Biotechnology Name : ____________________________ Date : __________ Period: ______ Part A: Short Answer Questions 1.

Nucleic acids are composed of nucleotides. What is a nucleotide? (3)

a. _______________________________ b. _______________________________ 10. The backbone of the DNA molecule is made up of two components, what are these? (2) c. _______________________________ d. _______________________________ 12. The two bases that are purines are: (2) a. _______________________________ b. _______________________________

2.Differentiate between purines and pyrimidines. (2)

13. The two bases that are pyrimidines are: (2) a. _______________________________ b. _______________________________ 14. The bases are paired by_______________________ bonds along the axis of the molecule. (2)

3.Describe the basepairing rule. (2)

15. Write the complementary sequence to following DNA strand: (3) AATTCGCCGGTATTAGACGTT

4.What is the function of RNA?

17. Use the image below to complete the following: Circle a nucleotide. Label the sugar and phosphate. Label the bases that are not already labeled.

5.What do the letters DNA stand for? (1)

6.Explain the following statements: a) What is the function of DNA? (2)

b)DNA replication is semi-conservative. (2) Part B. Matching Match the following enzymes with their function as they relate to DNA replication. 7.Differentiate between the leading strand and the lagging strand. (2) 1. 2. 3. 4. 5. 6. _____ _____ _____ _____ _____ _____ DNA Polymerase III DNA Polymerase I RNA Primase Helicase DNA Ligase Single Stranded Binding Proteins

8.A molecule of DNA contains 23% Adenine. What percentage of Cytosine does it have? (1)

9. Two scientists are given credit for discovering the structure of DNA. What is the name of those two scientists. (2)

A. synthesizes the first nucleotides of the new strand B. unwinds the DNA and breaks the hydrogen bonds between the 2 polynucleotide strands C. begins to build the new strand D. joins the sections of DNA together E. keep the strands from joining back together hence creating a replication bubble F. replaces the RNA primer with DNA

C. Multiple Choice 1. ____________ bonds hold the complementary parent strands together. a. Phoshodiester b. Hydrogen c. Covalent d. Ionic 2. In a double helix, the direction of the nucleotides in one strand is opposite to their direction in the other strand. The strands are a. Parallel b. Homologous c. Anti-parallel d. Awesome 3. In DNA replication the ___________ is synthesized continuously in the direction of the replication fork. a. Lagging strand b. Leading strand c. Parent strand d. Niece strand 4. _________ are used to speed up the process of DNA replication a. nucleotides b. phosphodiester bonds c. enzymes c. Okazaki fragments 5. In the second step ________ breaks the bonds which hold the complementary parent strands together. a. Gyrase b. Primase c. Helicase d. Single-stranded binding proteins 6. Before DNA polymerase III can begin its job, what must happen? a. DNA polymerase I must create a base for it to start at b. Primase lays down thymine and cytosine c. DNA polymerase III doesnt need any help d. Primase lays down RNA primers 7. The lagging strand is composed of segments known as a. Pkazoki fragments b. Brgan fragments c. Ruzycki fragments d. Okazaki fragments 8. The RNA primers must be replaced with the appropriate deoxyribosenucleotides. The enzyme that accomplishes this is called a. Primase b. DNA polymerase I c.DNA polymerase II d. DNA polymerase III 9. Once the primers have been replaced, DNA _________ joins the gaps in the Okazaki fragments. a. Primase b. Cohesivase c. Parisase d. Ligase 10. Which of the following processes requires DNA replication? a. transcription b. translation c. mitosis d. protein synthesis 11. In which of the following processes does the DNA unzip ? a. transcription and translation b. Replication and transcription c. replication and translation d. all of them 12. Which DNA strand can base pair to the following DNA strand? ATGCTA a. TACGAT b. ATGCTA c. UACGAU d. AUGCUA 13. Which of the following nucleotide chains could be part of a molecule of RNA? (a) ATGCCA (b) AATAAA (c) GCCTTG (d) AUGCCA 14. The genetic code for an oak tree is a. more similar to an ash tree than to a squirrel. b. more similar to a chipmunk than to a maple tree. c. more similar to a mosquito than to an elm tree. d. exactly the same as for an octopus. 15. Which of the following base pairs would not be found in a cell? a. adenine thymine b. cytosine guanine c. thymine uracil d. adenine uracil Part D. Complete the chart on the three chemical differences between DNA and RNA. Structure 1. Strand of DNA RNA

Nucleotides 2. Sugar 3. Nitrogen Base 4. __________________________ carries information from the DNA in the nucleus out into the cytoplasm of the cell. 5. The process of making RNA from DNA is called __________________________ . 6. Why is DNA replication necessary before each cell division?

7. . In the drawing below, the small segment of plant DNA is shown after the two strands of the DNA molecule have been separated. Your job is to play the role of DNA polymerase and create the new matching strands of DNA to make two pieces of double-stranded DNA in the drawing below. Use the base-pairing rules to write in the nucleotides for both new strands of DNA.

Old Strand New Strand

New Strand Old Strand

8. A DNA molecule (labeled as A) replicates to produce two new DNA molecules (labeled as B). Both of the B DNA molecule then replicates to form four new DNA molecules (labeled as C). Are there any A DNA nucleotide chains present in the C DNA molecule? Explain your answer. If you believe the answer is yes, how many of the A DNA nucleotide chains are present in the C DNA molecules?

9. What is translation?

10. What are the RNAs involved in the translation? Give each roles.