Archives of Medicine Collection 2010

Archives of Medicine
http://www.archivesofmedicine.com/
Editor in Chief Dr. Ricardo Correa Mrquez
Medicina Interna, Jackson Memorial HospitalUniversity of Miami E-mail: archmed@imedpub.com
v2
Archives of Medicine is a hybrid journal devoted to all areas of medicine.
Published by IMedPub publishing house. ISSN: 1989-5216
2010
http://www.archivesofmedicine.com/
Issue
1:1 1:2
Content
Artculo
A study on genital tuberculosis and infertility in Indian population Analysis of the relationship between power, anaerobic capacity and speed displacement in men between 50 and 60 years of age. Improved probes for detection of V617F mutation in chromosome 9-borne JAK 2 gene linked to conditions of Polycythemia Vera and other myeloproliferative disorders. Low back pain in residents of Comalcalco, Tabasco, Mexico: Prevalence and associated factors. The stream of life
1:3
1:4 1:5
iMedPub Journals
ARCHIVES OF MEDICINE
doi: 10.3823/051
2010 Vol. 2 No. 1:1
Original Article
A study on genital tuberculosis and infertility in Indian population

1
Savita S. Nadgouda, 2,#Pratap N Mukhopadhyaya, 2Arpan Acharya, 3Anju Nagee and 4Prashant D Kunjadia
1Jaypriya Hospital, 2, Ashoknagar Road, Bailappanavar Nagar, Hubli 580 029, Karnataka, India; 2Molecular Genetics Division, geneOmbio Technologies, Krishna Chambers 4th floor, Pashan-Sus Road, Pashan, Pune-411021, Maharashtra, INDIA; 3Ashok & Rita Patel Institute of Integrated Study and Research in Biotechnology and Allied Sciences, New Vallabh Vidyanagar, Anand-388021; 4MB Patel Science College, Anand-388001, India. 1Corresponding author Correspondence: Dr. Pratap Narayan Mukhopadhyaya, CEO & Head, R&D Operations geneOmbio Technologies, Krishna Chambers, 4th Floor, Pashan-Sus Road, Pashan, Pune-411 021, Maharashtra, INDIA. Electronic mail: pnm6619@gmail.com; Cell phone: +91 9881153425, Fax: +91 20 25871154
Abstract:
A set of 170 patients with infertility related complain were studied. 10% (17) of the population was found to be positive for tuberculosis infection. These patients indicated symptoms of bleeding disorder, amenorrhea, irregular menstrual cycle, HPR evidence, PCR positivity and tubal blockage in varying proportions. When subjected to WHO recommended TB treatment regimen, 3 patients developed cognizable side effects and discontinued treatment. Five patients were found to be cured of menstrual problems and ascites while 2 of them successfully conceived. It was found that the pregnancy rate in genital TB infected patient were less and those who conceived were lesser in percentage. Genital TB infection was concluded to be a major factor in females suffering from tubal infertility in India.
Introduction
In developing countries like India Genital tract tuberculosis is identified as an important cause of infertility. Most often, hysterosalpingograms (HSG) remain the primary method of diagnosis for understanding various tubal and peritoneal factors that might lead to cases of infertility (Karasick, 1991). This method has been identified as a unique procedure for ascertaining the internal architecture of female genital tract which is essential for ascertaining the changes associated with tuberculosis infection (Schwimmer, 1990). It has been found that around 0.75% to 1% of total gynecological complaints are associated with genital tuberculosis in India although this number varies from place to place (Arora and Arora (1992). Around 5% of all pelvic infections are cases of genital tuberculosis and further it accounts for 10% of all cases of pulmonary tuberculosis also (Arora and Arora (1992; Dawn, 1998). Althoguh most of the cases are from females of reproductive ages only, it has also bene reported in post menopausal individuals also (Alenti and Pierandrei, 1998). Infertility is defined as the inability to conceive by at least one year of unprotected intercourse. Treatment may be started earlier in case of an obvious cause or advanced age of the couple. Genital tuberculosis is an important cause of sub fertility, more so in endemic zones such as South India. Still, the true epidemiology of this disease remains unknown due to lack of highly sensitive and specific tests. Genital tuberculosis not only causes tubal obstruction and dysfunction but also impairs implantation due to endometrial involvement and ovulatory failure from ovarian involvement (Roy and Roy, 2003). The prevalence of infertility is about 10-20% among couples (with somewhat equal prevalence among men and women). There are many factors that can affect female fertility. Some, such as tubal or age factor, are completely known and some are in debate (e.g. endometriosis, cervical or immunologic factors (Xiang et al., 1998).
Under License of Creative Commons Attribution 3.0 License
Female genital tuberculosis (FGTB) is still a major cause of infertility in India in spite of the availability of specific therapy. The prevalence of FGTB in infertility clinics shows marked variations in different countries ranging between 15 and 25% (Xiang et al., 1998). In 80-90% of cases, FGTB affects young women between 18 and 38 years of age and is an important cause of infertility (Varma, 1991; Crofton et al., 1992). Genital tuberculosis (TB) predominantly affects individuals below 40 years of age and peak age frequency ranges between 21 to 30 year of age (Nwachokor and Thomas, 2000). In this study, the prevalence of genital tuberculosis in a cross section of female population in India was surveyed with special reference to incidences of infertility.
Materials and methods

Study population The resource population for this study comprised of 170 female individuals, aged between 25-40 years visiting the clinic with complaints that were within the purview of inclusion criteria. The parameters for selection were complaining of infertility and symptoms of pelvic pain, irregular menstrual bleeding, scanty menstruation or amenorrhea. A pelvic mass in variable combination was also considered to be criteria for inclusion of a subject for study. Constitutional symptoms comprised of sweating and weight loss. Local organ dysfunction manifested in amenorrhea, and bilateral tubal blockage was also noted as seen through classical hysterosalpingographic study. Analytical methods The analytical assays performed under this study were as described by cited authors. (1) Conventional culture method (Nyendak et al., 2009) (2) Polymerase Chain Reaction (PCR) for Mycobacterium complex (Beige et al., 1995) (3) hysterosalpingographic study (HSG) (Chavan et al., 2004)
This article is available from: http://archivesofmedicine.com
iMedPub Journals
doi: 10.3823/051
2010 Vol. 2 No. 1:1
(4) tissue histopathology (Lucas, 1988) and ultrasonography (Yapar et al., 1995).
Results and discussion

170 patients were analyzed in this study. Out of these 17 were found to be positive for Mycobacterium tuberculosis infection by culture method (Table 1). All these patients indicated bad obstetric history with ultrasonography finding confirming an altered endometrium associated with genital tuberculosis. It was noted that in 50% of genital MTB cases, the endometrium was involved. Further, around 30% of the patients with tubal adhesions, intrauterine adhesion was observed.
ity especially on the Indian subcontinent. In women with genital tuberculosis, the clinical pregnancy rate per cycle is lower and further, spontaneous abortion rate is high. Therefore they appear to represent a less favorable subset within other tubal factor-patients when treated with IVF-ET.
References
Karasick S. Hysterosalpingography. Urol Radiol 1991;13: 67 Schwimmer M. Gynecological inflammatory diseases. In: Pollack HM, editor. Clinical urography (1st edn) Philadelphia: W.B. Saunders, 1990: 985. Arora R.. Rajaram P., Oumachigui A., Arora V.K.; Prospective analysis of short course chemotherapy in female genital tuberculosis; Int J Gynecol Obstel 1992;38:311 Dawn C.S.; Pelvic infections; In: Dawn C.S.; ed Textbook of Gynaecology and Contraception: 9th ed.; Calcutta: Arati Dawn; 1998; 321 Alenti C., Pierandrei G.; Postmenopausal endometrial tuberculosis. A clinical case; Minerva Ginecol 1998; 50: 93 Roy H, Roy S. Use of polymerase chain reaction for diagnosis of endometrial tuberculosis in high risk subfertile women in an endemic zone. J Obstet Gynecol India 2003;53:260 Xiang W, Liao, ACR and Chan, C. A new molecular variant of Luteinizing Hormone associated with female infertility. Fertil Steril 1998; 69: 102 Varma TR. Genital tuberculosis and subsequent fertility. Int J Gynaecol Obstet 1991;35:1. Crofton J, Horne N, Miller F. Clinical tuberculosis. 1st edn. London: Macmillan Education Ltd. 1992;502-10. Nwachokor FN, Thomas JO. Tuberculosis in Ibadan, Nigeria a 30 year review. Cent Afr J Med 2000; 46:287 Chavhan GB, Hira P, Rathod K, Zacharia TT, Chawla A, Badhe P, Parmar H. Female genital tuberculosis: hysterosalpingographic appearances. Br J Radiol. 2004;77:164. Beige J, Lokies J, Schaberg T, Finckh U, Fischer M, Mauch H, Lode H, Khler B, and Rolfs A. Clinical evaluation of a Mycobacterium tuberculosis PCR assay. J Clin Microbiol. 1995; 33: 90. Lucas SB. Histopathology of leprosy and tuberculosisan overview. British Medical Bulletin 1988; 44:584 Yapar EG, Ekici E, Karasahin E and Gokmen O. Sonographic features of tuberculosis peritonitis and female genital tract tuberculosis. Ultrasound Obstet Gynecol. 1995;6: 121-125. Nyendak MR, Lewinsohn DA, Lewinsohn DM. New diagnostic methods for tuberculosis. Curr Opin Infect Dis. 2009; 22:174
Serial number
Observation
Number of patients (out of a total of 17 culture positive patients)
1 2 3 4 5 6
Bleeding disorder Amenorrhea Irregular menstrual cycle HPR evidence PCR positive Tubal block as evident from HSG and laproscopy
2 2 5 2 8 4
Table 1: Clinical and/or analytical observations of 17 out of 170 patients with complain of infertility.
All 17 patients were subjected to treatment regimen that involved the WHO recommended treatment scheme (PZA=1500 mg/day + INH (300 mg/day) + Rifampicin (450 mg/day) + Ethambutol (800 mg/day) for 4 months and Rifampicin + INH = 450:300 for another 5 months respectively (World Health Organization, 2003. Treatment of Tuberculosis: Guidelines for National Programmes). Out of them, 3 patients discontinued medication because of side effects (jaundice, skin rash and acid peptic diseases) and/or non compliance of therapy. Post treatment, all these patients were the subjected to standard in vitro fertilization (IVF) treatment. Around 5 of them were cured of menstrual problems and ascites while 2 patients successfully conceived. It was noted that the conception rate was low and further the birth rate was still lower. The risk factors not conducive to pregnancy were secondary amenorrhea, any endometrium or curettage and negative chromopertubation. There has been a rapid surge in female genital TB and therefore gynecologists will be face increased cases of TB infection. Genital tuberculosis can be asymptomatic or may present atypical symptoms or even mimic other clinical conditions that make the situation all the more challenging. Therefore it is necessary that we consider the possibility of TB in patients within the reproductive age group who present with symptoms of infertility, chronic pelvic pain and menstrual dysfunction where other causes have been ruled out. This if further important for those women who fall unto the high risk category for TB infection. This study highlights the fact that tuberculosis, a chronic infectious disease is one of the major etiological factors of female tubal infertil-
iMedPub Journals
doi: 10.3823/051
2010 Vol. 2 No. 1:1
Publish with iMedPub Journals http://www.imedpub.com ARCHIVES OF MEDICINE encompasses all aspects of medical science and clinical practice and cooperates closely with ARCHIVOS DE MEDICINA, a Spanish-language open access journal. Submit your manuscript here: Archives of Medicine (http://archivesofmedicine.com) Archivos de Medicina (http://www.archivosdemedicina.com)
Under License of Creative Commons Attribution 3.0 License This article is available from: http://archivesofmedicine.com
iMedPub Journals
doi: 10.3823/052
2010 Vol. 2 No. 1:2
Original Article
Analysis of the relationship between power, anaerobic capacity and speed displacement in men between 50 and 60 years of age.
Jhon Fredy Ramrez Villada,1,2 Carlos Enrique Melo, Robert Giorgi Laverde1
1Facultad de Cultura Fsica, Deporte y Recreacin, Universidad Santo Toms, Bogot (Colombia). 2Correspondencia: Jhon Fredy Ramrez. Email: jhonramirez@usantotomas.edu.co /jhonramirezvillada@gmail.com
The neural, structural and functional changes happened with the process of aging have led to suggest new intervention schemes with application of aerobic and anaerobic loads. These proposals must be examined carefully because it may cause damage, by characteristics of the degenerative process in accelerating functional dependence. We evaluated 13 athletes, aged 50-60 and attached to athletics groups aimed to analyze the impact of charges on body composition, aerobic, anaerobic capacity and power, and about the speed of travel. Anthropometric evaluation allowed us to estimate the body compartments and Wingate tests and speed on different sections, helped evaluate the transference of force generated functionality. The results reveal that the characteristics of anaerobic capacity and power are influenced by the weight of the different compartments and the cross-sectional area of the thigh. Similarly, the installment of 30 and 45 meters have a direct and positive proportional to the average power generated, but not with the peak of power. In conclusion, the relationship of anthropometric variables, capacity and anaerobic power (Wingate) and travel speed, allow the analysis of structural and functional behavior of the greatest assets, related to the training regimen.
Introduction
The speed has been considered to be in general terms the aptitude to cover a space or to realize a simple movement in the minor possible time (1-3). This capacity can be shown in the time of reaction, the rapidity of execution (expression speed) or the speed of displacement generated, aspects that will be determined by neural factors (quantity and quality of the units motorboats) and structural (type of muscular fibers) (4-6). On the other hand, consider that the manifestations of maximal strength and maximal dynamic strength are crucial for the manifestation of explosive strength, joint capabilities that have a high correlation with the times achieved in 60 meters or velocities in different sections (2, 7, 8). These evidences are supported on the basis that phasic motor units are larger and are composed of fast fibers (fast fibers twich, FT) that rely on anaerobic metabolism and to develop high voltages with a shorter contraction time (8, 9). With regard to the above, it is important to note that there are new models of intervention with subjects older than 50 who have shown promising results regarding the ability to express different types of force, alter the muscle cross-sectional area (hypertrophy) and increase the level of functional independence (10- 12). However, these models are not intended to stop the natural aging process, but are shown as alternative methods to slow the degenerative changes occurring in these stages of life. If, as the authors raise, the strength can be changed in subjects who started or are in the middle stage of aging (age >50) is appropriate to address the transfer of adaptations to common tasks such as walking, running, jumping (13-15), etc. The problem is that most test related to this issue have been validated in young people active, but not in sub-
jects over 50 years, where it became more evident deterioration in the agency as a result of the aging process. This scenario leads us to consider the importance of analyzing the reciprocal of the capacity and power of different energy production systems required under aerobic and anaerobic conditions, to understand more precisely the effects of the intervention models applied to functional independence and to suggest new control strategies that can be easily implemented. The first stage of this research aims to analyze the relationship of smooth scrolling speed in different sections, power and anaerobic capacity in men between 50 and 60 years old with history of aerobic training.
Materials and methods Sample

We interviewed 40 men belonging to the groups Masters athletics in the city of Bogota (Colombia), with a physical practice of not less than one year, a training frequency of 4-7 days per week and facing charges of aerobic training, which 17 individuals met the inclusion criteria (Table 1). Accepted after external review to start the process of selection and organization of the tests, subjects were assessed clinically using the following aspects: alteration of the spine, upper or lower limb, amputations, sequelae of fractures, prosthesis, treatment with steroids, cardiovascular disease and joint conditions. For participation in the process, the sample provides the informed consent form detailing the objectives, procedures and risks of research and the use of confidential data. This study was approved by the health team
iMedPub Journals
doi: 10.3823/052
2010 Vol. 2 No. 1:2
to estimate body density. Similarly, we calculated the body mass index and corrected thigh circumference in addition to the study (16-20). The instruments used for anthropometry consisted of: skinfold caliper Slimguide , anthropometric tape measure and caliper Holtain EBRD . To the knowledge of neuromuscular function, subjects were familiar with the different actions (speed 15 meters flat, smooth speed 30 meters, 45 meters and smooth speed Wingate test) 7 days before the first control. For the assessment of anaerobic power capacity and was selected the Wingate test (21), using a bicycle Monark model 810, which apply the pedal to the lower limbs for 30 seconds, against a constant resistance (0,075 kilograms per kilogram of body weight) in response to international considerations. Before to beginning of evaluation, there fitted the height of the chair and the thongs as the length of the low members of the patient, a verbal sign (beginning) happened, a regressive count (3, 2, 1) and one continues verbal motivation that should to assure the maximum declaration of the physical capacity. As for the speed of displacement, the distances to analyze were stretches of 15, 30 and 45 flat meters (22-24), which were established making use of a tape measure, a drawing of the line of trajectory on the surface (to delimit the space to cover) and a drawing of the line of preparation to two meters before the station of exit (fig. 2.). The times were coming out and turning on the right side, seeking thereby to control the quality of the measurement points were established and visible to the test helped to determine the route. Executed in each test were scored 3 tries and the most representative for further analysis, being used as instruments for SMEs: Konus digital timers, pins and a tape measure 30 m long Holtain.
and ethics of the Universidad Santo Toms (Bogot) and was conducted in accordance with the parameters set in the declaration of Helsinki. Of the 17 men who completed the selection criteria, 13 completed the study, there was a loss of 23.5% sample, individuals who were excluded by their irregular attendance, neglect or failure to attend any part of planned controls for the study. No injuries were referred, except subjective muscle pain and fatigue after the test execution.
Experimental Design
The protocol of this study is shown in fig.1, which warns that the tests were confirmed between 2 and 3 times in two weeks, separated by an interval between the tests of 2 days, intended to reduce possible learning effect and get some data analysis.
Assessment tests
The body composition assessment was made following signs of Kinanthropometry Spanish group (16, 17). We determined the percentage fat, percentage lean, bone and the residual percentage by measuring skinfold, biceps, triceps, subscapular and supracristal, following the equations of Brozek et al, De Rose and Guimaraes, Rocha, 1975 Wurch, 1974, respectively and with reference to Durning and Womersley (1974)
Statistical Analysis
To calculate means and standard deviations were used standard statistical methods in the case of the estimate of the correlation were applied nonparametric tests (Sperman and Kendall), establishing levels of significance with p <0.05 and highly significant for p <0.001.
iMedPub Journals
doi: 10.3823/052
2010 Vol. 2 No. 1:2
Results
The correlations between anthropometric variables, the Wingate test and the speed reached in the proposed distances of 15, 30 and 45 meters are presented in Table 2. Outstanding relationships between distances of 30 meters-45meters and the average power generated, with values close and highly significant. Emphasizes the same way, no correlation between lean mass and corrected thigh circumference, and a half peak power generated with the maximum speed reached. They can also be assessed proportional and positive behavior of the variables, where the gradual increase in the overall average power and power per kilogram weight is observed greater speed for the task of 30 meters. Similar observations stand out from the overall average power or average power per kilogram of total mobilized to the maximum speed reached in the task of the 45 meter flat.
sidual) influences the force exerted at some point in the descent phase in pedaling, goes into action as a determinant value, as is the force of gravity. What is expressed is to argue that the force exerted by the lower limbs is influenced by the load in kilograms of fat component, since it must be defeated with the same amount of lean lower body involved in the total power generated. These data have been utilized in several studies and in the same application of the Wingate test, where it becomes necessary to estimate lean mass mobilized in order to clarify the extent of participation of it in the requested task (21, 26). In this connection it is interesting the correlation observed between total body weight, BMI, thigh circumference and corrected peak power recorded in the subjects assessed, which although not before 5 seconds, if it is linear showing that the characteristics power of the subjects were altered by the percentage of lean mass requested, and as indicated by several studies, the quality and quantity of the fibers involved (ST / FT) (27-30). The results are consistent with studies which demonstrate the strong relationship between the state of the musculoskeletal system with the anaerobic condition, and hence the degree of operational independence, which must consider the quality and quantity of lean behavior increases suffering among the 25 peaks -30 years, when he reported a gradual deterioration that is noticeable after 50 years of age and that affects the work under anaerobic conditions (31- 34). Since the objective was to establish a distance that allows to analyze and diagnose the state of healthy subjects aged 50-60 and graphically reflecting the influence of the training methods applied, we proceed to discuss the results related to this aspect. By comparing the peak power and average power with the speed achieved on the 15 meter flat, there are no significant values. Moreover, when comparing the half-peak power, manifested in speed over the stretch of 30 to 45 meters, called attention to the relationship between average power and speed achieved for each task, which suggests a low-side characteristics power in the subjects rated (established by the time to reach the peak of power), and the other a high capacity linear subjects and to maintain efforts in time without the presence of fatigue (average power). The proposed analysis allows relating the proportion of fast fibers (fast twitch, FT) versus slow fibers (Slow Twitch, ST) taking into account the time required to reach peak power. The data to reflect on the deterioration of the capacity and power of applied energy systems, which can be explained in part by neural and structural deterioration mentioned by several authors, but which also shows the type of physiological adaptation to stimuli to which the subject is subjected (31-33).
Discussion
Considering the physical concept of power, which determines the value of it by the product of the applied force and distance (25), is a clear and highly significant proportional relationship found between total body weight and peak power this work (r = 0.80, p = 0.001). However, one should consider that the total body weight (lean, fat, bone and re-
We remind to the reader that the sample values are greater than 50 years with high participation in aerobic activities, models of intervention that while collaborating on improving cardiovascular endurance, harm when used in excess and in these specific age, the expression of strength and power, and consequently the manifestation of speed, key elements for maintaining functional independence (34, 10). Already some authors (8, 35, 36) were explained as the tonic motor unit,
iMedPub Journals
doi: 10.3823/052
2010 Vol. 2 No. 1:2
consisting of slow twitch (ST) is characterized by high resilience, while the phasic motor unit, consisting of fast-twitch fibers (FT), require anaerobic metabolism to eventually develop high stresses. The intent of the investigation was focused on to suggest an estimate of field test, to consider the relationship expressed strength, speed metabolism manifested requested and, where data on sections of 30 meters and 45 meters show capacity of over 50 trained with stimuli aerobics, to keep the speed of the task steadily, but not definitive, as it becomes necessary to apply an intervention model aimed at the force, allowing state with clarity and certainty the ideal stretch to use, and the limit of the neural adaptations, structural and metabolic attainable at these ages. We conclude therefore that the capacity and power characteristics are influenced by the weight in kilograms of lean component, fat and thigh circumference corrected in the study group, where you should specifically consider the percentage of participation among slow fibers (ST) and fast twitch fibers (FT). Similarly, the stretch of 15 meters is not related to peak power, average power and the minimum, however, on the stretch of 30 to 45 meters correlations of the average power and speed, suggests that subjects can maintain the intensity of the task consistently. The results suggest inviting new models of intervention, changing the traditional models geared solely to training of aerobic capacity for mixed models (force / resistance) (10, 37, 38). This work will increase the number of diagnostic tests for control of anaerobic capacity and power as well as for the analysis of the sedentary subjects or healthy in training loads operated with aerobic and anaerobic conditions.
Acknowledgments
We want to give recognition to the active collaboration of students and Cindy Castro Diana Lozano who continuously supported the work of the team, just as Dr. Luz Cristina Lopez for his tenure as dean before the respective estates.
iMedPub Journals
doi: 10.3823/052
2010 Vol. 2 No. 1:2
References
1. Weineck, J. Optimal training. Edit. European Hispano, Spain 1994. 2. Grosser, M.: speed training. Ed Martnez Roca, Barcelona, 1992 3. Manso JM. The speed. Edit. Sports. Madrid Spain 1998. 4. Zatsiorski V.M. sports metrology. Edit. C. People and education from Havana. 1989. 5. Cometti G. Modern methods of bodybuilding. Barcelona, edit. Paidotribo 1989 6. Izquierdo, M. Neural activation, cross-sectional area and Production strength of the extensor muscles of the lower limbs. Adaptations neuromuscular during strength training in men aged 40 to 70 years. PhD thesis (1997 i, ii), Spain: Universidad de Len. 7. Cometti G, 2002. The speed training. Barcelona: Nature With Love. 8. Bosco C. Muscle strength: methodological aspects. Inde, barcelona, 1998. 9. J. Lopez Exercise Physiology. Edit. Panamericana, Madrid. 10. Ramirez JF, Da-Silva ME, Lancho JL. Influence of a training Program jumps on explosive strength, speed and movement dynamic balance of older people. Rev Esp Geriatr Gerontol vol. 42 (4): 218-126, 2007. 11. Hakkinen K, Alen M, Kraemer WJ, Gorostiaga E, Izquierdo M, Rusko H, Mikkola J, Hakkinen M, Valkeinen M, Kaarakainen E, Romu S, Erol V, Ahtianinen J Paavolainen L. Neuromuscular adaptations during concurrent strength training. Eur J Appl Physiol 2003; 89: 42-52. 12. Izquierdo M, Aguado X. Neuromuscular adaptations during training strength in men of different ages. Journal of Physical Education and Sports 1998; 55: 20-26. 13. Izquierdo M, Ibaez J, Gorostiaga E, Garrus M, Zuniga A, Anton A, Larrin J.L. maximal strength and power characteristics and dynamic actions of the upper and lower extremities in middle-age and older men. Acta Physiol Scand. 1999; 167 (1): 57-68. 14. Izquierdo M, Aguado X, Gonzalez R, Lopez JL, Hkkinen K. Maximal and Explosive force production capacity and balance performance in men of Different ages. Eur J Appl Physiol Occup Physiol 1999, 79 (3): 260-267. 15. Ramirez JF. The strength training in patients older than 50 years: Considerations and perpesctivas. Arch Med 2007; 3 (6). 16. F. Esparza Manual Kinanthropometry. Monographs FEMEDE. 1st ed pamplona: Spanish group of Kinanthropometry (grec) 1993. 17. Siret J. Morphological age. Anthropometric Assessment of biological age. Cuban journal of sports medicine no.2 c. From Havana 1991. 18. Brozek J. The measurement of body composition. In: m.f.a Montagu (ed) To handbook of anthropometry. Charles C Thomas, Publisher, Springfield iii. 1960. 19. Wrch A. La femme et le sport. Medicine sportive franaise, Paris 1974, 4:1. 20. JVGA Durning, Womersley J. Assesemed Body fat from total body density and its estimation from skinfold thickness: measurements on 481 men and women aged from 16-72 years. Br J Nutr 1974; 32: 7797. 21. Bar-Or O. The winagate anaerobic test: its reliability and validity for Anaerobic capacity. J med sc: 13-126. 22. Conseil De LEurope. Eurofit. Europe Test daptitude physique. Committee pour le dveloppement du sport du conseil de leurope. Tampere: Editions du conseil de lEurope, Rome 1998, coni. 23. Eurofit pour adultes. Evaluation the laptitude physique en relation avec la sant. Conseil de leurope, committee pour le dveloppement du sport et lukk researcch institute for health promotion. Tampere: Editions du Conseil de leurope .1998. 24. Prat J. Eurofit. The battery Eurofit to Catalunya Barcelona: Generalitat de Catalunya, Directorate General of Sport 1993. 25. Ra Serway, Jewett JW. Physics I Third ed. Madrid, International Thomson Editores 2004. 26. Laurent Cm., Meyers MC, Robienson CA, Greeen JF cross-validation on the 20 - versus-30 s Wingate anaerobic test. Eur app physiology
journal, 2007. 27. Baker J, Rambsbottom R Hezeldine R. Maximal shuttle running over 40 m as ameasure of anaerobic performance. Br J Sport Med 1993, 27: 228-232. 28. Baker J, Davies B. Body mass and resitive force selection during high intensity cycle ergometry. Journal of exerc phys 2004, vol 7, No 5. 29. Dr Earles, Judge Jo, Gunnarsson OT. Velocity training induces power-specific adaptations in highly functioning older adults. Arch Phys Med Rehabil 2001; 82: 872-8. 30. Harman E, Lotz I. Strength and power: a definition of terms. N Strength Cond 1993, 15 (6): 18-20. 31. Glardini H. How to Classify different sports. Abcd n4 1 vol. 32. Warburton, Gledhill N, Quinney A. The effects of changes in Musculoskeletal fitness on health. Can J Appl physiol2001; 26:161-216. 33. U.S. Department of Health and Human Services. Healthy people 2000: national health promotion and disease prevention objectives. In. Washington: us Department of Health and Human Services, 1991. 34. D.E.R. Warburton, Nicol C.W., Brendis S.S.D. Health benefits of physical actividity: the evidence. CMAJ 2006; 174 (6): 801-9. 35. Guyton H, Hall J.E. Textbook of Medical Physiology 10 ed. Madrid, edit. Mcgraw Hill Interamericana 2001. 36. Kendel E. Principles of neuroscience. Fourth ed. McGraw Hill, 2001. 37. Izquierdo M, Ibaez J, Hkkinen K, Kraemer W, Larrin J, Gorostiaga E. Eleven weekly combined resistance and cardiovascular training in healthy older men. Med Sci Sport Exer in 2003, p: 435-443. 38. American College of Sports Medicine. Position stand: exercise and physical activity for older adults. Med Sci Sports Exerc (1998), vol 30, no 6: 992-1008.
iMedPub Journals
doi: 10.3823/053
2010 Vol. 2 No. 1:3
Original Article
Improved probes for detection of V617F mutation in chromosome 9-borne JAK 2 gene linked to conditions of Polycythemia Vera and other myeloproliferative disorders.
Arpan Acharyaa, Pratap N Mukhopadhyaya a#, Yashwant Chavana, Anita Shetea, Salil Vaniawalab, Anju Nageec, Prashant D Kunjadiad
aMolecular Genetics Division, geneOmbio Technologies, Krishna Chambers 4th floor, Pashan-Sus Road, Pashan, Pune-411021, Maharashtra, INDIA; bSN Gene Lab, 2nd floor. President Plaza-A, Nanpura, Ring road, Surat 395 001, Gujarat, INDIA; cAshok & Rita Patel Institute of Integrated Study and Research in Biotechnology and Allied Sciences, New Vallabh Vidyanagar, Anand-388021; dMB Patel Science College, Anand-388001, India. # Corresponding author. Correspondence: Dr. Pratap Narayan Mukhopadhyaya, CEO & Head, R&D Operations geneOmbio Technologies, Krishna Chambers, 4th Floor, Pashan-Sus Road, Pashan, Pune-411 021, Maharashtra, INDIA. Electronic mail: pnm6619@gmail.com; Cell phone: +91 9881153425, Fax: +91 20 25871154
Abstract:
Nucleotide positions 5063534 to 5063554 and 5063973 to 5063952 within the Human Janus Kinase 2 (JAK2) gene (Gene bank accession number NT_008413.17) were identified as novel, optimized oligonucleotide primer hybridization sites for thermal amplification of a robust 440 bp PCR amplicon which encompassed the V617F mutation linked to occurrence of Polycythemia vera (PV), a well known myeloproliferative disorder (MPD) in humans. The single strand oligonucleotide primer pair was also found suitable to generate high quality fluorescent nucleotide sequence data from both strands of DNA that was sufficient for detection of all possible genotypes of JAK2 gene with regard to V617F mutation. The accuracy and reproducibility of the method was satisfactory ((r2=0.99, p<0.0001). Experiment using simulated mixture of mutated and normal alleles indicated that 6-11% of mutant allele could be detected at an accuracy of r2= 0.99. In a resource population of 15 patients suffering from PV, 73.3% were found to carry the V617F mutation while one suffering from chronic myeloid leukemia was positive for Philadelphia chromosome and harbored normal JAK2 gene alleles.
Introduction
Polycythemia vera (PV) along with essential thrombocythemia (ET), idiopathic myelofibrosis (IMF), chronic myelocytic leukemia (CML) and essential thrombocythemia (ET) are important myeloproliferative disorders (MPD) that are demonstrated to arise clonally from a pluripotent hematopoietic stem cell (Fialkow et al., 1967; Adamson et al., 1976). It is a well known stem cell anomaly more specifically identified as a panhyperplastic, malignant and neoplastic marrow disorder. The disease causes high level of absolute red blood cell mass as well as increased white blood cell (myeloid) and platelet (megakaryocytic) production. (Berlin, 1975; Landolfi, 1998; Streiff et al., 2002). A constant hallmark of PV as well as other MPD bone marrow cells is their hypersensitivity to several cytokines (Prchal and Axelrad, 1974; Dai et al., 1992; Correa et al., 1994; Dai et al., 1994) and their ability to generate EPO-independent erythroid colonies in vitro (Prchal and Axelrad, 1974), commonly referred to as endogenous erythroid colonies (EECs). The gene JAK2, codes for a tyrosine kinase and is essential for effective signaling in response to several cytokines (Parganas et al., 1998). Within this gene, there exists a hotspot at nucleotide position 1887 where a G is substituted by T. This leads to alteration of amino acid at position 617 of the protein from valine to phenylalanine. The mutation is commonly known as the JAK2 V617F. It has been found in a majority of patients suffering from PV and in some patients with ET and IMF (Baxter et al., 2005; James et al., 2005; Kralovics et al., 2005; Levine et al., 2005; Zhao et al., 2005). The V617F mutation occurs within the negative regulatory domain thereby enhancing the JAK2 kinase activity which in turn causes cy Under License of Creative Commons Attribution 3.0 License
tokine-independent growth of cell lines and cultured bone marrow cells. It has been demonstrated that mutant JAK2 transfected into murine bone marrow cells produces erythrocytosis and subsequent myelofibrosis in recipient animals (Wernig et al., 2006; Lacout et al., 2006) suggesting a causal role for the mutation. Till date, nucleotide sequencing remains one of the most popular and convenient method of detecting JAK2 V617F mutation (Ma et al., 2009; Ohyashiki et al., 2009). The method assists in direct detection of the single nucleotide polymorphism (SNP) apart from providing additional information on neighboring regions also for further detection of other cryptic mutations unlike other methods such as those based on real time PCR (Rapado et al., 2008) that rely on specificity of probe hybridization and has potential for generating false negatives if cryptic mutation occurs close to the target but within the probe hybridization region. In this study we report an improved set of oligonucletoide primers for PCR amplification of the exon 12 region of JAK2 gene harboring the V617F mutation followed by their use in generating high quality nucleotide sequence employing an automated genetic analyzer.
Material and Methods:
Samples Collection and storage: The study group comprised of 15 patients diagnosed for polycythemia vera (PV) and one for chronic myeloid leukemia (CML). Blood sample / bone marrow was collected from all individuals included in this study in K2-EDTA vacutainer (Becton Dickinson, Sun Diego, Calif.) at SN Gene laboratories, Surat, Gujarat (India) and transported to the central proThis article is available from: http://archivesofmedicine.com
iMedPub Journals
doi: 10.3823/053
2010 Vol. 2 No. 1:3
cessing laboratory at geneOmbio Technologies, Pune, Maharashtra, India within 48 hour of collection at ambient temperature.
Bone marrow karyotyping:

GTG banding study of the clinical samples was done as described by Gadhia et al., (2005). Twenty well spread metaphases were studied and documented for each patient prior to recording of the data.
Nucleic Acid Extraction:

Genomic DNA was extracted by phenol/chloroform method after proteinase K digestion following standard techniques (Sambrook and Russels, 2001). The quality of DNA was checked by agarose gel electrophoresis (0.8%) and the quantity was determined using spectrophotometer reading at 260 nm wavelength.
Results and Discussion

The term myeloproliferative disorders (MPDs) was coined by Dr. William Damashek in the year 1951 to address overlapping features of polycythemia vera, essential thrombocythemia (ET), myelofibrosis and myeloid metaplasia (MMM) (Damashek, 1951). One of the recent findings is the association of a gene coding for tyrosine kinase and belonging to the Janus kinase (JAK) family. Four different JAKs are reported in mammals. These are JAK1, JAK2, JAK3 and TYK2 (Valentino and Pierre, 2006). The JAK and STAT (another set of signal transduction proteins) signaling pathways play a pivotal role in establishing MPD by transmitting signals through the cytokine receptors to activate intracellular signaling pathway (Kwaja, 2006). Due to the V617F mutation in JAK2 gene, valine at codon position 617 is substituted by phenylalanine. This results in loss of auto-inhibition property of the encoded protein thus leading to constitutive transmission of signals from the erythropoietin (EPO) receptor, the thrombopoietin (TPO) receptor and the granulocyte colony stimulating factor (G-CSF) receptor in haemapoietic cells with high efficiency (Kwaja, 2006). This phenomenon is the primary cause of myelo-proliferation associated with polycythemia vera. The discovery of this well known V617F mutation within JAK2 gene and its relation to MPD in the year 2005 can be compared to that of bcr-abl fusion gene responsible for chronic myeloid leukemia (CML) in the year 1983 (Bartram et al., 1983). The primary aim of our study was to design, optimize and validate an improved and robust set of oligonucleotide primers that are well suited for identifying the V617F mutation within human JAK2 gene using PCR and automated DNA sequencing technology using Sangers chain termination method (Sanger and Coulson, 1975). The primer pair was designed with an aim to generate specific PCR amplicon of size >250 bp and <500 bp in size for efficient thermal amplification. Thermal amplification of a region within the JAK2 gene covering the mutation hotspot at nucleotide position 1849 generated a PCR amplicon of 480 bp size (Figure 1). No non-specific amplification was detected across all samples and further the primer concentration was found to be optimized such that no significant primer-dimer formation could be seen on an agarose gel. JAK2 1849G>T mutation was identified by two different sequencing reactions, each targeting one of the two strands of DNA from all the 105 patients analyzed. Example of the electropherograms generated is shown in Figure 2. Perfect correlation was found from the data generated from both the strands. Analysis revealed that the accuracy and reproducibility of the method was satisfactory (r2=0.99, p<0.0001). In order to obtain the linearity of the test developed, we undertook titration experiments where in DNA from a normal individual and that from a mutated one bearing 50% or 80% of the mutated JAK2 allele respectively were used. Mixture of DNA samples of varying ratio were amplified by conventional PCR and sequenced using the primers reported
Designing of oligonucleotide primers:

The nucleotide sequence of Homo sapiens chromosome 9 genomic contig reference assemblies were accessed from the public domain (http:// www.ncbi.nlm.nih.gov; Gene bank accession number NT_008413.17). The hotspot for mutation at amino acid position 617 in the JAK2 gene was subsequently identified and oligonucleotide primers designed using the Primer 3 software (Rozen and Skaletsky, 1999). In silico analysis was performed to confirm the specificity of the probes. Electronic PCR result indicated that the primer pair would generate a PCR amplicon of size 440 bp flanking the mutational hotspot.
PCR Amplification and automated capillary electrophoresis:

PCR amplification was performed using an automated thermal cycler (GeneAmp PCR System 9700; Applied Biosystems, Foster City, Calif ) using a genAmp Total PCR kit (geneOmbio Technologies, Pune, India). The reaction comprised of 250 nanograms of genomic DNA, 10x PCR buffer, 1.5 millimolar MgCl2, 200 micromolar (each) deoxynucleotide triphosphates, 20 picomoles of each primer, JAK2F (5- GGCAGTTGCAGGTCCATATAA3) and JAK2R (5- TTCATTGCTTTCCTTTTTCACA 3) (Sigma Aldrich, India) and 1 unit of Taq DNA polymerase. The thermal cycling condition was as follows: 5 min for 95C (initial denaturation) followed by 35 cycles of 95C for 30 seconds, 56C for 30 seconds, and 72C for 1 min followed by a final extension for 7 min at 72C. The PCR amplicon was analyzed by electrophoresis on a 2% agarose gel spiked with Ethidium bromide (0.5 micrograms/ml) in 0.5X TBE buffer) and visualized under UV transilluminator (260 nm). The PCR products were purified by using Genpure PCR product purification kit (geneOmbio Technologies, Pune, India) and sequenced with JAK2F and JAK2R primers respectively using the BigDye Terminator v3.1 Cycle Sequencing Kit and analyzed with an automated genetic analyzer (Model 3130, Applied Biosystems, USA).
Data Analysis:
A consensus sequence was generated from the double strand nucleotide sequence data for each sample and then multiple sequence alignment were performed using clustal W software (Thompson et al., 1994) with reference sequence (Gene bank accession number NT_008413.17).
iMedPub Journals
doi: 10.3823/053
2010 Vol. 2 No. 1:3
in this study. Liner relationship was observed between the content of patient DNA and amount of mutated allele that was detected by our method (r2=0.99). If was observed that the lower limit of detection was between 6-11% mutant allele. Detailed information of the oligonucleotide primers used for PCR and nucleotide sequencing in this study appear in Table 1. Out of 16 patients, one was found to be positive for Philadelphia chromosome and subsequently diagnosed with chronic myeloid leukemia (Figure 3). Remaining 15 patients were found to be suffering from Polycythemia vera. Out of them, 20% (3/15) were genotyped as homozygous mutant and 53.3% (8/15) as heterozygous mutant while 26.6% (4/15) were found to be of wild type with regard to V617F mutation within the JAK 2 gene (Figure 4). Almost 73.3% of the PV patients were found to carry the V617F mutation. This finding is in line with the report published by Jelinek et al., (2005) that also reported high proportion (86%) of PV patients to be positive for V617F mutation within the JAK2 gene. Table 2 summarizes the diagnosis report of all the 16 samples included in this study. The discovery of the drug named imatinib mesylate (IM) for the treatment of CML had its basis in the identification of bcr-abl fusion tyrosine kinase that had occurred almost two decades earlier (Agarwal, 2007). Therefore significant enthusiasm exist in the medical fraternity that following the discovery of JAK2 mutation there will be development of similar specific pharmacologic inhibitors of JAK2 with the potential to transform the treatment of PV, ET and MMM.
Superior molecular biology methods for error-free scanning of the mutational hotspot spanning nucleotide position 1849 within the JAK2 gene will have greater impact on the screening efficacy of patients. This study brings together a highly improved thermal amplification protocol for amplification of a region of the JAK2 gene coupled with an indigenously manufactured, low cost PCR product purification kit that in combination generated a pure and specific amplicon which formed the basis of generating good electropherograms. The oligonucleotide primers designed for this assay functioned with equal efficiency both as PCR as well as nucleotide sequencing primers and were capable of consistently generating high quality read of bases that is vital to accurate identification of heterozygotes. Methods of identification of single nucleotide polymorphisms using nucleotide sequencing methods has the lone advantage of being capable of detecting the altering base directly rather than by indirect methods such as altering restricted PCR amplicon profile (RFLP) (Mukhopadhyaya et al., 2000) or using allele specific probes (Taqman chemistry based allelic discrimination or ARMS protocol) (Salvi et al., 2004; McWeeneya et al., 2000).
Acknowledgement:
Encouragements and support from Sachin Purohit and Bikash Aich during the course of the study is gratefully acknowledged.
Name of the primer & orientation JAK2F(+/+)
Reference gene bank accession no. Homo sapiens chromosome 9 genomic contig (Gene bank accession number NT_008413.17)
Primer hybridization position (nucleotide) 5063534 to 5063554
Tm
% GC
Length Hairpin
Cross dimer
59.97
48
21
Not found
Not found
JAK2R(+/-)
Homo sapiens chromosome 9 genomic contig (Gene bank accession number NT_008413.17)
5063973 to 5063952
59.74
32
22
Not found
Not found
Table 1: Characteristics of the novel oligonucleotide primers designed for PCR amplification and nucleotide sequence-based detection of V617F mutation (nucleotide position 1849) of JAK2 gene (Reference sequence: Gene bank accession number NT_008413.17).
iMedPub Journals
doi: 10.3823/053
2010 Vol. 2 No. 1:3
Serial number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Sample code JAK2-1 JAK2-2 JAK2-3 JAK2-4 JAK2-5 JAK2-6 JAK2-7 JAK2-8 JAK2-9 JAK2-10 JAK2-11 JAK2-12 JAK2-13 JAK2-14 JAK2-15 JAK2-16
JAK2 genotype status Homozygous mutant Homozygous mutant Homozygous mutant Homozygous normal Heterozygous mutant Homozygous normal Heterozygous mutant Heterozygous mutant Heterozygous mutant Heterozygous mutant Heterozygous mutant Homozygous normal Heterozygous mutant Homozygous normal Heterozygous mutant Homozygous normal
Cytogenetic report normal normal normal normal normal normal normal normal normal normal normal normal normal Ph positive normal normal
Diagnosis PV PV PV PV PV PV PV PV PV PV PV PV PV CML PV PV
Table 2: Diagnostic report of the resource population in this study. Abbreviations used: PV, Polycythemia vera; Ph, Philadelphia chromosome; CML, Chronic myeloid leukemia
Figure 1: A representative 440 bp PCR amplicon generated using primers JAK2F and JAK2R (this study) and template DNA from sample JAK2-10. Lane M: 100 bp DNA size standard; 2: 440 bp PCR amplicon.
iMedPub Journals
doi: 10.3823/053
2010 Vol. 2 No. 1:3
Figure 2: Electropherograms generated from normal homozygous, mutant heterozygous and mutant homozygous samples (V617F mutation; JAK2 gene). The amino acid stretch flanking position 617 and corresponding nucleotide stretch flanking position 1849 are shown along with electropherogram profile of all three categories of genotype encountered (three black boxes). The hotspot triplet codon and corresponding amino acid for each genotype is also indicated below each electropherogram boxes.
Figure 3: Karyotype showing presence of Philadelphia chromosome in sample number JAK2-14 where the patient was diagnosed with chronic myeloid leukemia (CML). The points of 9:22 translocation are shown in red boxes. This sample harbored wild genotype for V617F (JAK2).
iMedPub Journals
doi: 10.3823/053
2010 Vol. 2 No. 1:3
References Figure 4: Distribution of the JAK 2 genotype (V617F) in the resource population of 16 patients. III. Burst-forming units-erythroid (BFU-E) response to stem cell factor
Abbreviation used: PV, Polycythemia vera.
and c-kit receptor expression. Br J Haematol 86:12-21.
Adamson JW, Fialkow PJ, Murphy S, Prchal JF and Steinmann L (1976). Polycythemia vera: Stem-cell and probable clonal origin of the disease. N Engl J Med 295:913-916. Agarwal MB (2007). Clinical Applications of Molecular Haematology: JAK2 in Myeloproliferative Disorders. JAPI 55: 507-510. Bartram C, de Klein A, Hagemeijer A. Translocation of c-abl oncogene correlates with the presence of the Philadelphia chromosome in chronic myelocytic leukaemia (1983). Nature 306:277-280. Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Scott MA, Erber WN and Green AR (2005). Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet 365:1054-1061. Berlin NI (1975). Diagnosis and classification of the polycythemias. Semin Hematol. 12:339-351. Correa PN, Eskinazi D and Axelrad AA (1994). Circulating erythroid progenitors in polycythemia vera are hypersensitive to insulin-like growth factor-1 in vitro: Studies in an improved serum-free medium. Blood 83:99-112. Dai CH, Krantz SB, Dessypris EN, Means Jr. RT, Horn ST and Gilbert HS (1992). Polycythemia vera. II. Hypersensitivity of bone marrow erythroid, granulocyte-macrophage, and megakaryocyte progenitor cells to interleukin-3 and granulocyte- macrophage colony-stimulating factor. Blood 80:891-899. Dai CH, Krantz SB, Green WF and Gilbert HS (1994). Polycythaemia vera.
Damashek W (1951). Some speculations on the myeloproliferative syndromes. Blood 6:372-375. Fialkow PJ, Gartler SM and Yoshida A (1967). Clonal origin of chronic myelocytic leukemia in man. Proc Natl Acad Sci USA 58:1468-1471. Gadhia, PK, Vaniawala, S and Pithawala, M (2005). Some Observations on Spontaneous Sister Chromatid Exchange Frequencies and Cell Cycle Progression in Stimulated Lymphocytes of Patients With Different Malignancies. Int J Hum Genet, 5: 187-191. James C, Ugo V, Le Couedic JP, Staerk J, Delhommeau F, Lacout C, Garcon L, Raslova H, Berger R, Bennaceur-Griscelli A, Villeval JL, Constantinescu SN, Casadevall N and Vainchenker W (2005). A unique clonal JAK2 mutation leading to constitutive signaling causes polycythaemia vera. Nature 434:1144-1148. Jelinek J, Oki Y, Gharibyan V, Bueso-Ramos C, Prchal JT, Verstovsek C, Beran M, Estey E, Kantarjian HM, and Issa JPJ (2005). JAK2 mutation 1849G>T is rare in acute leukemias but can be found in CMML, Philadelphia chromosome negative CML and megakaryocytic leukemia. Blood 05: 1800-1809. Khwaja A (2006). The role of Janus kinases in haemopoiesis and haematological malignancy. Br J Haematol. 134:366-384. Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, Passweg JR, Tichelli A, Cazzola M and Skoda RC (2005) A gain-of function mutation of JAK2 in myeloproliferative disorders. N Engl J Med 352:1779-1790.
iMedPub Journals
doi: 10.3823/053
2010 Vol. 2 No. 1:3
Lacout C, Pisani DF, Tulliez M, Moreau Gachelin F, Vainchenker W, Villeval JL. JAK2V617F expression in murine hematopoietic cells leads to MPD mimicking human PV with secondary myelofibrosis. Blood 108:16521660. Landolfi R (1998). Bleeding and thrombosis in myeloproliferative disorders. Curr Opin Hematol. 5:327-331. . Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G, Huntly BJ, Boggon TJ, Wlodarska I, Clark JJ, Moore S, Adelsperger J, Koo S, Lee JC, Gabriel S, Mercher T, DAndrea A, Frohling S, Dohner K, Marynen P, Vandenberghe P, Mesa RA, Tefferi A, Griffin JD, Eck MJ, Sellers WR, Meyerson M, Golub TR, Lee SJ and Gilliland DG (2005). Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 7:387-397. Ma W, Kantarjian H, Zhang X, Yeh CH, Zhang ZJ, Verstovsek S, Albitar M (2009). Mutation profile of JAK2 transcripts in patients with chronic myeloproliferative neoplasias. J Mol Diagn. 11:49-53 McWeeneya DO, Galluzzi JR and Ordovas JM (2000). Allelic Discrimination for Single Nucleotide Polymorphisms in the Human Scavenger Receptor Class B Type 1 Gene Locus Using Fluorescent Probes Clinical Chemistry 46: 118-119. Mukhopadhyaya PN, Mehta HH and Rathod RN (2000). A method for the simulation of normal, carrier and affected controls for PCR-RFLP screening of genetic disease in dairy cattle. Molecular and Cellular Probes 14:381-384. Ohyashiki JH, Hisatomi H, Shimizu S, Sugaya M, Ohyashiki K (2009). Detection of Low Allele Burden of JAK2 Exon 12 Mutations Using TAcloning in Patients with Erythrocytosis. Jpn J Clin Oncol. [Epub ahead of print] Parganas E, Wang D, Stravopodis D, Topham DJ, Marine JC, Teglund S, Vanin EF, Bodner S, Colamonici OR, van Deursen JM, Grosveld G and Ihle JN (1998). Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93:385-395. Prchal JF and Axelrad AA (1974). Letter: Bone-marrow responses in polycythemia vera. N Engl J Med 290:1382-1389. Rapado I, Albizua E, Ayala R, Hernndez JA, Garcia-Alonso L, Grande S, Gallardo M, Gilsanz F, Martinez-Lopez J (2008). Validity test study of JAK2 V617F and allele burden quantification in the diagnosis of myeloproliferative diseases. Ann Hematol. 87:741-749. Rozen S and Skaletsky H (1999). Primer3 on the WWW for General Users and for Biologist Programmers. Methods in Molecular Biology 132:365386.
iMedPub Journals
doi: 10.3823/054
2010 Vol. 2 No. 1:4
Original Article
Low back pain in residents of Comalcalco, Tabasco, Mexico: Prevalence and associated factors.
Marco Antonio Zavala-Gonzlez *, Rosario Correa-De la Cruz **, Alberto Popoca-Flores ***, Sergio Eduardo Posada-Arvalo**
*Mexican Society of Public Health, A.C.; **Academic Division of Health Sciences, Jurez Autnoma University of Tabasco; ***General Hospital of Zona No. 2, Mexican Institute of Social Security, Tabasco Delegation. Correspondence: Marco Antonio Zavala Gonzlez. Address: Calle principal de la alberca # 24, Col. Ingenio Santa Rosala, H. Crdenas, Tabasco, Mxico, C.P. 86500. Tel.: +52(937)-1264197. e-mail: zgma_51083@yahoo.com.mx
Objective:
Cross-sectional analytical study, to determine the prevalence of low back pain and its association with known risk factors, in users of the Mexican Institute of Social Security, in Comalcalco, Tabasco, Mexico. Material and methods: A multistage sample was taken, randomly selecting a medical center of six, and 100 of 420 selected medical center users. Respondents were chosen by convenience, gathering different variables: sociodemographic, anthropometric, lifestyle, chronic degenerative diseases, and low back pain, by personal interviews and review of medical records. Descriptive statistics and odds ratio (p0.05) were estimated. Results: Prevalence of low back pain was observed in 63% beneficiaries. A significant association with occupation, age, sex, obesity, unhealthy habits and chronic degenerative diseases was found, concluding that the prevalence is high, and that risk factors identified in other areas are not applicable to this population.
Introduction
Low back pain has clinical, social and economical importance since it is a public health problem that affects the population indiscriminately. The available literature is heterogeneous and contradictory. It is unknown exactly what the proportion of affected people around the world is. Globally, it is estimated that 4-33% of the population exhibits it [1]. While in the United States (USA), Spain and Africa this ranges from 8% to 56% [2-4]. Recent data indicate that its incidence and prevalence have remained stable over the last 15 years [5]. However, the prevalence in the general population is rarely under study, compared with the prevalence in specific groups, like schoolchildren, adolescents, medical students, construction workers, nurses, farmers and indigenous people, to mention a few [6-14]. Most of the research has been developed in the field of occupational medicine, even over orthopedics, since industrialized societies are presenting an disability epidemic due to low back pain, with a tremendous socioeconomic and labor impact, that tend to increase [15]. In Mexico, Noriega-Eli et al. [16] stated that 10-15% of the disability reports in the Mexican Institute of Social Security (IMSS), are issued for low back pain. Given the frequency of low back pain, attempts have been made to identify its etiology, and so far, approximately 57 causes have been pointed out [17]. However, there is no linear correlation between clinical and anatomic alterations, so an etiological diagnosis is only possible in 10-20% of the cases, i.e., 80-90% of low back pains were non-specific [18,19]. Therefore, approximately 90% are cared for and controlled by primary care [3]. Risk factors are numerous, varied and heterogeneous, amongst them are: prolonged static posture, heredity, old age, heavy labor, smoking, obesity, stress, low psychological well being, female gender, operating
heavy machinery, exposure to intense vibrations, emotional and behavioral problems, abdominal pain, tiredness, odynophagia, rapid growth rate, tendon and quadriceps stiffness, study and work, previous episode of low back pain 12 months before current, age >25 years old, Tall stature (1.80 m), overweight, construction work, nursing and office work, repetitive and monotonous, frequent twisted postures, driving vehicles daily, lifting and carrying heavy loads, work dissatisfaction, unemployment, and work in the field [2-32]. On the other hand, it has not always been able to corroborate the significant association of these factors with low back pain, so it is recommended to check in different populations. In the IMSS in Tabasco, low back pain is one of the main reasons to request medical attention. In the Family Medicine Unit (UMF) No. 11 of the IMSS, Comalcalco, Tabasco, its one of the top 20 reasons for consultation in adults over 20 years old, and one of the 20 most common reasons for temporal disability [33-35]. Therefore, an investigation was conducted aimed at determining the prevalence of low back pain and its association with some known risk factors, in beneficiaries in the UMF No. 11 of the IMSS, Comalcalco,Tabasco, Mexico.
Materials and methods

An analytic cross-sectional investigation was conducted, in which the universe of the study were beneficiaries of the UMF 11 of the IMSS, in Comalcalco, Tabasco, Mxico, a finite and undetermined number, from which a multistage sample was taken: 1) Sub-universe of medical centers (6 units), random sample with maximum error acceptable 5%, estimated percentage of sample 10%, and p=0.05 obtaining 1 medical center, randomly selected by raffle method, Medical Center No. 6. 2) Sub-universe of 420 beneficiaries appointed to the selected medical center, probability sampling with maximum error acceptable 5%, estimated percentage
iMedPub Journals
doi: 10.3823/054
2010 Vol. 2 No. 1:4
of the sample 25%,and p=0.05, obtaining 100 beneficiaries, selected by nonprobability sampling by convenience. Selecting people >15 years old, of either sex, who went to receive medical and/or preventive attention in the selected location during September-December 2007; excluding: pregnant women, carriers of cognitive diseases, locomotive disabilities and/or musculoskeletal malformations, users of wheelchairs or crutches, and people with a history of spinal surgery.
Table I. Sociodemographic, lifestyle and health conditions of the population
Accepted after external review

Given the frequency of low back pain, attempts have been made to identify its etiology, and so far, approximately 57 causes have been pointed out [17]. However, there is no linear correlation between clinical and anatomic alterations, so an etiological diagnosis is only possible in 10-20% of the cases, i.e., 80-90% of low back pains were non-specific [18,19]. Therefore, approximately 90% are cared for and controlled by primary care [3]. Risk factors are numerous, varied and heterogeneous, amongst them are: prolonged static posture, heredity, old age, heavy labor, smoking, obesity, stress, low psychological well being, female gender, operating heavy machinery, exposure to intense vibrations, emotional and behavioral problems, abdominal pain, tiredness, odynophagia, rapid growth rate, tendon and quadriceps stiffness, study and work, previous episode of low back pain 12 months before current, age >25 years old, Sociodemographic and anthropometric variables on lifestyles and unhealthy habits, chronic degenerative diseases and low back pain were studied. The information was gathered in an interpretive survey, filled in by direct examination (subject to signature of informed consent [of the parents / guardians in the case of minors under 18 years old]) and clinical record review. The data were analyzed using the software Epi Info v3.3.2 (freeware distributed by the USA Center of Disease Control and Prevention) in two phases: 1) Descriptive statistics to identify characteristics of the sample, and 2) Odds ratio (OR) with 95% confidence (p0.05) to identify factors associated with Low Back Pain. The research was conducted with prior approval of the Local Committee of Inquiry 2701 of the IMSS.
Table II. Anthropometric characteristics of the population
Results
Description of the population: 100 beneficiaries, 57% male and 43% female were studied. The mean age was 32.512.49 years, mode 28, minimum 17, and maximum 76 years. The sociodemographic, lifestyle and health conditions of the population are shown in Table I, while the anthropometric characteristics are shown in Table II.
Factors associated with Low Back Pain

When looking for factors associated with Low Back Pain, it was found an association statistically significant with: student occupation, age >25 years, male gender, wage earning worker, obesity, sedentarism, smoking, alcoholism, chronic degenerative disease, Diabetes Mellitus, Systemic Arterial Hypertension, and Metabolic Syndrome (Table III). Table III. Odds Ratio: Independent Variables / Low back pain
Prevalence of Low Back Pain

The prevalence of Low Back Pain was 63% of beneficiaries.
iMedPub Journals
doi: 10.3823/054
2010 Vol. 2 No. 1:4
Table III. Odds Ratio: Independent Variables / Low
Conclusions
The prevalence of low back pain in beneficiaries of the IMSS, in Comalcalco, Tabasco, Mexico, is greater than that reported in the international literature. The significant association of low back pain with some risk factors identified in developed countries was not corroborated in the Comalcaco inhabitants, therefore the epidemiological findings reported in several areas should not be adopted by the health care providers without having ratified or rejected such association within its user population. This conclusion and recommendation is applicable to other Latin American populations. To provide better conclusions, larger studies with larger samples, a narrower selection criteria and the inclusion of other variables are required.
Discussion
The prevalence of low back pain in this series (63%) was higher than that reported worldwide (4-33%) [1], in USA (8-56%) [2], and Africa (1014%) [4]. This high prevalence may be related to the high BMI of the people (which denotes a population with overweight and obesity), and the large proportion of sedentary people. Given these findings, it is necessary to investigate on this matter in order to identify causes and associated factors. Regarding associated factors, the data was able to corroborate the association of some risk factors described in the literature. Smoking is consistent with what Manchikanti [2], Feldman et al. [7], Deyo [30], Croft [31], and Brage [32] reported. The significant risk with obesity agrees with that informed by Manchikanti [1], Latza et al. [9], Deyo [30], Croft [31], and Brage [32]. Likewise, it also coincided with the risk of sedentarism, noted by Juul-Kristensen et al. [22] and by Ozgu-ler and his group [23]. It also agreed with the results published by Latza et al. [9] which pointed out that the group people >25 years old, were at risk. In addition, the data was able to corroborate that the workers represent a risk group, which agrees with that reported by several authors [2,10,12,22,23,28,29]. On the other hand, there were no references that mention as risk factors: male gender, alcoholism and chronic degenerative diseases; and protective association with the student occupation so it is believed that they are factors associated particularly with the research population. Finally, there was no significant association with female gender, students workers, tall stature and overweight, contrary to the findings reported by Manchikanti [2], Feldman et al.[7], Latza et al. [9], Ozguler et al. [23], and Acouffe et al. [27].
Acknowledgments
We thank the authorities of the UMF 11 of the IMSS, Tabasco Delegation, for the facilities granted to carry out this study.
iMedPub Journals
doi: 10.3823/054
2010 Vol. 2 No. 1:4
References
1. Woolf AD, Pfleger B. Burden of major musculoskeletal conditions. Bull World Health Organ. 2003;81(9):215-22. 2. Manchikanti L. Epidemiology of Low Back Pain. Pain Physician. 2000;3(2);167-92. 3. Pea-Sagredo Jl, Brieva-Beltrn P, Pea-Martn C, Humbra-Mendiola A. Unidades de espalda: un modelo multidisciplinario. Rev Esp Reumatol. 2002;29:499-502. 4. Low Q, Morris L, Grimmer-Somers K. The prevalence of low back pain in Africa: a systematic review. BMC Musculoeskeletal Disorders. 2007;8:105-19. 5. Barbadillo-Mateos C, Rodrguez-Cardoso A, Herrero-Pardo-de-Donlebn M. Lumbalgias. Jano. 2001;61:101-5. 6. Watson KD, Papageorgiou AC, Jones GT, Taylor S, Symmons DPM, Silman AJ, Macfarlane GJ. Low back pain in schoolchildren: the role of mechanical and psychosocial factors. Archs Dis Child. 2003;88:12-7. 7. Feldman DE, Shrier I, Rossingnol M, Abenhaim L. Risk factors for development of low back pain in adolescence. Am J Epidemiol. 2001;154(1):30-6. 8. Smith DR, Wei N, Ishitake T, Wang RS. Musculoeskeletal disorders among chinesse medical students. Kurume Medical Journal. 2005;52:139-46. 9. Latza U, Karmaus W, Strmer T, Steiner M, Neth A, Rehder U. Cohort study of occupational risk factors of low back pain in construction workers. Occup Environ Med. 2000;57:28-34. 10. Kaneda K, Shirai Y, Miyamoto M. An epidemiological study on occupational low back pain among people who work in construction. J Nipn Med Sch. 2001;68(4):310-7. 11. Smedley J, Egger P, Cooper C, Coggon D. Prospective cohort study of predictors of incident low back pain in nurses. BMJ. 1997;314:1225-33. 12. Ando S, Ono Y, Shimaoka M, Hiruta S, Hattori Y, Hori F, Takeuchi Y. Associations of self estimated workloads with musculoeskeletal symptoms among hospital nurses. Occup Environ Med. 2000;57:211-6. 13. Holmberg S, Thelin A, Stiernstrm EL, Svrdsudd K. Low back pain comorbidity among male farmers and rural referents: a population-based study. Ann Agric Environ Med. 2005;12:261-8. 14. Vindigni D, Walter BF, Jamison JR, Da-Costa C, Parkinson L, Blunden S. Low back pain risk factors in a large rural Australian Aboriginal community. An opportunity for massaging co-morbitities? Chiropractic & Osteopathy. 2005;13:2133. 15. Saun-Castillo M, Arias-Anglada R, Lleget-Maymo I, Ruiz-Bassols A, Escriba Under License of Creative Commons Attribution 3.0 License
Jordana JM, Gil M. Estudio epidemiolgico de la lumbalgia. Anlisis de factores predictivos de incapacidad. Rehabilitacin. 2003;37:3-10. 16. Noriega-Eli M, Barrn-Soto A, Sierra-Martnez O, Mndez-Ramrez I, PulidoNavarro M, Cruz-Flores C. La polmica sobre las lumbalgias y su relacin con el trabajo: estudio retrospectivo en trabajadores con invalidez. Cad Sade Pblica. 2005;21(3):150-66. 17. Champn-Michelena D. Lumbalgia. Rev Soc Per Med Inter. 2004;17(2):50-6. 18. Moy-Ferrer F. Lumbalgia. En: Andreu JL, Barcel P, Figueroa M, Herrero-Beaumont G, Martn-Mola E, Oliv A, et. al., editores. Manual de enfermedades reumticas de la Sociedad Espaola de Reumatologa. Mosby/Doyma; Madrid. 1996. 19. Manek NJ, McGregor AJ. Epidemiology of back disorders: prevalence, risk factors and prognosis. Curr Opin Rheumatol. 2005;17:134-40. 20. Pea-Sagredo JL, Pea C, Brieva P, Prez-Nez M, Humbra-Mendiola A. Fisiopatologa de la lumbalgia. Rev Esp Reumatol. 2002;29:483-8. 21. Feyer AM, Herbison P, Williamson AM, De-Silva I, Mandryk J, Hendir L, Hely MCG. The role of pysical and psychosocial factors in occupational low back pain: a prospective cohort study. Occup Environ Med. 2005;57:116-20. 22. Juul-Kristensen B, Jensen C. Self-reported workplace related ergonomic conditions as prognostic factor for musculoeskeletal symptons: the BIT follow up study on office workers. Occup Environ Med. 2005;62:188-94. 23. Ozguler A, Leclerc A, Landre MF, Pietri-Taleb F, Niedhammer I. Individual and occupational determinants of low back pain according to various definitions of low back pain. J Epidemiol Community Health. 2000;54:215-20. 24. Papageorgiou AC, Croft PR, Thomas E, Silman AJ, Macfarlane GJ. Psychosocial risk for low back pain: are these related work? Ann Rheum Dis. 1998;57:500-2. 25. Harkness EF, Macfarlane GJ, Nahit ES, Silman AJ, McBeth J. Risk factors for new-onset low back pain amongst cohorts of newly employed workers. Rheumatology. 2003;42:959-68. 26. Jones GT, Watson KD, Silman AJ, Symmons DPM, Macfarlane GJ. Predictors of low back pain in british schoolchildren: a poppulation-based prospective cohort study. Pediatrics. 2003;111(4):822-8. 27. Acouffe J, Manillier P, Brehier M, Fabin C, Faupin F. Analysis by sex of low back pain among workers from small companies in the Paris area: severity and occupational consequences. Occup Environ Med. 1999;56:696-701. 28. Walter-Bone K, Palmer KT. Musculoeskeletal disorders in farmers
iMedPub Journals
doi: 10.3823/054
2010 Vol. 2 No. 1:4
and farm workers. Occup Med. 2002;52(8):441-50. 29. Palmer KT, Griffin MJ, Syddall HE, Pannett B, Cooper C, Coggon D. The relative importance of whole body vibration and occupational lifting as risk factor for low back pain. Occup Environ Med. 2003;60:715-21. 30. Deyo RA, Bass JE. Lifestyle and low back pain: the influence of smoking and obesity. Spine. 1989;14:5016. 31. Croft PR, Rigby AS. Socioeconomic influences on back problems in the community in Britain. J Epidemiol Community Health. 1994;48:16670. 32. Brage S, Bjerkedal T. Musculoskeletal pain and smoking in Norway. J Epidemiol Community Health. 1996;50:1669. 33. Instituto Mexicano del Seguro Social. Primer reporte semestral 2007 del Sistema de Informacin Mdica Ordinaria. Diagnsticos ms frecuentes en la consulta externa. IMSS; Villahermosa, Mxico. 2007:95-105. 34. Instituto Mexicano del Seguro Social. Reporte anual 2006 del Sistema de Informacin Mdica Ordinaria. Diagnsticos ms frecuentes en la consulta externa. Unidad de Medicina Familiar No. 11, Tabasco. IMSS; Villahermosa, Mxico. 2007:95-105. 35. Instituto Mexicano del Seguro Social. Reporte anual 2006 del Sistema de Informacin Mdica Ordinaria. Incapacidades temporales y permanentes. Unidad de Medicina Familiar No. 11, Tabasco. IMSS; Villahermosa, Mxico. 2007:125-35. Under license of Creative Commons Attribution 3.0 License Article available at: http://www.archivosdemedicina.com
iMedPub Journals
doi: 10.3823/055
2010 Vol. 2 No. 1:5
Original Article
The stream of life

Len Garzn1, ngeles Cavero2
Group of development biological process. Universidad de Oviedo. C/ Independencia 13-33004 Oviedo. E-mail: (1) garzonio7@yahoo.es, (2) E-mail: radonwww@yahoo.es
In this work the processes of development appear in general and those of the embryo in particular with a new methodology. In the absence of even a theory based on the operating forces between the cells of the alive matter, to be described, quantified and even to predict the characteristics of the new alive being, an attempt is made to approach the resolution of this issue and clarified the meaning of the erroneous law of Haeckel. The underlying philosophy can be summed up as meaning that the systems are more favourable to sustaining and maintaining life are those whose motives they repeat themselves: fractal coherent systems with Darwinism; concluding that although the alive beings constitute the most complex structures of the universe, turns out to be surprising that many of their characteristics likely to be measured could express oneself through simple allometryc equations. Introduction
The human being has been come considering and it is still considered as the historical animal par excellence. For us, this concept must be extended to all the objects of the universe. In this sense, the closest to us, and, in particular, those who constitute our habitat, called inert and alive, they possess a common history and share common characteristics, and others that are very different. The unit of the life is the cell, an open system for his support and maintenance (reproduction) exchanges with the environment across his limiting surface area and/or energy. His association originates multi-cellular beings. Convenience of supporting in a suitable value in the exchanges surfaces, determines many of its characteristics, in particular the form of the individual [1,2,3,4]. The evolution of living beings, Darwinism [5], contemplates so much the history of the species, from the primitive cells, in the phylogeny, as the history of the individuals, in the ontogeny-embryogenesis. In spite of being very interesting phenomena they have not raised, however, the attention that, we believe, deserve; even the basic underlying concepts are known only by the naturalists. These phenomena consist of a series of transformations that begin with the appearance of the zygote, resulting from the fertilization of an egg by sperm [6]. The cell division of this zygote, in which cell population increases descendants, passes through a series of stages (morula, gastrula, blastula...) until populations reach with a number of descendants of about 1013, correspondents rough way to the formed individual. The study of this process belongs to the embryology, being the human which one, for diverse reasons, has attracted the biggest attention from doctors and/or naturalists. As it is usually known [7,8,9,10], it consists of a detailed description of certain characteristics associated with the first embryo and with the foetus later along its development, description associated to first embryo and foetus after a long development, description provides information but not explanation and/or interpretation, within a consistent conceptual framework. In essence, this phenomenology could be likened with the used one in the pre-scientific era.
Results and discussion

First of all, it is admitted that the material objects, which set constitutes the Universe have formed thanks to the action of certain forces that have acted along the different entities that were appearing up to coming to the current moment. Initially, the Universe consisted of a set of particles and radiation (Figure 1), being accepted that the forces owe to the exchange of particles, since it happens for example in the game of the ping-pong, in which the ball that it goes and comes from one player to another, is what really keeps them together, the same in the case of tennis.
Figure 1 History of the Universe. It is the same as the history of the subject. Life is its most important product. This article is available from: http://archivesofmedicine.com
iMedPub Journals
doi: 10.3823/055
2010 Vol. 2 No. 1:5
The forces are the following ones (Figure 2) [11,12,13,14,15,16]: Nuclear fortress that keeps close the quarks (mainly u and d) in the nucleons, of which, the most important for us are the proton and the neutron. The electroweak, who includes the Coulomb, called electromagnetic. This is the most important force in the context of this work and with her we will deal with it in detail later.
poles Coulombs law, there is obtained a different outcome of the case in which the charges were punctual. A big variety of phenomena are related to the presence of dipoles in the molecules, like the electro-capillaries, some as striking as the so-called mercury heart ; in the oscillations of which the stress involved Mercury surface and the adsorption on its surface of existing ions, in an aqueous dissolution of potassium dichromate. The most important molecules in the vital processes are the proteins [18,19,20, 21,22], which are polymers of amino acids and present themselves in aqueous dissolution generally as folded chains. These molecules are covered by a blanket of water molecules thanks to the existing bridges of hydrogen both in branches of the molecule and in the proper water molecule. A molecule of the size of a protein exhibits a surface of chemical groups and of the corresponding electrons, means, it is an electrical surface, in which an outside electron can travel abroad as a massive object does it on an eventful surface. The process of catalysis is due to the fact that some of these accidents can possess a form similar to another outside molecule, as if it were a corresponding key and lock, with the result of greatly facilitating the reaction. The vital processes involve the repetition of reactions between proteins, in which the electron is the main protagonist. The huge variety of proteins explains the big diversity of the vital processes. Moreover it is known that proteins are produced by a series of molecular processes in those who involved in DNA and RNA molecules [23,24] who form the typical genes of every species. In other words, proteins of life game in certain species should be the same as those provided by the above machinery, machinery that uses certain and particular genes. The maintenance of this connection might be related to the genetic expression.
Figure 2. The matter forces. They are those who acted in the evolution of the matter, being the most important for molecular living.
The gravitational one that dominates the dynamics of the Universe, from the big masses, including super-cumulus and cumulus of galaxies, stars, up to the planets, satellites and large meteorites [17]. It is considered to be, next, the role redeemed by the forces in the different entities of the Universe and in particular those responsible for the existence of the living matter. In the atoms, molecules and bodies of our most immediate environment, nuclear forces are kidnapped due to the shielding exercised by the negative electrons (Faraday Effect). The role of the nuclei consists of providing the necessary support for electroweak forces could exercise their function, and in particular, the Coulomb force. Lets remember that this force is formally identical to the gravitational force, only referred to the charges. For us generally called molecular forces (calls like that because it holds for molecular dipoles) are the most important in the living matter and are derived from the Coulomb force. In the case of the water molecule it happens that, on having been asymmetric, the positive charges do not coincide with the negative and a dipole is had. By applying to di Under License of Creative Commons Attribution 3.0 License
Figure 3. The flowchart contains the information of the events that shaped the Earth as result of the force operating
iMedPub Journals
doi: 10.3823/037
2009 Vol. 1 No. 2:3
The above mechanisms, which might seem like magic, are not exclusive of the living matter, but the result of certain restrictions imposed by the environment. The work hypothesis consisted of verify that the behaviour of the alive matter is capable of being described quantitatively of same or similar way to as it is realized by the ordinary (inert) matter. The gravitational forces formed the Earth and shaped its surface transporting its materials. We can say that they prepared a suitable settlement for the living matter. Briefly, the events that happened in the formation of the Earth were the following ones (Figure 3). After the Hadean eon (3800 million years ago) the Earth entered in an age of major calmness. This is the Aeon Achaean, reaching to 2.5 Ga. The events consisted of the appearance of the first land emerged (further on, creatons) and subsequently in the appearance of rocks and minerals, which major complexity reached in the polymers so-called silicates.
When the cooling of the planet were temperatures reached below to 100C, water vapour around condensed forming seas and oceans. As a consequence of the volcanic activity, emerged the so-called arches of volcanic islands that further on the creatons would form, earlier or during the appearance of the prokaryotes cells (approximately 3.8 Ga ago). In favour of the acting forces (principally gravitational ones) began the processes of external orogeny and eventually transport of materials, due to the existing level differences. The water formed similar structures to the river, following the steps given below. Initial movement with capillary disorder (more organized) with vein water without end with flowing streams, creeks and rivers (Figure 4). One notice the underlying philosophy: it is the same motive that repeats itself to different scales. In the formation of the volcanoes occurred similar mechanisms. Keep in mind that during these processes the atmosphere was not containing free oxygen. This was of great significance in many aspects. The free atmospheric oxygen appeared approximately 2000 million years ago, that BP corresponds to the eon Proterozoic, between 2500 and 542 million years. During such a long period of time the atmosphere changes from reducing to neutral-oxidant. The seas and oceans were reducing with important contents of ferrous ions and uraninites. A much smaller scales, next to the molecular ones, local phenomena can appear, especially in the transport of fluids, especially water, and thanks to its big power of dissolution for the ionic compounds, derivative from its high dielectric constant. The latter processes are called of self-organizing processes geochemistry or synergistic [25]. Liessegang rings, the golden colour of some sandstone and the colorations in insects and birds are current manifestations of the same local transport processes and precipitation. As soon as there was reached a suitable temperature, which was allowing the presence of the water in its three states, the first microorganisms appeared in shallow seas: prokaryotes cells [26,27,28,29,30,31,32,33,34]. A biotic mechanisms are ignored that the AND originated. One of us has developed a nuclear theory to explain the origin of proteins. Considering the Stromatolites (Fig. 5) as a coastal architecture and comparing them with the previous shaped of the surface one might think that something new entered on the scene. Eukaryote cell appeared on Earth approximately 2000 million years ago [35,36,37,38]. Between the primitive cell prokaryote and fauna ediacarense (Figure 6) (which apparently shows an authentic display of fossils) and, above all, the Precambrian, spent a large time interval, of which fossil sites are not known.
Figura 4. In this figure we can appreciate the system used in the evolution, both cosmic and planetary and biological: the formation of repetitive structures.
iMedPub Journals
doi: 10.3823/037
2009 Vol. 1 No. 2:3
these polymers. Long before was known, there had been called bridges of hydrogen. From this base of alive beings were formed all the others according to Darwinism [5]. The cells must absorb nutrients of their environment and expel the produced garbage. In a stationary state or quasi-stationary must be to happen that the speed of production of garbage is equal at the speed of their expulsion. Because production of garbage is proportional to the volume and its proportional elimination to the surface, in the growth of the cell there can happened an accumulation of garbage and their poisoning [39]. As we noted, the multi-cellular organisms appeared approximately 580 million years ago with the Ediacara fauna, preceding the Cambrian explosion (542 million years ago) [40,41,42]. In these organisms the contributions of nutrients and the oxygen depend on the diffusion through the available surfaces for that. This process is governed by Ficks first law, under which the transport speed is proportional to the surface crossed by the fluid and the gradient of concentration. Compared with other processes of transport, particularly with the turbulent movement, the diffusion is a slow process. To reduce this slowness the living beings constructed big surfaces with the decrease of their thickness: certain worms and seaweed; hollow pipes (choral); intussusceptions [6]. In spite of the increase of the speed of absorption of the oxygen and nutrients, due to the biggest surface of exchange, the process of diffusion (from overseas), globally considered, may not be sufficient, in many cases, to satisfy the needs of a numerous population of cells (a few billion). In this situation, the solution, almost universal, consists of adopting the strategy of the natural transport of materials, as the case of a river basin, must bear in mind the fact that for the cells it must be done through thinnest pipes, this leads us to think in the capillaries and in the laws that govern the movement of the liquids along the same ones. These laws are explained by the contest of the so-called molecular forces. The behaviour of the movement of the liquids across capillaries obeys this type of forces and in this case one speaks about the Poisseuille law. This law has been used by some authors to model the mammals bloodstream and in calculating the exponent of scale in the basal metabolism [43]. In summary, the diverse and successive used strategies were the following ones: Cellular split, mitosis, surface creation (plates and/or widespread tapes, hollow pipes), fractal surfaces, branching of matter-energy transport and transport branch of information [44,45,46].
Figura 5. Witnesses of the vital activity of the first organisms, as cyanobacterias, the stromatolites are an example of biological and geological affiliation, which would remind to us the dental plaques and in general the bacterial films.
As if it were a triumph of life on Earth we can observe tubular structures, coordinated movements, eyes, etc., that tell to us about neurons and their connections. A structure as complex as cell eukaryote explains that it will take so long to find their habitat. To preserve this settlement it seems logical to suppose that the cell eukaryotes adopt a strategy of the repetition of mechanism that had taken so long to develop. From a logical point of view it seems more reasonable to admit a strategy of doubling that any other one, considering that the same one is a singular characteristic of the molecules type DNA-RNA. The linkage of hydrogen, are the only ones, perhaps, that might provide the elements of the zipper (or pieces of a puzzle) that it joins two fibbers of
Figure 6. We show here a stage of wildlife Ediacarese that can serve as an example of diverse forms that living bodies adopted in its evolution and involve into more recent floras
iMedPub Journals
doi: 10.3823/037
2009 Vol. 1 No. 2:3
In the evolution of the living beings we have not mentioned the temperature of the different systems that have been appearing. It is known that the environmental average temperature (of a few degrees centigrade) was probably the correspondent to the living beings, for balance reasons. Approximately 200 million years ago the above mentioned temperature experienced a sudden change with the appearance of the mammals. Thus, there was a notable increase in the rate of speciation, as if it were a new pre-Cambrian explosion (that we can characterize for the growth of the brain and cerebellum in relation to the corporal mass). Approximately 2.5 million years ago our species appeared.
The growth
The growth is accompanied by an occupation of the available space and, as mentioned above, this occupation must facilitate the material and energy exchanges [47]. In the animals, as is the case of embryos in the egg, the available space for the growth is full with the reserve material, which is being replaced by him [48,49,50,51,52]. If the space is filled with matter, the exchanges would be limited because the diffusion across the condensed matter is a slow process (it is the molecular diffusion). This is the explanation that the vegetable develops a fractal structure that is not compact, but it has enough foliage which facilitates the turbulent diffusion in order to easily reach the nutrients the leaf surface [53,54,55]. The image of the fractal vegetable would be this one: of a trunk branches out of these, other branches and so on until the terminal bud. The success of the vegetables perhaps stems from the fact of the availability of the exterior air space and also, although to a lesser extent, the Terraqueous space, in the bosom of which the roots constitute also a fractal structure, although, as clearly as in case of leaves. For animals available space is the egg and/or uterus, so that growth in this case is strongly constrained. Meanwhile the size of the embryo is small relative to its container, nothing is opposed to the growth, but after a while it is possible to warn the instability of the available space, which roughly coincides with the appearance of the somites. When the embryo occupies almost the whole space, growth takes place inwards originating, for the same causes indicated for the vegetables, fractals structures, the easiest to visualize is that of the lungs, which might be considered to be an indoor tree (Figure 7). The circulatory system is another fractal structure, easily reachable [56,57,58]. The fractal growth is consistent with Darwinism because their repetitive structure implies a comparatively simple genetic programming, an aspect that Dawking notes in his book The River of Eden [59]. If we knew the relationship between time t and mass m, means, m versus t, we would have valuable information about the history of the process, being able to deduce how they have been changing certain characteristics, such as the speed. Although not explicitly mentioned, it is supposed that these processes occurring at temperature virtually constant. Previously need to have the necessary concepts to tackle this study. The metabolism provides to us a valuable help on this matter [60,61,62]. In effect, since as everyone knows, this is the energy emitted per unit time (B Joules/sec) and is represented in the form of an allometryc equation (B=B0 mb) in which the mass of the animal is raised to the power b, whose value is about 0.7.
Figura 7. The splendour that vegetables show on display of fractals in the development of life, is nevertheless later to its implementation in the embryo and in the lungs of living higher.
But, what is the meaning and scope of the power b?. To solve this question it to apply the principle of conservation of energy for diverse types of animals, for example between the mammals. This principle means that anyone the animal, the energy exchanged during their average life time must be the same for the unit mass, this is, the gram. Accepting that this lifetime is given by an allometryc equation (t=t0 mc) [] 63,64, 65,66,67,68, it is verified b + c~1. The preceding hypothesis is supported by experimental measurements. As c a value of about 0.3, we find a relationship between the time of pregnancy and the mass of the foetus at term. And more general, if we know b and c, we can consider the previous equation as if the mass were a function of the elapsed time. We are going to study experimentally this process of development.
iMedPub Journals
doi: 10.3823/037
2009 Vol. 1 No. 2:3
The information provided by the literature has been adjusted using the MATLAB [69,70]. The kindness of the adjustment can express in different ways, in accordance to statistics. The easier and more intuitive to our judgment it provides r2, coefficient of determination, in that this value represents the percentage of all values of m that fall down inside the straight line; rest of values, namely (1 r2) % will fall down to every side of the same one, and they are called residual values. The straight line is a logarithm m versus logarithm t. Figure 8 includes the values of the correlation coefficient and exponent c, for birds that are cited.
firstly what happens up to the appearance of the curvature. This behaviour is the translation of the successive processes that take place in the early embryonic development, the most important of which in a compact cell who would remember a sphere or ball of football [71,72,73]. For a single cell, the relation surface/ volume are huge, so initially problems of exchange do not exist. After the cell splits and lumpy (Figure 9) increase the surface, but not as much as if the cells do not suffer this process, so that as time increases, the relationship between the exchange surface and the volume decreases, putting in danger the subsistence due to the accumulation of residues.
Figura 8. In the figure shows a summary of the empirical material concerning the behaviour of embryo development in birds, comparing the values of scaling exponent in the equation of life expectancy and the correlation coefficient.
Summing up, we would say that in the cases function as explained above is most suitable, if not the only one. Most notable of the previous study is the apparent absence of the embryonic period, or its difficult pursuit, from time zero onwards.
Figure 9. The figure shows a morula which represents a fleeting stage crowding of cells. This structure is not sufficiently stable because the profit of obtained surface is much less that the sum of cells components, since they lose in the mutual surface.
Human embryo foetus

The information provided by the literature refers to sizes (in mm) of the embryo - foetus according to the time passed (in days). At the end of about two months, the individual values are given in grams. With the help of Matlab we tested adjustments to equations with fewer parameters. The best equations were exponential and the potential, being the last one best suited to experimental values and extrapolated ones. The equation is d=3.106 *! 0-4 t2.747 mm (t in days). The same series of values shows that 470 mm correspond to 3100 grams. Taking to mass of the half cell to the value 6*10-10 gr, it is obtained: N=1.1*1010 *d cells, and D=1.44*log (N) divisions. The habit of the above equation (D versus t) indicates an initial behaviour characterized by an almost instantaneous rise, which over time decreases, as clearly indicated the presence of a curvature. Lets consider
The problem is solved thanks to the invagination, a process that consists of the transformation of spherical crowding in a cellular structure with double wall, which increases the surface values which facilitate the subsistence of the system, which passes the last crowding, called morula, to the following ones. Lets mention here that the organisms that we might call morulars, do not exist or are very rare. The slowdown that occurs then is due to emigration processes of the cells mother. In the embryonic development the variables used are masses and/or sizes and elapsed times, whose relationship is that of the preceding expression. If instead of using these variables we make use of the small ones, they are obtained dividing each of them between the value corresponding to the final term, it happens that for same or approximate value of c, we obtain the same equation, or said otherwise, to the same values of reduced time, the characteristics of the embryo - foetus are approximately identical . Applied to the embryo and to the foetus they provide different results, because the embryos more closely resemble each other that foetuses between them, or in other words, the characteristics of each other for the same reduced times remain the same, they are less evident in an embryo than in the foetus, since the embryo of an elephant does not exhibit peak and the bird does not exhibit horn.
iMedPub Journals
doi: 10.3823/037
2009 Vol. 1 No. 2:3
All the above can be summarized in the sense that, for the case of the human embryo and in general to all mammals, the phenomenon of growth from fertilization to birth consists essentially of two stages, the embryonic one and the fetal one. The fact that the most conspicuous mammal should be the Homo Sapiens, suggests to think that the behaviour of mammals should be similar, which leads us to conclude that the shortened time for them should be the same, or in other words, that all embryos resemble each other (Figure 10), and therefore, exhibit similar forms, but the corresponding foetuses should be completely different.
Haeckels Law
Comparing somewhat arbitrarily embryonic forms of some species (Figure 11), Haeckel enunciated that ontogeny recapitulates phylogeny, whereby the first one refers to the growth and development of an individual and the second one to the evolution of the corresponding species. In other words, every successive stage in the ongoing development of an embryo - foetus, corresponds to an adult forefather of the history of the considered species. Referring, for example, to species homo-sapiens, and considering that in the evolution of species it has been preceded by fish, amphibians and reptiles, the different forms that are displayed embryonic development, according to Haeckel, the adult forms of these species and in the same order [77]. Although the mentioned theory has been discredited by the modern Biology, its influence has been quiet remarkable, having been even extended to other fields. For our part, we believe that the concepts introduced on the synchrony and diachronic have very much in common, not only in language, but in other fields, such as the periodic table [78] in which the electronic structure of an element (synchronism) summarizes (diachronous) the set of all previous structures. Our position on this matter is Haeckels law does not exist. These must be, in any case, some important concepts related to Haeckels to extrapolate the big resemblance between the embryos that he studied. Assuming the current doctrine about the Universe and the universality of the operative forces (primary magnitudes), introduces a new way of coherent description for all the objects formed in the course of evolution and in particular for the correspondents to our most next environment. This methodology globalized and integrated, helps to clarify very important knowledge about the Universe in general and of the Earth, as the only settlement closer to life phenomenon, in particular.
Figure 10. Note the close resemblance between the embryos to different animals, which is a consequence of the almost universal equation that governs the growth. When there express themselves the magnitudes of the values of the embryo - foetus to term. For the same values of reduced times, the characteristics are identical for all series. This is the meaning for us is the law of Haeckel.
Figure 11. This is the famous series of embryos - foetuses used by Haeckel to demonstrate the law that takes his name.
Macroscopically, considered the differences between foetuses in contrast to embryos similarities. The extraordinary thing about this behaviour is explained by the emigration of so-called mother cells, means that as soon as was finished the phase of embryo, cells have take different ways to form different tissues: a peak in birds, a trunk in an elephant and a mouth in the Homo-Sapiens. Who dictates the indifferences cells of the mature embryo, the orders so they know which way to go so that no elephants with peak or mice with horn? The response is an evolution and genetic expression [74,75,76].
iMedPub Journals
doi: 10.3823/037
2009 Vol. 1 No. 2:3
References
[1] Thompson DW. On growth and form. Madrid: Hermann Blume Ediciones, 1980. [2] Prigognie I. The end of certainties. Madrid: Publishing house Taurus Sciences, 1997. [3] Gibbons A. The Birth of Childood. Science 2008; 322:1040-1043. [4] Narlikar J. The Structure of the Universe. Oxford: Oxford University Press, 1997. [5] Darwin Ch. Origin of Species. Madrid: Publishing house Edaf, 1995. [6] Wolpert L. The Triumph of the Embryo. Oxford: Oxford University Press, 1998. [7] Sadler TW. Langman Medical Embryology. Buenos Aires: Mdica Panamericana, 2004. [8] Gilbert SF. Biology of Development. Buenos Aires: Mdica Panamericana, 2004. [9] Tokin BP. General Embryology. Moscow: Publishing house Mir, 1990. [10] Lansen WJ. Human Embryology. Madrid: Elsevier Science, 2003. [11] Davies P. The accidental Universe. Barcelona: Scientific Library Salvat, 1987. [12] Gamov G. The creation of the Universe. Madrid: Espasa Calpe, 1963. [13] Garzn L. History of Matter, the Big-Bang to the origin of life. Oviedo: Editions Nobel, 1994. [14] Garzn L. The origins of life. Mundo Cientfico 2001; 219,12-19 [15] Hoyle F. The Universe: Galaxies, nuclei and quasars. Madrid: Alianza Editorial, 1967. [16] Hoyle F. The Intelligent Universe. Barcelona: Editions Grijalbo, 1984. [17] Audouze J and Israel G. The Cambridge atlas of astronomy. Cambridge: Cambridge University Press, 1985. [18] Koolman J and RhmK-H. Biochemistry. Buenos Aires: Mdica Panamericana 2004. [19] Maillet M. Cell Biology. Paris: Publishing house Masson, 2000; p.127-166. [20] Oberai A, Yungok I, Sanguk K and Bowie JU. A limited Universe of membrane protein families and folds. Protein Sci 2006; 15:1723-1734. [21] Choi and Kim S-H. Evolution of protein structure classes and protein sequence families. PNAS 2006; 38:14056-14061. [22] Styer L. Biochemistry. Barcelona: Editions Revert; p. 6-22. [23] Watson JD and Berry A. ADN. Madrid: Publishing house Taurus Santillana, 2003. [24] Dose K, Bieger-Dose A, Kerz Or and Gill M. DNA-strand breaks limit survival in carries to extremes dryness. Origins of Life and Evol Biosphere 21:177-178. [25] Gimeno MJ et to. Geochemical self - organization. Studies geol 1989; 45:315 - 324. [26] Garzn L. Biological life and temperature: to semiempirical approach. Origins of life and evolution of biosphere 2003; 36:10-16. [27] Garzn L. The origin of life. A new stage. Oviedo: Service of publications of the University, 1996. [28] McKee S and Gould GW. A simple matematical model of the thermal death of microorganisms. Bull Math Biol 1988; 50 (5):493-501. [29] Cossins AR and Bowler K. Temperature biology of animal. London: Chapman and Entrance hall, 1987. [30] Cairns-Smith AG. Seven tracks on the origin of life. Madrid: Alliance Ediciones del Prado, 1994. [31] Oparin AI. The origin of life. Phoenix Editions: Dover, 1952. [32] Schredinger E.: what is the life?. Barcelona: Editions Orbis, 1986. [33] Margulis, L. The origin of cell. Barcelona: Publishing house Revert, 1988. [34] Clark BC et to. Survival of life on asteroids, comets and other small bodies. Origins of Life and Evol of the Biosphere 1999; 29:521-545. [35] Kurland CG, Collins LJ, Penny D. Genomics and the irreductible nature of eukaryote cells. Science 2006; 312:1011-1014. [36] Margulis L and Sagan D. Microcosm. Barcelona: Publishing Tusquets, 1995. [37] Margulis L and Sagan D.: what is life? Barcelona: Publishing Tusquets, 1996. [38] Nicholson WL, Munakata N, Horneck G, Melosh NJ and Setlow T. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiology and molecular biology reviews 2000; 64 (3) 548.
[39] Skiner GE, Larking JW and Rhodehamel EJ. Mathematical modelling of microbial growth: A review. J Food Safety 14,175-217. [40] Gould SJ. Wonderful Life. NY-London: WW Norton, 1989. [41] Shen B, Dong L, Xiao S, Kowalewski M. The Avalon Explosion: Evolution of Ediacara morphospace. Science 2008; 319:81-84. [42] Seilacher A. Trace fossil analysis. Berlin: Springer, 2007. [43] West GB, Woodruff VH and Brown JH. Allometric scaling of metabolic rate from molecules and mitochondria to cells and mammals. Proc Natl Acad Sci U.S.A. 2002; 99:2473-2478. [44] Altman PL and Ditter DS. Biology data book. Bethseda MD: Fed Amer Exp Biol Vol 1,1972&Vol 3, 1974. [45] Azbel MY. Universal biological scaling and mortality. Proc Natl Acad Sci USA 1994; 91:12453-12457. [46] Brack A, Hornech G and Wynn-Willians D. Exo/Astrobiology in Europe. Origins of Life and Evol of Biosphere 2001; 31:459-480. [47] Heusner J. Size and Power in mammals. J Exp Biol 1991; 160:25-54. [48] Deeming DCh and Ferguson WJ, publishing MWJ. Eggs incubation: its effects on embryonic development in birds and reptiles. Australia: Cambridge University Press, 1995. [49] Starck JM and Ricklefs RE Editores. Avian growth and development. Oxford: Oxford University Press, 1998. [50] Walters M. Bird eggs. Barcelona: Editions Omega, 1994. [51] Harrison C. Field guide of the nests, eggs and chicks of the birds of Spain and of Europe. Barcelona: Editions Omega, 1991. [52] Slack JMW. From egg to embryo. Regional specification in early development. UK: Cambridge University Press, 1997. [53] Mandelbrot B B. The fractal Geometry of Nature. New York: W. H. Freeman, 1983. [54] Mandelbrot B B. The objects fractales. Barcelona: Publishing Tusqets, 2006. [55] Mandelbrot B B. How long is the coast of Britain? Statistical Self-similarity and fractional dimension. Science 1967; 156 (3775):636-8. 56] Goldberger TO, Amaral HER, Hausdorff JM, Ivanov PC, Peng CK, Stanley HE. Fractal dynamics in physiology; alterations with disease and aging. Proc Natl Acad Sci 2002; 99 (Suppl 1):2466-2467. [57] Kopelman R. Fractal reaction kinetics. Science 1988; 241:1620-1626. [58] Kalliokoski K, Kuusela A, Laaksonen S, Knuuti J and Nuutila P. Muscle fractal vascular branching pattern and microvascular perfusion heterogeneity in endurancetrained and a trained men. J Physiol 2003; 546.2:529-535. [59] Dawkins R. The river of Eden. New York: Perseus Books, 2004. [60] Dodds AJ, Rothman DH and Weitz JS. Re-examination of the _ law of Metabolism. JTheor Biol 2001; 209:9-27. [61] White and Seymour. Mammalian basal metabolic rate is proportional to body mass2/3. PNAS 2003; 100:4046-4049. [62] Smidt-Nielsen K. Why is animal size so important?. Cambridge: Cambridge University Press, 1984. [63] White CR and Seymour RS. Allometric scaling of mammalian metabolism. Journal of experimental Biology 2005; 208:1611-1619. [64] Enquist BJ, Brown JH and West. Allometric scaling of plant energetic and population density. Nature 1998; 395:163-165. [65] Enquist BJ, West GB, Charnov EI and Brown JH. Allometric scalling and lifehistory variation in vascular plants. Nature 1999; 401:907-91. [66] Dickson BG. Growth, debate, and progress in biological allometry. For Sci 2001; 47:201-228. [67] Vzquez L, Dobado A and Snchez JP, publishers. Alometrys in Biology: a cosmological perspective. XXIX Reunin Bienial de la RSEF; Seville 2003. [68] West GB, Brown JH and Enquist BJ. The fourth dimension of life: fractal geometry and allometric scaling of organisms. Science 1999 to; 284:1677-1679. [69] Matlab Reference Guide. The USA: The MathWorks, 1962. [70] Prez C. Computerized mathematics with MATLAB. Madrid: Publishing BRANCH, 1996. [71] Richardson MK, Allen PS, Wright MG, Raynaud A and Hanken J. Somite number and vertebrate evolution. Development 1998; 125:151-160. [72] Wolpert L, Beddington R, Jessell T, Lawrence P, Meyerowitz E, Smith J. Principles of Development. Barcelona: Oxford University Press, 2002. [73] Keller JP, Schmidt GIVES, Wittbrodt J and Stelezer HK. Reconstruction of zebrafish early embrionic development by scanned light sheet microscopy. Science
iMedPub Journals
doi: 10.3823/037
2009 Vol. 1 No. 2:3
2008; 322:1065-1069. [74] Dawkins R. The Selfishc gene. Barcelona: Publishing Tusquets, 1998. [75] McMahon T. Size and shape in biology. Science 2008; 179:1201-1204. [76] Richardson MK and Verbeek FJ. New directions in embryology and the nature of developmental characters. Animal Biology 2003; 53:303-311. [77] Banavar JR, Damuth J, Maritna A, Rinaldo A. Ontogenic growth: modelling universality and scaling. Nature 2002; 420:626. [78] Garzn L. Of Mendeleiev to the super-elements. Oviedo: Service of publications of the University, 1996.

Archives of Medicine Collection 2010

Încărcat de

Informații document

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

Archives of Medicine Collection 2010

Încărcat de

Drepturi de autor:

Formate disponibile

Archives of Medicine

Published by IMedPub publishing house. ISSN: 1989-5216

2010 Vol. 2 No. 1:1

A study on genital tuberculosis and infertility in Indian population

Materials and methods

2010 Vol. 2 No. 1:1

Results and discussion

Number of patients (out of a total of 17 culture positive patients)

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:1

2010 Vol. 2 No. 1:2

Materials and methods Sample

Under License of Creative Commons Attribution 3.0 License

2010 Vol. 2 No. 1:2

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:2

Under License of Creative Commons Attribution 3.0 License

2010 Vol. 2 No. 1:2

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:2

2010 Vol. 2 No. 1:3

Material and Methods:

2010 Vol. 2 No. 1:3

Bone marrow karyotyping:

Nucleic Acid Extraction:

Results and Discussion

Designing of oligonucleotide primers:

PCR Amplification and automated capillary electrophoresis:

Under License of Creative Commons Attribution 3.0 License

2010 Vol. 2 No. 1:3

Name of the primer & orientation JAK2F(+/+)

Primer hybridization position (nucleotide) 5063534 to 5063554

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:3

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:3

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:3

and c-kit receptor expression. Br J Haematol 86:12-21.

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:3

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:4

Materials and methods

Under License of Creative Commons Attribution 3.0 License

2010 Vol. 2 No. 1:4

Table I. Sociodemographic, lifestyle and health conditions of the population

Accepted after external review

Table II. Anthropometric characteristics of the population

Factors associated with Low Back Pain

Prevalence of Low Back Pain

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com

2010 Vol. 2 No. 1:4

Table III. Odds Ratio: Independent Variables / Low

Under License of Creative Commons Attribution 3.0 License

This article is available from: http://archivesofmedicine.com