dition, Ed. MedCom, France;
Dan E., 2004 Traumatismes de loeil chez le chien et le chat, EMC-Vtrinaire, 1, 199-229;
Laforge H., 1993 Diagnostic et traitement des ulcres cornens, Waltham International Focus, 3: 2-8;
Laforge H., 1997 Les ulcres de corne, Pratique Mdicale et Chirurgicale de lAnimal de Compagnie, no. 32
(supplment), 113-127;
5. Moore P. A., 2005 Feline Corneal Disease, Clinical Techniques in Small Animal Practice, 20, 83-93
1.
2.
3.
4.

244

Lucrri tiinifice vol. 51 seria Medicin Veterinar

ETIOPATOGENIA I SIMPTOMATOLOGIA
HERNIEI PERINEALE LA C]INE
ETIOPATHOGENESIS AND CLINICAL SIGNS OF PERINEAL HERNIA AT DOG
BURTAN L.C., BURTAN I. , F]NT]NARU M., CIOBANU S., TOPAL Roxana
FMV Iai
This paper presents the results of etiopathogenetic and clinical studies of perineal hernia at
dogs. The researche, conducted on 39 dogs, revealed that perineal hernia occurs on adults of
giant breed as Doberman, Rottweiler, German sheperd, Boxer, mentained in apartment without
regular system of physical activity.
The disorder is characterized by unilateral (69%) or bilateral (31%) paraanal swelling, variable
as size, in succesion of pelvic diaphragmatic unwind, that favours epiploon, urinary bladder ,
prostatic or rectal hernias. Rectum can be deviated or dilated (rectal diverticulum, rectal sacula).
Depending of the herniated organs, the affected animal was presented to treatment because of
constipation, anuria, tenesmus, rectal prolapse and perineal sweling.

Hernia perineal la canine nregistreaz frecven crescut (2,4,5,7,8), afectnd masculii n


vrst i cu regim redus de micare (1, 2, 8). Afeciunea const n deplasarea subcutanat perineal a
unor organe din cavitatea pelvin, datorit deirrii diafragmei pelvine (3). Migrarea viscerelor la
acest nivel determin tulburri ale defecrii i miciunii, crend disconfort animalului (4,8).
n lucrare sunt prezentate cauzele afeciunii, aspectele clinice i modificrile suferite de
organele deplasate.
MATERIAL SI METOD
Lucrarea a fost efectuat n perioada 2003-2007 lund n studiu 39 de cini cu hernie perineal
prezentai la Clinica Chirurgical a Facultii de Medicin Veterinar Iai i Cabinete veterinare din
Municipiul Iai. Prezentarea a fost impus de apariia unei deformri paraanale, de dimensiuni
variabile, asociat cu greutate la defecare, frecvente tenesme, uneori anurie. Animalele au fost
supuse investigaiilor clinice i paraclinice pentru a stabili natura deformrii i cauzele tenesmelor. De
asemenea, au fost stabilite condiiile de ntreinere privind habitatul i programul de micare.
REZULTATE I DISCUII
Investigaiile epidemiologice au evideniat faptul c animalele prezentate erau de sex mascul,
avnd vrsta cuprins ntre 6 i 15 ani i aparineau raselor de talie mare Doberman, Rottweiler, Dog
german i Boxer, la care se adaug rasa Pechinez. Relevm faptul c animalele erau ntreinute n
apartament, fiind supuse unei viei sedentare, fr un program de micare i alimentate cu hran
uscat granulat.
Clinic s-a constatat prezena deformrii paraanale, de dimensiuni variabile, situat unilateral
(69%) sau bilateral (31%), tabelul 1. Uneori, cele dou deformri conflueaz subanal, lund o form
globuloas cu diametrul de 10-12cm nfundat de prezena orificiului anal, cu marginile edemaiate i
congestionate. Animalul st cifozat i prezint frecvente tenesme nsoite de eliminarea de cantiti
mici de fecale sau picturi de urin, n raport cu organul herniat.
Palpaia transrectal a deformrii evideniaz consistena pstoas sau crescut a
coninutului. n cazul consistenei pstoase, ridicarea animalului de membrele pelvine sub unghi de
450-550 i compresiunea moderat a deformrii determin dispariia acesteia, pielea rmne flasc,
iar n centru prezint o depresiune ce corespunde canalului herniar prin care s-au angajat organele
pelvine. Acest aspect a fost ntlnit la 18% din cazuri, fiind considerat o hernie simpl, reponibil,
datorit angajrii epiplonului i absenei aderenelor.
n cele mai frecvente cazuri (82%) deformarea este ireponibil la taxis, datorit aderenelor
sau volumului deformrii. Aspectul clinic este consecina apariiei asociate herniei, respectiv leziuni
rectale(51%), hipertrofia prostatei (25%), sau retroflexia vezicii urinare (16%) aa cum rezult din
tabelul 1.

245

Universitatea de tiine Agricole i Medicin Veterinar


Tabelul 1. Structura herniei perineale la cine
Cazuri
Tipul herniei
Nr.
I. Simpl
7
II. Cu leziuni asociate, din care:
32
1.rectale
- deviaia rectului
11
19
- diverticul rectal
5
- sacula rectal
3
2.hipertrofia prostatei
8
3.retroflexia vezicii urinare
5
III. Localizare
unilateral
27
bilateral
12
Total
39

%
18
82
59
25
16
69
31
100

Hernia perineal, asociat cu leziuni rectale, se manifest prin apariia unei tumefacii
unilaterale, bine circumscris, cu tendina de a urca paracoccigian; animalul prezintconstipaie i
tenesme ce duc la prolaps rectal. Mucoasa prolabat este congestionat, edemaiat i acoperit cu
mucus uor sangvinolent. Tumefacia este moale la palpare, uneori consistena este crescut din
cauza deshidratrii coninutului rectal, iar prin taxis moderat se reduce. Dar, tenesmele i sprijinul
ischio-pubien, adoptat frecvent de canine, determin recidiva.
Tueul ano-rectal evideniaz prezena unei cantiti mari de fecale acumulate paraanal
corespunztor deformrii. Uneori, tueul se execut cu dificultate, nu numai edemaierii anale ci
existenei unei stricturi cauzate de afeciuni ale complexului glandular anal (2,6,9). Aceasta reducere
a lumenului anal, consistena crescut a fecalelor datorit unei deficitare planificri a scoaterii
animalului pentru defecare, contribuie la suprancrcarea rectului care poate devia, sau elasticitatea
peretelui poate ceda.
Evacuarea coninutului prin clisme repetate i tueu rectal permite palparea lumenului
rectului i stabilirea cauzelor care au generat hernia perineal. Datele din tabelul 1 evideniaz faptul
c la acest nivel putem ntlni deviaia rectului, diverticul rectal i sacul rectal, confirmnd
observaiile efectuate de ali autori (2,4).
Deviaia rectului, denumit i inflexiune sigmoid rectal reprezint modificarea traiectului
rectului, fr a influena diametrul acestuia. La tueul ano-rectal se palpeaz devierea ntregului canal
rectal spre partea deformrii, dei carnivorele prezint ampula rectal mai voluminoas (3).
Acumularea de coninut la acest nivel duce la alungirea poriunii retroperitoneale a rectului care,
deviind lateral formeaz un adevrat depozit la acest nivel si schimb traiectul rectiliniu al organului.
Diverticulul rectal se caracterizeaz prin formarea unui sac lateral rectului, datorit slbirii
musculaturii rectale i hernierea mucoasei prin aceast bre. Iniial brea este mic, dar depozitarea
coninutului rectal n aceast pung mucoas determin mrirea breei consecutiv lipsei evacurii.
Tueul ano-rectal evideniaz prezena unei pungi mucoase lateral rectului. n acest caz deformarea
apare unilateral.
n sacula rectal tot peretele rectului retroperitoneal are tonus sczut nct, acumularea de
coninut paralel cu lipsa posibilitii de defecare, duce la destinderea peretelui muscular pe ntreaga
circumferin antrennd i mucoasa formnd astfel o ampul rectal ntins. Coninutul acumulat se
ntrete, provoac tenesme dar strmtarea orificiului anal mpiedic evacuarea. Aa se formeaz un
depozit care determin deformarea bilateral a regiunii perianale, n special subanal. Tueul anorectal pune n eviden aceast pung rectal lipsit de tonus i plin cu coninut.
Hernia perianeal asociat cu retroflexia vezicii urinare apare ca o tumefacie paraanal
unilateral, cu aspect globulos i consisten crescut. Schimbarea poziiei animalului prin ridicarea
membrelor pelvine i compresiunea digital a deformrii evideniaz ireductibilitatea herniei.
Animalul prezint tenesme, cu evacuarea unor cantiti mici de fecale, dar cu anurie. La tueul anorectal se constat reducerea lumenului canalului ano-rectal datorit compresiunii exercitate de
deformare. Cateterismul vezical este negativ ntruct cateterul nu avanseaz complet pe traiectul
uretrei. Starea general a animalului se nrutete treptat (abatare, hipotermie, prolapsul
membranei nictitante, vom) datorit instalrii sindromului uremic.
246

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Asocierea herniei perineale cu hipertrofia prostatei se manifest prin apariia unilateral a unei
deformri globuloase, cu consisten crescut i ireponibil datorit aderenelor. Animalul suport
hernia, dar prezena prostatei hipertrofiate n zona retroperitoneal a cavitii pelvine tulbur
defecarea. n acelai timp, prezena prostatei la acest nivel modific traiectul uretrei, crend
dificulti n evacuarea urinei.
Din cele prezentate se confirm faptul c hernia perineal este consecina deirrii diafragmei
pelvine i angajarea unor organe retroperitoneal (epiploon, prostat, vezic urinar) sau apariia de
modificri n forma i poziia ultimei poriuni a rectului. Tonusul sczut al diafragmei pelvine la
animalele n vrst i slaba prezen a esutului adipos n canalul pelvin, favorizeaz apariia herniei
perineale. De asemenea, viaa sedentar prin ntreinerea n apartament, distana ntre orele de
plimbare, act ce se poate rezuma uneori numai la cteva minute necesare unor acte fiziologice,
favorizeaz suprancrcarea colonului descendent, rectului i vezicii urinare. Singurtatea face ca
animalul s atepte sosirea stpnului adoptnd poziia cu sprijin ischio-pubien. Aceast atitudine
face ca rectul i vezica suprancrcate, sau prostata hipertrofiat s cad n conductul pelvin i s
exercite compresiuni asupra diafragmei pelvine.
Prezena unor leziuni la complexul glandular perianal, sau a constriciei sfincterului anal
favorizeaz retenia fecalelor care preseaz asupra pereilor rectului aprnd devieri ale traiectului
sau cedri ale peretelui muscular. Acumularea este favorizat i de prezena unei constipaii cronice
sau de introducerea n alimentaie a oaselor de pasre care pot traumatiza conductul ano-rectal.
Spre deosebire de alte specii, la cine vezica urinar este situat n cavitatea abdominal,
prezentnd un col vezical lung care ncepe de la pubis i strbate canalul pelvin. Sprijinul ischiopubien prelungit favorizeaz retroflexia vezicii spre stnga sau dreapta, cu alungirea ligamentelor
lateral sau median. Polul anterior al vezicii exercit presiuni asupra diafragmei pelvine care, cednd,
permite angajarea acesteia n canalul pelvin i apariia retroperitoneal. ntruct miciunea nu se
execut, iar diureza continu ndoirea gtului vezicii duce la retenie urinar i mpingerea polului
anterior al acesteia subcutanat paraanal. De asemenea, gtul lung al vezicii urinare continuat cu o
uretr acoperit pe 2/3 de prostat, favorizeaz cderea prostatei hipertrofiate n conductul pelvin i
deirarea diafragmei pelvine.
Modificrile topografice ale rectului i vezicii urinare nu se ntlnesc la cea ntruct, n
conductul pelvin apare i vaginul care completeaz golurile mpiedicnd angajarea altor organe i
compresarea diafragmei pelvine.
1.

2.
3.
4.

CONCLUZII
Hernia perineal se ntlnete la cinii aduli, apariia fiind favorizat de viaa sedentar, distana
mare dintre orele de plimbare ducnd la ncrcarea rectului i vezicii urinare, la care se adaug
sprijinul ischio-pubien prelungit.
Apariia herniei este consecina deirrii diafragmei pelvine, permind angajarea epiploonului,
rectului modificat, prostatei hipertrofiate sau vezicii urinare retroflexate.
Clinic se manifest printr-o deformare paraanal unilateral (69%) sau bilateral (31%).
Modificrile rectale sunt reprezentate de deviaia rectal, diverticulul rectal i sacula rectal.
BIBLIOGRAFIE

1.
2.
3.
4.
5.
6.
7.
8.
9.

BOJRAB M.J., BIRCHARD, S.J. TOMLINSON J.L., 1990 Current techniques in small animal surgery, Lea and
Febiger, Philadelphia-London, 442-449
BURTAN I., MOROANU N., FNTNARU M., CIOBANU S., 1994 Etiopatogenia i diagnosticul herniei
perineale la cine, Lucr. t. U.A.M.V. Iai, vol.37, 68
COOFAN, V., PREDOI, G., 2003 Anatomia topografic a animalelor domestice. Ed. BIC ALL Bucureti
ETTINGER, S.J., 1989 - Text book of Veterinary Internal Medicine, vol. II, W. B. Saunders Co., Philadelphia,
1316-1322
DUPRE G., BOUVY B., PRAT N., 1993 Nature et traitement des lesions associes aux hernies prinales.
Pratique Md. Chir. Anim. Comp., 28, 333-334
KRAHWINKEL D.J.Jr, 1983 Rectal diseases and their role in perineal hernia, Vet. Surg., 12, 160-165
MATE N., 2004 Patologia chirurgical a animalelor domestice, Ed. Medical Universitar Iuliu Haeganu ,
Cluj Napoca
STANCU D, 1984 - Clinic i terapeutic chirurgical la animale, Ed. Ceres, Bucureti
WHITE RAS and GORMAN N.T., 1987 Clinical diadnosis and management of rectal and pararectal tumors in
the dog, J. Small Anim. Pract., 28, 87-107

247

Universitatea de tiine Agricole i Medicin Veterinar

OBSERVAII PRIVIND IMPLICAREA ENDOMERTITELOR N


DESFURAREA PROCESELOR DE REPRODUCIE LA VACI
CONSIDERATIONS CONCERNING THE INVOLVEMENT
OF THE ENDOMETRITIS N THE DEVELOPEPEMENT
OF REPRODUCTIVE PROCESSES N COWS
CANTEMIR M.
DSVSA Iai
The puerperium represents one of the most important stages of the sexual cycle in cows.
In this period there must be followed some aspects concerning:
a. the elimination of the liquids and placentar remains, the restart of the ovarian activity and
the existent microflora from the puerperal uterus;
b. the uterin involution in order to the restart of the genital functions and the fiziologic
reorganization in view of a new gestation (BADINAND, E., 1981, BARKMO, H.; 1994, BOGDAN, AL.
i col., 1984, BOITOR,I., 1984);
c. the restart of the ovarian activities concerning the evolution of the ovarian folicles to the
ovulatory stage. Some authors sustain that the examination method of the femele gonads is very
important and they appreciate the evolution from the folicle to the installation of the corpus lutei
(CERNESCU, H., 1995, RUGINOSU ELENA, 1998, CONSTANTINESCU, M., 1999, FEREDEANT, T.,
1984, GEORGESCU, G., 1993, GLUHOVSCHI, N., 1983, GROZA,I., 1985, GRUNERT,E., 1978,
RUNCEANU,L., 1989, 2001, 2002, DRUGOCIU, D., 2001);
d. the microflora of the puerperal uterus represents an important element in the prophilaxy
of the post-partum genital infections, aspect highlighted in several publications (CARP- CRARE,
M., 1998, GRECEANU. AL., 1986, GRUNERT, E., 1978, PARAIPAN, V., 1982, THBAULT, C.H., 1991).
Multiple researches testify that the puerperal period is the starting point of the evolution to a
normal sexual cycle, or contrariwise, to a pathological evolution (BROIU, A. 2002, SEICIU, FL.,
2002).

MATERIAL I METOD DE LUCRU


Cercetrile au fost efectuate n cadrul unei ferme de cretere a vacilor pentru lapte, pe un
numr de 1840 animal urmrindu-se prin examen ginecologic:
numrul mediu de nsmnri sau monte pentru obinerea unei gestaii la vacile cu
afeciuni inflamatorii uterine;
stabilirea factorilor prioritari care duc la apariia strilor patologice ale reproduciei ;
stabilirea frecvenei afeciunilor ginecologice i obstetricale, diagnosticarea i
eficiena folosirii unor formule terapeutice n afeciunile inflamatorii uterine;
intervalul mediu ntre ftri ( CALVNG INTERVAL) la vacile cu afeciuni inflamatorii
uterine;
intervalul de timp pentru redarea n circuitul reproductiv a vacilor cu afeciuni
inflamatorii uterine;
Din punct de vedere clinic, femele au fost grupate n urmtoarele categorii:
a) anestru sau sindromul lipsei cldurilor care n cazuri patologice ne indic fie
infantilism genital, hipoplazie ovarien uni sau bilateral, hipotrofie ovarien, corp
luteal persistent, distrofii chistice i polichistice ovariene i afrodizie funcional;
b) sindromul repetrii cldurilor care se manifest prin scurtarea intervalelor normale
dintre clduri sau a prelungirii estrului sunt de cele mai multe ori anovulatorii, de
unde i denumirea de clduri false ;
c)
sindromul cldurilor linitite care este un sindrom de sine stttor dar poate evolua i
ca intermediar nspre anestru;
d) afeciuni inflamatorii ale salpinxului, uterului, cervixului i vulvo-vestibulo-vaginale.

248

Lucrri tiinifice vol. 51 seria Medicin Veterinar


REZULTATE I DISCUII
S-a urmrit i dinamica parturiiilor lunare a vacilor i junincilor sntoase i a celor cu
afeciuni ginecologice i obstetricale n perioada 2003 2007 aa cum sunt evideniate n tabelele 1 i
2.
Tabel nr. 1 Dinamica parturiiilor i afeciunilor ginecologice i obstetricale pe perioada anilor 2003 - 2007
Media
Matc
Parturiii
Procentul de natalitate
Numrul afeciunilor
%
anilor luai n studiu
2003-2007
1790
1576
88%
215
0,16
Tabel nr. 2 Dinamica parturiiilor i a afeciunilor ginecologice i obstetricale pe luni n perioada 2003 2007
Luna Media anilor luai n studiu
Parturiii %
Afeciuni
%
ginecologice
1.
143
8,8
21
0,14
2.
253
16
19
0,07
3.
351
22
39
0,11
4.
349
22
39
0,11
5.
142
9
35
0,24
6.
47
3
11
0,23
7.
23
1,3
6
0,26
8.
27
1,8
4
0,14
9.
36
2,2
5
0,13
10.
44
2,7
4
0,09
11.
68
4,3
15
0,22
12.
90
5,6
17
0,18
Total 1550
88,2 215
0,16

Analiznd datele din tabelul nr. 2 observm c cel mai mare numr de parturiii se
nregistreaz n primele cinci luni ale anului.
Din cercetrile noastre efectuate pe parcursul anilor 2003 2007 pe efectivul matc, frecvena
cea mai mare de afeciuni ginecologice i obstetricale s-a nregistrat conform datelor din tabelul nr. 3.
Media
anilor
luai n
studiu
2003 2007

Retenia
anexelor
fetale

Endometrit
cataral
puerperal

Tabelul nr. 3
Endometrit
Endometrit
purulent
cataral
puerperal
cronic

Nr.
42

Nr.
23

Nr.
15

%
2,35

%
1,26

%
0,82

Nr.
21

%
1,17

Piometru

Total

Nr.
2

Nr.
104

%
0,10

%
6,05

Retenia anexelor fetale ocup ponderea cea mai ridicat (45 de cazuri), urmat de
endometrita cataral puerperal 23 de cazuri, endometrita cataral cronic 21 de cazuri, endometrita
purulent puerperal 15 cazuri, piometru 2 cazuri.
n perioada puerperal au loc numeroase restructurri n ceea ce privete modificrile
materne din timpul dezvoltrii produsului de concepie.
Condiia fizic i starea de sntate a femelei, modul n care a decurs parturiia, calitatea
asistenei medicale la parturiie, condiiile mediului, factorii de stress influeneaz ntr-o mare msur
revenirea la statusul fiziologic al femelei dup parturiie.
Involuia uterin postpartum este n corelaie direct cu numrul i calitatea florei bacteriene
din uterul puerperal. Astfel, la vacile cu retenie placentar, s-au izolat diferite specii bacteriene :
Corinebacterium pyogenes, C. Spp., Bacterii coliforme, Escherichia coli, Proteus spp. Pasteurella
haemolytica, Enterobacter spp.,( dup Olson, D. i col., 1984).
Eliminarea loiilor, ncepe din prima zi postpartum pn n a 21 zi postpartum ( Ruckebusch,
1991). Prelungirea eliminrii loiilor este simptomul unei subinvoluii uterine, premiza unor afeciuni
inflamatorii ulterioare.

249

Universitatea de tiine Agricole i Medicin Veterinar


Principalele afeciuni ginecologice i obstetricale studiate pe perioada anilor 2003 2007 i
care au o influen important asupra parametrilor de reproducie sunt :
distociile de origine maternal i fetal
retenia anexelor fetale
endometrita puerperal cataral
endometrita purulent puerperal
prolapsul vaginal
prolapsul uterin
inversiunea vaginal
endometrita cataral cronic
endometrita purulent cronic (latent)
piometru
corpul luteal persistent
chitii foliculari

Principalii parametri de reproducie asupra crora s-a studiat influena afeciunilor ginecologice
i obstetricale
1.
2.
3.

SERVICE PERIOD - reprezint intervalul cuprins ntre momentul ftrii i prima mont
sau nsmnare artificial fecund;
CALVING INTERVALUL - este perioada de timp ntre dou ftri;
INDICELE DE GESTAIE - reprezint numrul de nsmnri artificiale pentru o
gestaie;
Tabel nr. 4
Specificare
SP
Retenia anexelor fetale
102
Endometrita
206
cataral puerperal
Endometrita
202
purulent
puerperal
Endometrita cataral cronic
151
Piometru
156

CI
387
490

IG
2,0
4,7

487

4,1

436
439

3,6
3,8

Analiznd datele din tabelul numrul 4 se constat c afeciunile puerperale influeneaz


negatv parametri de reproducie, ducnd la o cretere a valorilor, cu repercusiuni economice majore.
1.

2.
3.

4.

CONCLUZII
n urma cercetrilor efectuate se poate concluziona c vacile cu diverse afeciuni pospartum au
nregistrat n general valori medii i mari ale diferiilor parametri de reproducie la nivele
inferioare, comparativ cu animalele sntoase din punct de vedere clinic.
Analiza dinamicii parturiiei i afeciunilor ginecologice pe luni arat c cele mai frecvente cazuri
se nregistreaz n perioada ianuarie mai.
Cea mai ridicat frecven a afeciunilor ginecologice este reprezentat de retenia anexelor
fetale (2,35 %), urmat de endometrita cataral puerperal (1,26%), endometrita cataral
cronic (1,17%), iar cele mai reduse cazuri s-au nregistrat n piometru.
Analiza parametrilor de reproducie arat c n cazul endometritei catarale puerperale SP a fost
de 206 zile, CI de 409 zile, ceea ce a dus la creterea IG 4,7. Parametri ridicai i apropiai de cei
din endometrita cataral se nregistreaz i n cazul endometritei purulente puerperale. Prin
intervenia la termen i calificat n cazul reteniei anexelor fetale se nregistreaz un CI aproape
normal (387 zile) i un SP de 102 zile. Corespunztor IG este mai sczut dect n celelalte
afeciuni.

250

Lucrri tiinifice vol. 51 seria Medicin Veterinar


BIBLIOGRAFIE
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.

BADINAND, E., 1981, - Linvolution uterine. Compte redus de la Societe Francaise de Buatrie., 201- 211.
BARKMO, H.; 1994, - Fertility production and culling follwing cesarian esction in dairy cattle. Theriogenology
38(4)., Ref. In: Journal of Reprod. And Fertility., No.2.
BROIU, A., SEICIU, F., 2002 Ginecologie i andrologie veterinar. Ed. Romnia de mine, Bucureti.
BOGDAN, AL. i col., 1994, - Fertilitatea, natalitatea i prolificitatea n zootehnie . Vol. I, Editura Dacia , ClujNapoca.
BOITOR,I., 1984, - Puerperium normal i patologic. Editura Ceres, Bucureti.
CARP- CRARE, M., 1998, - Imunologie i imunopatologie. Editura Vasilian, Iai.
CERNESCU, H., 1995, - Ginecologie veterinar. Editura Helicor, Timioara.
CONSTANTINESCU, M., 1999, - Cercetri clinice i de laborator privind rezultatul folosirii unor imunostimulatori
n puerperium precoce la vac. Simpozion U.A.M.V., Iai
DRUGOCIU, D., 2001, - Ovariopatiile la taurine. Etiologie, diagnostic, terapie. Editura Ion Ionescu de la Brad ,
Iai.
FEREDEANT, T., 1984, - Prostaglandinele n reproducia animalelor. Editura Ceres, Bucureti.
GEORGESCU, G., 1993, - Obinere unor efective de taurine cu un ridicat potenial biologic i reproductiv. Rev.
De Med. Vet., No. 1.
GLUHOVSCHI,N., 1983, - Biologia i patologia placentei la animale. Editura Ceres, Bucureti.
GRECEANU. AL., 1986, - Microbiologie general i imonologie. Lito,I.A., Iai.
GROZA,I., 1985, - Observaii asupra comportamentului vacilor n sistemul de ftare colectiv. Lucr. t., Analele
ICPCB Baloteti, Vol. X.
GRUNERT,E., 1978, - Etiology of retained bovine placenta. Theriology Current Therapy.
PARAIPAN, V., 1982, - Horminoterapia n reproducia animalelor. Editura Ceres Bucureti.
RUNCEANU,L., 1989, - Reproducie i patologia reproduciei. Curs Lito. Editura Ion Ionescu de la Brad , Iai.
RUNCEANU,L., COTEA V. CORNELIU, 2001, 2007, - Reproducie, obstetric i andrologie veterinar. Editura
Ion Ionescu de la Brad , Iai.
RUNCEANU, L., DRUGOCIU,D., ROCA,P., ANTON, C., 2002, - Reproducie, obstetric i ginecologie clinic.
Casa de editur Venus, Iai.
THBAULT, C.H., LEVASSEUR, M.C., 1991, - La reproduction chez les mammiferes et lhomme. Ed.
Marcheting, des preparations grandes ecoles medicine Ellpses, I.N.R.A. France.

251

Universitatea de tiine Agricole i Medicin Veterinar

SEXAREA EMBRIONILOR BOVINI UTILIZ]ND REACIA N LAN


A POLIMERAZEI (PCR)
CENARIU M., GROZA I., CIUPE Simona , STEGERAN Brndua,
PALL E., CTAN Laura, BARTO A.
USAMV Cluj-Napoca
We have developed a polymerase chain reaction (PCR) based method for accurate sex
determination of preimplantation bovine embryos. The method uses two different sets of primers
in the PCR. The first pair of primers recognizes the bovine specific satellite sequence that is
amplified in both females and males. In addition, one pair of primers recognizes bovine Y
chromosome-specific sequences that are amplified in males only. Duplicate embryo extracts were
used in the PCR; the first sample was run in the presence of bovine-specific primers while the
second sample was run in the presence of the male-specific primers. The method has been
specifically designed for screening bovine embryos. Based upon examining blood cell DNA from
adult males and females, the assay is extremely accurate, as no single incorrect result has
occurred yet. The method has been used for the transfer of bovine embryos on which sex
determinations have been performed. The pregnancy rate was of 48% while the accuracy of sex
prediction was 100%.

Majoritatea cresctorilor de bovine doresc s aib posibilitatea cunoaterii sexului


embrionului supus transferului la vacile receptoare (1,3,6).
Lucrarea de fa i propune implementarea n practica transferului embrionar din ara noastr
a unei metode rapide, minim invazive, relativ ieftine i foarte precise de diagnostic al sexului la
embrionii bovini, utiliznd reacia n lan a polimerazei (PCR). Aceast metod se bazeaz pe izolarea
ADN-ului embrionar de la nivelul unui numr ct mai redus de blastomere (2,4,9) recoltate prin
biopsie i identificarea secvenelor nucleotidice specifice cromozomului Y, prin utilizarea unor primeri
specifici (5,7,8). De asemenea, ne propunem evaluarea ratei de gestaie la receptoarele la care se
utilizeaz embrionii sexai prin metoda PCR n vederea transferului.
MATERIAL I METOD
n vederea sexrii embrionare au fost recoltai un numr de 109 embrioni bovini, de la un lot
12 vaci, aparinnd raselor Black Aberdeen-Angus i Siementhal, precum i metii ai acestora. Acetia
au fost pasai ntr-o plcu Petri cu mediu PBS Dulbecco steril, suplimentat cu 0,4% albumin seric
bovin (BSA), n care am efectuat aprecierea morfologic a acestora cu ajutorul unei stereolupe.
Embrionii care au atins stadiul de morul sau blastocist i ai cror calitate a permis includerea
acestora n categoria transferabili au fost supui n continuare procedeului de biopsiere, n vederea
recoltrii blastomerelor necesare realizrii sexrii. Biopsierea embrionilor bovini a fost executat cu
ajutorul unui micromanipulator PrimeTech PMM CT-150 adaptat la un microscop cu inversie Nikon
T6200, prevzut cu o camer foto. n vederea efecturii biopsiei am utilizat metoda cu ajutorul
acului, datorit modalitii facile de executare i a eficienei crescute n ceea ce privete obinerea
unor embrioni de bun calitate dup biopsie. Aceast metod implic utilizarea unui ac fin, cu
ajutorul cruia am penetrat membrana pelucida (fig.1), din exterior spre interior i mai apoi din
interior spre exterior, iar prin ancorarea acului la nivelul orificiilor create i efectuarea unei traciuni
uoare n sens invers (fig. 2), am produs desprinderea unei poriuni mici din membran, suficient
pentru introducerea pipetei de biopsie i aspirarea unuia sau mai multor blastomere.

Fig.1 Penetrarea membranei pelucida

252

Fig. 2 Efectuarea traciunii

Lucrri tiinifice vol. 51 seria Medicin Veterinar


n continuare am efectuat recoltarea blastomerelor de la nivelul masei celulare interne, cu
ajutorul pipetei de biopsie, care se introduce pe la nivelul breei create n membrana pelucida i se
efectueaz aspirarea uoar, pn la obinerea rezultatului dorit (fig.3).

Fig.3 Aspirarea blastomerelor pe la nivelul breei

Dup ndeprtarea blastomerelor biopsiate, am adugat peste embrionii rmai la nivelul


plcuei Petri o cantitate de 1,5 ml PBS Dulbecco suplimentat cu 0,8% albumin seric bovin (BSA),
iar n cel mai scurt timp posibil acetia au fost aspirai individual la nivelul unei paiete de 0,25 ml
i transferai pe cale nechirurgical la vaci receptoare, sincronizate din punct de vedere al ciclului
sexual cu donatoarele.
Astfel, dup biopsiere, blastomerele obinute au fost transferate n tuburi Eppendorf n care sau introdus n prealabil 18 l ap ultrapurificat i au fost supuse denaturrii cu ajutorul proteinazei
K, care a fost adugat n proporie de 0,16 g/l, tuburile fiind nclzite la 37C i meninute ntr-o
baie marin timp de o or. Ulterior, pentru oprirea procesului de digestie, enzima a fost inactivat
prin introducerea tuburilor n amplificatorul termic, la 95C timp de 20 minute.
n vederea obinerii probelor martor de ADN, am recoltat probe de snge de la femele i
masculi aduli, din care am izolat ADN-ul cu ajutorul kitului Qiagen DNeasy Blood and Tissue Kit.
Martorul negativ a fost obinut prin nlocuirea ADN-ului cu PBS. n vederea amplificrii probelor de
ADN au fost utilizate dou seturi de primeri:
primul, cu specificitate pentru bovinele de ambele sexe, a fost utilizat ca martor al
prezenei ADN-ului la nivelul probelor i a determinat apariia unui produs amplificat
cu dimensiunea de 301 perechi de baze (bp). Acest set a fost conceput utiliznd
secvena 1715 de ADN satelit bovin, dup cum urmeaz: sens 5 TGG AAG CAA AGA
ACC CCG CT 3, antisens 5 TCG TGA GAA ACC GCA CAC TG 3.
al doilea, cu specificitate pentru cromozomul Y, utilizat pentru identificarea
embrionilor masculi a fost conceput utiliznd secvena repetitiv BRY4a din cadrul
genomului bovin i a determinat apariia unui produs amplificat cu dimensiunea de
216 bp. Setul a fost: sens 5 CTC AGC AAA GCA CAC CAG AC 3, antisens 5 GAA
CTT TCA AGC AGC TGA GGC 3.
Amestecurile de reacie au fost constituite din probele de ADN, primerii specifici i supermix.
Tuburile cu supermix sunt comercializate ca atare, avnd urmtoarea compoziie: 22 U/ml Taq ADN
polimeraz complexat recombinant, polimeraz termostabil Pyrococcus spp GB-D, anticorpi
Platinum Taq, 66 mM Tris-SO4 (pH 8,9), 19,8 mM (NH4)2SO4, 2,4 mM MgSO4, 220 M dNTP,
stabilizatori.
Tuburile de reacie au fost introduse n amplificatorul temic (Eppendorf Mastercycler
Gradient) (fig.4), utilizndu-se urmtoarea schem de amplificare (fig.5):

253

Universitatea de tiine Agricole i Medicin Veterinar

Fig.4 Amplificatorul termic

Fig.5 Schema de amplificare

Dup terminarea reaciei de amplificare am efectuat electroforeza n gel de agar 1,5% i am


citit rezultatele acesteia cu ajutorul unui transiluminator UV cu protecie, prevazut cu o camer foto.
REZULTATE I DISCUII
Aprecierea morfologic efectuat cu ajutorul stereolupei a evideniat stadiul de dezvoltare
atins de fiecare embrion n parte (fig.6), precum i gradul de integritate structural a acestora,
permind clasificarea embrionilor.
Clasificarea dup stadiul de dezvoltare atins:
- 90 embrioni n stadiul de morul (tnr, compact);
- 19 embrioni n stadiul de blastocist timpuriu.
Clasificarea dup gradul de integritate structural:
- 102 embrioni transferabili;
- 7 embrioni netransferabili.

Fig.6 Embrionii recoltai de la una din vacile donatoare

254

Lucrri tiinifice vol. 51 seria Medicin Veterinar


Astfel, biopsia a fost efectuat pe un numr de 102 embrioni bovini, din care 83 au fost n
stadiul de morul i 19 n stadiul de blastocist timpuriu.
Biopsia embrionar a reuit n procent de 100%, de la toi embrionii luai n studiu putndu-se
recolta cel puin un blastomer. Am ncercat crearea unui spaiu ct mai mic la nivelul membranei
pelucida, astfel nct integritatea embrionului s fie ct mai puin afectat.
Dup efectuarea reaciei n lan a polimerazei (PCR) i a electroforezei n gel de agar, utiliznd
ADN-ul izolat de la nivelul blastomerelor recoltate prin biopsia celor 102 embrioni, am obinut
urmtoarele rezultate:
44 de probe au prezentat o singur band de ADN cu dimensiunea de 216 bp, n cazul
utilizrii primerilor cu specificitate pentru secvena 1715 de ADN satelit bovin
(comun ambelor sexe), ns nu au prezentat nici o band n cazul utilizrii primerilor
specifici pentru secvena repetitiv BRY4a, specific cromozomului Y. Acest aspect
demonstreaz proveniena ADN-ului de la un embrion femel;
58 de probe au prezentat dou benzi de ADN, una de 216 bp, n cazul utilizrii
primerilor cu specificitate pentru secvena 1715 de ADN satelit bovin (comun
ambelor sexe) i una de 301 bp n cazul utilizrii primerilor specifici pentru secvena
repetitiv BRY4a, specific cromozomului Y. Acest aspect a confirmat proveniena
ADN-ului de la un embrion mascul (fig.7).

Fig.7 Gel obinut n urma electroforezei a 8 dintre probele de ADN amplificate.


Probele 1-5 reprezint embrioni masculi, probele 6-8 reprezint embrioni femeli

Evaluarea ratei de gestaie a relevat faptul c din cele 102 vaci receptoare, un numr de 49 de
femele au fost diagnosticate ca fiind gestante, ceea ce reprezint un procent de 48%.
Conform rezultatelor sexrii cu ajutorul reaciei n lan a polimerazei, embrionii transferai
celor 49 de receptoare diagnosticate gestante au fost:
20 embrioni femeli;
29 embrioni masculi.
n momentul parturiiei, sexul estimat prin intermediul reacei n lan a polimerazei (PCR) a
fost confirmat n procent de 100%, astfel din cei 49 de viei nou-nscui, 20 au fost femele, iar 29 au
fost masculi.

255

Universitatea de tiine Agricole i Medicin Veterinar


CONCLUZII I RECOMANDRI
n urma efecturii sexrii embrionilor bovini preimplantaionali cu ajutorul reaciei n lan a
polimerazei au rezultat urmtoarele concluzii i recomandri:
1. dup efectuarea reaciei n lan a polimerazei i a electroforezei n gel de agar, 44 de probe a
prezentat o singur band pentru secvena de ADN comun ambelor sexe, ceea ce ne-a
determinat s afirmm c acestea proveneau de la embrioni de sex femel;
2. 2) 58 de probe au prezentat cte 2 benzi, una pentru secvena de ADN comun ambelor sexe, iar
a doua pentru secvena de ADN specific cromozomului Y, ceea