P. 1
Descifrand Tainele Ereditatii Vol. I - Gavrila, L., Dabala, I

Descifrand Tainele Ereditatii Vol. I - Gavrila, L., Dabala, I

|Views: 593|Likes:
Published by SiMonNyk

More info:

Published by: SiMonNyk on Jan 09, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

04/15/2013

pdf

text

original

Sections

LUCIAN GAVRILA O IOAN NANET,A
DEscrFnîun TATNELE EREDrrAlrr

VOL. I

,:l

-

CoPErtA dE EPAI}TINONDA TIOTIU

Blank page intentionally inserted

4

PREFATA

Nu eristd un alt domeniu al biologiei atit d.e dinamic co. cel
ala gemeticii. lor sncinn de a scrte a &r,te dp Genetied, este' fmr-
t'e d,ificild, cdci, m,enfinerea tn acfumlitatn docurnentdrii repre-
zintd, o adeudnatd cursd. conhw-crwtnmetru, dabele stiingifice,
unele de rutinó,, iar altele foarte noi, sau chinn nebdnuite
pnd deunózi, apdrînd Tnintr-ttm adeadmt fenonterL de aualangd
inf o,rmnpictrtald.

'Iotodatd,

fenvmenul ereditar este ertrem de compler, iar
.;tiinîa ereditd{ii reprezin,td, un dameniu în care trecerea de la
tezd la antitezd. ;i sintezd,, într-o desfdgurare profund dialecticó,
es'te un loc cornun.

Ultimul deceniu o însemnat W$i errcrmi în aprofunzdo"r'ea
stttdiu,lui fenomenului ereditur. Datele mai u,echi despre repli-
carrea semiconseruotiud a ADN au fost cornpletate cu rnod,ele
noi, dem.anstrînd,u-se realitabm unei replicdri segmenfune, dis-
canySinuu. A fast demonstrató, transmitureo, inf ormnfiei ,erediture
de la,^tRN la ADN, aducîndu-se astfel u"n s.erios 'omendoment
la dogmn centtwld a biologiei rntoleculare. Saau ob$inut rezul-
fute rem.arcsbite în stadiul structurii ,rn^oleculotre a .cromozomu-
lui de tip eucario't, bsndarea crarnozomnld reprezentînd o ue'ri-
tv'bild ,,Ao'r-nbd cu origenK penh'u citogeneticd.
S-o dooedit cd, genele prezintd, secuen{e codificatoore. trsn-
scrise ;i traduse ;i secuenfe intercalate printre secuen{ele codi-
ficatmre ;i care sînt transcnse dar nu sînt traduse, genele ansînd
d,eci o structurd m,ozaimtd,. De asemenea, Ia baci;eriofagi, s-a de-
mnnstrnt fenam,enul acoperirii de Eene. S-au descifmt proprie-
tófile gemelor sdritosre pi s-a elobstwt ipoúem ootcoEenrei.
Rezultute dc el:cepÍie ou f ost obfinute îmtr-un domnniu nou
al g,enetùcii mn'lecu.Inre, cel ol mnnipuldrii de Eene cunoscut ;i
sub d,enumirm de dhginerie g'eneticd. Cu oicasta Genetica ca-
pdtd nebúnuite implimiii de ordin ;tiinlific, econotnic, social,
polùtic

Ei chinr m,aml, im wuele reslizdri epoele din dorneniul
ingineriei genetice pot fi comptnte ca gwndmte ;i insolit cu

mdrelia pa1i,lor tui Armstrong pe lund,. $tiinfd, cll Wofunde
r ezonan,te umnniste, Genetica demonstreazd unicifu.úeo fincúrui
ittdir;i.d umnn, irepetabilitatea .so spafio-temporard. Totodnú.,
genetr,ca aduce în discu[ie, de dnta aceasta pe temeiuri mate-
rialist-cLialecti,ce, eristenfa unui desbin. $i acest destin se nLb
mc;te destin genetic. EL se împline;te cu rígo'we matema;ticd",
fdrd a euea însd implacabilitatea destinului ulnfln dl;in mitolo-
gía greacd.

Conceputd. dupó rrn plan original, cortea de fatd re-
prezhrtd. o încercare, ùt linútele uttui spaf,iu redus, de a da
cititorului o imngine integrald asupra fanom,enului ereditar. În
intenlia auborilor a sta't pe d:e ,o

fxtrte pre'zentorca cît mai catn,
pletd a datelor clqsice si a datelor m.oderne priuittd fenornenul
eredit'ar ca ;i o încqcare de interpreffire a datalor dc gvneticd,
clasicd, formnld, prin dntele geneticii mo'leculare. Euide,nt, e&r-
tea de fald este urn din tariantele posíbile.
Pentru docum,enture ne-ant folosit de posibilttdfile pe care
ni le-.au oferit biblioteca Facultd,tii de biologie a Uniuersitd'fii
din Bucunegti, bibliotem d,epartarnentului de Biolngxe gi Bíochi-
mie al Uniuersitdfii Haruo,rd (S.U.A.) precum ;i scltimbul initer-
rwlional de lucrdri ;tiinfifiee, ostÎet încît auborii au auut posi-
bilitwtea de a consulta ntulte tuqdri originale de geneti,cd, cla=
sicd sau m.odernd.

Autorii erpúmd gratitudine tuturor ,acestor institufii ;i tu-
turor celor care le-au oferit, pe o cale sau alta pasibititatea
documentdrii.

Bibliografia este sel.ectiud, gi totodatd. cugnind,e luqdrile
principale deuqrite clnsice sle genetici,i f,orunnle ;i rrualeculnre.
Din ntotiue de spf;iu nu s4 realizat o pennanentó eorelare o
citdrii în tert a autorilor cu Ubliografin firnld.
Lucrarea se adreseazd. speeiali;tilor în geneticd, stud'enfilor
facultd.,tilor de biologie, medicind ;i agronomiie precurn 9i pro-
f esorilor de biologie ;i etexilor de liceu. De osemsnea, ea pmte fi
consultatd de oricine este interesat în descifrarea miw,u;Iosului
fenomen ereditor, cuno;tinfele despre eredifute fdcînd Wrte in'
tegrantú din ceeo ce se poate numi formnlia intelectuald a
omului modern.

AUTORII

CUPRINS

CAP. f. Suhstratul rnaterial al ereditàlii
l. Delinirea ered.itdlii.
2. Delinírea substratului chimic aI ereditdlii
3. Sl.tuctura acizilor nuclcici.
3.1. Scurt istoric
3.2. Structura primarà a ,{.DN
3.3. Structura secuudarà a ADN .
3.4. Structuri tautomere
3.5. Exceplii de la structura bicatenarà a ADN
3.6. Cantitatea de ADN gi informalia ered.itarà
3.7. Sinteza replicativà a ADN

CAP. II. Struetura ARN qi transcrierea genetleú
l. Generalildli
2. Transcrierea geneti,cà
3. ARN nnseger
4. ARN ribozomal
5. lnN d,e tronsfer
6. I RJV nuclear eterogen. .
7. A RN crontozontal
8. IRN ttiral

9. Reuerstranscrieyea

CAP. III. Organizarea materialului ereditar
l. Organizarea uiralà -
2. Organizarea cclul,ar d
2.1. Organizarea procariotà.

82

2.2. Organizarea eucariotà

85

2.2.1. Organizarea genelor eucariote

88

2.2-2. Structura electronomicroscopicà acromatinei
gi a cromozomului eucariot

104

2.2.3. Complexul sinaptinemal

106

3. Caracleri,stici,le organizdrii eucariote

109

4, Procariote-Eucariote, o comparalie .

109

5. Genomul extranuclear

lll

CAP. IV. Codificarca biochimieà'gi expresia genieà

116

l. Generalitàli .

116

2. Cod,ul genetic

ll7

3. Catacteristicile codului genelic

123

I
I
ll

18

1B

l8

22
30
32
33
35

50

50
52
57

6l

66
73

74
74

76

79

79
82

4. Biosinteza proteinicd

f28
4.1. DesfAgurarea proc'esului de biosintezó proteinicà. 129
4.1.1. Inifierea catenei polipeptidice

l3l

4.1.2. Alungirea catenei polipeptidice

137

4.1.3. Terminarea catenei polipeptidice

140

cAP. V.Caraeteristleile
(genelor)

organizarii qi funcgionóril factorllor oreditnri

l. Ciclul de tiald la organismele superíoare .
2. Caraateristicile genetice ale meiozdi
3. Localizarea genelor pe cromozomi
4. Descifrareo naturii genomul.ui (gcnotipului) prin stud,iutr
fenotil>ului (analiza geneticd) (Genetica factoriald. sau for-
mald)
4.1. Ivlonohibridarea .
4.2. Dihibridarea
4.3. Bxceplii de la raporturile mendeliene de segregare
4.3.1. Dominanla incompletà sau semidorninanla
4.3.2. Supradominanla
4.3.3. Codominanfa
4.3.4. Alele multiple (polialelia)

5. Factorul Rh
6. Variantele electroforetice ;i semnificalia lor
7. Interacliunea genelor
B. Complementaritate genicd .
9. Gene inhibitoare .
10. Gene epistatice.
ll. Gene duplicate cu e.fect cumulatíu
12. Penetran!à. gi expròsiuitate genicà
13. Determinismul genetic aI ciracterelor cantitatfue
11. Gene letale . .' .
15. Pleiotropia

145

146
117
148

r49

152

r5B

167
167
168
168
169

t74

177

t79

181
182
183
185
186
189
193
195

B

t

1

I

)

Capitolul I

SUBSIRATUI, MATERIAL AL EREDITATII

Motto:'

Spirala este esenfa vie{iir

Goethe

,

1. DEFINIREA ERBDITATII

Îrncà din anul 1863 Spenoer defineEte ereditatea ca fiind
proc€sul cìare detenminà asemànar€a dintre pàrinli Ei descen-
den{i. IJlterior, la 1885, A. Weis,mann în{elege prin eredita't'e
,,'ttransferuù de Ia o genera,,lie la al'ta a unei substanfe cu o con-
stitu{ie molecularà definità36. Prin ac+easta Weisrnann devan:-
seazà cu aproape trei sferturi de veac, conceptia modernà
despre, o bazà molecularà a ereditàtii, iar oonc€ptul sàu de
pl asrnrt gerrnirwt't u d, cu ierarhia strl.c t ur al -f unclio nralà determi -
nanfi-biofsri-idnrúte-ide, este comparabiù cu cnncephll actual
asupra ierarhiei sistremului eredi'tanr care pornegte de la pere-
chea de nucleotide qi ajunge Ia genarTr.
Astàzi prin ereditate se înfelege conservarea specificitàlii
unui sistrem ibi'olqgic dat, în tÍa:npuù reproducerii s,al€, conser-
vare care asirgurà oon,tiuruul în evolufie, legàtuna organicà dintne
generafii, adicà asemànairea dintre acesúea. Totodatà, pe Iîngà
coarlinutul 'evolutiv, apare ca fenomen biologic fundarnentaln
stà,r€,& de neas,ernànane, de discontinuitate evolutivà, adicà vE-
riabilitatea, eea mai generatà lege a naturii. Cele douà procese,
conservatismul ereditar qi vari'abiùitatea ereditarà sînt douà ùa-
turi inseparalbile ,car,e definesc unitatea dialeeticà a organismu-

* Acest panseu al celebrului autor al lui Faust po'ate fi luat, în
lipsa uneia exacte, drept definifie a vie{ii. Geniul marelui poet a pà-
truns esenfa viefi,i, de vreme ce Tem,a, singur,a planetà pe care sàtàguiegte
în.mod cert Viata se ,aflà într-o g,alaxie de formà spiralà, iar macromo-
leculele din interactiune'a càrora irumpe triumfàtorare Viata au li ele în
esen!à o fitrucfurà spir.'alà. (L. Gravrilà

- Simpozionul, Prognese gi Pers-
pective în biologie: Progrese în Genetica molecul.arà Bucuregti, g

aprilie 1981.

r

lui viu. Fieoare organism are propria sa eredi,tate înscrisà codi-
ficat în s,tructuri moleculare specifice sub formà de irrforma-
tie ereditarà. Cu studiul ereditafii Ei variabilitàtii se oeupà
$tiinfa Ereditàtri numità încà Gsslgriss. Ea studiazà meoanis-
mele înregisúràrii, reduplicàrii qi modificarii imforrnafiei eredi-
tar,e precum $i aie fun,cfi,onràrii m,aú,eria,lnrlui enedirtar în conr,r.u*luL
proceseil.or rbiosintetice din organi:srrt car,e conduc I'a ,contur,ar€a
cliferitelor caracteristici a,ie arcestuia.
Cuvîntul eredita,t,e este de origin:re

'latinà (lueredibas =- a rno$-
teni) qi sem'nificà trransmiterea din gen,era{ie în g'Enerafi'e, ou
a unor caractere cai ata,re, ci a, capacità{ii. de a dezvoita aceste
caractere la d,escend'enfi.
Cuvîn'tul Geneticà, dat acestei gtiin{e de càtr,e W. Batesor,
în 1905, provime de la ,,grec€scul genrtao care înseamnà a d,a
naEtere, a gen'era. Principiile de 'bazà ale Geneticii au fost for-
mulate în anul 1865 de càtre Gregor N{endet în {ucrarea ,,tJtber
die Pflan,zer:r hyb'riden6t Ei au la' bazà, conceptul de factcri ere-
clitari (gene) de naturà materialà. Etre au fos,t elaborate' în urma
unor exp€rienfe de hilbridare efectuate îrn,tre diferite soiuri d'e
mazàre. Fàrà a cunoaqte care este natura chirnicà ,r factorilor
ereditari, Mendel a starbilit, prin in'terpretarea corectà a nezul-
tatelor ,experi,errfelor de hibridare, prin analiza fe,notipi,cà,
indirectà a factoril,or ereditari, dubtl artà cle analiza statisticà.
comportamentu[ acestor factori ereditari în conrrdifionare,a
qi transmiterea ca,racterelor eredi,tare. lli,tate pentru m,ai 'bine
de trei deceurii, principiile elaborate, de Mendel au fost con'fir-
rnat,e ia începutu'l secolului nostru, dovedindu-,s,8 a fi universal
valal:ile în lumea vie. Mendel trebuie astfel consldena,t fonda-
torul celei rnai moderure qtiinfe biologice Geneticai. Legînd
factorii er,edi,tari ,mend.elieni de c'roln,o zomi qi dezvol,tîn'd prin-
cipiile memcleliene de ereditah, qcoala iui Morgan a e'lucidat
clesfàqurarea f enomenului eredit'ar la nivel celular, ,constatÍn-
d,u-se ,exis'tenla unui comportam,ent identi,c al factorilor eredi-
tari rn€n;delieni qi al cromozomil'or î'n tirnpui diviziunii celulare.
Ràmin,ea încà n,edescifratà natura chinnicà a faatoriùor eredi,tari.
Deqi în arnul 7924, Feulgen Ei Ross'enbeck ,eviden

liazà,, printr-o
metodà selectivà de colorare cu leucofux,inà prezenfa la nivelul
nucleulrui cel'ular qi ,al croln,ozormilor a acid,ului dezoxi,ritbouru-
cl'eic (ADN) nu s-ai putut s'tabiili urici,o ,relaf;ie dintre acas,tà surb
stan!à Ei fac'torii ereditari, a càror

'localizare pe cromozorni fu-

sese clar dernornstratà de Scoal,a lui Morgan"

10

2. DEFINIT3EA SUBSTRATULUI CHIMIC
AL BIBEDITATII

În pr,ocesul de transrni'tere a carac,terel'or ereditare de la o
genera{ie la, alta nu are loc o transmitere ,ca atar,e a unui ca-
raoùer. Bste de neimagiurat ,bunàoarà transmiterea la nivel'ul
zigotului uman a ,,ochilor albaEtri(. Dar la nivelul acestui zigot
,roeva" a'fost trans'rris qi acest ,,cevar(( va face ,cE î'n dezvoltanea
ulterioaià a embriou:ului uman sà aparà nnaurifest caracterui
,,ochi a',libaEtri((.' Ce este acest ,,oeva66 Ei ca,re sînt proprietàlile
sale? Fàcînd o paralelà între legil,e fizicii Ei le,gi'tàfi'le feno'me-
nului eredita'r, E. Schródingep, în 1943, devansînd conceplia
modermà molecularà despre ereditak, a ajuns la concluzi:a cà
gen'el,e 'îEí pàstr'e à,2à struotura lor de-a lungul generaliilor,
deoarece cr'omozomu'l în cane e'le se aflà, repre zintà un fel de
cristal sta,bil aperiodic, compus dintr-o succesiune de elemente
izomerice, caracùe'rizate de peruuneur{à gi a càror naturà exactà
eete de fapt.,legatà de codul genetic. i
Trei trepte ,experimentale au dus la descoperirea a,celui
f,cevars adicà a subs,tratului material al ereditàtii care s-a do-
vdit a,fi s'ubstanta chimicà macrcrmolecularà ADN.
Primp, treaptd, este repr,€tentatà de experienfele medicului
englez Griffitllr, efectua,ùe în 1928 cu agpntul pneumoniei
Diplocoecry . pneur:rnùrnipp sau pneumococ. Aceastà tbacùerie se
prezin,tà, su,b forma a douà tipuri diferite: qnul virule'nt qi în-
capslllat, altul nevirulent Ei neîncapsulat. Caracterele de viru-
lent, qi nevirtr'lent sî'n't ereditare adicà se transurrit constan't d,e
la o gengrat-le celuùarà la aLta
fi,pqt virulent a fiost oro,tat cu ,,Slt deoar€€, crescut pe agar
formeazà, colonii netede (în englezà sm,ooth-- neted). Celu,lele
sale sînt, înconjurate de o capsulà formafta din polizaharide
specifice încît existà pneumococi, de diferite tipuri serologice
Sr, S11,, Srrr.

Tiputr nevirulent nu pr,ezi,ntà capsulà Ei for,rne azà pe a€ar
col'onii rugoase. El a fost notat cu ,,Rtt (rough

- ,aspru).
Îm mod spourrtan form,a S se poa,te trans;forima prin mutalie
în form,a R cu o frecventà foart'e micà dar niciodatà nu are
loc mutalia spontanà în sensul .R->S. Rezul,tà deci cà prin mu-
talie naturalà tipul R provenit din diferitele tipuri serologice
aile,lui S poate fi Rr, Rrr, Rrrr.
Injectînd la Eoareci pneumo,coci cu diferite variante expe-
rimentale, Griffi'th a constatat cà:
1. Tipul viruleurt ,,S* produce rboala Ei animalele mor;

11

r

2. Tipul virul,ent ,,Sn ornorit prin fierbene nu produce

boala;

3. Tipul ,nevinulent

,,R( 'n-u produce boala;
4. Dacà la aeelaqi $oarece se injectEazà simultan tipuriie
dirn variantele 2 Ei 3 animalul pr.ezínl,i,boala Ei 'moar,e. Din ssre-
menea animale s-au putut izola celule vii capsulate qi deci 'viru-
lente de pnreumococ. Experienla a t'ost riguru,s efectua€n exclu-
zîindu-,se posirbili'tatea învierii celule'lor de tip S omorlte prin
fierbere, încît s-8 impus o singurà concluzie: celulele vii 'ale
tipului R nevirulent în amestec cu celulele moarte ale ti:pului
S se transfo'rmà în celule viru,lente. Fenom,enul a fost numit
T RAIVSFOR MARE GEN ETIC 4..
Transformarea geneticà se desfàEoarà cu pne'cizie, pàstrîn-
du-se tipul serologic inifial: dacà în amstecul iniectat ,au intrat
celule de tip Sr omorîte prin fierbere qi celule Rrr vii, din
animale !-or putea fi izolate celule de tip 51 vii qi cetrule Rn.
Dintr-uo asemerlea arnestec ,nu vor putea fi izolate celule de
ti,p S ttt sau Sr rr. Acest lucru ar fi posibil numai în urma unui
fenomen de mutafie spontanà, dar un assrn€nea eveninrent esùe
pe de o parte foarte rar qi necesità P€, de al'tà parte un timp
cu mult rnai îndelungat decît dureazà experienfa de 'mai s:tls.
Celulele virulente de tip Sr renrtate prin tnansformarea c€-
Iulelor nievir"ul€nte de ti,p Frr aflate în prezen{a celulelor S
omorîte prin fierbere

'trsnsmi,t cu fidelitsb, în'generafiile celu-r
lar.e ulteiioane, caracùenrl de virul,en!à. Transformar,sa arìe astfel
carac,ter permanerr,t, virulenta fifuld înscrisà în 'baza eteditarà a
c,e1,,u,1e1or Rrt. Griffift nu a puhrt da o expLicatle csrespunzà-
toare acestui pruces de transforrnare geneticà, dar el are un
merit de,osebit deoarec€ l-a sernrnralat penúru prirnar datà, iimput-
sionînd lumea qtiintificà la elucid,area mecanismul'ui sàu.
A doua treaptú în elucidar€a mecanismului transformàrii
est,e reprezentatà de experientele lui Al'loway efectuate în 1932
Ei de experienfel,e lui Dawson qi Sia din 1937. AceEtia au r.euEit
sà determine tra'nsform'area geneti,cà prfur cr-ll'tivarea cel'ulelor de
tip ,,R" în mediu lichid la care au fost adàugate extracte filtrate
obtinrute din Liza, celulelor de tip ,,S".
Deqi nu au precizat natur,a agentului transformant aceEti
autori au putut astfel excliude implicarea materialului capsular
în pnoces,ul transformàrii. Tnebuia càutatà aità substa,rrfà cu
pr'opri etàti transfortn an'te .
A trein trmptd qi c€a d'ecisivà în ,elucidarea naturii agentu-
lui transformalrt ,este repnezentatà de experienlele americanilor
O. T. Avery, C. M. Macleod qi M. MacCarty al'e càror rg2u,ltate

L2

sint publ.icate în 1944 într-s lucrare devenità clasicà. În aceastà
lucrare se aratà ,cà în urma cultivàrii eelulelon de tip R ftl pne-
rcrtta ADN înaùt purificat, extras de la celulele de tip S se poate
obline o transforro,arìe efectivà a cehrlelor rrevirulenrte R în
celule virulente, S. Descoperirea era suprinzAtoare (Wabon a
numit-o ,,bomba( lui Avery) pe fondul tmei' gîndiri dogmatice
dominatà de acceptar'ea generalà a ideii cà sulbstantele pno-
teinice au rol de rnateri'al ereditar, f,apt ce a fàcut ca '1a' început
chiar lui Avery sà-i viarà ,greu sà creadà în propri,a sa descope-
rire epocalà ! Di,n aceastà eauzà, reznrltatele unei asemenea ex-
perienfe trebuiau verificate riguros prin efeetuarea diferiúelor
teste. Astfel, testele senoLogice au ,el"iminat posi'bilitatea conta-
minàrii 'extracfului de ADN cu polizaharide. Testele proteoli-
tice, în Llrma càrora extraetul îEi pàstra activiùatea transfor-
mantà au eliminat posibilitatea ca proteilrele sà fie irnpli-
cat,e înr, fenomenul transf,or,màrii. În sfîrEit, ;tes'tul de drrgestie cu
dezoxiri,bonucleazà (errzimà ce hidroLíze,anà rnolecula polimericà
de ADN) aratà cà extrashrl îqi pierde proprieúatea transfonm€uî.-
tà. Era dovada peremptorie cà agentul transformant este ADN,
Prin aaeas'ta s-a pus piatra de ,tqmelie Ia zidirea g,enetici'i rnole-
culare, Etiin!à prin care biologia secolului XX qi a celor ct U
vor unna se va înscrie ca un domeniu rerrolu-tionar al qtiintelor
naturii. Descoperirea lui Avery qi colaboratorilor sài declan-
qeazà o febrilà aetivitate în toate labora,toarele lumii, Se de-
monstreazà ro,lul transfor,matrr't aL ADN qi la alte bacùeri.i apoi
Ia plante qi anima'le, fenomenul ,tmnsformàrii dewnind în cele
din urmà e cale prin care este transforrnatà dirijat ereditatea
in cadrul ingineriei g'ene,tice.
O altà dovadà a rolului geuretic al ADN ra l€prezentat-o des-
coperir,ea conjugórii fucteriene de càtre Irederberg gi Tatum în
1946. Acesta este un proces na,tural prin care ADN al unei
bacterii este direct transferat unei atte rbact'erii. Bacteriile se
deos,e'besc dupà tipul sexua't. Astfel sint bacterii de tip sexuat
mascul clesemnate F+ qi d,e tip sexuat fernel, desemnate F- între
el,e fiind un tra,nsfer unidir,ecfional de material gearetic de la
F+ l,a F-.

Capacitat'ea d,e a transfera gene o au numai acele bacterii
care posedà un factor ereditar numit frctor de fertilitute (F).
Aceasta repnezintà tot o moleculà ADN, localizatà ln citoplas-
ffià, adifionalà cromozomuiui bacteria,n principal. El se poate
integra în cromozomul, principa,l devenind ceea ce se numegte
u,n episom. În stare integratà faetorul F conferà bacteriei capa-
citate,a de a transfera cu o frecventà înal'tà gene la tipul femel

13

$i as€rn€rr€a tulpini au fost desemnate Hfr càci tra,nsferînd ge-
nele cu o mare frecven!à determimà totodatà o inal'tà frecvenfa
de reeorn,bi,nare a gemelor în popul'afia [bacterianà considera'tà.
Tnansferul de gene se face într-o manierà ,unicà, s'ecvenfialà qi
orientatà, pe ,baza

sa stabilindu-se ordinea genelor pe cr€mozo-
mul bacterian (cartare,a geuricà) qi totodatà s-a conchis cà ,acesúa
are forrnà circularà. Conjugarea baot'erianà explieà rolul pe
care î1 are ADN în ereditate, statutul sàu d,e substantà ere-
di'tarà.

,În annrl L952, N. Zinder qi J. Ledenber,g descoperà transferul
de gene între diferite tulpini bacùeriene mediat prin transduc{ie
fagicd. Bocteriofagii sînt virusuri ale bacteriilor descoperit'e în-
cà din 1917 de cà'tre d'Here1le gi cane se ,mai nurnesc simplu
fo,gr.Fagii se multiplicà în celulele bacteriene lizîndu-le (ciclul
liúic) sau îEi integre azà ADN lor în cromozomul c,elulei 'bacte-
ri'ene (-ciclul lizogen). Ciclul litic Ei ciclul lizogp6l sîrnt rever-si-
biLe. Integrat în cromozomul bacterian La iegiree din acesta
ADN fagic poate smulge gene baeùeriene pe care sà le trans-
fene la, o al'tà tulpiurà

'bàcteriaura (Ftg. 1). În aceln+i an, A. H,er-

atI dpdr prototrofr

+--+ SUfftune 5t

presiune
alt'ernariL

A

22 (Ohe- f r P- mef r

'lis+,

protof rof i ( phe+ trF+ nef+ hts+ )

Ftllru de
Fig. î. Experienfa de transducfie efectuatà de Zinder gi Lederberg în 1952.
Douà tulpini auxotrofice de Salmonella typhimuri%ffi, LA22 qi LAZ au fost
plasate fiecare într-un bral separat al tubului Davis de forma literei It. Brafele
sînt separate printr-un filtru d.e sticlà care nu permite schimbul de celule dar
permitè trecerea mediului lichid dintrun-un braf în celàlalt, astfel' cà cele d.ouà
tulpini sînt de fapt crescute pe un acelagi med.iu. Formele prototrofe apar numai
în bralul care confine tulpina LA22 nu însà gi în acela care confíne tulpina LAz.
Cu alte cuvinte un ,,agent filtrabíI" (FA) activ genetic apare legat de tulpina
LAZ care poate produce prothtrofi La22. S-a d.ovedit cà ageutul filtrabil este
de fapt un fag temperat care a trecut odatà cu mediul de culturà prin filtnr de
stidó de tulpina LAz la tulpina LA22 pe care o lizogenizeazà,, transfedndu-i
genele de tip sàlbatic (poe+, trp+) d,e la tulpina nelizogenó LAZ gi transformînd-o
astfel într-o tulpina prototrofà. Acest fenomen d.e trecere a unor gene de la o
tulpinà bacterianA la alta imediat d.e fagi s-& numit transducfie fagicà. F*gul
transductant a fost desemnat Prr.

T4

lA

Z( phe +

lrp, qet- nis- I

i.

o'p-

rta

[tà.
$i

ZO-

;ta
pe

ìg_

fonto.r,o
f.tgicó

..

32

p ce rntró în ADtl

' 35

S ce intró ín

ProtetnEls

copsrdeu

/-- ,

-bGCterie"

Fig. 2. Demonstrarea rolului genetic al ADN prin studii autorad.iografice efec-
tuate de Hershey qi Chase (1952). a.b.

- radioactivitatea însofegte numai ADN

qi se deceleazó" în interiorul celulei; c, d.

- radioactivitatea însofegte numai pro-
teinele gi nu apare în interiorul celulei bacteriene gazdà.

shey Ei Martha Chas'e, demo,ns'tre azà. rolutr în ereditate a,l ADN
fagic, excluzînd totoda;tà orice implicalie dir,ectà a proteinelor

in fenome,nul

'ereditar (Fig. 2). Fagii pàtrund în celula bacteri,a-
nà unde s,e mu:ltiplicà pe sea,ma componentelor celul,ei gazdà qi
apoi, în urrna lizei celulei bacùeriene se elibereazà noiil.e parti-
cule fagice. Bacteri'ofagii au a1càtuire foarte simplà. Ei prezin'tà
o capsidó, proteinicà cane încon'jurà u,n miez de ADN. Auú'orii
au f'olosit bacteriofagi de 'tip T2 ca're conlin coa 400/o ADN $i
6A0/a proteine. Capsida proteinicà, î,n interiorul càreia s,€ aflà
ADN form,e azà, capul rbacteriofagul'ui care se continuà cu ,o
,,coadà33. Cu ajutorul eozii, 'bacteriof,a,gul se ataEeazà la peretele
celu,lar aI celulei bacteri,€n€, coada avînd la partea sa distalà
o placà h,exagonia[à cu gas€ spini scurfi qi nurnenoase fibrile Ei
posdà activita,te li'zozimicà prin care peretele celulei baeteriene
este dizoivat local. Pe a,ceas,tà cale ADN fagic este injectat în
rnt'eriorul celul,ei bacteriene, înveliqul proteinic a,l fagului ràmî-
nînd la exterior sub for,mà de ,,fantomàí fagicà. Prin experienfe

15

I

de marcare cu izotopi radioactivi, Hershey Ei Chase au de-
murstrat carre este funcfia ADN (Fig. 2). Comptrlen,ùele bacterio-
fag{ilui au fost marcate ,f rînd, proteinele capsidei cu 3qS

qi

4DN fagie cu 32P. 35S

Ei 32P

diferà în intensÍ;tntea energiei ra-
diafiilor B pe care le emit fiind u$or de distins. Cu asémenea
bacteriofagi marcali au fost infectate culturile ,bacterien,e. Prin
urentrifugare au fost î,ndepàrtafi bacteriofagii urea'taqatt iar prin
agitare puùernicà s-au putut separa ,,fantomre,le6s fagice. Cînd
s-au marcat pruteinele cu 35S

s-a eonstatat cà ùrtre AO qi g7o/o

din 3qS

este asociat cu fracfiun,ea proùeinicà a ,,faurtomelors fa-
gice. Cînd s-a marcat ADN cu 3ZP

s-a consta,taú cà cea mai mare
parte a radioactivitàtii apare în interiorul celulei bacteriene. S-a
tras concl,uzÍa cà îilr. timpul ilrfecfiei fagice ùr celula gazdà nu
pàtrunde întreg lbacteriofagul ci numai ADN-uI sàu. Ac€sta stà
Ia tle;za rnultiplicàrii fagului cu aparifia de noi partieutre f'agice.
identice cu eea inifialà. Deqi în celula gazdà pàtrunde doar
ADN, dupà 30 minuúe rezultà panticule vira,le întregi care
conlin atît acid nucleie cît qi pnoteirÌe. Rezultà cà ADN con-
line toatà furforrrnafia eredi,tarà, atît pentru propria sa sintezà
cît Ei penrtru sinteza prote,inelor virale.
Aceste douà cate,gorii de experienfe d,e ,transformare

Ei

de infecfie fagicà au demonstrat faptul, cà ADN-'utr reprczintó,
mnfurinlul gtenetzc, substratul chimic al ereditdfii, otît ls, uiru-
suri cit fL la sistemele Aiobgice celulare.
Dat fiind faptul cà uurel,e virusuri rùbouiru,suril"e pr,e-
zintà ca rniez de acid nucLeic acidul ri,bonucleic (ARN) s-a pus
în mod firesc problema cin'e îndeplfureqúe, în acest caz rolul de
material ereditar.

Experienlele lui Fraenke,l-Co,nrat, Singer Ei Williams pe d'e.
o par,te Ei ale lui Gi,erer qi Schrarnm pe de alta, desfàqurate,
între 1955-1956 au adus dovezi sigure, dupà care la ri,bovirusuri
ARN viral. îndepliureEte rol de material er.editar (Fig. 3). Aceqti
autori au lucr,at'ctl virusuù rnozaicului tutunului (VMT) oare are
formà cilindricà în interior aflîndu-se ARN (60/a) ce ,este încon-
jurat de proteinà (94o7o| avî,nd o lungime de 300 pm gi o 'làfime
de 15 pm. Pe cale chirnicà proúeina viralà poa'te fi separatà de
ARN. Cele douà compon,ente pot fi astfeL in,ocul,a,te separat la
plante de tutun. S-a constatat cà proteiura viralà nu estre capa-
bilà d,€' a determina infecfia vira,là pe cîn,d ARN viral are'
caracùer infec{i,os.

Cînd Gi'erer gi Sc,hramm au fol,osit ARN pur izolat de la
VIW| spre a infeota pla,nte de tutun, BU constatat cà se produce

16

3. STRUCTURA ACIZ,ILOR }IUCLBICI

3.1. SCURT ISTOR,IC

Acizii nucleici sînt acizi ,orga'nieí car'e aonfin f,osfor, r'spre-
zerr-tînd substante macromoleculare din grupa,biopolimerilor.
Descifrarea structurii ADN a fost îndelung pregàtita. În
anul 1868, studentul elvelian de numai 24 d,e ani, F. Miescher
descoperà în nucleii celulelor prele,vate din plrroi uman, ,c8 de-
altfel qi în lapfii d,e somon qi sperma altor animale o substan!à
cu un înalt confinut d,e fosfor pe care a nu'mit-o nucleinrt Ei pe
care, în 1872, 'c considerà a fi materialul genetic activ at sper-
matozoizilor. Mult timp aceastà idee nu a fost îmtbràliqatà de
iurnea biologilor. Abia îrn 1939, Astbury Ei Caspersson, în ca-
drul celui de-al VII-le,a Congnes de Geneticà, vor avansa ideea
cà acizii inucleici ar servi ca matrifà pentru siurteza proteinelor,
asigurînd reproducerea materiei vii.
În 1899, R. Altmann identificà în mucleina d'e d'rojdie o sub-
stan!à macromo,lecularà pe care a numit-o acid nucleic. În anul
1909, P. Leven,e aratà cà acidul nucleic de drojdie oonfine patru
baze aza,tate: odenina, gunnina, citozinn qi unacilul precum Ei
acid fosforic qi o pentozà riboza. În 1930, ac'elagi autor ana-
Iiz.eazà cornpozifi,a chimicà a acidului nucleic din

'timus Ei con-
statà cà acesta cornline adnnind,, guanind., citozind qi timind, ca
baze azotatn precum Ei acid fosforic Ei d'ezstirùbozd. La acea
vreme, ,acidut care es,te nucleic de la drojdie a prinit denumirea
de acid riborw"cleic (ARN) i,ar c.el din timus de vigel a fost numit
acid timonucleic, de fapt acid dezoriribonucleic (ADN).

3.2. STRUCTURA PRIMARA A ADN

Unitàlile structurale al,e ADN, rnonomeri, se numesc nr,t -
cleotid;e. D'e aceea acizii nucleici se numesc polinucleotide, adi-
cà polim,eri de nucleoticle. În anul 7952, Todd a s'talbilit ;tregà-
turile chimice dirr-tre co,rnponentel'e de lbazà, ale nlacromolecu-
lei ADN. U,n nucleotid este alcà'tuit dintr-o bazà, anotatà, o
mroleculà de dezoriribozd, Ei un rest fosforic. Bazele a:zofra,te sînt
de tip organic, relativ hidrofobe. Ele sînt de douà feluri : puri-
nice adenina (A) Ei guanina (G) Ei ptrimidinice citoziura
(C) Ei timina fI). Nucleul purinic este ,un dublu heterociclu al-

1B

t

H

C

N,/ùc/r\

[ ;lr à..

HCs.#Ò-- g

/

Nil

Fig. 4, Nucleu purinic.

C

x/ù cH
tl :il
htc \ 3-'C H
N

Fig. 7. Nucleu
pirimidinic.

N Hr

r'
,,r49\c/\
''l

il cH

HC f.. ,-C--. ,/
NN

H

Fig. 5. ddsnina.

E

di|/ \cz

ril

HzN /'c\^-

nJ

\

n

\.,

NH

Fig. 6. Guanína.

càtuit din 4 a'tomi de ar'ot (N) Ei 5 atomi de, carbour (C) (Fig. 4).
Adenina este o 6.aminopurinà- (Fig. b), pe cînd guanià"-este
2-amino, 6-oxipuri,na (Flg. 6).
Nucleul pirimidinic este un heterociclu aroma,tic alcàtuit
din 2 atomi de azot qi 4 atomi de carbon (Fig. 7). Timina este o
?,6-dioxi, 5-*gtilpirimidina (Fig. B) iar citozina este o 2-oxi,
6-armiuropirimidfutà (Fig. 9). Bazele azota,t'e A, G, T, C, pred.o-
minà în ADN de Ia marea majoritate a speciilor. În unele ca-
zuri însà, 'bazele azotate obignuite pot fi ilrlocuite de unii deri-
vatt ai lor (Frg. 10-13). Astf€I, la grîu circa tlq din resturile
citozinà apar ca 5-metilcitozinà, care are pnoprietàli de îrnpere-
chere asernànàtoare citozinei. Acest derivat al' citozinei apare qi
la alte gramin@,

"* 6ealtfe'1 Ei la mamif'ere.
[,ar fagii de tip T ai ,bracteriei Escherichia co:|,i, (8. coli,) cito-
zima este întrocuità compleú ou 5-hidroximetilcitozina care de
regulà este conrjugatà cu gil.ucoza. De asemenea, la unele viru-
suri se aflà 5-hidroxirneti'1uraci,lu1, iar la unrele lbacterii se aflé
O-metilpurinà.

Purinele qi piri,midinele oomfin dutble legàturi sau legaturi
conjugate, din care cauzà ele se po't pnez'enta sub forme chimice.

NHr

lL

C

o

ll

r

**[' -f -cHl

1,.-*'cH

H

Fig. 8. Timina.

y1 2 \..cH,

iil

or-*-ci-i'

Fig. 9. Citozina.-

19r

v

)

A nalcai ai edentfrèí

Fit. 10. Analogi si adeninei : &metilami-
nopurina gi 2-emlnopurine.

{ HzN-L-*

NA*zri

Jt-*A_

6- netrlaninopurìna

2

- anrnopurina

[-t N -c Hl

N

htpoxanfina

\r

n tralog al guaninet

Fig. I î. Amlog al
guanineí; hiporen-
tina.

H

rrí

\

N

ura c ilul

o

*

5 - fl uorouractÍ

\ \o

HN )ly,

Al

5-bronouracil r \.

''o

**r\Br'

o^d "'

5 - h i d r ox t n e ! t i c : !' o z ì n i

NJ H2

N LcH2oH

oLJ

5 - b ro moc tloz;n t

NHr
l'

N,ry*

lil
,,4.'/

vN

A na logi ai uret'iluluì

Fig. '12.

Analogi ai uracilului. Uracilul ; S-bromouracil ; S-fluorouracil"

5 -nettlcrfoztnà

NHr

IL

N*

L)

NH

cHr

Analogì aì citozinei
Analogi al citozinei. S-metilcitozinà; S-hidroximetilcitozinll; S-bromoci-
tozinl,.

0

.Fig. 13.

20

diferi.te, cun,oscute sub d'enumirea cle structuri fut^ttompre. Ast-
fel, rnucleel,e, structurale ale macrornoleculei ADN se caragùeri-
zeazà, ,atît printr-o mare stabilitate structuralà, cît Ei prin posi-
bilitàti de a se prezenta sub variante structurale. Asemeneà
àspecle c'o,ntra'dictorii stau l'a baza dialecticii fenomenului ere-
di tal'.

Purin'eLe Ei pirimidi'nele pot r'ealiza legàturi chimice cu pen-
tozele. Atomii de carrbon ai pentozel'or sînt num€'rotafi l' , 2' , 3',
4' gi 5'. Cat'bonul I' a,l pentoz,ei ,s,e

leagà cu a'tom'ul dre azot din
pozifia 1 al pirimidinei sau cu ato'mul de arnt dfur pozifia I al
purinei. Prin intermediul restului fosforic s€ rsalizeazà 'lqgà-
turi între caflbonul 5' al dezoxiriibozei unui nucleotid qi carbonul
3' al dezoxiritbozei nucl,eotidului urmàtor, forrnînd{"r-se serii
lungi de asemen,ea legàturi 5'-3' sau 3'-5' în cadru,l polime-
rului care stau la baza structurii primare a'maeromol,eculei ADN
nepresent'atà de ro catenà polinucleotidicà de 'lungime variabilà,
specificà fiecàrei specii. fuegà'turile 5'-3' sau 3'-5' r,eprezintà
legàturi internucleotidice fosfo-diesterice poval,en'te, realizate
i,ntre acidul fosforic qi grupàrile hidroxi'lice (oxidrilice) al'e
glucidului din pozifiile 3' gi 5', avind loc esteri,ficarea a douà
grupàri hidroxilice al'e restului f'osforic:

Legàturile, fosfodiesterice sînt foarte puternice' Ei deci stabile,
pe s'eailt& lor realizîndu-se o structurà f,iniarà, nepr€zen,tînd o
adevàratà coloanà vertebralà a monocatenei ADN. În structura
macr,omoleculei ADN iur,trà patru tipuri principale de nucleo-
tide: dezoxiadenozintrifosfat (dATP), dezoxitimidimtrifosfat
(dTTP), dezoxigu'anozintrifosfat (dGTP) qi dezoxicitidintrifosfat
(dCTP). Cînd se asamibLeazà, în monocatena po,linucleotidicà
acreste nucleotide ràmîn sub formà de dezoxinucleotid-5'-mono-

f'osfat.

Nucleotidul prezintà o regiune specificà, ,r€pnezentata de
baza arntatà Ei o regiuure nesp€cificà reprezentatà de dezoxiri-

R1

I

o

I

C) _-P-OH

I

o

I

R2

2l

rr

bozà Ei res,tul fosforic. În cadrul macr,omol'eculei, pun{ile fosfo-
diesteric,e s€ stabilesc î,ntotdea,una între aceleaEi grupàri care
sînt grupàri nespeci,fice, ceea ce conferà acestei pàrti a rn,a,cro-
molec'ulei o mare regu,laritate, respectiv uniformitate, ce ca-
racterizreazà, ,toate ,moleculele de ADN, d,e, oriee provenien!à ar
fi. Nu acelaEi lucru s€ poate spune despre bazele azotat€, care
repreziultà r,egiunea specificà a nucle,otid,elor, a càror înqiruire
de-a lurrgul catemei pol,inucleotidice variazà de la o m'oleculà
de ADN ,La alta, adicà de la o specie la alta qi aceastà orînduire,
secverrfà de 'baze, az,otate, specificà fiecàrei specii, r€prezintà
modul în care ,este înscrisà, (surb formà codificatà ibiochimic) îr .^
macromoleflila ADN infonnatia geneticà ce dirijeazà r,ealiza-i
rea diferitelor caractere ereditare.

3 3 STRUCTURA SFCUNDARÀ A ADN

:

Pen,tru d'escifrarea struchrrii secun dare a, ADN au fost f o-
losite metode precum spectrofotometria, rezonanta m,agneticà
nuclearà, albsortbfia în ultraviolet, crofrnatografia î,n raz,e X etc.
Difrac{ia îm raze X a dat cel,e mai bune rezultate în d'escifrarea
structurii secundare a ADN.
Primele cer,cetàri privind descifrarea structurii ADN prin
analíza imaginilor difracfiei în raze X au fost într,eprinse de
càtre Astbury în anul 1938. În acelaEi an Astbury qi Bel,l ,arr
aràta,t cà macromolecula de ADN ane ro structurà fibrilarà, iar
pe axa sa Lun,gà bazEle azotaúe stau perpendicular, între d,ouà
baze azobte vecine fiind o distanr!à de 3,4 A. Cele mai bune
imagini ale difracliei în rare X sînt însà otbfinute în periroada
1950-1952 de càtre M. H.F. Wilkins Ei Rosatlind Franklin. Prin-
cipiul difracliei în raze X este urmàtorul: un fascicul, de raze
X trece priurtr-o substan'tà Ei cade apoi pe o placà fotografi,cà.
Dacà substanta prezimtà un aralrja,m,ent ner,egulat a'l unitàfil'or
sale structurale r,azele X votr produce pe pJ.aca fotograficà o
patà centra'là repnezentînd pozilia fascicului principal. Dacà
subr-rnitàfile substanlei prezintà u,n aranja,ment ordonat, ra-
zel,e X vor fi d.eviate îm anumite direclii rnai mult decît în al-
úele. Dacà aranjamentul subuni'tàlitor preziurtà un mode,l ce se
repetà regulat, pB placa fo,tograficà vor apare benzi foarte dis-
tincte între care 'existà spalii fo'arte clane. S-a constatat cà ADN
care provine de la sun$e f'oarte difurite produce prin difraclie
în taze X un model de benzi foarte clar qi aproape Ídentic

22

ceea ce deno,tà aranj,amentul ordonat al rnonomerilor în ca-
dnul, macrornoleculei ADN. Ma,i m,ulú, modelul de difracfie în
raze X a sugerat cà macromolecula ADN ar,e o struchrrà heli-
coldaià (Frg. 14).

De o deosebità importa'n!à în elucidarea structurii secundare
a ADN s-au dovedit a fi cercetàrile lui Chargaff dful 1950, prin
care ,s-a stahilit, contnar pàreril,or oomune dominate de con-

rq A

f O fi ----

)

.Fig. 14. Structura secunsari a ADN Stlonstantele fizice ale mactomoleculei.

23

ceplia ,tetranucleotidului lui Levene (macr'omoleculà ADN/1a
toate speciile rezultà printr-o repetare uniformà a celor pa,tru
nucleotide), cà cele patru baze azotate principale care, 'intrà în
stntctura ADN nu sînt prezente în propor{ii e,gale la diferiùele
specii. Mai mult, el a staibilit r€gula echivalenfei dupà care ,t,ot-
deauna cantit'atea de adeninà (A) este ega'tà cu ace€a a timinei
fI) iar canti,tatea de guaninà (G)-este

"Suta cu ac€ea a citozirrei

(C) de unde rezultà un raport T/A-C/G
foa'rte diferirte precurn Mgcofu:ctqium tubercrrtosis ansium" Soc-
charomryces cereuisine, Bos tantrus sau Homn sopnens. Aces:te
constatàri cunoscute qi surb denumirea de legile lui Charga,ff au
reprezentat un punct de sprijin de mane importantà pentru ,ela-
borar,ea ideii împerecherilor de baze, piatrà de temelie a mode-
lului propus de Watson Ei Crick în 1953 pentru structur,a se-
cundarà a ADN.

Pe de altà parte studiile de hidrolizà, urmatà de s,epararea
cromatograficà a bazelor azotate Ei estimarea lor cantitativà în
spectrofotometrie în u'ltraviolet, efectuate de càtre Chargaff gi
colaboratrorii în 1949, au aràtat cà ADN d,e la cele patru specii
menfionate anterior are o compontie în baze azotate foarte di-
feri,tà, raportul A + T/G + C fiind foarte variabil la aceste
organisme, independent de lesutul sau de individul de la care
este ex,tras ADN

Tabelul î

Compozlfin tn baze a AIIN

Specia

Proporfia în u/o

alrlclc

Om (spermà)
Somn (lapfi)
Arici de mare
Drojdie
Mycobacterium tuberculosis
Escherichia coli
Virusul Vaccinia
Bacteriofagul Ta d.e E. coli

31,0

29,7

32,8

31,7

l5,l

26,1

29,5
32,6

31,5

29,l

32,t

32,6

14,6

23,9
29,9
32,6

19,1

20,8

t7 ,7
18,8

34,9
24,9
20,6

18,2

18,4

24,4

17,7
17,4

35,4

25,1

20,3
16,6*

* S-hidroxímetilcitozinà

Apar varia{ii mari în raportul A+T/G+C la di-ferite orga-
nis,me (ta',belul nr. L). L'a plante,le Ei ani,malele superi,oare apare
un exces de A + T fa!à de G + C. Varia{iile acestui raport nu
sînt întîmplàtoare. Raportul A + T/G + C este specific fiecàrei

24

speci.i, fiind ,mult mai apropiat la rorg€Inismele înmdite filoge-
netic.

Sintetizînd în mod magistral date,le ecumulate în literatura
de specialitate, bazafi Ei pe ,experienlel'e proprii incluzînd tno-
d,elarea molecutrarà, în anul 1953, Watson qi Crick au propus
modelul de structurà bicateurarà a ADN (Fig. 14). unanim BC-
ceptat, reprezentînd una dintre cele mai mari descoperiri din
istori,a Etiinfei, pentru care autorii au primit pr.emiul Nobel.
Mod,eluL propus de Watson gi Crick se deos€tbea radical de
modelul ,tricat€rr,àr propus de Linus Pauling qi Corey în care
baz'ele erau dispuse la exteriror Ei în care nu existau forte care
sà asigure stabilitatea structurii tripiu catenare, iar unele dis-
tanfe uan der Waals ,erau prea mici (Wabon $i Crick, 1953).
I)e asemenea Watson qi Crick aÌu adus argumente qi îm,potriva
mod'eiului tot tricatenar propus de Fraser, înaintat spre pu,bli-
care chiar în perioada în care apànea lucrarea 1or. Ei au propus
modelul de structurà ibicatenarà, în cane fiecare catenà heli-
calà s,e ràsucneqte în jururl aceleia$i axe virhrale Ei 'constà dilr
grupe fosfodiesterice care unesc nesf,urile B-D-dezoxiribofuralto-
zice cu legàturi 3', 5'. Am,bete catene sînt orientaùe dertral,
dar s€cv€nfele a'tomilor in cele douà catene sînt ori,en,tate în
dir'ecfii opuse. Bazele se aflà spre interiorul helixului iar gru-
pele fosfat în afarà. Zahàrul este perpen'dicular pe bazà. Struc-
tura, prezin'tà repetifii (pasul eìicei) dupà fiecare 10 resturi pe
fiecare catenà, adicà dupà 34 A, existînd cîte un rest (baza) pe
fiecare catenà la fi'ecare 3,4 A. Distanta aùomuLui d'e fosfor fatà
cl,e axa fiibrei este de 10 A. Fiind dispuse la exterior, gnrpàrile
fosf,at sînt uEor accesibile' cationilor. Aceasta ,este o structurà
deschisà Ei con{inutul sàu de apà ,este mare. Planurile lbazelor
sînt perpendiculare pe axa fibrei. Ele

'sînt r.rni'ùer prin pun{i de
hidrogerÌ, formînd perechi specifice de b,az'e càci to'tdeau,na are
lroc uÈirea unei baie purinice cu una pirimidinicà Ei viceversa.
Astfel, ADN se prezintà ca ,o suibstan!à ma'cro,molecularà rbi-
cat,enarà, adicà alcàtuità din d,ouà lan{uri polimerice (catene)
ràsucite ;plectonemicul unul în

'jurul celuilalt dupà un ax vir-

'tual, rezul'tîurd structurà

'bic,aten,arà he[i'coidalà numità dublu

nttK*-^t*t

dubtutui helix,este de 204 avînd un pas (spirà)
de 34 4.. Fiec,ar,e, spirà a dublului helix ADN cuprinde cîte 10
nucleotid'e, ceea ce înseamnà cà dimensiu,nea fiecàrei baz.e este
de 3,4 A.

C,e[e d'ouà lanfuri polinucleotidice sînt antiparalele, adicà la
unu,i legàturil'e f,osfodiest'erice, s,e r,ealizeazà între C 3' al dezoxi-

25

7

dezoxtribozà

guaninà

''

I

delr.ri ri boz6

dczoxiribozà

Fig. 15. Perechile specifice de bazà A:T
gi G : Q eare stau la baza structurii
bicatenare a ADN.

rirbozei unui nudleotid $i C 5'
al dezoxiri;bozei nucleotidu-
lui vecin, pe cî,n'd la niveflul
celuilalt lan! polinucleotidic
legàturile fosfodiesterice se
rearlizeazó, în seos, inver-s C 5'

---v Q 3' . Rapor,tu.l A/T

-

G/C: 1 a sugerat realizarea
unor împ'erecheri, d'or,'eclite a
fi real'e Si prin modelare mo-
lecularà, între A $i T r'espec-
tiv G gi C. Împerecherea de
baze azotate are la bazà prin-
cipiul compl€mentarità{ii, cel
mai de seamà în organizarea
Ei funcfionarea rnaterialului
ereditar. Astfel, A se dove-
deEte a fi complementarà lui
T iar G lui C, adicà hazele

ciîosinà

purinrice prezintà complementaritate chi'mico-spafiatà pentnu
cele primidinice, iar bazele pri,midiuricre' prezimtà compleme'n-
taritate pentru cel'e purinice (Fig. 15). Asem€in,€,a perechi d,e
baze prezin'tà dirnensiuni egal'e conferind ma,cromolecvulei. ADN
un diametru uniform pe toatà lungim,ea sa. O împerecher,e
purinà-purinà sau pirimidinà-pirimi'dinà ar depàqi sau ar fi
mai, mica faF de diametrul de 20/^ cît are în mocl nor"m,al
dub,l'url he[ix ADN lipsimdu-l de reg'ulari'tate. Îm'perecherile cle
barn se realizeazà prin intermediut u:rror punli de hicirogen,
douà între A qi T qi trei între G qi C. Î,mperecherile sint, re-
ciproce: A-T, T-A respe,ctiv G-C, C-G.
Dar legàturile de hidrogen joacà un rol foarte important în
reacfiile biomoleculelor, formîndu-se Ei dezorganizîndu-se cu
uqurintà fàrà a necesita surse energetic'e speciale, avînd totodatà
rol esen{ial în reacliile car,e imp,licà recunoaqterea de, structuri
compleurrentare cum ar fi replicarea, tra,nscrierea Ei repararea
ADN ca Ei în traducerea me,sajului genetic.
Structura bica'tenarà a ADN prezintà de regulà o mare
stabilitate' rizicà, asi.guratà pe verticalà d,e' punlile fosfodieste-
rice intraca,tenar,e, iar pe orizontalà de punfile de hidrogen in-
tercatenare qi de stivuirea (stacking) perechil,or de baze ,a'za-
tate în cadrul dub'lului helix, 't,oa,t,e acestea fàcînd ca ADN
duhlu-catenar sà aparà ca o structurà CIarecum rigidà, para-

26

l

cristalinà. Caracteristicile structurale finale ale ADN dublu-ca-
tena'r sînt dictate însà de moieculel'e de dezoxiribozà care se
aEazà cu ,oxirgenul inelului orientat în sus Î,n cadrul unei catene
qi ,orienta't în jos în' cadrul catenei complemen,tare. Din eauza
acestui aranjament opus al moleculelor de dezoxiri'bozà în cele
douà catene Ei d'eoarece zahàrul 6e leagà la o pozitie exc€ntricà
a b,azei az'otate, întreaga mroleculà de ADN este obligatà sà se
ràsuceascà, sà se spiraliz'eze, rezultînd nu o s'tructura dreaptà
bicatenarà ci una spiraiatà dublul h,eli,t, în care fiecarre p,e-
reche succesivà de baze azotate se întoarce cu 36 " în direcfia
acelor',de ceas,onnic, dublul helix fàcînd u,n úur complet (360o) 1"
fiecare X0 perechi cie ,baze.
Structura polimericà a macromoleculei ADN permite în-
scrier',ea în aceasta, sub formà codificatà, a unei cantitàfi de
informaiie geneticà teonetic nelimitatà. Nu,màrul, permutàrilor
posi{bile este de 4n, în ,car,e n reprezin'tà numànrtr nucleotidelor
de-a iungul u:n,ei catene ADN. Cunoscînd cà cele mai rnici virr.'-
suri au în ADN cel pu{in 1500-3000 nucl'eotide, aceasta fiind
limita inferioarà dirnensionalà a genom,ului pentru sistemele
biologice, pute'm a:vea im,aginea enormei diversi'tàti informa-
{iornaie a siste,melor 'ereditare din lumea vie, Ei ne ptrtem ex-
plica, de c€ este ,posiibll ca fieca,re specie sà ailbà pnopria sa in-
fonmafi,e ereditarà, rdiferità de a altor specii.
Rece,nt douà eohipe de cercetàùori, una americanà condusà de
A. Rich de la Massachusetts Institute of Technology, gi alta
ol,and ezà (J. H. van Boom qi Gijs van der Marel) de ,la Uni-
\rersitatea din Leyda au descris la nivelul unor polinucleotide
sintetice de tip p,oli d (G-C) duplexuri ADN cu spirala orien-
tatà se,nestrLt (ADN de stîn*ga) avînd conformalie dife,rita de
ADN ,normal cuno,scu't ca ADN de dreapta. ADN de stî,r\ga pre-
zintà aceeaEi regularitate internà, 'aceleaqi asocieri de baze
az,otate ca Ei ADN de dreapta, dar Ei unele difer,ente stnrrchr-
rale consid'erabile. Astfel, în ADNT de stînga grupele fosfat se
dispu,n, nu dupà uin traiiect rectiliniu, ci dupà 'un tra'iec*t îm
zLg-zag, ADN de stînga, numindu-,se Ei ADIV-Z. În ADN de
stîng,a perechile rd'e ibaze sînt expuse mai spre exteriorul dutbl,u-
lui helix Ei pasu[ elicei c,uprinde, nu 10, ci doar 6 perechi de
b,aze, din care cauzà, forfe'le de stivuire sînt mai mici iar mole-
cula cle ADN-Z apar,e mai fragilà, avînd un dia'metru ceva
ma,i mic.

Plasarea perechilor de bazre' ,azo'tate mai spre ,exteriorul rna-
cromol,eculei ADI.{-Z face ca su,bstanlele reactante sà interacfio-
n,eze rnai usor cu ibazele azotate. Dacà a'ceste su'bstante sînt can-

27

rI

cerig€re, ADN-Z poate sà condilioneze transformarea rnal,ignà
a celulei. StructurA de fip ADIV-Z poate sà aparà în anurnite
condifii chiar în cadrul structurii normale de ADN nativ l'a ni-
velul unor anlunite segrnente ale acestuia.
Conformafii sen,estreau fost descrise la nurn,eroase polinucleo*

tide sintetioe de

'tip pali-d (GC), poli-d (GC) sau poti-d (AC).
poli-d (GT). Se aratà cà structura sen,estrà este accesiibilà ori-
càrui segment de ADN cu o s'ecven{à de 'baze alter'native puri-
nà-pirimidiurà (Arnott Ei colab., 1980). I)escoperirea, confcrma-
{iei senestre a ADN extinde eno'rm limitele structurilor $ecun-
dar,e cunosc,ute pentru duplexurile ADN. El,e pot fi implicate în
multe aspecte referitoare la schi,rnibàrile conform,afiona'le ale du-
plexu'lui ADN în replicare, dena,turare, transcrier,e. Regiunile
dextre Ei s,enestre dintr-o moleculà de ADN pot fi separate dcar
de 2 nucl.eotide.

P'e baza datelor de structurà a ADN se poate deduce funclia
sa de rnoleculà informafionalà Ei se poate defini unitatea func-
fionalà de transrnitere a caracter,el'or ,ereditare care a fost nu-
mità gènd,. Genq, reprezùntd lLn se'gmeflt, o por[iune din lnfrero-
m,alecula de ADN la tost'e sisternele biologice sau de ARN (l,a
ribo'uirusuri) de lungime uarinbild care define sub farmd codi-
ficatd informn{ia ereditard ce dirije'azd, sinteza unei ca'tene po,li-
peptidice. Gena c,on{ine în m'edie între 900 Ei 1500 perechi de
nu'cleotide. Peste arrrumite limite de temperaturà (într'e 63aC .9i
100'C) stabilitatea legàturilor de hidrogen cedeazà avînd ioc
desfacerea dublului heiix.
În c'eLe douà catene complem,entare, fenomen ,numit clena-
turare termicà. Cea mai scàzutà ,temperaturà de denaturare cu-
noscutà este' 65"C qi se Înregistreazà în cazul den,aturàrii poli-
nucleotidului sintetic poli d (A-T). Dacà amest,ecul monoc&t,€n€-
lor r,ezultate din denaturarea dublului helix de ADN se ràceqte
brusc ele rà'mînd permanen,t separate' gi un asemenea ADN se
llumeq.te ADN denntLdtr'at. Dacà amestecul de rnonocatene se rà-
ceEte lemt, treptat, are loc o reasocier,e a catene'tror cu refacerea
legàturilor de hidrogen di,ntre el,e, r,estaibilindu-se structura bi-
cat'enarà a ADN. Acest fenom,en s-a numit rennturareq ADN
(Fig. 16).

Temperaturà de denaturare p,oate constitui un indiciu indi-
rect privind prooentul d,e baze azotate din struct,ura ADN. thir
ADN în care predominà perechile A-T, între care existà 2
punfi de hidrogen, v8 prezent,a o temperaturà de denaturare mai
micà deeît un ADN în' care predo,minà perechite G-C care,
prezentÎnd trei punfi de hidrog€D, sînt mai rezistente la dena-

2B

cíe'cturare

-

Fig.

Fit. 17. Temperafura de de-
aefurare a ADN de la diferite
surse, avînd un confiuut va-
riabil G+C (dupA J. Marsrur
$i P. Doty, 1959).

il

Af,

a

H

AD I{

z,"qJ

qnr

"toC*C

100

BO

60

?0

0

40

r &4: j: gj:

ADN

AR N ir,rlerenicn

16. Denaturar_ea.gi renaturarea aDry (A). Denaturarea gi
hibridarea molecularA (B).

Hycoba cterrun phlei

29

F-

turare, nec,esitînd pentru aceasta o temperaturà mai ridicatà
(Fig. 17).

Prinr denaturare-r€rrsturare se pot rea,liza hibrizi ,moleculari
între ADN ,ce provine de la diferite specii, putîndu-se aprecia
gradul de înrudir,e dintre specii pe criterii rnoleculare. Astfel,
dacà renaturarea ADN homolog e,ste teonetic de 1000 , renatu-
rarea ADN heterol'og (ce provine de la specii diferite) esúe în
fr-rrrcfie de apropierea filogeneticà a speciilor (7So7o între ,om

Ei

maimuta Ei 250/o în,tre om Ei goar,ece, bu'nàoarà)
Hilbrizi moleculari pot fi realizali Ei între ADN Ei ARN, iar
cînd aceastà hibridare se realiz eaz,à, in si;tu, se pot loca,liza pe
cr'omozomi genele care dirijeazà sinteza diferitelor categorii d,e
ARN celular.

3.4. STRUCTURI TAUTOMERE

Prin deplasarea unor atomi de hidrogen de la un atom de
azot sau ,oxigen d'e la o ,grupare l,a alta a nucleului purinic
sau pirimidinic, fenomen numit migcare tautomerà apar formele
tautomere ale inelului purinic sau pirimidinic care 'trec de la

l-l

I

NJ-H

I

1;':-/'-\C/\
rll

\

illr'Hà

Fì Cì'.-1 rr/C\ /
r,l

NH

Adentna :f orna antnOJ

Adentna ( forp; tmíno,

OH

I

l^
\r,

y/ \ c-c H.

i lL,, J

o=i\ ,/cH

NH

Ttornà ( forn.: enoliciI

tautomere.

**r'

HC\

NH

ti

C

-N

\C

tl \.u

,/\-,t'
NNH

'aÚtú

roe ra

,e'

-T A
ó?''/ il

%,'cx

t

O:C

c-cH"

t'

I

--'>

\ ./cH

NH

Itnt. ) {rornA: cetonrca)

Fig. 18 Structuri

30

forma amino (NHz) la forma imino (NH). AceIaEi lucru se în-
tîmplà ctr atornii de oxigen legali de atomii C6 ai guaninei qi
timinei cane au în mod normal forma aeto (C:O) qi care În
urma miqcàrii tauto,mere trec în forma enolicd (C-OH) (Fig. 18,
19).

MiEcarea tautornerà creeazà posibilitatea împerecherii gre-
site de baze azotate de tip A-C qi G-T, fenomen care poartà
în sine ca'uzele apariliei de mutafii spontane (vezi procesul mu-

tagen).

/(

,W,ì

4/ -

')n,n,

wo

-''

í-- . .-

NHz

6 (nornalà ceto)

,0

C r4ornalé anino)

rv N Hz.

G4 (f orna rarà enattrè )

NH

1/\

t,---r/

,N \r
Cf r f orna rarà inino;

Fig. I 9. Tranziliile tautomerice d.e la formele comuue, stabile ale bazelor azotate
(A, T, G, C) la formele rare, tautometice (A*, T*, G*, C*).

31

N

A ( oornalà antno )

3.5. EXCEPTIE DE LA STRUCTURA BICATENARA A ADN

Cercetàrile lui Sinsheimer (1959) efectuate la bacteriofagut
g XL74 a:u aràtat cà ADN la acest virus prezin,tà o structurà
care nu se încadreazà în modelul de structurà bicatenarà. ,El nu
prezintà o structurà complementarà, fiind atacat de càtre losf odi-
ester'ozo, extrasà din E. col;i, acliunea acnestei enzime fi,iurd in-
eficace pe structurile bicatenare de ADN. S-a tras aoncluzia
cà ADN de q X174 este monocatenar, adicà s€r prezintà în mod
n,ormal ca structurà primarà, apàrînd ca o mol'eculà ci,rcu'larà
de ADN mornocat'enar (Fig. 2q. O situa{ie asemànàtoare s-a evi-
denliat gi la atli bacteriofagi precum q^R Ei StB. Asomenea ca-
zurí în care ADNT se prezintà îm s,tare naturalà ca strucfurà
monocatenarà ne sqgerc azi cà de fapt la toaùe sistemel'e tbio-
logice ar fi po'sibiià înscrierea informaliei ereditare în structuri
monocatenare. Starea dublucatenarà nativà a ADN Ia covîrgi-
toarea m,ajoritate a 'sist,em,€1,or biologice este o stare redutantà,
r'eiteratà. Dar cum înseEi s,tructurile monocatenare devin în
timpul replicàrii structuri dutblu-catenaffi', însea,mnà cà natura
a avut o anumità ,,rafiune( de a-gi baza realizarea fenome-
nului ,ereditar pe structuri dublu-catenare. Dealtfel natura face
un foar,te interesant joc de duplicitate, începînd d,e la pereehea
de'baze azot'ate specifice, structurile du'blu-catenare, structurile
cromozomale bicroma,tidice, existenîa structuril,or sernicnomati-

Fig. 20. Bacteriofagul OX 174. a. particule fagice intacte colorate cu ecetat d,e
uranil ; b. cromozomal circular (ADI{) moîlocatenar de OX 17 4 (dupà Finch,
Dressler gi Wolfson, din Goodenough gi Levine, 1971).

32

dice qi contiqruînd cu existenta a d,ouà seturi de cromozomi în
garni'ttrra diploidà (numàrul, d,e cr,omozomi variazà 'd,e la 1 la
precariote tra cel pufin 2 (Ascorris megaloceplwla uniuq,tm,s) sau
4 (HWlopappus gracilis compozità) qi ajurgfnd la ordinul a
B, 10, 20,100 qi mai mu,lfi la al,ùe eucariote (Lima-de-Fari.a însà,
consiclerà cà oric,e celulà 'eucariotà are de fapt nevoie doar de
3 crornozomi: un autoz'o,m pe care sà fie plasat'e majoritatea g€-
n'elor, un cromo zom de sex care sà intervinà în determinarea
s,exului qi un cromozom organizator nuel'ear eare sà posede,
genele nucleolare) apoi douà sex,e separa,te, implicînd douà ti-
puri Ce gameli diametral ,opuse qi terminînd cu larg raspîndi-
tele cazuri d,e simetrii ale naturii (sà luàm doar fiin@ timanà,
doi ,ochi, douà urechi, douà nàri, douà mîini, douà pícioar€, . . ,
e,te . . .). Complernentaritatea apare ca o condi{ie esenlialà în
desfàgLlrarea multor fenomene ale naturii. În cazuL ADN, com-
plementaritatea catenelor din structura dublu-catenabà est'e
esenfiaià în procesele de replicare Ei transcriene, iar 'existenta
a clouà caten,e apare ca o ,,grijà( a naturii de r asigura ,trans-
miterea fidelà a informaliei ereditare în condiliile în carre feno-
menul mutagen ar afecta urr-à dintre cele douà catene. Dacà mu-
ta{ia afecteazà o structurà monocatenarà gansa d'e a transmite
fidel irnformafia ereditarà este practic nmlà, p€ cînd în cazul
structurii dublu-catenare aceastà qansà este de 500/* Dealtfe},
vom vedea cà în cazul reparàrii 'leziunilor din ADN induse de
mutageni, integritatea uneia dintre cele douà catene ale dublu-
lui helix ADN devine esentialà, condifie sine qua non a reuqitei
repaieirii. Este d,e la' sine înleles cà aceas'tà ,,gii;à" a ADN, spre
a-$i asigura înd'eplinirea funcfiei sale, ru are nimic d'e-a faoe
cuaspeót"d,eteléologie.

'

''' :l

3.6. c.$urarEA DE aDN gr TNFoRMATTa EREDTTARA

Canr' fuuu relativà de ADN poate fi apreciatà citofoto,metric
prin anatifa nucleilor interfazici colonafi cu leueofuxinà (meto-
da Feulgen-Ross'enbeck). Cantitatea dp ADN este specificà fie-
càrei specii, €a menfinîndu-se consta,rftà de Ia o generafie celu-
larà ia alta. În ciclul celular (perioada dintre douà diviziuni suc-
cesive alcàtuità din in,terfazà Ei mitozà) se r,emarcà o.trecere a
cantitàtii de ADN de la ,o valoare considera'tà diploidà .tipicà
pentru fiecare specie (2 C) gi care se înregistreazà ,1a' sfîrEitul
diviziunii nuclear€,' cînd nucleii fii trec în interf azà; la dubla-

3

- Descifrînd tainele ereditóiii, vol. I

33

rea ac,6tei cantitàti de ADhT (4 C) în timpul interfazei. La ur-
màtoarea diviziune nuclearà prin intervenlia aparatului mitotic
cantitatea dubtà (4 C) de ADN va fi distrirbui'tà echilibra,t în
c,elulele fiice, acestea primind o aceeaEi canti'tate diploidà (2 C)
de ADN.

Mitozn apare astfel ca un mecarrism ,bi'ologic fundarnental
car s asigurà constanta cantitativà a ADN-ului în succesiunea
g'enerafiilor celulare. Nlitoza apare astfel ca e permanen:tà le-
gàturà între trecut Ei prezent, asigurînd transmi,t,erea unei ace-
leiaEi' cantità{i de informalie geneticà de la celula ma,mà la
celulele fi.ice (Gawilà Ei Dàbalà, 1975).
S-a mai constatat cà în gamefi (celule sexuale) cantita'tea
.le ADN este r'edusà la jumàtate fa!à de can,titateia dipl,oidà ca-
r,acteristicà speciei considera,te (2 C). Din aceastà cauzà, gaffielii
sînt haploizi (cantitatea de ADN:lC). Totodatà s-a constatat
cà în gameti numàrul de cromozomi,est,e redu's Ia jumàtate fa!à
de celulele somatice (toate celelalte celule a1e organismului. Prin
unirea gamefil,or de sex opus, în pr,ocesul fecundàrii, s,e re-
stabileEte cantitatea, n,ormalà de ADN caracteristicà speci'ei date
(1C + 1C=:2C). Ga,melii apar în urma unei diviziuni celulane de
tip specia'l numità meiozd,, aceasta fiind de fapt o diviziune de
reducere (îniumà'tàtire) a numàrului de cromozoml Ei t,otodatà
a cantitalii de ADI.I. Meioza apare ca u,n mecanism compensa-
toriu al fecundàrii, obligatoriu la or€anismele cu reproducere
s'exuatà care previne màrir,ea exponenfialà a cantitàtii de ADN,
ce ar avea loc în condiliile unei fecundàri a gamelilor a càrror
cantitate de, ADN nu ar fi redusà la jumatate comparativ cu

celule,le somatise.

ADN-uI se caracterízeazà printr-o nemarcabilà c'onstan!à
cantitativà riguroasà dea lun,gul generaliilor c.elulare, ceea ce
n,u 'este eazul altor com,ponente macromoleculare atre' celulei
(proteine, acizi ribonucleici etc.) care prezintà varialii canti"ta-
tive evidenùe nu numai de-a lungul generaliilor celulare dar
ehiar în cadrul diferi'ùelor ce'lule ale aceluiaEi organ'ism ia un
m,ome,nt dat. Recent, s-au adus multe date în sprijinui unor
exc,epfii de ]E rqgula cronstenlei valorii canrtitaúive a ADN, în
ciclul celular, rearlizînd'u-se vari,alii aùe cantitàlii de, ADN prin
mecanisme de replicare diferenfiatà a ADN (Nagl, 1978, 1979).
Prin experirenle de marcar,e cu izotopi radioactivi (1tr3, CI4,
P31 s-a constatat, cà radioactivitatea odata încorporatà în ma-
cromoleeula de ADN (de exemplu timidina tritia'tà timidina
H3 este încrcrporatà în' ADN în locul timinei fiind un pre-
cursor al acesteia) nu o mai pàràseEte atîta timp cît celula trà-

34

ieSte, c€ea ce înseamnà cà, odatà sintetizatà, rnacromolecul,a de
ADN nu ma'i este dezagregatà spr€ a fi resinrtetizatà. Aceasta în-
seamnà cà spre deosebire de alte oomponente macromoleculare
care sqrferà turnover rapid (degradare Ei resintezà ,cu sctrirnib
continuu de ,atomi) macromolecula de ADN se caracterizeazà,
prfu:tr-o,rnare stabilitate.
Urmàrind cin,etica' renaturàrii ADN-ului denaturat car€ apar-
line la specii diferite se coxLstatà cà cu cît specii'le sint rnai apro-
piate filogenetic cu atît proeenúul de refacere de strtreturi du-
blu-catenare este rnai mare, ac€;asta deoarrece speciile a'propiate
din punct de vedere fiL,ogenetic prezintà într-o proporfie mai
mare succesiuni similare de baze azotatn în macromolecula lor
de ADN, adicà pr,ezintà u,n anumit fond de informafie eredi-
tarà co,nnunà. Acest fapt ne face sà gîn'dim cà ,evolufia speciilor
s-a desfàqurat în principal la nivel molecular.

3.7. STNTEZA REPLICATIVA A ADN

Deoarece ADN confine informatia geneticà a celulei, sinteza
sa este unul dintre cele mai importante evenimente din via,fa

acestei,a.

Realiza,tà prin intervenfia unui cornplex aparat errzimatic,
sinteza ADN este o reaclie de tip repficativ, fiind ,rrnicul caz
din lumea biomoleculelor în care o substantà îqi dirijeazà prc-
pria 'sa sintezà. Complexul de replicare care include aparatul
enzimatic Ei molecula, de ADN în replicar'e se num'e$te repli-
to%ouotura

tbic,anrtenarà se dov'edeqte €ù avea implicafii ,biolo-
gice dintre ,cel,e mai profunde, dar prezintà Ei un foar,'te iqLtere-
sant punet de dezbatere filozoficà ea expl,icînd, cel pulin în
parte, unele dintre misterele vielii.
In uirso, sintez,a aeí,zilor nucleici (ADN gi ARN) s,e d.esfàqoarà

în trei etape:

a) stnteza precursorilor nucleotid'elor purinice qi pirimidi-
nice adicà a acidului uridilic Ei a acidului inozinic (Frg. 2I);
b) sirnteza nucl,e,otidelor propriu-zise care intrà direct în al-
càtuirea macromoleculelor acizilor nucleici (dezoxiadenozintri-
fosfat (dATP), dezoxiguanozintrifosfat (dGTP), dezoxicitidintri-
fosfat (dCTP) qi dezoxiti'midintrifosfat (dTTP) pentru ADN;
ad'enozintrifosfat (ATP), guanizintrifosfat (GTP), citidintrifosfat
(CTP) qi uridinúrifosfat (UTP) pentm ARN;

35

Acid uridilh ( UMP,

lnterconrersb
pirimidinnudeo-
tldicó

Ì

I

I

)l=

!cr

lo

I

i

t
l

2
É.

f u'io;n
lrilosfot (

Uf P)

Citidin
tritosfot (CTP)

Guonosin

trifosîot (GTP)

Adencín
trrfosfot (ATP)

Dezoxitimidin
trifosfat (dTTP)

Dezoxicitidin
trifosf ot (d CTP

Dezoxíguonosin
trifosfot (dGTP).

Dezoxiodenozin

trifosfot (dATP)

Acid inosinic ( IMP)

Fig. 2l . Cóile bioslntezei nucleotidelor.

t

c) polirn,erizarea ordona,tà a nucleotidelor într-o secventà
camplementarà unei matrife (dupà modelul semiconserl'ativ) sub
cataliza unor enzime polimerazice celulare.
Sinteza in uitro a ADN a fost realizatà de càtre A. K,orn-
berg, I. Lehma'n,n, M. J. Bessman Si E. S. Simms în 1'J56, în
sisterne acelulare folosind un echipamern't enzimatic polim,era-
zic extras de la E. coli (ADN potimeraza I sau enzirna lui Karrl-
berg) în prezenfa ionilor Mg++ $i a unei matrile ADI{ înait-
poiimerizatà.

Sinteza in uitro a ARN a fost realizatà pentru prima Catà
de càtre Marianne Grunberg-Manago Ei Severo Ochoa de La
Universitatrea din New York, în anul 1955. Pentru aceasta au
folosit un sistem ,enzimatic ARN polimerazic, ionii metalici ,bi-
valenli (Mg++) Si un segment ADN ca matri!à.
Mecanismul de replicare ssmiconseruatiud, a ADN pr€:supune
separarea ca,tenelor complementar,e prin desfacer,ea punlilor de

36

lnFrcqrversie
prrh-rruc.leo-

hidro'gpn, fiecare catenà servind drept matri!à pentru sinteza
unui noi catene, complementare, refàcîndu-se a,stfel structura
bicatenarà a noilor macromol,ecule ADN care vor avea astfel
cîte o cat,enà veche Ei alta nou sintetizatà,. Acesta este modelul
sernicanseruatiu de replicare a ADN. Prima dovadà experimen-
tatà în spriiinul m,odelului semiconservativ de replicaró a ADN
este aclusà ia nivel cromozomaì de càtre H. Taylor (1957, 1958)
în sistemele eucariote qi în acelagi timp, la nivel molecular', de
càtre meselson qi Stahl (1958) în sistemel'e procariote (8. coli).

+vr

Incà din anul 1950 Srvift aràtase cà replica'rea ADhl în
celulele eucariote este restrînsà doar la inteif azà, la un stacliu
pe care Flowarcl qi Pelc l-au numit stadiu ,,So', separat cle ctivi-
ziunea pr,ecedentà printr-un stacliu G1 (de gol sintetic) qi urmat
de trn stadiu G2 în care, de asemer€a nu se mai sintetize'azà
ADN. G1 este f'oarte varia,bil durînd de La 3-4 ore, la zile, sàptà-
mîni qi luni, depinzînd de tipul de celulà gi starea fizioiogicà
(Gavrilà gi Dàbalà, 1975) . G2 este mult, mai constant, clurînd
2-5 or,e iar S clureazà 7

-B ore. Pregàtirea nucleului pentru re-
plicarea A.DN se face . în Gt, fapt demonstrat de expuner,e,a,
prin transplant a nucleilor, Ia citoplasma celulelor aflate în
Gr (nu qi în atte f.aze) care aratà cà ace;ti nuclei i,ntrà de îndatà
î:n stadiul,S, de sintezà a ADN. În 1957 Taylor, W.oods $i }lughes
au efectuat experienfe ,autoradiografice la cromozomii cle Vicia
faba, folosind timidina tritiatà (3H) precursor al timinei. Radi-
celele crescute pe mediu cu timidinà

-3g au pr,ezen,tat crorrt:o-
zomii uniform rnarcali pe toatà lungimea 1or. Ele au fost apoi
transferate pe rnediu fàrà timidinà tritiatà (mediu ,,rece'(). Iì,a-
dicele au frost tra,tate cu colchicinà pentru a fi prevenità for-
marea fusului de diviziune astfel cà produgii replicàrii fiecàrui
crom,ozom ràmîn unili la nivelul centromerului. S-au efectuat
preparate citologice pentru cromozomi dupà un ciclu cle divi-
ziune, dupà douà cicluri etc. Cînd au fost analizat'e autoi'aclio-
grafic aceste preparate, autoradiogramele cromozomiior" clin
radicele cultivate pe m,ecliu cu timidina tritiatà prezentatr am-
bele crornatide marcate radioactiv (FiS. 22). Cînd s-au efectuat
preparate din raciicele cultivate pe rnediu radioactiv qi apoi
transfera.te pe mediu neraclioactiv (fàrà timidinà

-lH), pentru
un singur ciclu celular (o si;ngurà diviziune). cromozomii din
aeeastà a doua rnetaf azà, statrn'ochineticà cl'e clupà mal'care
prezentau o cromatidà rnarcatà qi alta nemarcatà. Aceasta a
fost prima dovadà experim'entalà certà în sprijinui modelului
serniconservativ de replicare a ADN. El a fost dovedità gi la
alte organisrne veg€tale pi:ecurn Crepis gi Belleuolia. Dar ela

37

r

:/

a doua nefafaú
sf afncchineticà
drp; mdi'ca re

( o c í'ona f ,,Cà rna rcafí
' si a rf a na narraté I

Fig. 22. lVIodelul replicórii semiconservative a cromozomuiui eucariot (duplt
(Taylor, Woods gi Hughes, 1957)

o d,ovadà inclirectà a replicàr:ii ADN, prin care de 'fapt s,e do-
vedea replicare,a semicons,ervativà a cromozomi'lor.
Dovadà directà, la ni.vel m,olecular, a replicérii semiconser-
vative a ADN a fost adusà în 1958 de càtne Mese,lson Ei Stahl,
prin experienfe de transfer izotopic (FiS. 23). Autorii au cres-
cut pentru multe genera{ii ceLular.e E. col,i pe mediu în car'e în

Mode(e de obsorbfre UV dupò

centrilugort

Aspcctut. -

totogrcfterit tn
UV

Crenerofic 1

ADN extros din

!,octerii trons-
f r:rote pe mecíu

cu lltN

Fig.23. Reqrezentarea graficà a experieufet lui Meselson Si Stahl (1958) .L

- light

: u$or'i"S;tilr

J" ;^ó:Tffi*i:t(til ffi ilHPir#r.- heavv

3B

duprcare ctt :[:#,!;:::í;3

c,tpticare ràri
lintdinà frÌtrafà dupà marceie linrdinà frifíatà
(anbele cranalide
narcaf e )

:ffi

lnbrptltqre

in tcrm6É deruptrcore

ccmiatìserntivó

J

^

/\,r!

sursa, de anlt (NHrrCl) iurÉra nu azotul normal' 11'N

ci iz t,opul

sàu greu 15N,

astfel cà în macromolecula ADN atomii cle N

erau r€prezentanli de 15N.

În prealabil s-au fàcut cercetàri de

ultracentrifugare qi s-a constatat cà ADN cu 1r'N

bande azà di-

ferit (mai sus în tubul de centrifugà) fata de ADN cu 15N

care
hande azà la un nivel inferior, spre fundul tubului de centri-
fugà. Dupà cre$terea bacteriei pe mediu cu 15N pentru rnult,e
generafii, celulele sînt transferate pe mediu cu t4N pentru a
desfàgura un singur ciclu de diviziune (a càrui duratà era
precis deterrninatà 90 minute). S-a extras ADN Ei s-a ul'tra'-
centrifugat. S-a c,onstatat cà a,cest ADN ,bandeazà la un nirtel
intermediar în,tre 14N

qi 15N.

Cu alte cuvinte acesta era un ADN
hibrid, în care o catenà prezenta ca atomi de N, azotul normal

14N

iar catiena complementarà prezenta izotopul greu al, acestuia

l5N.

Dupà douà generafii celulare d€ 'la transfei pe mediu cu

14N

se constata cà prìopor{ia de ADN hibrid 14N

- 15N

scade la
jumàtat,€, cea,laltà jumàtate fiind repr€z€ntatà de ADN cu 14N,
dupà trei generalii raportul dintre' cantitatea de ADN hibricl qi
ADN c,u 14N

este de 1 : 3 q.a.m.d. (Mode1 semiconservativ de
replicar€ s ADN propus de càtne, Wafuon gi' Crick în 1953)"
Mod'elul semiconservativ de replicare a ADN asigurà o
continuitate a fenomenului ereditar, càci cele douà noi' mole-
cule bicatenar'e de' ADN sîn,t identice pe de o parte între ele,
iar pe de altà parte sînt identice cu uurcromolecula inilialà
(parentalà) de ADN ca,re $i-a ,,topit(( iidentitatea în sinteza
rnoleculelor fiice. Primul eveniment a} replicàrii ADN ,este
desfac,erea, separ,area catenelor complementare aLe dublului he-
lix din care cauzà molecula de ADN }'a punctul de replicare
are formà de U, aceastà structurà fiind,,, numità bifurcagie de
replicere. ADN este replicat cu ajutonil unui complex multi-
enzimatic nurnit' ,,aporat de rep1icare66. Ansamb,lul de eveni-
rneur,te care realizeazà, replicar,@ ADN a fost conve,nfi,onal îrn-
pàrlit în inifierea, continuarea Ei terminairea replicàrii, etape
care se pot întîlni Ei în sinteza altor 'rnacrornolecule informa-
fionale' (ARN Ei pro'teine). ADN natural se aflà sub formà de
structurà ter{iarà, structurà în car€, el este superspiralizat. La
eucari,ot,e tururile superspiralizate din ADN liniar rezultà în
urrna asocierii sale cu proteinel,e bazice, hist;one; pe cînd
la procariotele, Ia care macromolecula ADN ,este circularà, tu-
rurile superspiralizate sîn't formate prin intervenlia unei en-
zime speciale care s-a nu,mit ADN Eirazn, aceasta aclionînd
chiar din, m,omentul replicàrii. Tururile superhelicale pot sà
aparà Ei'ca rezultat aI desfacerii (desfaquràrii) dublului helix în

39

r

tirnpul replicàrii. Din cauza vitezel mari cu care ar€ loc. des-
ràsuci{ea dublului helix în fata bifurca{iei d'e replicane, rnai
ales ia moleculele :ci,rcular, .închise rse forrae azà o supe,rspirali-
zare, astfel cà o ,etapà' necesanà, în replicarea ADN ,€ste ,îftd,o.'.
pàrtarea structurilor terfiare superspiializate, În scast, ,proces
intervin enzime care, ralaxeazà, tensiunea de ,,:ràsucire, ,prin
crestat"ea unei catene înaintea 'bifurcafiei gi astupapea ;acestei
crestàturi dupà ce s:-a reaLizat relaxarea. Aceste erìZime, s:€ru
numit enzim,e de crestore-,ast'ttpw€, descrise atît la procariote
cît qi ia eucariote. S-a mai descris Ei ,enzirna Al)N=topoízorne-
TazQ, o enzimà care introcluce ,o crestàturà morl,ocatenarà tran-
zitorie în duplexul ADN, oferind astfei LtR pivot pentru clespi=

raliz.area superhelicelor.

: ì

Pentru desfacerea, ,punfilor" de hidrogen dintre ca'tenele corn,-
plementare în veder,ea replicàrii inlervine o enzinrrà destabili-
zatoal"e a dublului helix care a fost numità unusindszd.,
Catenele compl,ementare separate funcfiori.eazà ca rnatrifà
pentru sinteza de noi cate'ne complementare. Nucleotideie 5'*
trifosf at libere din mediu se aliniazà pe matri{à, împerechín-
clu-se cu bazele complementare d,e pe aceasta cu italbilirea
unor Punli cle hiCrogen. Enzima ADN polimerozq dependen,tà
de ADiV catalizeazà formaiea legàturilor covalente : fosfodies,
terice dintre nucleotidele învecin",ate. Inilial a fost descrisà €rrr
zima polim,erazicà. ADN polimnraza I sau enzi'ma tui Kot*rt-
berg ca avînd rol esen{ial în replicsr'e, dar cercetà,ri ulterioarq
au stalbilit cà ea intervine ,nu*ui într-,o etapà ulterioarà a pr.o-
cesului ar'înd rol esenfial în sinteza rep.ara,torie. As tàzi estg
urnanim acceptatà, interve'ntia în etapele inifiale a;le,. neplicàr:ii
ca Er în alungirea catenei nou sintet íz,a'te a enzim,ei polim,era-
zice dese,m;natà ADN pol,imeroaa III.

,

Toate enzimele polimerazice eu capacitatea de a alungi nu-
mai catene polinucleotidice deja existent,e,,rlu însà'Ei de a ini-
tia sinteza ,,de no'vott ,a unei cate,ne. Pentru aceasta ele rl€ce-r
sità un elem'ent ajutàtor prin car,e se: primeazà (i,nifiazàl o as,e-
rn€rr,ea sintezà. În calitate de primer poate fi folosi,t ,un mic
segment de ARN lung de cîteva nucl,eotid'e. De aceea primul
e'v"eniment în replicare dupà destabilizarea (,,topirea{t) dubtrului
heiix este si'nteza prin in,tervenfia enzimei ARN pattmerazd, 'a
unu$ ARN primer. Acesta oferà ADN polimerwzei un capà't
3'-OFI liber al càrui nuclmtid,este împerecheat cu,o bazà oorn-
plementarà din matrifà. Acurn, ADN pcttimero,za, catalizeaz,&
reacfia de cond,ensare a acestei grupe 3'-OH a prim,erului ,$i
a gr.upei 5'-f,osfat a', primului nucleotid 5:-trifosfa.t a,l.iniat pe

40

rnatritrà,'',cui realizarea primei ,le,gà'turi covalente f,osfodiesterice.
Replicarea ,ADN este ,astfef ini{iatà. Are loc alungirea noii
catene, ;capàtul ,3f-OlI al fiecàrui, nucle,otid aliniat servind de
fiecare datà ca prim,er, din care eauzà catena de ADIV nou sJn-
tetizatà' se mai numeqte Ei ADN primer. Proeesul continuà
pînà 'ce es.te f,olosità întreaga matri!à avînd loc sinteza cîte
unei caterr-e complementare matri$el'or cu forrnàr€a,

. €t douà rno-

lecule fiice identice de ADN.
' Toate' ,ADN pólimerazele dependente de ADN pot cataliza
adàugarea de nucleotide Ia o càtenà primer numai ca ràspuns
(în virtutea eomplementaritàtii bazelor azotàte) Ia secvenla d,e
baze pe'care or gàsesc pe o a doua catenà, batena matri!à. Ast-
fel daeà un grup 3'---OH lib,er de pe o catenà primer stà 'opus
un'ei tirnine pe catena matri{à (ternplate) polim eraza va, per-
mite atagdrea numa,i a unui dezoxiadenozintrifosfat (dATP) la
ca,tena ,pfim€r chiar dacà dCTP, dTTP qi dGTP se aflà fur :me-
diu. Cîttd în mediul de reactje' sé aflà un 'ànnestec confínÍnd
ADN ,polimeraze gi nucleo ztd-trifosfafi împreunà cu fragrnente
dE ADN; ''aceste 'fragrnente pot servi atît ca primer cît qi ca
rn6itfità,. . , ;

Polaritatea opusà a catenelor-matri{à, 3'-+5' a uneia Ei
5'+3' a celeil,alte a, ridicaú problema existentei ,a douà poli-
meraze cane sà dirijeze potiùerizar€a, rtna în- direclia 5':r3' ,
alta în 'directia' 3'+5i, Aici s-a înregistrat dilema centralà a

r.

-.'

a.

'

'

replicàrii ADN dat fiind faptul cà nu au fost descoperite douà
enzime' p-olimeraziee care sà polimeriz'eze în direcfii opuse.
Cercetàri' recente au stabilit însà cà în repliea,re intenvine o
singurà enzimà esen{ialà , ADN polimereza III, car,e are speci-
ficitate de direc{ie, nu de se,cven!à de nucleotide. Astfel, ,aceastà
enzimà se deplaseazà numai în direcfia 3'-+5' pe anlbele ca-
tene-rna,tri!à, determinînd polimerizarea noilor catene (replici-
lor) numai în direc{ia 5'--+3'. Comportamentul polimera'zei III
nu este în acord cu m'odelul ini{ial d'e replicare propus de
Kornbefg, în qare s,e acorda rol ,esenfial enzimei ADN polime-
raza, I, enzimà care ar fi determinat o sintezà continuà a noi-
Ior catene.' Experienle1e de fftfrrcare pulsatorie (pentru scurt
!imp) cu timidi'na tritiatà ef'ectuate de càtre Okaiaki Ei colab.
fntr-e ,19:59-1970 au adus dovezi ,pentru existenta unui model
discontinuu de r,eplicare în care, noile catene sînt sintetizate pe
segmente mici
cleotide, cpre'apoi sîn! urrile prin punli fosÎodiesterice eovaLen-
te ,Frip 'aetivitatéa enzimei, ,ADN-ligwo în segmente mai mari
qi în ultimà instan{à:,reZUltà,'o'catenà continuà nou sintetizatà,

4t

i

I

I

I

I
I
I

I

I

replieà a matri{ei (complem:enta'rà ,ac'esteia). În aces.t caz, sin-
teza fiecàrui fragment Okazaki este prim,atà d,e urr segm,ent d.e
ARN primer sintetiza't prin intervenfia ARN polimerazei. Dupà
sin,teza fragmentului O,kazaki, ARN primer este excizat. Golul
ràmas în urma exciziei este umplut prin activiúatea polim'era-
zei f. La

'nivelul ,bifurcafiei de replicare sinteza fr,agmentului
Okazatki se continuà de pe o catenà pe cealaltà, ADN polflme-
raza III sàrind de, pe .o ca'tenà pe cealaltà Ei det'ermi,nînd pli-
meriza,rea pînà ce întîIneqte originea ,replicàrii în cazul pri-
mului s,egment replicat sau bariera segmentului ADN deja
r,epJicat în cazul urmÉúoarelor segrnente replicate. În ,acest caz
intervine o ,enzimà grtdonuclewicd, care deterrninà o incizi.e ,rno-
n,ocatenarà în segmentul ADN nou sintetlz.at ce s'e continuà de
pe ,o catenà pe cealaltà în urma càreia apare un capàt reactant
S'-OH fàcînd ca procesul de replicare sà s,e continu€, iar bi-
furca{ia de replicare sà se deplas,eze secvenfial de-a lungul în-
tregii matrife avînd loq o progresivà desfàEurare a dublului-
helix (Fig. 24A). Acesta este modelul ,,cufitului qi furcul,itei"
propus de R. Barzilai qi C. Thomas ca o variantà a modelului
pr'opus d'e Okazaki qi colafboratorii în ca,re în cadrul sintezei

A

?

B

3'

,"/ 5'

g

t'/

y,,/

3',

tit5'
3;

1'j

r

3'l

I

ctt

'lt

3'f

"5{

Fùg. 24A. Replicarea ADN dupó mod.elul Okazaki-Kornberg. Se prezintà o
secvenfà de evenirnente (a-d) de despiratizaÍe 9i de replicare segmentat5- la
nivelul bifurcafiei uuui dublu-helixADN.ADN-polimeraza catalizà;sinteza ADN
numai în direcfia 5'-+-3', d,eplasîndu-se pe ambele catene-matrifó d.oar în direcfia
3'-;-5', sórind., 1a nivelul hifrrcafiei de pe o catenó pe celattà, a) Despíralizarea
dublei-elice (blocurile negre reprezintó puncte de inifiere a segmentelot Okazaki
putînd fi scurte fragmente de ARN-prímer). A gi B reprezintà catenele-matflla.
b) Pe mà,sura despiralizàrÍi, o po$iune din catena B ràmîne tenporar sub formà
înonocatenaró pînà ce o nouó moleculà de ADN polimerazó pàtnrnde la nivelul
bifurca$iei spre a umple golul. c) ADN polimeraza determinà pe catena A (cate-
na hdding :

"**;,:1!fi#;fl:r ;nHffiJf ,:**,*,:ffi:' B (tagging :

42

discon'tinue se sintetizeazà segmente scurte de ADN ataEate la
matri{à numta,i prim intermediul punfilor de hidrogen. Dupà o
scurtà perioadà de sintczà, pe una din matrife, un segment mo-
nocatenar al, celei de-a doua catene parental,e (matri!à) stà
expus. Intenrine o & doua molec,ulà de, ADN pol'im,erazà. la ni-
velul bifurcafiei qi copiaz.à acest sqgment expus al celei de-a
douà ''maf'rite''în direcfie invensà fata de prirna matri!à (data
fiind plari'tatea lor opusà) dar în aceeagi direefie ehimicà per-
misà, adicà 5'+3' ca pe prima matri!à.
Mode.lul de replicare discontinuà propus de Okazaki a fost
unanirn aca€ptat qi s-a dovedit a fi aplicabil la toatq siste,mele
biologice. Este posi'bil ca repficarea pe o caùenà sà fie înaintatà
(sau unires segrnentelor Okaraki sà fie mai rapidà) iar pe cate-
rur comple,mentanà sà fie rnai întîrziatà (Fig. 248).
Replicarea este' reac{fa' cea mai importuntà din lumea vie Ei
desfàqurarea ei cade, dupa cum este Ei firesc, sub incidenla
unui strict control celular. Controlu,l este efectuat la mai
rnulte nivele. L.a, nivel molecular existà mecanisme care asigurà
oorecfia repli,càrii càci o bazà azntatà, greEit î,mperechea,tà cu
b,aza complementarà din ma,tri!à face ca desfàqurarea polime-
rizàrii sà nu fie continuatà pîd c€ nu este îndepàrta'tà baza
aaotatà gregit împerechsatà. La beza unei asemenea activitàti
de corecfie stà re pare activitatsa ADN polimerazei f. Greqetile
de încorporare datorate acfir.rnrii unor agenfi mutageni sau iare-
fieaciúàîii în corecfie a ADN polimerazei I stau l,a baza unuia
dintre ,mecanisme,le de apari{ie a m'utafiilor.
Dacà la ,:ptrocariote (bacteriii , astilLomicete) replica,rear nu
sste restrînsà la o f.azà, anume a, 'ciclului' celular, €B fiind po-
tenlial continuà în condilii optime de'mediu pe parcursul între-
gutui ciclu :celular, la eucgriote replicarea este restrînsà la o
f.azà, b,inó delimitata a ciclului celular plasatà în interf azà. Ei
care a fost numità fazo de sinúezd ,S. Durata fazei S este va-
riarbità nu nurnai 1,& diferitele specii dar Ei în cadrul aceluia$I
individ la nivelul celulelor afliate în difeite stadii de dezvol-
tar,e, fiind mai scurtà în stadiile timpurii ale em,briogene zei
fatà de celulele somatice diferenfiate. I),e as€rr€nea faza S pre-
rnergàtoare meiozei este foarte lungà comparativ cu aceea din
ciclul mitotic.

Cnornozornii euca,riotelor reprezintà totodatà structuri com-
plexe în care ADN este permanent complexat cu proúeine ba-
zice de tip histonà. Replic,ar€,a, cromozornului eucariot se reali-
znazà, asincron nu num,ai între diferiti cromozomi n@mologi ai
comple'm,entu'lui cromozomal al unei oelule dar chia,r la urivelul

43

SrpiìiJft3 cafenelo,c

T

toroftint rtP' 3''5')

loooitomerat
J finN grretà)

Ftla.xarea AI)N-

ARtí Pnmen -

E longerea,t2/erter

î,0*tderra tovalcnti I
ttle nei

tte lirerò

3' 5*

-

Probrn desbÚi lita foars
Í aheiiwlui A0N {fr0P)

-

Frt,nîld (frùlîutd rin':tî 'n

, nrornlhr molr/
- ''(

n"o"'na dna 8J

A tl N

,toliate,'du fi

-

* fltt; l{
('P ilt tt H ; e x tt:;utfea Í,t
Slalîh'P'súm€rttù t'ì

- l'8 tl pilìnenta !

-l- t Dtt liyn

Sryerspinali taret

I 0/1/

-fr-,1,/;i,:r":,:í:

.

i.Èb J l't-^).íol"r-r-,

\

$,'(,ii,í,.7).,,J;

Fig. 24. B. SCHEX,IA COM?LEXULUT ENZTMATTC CARE pAnrrcipìt.
/N REPLICAREA ADN.' pentru simplificare se aratà" în detaliu doar sinteza
catenei. succesoare (,,lagging") eare, spre ,deosebire de catena directoare (,,lea-
9irg") are o direcfie de sintezà opusó direcfiei de migcare a bifurcaliei de replicare-
In dreapta schernei se redà d,enumif,ea proteinei sau enzimei particlpante în ,re-
plicare, iar în stînga se trece funclia pe care aceasta o ind.eplinette. În paran-
tezI- este trecntà denumirea enzimelor sau proteinelor detectate la bacteria'F..

coli.

Relaxarea ADN este neeesarà spre a permite înaintarea bífurcafiei tlo repli-'

9a1e, îngreunatà de torsionarea duplexului circutar ADN. Aceastà torsionare este
îndepàrtató prin ac!íunea unor enzime care au capacitatea cle a introduce crestó-
turi monocatenare tranziente în duplexul ADN eeea ce perrnite rotatia liberà în
jurul celeilalte catene. Aceste enzime s-au nurnit inifial swivelazà (pivota za,l ,
enzirnà de crestare-închiclere, enzimó de relaxare a ADN sau unwind,azd, dar
acum poartà numele de topoizomerazd, ADN, însemnînd enzimà ce deterninìl
schimbàri în conformalia macromoleculei ADN. Topoizoyneya,za, are d.ouà subuni-
tàti ce constituie un tetramer. Una din aeeste subunitófi funclioneazi ca topoizi-
rnerazà- propriu-zisó adicà ca enzímà de relaxare, fiind sensibilà la acid nalidixic-
un foarte eficient inhibitor al replicàrii ADN, pe cînd cea d.e a d.oua subunitate
a topoizonerazei acfioneazà ca ADN girazd, sau proteinà, omega, introd.ucînd tururi
superhelicale în ADN nou sintetizat.
Hel'icaza ADN realizeazà separarea catenelor prin ruperea punfilor d.e hidro-
gen folosind energia provenitó prin defosforilarea ATP dependentó d.e ADN.

44

unuia qi aceluiaqi cr:orn,o z,o,m. Crom'ozomul eucariot este deci o
structurà multirepliconicà, prezentînd la nivelul sàu mai multe
puncte C,e ini{iere ,a replicàrii.
tlu,bermann qi Riggs (1968), extragnnd ADN din celulele
,,Hela(i marcat pulsatoriu, au màsurat lungimile varia'te ale
seqmentelor marca'te pulsatoriu reuEind sà calculeze cà viteza
de repii,care este de L pm/minut (la E. eoli aseasta este de 30
1rm/minut). IJn cromoz,om 'uman de lungime medîe ane circa
30 000 um ADN iar cromozomul eucari,ot are a singurà mole-
culà de ADN. Dacà neplicarea ar fi iniliatà la un capat al er,o-
mozomului qi s-,Br desfàEura secventral spre celàlalt capàt ar
fi necesare 500 ,ore pentru replicar,ea ADN al unui crorn,ozom.
Dar se gtie cà replicarea are loc în 6-8 ore. Aceasta a adus
încà c clovadà cà la eucari,ote cromozomul ,are un numàr mars
de unitàli de replicare de lungimi diferite cu un aornporta-
ment retrativ independent în replicar,e (Fig. 25).
Distribufia produEilor cle replica,r,e (cr,ornozomii fii) se reali-
zeazà, La eucariote prin intervenlia unui complex mecanism
mit,otic care este strict controlat ereditar. Replicarea ADN este
supusà unui control riguros, la nivel molecular, dar €a cade

<-

Helicaza de E. coli se numegte protcina re/, qi ea se deplaseazó pe monocatena
ADN în direcfia 3'* -5' îndepàrtînd catena complementaró, pé cînd helíca.zc III
se deplaseaz[ în direcfia 5'+-3' avînd. aeeeagi acflune. Acfiunea lor complementerll
este facilitató de prezenfa proteiuelor neenzimatice unafindoze FIDP) sau protei-
ne d.e topire a duplexului ,.tDN. Aceste proteine asigutó stabilizatea monocaterer
lor spre a putea servi ca matrife.
Sinteza fragmentelor Okazaki este iniliatà prin sinteza unui ARN prirner
catalizatà de enzima ADN primaza (ARN polimeraza) prod,us al genei dna G
care acfioneazà sinergie cu produsul proteinic al genei dna B. Proteina dna B
este o AîP- azd depend,entó de ADN care se deplaseazà pe matrife folosind energia
eliberató priu defosfotilarea ATP. Ea marche az6, la anumite distanfe pozifiile
pentru sinteza primerului de càtre ADN primazà,, din care caazà, s-a numit ,,proîno-
tor mobil".

Dupà primare se realizeazà, elongarea catenei (polimeizarea uucleotidelor)
sub catalíza ADN polimerazei lff. Elimiuarea primenrlui ARN se face sub acfiu-
nea RNceai I{ sau a activitàfií exonucleazice 5' a ADN polimerazni f.Golul rAmas
dupà excizia primerului este umplut prh acfiunea polímerizatoare a ADN poli-
vnerazei f . Intervine apoi ADN ligaza care tealizeazà, închiderea covalentà a
catenei (unirea prin punti fosfodiesterice a fragmentului Okazaki recent sinteti-
zat cu cel preced.ent, realizind.u-se astfel treptat sinteza unei catene urtice
catena nou sintetizatà sau replica). Dupó teahzarea replicàrii intervine ADN
giraza sau proteina omega spre a conferi moleculei fiice d.e ADN starea supespirali-
zati, stare care este normalà, stabilà, fiiud. cerutà se pare d.e funcfiorarea sa
în replicare, transcriere gi recombinare (Dupà WACKERNAGEL, 'W'. 1980
Replication (in :) Progress in Botany, Springer-Verlag, Berlin, Heidelberg,

NewYork, 154- 170).

45

F

.

puncf -

ount r
[ -" "

terninal

lernrnàll

ca nui.,

gún cl
t

^rninal

I untlatea dP t unilaf ea de ,
FreplicarelT'-- repticare Z

-1
calena nou stnlelizatà

t

l#.r ;îffilF

,-ÉSffit*'

Fig. 25. Modelul lui Huberman gi Riggs (1968) d,e replicare a, ADN eucaîiot.
Sînt reprezentate douA unitAfi de replicare adiacente care apar ad.esea $í în imagi
nile autoradiografice ale fibrei de cromatfutà. Cele douà unitàfi de replicare desem-
nate I gi 2 au fieeare cîte un pnnct de inifiere a sintezei ADN 11, respectiv
fr, la nivelul càroîa se corctituie în timpul replicàrii buclele de replicare {ochi de
replicare) corespunzAtoare. Fiecare unitate de replicare are un punct terminus
indicat prin baie transversale. a) Inainte de reptcare. b) Replicarea a început
în unitatea 1 dar nu încà. în uuitatea 2. c) Replicarea este completà ùr unítatea
1 ti a început în unitate a. 2. d) Replicarea este completó în ambele unitàfi. e)
Dublu-helixurile fiice separate în punctul terminal comun dar sînt încé unite
cu segmentele ad.iacente. În d.reapta se îeprezintà, schematic , ,grainuritre" obser-
vate în autoradiografie.

Si sub incidenfa un,or semnale venite din citoplasmà. În urrna
ulÌ,or fuziuni cel,ulare dintr,e celule a'flate în S Si GL are loc o
sintezà prernaturà de ADN în nucleul aflat în GL urmatà de
oondensar,ea prematurà a cr,omozomilor. Condensarea crornati-
nei crom,ozomale poate duce la aooperirea $i deci la reducer€a
numàrului unor punct,e de inifiere a replicàrii. Cr'omatina con-
d,ensa,tà numità heter'ocr,omatinà prrezintà o replicare tardivà în
faza S comparativ cu cromatina difuzà eucnomatina.

46

:

I

i
I
i

I

F

t

t

L

ADN are capacitatea de a exercita un anumit autocsrrtrol
ai replicàrii sale, prin care este prevenità reactivarea secven-
lelor de inifiere imediat dupà ce acestea au funclionat în r-.epli-
care. În acest proces de autoc.ontrol un rol esenfial se pare cà
îl au diferitele fracliuni de ADN saúelit (secrien!,e simple de
ADN, dar înalt repetate localiza'te de regulà la nivelul regiuni-
lor centromerice) dar mai ales ADN cu secvenfe mijlociu re-
pelate, incluzînd secvenf,ele repetate cu simetrie rotatorie in-
versà numite palindroarne de tip ABC XY C'B'A', precum gi
secrrente poli

- (AT) de vreme ce ADN satelit nu se afla Ia
toate speciile. Un rol esenfial în replicarea ADN îl joacà sin-
teza ARN sub cata"liza ARN polirnerazei, acest ARN condifio-
nind inifierea repl.icàrii ADN, fiind se pare vorba de un ARNm
de ini{iere la ,eucariote. Replicarea ADN este însofità gi de sin-
teza d,e proteine histonice.
Cei mai important este însà reglajul genetic al replicàrii.
La eucariote existà un control i"ntracromazornnl aI rephcarii.
Tofi repliconii dintr-un cromozom eucariot, avînd dimensiuni
diferite, trebuie sà funcfioneze în cadrul aceleiagi perioade S
din inberfazà, repliconii de la nivelul heterocromatinei (bogatà
în AT) funclionînd spre sfîrgitul acestei perioade S, ,pe cind
cei d,e la nivelul eucromatinei (bogata în GC) funcfioneaza la
începutul acesteia. Cromozomul Y de drosofilà, care este în
cea rrrai mare parte heterocromatic, se replicà mai tîrziu fa!à
de ceilalfi cromozomi gi acest lucru este valabil Ei atunci cind
are loc trarrslocarea unor pàrfi ale sale în cromozomi ,eucrotna-
tici. Acreasta înseamnà cà pàrlile cromoz,omului Y confin in-
formafia care regleazà timpul replicàrii 1or.
La eucariote replicarea ADN nuclear Ei extranuclear este
reglatà gi Ia nitselul celular. Pentru replicarea ADN este nece-
sarà enzima tirnidinkinnzd. care este sintetizatà înainte de mi-
tozà qi este hidrolizatà sau inactivatà dupà realizarea repiicàrii.
Sinteza ADN inceteazà cînd s-a atins nivelul 4 C, ceea c€ pre-
supu,ne un mecanism fin de control celular al replicarii ADN.
În dezvoltarea timpurie a ovulelor are loc replicarea nu-
clearà fàrà a avea loc replicarea celularà. Toate cazurile de
endoreduplicare, poliploidie Ei polinemie aratà absenfa unei
coordonàri replicare ADN

- diviziune nuclearà sau celulara.
Faptul cà replicarea ADN este dependenta de factori cito-
plasnatici este demonstrat de constatarea cà nucleii dfun neu-
ronii adulli nu sintetizsazà ADN ln mod nor,mal. Daca însà

17

acesti'nuclei sînt transplantafi în ovule activate partenogene-
tic ale.aceleiaqi specii, in aceEti nuclei are loc replicarea ADN
la numai o orà de la transplantare. De asemenea, cînd nuclei
din blastula medie care sintetiz,eazà ADN sint transplant'ali
în ovocite in creqtere care nu mai sintetizeazà ADN, nucleii
transplantali înceteazà sinteza ADN.
Cînd 1à celulele ,,HeLa" se asociazà experimental nuelei qi
citoplasmà din stadii diferite ale ciclului celular sinteza ADN
este iniliatà numai dacà nucleii din G1 sînt piasali în cito-
piasma aflatà în faza S.
S-a tras conluzia cà citoplasma S trebuie sà oonlinà
unul sau mai mu1!i factori care promoveazà sinteza ADN nu-
clear. Este posibil ca aceqti factori citoplasmatici sà aibà ori-
gine nuclearà.

Replicarea ADN este reglatà de asemenea la niuelul ,tesutu-
rilor gi organelor. Sînt date. dupà care evenimentele desfà$u-
rate la nivelul rnembranei nucleare pot influenla sinteza ADN
nuelear. Desfàqurarea mitozei, frecvenla diviziunii, orientarea
fusului mitotic, incapacitatea anumitor cromozomi sau pàrti din
cnomozomi de a se distribui în timpul miùozei, frecvenla re-
oqmbinàrii mitotice ca qi distribufia cromozomilor în meiozà
în urma sinapsei cromozomale sînt controlate genetic.
Antplif icarea genícd. sau extrareplicarea anumitor segmente
din ,$rrori, in special a genelor riibozomale, se desfàgoarà atît
în celulele diploide cît qi în celulele endopoliploide ducînd la
sinteza unui ADNr amplificat, labii metabolic, fiind degradat
dupà ce Ei-a îndeplinit funcfia de transcriere (sinteza AIINr).
Reoent, Mihàescu Ei Gavrità (1980) au evidenfiat fenomenul de
amplifioare a genelor ribozomale în celulele de rnamifer în
culturà infectate cu adenovirus, tratate în prealahil cu tioace-
tamidà. Uneori ADN amplificat nu este transcris aga cum este
cazul cu ADN de la nivelul pufelor insectelor Scinride sau dacà
este transcris, ARN sintetizat nu este transportat în citoplasmà,
aoest ADN arnplificat, r,epetitiv, l.,ocalizat de regulà la nivelul
regiunilor heterocromatice ale genomului putînd juca în prin-
cipal rol reglator.

Hormonii animali gi fitohormonii pot juca un rol important
în determinarea unei replicàri diferenliate a ADN. Cromome-
rele cromozomului eucariot al càror ADN suferà o replicare
amplifioa€ de ADN s-au numit arnpliconi. Amplificarea ,si sub-

48

replicarea nu sî:rt fenomene alternative, ci coexistente. Astfel,
în celulele suspensorului embrionar de la Phoseolzs se aflà
cromozomii politeni, la nivelul càrora apar,e un fenomen de
amplificare genicà a ADN satelit. În acelaEi timp apare un
fenomen de subreplicare a segmentelor ADN car,e cuprind ge-
nele ribozomale. Conlinutul total de ADN nuclear apare însà
ca un multiplu al valorii diploide.

{ - Desclfrlnd taiuele ereditàlii, vol. I

F

Capitolul II

STBUCTURA ARN $I TBANSCBIEREA GENSIICA

1. GENENALTTATI

ADN are douà funclii pri,mare: funclia autocatalitica, reali-
zatà în proeesul replicàrii saùe gi fu,nclia heterocataliticà realizatà
în procesul de sinteza de molecule specifioe, în spetà proteine.
Dacà ADN reprezintà substanfa macromolecularà cu fiurc-
lie primarà ereditarà, ARN este implicat în realizarea decodi-
ficàrii informafiei ereditare care are loc în procesul de biosin-
tezà proteinicà, cînd secvenla de nucleotide din ADN este mai
întîi transcrisà în ARN mesager gi apoi tradusà în secvenla de
aminoacizi a catenelor polipeptidice. Incà din anul 1952, A.
Dounce a aràtat pentru prima da,tà cà ADN îqi îndeplineqte
funcfia heterocataliticà în douà etape: transcrierea qi tradu-

cerea mesajului genetic.
Ca qi ADN, ARN este o substan!à rnacromolecularà, poli-
mer al unor ribonucleotide, avînd de regulà structurA mono-
catenarà. Axui principal ai monoca'tenei este reprezentat de o
ooloanà glucidofosforicà ia care sînt ataEate hazele azotate (Fig.
26). Ca pentozà, în ARN intrà D-ribozo care spre deosebire de
2-deoxi-D-riboza din structura ADN, are patru grupàri hidro-
xil. Bazele azotate din ARN sînt douà Tsurinice Adeninn qí Gua-
nirn qi d.ouà pirimidinice Citozina qi Uronil. Deci locul timinei
este luat ín ARN de uracil (U) care prezintà complementarita,te
pentru adeninà. Legaturiie fosfodiesterice creeazà o anumità
polaritate a monocatenei ARN care va prezenta un capàt 3' Ei
altul 5'.

ln structura ARN, în afa,ra rbazelor tipice ma'i pot intra Ei
alte baze, unele modificate dintre car€ oomun este nucleotidul
pseudouridina qi dihidrouracilul mai frecvente în u,nele tipuri
de ARN. În cazuri foar,te rane, în structura ARN indrà Ei ti-
mina.

50

ccdtut s' ,--*-ill

ó *.\

Jt )^ Adeninè

t

'N- -l.l

O-P-O-Cl+ I

J' t'..1

\-i4

NHr

I I Hc-coN
? ot

,è. -A- citozinó

oGP-o-cH, 'N- ì

d'

ir...l

I\-,4 ?

I I rN',/\Nu

''r-lrJt'A*oé-*"

ó,

(l!

À Àr tf"-ì*

o'É- o - Ct*j*-N'c-'o

ri

Gucni;rè.

Urocil

00H

I

O -p- O-CHe

ót j*,ó,u'r'

Fig. 26. Formula chimicà a uaui poliribonucleotid,

Spre deosebire de ADN, ARN prezintà o mare heterogeni-
tate structural-f uncf ionalà.
Degi în general structura ARN este m,onocatenarà, acesta
poate prezenta prin pliere în urma potrivirii de secvenfe com-
plementar,e, regiuni bicatenare l,a nivelul càrora apar perechi
de baze azstate unite prin punli de hidrogen.
Unele riibovirusuri prezin,tà în mod normal ca miez de acid
nucleic ARN bicatenar cum este cazul reovirusului. De aseme-
nea diferitetle tipuri de ARN celular înspecial celribozonwl qi

51

F

l.

de transfer pot prezenta regiuni bicatenare, separate de regiuni
monocatenare.

Datà fiind structura principial monocatenarà a A.RN pro-
porfia de baze complementare A-U Ei G-C nu realizeazà de
regulà raportul unitar. Monocatenele ARN au formà liniarà,
nefiind încà decelate molecule circulare de ARN. Numàrul de
nucleotide ce intrà în structura diferitelor tipuri de ARN va-
riazà între 75 qi 10.000.
Se pot distinge douà categorii esenlial diferite de ARN:

AIIN uiroZ

- materialul ereditar al ribovirusurilor Si ARN

celukr

- molecule care intervin in decodificarea informa{iei
ereditare qi traducerea sa in secvenle aminoacidice în proce-
sul de biosintezà proteinicà celularà.
ARN uiral. Este ARN care ca Si A"DN este inzestrat cu func-
lie geneticà primarà qi anume funcfie de depozitare a informa-
tiei ereditare Ei transmiterea sa în generafiiile virale succesive
prin replicare. Se întîlneEte la unele virusuri vegetale, (\IMT),
la unii bacteriofagi (Qf3, R 17, MS,;), unele virusuri animale
(polio, virusuri poliedrale citoplasmatice de la insecte etc.).
Cantitatea de ARN viral reprezintà I0/o din greutatea particu-
lei virale cum este cazul virusului influenza sau 6olo î,n ca-
zul VMT.

De regulà ARN viral este monocatenar (VMT, virusul gri-
pal, polio, fagi Qp, R17 ; F2) sau bicatenar cu catene corr*pì.emen-
tare (reovirus).

ARN celular. Acest tip de ARN nu codificà informalie gene-
ticà qi este sintetizat pe matri!à ADN, adicà transcrie infor-
matia geneticà. Niciodatà î,nsà ARN celular nu îndeplinegte
funcfie de matri!à pentru pr"opria sa sin'tezà, deosebinclu-se
principal de ADN sau de ARN viral. El îndeplineqte însà func-
{ia de primnr în replicarea ADN.

2. TIìANSCRIEBEA GENETICA

Transcrierea geneticà reprezintà un prooes complex desfà-
qurat în mai multe etape, în care pe matri!à de ADN se sinte-
tizeazà. mon,oca'tene ARN, asigurindu-se transferul informa-
liei genetice de la ADN la ARN. În cadrul procesului enzima
numità AP"N polimerczd,

- dependentà de ADN

- recunoaqte
secvenle specifice de pe matrila ADN gi catalizeazà polime-
rizarea unor ribonucleotide trifosfat libere, aliniate pe matrila

52

ADN in virtutea complementaritàlii de baze azotate de tip
A-U, T-A, G-C, C-G, primul partener a1 perechilor fiind
lrerze azotate di,n ADN, al doilea fiind baz,e 'azotate ce .sînt in-
cluse in catena polirilbonucleotidicà. Matrifa Ei catena poliri-
bonucleotidicà nou sintetizatà formeazà un hibrid molecular
ADN-ARN temporar, prin intermediul pun!ilor de hidrogen
din'tre bazele compl.ementare. Ca substrat pentru ARN polime-
razi servesc cei patru ri,bonucleotidtrifosfati ATP, GTP, CTP
Ei UTP. ARN polimeraza, spre deosebire de ADN-polimerazA
are capacitatea de a inilia sinteza ,,de novos a unei catene po-
linucleotidice fàrà a neoesita prhTter. Cel mai bine studia,tà este
ARN polimeroza bacterianà.
ARN polimeraza bacterianà este o enzimà compl'exà alcà-
tui,tii din 2 su'bunitàti a, o su,bunitate B, o subunitate $' Ei fac-
torui alosteric o. Ba are o greutate molecularà de 495.000 dal-
toni. Holoenzima se poate separa în miezul enzimatic gi facto-
rul o. Factorul o este factor de inifier,e, ,el fiind acela care re-

cunoaEte ,o

secvenfa specificà din ADN (promot'ord), condi{ion'înd
form,area comptrexul,ui ADN-ARN polimwazà,. Dupà inilierea
sintezei ARN factorul o se desprinde de pe holoenzimà Ei se
poate asocia cu un alt miez'enzimatic càruia îi oonferà specifi-
tate pentru matrita ADN.
Procesul de transcriere cuprinde ca qi în cazul replicàrii.
ADN o fazà de ini{iere a catenei ARN, o fazà, de elongane Ei o
fazà de terminare a transcrierii. Fiecare fazà se desfàqoarà prin
inlervenlia anumitor factori de inifiere, de elongare qi de ter-
minare. ARN polimeraza esùe dependenta de ADN, ceea ce
înseamnà cà ea func{ioneazà numai în prezenla matritei ADN.
Caiena din duplexul ADN care funclioneazà ca matrifà în sin-
feza ARN, care 'este deci transcrisà, se numeEte catend sena.
Procesul de inifiere a ,transcrierii pnesupwre mai întîi pre-
inifierea în care are loc formar,ea unui complex molecular ADN-
.ARN polimerazà, enzima recunoscînd prin facúorul 6 o sec-
.ientà specificà din matrifa ADN cu care se asociazà intim.
Urmeazà apoi formarea complexului de iniliere propriu-zisà a
transcrierii Ei în care este iniliatà polimerizarea secvenlialà a
ribonr-rcleotidelor cu desfàSurar€a alungirii catenei polirlbonu-
cleotidice (ARN), prin formarea de punli fosfodiesterice suc-
cesive. Transcrierea poate fi prezentatà astfel:

ATP -i- GTP + CTP + UTP :

matri!à ÀON

- ARN

ARN polimerazà

+ PPt (pirofosfat)

53

Creqterea catenei ARN are loc prin formarea punfilor fosfo-
dieterice succesive în direc{ia 5'-> 3', adicà prin* adilia unui
ribonucleotid-5'-fosfat la capàtul 3'-OH al ri,bonucleotidului

precedent.

Formanea punfilor fosfodiesteriae (alungirea catenei ARN)
este catalízatà de miezul enzimatic al ARN polimerazei.
Ribonucleotidul inifiat 5' al unei catene ARN este de obicei
un ribonucleotid trifosfat purinic (ATP sau GTP) care îgi pàs-
tr€szà toate grupele fosfat. Aceasta înseamnà cà în rnatri!à, l,a
situl de iniliere a transcrierii diferitelor catme ARN se aflà
fie dezoxitimidinmonofosfatul, fie dezoxicitidinmonofosfatul,
ceea ce înseamnà cà o glupare de pirimidine în ma,trita ADN
a,r putea c,onstitui situl de ini{iere a transcrierii ARN, recu-
noscut de càtre transcriptazà prin facùorul o.
Situl dín ADN la care se atageazà ARN polimeraza qi a cà-
rui secventà este recunoscutà în rnod specific de factorul o s-a
numit pro,motor. El reprezintà o regiune micà dfur matrita ADN
de pîlrà la 50 nucleotide lungime, localizatà imediat înaintca
genei sau grupului de gene a càrei informa{ie geneticà hrelbuie
transcrisà în ARN. De refinut cà secvenfa promotorului nu
este transerisà în ARN. Studiimd inifierea transcrierii ARNm
specific pentru enzirna p-galactmid,azd., Gilbrt qi Maxarn au
staibil,it în 1973 secvenfa de baze din punctul de inifiere a sin*
tnz,ei ARNnz care este urmàtoarea:

I

5',..... TGGAATTGTGAGCCGATAACAATTTCA 3'

3',

Inifierea sinúezei ARNnz pentru F-golnftozidnzd este indi-
catà prin sàgeatà. Se poate cons'taú.a cà s;ec'venfa de baz"e, cores-
punzàtoar,e sitului de iniliene a transcrierii este bogaúà în pe-
rechi A-T. Inilierea transcrierii poate fi ur-hirbatà în mod spe-
cific de anti,bioticul rifampicinà la procariote sau a-amanitinà
Ia euoariote.

$i alti factori sînt impl,icafi în controlul inifierii transcri'erii,
cel mai important pentru bacterii fiind factorul proteinic CRP
(proteina rreceptoa,ne a cata,bolitului) numità încà factor CAP
care reprezintà proteína receptoare a AIVIP ciclic, acest nucLeo-
tid monofosfat ciclic avînd rol important qi multiplu în, reacfiile
biochimice lega,te de deoodificarea informaliei genetice. Aibsenfa
CRP sau chiar a AMP ciclic duce Ia descreEterea vitezei de
initiere a transcrierii qi ca urmare a sintezei ARN.

54

Desfàqurarea ,transcrierii (elongarea catenei ARN) se reali-
zeazi cu o vitezà, de 60 ntrcleotide pe secundà, dar viteza de
transcriere poate fi influentatà de lnsàqi secvenfa car,e tnebuie
transcrisà, acesta fiind chilar un rnecanism de reglare a franscri-
erii. ElongaÍea catenei ARN este inhibatà specific de catre anti-
bioticul streptolidigina, care ar'e afinitate pentru ARN polime-
razÀ, inactivînd-o. Aaelaqi efect are acliuniea acúinomiciÍtzi D.
Terminarea si;ntezei ARN esúe dírectà, condilionaÉ de întîlni-
rea de càtre compl,exul tripartit de ,transcriere ADN

- miezul

enzimatic al ARN polim,erazei

- ARN nàscînd, a unui sit de
tgrminare din cadrul secvenlei ADN ce este transcrisa cu eli-
berarea catenei ARN adicà a transcriptului qi dezorganizarea
complexului de transcriere. Transcriptul ARN începe la capà-
tul sàu 5' cu o aga-numità sectsenló ghid sau cozducdtmre (lea-
der) care poate avea pînà la 150 de ibaze

$i include qi comple-
mentul operatorului (vezi reglajul genetic) sau al unei pàrli a

aeestuia.

T,erminanea transcrierii însà poate avea l,oc prin intervenfia
unui factor proteinic care a fost desem,nat factorul de termi-
nar€ q (rho) care este alcàtuit dín 6 subunitàli identice aranjate
în cerc gi care are capacitatea de a se lega Ia ARN pli.marozó.
spne a înceta transcrierea la nivelul unor bariere naturale al.e
transcrierii care apar în ADN reprezentate de secvenfe speci-
fice de nucleotide localizate fie în cadrul secvenfei unei gene,
fie intre gene adiacente. Sinteza ARN se desfàqoarà polarizat.
Transcrierea începe la capàtul 3'-OH al matrifei ADN qi sin-
teza ARN se d,esfàEoarà în direcfra, 5'

-+ 3'. Rezultà deci, cà
atrila gi transcriptul sînt antiparalele. În vederea transcrierii
are loc ,o desfacere localà a dublului helix ADN î:r zona ce ur-
meazà a fi transcrisà qi apare astfel a$a-numítul ochi, de fiqrn-
sqie:re. Pe màsurà ce transcrierea se desfàgoarà, în urma se re-
face structura dublu-catenarà a ADN Ia parametri sài inifiali.
Desfaoerea localà în transcriere poate fi folosità Si în rreplica-
rea ADN.

In uiuo transcrierea este ,asimetricà adicà doar una din cele
douà caúene ale dublului helix ADN serveqúe ca matri!à pentru
sinteza ARN. Dar acest lucru nu însea,mnà cà în toate cazurile
una gi aceeaqi catenà ,a ADN este activà î,n transcriere ian cea-
laltà este inactivà. Pentru o genà datà sau un grup de gene
(vezi operonul) o catenà ADN este activà în transcriere iar ca-
terra complementarà inlactivà, pe cînd, pentru altà genà sau alt
gnup de gene aceeaqi ca0enà ADN poate fi inactivà iar catena
complementarà poate fi activà în transcrier,e. Dar dacà un

55

sqgrnent al unei catene ADN este activ în,transcriere segmen-
firl corepunzàtor de pe catena oomplementarà este în mod ,de-
terminat inactiv î:r transcriere. Altfel s-ar sintetiza douà ,trans-
cripte care prezentînd oompl'ementaritate ar duce la formare de
structuri bicatenare ARN, de regutà inaetive în dirijarea sinte-
zei pro0einice. Faetorul o joacà rol esenlial în selocfia catenei
active; càci în absenfa sa miezul enzimatic al ARN polimerazei
nu prezintà specificitate de secventa Ei catenà, putîndu-se l,ega
la orice secven!à a oricàreia dintre cele douà catene ale ADN.
În prezenla factorului o însà, ARN polimeraza capàtà capaci-
tatea de a recunoagte secvenfa specifieà de p mtena selÉ ce
trehuie transcrisà.

În naitocondrii s-a stabilit existenfa r,rnei transcrieri gen,etice
sirnetrice, am'bele ca,tene ale ADN mitocondrial fiind ac"tive în
transcrie're, dar int'ervine Ei aici un mecanism specific car',e de-
grad.ea,zà rapid unul din cele douà transcripte.
I"a procariote produsul imediat al' transcrierii s-.ecvenfelor
din ADN ce specificà sinteza diferitelor proteine este un ARN
rnesaEer policistronic, adicà care conline transcrisa informafia
g_enetiqS pentru mai multe proteine, sistemele dc transcrierg $i
de traduc€re fiind intirn cuplate (FiS. 27), f.apt care Du se. evi-

Fig. 27. Transcrierea gi traduceîea mesajului genetic la procatiote sînt freev'efiLt

rt'l

,'. .,:'

56

E

8-,..

6f;"':r::r

ientiazà la eucariote unde transcrierea are loc în nucleu iar
t:aducerea mesajului genetic are loc în ciúoplasmà, la nive-
-u. ribozomil.or. La eucariote pr,oduEii imediali ai transcrierii
sint mult mai mari decît produEii maturi astfel cà ei sînt su-
pugi unor prelucràri posttranscripli,onale prin care sînt pe de
..' prrte modificate unele baze azotate (metiiare, acetilare etc.)
-'r sint ,excizate anumite secvenle de baze azotate iar uneori
a:iugaie unele secvenle specifice de ,baze (adenilare). În urma
ai-€s[oi prelucràri posttranscrip{ionale, ARN rrlesagter frrea.ffsor
e:::ariotic clevine un ARN masager mnnocistronic ma,tur care
jeline informalia ce specificà o singurà catenà polipeptidicà.
!: :'eglarea transcrierii intervin factori inductori Ei repnesori
:ine evidenfia{i mai ales la procariote. La eucariote transcrierea
-lDli din cromozomi este dependentà de starea decond'ensatà
i:::erfazicà a cromatinei, starea condensatà a cromozomilor mi-
:c:i,-'i sau a heterocromatinei nepermi!înd transcrierea ADN. În
',-elelea transcrierii la nivelul cromozomilor condensali ar,e loe
r.l:r proces d'e deslînare localà, cu aparilia de ptle sau inele
fuJbiani în cazul cromozomilor politeni de diptere. Sinteza
-lRN ale loc pe parcursul întregii interfaze qi continuà gi în
piofazà cind inceteazà, reîncepînd în telofazà. Din

'aceastà cau-
zà s-.ì tras concluzia cà ea este condilionatà de integritatea
mem'branei nucleare Si a nucleolului. Aceasta poaùe fi justifi-
cai pentru sinteza ARN riboz'ornal, nu Si pentru alúe categorii
de ARN. Mai sigur este cà sinteza ARN este condili,onatà de
s:area difuzà, deconderr.satà a cr,omatinei.
Prcpor{ia din ADN la bacterii care este transcrisà 'este de
o:'C:.nul a B0-1000/o pe cînd la eucariote aceasta este mult mai
mi-'à \2-2007r) Ei este dependenta de tipul celular qi de orga-
nismul considerat. Transcrierea la eucariote nu este cuplatà
ri--i :emporar qi nici spalial cu traducerea mesajulúi genetic.
Transcrierea a fost vizualizatà electr,onomicroscopic atît la
p:ccariote cît qi la eucariote (FiS. 28 A, B, C) d,e càtre Miller
1; coia'b. (1970).

Difelitele categ,orii de ARN celular intervin în etape speci-
!:ce aie decodificàrii informaliei ereclitare.
S: pot distinge mai multe tipuri de ARN celular: ARN rne-
scger', ARN ribozomal, ARN de transfer, ARN heterqen qi
-{iìN cromozontal. Primele trei tipuri de ARN celular intervin
diret-c în procesul decodificàrii.
3. ARN mesager (ARl{m) a mai fost numit ARN d,e infor-
n:.aiie. If.oleculele cle ARNm sînl componente centrale în ex-
presir genelor structurale. ARNrn reprezintà 20/s din ARN ce-

37

(,

co

/

AON

o geno

II

ARN m

( Nu sirrt vrz rbrte
polrpeptrdele sr ARI'it)

Fig, 28. l. Transcrierea geneticà. la pro-
cariote. Interptetate dúpó electronografie.

ARN

tolrmcrozo
,/

g$)q"*--:-
aDN

.'/ strrl .Jc rnrtrere
f '. Gl tr3f,scrlpt'cr
,' aìn -

Fig. 28. B. (a)

- ulr fragruerrt de ADN de ,8. col,i avînd atagate mole-
cuÍe ale enziurci ARN-polinrerazei qi ribozonri; (b--c)

- diagranazo-
uei de initiere a trartscrierii cu red.area deplasórii secventiale a ARN-
polimerazei spre stînga determinînd sinteza de ARNzra pe mattifa
enx. La aceste molecule de ARNm. se atageazà tibozomii, la cape-
tele lor 5', traducînd secvenla sa polinucleotidicà într-o secventà de
aminoacizi a polipepticlelor pe màsurà ce aceasta se tleplaseazà spre
capàtul ,,în ciegtèró" 3' al mesagcrului; (d) Degradatea ARNm începe
cu- capàtul 5' gi astfel ru ruai *:rl"r?."r"qarea de ribozomi care se disa'

/

/
/'\

fj

$

.

lo)

srl tèrnlnot

nroleculo deARN

(br

ot l

s'l de tnitlere-ARN '

)

,d

;1 î.

Fig. 25. C. Trauscrierea la eucariote. (a). Electronogtafia unei secvenf€ ADN
în-procesul de trauscriere în ovocita de Triturus airidescens. Moleculele de A'RN
transcrise pofnesc radiar din axa ADN. La intersecfia unei catene ARN 9i axei
ADN se ailó un grauul proteinic dens care cel mai probabil teprezintó molecule
d.e ARN polimeri,zó b-f. Secvenfa de evenimente redatà diagramatic care duc
la transcierea unui segment ADN. (b).O moleculó de ARN polímerazà ($l)
se ataqeazà [a un sit de iniliere pe o secven!à d.e ADN ce trebuie transcrisà
la un moment dat. (c). Molecula de eRN polimerazà se deplaseazà,pe catena ADN
ttanscriind-o întt-o secvenfà ARN. Dupà ce polimeraza + I s-a d.eplasat pe un
anumit interval, se atageazà polimeraza * 2 la situl de inifiere gi lucepe_ 9i ea
transcrierea, g.a.m.d.. asifel ca pe cînd molecula de ARN asociatà cu ARN poJi-
rneraza, nr. I reptezintó o secvénfó complementaú" la aproape întreaga lungime
a unei catene ADN, celelalte asociate cu ARN polimerazele 2, 3, 4 etc. sìnt pro-
gresiv mai mici. La termina*i$'ffT'i'ii

irlilJ;J:-eraza este eliberató împre'

luL,ar, avînd duratà scurtà de via!à. El tra,nscrie informafia ge-
neticà de pe un segment al unei catene a dublului helix ADN
aonespunzàtnr unei gene care trebuie sà funcfioneze la un mo-
ment 'dat Ei funcfioneazà. ca m,atri!à pentru sinteza sa- &gmen-
tul din ADN care serveEte ca matri!à pentru sinteze ARNnt
poate cor,espunde la o genà sau la mai multe gene care delin
informa,fia geneticà pentru sinteza unor proteille sau enzime

59

înrudite ce controleazà un acelaEi caracter sau rnrervln în
aceeaEi cale metatboiicà.

Dimensiune'a diferiteior: molecule de ARNrn este în functie
de màrirnea mesajului pe care ît poartà, adicà corespuncle
secvenlei de baze a diferitelor gene pe care le transcrie, gene
care au la rîndul lor dimensiuni foarte diferite Ei care speci-
ficà în consecin!à catene polipeptidice de lungime varia'biià.
As'tfe1, cons'ta,nta de sedimentare a diferitelor moleculre cle
ARNrn cle ia acelaEi organism variazà între B S qi 45 S.
ARNrn pentru ovalbumi'nà cuprinde cca 1890 nucle,oticle.
llnul dintre cele mai mari tipuri de ARNnz est,e cel pentru
fibroina firului' de màtase din glanda posterioarà de Bambyr
mori. Acest ARNnz are constanta cle sedimentare de 32 S (Tay-
lor, 1979).

Durata de r,ta!à a ARNrn la procariote este de 2_.1 rninute"
De îndatà ce au f,ost traduse, moleculele de ARNnr sînt distrtr-
se, evitîndu-se astfei aÌteràriie posibile clin structura sa ceìre
ar cluce Ia modificarea mesajului genetic gi la sinteza cìe pro-
teine modificate, sau la traducel'ea unui ARNnr care nì-r este
în eonformitate cu cerinfele de mecliu celnlar care se -.chlrnbà
rapid de la o perioadà de ti'rnp la alta.
Cele rnai multe tipuri de ARNm prezintà la capàtul 3' al mo-
noca,tenei o secven!à poi[ (A) care este adàugatà posttranscr'lp-
fional gi este implicatà în conturarea duratei de via!à a AF!.N'r.
. Complexul enzima'tic care clegradeazà ARNm procariot, are
capacitatea de a distinge diferitele tipuri de ARNnx pe cir,re ie
degradeazà în mod specific, degradarea fiincl cupiatà cu tr"a'clu*
cerea mesagerului.

La eucariote, la care ciurata de via!à a celulei este mai mare
+i durata de via!à a ARNnz este mai mare, de cca 1-4 ,ore.
Atît la procariote cît Ei la eucariote existà situalii ín care
ARNrn are o duratà de via'!à mai mare. Este cazul celul,eior" cle
Bacillus cereus irnduse sà devinà spori în care ARNnr clureazà
cca 6 ore Ei reticuiocitelor mamiferelor în care 900/o diri sin-
teza proteinicà este reprezentatà de sinteza hemoglobinel i:rr
cînd .se maturiz'eazà, pierd spontan nucleul, nemaifiind der.:i \ireo
matri!à pentru sinteza ARI{nz pentru hemoglo;binà. Cu toate
aceslea, sinteza hemoglobinei este continuatà pe seama ARNrz
sintetizat' încà din s,tadiul nucleat Ei care persistà Ei funclion ettzà
rnulf timp (cîteva zile) dupà ace,ea.
În cazul dormanlei adoptatà de mul.te ouà 1a anirnale qi
seminlele de plante, ARNrn este menlinut într-o for:mà sta-
bilà pentru luni qi chiar a,ni.

60

Moleculeie de ARNrn cu durata lungà de via!.à, cum sînt
Ei cele din ovulele de ,broascà care sînt pàstrate multe Ìuni
înainte de a fi traduse, sînt protejate fa!à de atacul enzimelor
depolimerizatoare ribonucleaze prin asociere cu categorii spe-
ciale de proteine. Asemenea asocieri ARNrn proteine la
eucariote care apar înainte de trece,rea ARNrn din rnucleu în
citopiasmà unde se asociazà cu ribozomii

- sedii a,le sintezei

proteinice

- au fost numlte informozomi sau informnfere.
La bacterii, genele aflate în raport de contiguitate gi înru-
clite rnelabolic (legate de aceeagi cale metabolicà) formeazà o
unita'te reglatoare care s-a numit operon. Ele sînt transcrise
într-un ARNm policistronic ce poartà mesajul genetic pentru
mai multe proteine. La scurt timp de la inilierea sintezei
ARNrn bacterian, ribozomii se ataqeazà la aceasta Ei se depta-
seazà de-a iungul sàu în urma ARN polinterazei, spre a asi-

- gura traducerea mesajului genetic.
De regulà, la eucariote ARNm este monocistronic Ei trans-
crie gene care dirijeazà sinteza de polipeptide. Aceste gene sînt
de regulà reprezentate de secvenfe unice, nerepetate din ADN.
ARNnz eucariotic se sintetizeazà sutb forma unui precursor he-
terogen

- numit qi ARN nuclear he,terogeru care are o ,greutate

moiecularà de 5 X 105

- 107 daltoni. S-a mai numit pre-ARNnz.
Precursorui ARNm este supus prelucràriior posttranscripfional'e
în cadrul càrora vor fi eliminate nueleotide, de la capàtul 5'aI
moleculei Ei totodatà vor fi adàugate la capàtul 3', 50-200
resturi adenilat formînd un segment de acid poliadenilic care
cond.i{ioneazà durata de via!à a ARNm
La procariote ARNm reprezintà copia exactà a secvenlei ge-
nice,, fàrà a-i lipsi anumite segmente. La eucariote în cazul
unor gene apar por{iuni (secven{e interpuse sar-r spa{iatoare în
cadrul secvenfei genice codificatoare) care sînt ,transcrise în
ARNrz dar nu sîtnt traduse. O situalie sirmilarà apare în cazul
unor virusuri anirnale.
Asertenea secvenle spaliatoare apar în genele pentru catena
f3 a hemoglobinei, h genele pentru imunoglobulinà, ovalbumi-
nà qi în genele ARNú Ei ARNr. Secvenlele spaliatoare sînt im-
plicate se pare în reglarea activitàfii genice. Ele pot fi transcri-
sp în ARNrn, dar ulterior sînt excizate. Este admisà Ei posibili-
ta,tea ca la eucariote ARNrn sà fi,e sintetizat segmentar, segmen-
tele fiind ulterior unite într-o monocatenà unicà de ARNnz în
care nu sînt incluse qi secven{ele spafiatoare.
4. ARN ribozomnl (ARNr). ARNr r'eprezintà cca 800/o din
ARN celular total qi intrà în structura ri'bozomilor care ;sînt

61

particule ribonucleoproteinic,e implicate în biosin teza proteinicà.
Ribozomii confin 40-600/o ARNr qi proteine tbazice ribozomale.
Ri:bozomii apar în citoplasma tuturor celulelor procariote gi
eucariote avînd un diametru variabil. de 140-230 À. Proteinele
ribozomale în numàr total de 53 la procariote Ei 70-80 la euca-
riote se leagà de ARNr prin legàturi necovalente, migurînd
stabilitatea structunalà a ribozomului permi!înd totodatà ataqa-
rea altor tipuri de ARN la riibozom. Prin ataqa,r'ea de ribozomi
pe monocatena ARNrn se pàstreazà, conformafia monocatenarà
a acestuia propice decodificarii

- traducerii mesajul.ui ,gene-
tic. Ri'bozomii se ataqeazà la, ARNrn formînd poliribeotrri sau
polizarni, între ei fiind o distanfà de 50-150 À.
Ribozomii procariotelor au constanfa de sedimentare 70 S
(subunitali 30 S gi 50 S) pe cînd cei eucariotici citoplasuratici
au constanta de sedimentare B0 S (subuniffifi 40 S Ei 60 S) fàrà
ca ri'bozomii eucariotici sà constituie un grup uniform ,,80 S6c
càci greutatea lor moleculara variazà de la 3,9 X 106 daltoni la
plante la 4,55 X 100 la mamifere, sohimrbarea masei rirbzomale
bazîndu-se în special pe variafia dimensiunii subunitafii mari
ribozomale (60 S) de Ia 2,4 la 3,05 X 100 daltoni, variafle ca,re
este cleterminatà de varialia cantitativà atît, a ARNr cît qi a
proteinelor ri,bozomal,e asociate. Subunitatea rirbozomalà micà
(40 S) a ri'bozomul.ui eucariot nu s-a schimbat aprecia,bil în
cursul evolufiei eucariotelor. Ri'bozornii organitelor celulei eu-
cariote, cloroplastici qi mitocondrial,i sînt de tip procariot avînd
oonstanta de sedimentare 60-70 S. Prin scàderea ooncwttrafiei
ionilor Mg2+ sub 0,35 ffiM, riibozomii bacterieni disociazà în
subunitàtil,e 50 S qi 30 S.
Greutatea molecularà a prroteinelor bazice structurale ribo-
zomale este de 25.000-26.000 dattoni. Proteinele ribozomale
sînt heterogene fiind descrise douà categorii, urla S, corespun-
zàtoare su,bunitàlii ribozomale mici qi alta L c\orespunzàtoare
subunitàlii ribozomale mari. Fiecare categorie de proteine ri;bo-
zomale are rnai multe fracfiuni Sr-Szr gi L1-L32. Ia, euca-
r:iote fracfiunile celor douà categorii de proteine ribozomale
sî,nt mai numeroase. Ele sînt esentiale în funcfionarea rirbozo-
milor. Proteinele riibozomale Lt Qi Lp au proprietali contractile
qi se pare cà sînt implicate în translocarea aminoacizilor în
timpul sintezei proteinice.
Asamblarea ribozomului realizatà l,a rrivelul nucleolului este,
cel pulin ùr parte, ur proces autodire4ionat, deci nedireclio-
nat de alte structuri celulane pneexistente. Sînt date dupà care
unii ribozomi pot fi specific mesageri, cu funclie informalio-

62

@
"^6(=ù

^D9

p6fi

@>"'

Fig. 29. Ciclul ribozomului. Subunitatea 30S se asociazà cu ARNrz dupà care
are loc atagarea subunitàlii 50 S.

nalà. Se pesupune cà ARNr posedà in uiuo un mesaj tradus,
specific pentru sinúeza proteinel'or ribozomale (Rieger qi co-
lab., 1968, 1976). Interesant este cà ritbozomii ca qi cromozomii
eucariotici sînt organite celulare, lipsi'te de memibrane deiimi-
ùante, care prezintà totoda,tà

- spre deosebire de alte organite
a1e celulei _- irn ciclu caracteristic de organizare Ei desfacere
în vederea funcfionàrii. Existà astfel un ciclu ri'boz'omai (Fig.
29) (vezi Ei sinteza proteinicà) Ei un ciclu cromozomal (vezi .or-
ganizarea geneticà).* În celulele eucariote care sintetizeazà pro-
teine pentru secrefie-export, majoritatea ribozomilor sînt eta-
$ati la nembranele reticuiului endoplasmic prin intermediul
subunitàtilor mari 60 ,S: Rirb62o*ii lirberi neatagafi la membra-
nele reticulului endoplasmic sintetizeazà pruteine care ràmîn în
citoplasma celulei. Se admite cà în acest proaes de seleclie
de cà'tre ribozomii ataqafi sau neataqa'F la reticulul endoplasmic
a unui ARNrn particular spre a fi tradus, un ro1 important î1
joacà secvenla lider din ARNrn ce poate fi recunoscutà în mocl
diferenliat de càtre cele douà tipuri de ribozomi. De asemenea,
proteinele destina,te nucleului sînt sintetizate pe ribozomii cito-
plasmatici neataga{i la neticulul endoplasmic. Dupà sintezà,
acest'e proteine sînt pompate sau suctiornate în nucleu. Se admi-
te cà Ei la procariote ARNrn ce codificà proteine speciale sînt
traduEi în locuri speciale qi prorbabil de càtre ribozomi speciali.
As,tfel, la Bacillus sinteza proteazei neutrre, care este secretatà
în mediu, afie loc pe ribozomi localizali la periferia celulei.
În subumitatea ribozoma'Ià micà intrà ARNr de tip 16 S la
procariote Ei 18 S la eucariote.

+ Reunirea stùunitàfi'lor ri,bozomale spre a constitui particuie ribo-
zontatre funcfionale este aleatorie, ceea ce înseamnà cà reciclarea sub-
unitàlilor ribozoma,le într-o nouà rundà de sintezà nu presupune aso-
cierea aceloraqi subunitàfi care au constituit ribozomii func{ionali ai
rundei precedente.

63

F

În subunitatea ribozomalà mare intrà ARNr de tip 23 S la
procariote qi 28 S ta eucariote.
Atît la procarioùe cît Ei la eucariote asociat subunÌtàtii ribo-
zomale mari mai intrà qi un tip aparte de ARNr, care are con-
stanta de sedimentare 5 S. În plus, la eueariote, s-a descris gi
un alt tip de ARNr care are constanta de sedimentare 7 S qi
care intra în componenla subunitàtii mari a ribòzomului, exis-
tînd la eucariote deci 4 tipuri de molecule de ARNr (Wool,

1e7e).

Toate m,o1,ecu1e1,e de ARNr atît la procariote cît qi la euca-
riote s'e sintetizeazà sub formà de molecule precursoare de
ARNr' (pre-ARNr) care, dupà transcriere, sùrt supuse, prelucrà-
rilor posttranscriplionale. Acestea includ pe de o parte metila-
r:ea resturilor rirbozà la cca 5oA dintre nucleotide, deterrriinînd
diferenlieri calitatíve în func{ia catenelor poliribonucleotidice,
iar pe de altà parte clivar,ea unor secvenle (eliminarea) ducînd
la reducerea lungimii pre-ARNr gi delimitarea unei rnolecule
mature de ARNr. Dupà pr,elucrarea posttranscripfior,ra'là struc-
tura primarà mronocatenrarà a ARNr poart.e suferi cqrúorsionàri
spaliale cu realizarea de regiuni bicatenare gi cu aparifia unor
modele spaliale caracteristice.
Genele (ADNr) pentru cele trei caúegorii de ARNr sînt dis-
puse în'tandern (policistroni) în ADN (genom) gi sînt tnanscrise
în ordinea 16 S

- 23 S la procariote. Aceste gene apar de ase-
menea strîns lincate, Ia eucariote fiind dispuse în'ordinea 18 S
- 28 S qi transcrise ca un pre-ARNr unic care are o:constantà
de sedimentare 45 S. Acesta va fi separat prin prelucràrile post-
transcriptionale ulterioare în cele trei tipuri de ARNr matur.
La eucariote, genele pentru sinteza ARN 18 S. qi 28 S s'e
afià în regiunea orgwuizator nucleolard (NO) Iocalizata la nive-
lul constricliilor secundar,e implicate în formarea nucleolului.
Rezu1tà cà aceste gene ri'bozomale sint gene nucleolare. EIe sînt
r,egiuni vital,e ale genomului de vreme ce mutantele de Xeno-
pzs desemnate D-nr.r fur stare homozigotà tripsite de nu'crleol
nu sînt capabile sà sintetizeze ARNr gi mor. Genele pentru
ARN 5 ,S, prezente qi ele în copii multiple la eucariote sînt
neLincate cu celela,lte gene ri'bozomale, fiind distrirbui.te pe di-
verEi cromozomi, în spetà în regiunea teiornericà a lor. Deqi
nelincate cu genele ri'bozomale LB S qi 28 S, genele ri'bozomale
5 S sînt transcrise coordonat cu genele pentru ARNr 18 S Ei 28 S.
S-a constatat cà prezenla ARN 5 S în subunitatea mare a ribo-
zomului este esentialà în funclior.ar€a normalà a rÍhozomului
în sinteza proteinicà.

64

ARNr din cloroplaste gi mi,tocondrii prrezintà greutàfi mo-
lecuiare mai mici decît molecrrlele c€respunzatoa,re din cito-
plasrnà.

Nu se cunoaqte deocamdatà cane este firncfia particul,anà a
ARNr. Se admite cà bazele neîmperechearte din ARNr ar par-
ticipa, intr-un fel sau altul (posiibil tot pe principiul comple-
mentaritàtii qi for'rnàrii de punfi labile de hidrogen) la inter-
acliunea cu oelelalúe oategorii de ARN celular spr€ a deoodifica
mesajul genetic purtat de ARNnz. Are loc o al,iniere corectà a
diferitelor tipuri de ARN c'elular cerutà de o fidelà traduoere
a informaliei genetice într-o secvenfà corectà de amînoacizi
pentru sinteza unui polipeptid norma'l. Un rol prfurcipal în rea-
lizarea acestei alinieri revine ionilor de magneziu (Mg2+1 care
joacà de asemenea un rol important în asamblarea unitàfilor
ribozomale.

Existà diferenle semnifica,tive în structura ribozomilor la
procarioúe Ei eucariote, diferenle care formeazà ceea ce WooI
(1979) a denumit dilema centrald, a rùbozomalui. Astfel, ribozo-
mii eucariotici sînt apreciabil mai mari decît cei procariotici,
conlinînd un numàr mai mare de proteine ribozomale (cca 80,
fa!à de 53 l,a procariote) qi au o mol'eculà în plus de ARN.
Totodatà moleculel,e de proteine rilbozomal,e Ei de ARNr sînt
mai mari la eucariote fa!à de procariote. Diferenla în dimen-
siune este un paradox deoarece ribozomii eucariotici îndepli-
nesc aceeagi funclie generalà

- cantonarea sinrtezei pr,oteinice
oa +i ri'bozomii procaniotici. Se admite ca peurtru a ju.stifica
aceste diferente dimensionale la ri,bozomii eucariotici trebuie
desooperite funclii noi. Unele proteine ribozoma,le suplimen-
tare pot fi specializate pentru inúeracfiunea cu reeeptorii din
reticulul end'oplasmic numili ribophorine I Ei II, altele pot fi
implicate în reglar,ea mai complexà a traducerii ARNm. Nece-
sitatea suplimentarà pentru anumi'te proteine ribozomale, ne-
implicate în biosinteza proteinicà poate fi determinatà de panti-
cularitàlile biogenezei organitului: proteinele ribozomale sînt
sintetizate în citopiasmà qi tra,nsportate în urucleol uurde sînt
asamiblate în subunità!ile ri'bozomale prin atagarea lor la pre-
cursorii ARNr pe cind acegtia sînt încà tr,anscriEi de pe ADN
ribozom,al. Pre-ARNr va trebrui prelucrat qi ARNr 5 S'transcris
din alte situri în nucleu trebuie sà fie î:rcorporat în subr:nitatea
mane ribozomalà. Cele douà subunitàfi rirbozomale tnebuie trans-
portate din nuctreu în citopl,asmà. În acrest prooes extrem de
complicat de transport bidirecfional nucleu citoplasmà ar
putea fi implicate proteinetre ribozomale suplimerrtar,e ale rirbo-

S - Descifrind tainele ereditófii, vol. I

65

zomului eucariot. Ele de ase,menea pot participa la asamblarea
subunitàlilor ri,bozomale ca qi în 'transportul lor spre cito-

plasmà.

Proteinele ribozomale ale organitelor celulei eucariote mito-
condriale Ei cl,oroplastice sînt codificate în ADN nuclear qi sin-
tetizate pe ribozomi citoplasmatici. Din aceastà cauzà la euca-
riote cu mitooondrií qi cloroplaste sînt sintetizate în citoplas-
mà circa 200 de proteine riibozomale care trebuie distribuite în
nucleol, mltooondrii qi cloroplaste. Cum se reaùizeazà aceasrtà
distritbufie nu se cunoaqte. S-ar puùea ca toate aceste proúeine
só fie fil,trate prin cele trei organite, fiecare relinînd grupul
corect de proteine ribozomale. S-ar putea ca proteinele supli-
mentare ale ri,bozomilor eucariotici sà condilioneze ele însele
aoeastà distriibuire. În sfîrqit, nu poate fi exclusà nici posibili-
tatea ca proteinele ri,bozomale suplimentare de la rihozomii
eucariotici sà nu a,ibà ,o funcfie specialà sau sà nu îndeplineascà
nici ofuncfie. Existà mutanfi de Bocillus suúilis qi B. megate-
úum rezistente la ttriostrepton qi ca,re sînt lipsi{i de proùeina
ribozomalà L 1L Mutantul de Ia prima specie spre deoserbire de
acelra de la a doua specie de BacilZzs nu prezintà nici un fel
de deficientà. Concluzia care se desprinde este cà proteina L L1
la B. wbtilis. mu îndeplineEte \n€o funcfi,e ribozomalà sau în
sinteza proteinicà, dan nu poaùe fi orclusà posi,bilitatea ca rolul
sàu sà fie preluat de al,te pr,oteine ri'bozomale prezente la acest
mutant.

5. ARN de transfer (ARNí). A mai fost numit qi ARN so-
lubil (ARNs), ARN accegttor de aminoacizi sau AIÌN adn@r.
Sînt molecule adaptoare sau de racordare la care se ataqeazà
diferiti aminoacizi carìe sînú transferafi la ribozomi în timpul
biosintezei proteinice. Ac'este moiecule de racordare se atageaza
la rîndul lor în mod specific la grupàrile cetonice qi aminice li-
bere de pe monocatena ARNrz pe principiul împerecherii com-
plementare de hlazr azotatn cu formarea unor punfi temporare
de hidrogen. ARNú foacà rol cheie în ,biosinteza pr'oteinicà.
Perntru fiecare aminoacid existà ce1 pufin cîte o moleculà
specificà, diferità de ARNú. Greutaúea mol.ecularà a ARNf este
de circa 25.000 daltoni avînd o oonstantà de sedimentare de
4 S. Lungimea molecutrei ARNú este de 73-90 nucleotide. Re-
prezintà 7A-150/o din cantitatea totalà de ARN celular. Ca gi
ARNr, ARNú nefiind purtà'tor de mesaj genetic are, spre de-
osebire de ARNnz o duratà de via{a mare, prrezentînd o stabili-
tate metabolicà mare, diferitele molecule ARNú putînd fi re-
ciclate de nenumàra'te ori. Capàtul iiber 3' al monocatenei se

66

úerminà la toate tipurile de ARNú cu secvenfa CCA pe cînd
la oapàtul, li'b,er 5' se aflà secvenla terminatà în G. Moleculele
ARNf prezintà o mare stabilitaùe rneta,bolicà cane derivà toc-
mai din prezenfa guaninei (pG) Ia capàtul 5' al monocate'nei
sale. Aceasta faoe oa ARNú sà nu fie supus aga cum este supus
ARNrn digestiei enzimartioe, ,gua,nfura stabilind punti de hidrogen
cu ,Lraza opusà din ttrlpina dublu-catenarà a structurii trifoliare
a ARNf. ARNú conline qi unele nucleotide areo iqnuiúe pnecum
acidul inosinic (I) care poartà purfura hipoxamtilra gi care nu
formeazà aceleaqi per,echi de baze azotate ca oele formate de
A Si G. Alte nucleotide neobiqnuite aflate în ARNú sùrt acidul
l-metiliinosisric (I-) acidul l-metilguanú,lic (G-) gi acidul NlN-di-
metilguami,lic (G-) la care, prezenta gmpàrilor mgtil determinà
formanea de perechi cu oricarre aùte tb,aze azotate. Tot ca bazà,
neobiEnuità intrà în ARNú gi aeidul pseudouridilic (ìf) la care
inelul pirimidilic uracil este ata$at lra ribozà nu prin azotul sAu
N1 ca în acidul uridilic normadt ci prin carjbonul sàu 5. Aci-
dul ,riiboti,midilic (T) esúe de asemenea o riibonucleotidà neorbiq-
nultà ce intrà în ARNú qi care este LegaÉ de convertirea ura-
cilului în timfurà în urma unei metilàri a uracilului la C 5. Mai
existà Ei o altà bazi'neorbi.qnuità în ARNú qi anume acidul d[-
hidrouridilic (Ui) sau DHU) în care uracilul poartà hidrogen
suplimentar la C 5 qi C 6. ln realitate dihidrouracilul nu este
o pirimidinà deoanece legàtura dintre C 5 gi C 6 nu este o
punte durblà ci, uina simplà. Nucleotidele neobiqniuite nu pot fi
introduse în pnecursorul ARNú în timpul transcrierii, prin nici
un mecanism de împer,echere de baz.e complementare. Ele apar
în urma modificàri,lor posttaranscriplionale a nucleoúidelor nor-
m,ale, deja prezente în pre-ARNú.
Prin plierea monocatenei rezultà rqgiuni dublu-catenare în
zonele ùr car,e ,bazele azatat'e se împenecheazà compl,ementar cu
formar,ea d,e punfi de hidrog'en. Din ara,nfamentul spatia,l al re-
giunilor bicatenare qi a1 r,egiunilor monocatenare rezultà o
structurà secundarà care este cunoscutà ca m,odelul frunzei
d'e trifoi (FiS. 30). Structura secundarà ,bidimensionalà po.ate
fi la rîndul ei supusà plierii sprc a da o str-ucturà terliarà tri-
dimerr.sion,alà caracteristicà de forma li'terei T (Fig. 30c).
În structura unor tipuri de ARNú inúrà gi inosina (I) mai
ales în secvenla antioodonului pen'tru codomii serinei (UCU),
leucinei (CUU), pr,olinei (CCC), argtrinei (CGC), izoleucinei
(AUA) ,etc., în care inozina (I) intrà în pozifia 3 antiparalelà
(deci pozilia L în citire dir,ectà). Neputfndu-se împereehea, ba-
zele metilate deiimiteazà regiuni'le bioatenare ale monocatenei.

67

l9 ig'a

u i,rq,.!r

u c6o

r, i,

ù ru

hU

@e-

G\

g\
lg'

Ir'

'iG

G\

É

ln

"l'

{s

G2o

hrt

oHq.

(b,

lr'

I

6 .ogót'/ 3oH
,

-brllul

daq:l9roa
èlu o ordmcrddu

hollt al f ia&:rt

bÈlo l,r'nr' irlCl
i?!ota mitrf:.ftú!)

Fíg. 30. Structura ARNI. (a). Secvenfa celor 76 nucleotide din macromolecula
de ARNI pentru alauinà de la drojdie prezentatà în modelul birlirnensional al
fnrnzei de trifoi. Se indicà cele patîu bucle majore incluzînd gi bucla anticodonului
ca.re are secve[ta A-A-A gi care se pottivette prin complementaritate cod,onu-
lui din ARNz fenilalaninà U-U-U. Bazele încercuite cu linii continui ocupà
aceleagi prclzílii în toate moleculele de ARN care au fost analizate pînà in prezent.
Bazele încercuite cu linii înherupte sînt .ìiferite la alte tipuri de ARNf. Numero-
tarea bazelor începe de la capótu1 5'. Nucleotidele aeobignuite gàsite la ARNú
sÎnt: lU: DihU: dihid.rouridina, Y:pseudouridina, mx : nucleotide metilate
ti î

- timina (un uracil metilat în pozifia 5 în inelul pirimidinic). (b). Diagra-
ma schematicà care indicó maniera în care ARNtFtea poate fi ràsucit spre a pro-
duce unele dintte relafiile fizice observate între diferitele pàrfi ale moleculei. Li-
niile subîiri indicà punfile de hid.rogen ce apar între baze în cadrul structurii
tertiare pliate. (c). O reprezentare trid.imensionalà a ARNú redatà dupó studii
de difracfie în raze X.

Descifrarea secvenlei de baze din structura primarà monoca-
tenarà a ARNú pen,tru alaninà la drojdie precum qi a structurii

sale secundare

- c€nfiguraîia spatialà cu negiuni monoca,tenare

qi bicatenare

- au permis lui HolLey $i colaboratorilor sài sà

68

.€m A
UA
6mA
àl

lc)

I

G

9c

ù

U

elab,oreze modelul frunzei de trifoi pentru aceastà configuralie
spafialà eare s-a dovedi,t a fi valalbil pentru úoate tipurile de
ARNú. Pentru aceastà realizare Holley a fost distins cu pre-
miul Nobel. Folosind datele de secvenfiere a ARNú pentuu ala..
ninà extras de La drojdie, Khorana qi colaib. au nealizat pe cale
chimicà, prima sintezà a unei ,gene, gena care dirijeaza sinteza
ARNú pentru alaninà.
ARNf se sintetizeazà pe maúri!à de ADN prin intervenlia
ARN-polimqoaei qi apare mai îrntîi ca moleculà pr,ecursoare
care, dupà transcriere, este supusà prnlucràrilor posttranscrip-
fionale. Moleculele precursoare la ARNú ca Ei la ARNnz pre-
zintà la capàtul 5' o secven!à suplimentarà numità secvenla
conducàtoare sau din cap (leader) iar la capàtul 3' altà sec-
verr!à suplimentarà numità secven{a din coadà (troiler). De
as€rnenea, precunsorul ARNú pnezintà secvenfe interpuse in
cadnul secvenlei care va constitui seeventa ARNú matu'r func-
fional. Printre prelucrarile posttranscripfionale unele deùerminà
excizia unor nucleotide din pre-ARNú sub acfiunea' enzimei
RN-aeò P (P de la precursoare) pe cînd ,altele determinà adi{ia
la capàtul 3' al monocatenei a-secvenlei 5' NìCf A 3', impli-
catà în aminoacilarea ARNú. Implicarca secven!,ei CCA în ami-
noacilarea ARNú (atagarrea aminoacidului activat

- vezi sin-
teza proteinieà) a fost dovedità în experienle de îndepàrtare a
acesteia folosind fosfodiestntaza, din venin de qarpe care aclio-
neazà numai asupra acestui capàt monocatenar ,al moleculei
ARNú. ARNú lipsit de secvenla CCA de Ia capàtul 3' pierde
capacitatea de a accepta aminoacizi. Capacitatea acceptoare
pierdu,tà a unui ARNú tratat cu fosfodiesterazà poate fi redo-
bîndità dacà acest ARNf deficient este pus lntr-un amestec de
reacfie care confine o enzimó specialà (terminaltransferaza) ce
are capacitatea de a ,adàuga nucl,eotide terminaie fàrà a ne-
curge la împerecherea complementarà de baze cu o matri!à
polinucleotidicà qi substraturile sale CTP qi ATP. Alte pre-
lucràri posttranscriplionale sînt cele care realizeazà modifi-
carea chimicà a unora dintre nucleotidele ràmase. Printre mo-
dificàrile ehimice mai importante sînt metilarea gi formarea
pseudouridinei.

Modificàrile chimice ale nucleotidelor obiEnuite (incluse în
ca,ùena pre-ARNú în timpul transcrierii sale de pe matrila ADN)
care due la convertirea lor în nucleotide neobiEnuite sînt cata-
liza,te de enzime speciale existente atît Ia procariote cît gi 1a
eucariote. O astfel de enzimà convertegte grupul NHz de pe
carbonul 2 al acidului adenilic din pre-ARNú în grupul OH

69

F

creind astfel un rest inozinà la un.ele situri ale catenei pre-
ARNú. Atrt€ enzime transferà grupul nretil (enzimele se numesc
în cqnsecinfa metilaz,e) la hipoxantinà, guaninà sau uracil din
pre-ARNú spne a da I*, G', G- sau T. În sfîrqit, alte enzime
rearanjeazà legàturile dintre inelutr pirimldinic qi ri,bozà spne a
converti uracilul în pseudouracil sau spre a hidrogena inelul,
convertind uracilul în dihidrouridinà. Asemenea prelucràri
posttranscripfionale au putut fi sfirdiate Î,n cazul microinfec-
liei nucleului de drojdie de ,bere în ovocita de broascà.
Prelucràrile posttranscriplionale implicà în cazul precurso-
rului ARNú (pre-ARNú) pentru tirozinà de la drojdie, elimi-
n:rrea secvemfelor inrùerpuse din pre-ARNf (descrisà prirna datà
de càtr.e Goodmatr Ei colarboratorii în 1977), excizia secvenlelor
suplimentarè 5' Leader $i 3' trailer, adàugarea secventei CCA
la capàtul 3'. Toate aceste prelucràri au loc în nucleu. Tot în
nucleu mai sînt modificate, în cazul ARNú pentru tirozinà de la
droidi,e sintetizat în ovocite de broascà microinjectate cu nu-
cleu .de drojdie, cel pulin Sapte ribonucleotide înain,te ca ARNú
sà fie transportat din nucleu în citoplasmà (Melton Ei colab.,
1980). Aoeste modificàri ce duc la formarea în pre-ARNú a 5
metil-citozinei (m5C), 1, metil-adenozina (-lA), pseudouridi-
na (rÍ) 9i dihidrouridina (DHU) apar în nucleu. O singurà mo-
dificare apare în ciúoplasmà qi anume a guaninei. S-a constatat
cà modificàril'e apar într-o ordin'e pnecisà, strictà, cane 3e core-
leazà cu schimbàrile din dimensiunea precurff)rului ARNú de-
terrninate de eliminarea secvenlelor leoder qi trailer. Astfel, de
înd,atà ce secvenf"a leader este eliminatà Ei este adàugat 3'CCA,
U din regiunea antioodonului este modificat în pseudouri-
dinà (tY).

Determinarea secvenfei ADN corespunzînd Ia 4 din cele B
gene ARNú pentru tirozinà (ú ADNúyr) de la SacchmwnVces
cereuisiae a condus l,a consta,tarea cà aceste gene ARNú pentru
tirozinà conlin o secven!à interpusà de 14 baz'e adiacente anti-
codonului car'e nu este prezentà în ARNú rnatur qi deci ea este
eiiminatà în cadrul prelucràrilor p'osttranscripfionale.
Maturarea precursorilor ARNú diviza'tà în mod oonvenlional
în douà proc€se separate

- reduoerea dimensiunii Ei modifi-
carea de ibaze reprezintà u,n proces unic, càci cele douà aspeote
sînt inúim legate, desfàqur,flndu-se conoentr,an't. Succresilrnea

ordonatà a etapelor de prelucrare posttranscripfionalà a ARN
în general qi a ARNf în'special, sugereazà cà enzimele de ma-
^uurafie care condilioneazà transformanea pre-ARN îrr ARN ma-
tur au capacitatea, unele de a recunoaqte precursori cu sec-

70

venF 5' leadq, iar aitele de a recunoaqte gi accepta ca suíb-
strat pre.ARN fàrà aceastà secventà 5' leader. Este posib,ii ca
în aoeas'tà capaciúaùe de recunoaqtere sà joaoe un €utumit rol
qi secvenfele interpuse. Ar trelbui sà fie un numàr de cel pulin
61 tipuri de A-RNÚ care sà traducà mesajul genetic (vezi eodul
genetic) qi care ar corespunde celor 61 aodoni sens din ARNrn.
Ta E. coli sînt 30-40 tipuri diferite de ARNú specificagi de
gene limitat redundante. La eucariote, genele pentru ARNf
sînt înralú redundante.
Teoretic ,ar trebui sà fi,e un numàr de 64 tipuri diferite de
ARNf care sà traducà m,esajul genetic (vezi codul genetic). Au
fost izolate în stare purà aproape toate tipurile de ARNú, iar
la pesùe 20 dintre ele a fost stabilità secvenla de nucleotide a
monocatenei (structura primarà). Genele pentru ARNf ca gi
c,ele ribozomale sînt prezente atît Ia procariote cît gi ia euca-
rioúe în copii multiple (40-80 la procariote, 32A-14A0 la eu-
cariote), în unele cazuri fiind distribuite grupat în genom for-
mînd aqa-numitii clasteri. Fieca,re aminoacid are cel pulin un
ARNú specific care intervine în activarea sa în cadrul biosin-
tnrei protcinice. Uneori, acelagi aminoacid poate fi activat de
douà tipuri, diferite de ARNú care s-au numit ARNf isooccep-
úori. Specificarea unui aceluiaqi ,amfuroacid de douà tipuri de
ARNú ar fi o màsurà elaboratà în cursul evoluliei de a asigura
realizarea biosintnzei proteinice în condifiile în care ]a nivelul
unuia dintre ARNú isoaccepùori s-a manifestat felomenul mu-
tagen.

Fiecare moleeulà de ARNú prezintà rogiuni specifice de in-
teracfiune cu alte molecule, negiuni, în care nu apar împe-
recheri de ,baze prezentîndu-se ca bucle Ia nivelul càrora ba-
zele sînt expuse avînd posibili,ùatea interacliunii cu alte ele-
mente. Astfel, secvenfa CCA de la capàtul 3' al moleculei
ARNú este implicatà în ataEarea aminoacidului corespun zàtor
la molecula ARNf, h vederea transportului sàu. Fiind aceeaqi
la toate moleculele ARNú, secvenfa CCA nu este implicatà în
specificitatea a,taEàrii aminoacidului la ARNú.
Molecula ARNú prezintà însà o regiune care conferà speci-
ficitate ARNú prin care acresta r,ecunoatte în mod specific un
aminoacid dat. Aceastà regiune es.te variabilà la diferitele
tipuri de ARNú. De asemenea, molecul'a ARNf mai prezintà o
regiune de recunoaqtere a ri'bozomului reprezentatà de prima
buclà din modelul frunzei de trifoi, alcàtuità din 7 baze ne-
împerecheaúe, numità bucla TìI'C, precum qi o rcgiune de re-
cunoaqtere a codonului din ARNm, regiune care s-a numit

7l

F

anticodon sau nodoc (opusul lui codon) qi car,e este formatà,
ca gi eodonul din ,trei bazp, ,azotate (tripleta). Ea se aflà în
'bucla antioodonului. Regiunea anticodonului este specificà fie-
càrui tip de ARNú gi ea courdifioneazà recunoagterea cprectà a
codonului din ARNrz cotrespunzàtor aminoacidului purtat de
ARNf gi- care este specificat (codificat) de càtre oodonul din
ARNm. Între prima buclà qi bucla anticodonului se aflà o
buclà micà numità ,,ciot6'.
Recunoas.terea codonului de càtre antioodon se bazeazà pe
principiul complementaritàlii bazelor azotate de tip (A U A

-

L23

codon

- U A U anticodon; C G A codon

- G C U

- antico-

321

12 3

321

don etc.) care se asociazà tempor,ar prin formarea unor punfi
d,e- hidrogen. Codonul qi anticodonul sînt ,orientate antipar,alel
(5'-t3' codonul, 3'+5' anticodonul).
Împer,echerea corectà codom-anticodon condilioneazà plasa-
r.sa în catena polipeptidicà oe se sintetizeazà. ,a unui aminoacid
dat Ia l,ocul corespunzàtor, sintetizîndu-se astfel o proteinà nor-
malà structural qi funcfional.
Dar, potrívit ipotezei oscilàrii (u:obble) elarboratà de Crick
în 1960, une'ori un flntlpit tip de ARNf are capacitateoa de a
recunoaqte prin ,anticodonul sàu mai mul{i codoni (triplete)
care însà se deos,ebesc doar prin cea de-a treia

'bazà,. însearnnà
cà in cad'rul internelafiei codòn-anticodon, esenfialà în d,escifra-
r,ea, decodificarea (traducerea) mesajului genetic transcris în
ARNrn, primele douà perechi de baze prezintà o mai mare spe-
cificitate a împerecherii pe cînd c,ea de a treia capàtà caracter
oscilant. Astfel U aflat în conformitate cu antiparalelismui
imperecheril,or cle ,baze pe primul loc în secvenfa anticodonu-
iui (altfel, ea ocupà tot locul trei în acesta dacà consideràm
orientarea generalà de la stînga l,a dreapta) poate sà se împe-
recheze cu A dar Ei cu G afiate în codonul ARNrn ca cea de
a treia'bazà.

Tot astfel G din antioodon poate recunoaqte, în aceleaqi
condifii tipologice atît C cît qi u, iar hipoxantina poate recu-
noaEte u, c si A aflate în pozilia a tr,eia în codon. Nu acelagi
lucru este pentru C qi A a,flaúe în pozifia ulrtimà (considerînd
sensul gen,eral stînga+dreapta) în an,ticodon. Acesùea nu pot
recunoa$te qi nu se împereoheazà decît cu bazele oomplemen-
tare conespunzàtoare a,flate în a treia pzí\ie în codon qi anum,e

GqiU.

72

Cea de a patra buclà din modelul frunzei de trifoi conline
6-12 tbaze neîmperecheate. Ea s-a numit bucla dihidrouraci-
lului, fiind implicatà în legarea ARNú la o,minmrilsintetozd,
enzimà activatoare specificà pentru fiecar,e amimoacid.
Inifierea tuturor catenelor polipepti'dice (tradueerii mesa-
jului genetic) se realiznazí, prin intervenfia aq€Fnumitului
ARNú i,nifiator. Aoesta este ARNú ce transferà N-formilm'etio-
nina (ARN/M"') l,a ,bacterii, virusuri, mitocondrii qi cloroplasùe
qi ARNú ce transferà metionina (ARNtue\ la eucariote.
Func{ia ARNú este în esen!à legatà de decodificarea mesa-
jutui genetic. Dar ARNú mai poate juca rol qi în alte procese
celulare, mai ales la baeterii cum ar fi negl,area activitàlii ge-
nelor (operoni) care dirijeazà sinteza unor aminoacizi, transpor-
tul unor aminoagizi necesari formàrii punlilor interpeptidice
din perelii celulari ai bacteriilor, sin'teza am.inoacilfosfatidilgli-
cerolului, adilia terminalà a resturiior aminoacizi la protei-
ne etc.

În cazul în care Eenel,e pentru ARNú suferà mutatie se sin-
tetiz.eazà ARNú la care este alteratà specificitatea de recu-
noaqùere de càtre ,antioodon a codonului corespunzàtor datorità
modificàrilor ce apar în bucla antic,odonului sau adiacent eÍ.. IJn
asemenea ARNú va putea sà recunoascà codoni rLonsens sau
missens, care condilione'azà fie terminarea la'nfului polipepti-
dic în primul caz, fie încluderea în lanful polipeptidic a unui
aminoacid necor,espunzàtor datorità modificàrii prin substitufie
a secvenlei de bazà în cel de-al doilea caz.
ARN nuclear heúerogen gi ARN crornozomnl.
La eucariote se mai descriu qi alte d,ouà tipuri de ARN
celular. Esúe vorba de ARN nuclear heterog'sn Ei ARN cro-
mozsmnl.

6. ARN nuclear heterogen (ARNhn) reprezintà o clasà de
molecule ARN cu greutate molecularà variarbilà într,e 105 qi
2 X tÙz daltoni cu dur,ata de via!à scurtà (5-10 minute) fiind
instabil. metabolic. ARNhn repî'ezintà cca 3olo din totalul ARN
oelul'ar. Fiiurd sintetizat pe matrila ADN are o compozifie de
ibaze eomplernentarà ADN. Are un con{inut G + C de cca
4A-450/o cu mult mai mic decît cel aI ARNr care este de cca
700/0. Est€ localizat î:r afara nucleolului.
Din ARNhn derivà, în urma prelucràrilor posttranscripfio-
nal,e ARNzn, din care cauzà, ARNhz s-a mai numit ARN pre-
rnesager sau pre-ARNrn. Partea din ARNhn care nu nepnezintà
ARNnz este transcrisà de pe ADN care prezfurtà secvenle re-
pertate de nucleotide qi care se pare cà sînt implicate în me-

73

7

canisme de reglare. Aceastà parte a ARNhn poate prezenúa o
conformafi,e caracùeristicà sub formà de ac de pàr numità struc-
turà lwirpin qi care se formeazà prin împerecheri intracatenane
de baze complemerrtare.

7. ARN crarLozatnol (ARNc). Este un tip de ARN comple-
mentar unor secvenfe specifice din ADN cromozomal al euca-
riotelor. O parte din acest ARNc reprezintà molecule precur-
soare ale ARNzn, ARNr, gi ARNú. ARN crorìoZohd, pe de altà
parte se cr,ede cà reprezintà o categorie de ARN celular legatà
de interacliunea ADN-proteine càreia îi conferà specificitate
de secven!à, acest tip d'e ARN legîndu-se covalent I'a proteinele
cfomozomale histone.
Greutatea molecularà a ARNc ,este mai micà decît c€a a
ARNú càci cuprinde doar 30 pînà La 50 rrucleotide. Confine pînà
la 270/o dihidrour,acil. Nu se $tie încà dacà ARNc este într-ade-
vàr un tip aparte de ARN celular sau repr,ezintà un produs de
degr,adare a ARNhn. Sînt date dupà care ARNc intervine
în,tr-un mod specific în reglarea activitàtii genice la eucariote,
avînd efect derepresor asupra geurelor represate prin comple-
xar,ea ADN cu hisúonele.
B. ARN airol. La unii fagi oa Ei la unele virusuri vegetale Ei
animaie miezul de acid nucleic este reprezentat de ARN, PUt-
tàtor în aoest oaz de informafie geneticà primarà din cane cauzi
se mai numeqte Ei ARN geneti,c. ARN uiral poate fi mon,oca-
tenar (bacteriof,agii Fz $i R17, virusul moz,eicului tutunului, vi-
rusul gripal qi polio). Reovirusurile au ARN 'bicatenar. Mole-
culele ARN sînt liniare, niciodatà circulare.
ARN airal îndeplineqte atît rol de matrifà pentru replicarea
sa în veder,ea multiplicàrii panticulelor viraie cît qi rol de ARN
rnesryer pentru sinrteza de proteine virale specifice. Genomul
viral ARN îndeplineEte deci o funclie dublà, gen'omul qi tran-
scriptul fiind într-un anume sens unul qi acelagi lucru gi
aceeaqi enzimà numità replimzd, sau tronscriptazd,, de fapt o
ARN polimerazà servind atît funcfia de replioare cît Ei func-
lia de transcriere.

Cel mai bine studiat este ARN al fagilor QP $i R17 la care
s-a realizat secvenflenea nucleotidelor în cea rnai mane pa,rte.
Astfel cromozomul fa,gului R17 alcà,tuit dintr-o monocatemà ARN
conline cca 3510 mucleotide, purdînd informafia pentru sinrteza
a 3 proteine Ei ràmînînd încà 580 nucleotide, primele 100 uru-
cleotide de la oapàtttl 5' nefiind niciodatà traduse în pr"oteinà
ca dealtfel nici cele 50 nucleotide oare pneced capàtul 3'. Ca-
pàtul 3' al catenei confine secvenrta 5' . . . CCA CCCA-3' qi se

74

PPP

G:C
A:U
U:A
c

=G

6=C
U:A

A

A--U
c

=G

G

A

U

A

A,

c

PPP

,OHV. A

::U:.

5

\----w.-J

RF

G

A,

U

L

nrptirazi

.+[,
(a tena -naîrtlà)

(-)

u

A

A

C

A

PPP

^lJ

' ARN progen

forma, replicativA

^ REPL'T A2 A
" pr,"r",;;;;i

U

t+t

AoH

Fig. 31. Replicarea ARN viral. RF

-

dublu-catenaró.

admiùe cà aceastà secven!à este recunoscutà specific de càtre
enzima replicazà. Pe parcursul secventei ARN apar posi'bilitàîi
de împerecheri complementare intnacatenare cu formare de
structuri buclate de tip hairgnn, structuri impliaate în confe-
rirea de stabilitate monocateil]ei ARN în timpul infecfiei, în
împacheúarea sa într-o formà mai c€mpactà în capsida fagicà.
În vederea sintezei proteinelor virale moleculele de ARN
viral,, acfi'onînd ca ARNnz se ataqeazà, la rirbozomii celulei gazdà
formînd poliri'bozomi.
Im,ediaú dupà injectarea ABN viral în celula gazdà Ei lega-
rea sa de riib,ozomii celulei gazdà este sintehzatà ,e!ìzima ARN
sinfu,tazd (ARN-re plicozd) care catalizeazi formarea unei c:a-
tene complem,entare nealizînd astfel replicarea ARN viral
(Fig. 31). Dacà se considerà oatena inifial'à, care pàtrunde în
celula gazdei drept ca;tena ,,*tt ea se,rye$te ca matri!à pentru
sinteza caùenei complernentare ,-u pe principiutr împerecherii
de baze complementare cu formarea de punfi cle hidrogen, rea-
lizîndu-se pemtru un anumit timp o structurà bicatenarà ARN
numità tormd replicatiud, (Rtr'). Au loc a,poi multe runde de
replicare ale formei replicative bioaúenare. Unele din catenele
+ nou sinúetizate acfioneazà ca ARNnr dictînd sinteza de
replicazà qi pr'oúeine ale capsidei. Alte oatene f , dar nu este
exclus ca Ei unele din acelea cìare au participat la sinteza pro-

75

Fig. 32. Dogma centralA revizuità
a biologiei moleculare. Diagrama
redà relaliile de transfer de infor-
mafie dintre mecromoleculele in-
formafionale: liniile gtoase

- re-
latii dovetlite pînA ln prezent;
linia subfire continuà

- lagganis-

mul special de transfet de infor-
maJie de la ARN la ADN (re-
verstranscriete) care are loc in
celulele infectate cu oncovirusuri ;

liniile întrerupte

- transfer de

informafie nedovedit pînà îu pre-
zent.

teinicà, devin împachetaúe în capsida proteinicà a noilor par-
ticule fagice, corrrstituind cromozomul viral.
Iatà deci cà avem aici de-a faoe cu o dualitate în care
aoeeaqi rnoleculà de ARN viral poate funcliona atît ca mate-
ri,al genetic cît qi ca ARNm.
9. Reuerstmnscrierea. Pînà acum ,aîn analizat tnansferul
informaliei genetice de la ADN la ADN in procesul replicàrii
ADN de l,a ADN la ARN în procesul transcrierii gi de Ia ARN
la ARN în replicarea ARN viral.
Pînà în anul 7970 a dàinuit ideea, cristalizatà în a{a-numita
dogmrt 'a biologiei mpleculare (Fi'S. 32), potrivit càreia transmi-
terea informafi,ei ereditare se f,ace unidirecfional în sensul
ADN--*ARN-+proteine. În anul 7970 Temin gi Mizutani pe de
o parte gi Baltimore pe de alta au descris o ADN polim,erozd
dependentà de ARN izolatà din uirionii virusurilor onoogene
ARN (ri,bovirusuri oncpgìene din farnilia Retrouirifue) Si din
celule infectate cu asem€n€,ar virusuri ca gi din celule transfor-
matre malirgn. Aceastà enzimà ar€ capacitatea de a transcrie
ARN natural sau sintetic qi de a sintetiza astfel, folosind ca
matri!à ARN, o c€pie oomple'mentarà ADNc. Este deci o
violare a dogmei centra,le a biologiei moleculare càci în acest
caz ernzima ADN-polimerazd,, dependentà de ARN, condifio-
neazà transferul informaliei genetice de Ia ARN l,a ADN. Din
aceastà oauzà a fost numità inuertazd, reuertazd sau reuers-
transcriptazd i,ar procesul sintezei unei oopii ADN pe ma'trità
ARN s-a numit inverstranscriene sau rwqstranscriere.
Reverstranscriptaza folosegte ca substrat dezoxiribonucleo-
tid-trifosfafi, este depende,ntà de o matrifà ARN Si pentru
reacfia de polimenzarc ureoesità un ARN gnim,er cu rol de a
inifia sinteza catsnei ADN la oare se leagà printr-o legàturà

76

covalentà fosfodiesúericà. De as€imenea enzima necesiúà pentru
r'e'acfia neverstranscrierii ioni bivatlenfi de Mg qi Mn. Drpà
adàr,rgarea primului dezoxiribonucl'eotÍd la gfupul 3'JH al
primerului ARN, reacfi,a de reverstr,anseriere se desfàgoarà prin
adàugarea succesivà de dezoxiriboqlucleortide, oane se împe-
r'echeaaà cu 'bazele comple'rnentare din matrila ARN, între
dezoxiribonucl'eotide statbilindu-se legàhrri oovalente fosfodi-
esterice. Monocatena ADN astfel sinúetizatà, copie a matrilei
AFIN, formerazà cu aceasta,, prin interm,ediul punlilor de hidro-
gen dintre bazele oomplemenùare o structurà tbicaúenarà hi,bridà
ARN-ADN, Intervime se parre o ribonucleozd. H care hidroli-
zeazà. ARN dirrr hilbrid astfel, ca mourocatena ADN poate servi
ca matri{à pentru sinùeza unei catene complem'entare. Rezultà
un ADN bicaúenar purtàtor de informalie geneticà viralà qi
carìe se poate inf,egna în oromozomrul. oerlrulei gazdà sub fonn,a
a oeea ce a fost numit prwirus. Fàrà a duce la \in oelulei
infectaúe, pB oalea reverstranscrierii, celula gazdà este însà
transformatà malign. La un momeurt dat, sub influenfa dife-
ritilor faotori mutageni, fizici, chimici sau rbio,logici (infectia cu
{rn alt virus) provirusul ADN se desprinde din cromozomul
gazdé qi poate transcrie molecule de ARN viral, asi'gurind ast-
fel multiplícarea virusului oncogen.
ADN proviral se integreazi în cromozomul gazdà în regiuni,
om,oloage, inùegrarea fiind oondifionatà de o enzimà numità
integrazd. pe cînd în excizia sa pe lîngà inúegr,azà intervine qi
o erciào,nazd. In'tegrarea gi excizia ADN pr,oviral sînt în esmrfà
fenomene reoombinatorii de tip rupere-reunire (vezi recombi-
narea geneticà).

Virusurile oncogene prezihtà un genom repreuen'tat de ARN
rnonocatenar avînd o constantà de sedimentare de 78 S, care
cuprinde patru gene simbolizatn g@g, onc, i.rw qi poZ.
Gena gog specificà proteineLe virale interure avînd ca pro-
dus primar o proteinà cu masa molecularà de 76 000 dalúoni.
Gena otzc specificà o proùeinà implicatà în inducerea tramsfor-
màrii maligne a celulelor în creqtere. Gena inu esbe legatà de
sinteza glicoproúein'ei de la suprafala înveliqului virio.nului, iar
gena pol specificà sinteza inve'rstnanscriptaa,ei (reverstranscrip-

taz'ei).

În 1969, Huebner gi Todaro au elaborat ipoteza oncogenei,
potrivit càreia toate celulele contin în ADN o uirogend, adicà
,o genà oare oonfime informafia geureticà a urnui virus incluzînd
qi ,aceea pentru transformarea malignà a celulei gazdà, adicà

77

oncog€na. Virogena este replicaità qi transmisà odatà cu ADN
gazdà dsa lun€ul generafiilor celulare. În mod normal oelula
a elaborat mecarrisme de represi,e a virogenei. Cînd mecanismul
de represie este alterat virogena se exprimà qi duce prin acti-
vitate'a onoogenei la transformarea malignà a celulei. Altera-
nea meoanismului de represie apare în urma ac{iunii diferililor
agenti fizici, chirrici sau biologici.
Desi'gur virusurile onoogene pot fi ribovirusuri (ARN) sau
dezoxiriibovirusuri (virusuri ADN). Reverstranscrierea este î'nsà
specificà ribovir'usurilor oncogsne.

Capitolul III

ORGANIZAREA MATEEIALT]LI]I MH}ITAR

Sisùemel,e biologice cuprind douà tipuri fundamentale de
organizare Ei e,nume orgonizorea ui,w'ld qi orgm,iznrea celulord,.
La rîndul sàu orgamizarea celularà cuprinde douà tipr:ri diver-
genùe de ,organizare: organizarea procariotà Ei organiza,rrea eu-
cariotà, precum qi un tip intermediar, organizarea ntezwriotd
(Gavrilà, 1978).

1. ORGANIZAREA VIBALA

Asupra concepttrlui de virus a fost etraborat neoent un ex-
celent studiu critic (7nrnea, Ei Herlea, 1974).
Statutul particular af sisternului viral poate fi desprins
de expresia aforisticà a lui Lwoff care în 1957 afirmà cà
,,virusurile pot fi oonsiderate ca virusuri, din cauzà cà viru-
surile sînt virusurir(. Virusurile se caracùeriznavÀ prin existenta
în structur'a lor a unui singur tip de acid nucleic (fie ADN,
fie ARN, niciodatà ambele tipuri d,e acid nucleic). Virusurile
nu cresc, DU se divid qi nu posedà aparat enzimatic pentru
produoere de energie. Prin aceasta virusurile se deosebese esen-
fial de toate celelalte sisteme bioLogice existente actual-
mente în natura. Dar virusurile pot fi oonsider,aúe toúuqi sis-
teme biologice prin faptul cà ele pr'ezintà caracterlstici struc-
tunale qi dimensiunri cpnstanùe, pot suferi rnutafii qi recomibi-
nane geneticà qi pr'eziurtà o ontogenezà, precisà în care pe seama
materialului biologic ail celulei gadà, materialul lor genetie
dirijeazà formarea noilor particule vira,le, asigurînd astfel per-
petuarea lor.

Viruzurile au orgranizare acelularà. Particul,a viralà com-

79

pletà numità oirion sau virusul infeclios matur reprezintà o
unÍta,te de structurà qi funcfie atcàtuit dintr-un îmveliE protei-
nic

- capsida $i un miez de acid nucl,eic. Miezul de acid nu-
cleic este reprezentelt de ADN la d.ezoúriboairusuri qi de ARN
I'a ribatirusuri. Acizii nucleici virali nu sînt asociafl cu pr,oteine
cu exceptia unor cazuri îur care se descrie exisùenfa în interio-
rul capsidei a unei proùeine implieatà în împachetarea (supra-
spiralizarea) acidului nucleic viral obligat sà fie cantonat
într-un spa{iu foarte restrîns. Alte tipuri de proteine virale
,,interne( au rol enzimatic (replieaza sau reaerstrans*i.pfuza
de exemplu).

Miezul de ,acid nucleic viraù. se mai numegte crarnozo'm ui-
rol. Virusurile sînt par,azilt obligali de nivel gearetic, deoarece
virusurile, nu se reproduc de sine stàtàtor, ci ele se reproduc
pe searna componentelor oelulei ,gazdà dupà planurile anhitec-
turale furscrise în informa{ia ereditarà viralà depozitatà în
miezul de acid nueleic ADN sau ARN.
Datoriúà acestui fapt marea majoritate a virusurilor rnani-
festà o înaltà qi striotà specificitate de gazdà: un virus oe in-
fecteazà Eseherichia coli bunàoarà, în mod normal nu va pu-
tea infecùa o al.úà specie de bacterie, ba mai mul.t prezintà pre-
ferfur,!à pmrtru o ,anumità tulpinà de E. eoli. O singurà exoepfie
se impune a fi amintità. Este vonba de virusul PIV? care in-
fecteazà peste 40 de specii, diferiúe de planrte

Ei chiar o insectà.
În afarà de virion, virusul se mai poate afla sub formà de
vinus vegeú,artiv crorespunzînd eromozomului viral aflat liber în
citoplasma celulei gazdà în ,timpul mul'tiplicàrii sale sau sub
formà de provirus cînd este integr,at în eromozomul gazdà. în
cazul dezoxiri,bovirusurilor, ADN poate fi dublu-catenar (li-
niar sau circulan), sau monocatenar, circular. Acesta din urmà
devine dublu-catenar în timput nepticàrii.
La ri'bovirusuri precum ,ba,c,teriofagii

8p, Rn pi fz, VMT,
unele vimsuri 'animal,e (influ'enza gi alt poliomelit€i) ARN este
monocatenar qi devine dublu-c,atenar în timpul replicàrii. Reo-
virusul are un ARN duiblu-oatenar chiar atr:nci cînd es,te în
stare de virion. virusurile planúelor au în gener,al un ARN
duiblu-c'atenar. La reovirus qi alte virusuri animale genomul
viral este segmeùltat adicà ARN esúe rreprez*ntafi prin mai multe
piese de z4,R.fú bicaúenar. Genomul ARN al virusului gripal ,este
disc,onúiuruu. El este monocaùenar si format din g fr,agmente
avînd o greutaúe molecularà cuprinsà ùrtre 105 gi 106 dalúoni
realizînd o m,asà molecularà de 5,5 X 106 dalùoni.

80

Virusurile gripale, paragripale qi rabdovirusurile se numesc
virusuri cu catenà negativà deoarece ARN-ul lor nu are funclie
mesagerà, $i pàtrunzînd în oelula gazdà,, nu poate induce sin-
teza proteinelor virale specifice, din asemenea virusuri nepu-
tîndu-se extnage ARN viral infectant. În particulele virale ale
acestor virusuri existà enzima transcri,ptazd care asigurà tran-
scrierea unei catene ,,*tt pe catena inilialà ,,-sc. Transcrierea
qi replicarea ar putea fi reaLizatà de aceeagi enzimà ARN
trarrscriptazà,, sau enzima de transcriere este modifica,tà prin
adilia unei proteine din celula gazdà astfel cà ea d,evine o

replicazà.

Dimensiunea genomului viral variazà între 3000 nucieotide
qi peste 10 000 nucleotide, codificînd între 3 Ei 10 proteine cu o
secvenfà de cca 140-160 arnin,oacizi. Bacteriof,agii ARN repre-
zinti unele dintre cele mai mici virusuri avînd cca 3300 nu-
cleotide care cor,espund la 3 gene priurcipale, douà specificînd
proteine structurale al'e virusului iar a tr,eia specificînd ARN-
sintetaza.

Adenovirusurile mai mici prezintà o macromol,eculà d,e ADN
sub formà circularà atît la nivelul virionului cît gi în forma
sa replicativà, pe cînd în cele mari, la nivelul virionului, ADN
se prezintà ca o moleculà filamentoasà lungà de 6 pm Ia fagul
qzg ee infecteazà bacteri,a Bacillus su,btilis gi de 47-52 pm la
fagii de tip Tz $i Ta ai bacteriei E. coli. Virusul variolei aviare
are o moleculà de ADN lu,ngà de 93 pm.

*FÀglI

l. al bacteriei E. coli ,ar,€ o moleculà de ADN lungà
de 16 pm qi care prezintà la oapete prelungiri monocatenare
din care cauzà aceste ca,pete sînt ,,lipicioase6r sau ,,adezivea,
adicà au secvenfe oomplementare pe seama càrora molecula
bioaúenrarà linianà de ADN se circuLanzeazi in aitro ca qi în
timpul cînd se aflà în celula b,acterianà.
$i fag'ii Tz, Ta, Te $i T7 pr,ezintà secvenle terminale repe-
tate în moleculele limiare dublu-caten'are de ADN dar ele se
aflà la n,ivelul unor regiuni dublu-catenare, neputîndu-se rea-
liza circularizarea.

Forma circularà protejeazà macromol,ecula ADN de atacul

exonucleazelor.

De regula însà la nivelul ADN viraù nu se aflà secvente

repetate de baze.

Se cronstatà cà virusurile car,e au acid nucleic reprezentat
de o moleculà monocatenarà în virioar aceasta devine dublu-
catenarà în timpul replicàrii. Monocatena reprezintà rnesagerul
Ia fagi pnecum QF qi f2 oar€, patrunzînd în celula gazdà poate fi

81

$ - Descifrtnd tainele ereditàfii, vol. I

7

direet tradusà de maqinària de sinte'zà proúeinicà a celulei
gazdà. În aL,te cazuri, caúena caÌre pàtrunde reprezintà comple-
mentul mesajului, aqa cum este cazul lui p X 174. În aoest @2,
neplicarea rnonocaùenei este primul eveniment qi numai dupà
aceasta aparatul genetic este disponibil pentru tra,nssriere.
În ,eoncluzie se po,ate spune cà informafia geneticà a viru-
surilor se aflà codificaúà în cnomozornul viral care este nepre-
zentat fie de ,q,,DN, fie de ARN gi care se aflà sub formà de
m'olecule liniare sau circul,ane rbicatenare saru monocatenare.
Moleculele monocatenare d,e ADN sau de A.R,N ,capàtà în tim-
pul replicàrii formà bicatenarà, reprezentînd inúermediari r,e-
plicativi sau forme replicative.

2. OBGANIZAREA CELULABA

Toate sistemele biologice cu excepfia virusurilor pnezin'ta
organizarre celularà. Organizarea celularà a nepnezentat o etapà
esenfialà în organizarea qi evolufia ma'teriei vii care a oferit
enorme posibilitàti qi perspective evolutive. Deosebirea princi-
palà dintre virusuri Ei celule courstà în faptul cà niciod,atà o
particulà viralà nu va pute,a da naqtere direct la alte douà
particule virale prin diviziune. În cazul celulelor, oricît de
simple ar fi ele, chiar arflate la limita superioarà dimensio-
,nailà a particutreilor virale, cum sînt

'micr,oplasmele gi ricketiile,
multiplicarea presupune diviziunea unei celule preexistente
prin care nezultà douà celule fiice identice. La berza, multipli-
càrii celulare stà o finà coordona,re între replica'rea ADN qi
distribu{ia produqilor de replicare în celulele fiice prin inter-
verrfia unor mecanisme specializafre qi extrem de diversificate.
Toaúe celulele au de asemenea ambel,e tipuri de acizi nu-
cleici qi un sistem propriu de sintezà proteinicà.
În cadrul organizàrii celul,are se deose,besc douà tipuri oar-
dinale de onganiz,ar'e geneticà

- procariot gi eucariot qi un úip

intermediar

- mezocariot.

2.1. ORGANIZAEEA PROCABIOTA

Aoest tip de orga,nizare car,acteriz,e,azà. bacteriile, actinomi-
cetele qi al'gele albastre-verzi ururnite incà cianobacterii, prezen-
tînd toàte atributele sisùemului biologic oelular, inclusiv auto-

82

r,eproduoerea si morfogeneza autonomà. Materialul ior ereditar
este reprezentat de o moleculà circularà dublu-catenarà de
ADN care se mai numeqte crom ozom bacterian. Cor,espondentul
m,orfologic a'l crorîozcmului circular bacterian este Àucleoidul
bacterian care prezintà la nivel ultrastructural ca Ei geuoforul
algelor alibastre-verzi fibrile fine de ADN care au un diam,etru
de 25 A lGavrilà qi Tàciurà, 1978).
Nucleoidul bacterian nu este separat fa!à de citoplasmà,
de càtr,e o structurà mem,branarà, astfel cà aoeste organisme
nu au un nucleu ,adevàrat. Materialul genetic nu esté închis
în,tr-un spafiu genertic definit, astfeL cà r,àporturile sale cu cito-
pl,asma sînt directe. La procariote relafia- ADN-cromozom este
de toúalà omologie. cromozomul bacterian cuprinde, urr set
complet de determinanli genetici (gene) ai tuturor caracterelor
unei celule bacteriene, pentru me,taibolism energetic, biosinteze
c'elulane, creqtere qi diviziune ca gi penúru regl'area activitàlilor
intracelulare. ADN bacúerian nu se asociazà de regulà cu
proteine tbazice histonice. Date recente indicà prezenla, la bac-
teria E. coli Ei ],a cianobacteriile Annbaena qi Aplwno&psa, aso-
ciate la ADN, a unor proteine

'bazice d'e tip hisùonà cu greu-
tate moleoularà micà de 10.000 dalto,ni. Structura supercpira-
liza;tà a ADN bacterian este menlinutà de càtre ARN.
Cnomozomul circular bacterian reprezintà suportul fizic al
unicului grup de înlàn{uire a genelor, toate genele bacteriene
fifurd úransmise în bloc la descemden{i. El reprezinrti cea mai
rDBr€ mol,eculà descrisà pînà în prezent în'tr-un sístem ibiologie
cuprinzînd un numàr de coa 2000-3000 de ,gene. Are un peri-
metru de 1400 pm. Circularitatea cromozomului bacterian îl
pnotejeazà fafà de acfiunea depolimerizatoare a unor enzime
precum dezoxiribonucleaza. Date asupra circularitàtii cromozo-
mului ibacteria,n au fost obfinute, prin urmàrirea proc€sului

"

de
conjugare bacterianà. S-a constatat astfel cà în cadrul acestui
pnoc€s transfenrl, de gene de Ia celula donor l,a celula receptor
se face cu o secvenfialitate precisà qi determinatà în rtimp
(Jaeob qi Wollman, 1961). Ulùerior Cainns (1963) aduce dovezi
ooncludente electronomicrpsoopice qi autoradiografice care pro-
beaeà, circularitatea, cnomozomului baetrerian. Toate ibacterlile,
cu o posibilà excepfie a bacteri ' Psqud,omonos, prezin,tà cro-
mozom circular. Se cunoagte încà putin despre organizarea unor
asemenea inele de peste 1000 pm lungime, aflate în celul,e a
càror lungime nu depàEeqte l-2 pm. Crom,ozornul ,bacterian
pnezin'tà un punct de ataqare pe membrana celularà, iar ata-
garea aceasta reclamà sintezà proteinúcà. Sînt date dupà cane

83

situl de ,ataryare la membrana celularà corespr:nde unei negiuni
dim cromozomul bacterian bogatà în secvenle A-T. De regulà
fiecare celulà tbacterianà are un singur cromozom dar fur cazu-
rile cînd replicarea cromozomului nu este urmatà de diviziu-
nea celul,ei pot apare 2-4 cromozomi. Dar aoeqti cromozomi
multipli nu aduc o informalie geneticà suplimenúarà, ei repre-
zentînd copii identice ale crromozomului original. Condifia nor-
malà a celulei bacteriene este haploidia, càci ea prezin,tà un
singur set de determinali ereditani (gene).
în ,afara cromozomului circular

- suportul grupului prin-
cipal de gene în citoplasma celulei bacteriene se pot efla una
sau mai mulùe structuri eneditare adifionale, extracromozo-
m,al€ (separ:ate fizic de cromozomul principal) confilrînd fiecare
coa 0,5-2010 din ADN total al oelul,ei, cane au fost numite
plasmide. Ele se replicà indepemden,t de cromozomul principal
bacterian qi sint moqtenite sta,bil. Ele sînt r,epliconi tipici. Plas-
mida (termen introdus de Lederberg, fur 1952) reprezi,n'tà o mo-
leculà circularà de ADN ',bicatena'r, mult mai micà 1lo/o) co,m-
panativ cu c\ea a cromozomului ibacterian. Plasmida poartà
6-10 geille fiind de f,apt un cromozom bacterian miniatural.
'Ca exemple de plasmide pot fi considerafte factorul de ser (F),
Jactorul de rezistm.fd la ontibiotice (R), factorul colícinogeni,c
(col), fagti temperafi cum ar fi fagul î,, care în stare de profag,
se integre'azà in cnomozomul gazdà tot astfel precum se poate
integra qi factorul F. În stare integratà asemenea structuri
,poartà numel,e de episomi.
Unele plasmide au fost numiúe conjugoni, datorità proprie-
tàfilor de a se comporta ca factori determinafi ai conjugàrii,
fiind tr,ansmisi'bile de la o c'elulà la a'l'ta în procesul oonju-
garii.

Datorità tra,nsferului de plasmide de la o celulà la ,alta
,ca gi a pierderii spontane a unora dinrtre ele, celula bacterianà
se aflà într-o stare permanentà de variabilitate genotipicà asi-
gurîndu-se astfel o mai bunà qi uruanlatà adaptare a acestora
la mediul lor de via!à. Datà fiind implicarea plasmidelor în fe-
nomenele de rezisten!à la antibioticre, studiul 1,or a càpàtat un
mare impuls în ultimul timp cînd au apàrut tulpini ,bacterie'ne
multipiu r,ezisten,te. Dar în prezenú studiul plasmidelor bacte-
riene este intensificat qi prin ace'ea cà aceste structuri mole-
culare s-au dovedit a fi excelen{i càràugi ai unor fragmenúe de
ADN euoariot, reprezentînd un fe} de ,,cal trnoiams prin care

84

est'e introdus intr-o celulà bacterianà un fnqgmenú d'e ADN
purtàùor al unei gene eucarioùe. Esúe vor"ba de realiTÀrea aqa-
zizului ADN recombinant.

You're Reading a Free Preview

Download
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->