Jenni Korhonen

Antibiotic Resistance of Lactic Acid Bacteria

Publications of the University of Eastern Finland Dissertations in Forestry and Natural Sciences

JENNI KORHONEN

Ant ibiot ic Resist ance of Lact ic Acid Bact eria

To be presented by permission of the Facu lty of Forestry and Natural Sciences , University of Eastern Finland for public exam ination in the Aud itorium L22, Snellm ania Build ing, University of Eastern Finland , Kuopio, on Saturday 24 th April 2010, at 12 noon.

Publications of the University of Eastern Finland Dissertations in Forestry and N atural Sciences 7

Departm ent of Biosciences University of Eastern Finland Kuopio 2010

Kopijyv Ku opio, 2010 Ed itors: Prof. Pertti Pasanen Prof. Tarja Lehto, Prof. Kai Peiponen Distribution: Eastern Finland University Library / Sales of publications P.O.Box 107, FI-80101 Joensuu, Finland tel. +358-50-3058396 http:/ / w w w .uef.fi/ kirjasto Print: ISBN : 978-952-61-0096-8 ISSN L: 1798-5668 ISSN : 1798-5668 Online: ISBN : 978-952-61-0097-5 (PDF) ISSN : 1798-5676 (PDF)

Authors ad d ress:

University of Eastern Finland Departm ent of Biosciences P.O.Box 1627 70211 KUOPIO FIN LAN D em ail: jenni.korhonen@uef.fi

Supervisors:

Professor Atte von Wright, Ph.D. University of Eastern Finland Departm ent of Biosciences P.O.Box 1627 70211 KUOPIO FIN LAN D em ail: atte.vonw right@uef.fi

Professor Sinikka Pelkonen, Ph.D. Research Departm ent of Veterinary Bacteriology Finnish Food Safety Authority Evira N eulaniem entie 4 70150 KUOPIO FIN LAN D em ail: sinikka.pelkonen@evira.fi

Review ers:

Professor Wolfgang Kneifel BOKU-University of N atural Resources and Applied Life Sciences Departm ent of Food Science and Technology VIEN N A AUSTRIA em ail: w olfgang.kneifel@boku.ac.at

Associate Professor Arthur Ouw ehand University of Tu rku Functional Food s Forum TURKU FIN LAN D em ail: arthur.ouw ehand @utu.fi

Opponent:

Professor Sven Lind gren N ational Food Ad m inistration UPPSALA SWEDEN em ail: sven.e.lind gren@telia.com

ABSTRACT: Lactic acid bacteria (LAB) are a heterogeneous group of bacteria found w idely in nature . They colonize the gastrointestinal and urogenital tracts of hum ans and anim als, and are present in food s such as d airy prod ucts, ferm ented m eats, fruits and vegetables. LAB are also intentionally ad d ed to several probiotic prod ucts because of their potential health benefits. Many LAB species are generally recognized as safe (GRA S), and several LAB species have received a Qu alified Presum ption of Safety (QPS) status given by Eu ropean Food Safety Au thority (EFSA). Resistance to antim icrobial d rugs (antibiotics) is a com m on character istic in the w orld of bacteria. In the interaction betw een bacteria, genetic m aterial is transferred from one bacterium to another, and also genes cod ing for resistance to a certain antibiotic m ay be passed on to other bacterial species. Since LAB are natural and profitable inhabitants in m any environm ents (gastrointestinal tract, several food s), strains w ith resistance to antibiotics w ould not be d etrim ental to the w ellbeing of hum ans or anim als. H ow ever, there is som e concern that antibiotic resistance in LAB could then be transferred to possibly pathogenic bacterial species, com plicating the treatm ent of a d isease or infection and lead to the spread of antibiotic-resistant bacteria. H itherto, only little attention has been p aid to the antim icrobial susceptibilities of LAB (Eu ropean Com m ission. 2005, Eu ropean Com m ission 2008). In ord er to illustrate the current situation of antibiotic resistance patterns in beneficial LAB, stud ies w ere first cond ucted to isolate and id entify lactic acid bacteria of anim al and hum an origins, and second ly to evaluate their antim icrobial resistance patterns. Moreover, tentative cutoff values d ivid ing the populations into susceptible and resistant w ere also proposed based on m inim um inhibitory concentrations (MIC) for a total of fourteen Lactobacillus species. Most of the LAB strains w ere found to be suscep tible to all antim icrobial agents used in the stud ies. The m ost frequently found resistance w as against tetracycline, follow ed by resistance against am inoglycosid es. The horizontal transferability of antibiotic resistance betw een LAB (Lactococcus garvieae species) and pathogenic Listeria monocytogenes w as also achieved , d em onstrating that a gene cod ing for tetracycline resistance tet(S) can be transferred from a fish pathogen to a hum an pathogen by conjugation in vitro. Universal Decimal Classification:579.864, 615.015.8, 615.33, 577.18 N ational Library of M edicine Classification: QW 142.5.A 8, QW 45 CA B Thesaurus: lactic acid bacteria; Lactobacillus; drug resistance; antibiotics; tetracycline; aminoglycoside antibiotics; horizontal transmission; Lactococcus garvieae, Listeria monocytogenes

TIIVISTELM: Maitohappobakteerien vastustuskyky antibiootteja kohtaan selvitettiin porsaid en, vasikoid en ja ihm isten suolistosta sek elintarvikkeista eristetyist kannoista. Tu losten perusteella ehd otettiin neljlletoista laktobasillilajille raja-arvoja, joita voitaisiin kytt jaettaessa kantoja herkkiin ja vastustuskykyisiin. Eniten vastustuskykyisyytt havaittiin tetrasykliinille sek am inoglykosid eille. Lisksi havaittiin, ett antibioottivastustuskyky voi siirty lajien vlill laboratorio-olosuhteissa Lactococcus garvieae bakteerin ja ihm iselle tautia aiheuttavan Listeria monocytogenes bakteerin vlill. Y leinen suomalainen asiasanasto: maitohappobakteerit; resistenssi -- antibiootit

In nature we never see anything isolated, but everything in connection with something else---

Johann Wolfgang von Goethe

ACKN OWLED GEMEN TS

This w ork w as carried ou t in the Dep arm ent of Forestry and N atu ral Sciences, University of Eastern Finland (form erly Dep artm ent of Biosciences, N u trition and Biotechnology, University of Ku op io). My w ork w as financially su p p orted by Eu rop ean th Union 6 Fram ew ork Program p roject Assessm ent and Critical Evalu ation of Antibiotic Resistance Transferability in Food Chain, ACE-ART, and also by Finnish Cu ltu ral Fou nd ation. In p articu lar, I w ish to exp ress m y sincere gratitu d e to m y p rincip al su p ervisor, Professor Atte von Wright, for giving m e the op p ortu nity to w ork com p aratively ind ep end ently and still having his fu ll su p p ort w hen need ed . Thank you for sharing you r tim e and thou ghts w ith m e d u ring these years. Sincere thanks go also to m y other su p ervisor, Professor Sinikka Pelkonen . Sincere thanks to Pau la H yvnen, for her com m ents on the thesis, and you r gu id ance and infinite su p p ort d u ring m y stu d ies and w ork at the d ep artm ent. I ow e m y thanks to the official referees, Professor Wolfgang Kneifel and Associate Professor Arthu r Ou w ehand , for agreeing to review m y thesis. Thank you for you r constru ctive criticism s. Thanks also to Ow en MacDonald for langu age consu lting. I w ish to thank all the form er ACE-ARTists, esp ecially all co-au thors arou nd Eu rop e and also in the d ep artm ent. Thank you for the p leasant collaboration and you r efforts in scientific research. Many of you r com m ents have essentially im p roved the p u blished p ap ers. Sp ecial thanks for thorou gh review ing to Angela van H oek, Geert H u ys and Sigrid Mayrhofer, and also to Mia Egervrn for nice collaboration. Particu lar thanks to m em bers of ou r su bu nit, N u trition and Food Biotechnology , for the p leasant w orking atm osp here. Sp ecial thanks to Carm e Plu m ed Ferrer, Kristiina Kinnu nen and Jou ni H eikkinen, for sharing you r exp ertise on lactic acid bacteria. For their technical assistance, I w ou ld like to thank Mirja Rekola, Elvi Mkirinne, Riitta Venlinen and Eeva-Liisa Palkisp . I w ou ld like to thank m y m other and father, Marjatta and Sakari, and m y m other - and father-in-law , Eeva and Veikko, for their care and su p p ort d u ring m y stu d ies and w ork. A clean hou se, d inner read y and child ren hap p y, after som etim es long hou rs at w ork. What m ore cou ld you ask! Finally, I w ish to thank ou r child ren, Aino, Lau ri and Elsa, for bringing m e the joy, and giving m e a p ersp ective of life in general. To m y hu sband Petri, a sp ecial thank you for those constru ctive argu m ents that w e both so m u ch enjoy, no m at ter the su bject! Thank you for you r u ncond itional love and su p p ort d u ring ou r years together. Ku op io, Ap ril 2010

Jenni Korhonen

ABBREVIATION S ACE-ART Assessm ent and critical evalu ation of antibiotic resistance

transferability in food chain ATCC BLAST CAMBH CFU CLSI EFSA EMBL FEEDAP GIT GRAS LAB LAMVAB L. Lb. Lc. LSM MIC MRS MTT N CCLS OD PCR QPS RAPD rp m TC TF W. Am erican Typ e Cu ltu re Collection Basic local alignm ent search tool cation ad ju sted M ller-H inton agar Colony form ing u nit Clinical and Laboratorty Stand ard s Institu te Eu rop ean Food Safety Au thority Eu rop ean Molecu lar Biology Laboratory Panel on Ad d itives and Prod u cts or Su bstances u sed in Anim al Feed Gastrointestinal tract Generally recognized as safe Lactic acid bacteria Lactobacillus Anaerobic MRS w ith Vancom ycin and Brom ocresol green Listeria Lactobacillus Lactococcus Lactic acid bacteria su scep tibility m ed iu m Minim u m inhibitory concentration d e Man, Rogosa and Sharp e Agrifood Research Finland N ational Com m ittee on Clinical Laboratory Stand ard s Op tical d ensity Polym erase chain reaction Qu alified p resu m p tion of safety Rand om ly am p lified p olym orp hism DN A Revolu tions p er m inu te transconju gant transform ant W eissella

LIST OF ORIGINAL PUBLICATIONS

This thesis in based on d ata presented in the follow ing articles, referred to by their Rom an num erals.

Korhonen, J.M.,

Sclivagnotis,

Y. and

von

Wright, A. (2007)

Characterization of d ominant cultivable lactobacilli and their antibiotic resistance profiles from faecal sam ples of w eaning piglets. Journal of A pplied M icrobiology 103: 2496-2503.

II

Korhonen, J.M., H assel, A., Kom ulainen, H . and von Wright, A. Antim icrobial susceptibility of lactic acid bacteria from fecal sam ples of w eaned calves. M anuscript.

III

Korhonen, J.M., van H oek, A.H .A.M., Saarela, M., H uys, G., Tosi, L., Mayrhofer, S. and von Wright, A. (2010) Antimicrobial susceptibility of Lactobacillus rhamnosus. Beneficial M icrobes 1: 75-80.

IV

Korhonen, J.M., Danielsen, M., Mayo, B., Egervrn, M., Axelsson, L., H uys, G. and von Wright, A. (2008) Antimicrobial susceptibility and proposed m icrobiological cut-off values of lactobacilli by phenotypic d eterm ination. International Journal of Probiotics and Prebiotics 3: 257-268.

Guglielm etti, E., Korhonen, J.M., H eikkinen, J., Morelli, L. and von Wright, A. (2008) tetracycline in Transfer of plasm id -m ed iated from fish and resistance to

pathogenic bacteria

aquaculture

environm ents. FEM S M icrobiology Letters 293: 28-34.

Cont ent s

1. 2.

Introduction .............................................................................. 15 Review of the literature ......................................................... 17

2.1 ANTIBIOTIC RESISTANCE IN THE FOOD CHAIN ................................... 17

2.1.1 M echanisms of antibiotic resistance ......................................................... 19 2.1.2 A ntibiotic resistance determinations ........................................................ 20
2.2 LACTIC ACID BACTERIA ..................................................................... 21

2.2.1 Identification of LA B ............................................................................. 23 2.2.2 LA B of human and animal origins ........................................................... 24 2.2.3 Safety of LA B ....................................................................................... 25
2.3 ANTIBIOTIC RESISTANCE OF LAB...................................................... 27

2.3.1 Phenotypic antibiotic resistance of LA B .................................................... 27 2.3.2 Genotypic antibiotic resistance of LA B ..................................................... 29 2.3.3 Horizontal transferability of antibiotic resistance from LA B in the food chain . 29

3. 4.

Aims of the study .................................................................... 31 Materials and methods .......................................................... 32

4.1 BIOLOGICAL ORIGINS OF LAB STRAINS (I-V) ..................................... 32 4.2 ISOLATION AND IDENTIFICATION OF LAB (I-IV) ............................... 33

4.2.1 Sampling and culturing of LA B from faecal samples (I-III) .......................... 33 4.2.2 Identification with biochemical methods (I-III) ........................................... 33 4.2.3 Identification with molecular biology methods (I-III, V ) .............................. 33 4.2.4 LA B strain characterization (I-II) ............................................................ 34
4.3 MICROARRAY ASSAY FOR LB. RHAMNOSUS (III) ................................ 34

4.4 PLASMID TRANSFORMATION AND MATING PROTOCOL OF LACTOCOCCUS SPECIES (V) ............................................................................................... 35 4.5 ANTIMICROBIAL RESISTANCE DETERMINATIONS (I-IV) ..................... 36

4.5.1 A gar dilution method (I-III) .................................................................... 36 4.5.2 Broth microdilution method (III-V ) .......................................................... 37 4.5.3 Etest method (III-IV) ............................................................................. 37

5.

Results and discussion ........................................................... 38

5.1 SPECIES DISTRIBUTION AMONG THE FAECAL SAMPLES OF PIGLETS AND CALVES (I-II) ............................................................................................ 38 5.2 RAPD FINGERPRINTS OF PIGLET AND CALF ISOLATES (I-II) .............. 39 5.3 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LACTOBACILLUS SPECIES OF PIGLET ORIGIN (I) ................................................................. 44 5.4 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LAB SPECIES OF CALF ORIGIN (II) ............................................................................................... 46 5.5 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LACTOBACILLUS RHAMNOSUS AND PROPOSED MICROBIOLOGICAL CUT-OFF VALUES (III) 52 5.6 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LACTOBACILLUS SPECIES AND PROPOSED MICROBIOLOGICAL CUT-OFF VALUES (IV) ........ 53 5.7 ANTAGONISTIC ACTIVITY AND TRANSFORMATION OF LACTOCOCCUS SPECIES (V) ............................................................................................... 58 5.8 TRANSFER OF THE TET(S) GENE FROM LACTOCOCCUS TO L. MONOCYTOGENES (V)................................................................................ 59

6. 7.

Conclusions ............................................................................... 60 References ............................................................................. 62

1. Introduction
Lactic acid bacteria are a heterogeneous group of bacteria, m any of them having received a generally recognized as safe (GRAS) or qualified presumption of safety (QPS) status. These bacteria are w id ely found in nature, includ ing the gastrointestinal and urogenital tracts of hum ans and anim als, and are present in many ferm ented food s like salted gherkins, m arinated olives, capers and salam i, and d ifferent m ilk based prod ucts such as cheeses and yoghurts. Lactic acid bacteria have trad itionally been associated w ith these d airy prod ucts and w ith cereal-, vegetable- and m eat-based ferm ented food s, either as intentionally add ed starters or d ue to their natural presence leading to spontaneous ferm entation. Certain lactic acid bacteria are also used as probiotics ad d ed to confer health benefits to consum ers or to im prove anim al prod uction. In this respect, lactic acid bacteria species are economically very im portant to the food and feed ind ustry. During the recent d ecades, there has been concern about the possibility of the spread of antibiotic resistance in the environm ent. Accord ing to the European Com m ission (2005), it has been estimated that som ew here from one to ten m illion tons of antibiotics have been released into the biosphere over the last 60 years. This has lead to a very strong selective pressure for the appearance of resistant bacterial strains. Much of the concern has been about pathogenic bacteria and their antibiotic resistances, since infections caused by these resistant m icro-organism s are not only m ore com plicated to treat, but the treatm ent is m uch m ore costly d ue to th e m ore intensive and tim e consum ing care need ed in these cases. Since lactic acid bacteria are present in the gastrointestinal tract in large am ounts and are also intentionally ad d ed to our d iet, concerns have been raised about the antibiotic resistance in these beneficial bacterial species. For exam ple, lactic acid bacteria resistant to certain antibiotics could benefit the host (hum an or anim al) by helping to m aintain balance in the gastrointestinal tract in cases of d iarrhea caused by antibiotic treatm ent. H ow ever, there is a risk associated w ith the ability of these resistant strains to transm it the resistance factor (gene) to other, possibly pathogenic bacteria. This could com plicate the treatm ent of a patient w ith an antibiotic resistant bacterial infection or d isease. H ence, the possibility of the circulation of genes cod ing for antibiotic resistance also from beneficial lactic acid bacteria, in the food chain via anim als to hum ans, has been investigated .

15

At the beginning of 2004, the European Union launched a 6 fram ew ork project Assessm ent and Critical Evaluation of Antibiotic Resistance Transferability in Food Chain (ACE-ART), in w hich m ost of the w ork includ ed in this thesis, w as cond ucted . The m ajor objective of this project w as to critically evaluate the im pact of antibiotic use in anim al and plant production and in the prophylaxis and treatm ent of d isease in hum ans using non -pathogenic lactic acid bacteria as m od el organism s. In ord er to obtain a w id e perspective of the current situation of antibiotic resistance patterns in lactic acid bacteria, a large array of these beneficial bacterial strains belonging to Lactobacillus, Lactococcus and Streptococcus thermophilus, together w ith Bifidobacterium, w ere includ ed in the stud ies of ACE-ART -project. In this thesis, the antibiotic resistance profiles from faecal sam ples of w eaning piglets and calves w ere d eterm ined . In ad dition, the antibiotic resistance of Lactobacillus rhamnosus strains from various sources (m ostly hum an and food origins) w as stud ied . In sum m ary, antim icrobial susceptibility and proposed m icrobiological cut-off values of lactobacilli by phenotypic d eterm ination w ere performed , containing both published and unpublished d ata of fourteen Lactobacillus species w ith their p henotypic antibiotic resistance phenotypes. Moreover, in ord er to d etect the horizontal transfer of antibiotic resistance genes in the food chain, in vitro transfer of a plasm id d erived tetracycline resistance gene, tet(S), w as achieved from Lactococcus garvieae to the pathogenic Listeria monocytogenes.

th

16

2. Review of the literature

2.1 ANTIBIOTIC RESISTANCE IN THE FOOD CHAIN

There is a close association betw een the quantities of antimicrobials being used and the rate of d evelopm ent of resistance to these substance s and thus the m isuse of antibiotics in hum an m ed icine is believed to be the principal cause of the antibiotic resistance problem (Singer et al. 2003). Another aspect, how ever, is the selection of resistant bacteria in the food chain d ue to the heavy utilization of antim icrobial agents in anim al husband ry (Teale 2002). As early as 1969, the Sw ann report (Anonym . 1969) d rew attention to the potential transfer of antibiotic resistan t bacteria from anim als to the food chain and to hum ans. In anim als, antibiotics are used for three d ifferent purposes: to treat sick anim als (therapeutic use), to prevent infection in anim als (prophylactic use) and to im prove feed utilization and prod uction, in other w ord s, to convert feed into m ore bod y m ass (grow th prom oters) ( Barton 2000, Singer et al. 2003). The therapeutic use of antibiotics is not questioned in farm anim als, but the view s of experts d iffer on the use of antibiotics as anim al grow th prom oters, and there is d ebate w hether the banning of these substances w ould have beneficial effects on hum an health. In the European Union, avoparcin (a glycopeptid e, w hich prod uces cross-resistance to vancomycin), virginiamycin (a streptogramin), bacitracin (also used in human medicine), tylosin and spiram ycin (both m acrolid es) have been banned as feed ad ditives (Teale 2002, N ousiainen et al. 2004), and the EU is m oving tow ard s a total restriction on grow th prom oters, thus fulfilling the recom mend ation of the Sw ann report (1969) w here it w as stated that antibiotics used in hum an m ed icine should not be used as grow th prom oters. N onetheless, the recom m end ations of the Sw ann report have not been ad opted in m any countries outsid e the EU (Teale 2002). For exam ple, in the USA a total of 19 d ifferent antibiotics are allow ed to be used for grow th prom otion , includ ing several antibiotics, like penicillin and streptomycin, w hich are used also in hum an m edicine (Singer et al. 2003). If an antibiotic resistance is to cause a disease in hum ans via the food chain, certain events have to take place (Figure 1). First, there has to be an antibiotic resistant bacterium and a selection pressure present in a particular group of animals. The bacterium has to rem ain in the food pr ocess, through, for exam ple, faecal contamination in the process or via a recontam ination by im proper handling, or lack of an ad equate tem perature treatm ent in the process. After con sum ption, the resistant bacterium has to colonize the GI-tract. (Singer et al. 2003) In conclusion, the transm ission of antibiotic resistance via the food chain is the same as for food borne pathogens. The risk of transm ission

17

of antibiotic resistance from anim als to hum ans is consid erably red uced w ith proper food hand ling and good food preparation practices. (Singer et al. 2003) It should also be noted that the use of antimicrobials is not restricted to anim al husband ry but also occurs in horticulture, for exam ple the use of am inoglycosid es in apple grow ing (Teale 2002).

Figure 1. Possible transmission routes of antibiotic resistance bacteria from animals to humans. Modified from Khachatourians 1998, Anonym 2004 and Claycamp and Hooberman 2004.

18

In Finland , the use of antimicrobial d rugs for anim als has rem ained rather stable for several years; although a slight increase m ay have occurred . Accord ing to N ational Agency for Med icines, the consum ption of veterinary antimicrobials w as 15 100 kg year 2007, calculated as w eight of active substance. In com parison, in the year 2001 the consum ption w as 13 800 kg. The possible reason for the increm ent rem ains to be clarified , i.e. is it because of an actual increase in antim icrobial consum ption or sim ply d ue to statistical variation. The overall good resistance situation can be traced to the strict antimicrobial policy. H ow ever, pressure for increasing the use of antibiotics in Finland w ill probably rise in the future. This is m ainly because of increased herd size and the trend tow ard s m ore inten sive livestock prod uction. (Myllyniem i et al. 2007)

2.1.1 Mechanisms of ant ibiot ic resist ance The genetic basis for the d evelopm ent of antibiotic resistance in bacteria in the food chain is based on tw o facts. Firstly, the bacteria m ust com e into contact w ith the antimicrobial agent in concern, and second ly, resistance against the antibiotic m ust d evelop (Khachatourians 1998, Levy and Marshall 2004). Resistance against a certain antimicrobial agent can be inherent in a bacterial species, this being referred to as intrinsic resistance, or natural resistance. In this case, the resistance is typical for all of the strains of that particular species. In contrast, the resistance is consid ered as acquired , w hen a strain of a norm ally susceptible species becom es resistant to an antim icrobial d rug. (European Com m ission 2008) The antibiotic resistance genes can be spread from one bacterium to another through several m echanism s. Intrinsic resistance is estim ated to present a m inim al potential for horizontal spread (betw een different bacterial species), as has been d em onstrated for exam ple w ith the chromosom al vancom ycin resistance d eterm inant of the Lactobacillus rhamnosus strain GG (Tynkkynen et al. 1998). Sim ilar to intrinsic resistance, acquired resistance usually possesses a low risk of horizontal d issemination, w hen the resistance is a result of a chrom osom al m utation. In contrast, acquired resistance is consid ered as having a higher potential for horizontal dissem ination of antibiotic resistance, w hen the resistance genes are present on m obile genetic elem ents (plasm id s and transposons). (Khachatourians 1998, European Com m ission 2008) Antim icrobial d rugs can be d ivid ed into d ifferent groups based on their m echanisms of action. Tod ay there are m ore than 250 antibiotics available for therapeutic use (m ore than 100 of those are -lactam s), but these d rugs act only against a few d ifferent bacterial target sites (van d en Bogaard and Stobberingh 1996). These sites of action includ e cell w all synthesis, protein synthesis (targeting for 30S, 50S or tRN A), DN A gyrase or folic acid m etabolism (N eu 1992). The m ajor antibiotic fam ilies and their target of action relevant to this thesis are show n in Table 1.

19

Table 1. Major antibiotic families and their target of action.

Sites of inhibition Cell wall synthesis Group -lactams Antibiotic Amoxicillin (AMO) Ampicillin (AMP) Penicillin C (PEN) Vancomycin (VAN) Gentamicin (GEN) Kanamycin (KAN) Neomycin (NEO) Streptomycin (STR) Chloramphenicol (CHL) Tetracycline (TET) Erythromycin (ERY) Tylosin (TYL) Clindamycin (CLI) Lincomycin (LIN) Enrofloxacin (ENR) Trimethoprim (TMP)

Glycopeptides Protein synthesis Aminoglycosides

Chloramphenicols Tetracyclines Macrolides Lincosamides

DNA replication/transcription Folate synthesis

Quinolones Sulphonamides

2.1.2 Ant ibiot ic resist ance det erminat ions Antim icrobial susceptibility testing m ay be perform ed using d ifferent phenotypic test m ethod s. In CLSI (Clinical and Laboratory Stand ard s Institute, form erly N CCLS, N ational Com m ittee on Clinical Laboratory Stand ards) the approved stand ard s state that the m ethod s of choice are agar dilution and broth m icrod ilution (Anonym . 2007). Other w idely used m ethod s includ e the agar grad ient m ethod and com m ercial m ethod s, such as Etest, w hich consists of a pred efined grad ient of antibiotic concentrations on a plastic strip (AbBiom erieux, Sw ed en). In ad d ition to phenotypic antibiotic resistance d eterm inations, also genotypic d etection of particular genes causing resista nce m ay be perform ed . These genotypic m ethod s includ e d ifferent PCR based m ethod s, southern hybrid ization, plasm id profiling and microarray (Aquilanti et al. 2007, Am m or et al. 2008). The situation is clearest w hen the phenotypic and genotypic resistance patterns are in agreement. H ow ever, a phenotypically resistant bacterium strain m ay be genotypically susceptible. This is usually d ue to the fact that appropriate genes are not includ ed in the test patterns, or th ere exist unknow n resistance genes. Tetracycline, for exam ple, has m ore than 40 d ifferent genes conferring antibiotic resistance d iscovered at the m om ent, and the num ber of tetracycline resistance genes continues to increase (Roberts 2005). With tetracycline, also new mosaic genes have recently been d iscovered (Patterson et al. 2007, van H oek et al. 2008a). In contrast, a susceptible phenotype m ay also carry silent genes, w hich are observed w ith genotyping. The silence of antibiotic resistance m ay be caused by d ow n -regulation in a prom oter region or

20

by other mechanism s. Despite of their silence, they still could be a potential concern since they could be transferred to other species w here they w ould be activated.
2.2 LACTIC ACID BACTERIA

Lactic acid bacteria (LAB) are gram -positive, acid -tolerant and non-spore form ing cocci and rod s. They are a heterogeneous group of bacteria com prising about 20 genera w ithin the phylum Firm icutes. From a practical point of view the genera Aerococcus, Carnobacterium, Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, V agococcus and W eissella have been consid ered as the principal LAB. (H olzapfel et al. 2001, Axelsson 2004) One com m on feature of the LAB is their ability to prod uce lactic acid as a m ajor end prod uct of their ferm entation of hexoses. As ferm enting organisms, LAB lack electron transport system s and cytochrom es, and they d o not have a functional Krebs cycle (Batt 2000). Based on end prod ucts of glucose m etabolism (Figure 2), LAB can be d ivid ed into tw o groups, nam ely hom oferm entative and heteroferm entative (Jay 2000). LAB are w id espread organism s and they m ay be found in m any environm ents rich in carbohyd rates. In ad d ition to carbohyd rates, LAB have com plex nutritional requirem ents for am inoacid s, peptid es, fatty acid esters, salts, nucleic acid d erivatives and vitamins (Tannock 2004). In short, they have com plex nutritional requirem ents d ue to their lack of m any biosynthetic pathw ays. On the other hand , they are found in a w id e range of different environm ental niches due to their good capacity for ad aptation. In food prod ucts, they are found in d airy prod ucts, such as yoghurt and cheese, in ferm ented vegetables (olives, sauerkraut), in ferm ented m e ats (salami) and in sourd ough bread (Tannock 2004). They are also associated w ith both terrestrial and m arine anim als (see chapter 2.2.2, LAB of hum an and anim al origins).

Figure 2. Generalized pathways for the production of fermentation products from glucose by A: homofermentative LAB and B: heterofermentative LAB (Kandler 1983).

21

Lact obacillus species The genus Lactobacillus is the largest LAB group com prising at the m om ent around 140 species and 30 subspecies (Bernard eau et al. 2008, Claesson et al. 2008). These num bers are constantly being revaluated on the basis of mod ern m olecular biology m ethod s and w hole genom e-based techniques (Makarova et al. 2006, Felis and Dellaglio 2007). Based on their ferm entation characters, Lactobacillus species can be d ivid ed into three groups; obligately hom oferm entative, facu ltatively heteroferm entative and obligately heteroferm entative (H am mes and Vogel 1995, Axelsson 2004). Moreover, if one uses 16S phylogeny, then the Lactobacillus species can be d ivid ed into three groups: the L. casei-Pediococcus group, the Leuconostoc group and the Lactobacillus acidophilus/delbrueckii group (Collins et al. 1991, H amm es and Vogel 1995, Stiles and H olzapfel 1997). Since then, based again on 16S rDN A sequences, it w as proposed to d ivide, the Lactobacillus species into five groups, nam ely Lb. acidophilus, Lb. salivarius, Lb. reuteri, Lb. buchneri and Lb. plantarum (Schleifer and Lud w ig 1995). H ow ever, these classifications have generally been consid ered as unsatisfactory and also the use of 16S rRN A genes as phylogenetic m arkers has been criticized (Claesson et al. 2008). N ew proposals for the classification of the lactobacilli species claim that the genus could be d ivid ed into seven or eight groups (Dellaglio and Felis 2005, H am m es and H ertel 2006). As com plete genom e sequences become available, the high d iversity of Lactobacillus has also been suggested to require the creation of new , subgeneric d ivisions (Canchaya et al. 2006, Claesson et al. 2008). Lact ococcus species In contrast to Lactobacillus species, the genus Lactococcus com prises at the m om ent only five species, nam ely Lactococcus garvieae, Lc. lactis (subspecies cremoris, ssp. hordniae and ssp. lactis), Lc. piscium, Lc. plantarum, and Lc. raffinolactis (http:/ / w w w .ncbi.nlm .nih.gov/ Taxonom y/ ). They can initially be d istinguished from each other by their possible ability to grow at tem peratures above 40 C and in >4 % sod ium chlorid e (Batt 2000). Plasmid s are com m on com p onents of Lc. lactis genom es, these being d iverse in size, copy num ber and d istribution. Plasm id s often carry som e significant characteristics, such as carbohyd rate ferm entation, proteolysis, polysaccharid e prod uction or bacteriosine prod uction. Occasionally some plasm id s also encod e the d eterm inants necessary for conjugation, and transfer of conjugal plasm id s may be a significant factor in horizontal gene transfer, likew ise other transposable elem ents (Cou rtney 2000). W eissella species W eissella species have been classified as Lactobacillus or Leuconostoc species until the reclassification propose by Collins et al. 1993. W eissella species are heteroferm entative lactics (Batt 2000, Jay 2000), and com prise at the m oment of fourteen species (http:/ / w w w .ncbi.nlm .nih.gov/ Taxonom y/ ). W eissella ssp. have been found in different ferm ented vegetable based food s, such as

22

ferm enting cassava (Kostinek et al. 2007) and sauerkraut (Plengvid hya et al. 2007), in sourd ough (Di Cagno et al. 2006) and in blood sausage, Morcilla d e Burgos (Santos et al. 2005) and in Shochu, a trad itional Japanese liquor (End o and Okad a 2005). W eissella ssp. have also been isolated in hum an sam ples from vaginal microbiota (N am et al. 2007) and saliva (Kang et al. 2006). 2.2.1 Ident ificat ion of LAB Reliable id entification of LAB is crucial in many tasks, e.g. applications in ind ustrial processes (technological properties), but also safety and quality control problem s (Temm erm an et al. 2004). Previously id entification of bacterial species w as based on the phenotypic characterization, but m olecular biology (genotypic) m ethod s, largely DN A-based techniques, offer m uch greater d iscrim inatory pow er, all the w ay to d ifferentiation of ind ivid ual strains. Usually a com bination of both phenotypic and genotypic id entification techniques (polyphasic approach) is preferred (Tem m erm an et al. 2004, Aquilanti et al. 2007). Phenotypic m ethod s includ e m orphological analysis, grow th characteristics and sugar ferm entation profiles (e.g. w ith com m ercial API-tests, BioMerieux, France). H ow ever, these m ethod s have a low taxonom ic resolution and often allow d ifferentiation only at the genus level (Tem m erm an et al. 2004). On the other hand , no special laboratory equipm ent is required to perform these tests. Cultivation, m icroscopy and sugar ferm entation profiles are im portant, even though in m ost of the cases, these tests are insufficient for accurate species identification d ue to the great num ber of d ifferent LAB species w ith similar phenotypic characteristics. The use of m olecular tools has revolutionized the id entification of m any bacterial species, includ ing LAB. Many of these techniques are based on the polym erase chain reaction (PCR) using oligonucleotid e primers to am plify targeted DN A fragm ents. These PCR prim ers m a y be d esigned to different taxonom ical levels, from genus-specific (for exam ple d ifferentiation betw een W eissella and Leuconostoc species, Schillinger et al. 2008) to the species-specific level (for exam ple d ifferentiation betw een Lb. brevis, Lb. fermentum and Lb. parabuchneri, (Coton et al. 2008)), to sub-species level (for exam ple betw een Lc. lactis subsp. lactis and Lc. lactis subsp. cremoris (Pu et al. 2002)), and also further to the strain-level (for exam ple id entification of Lb. reuteri strain 35 (Coudeyras et al. 2008)). This approach is suitable w hen the bacterial species has been prelim inary characterized w ith other, usually phenotypic, method s. Another genotypic m ethod w hich can be used to id entify unknow n bacterial isolates is ribosom al DN A sequencing, usually targeted to 16S or 23S ribosom al subunits. The obtained sequence is com pared w ith DN A sequences in online databases, such as EMBL (European Molecular Biology Laboratory) or Genbank using a sequence search engine like BLAST or FASTA (http:/ / w w w .ebi.ac.uk/ em bl/ ; http:/ / blast.ncbi.nlm .nih.gov/ Blast.cgi/ , (Altschul et al. 1990).

23

A w id ely used DN A fingerprint technique based on the PCR method is rand om ly am plified polym orphic DN A (RAPD), w here short arbitrary prim ers are used to rand om ly am plify DNA fragm ents. RAPD-PCR has been used w ith LAB in several stud ies and has successfully typ ed LAB strains (Urso et al. 2006, Aquilanti et al. 2007). Despite the usefulness of RAPD-PCR for strain typing it also has been criticized . Most concerns are related to the reprod ucibility of t he results. H ow ever, w ith careful optim ization, includ ing ensuring the quality of the tem plate DN A, polym erase enzym e and PCR cond itions, the RAPD -PCR m ethod has been found reliable and reprod ucible (Ravelo et al. 2003, Foschino et al. 2008). Accord ing to EFSA, an ind ispensable pre-requisite for d eterm ining antibiotic resistance w ith accuracy is the correct id entification of the strain of concern at the species level by m eans of m olecular taxonom y methods (European Com m ission, 2008). 2.2.2 LAB of human and animal origins A com position of LAB species d iffers betw een environm ents. Especially in hum ans, d etailed reports about LAB species and strains, as useful bacteria, have received enorm ous attention in recent d ecad es. Accord ing to Reuter et al. (2001), the m ajor autochthonous Lactobacillus species found both in infants and ad ults are Lb. ruminis, Lb. salivarius, Lb. reuteri and Lb. gasseri (Reuter 2001). Dal Bello and co-w orkers (2002) found also food -associated LAB, nam ely Lb. sakei and Ln. mesenteroides as intestinal inhabitants, w hen alternative incubation cond itions (30 C, 2 % O 2) w ere used (Dal Bello et al. 2003). The list of d ifferent lactobacilli species found in hum ans is inevitably m uch longer. H ow ever, m ost of the LAB species found in hum an intestinal sam ples are transient over tim e, and colonize the intestinal tract for only a short period of tim e (Walter 2005). In ad d ition, variation betw een ind ivid uals m ost probably influences the species com position, d ue to antibiotic treatm ents, d ifferences in the d iet consum ed or other environm ental factors (Donohue 2004, Dicksved et al. 2007). Taking into account the recent d evelopment in taxonom y of LAB, the com plexity of the species com posite on of LAB w ill m ost probably increase, not least w hen culture ind epend ent method s are used to id entify the strain . For exam ple, the PCR-DGGE (d enaturing grad ient gel electrophoresis) system d escribed by Walter et al. (2001) permitted not only the d etection of Lactobacillus species consid ered to be norm al intestinal inhabitants but also several LAB com m only associated w ith food and often used as starter organism s. These non -cultivable LAB species includ ed lactobacilli (Lb. sakei and Lb. curvatus), ped iococci (P. pentosaceus), leuconostocs (Ln. mesenteroides) and w eissellas (W . confusa). (Walter et al. 2001). In piglets as in hum ans, the m ost d ominant LAB species found are Lb. ruminis, Lb. reuteri/fermentum, Lb. salivarius and Lb. acidophilus/delbrueckii group lactobacilli (N aito et al. 1995, Leser et al. 2002, Yin and Zheng 2005, Yun et al. 2009). This is not surprising, since both hum ans and pigs are m onogastrics. The LAB species com position varies in piglets d epend ing to som e extent on w hich m ethod s are being used for analysis (culture-d epend ent versus culture-

24

ind epend ent m ethod s), and betw een d ifferent gastrointestinal locations. In ad d ition, the diet and the age of the anim als have an influence on the LAB species com position. Lb. reuteri has been observed to be a m ajor com ponent of Lactobacillus species in intestine of pigs, but also in chickens, cattle, d ogs, m ice and rats (Mitsuoka 1992). The id entification of lactobacilli species com position in calves has not received as m uch attention as in hum ans or pigs w hen consid ering LAB isolated from faecal sam ples. Instead , m uch of the w ork on calves and ad ult cow s has focused on w hich LAB species can be found in the rum en. The m ost frequently found lactobacilli species from faecal sam ples in calves are Lb. mucosae and Lb. reuteri, follow ed w ith Lb. acidophilus/delbrueckii group lactobacilli (Busconi et al. 2008). Streptococci w ere other im portant LAB together in ad d ition to the lactobacilli found in the stud y of Busconi et al. (2008). A novel finding in faecal sam ples of calves has been W eissella species, also Lactococcus species have been found (see publication II, Korhonen et al.). Interestingly, Lc. garvieae has been associated w ith m astitis in cow s (Devriese et al. 1999). In fish, the d om inant LAB species are carnobacteria, for exam ple Carnobacterium divergens and C. piscicola. Lactobacilli and lactococci have also been isolated from fish as w ell as several other LAB like aerococci and streptococci. (Gatesoupe 2008) H ow ever, LAB norm ally account for only a trivial percentage of the intestinal m icrobiota of fish, w hich m ay partly be d ue to the inappropriate cultivation m ethod s used in these stud ies. The m ain reason for not isolating LAB from aquatic anim als might be that the LAB from fish are generally slow -grow ing m icroorganism s and for this reason, a longer incubation tim e of up to four w eeks and a low er incubation tem p erature (4-12 C) have been recom m end ed , as w ell as resorting to non-culturable m ethods (Ringo and Gatesoupe 1998).

2.2.3 Safet y of LAB Lactic acid bacteria have been used all over the w orld in various trad itional and ind ustrial food ferm entations. Moreover, LAB have intentionally been add ed as probiotics in ord er to achieve beneficial effects on health of hum ans and anim als. Members of Lactobacillus and Bifidobacteria species are generally recognized as safe (GRAS-status), since they have a long history of use (Donohue 2004). H ow ever, the huge variability of LAB and also other m icroorganisms require a m ore d etailed assessm ent of safety. Due to the apparent need to d evelop a tool for setting priorities associated w ith the risk of using these bacteria in food or feed prod uction, EFSA has been consid ering how best to cond uct a form al assessm ent of safety. Thus, a system w as proposed for a prem arket safety assessm ent of selected grou ps of m icroorganism s lead ing to granting a Qualified Presum ption of Safety (QPS). Therefore, EFSA proposed that a safety assessm ent of a d efined taxonom ic group, such as a genus or group of related species could be m ad e based on establishing id entity, bod y of

25

know led ge, possible pathogenicity and end use (European Com mission 2007). Thus EFSA has stated (2007) that tod ay a total of 33 Lactobacillus species can be consid ered to have QPS-status (European Com mission 2007); these species are show n in Table 2.

Table 2. Lactobacillus species with QPS- status according to EFSA.

Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus acidophilus amylolyticus amylovorus alimentarius aviaries brevis buchneri casei crispatus curvatus delbrueckii Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus farciminis fermentum gallinarum gasseri helveticus hilgardii johnsonii kefiranofaciens kefiri mucosae panis Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus paracasei paraplantarum pentosus plantarum pontis reuteri rhamnosus sakei salivarius sanfranciscensis zeae

In ad d ition to Lactobacillus species, also other LAB species have been granted QPS status. They includ e three leuconostocs, (Ln. citreum, Ln. lactis and Ln. mesenteroides), three ped iococci (P. acidilactici, P. dextrinicus and P. pentosaceus), Lc. lactis and Streptococcus thermophilus (European Com m ission 2007). One of the difficulties in the QPS approach is the difficulty to apply a strain-to-strain approach to und efined microbial cultures, as are found in many ferm ented food s, such as trad itional d ried sausages and cheeses; w here the ferm entation is based on the use of these und efined cultures and / or backslopping (Rossetti et al. 2009). Since systematic investigation s have rarely been und ertaken, there is no convincing bod y of know led ge available for a given microorganism . Nonetheless, in m any instances there exists a long and d ocum ented history of safe use of LAB in food s. Som e LAB have also been associated w ith d isease, although this occurs in very rare cases, w here they can cause opportunistic in fections in people w ith severe und erlying illnesses. LAB have been isolated from end ocard itis, bacterem ia, blood stream and local infections (Ishibashi and Yam azaki 2001, Cannon et al. 2005). In most cases, the infective bacterium has been show n to be of host origin. H ow ever, there are a few cases w here the infection has also been associated w ith the consum ption of probiotics. One of the m ost im portant safety aspects of LAB is their resistance tow ard s antim icrobial d rugs that m ight be transferred to other, possib ly pathogenic, bacterial species, see chapter 2.3.3, H orizontal transferability of antibiotic resistance in the food chain.

26

2.3

ANTIBIOTIC RESISTANCE OF LAB

Stud ies of antibiotic resistance of LAB have not been extensivelly investigated until recently, in contrast to the situation w ith pathogenic species and their antibiotic resistance. H ow ever, interest in LAB and their antibiotic resistances has recently gained strength since the resistant d eterm inants are know n to be able to be transferred betw een bacterial species, also from beneficial bacteria to pathogens (see below ).

2.3.1 Phenot y pic ant ibiot ic resist ance of LAB The first step in characterizing LAB species as being either susceptible or resistant to antibiotics is to d eterm ine the susceptible/ resistant patterns w ith phenotypic m ethod s. This is easier said than d one, d ue to the various m ethod s available. These includ e factors like size of the inocula and incubation tim e (Egervrn et al. 2007), different test m ethod s (broth versus agar applications), includ ing microd ilution (Kushiro et al. 2009), Etest (Danielsen and Wind 2003), agar d ilution (Florez et al. 2005) and d isc d iffusion (Gevers et al. 2000). Moreover, d ifferent grow th m ed ia have been used for actual testing, includ ing Iso Sensitest, MRS, M17 and Mller-H inton (H uys et al. 2002, H um m el et al. 2007). In the stud y of Klare and co-w orkers (2005), a new grow th m ed ium, LSM (LAB susceptibility test med ium) w as d eveloped particularly to support the grow th of Lactobacillus, Lactococcus, Pediococcus and Bifidobacteria but w hich w ould not have any antagonistic interactions betw een com ponents of the m ed ium and specific antim icrobial agents (Klare et al. 2005). Subsequently, several stud ies on phenotypic antibiotic resistance of LAB have been conducted using LSM broth and agar (Klare et al. 2007, Devirgiliis et al. 2008, H uys et al. 2008, Devirgiliis et al. 2009, H aakensen et al. 2009, Kushiro et al. 2009) assisting in the com parison of results obtained in different laboratories and on the other hand easing the d eterm ination of com parable MICs and the safety evalu ation. The European Food Safety Authority has recently (European Com m ission 2008) upd ated the microbiological breakpoints that categorize the LAB as either resistant or susceptible, see Table 3. The major difference to the previous m icrobiological breakpoints given by EFSA (European Com mission 2005) is that the categories have been d ivid ed m ore specifically according to species. This m eans that the correct taxonom ical id entification is even m ore crucial, but on the other hand it d oes provid e tools for assessing m ore precise MIC values of the LAB species und er stud y. When an adequate num ber of strains of a particular species have been stud ied (in the ACE-ART project this w as set as 50 strains) and the MIC values d eterm ined , the m icrobiological breakpoints (or epid emiological cut-off values) can be estim ated . In som e cases, how ever, the d istribution of MIC values is not bell-shaped and the MIC d istributions cover more than optimal five dilutions. This causes uncertainties w ith the proposed cut-off values, and thus one has to apply the cut-off value only as a conservative estim ation.

27

Table 3. Microbiological breakpoints for selected LAB (European Commission. 2008).

Q+D AMP VAN GEN KAN STR ERY CLI TET CHL Lb. oblig. homoferm. 1 2 16 16 16 1 1 4 4 4 Lb. helveticus 1 2 16 16 16 1 1 4 4 4 Lb. acidoph./delb. 1 2 16 16 16 1 1 4 4 4 Lb. oblig. heteroferm. 2 n.r. 16 16 64 1 1 4 8 4 Lb. reuteri 2 n.r. 8 16 64 1 1 4 16 4 Lb. fermentum 1 n.r. 16 32 64 1 1 4 8 4 Lb. facult. heteroferm. 4 n.r. 16 64 64 1 1 4 8 4 Lb. plantarum 2 n.r. 16 64 n.r. 1 1 4 32 8 Lb. rhamnosus 4 n.r. 16 64 32 1 1 4 8 4 Lb. paracasei 2 n.r. 32 64 n.r. 1 1 4 4 4 Enterococcus 4 4 32 512 128 4 4 4 8 8 Pediococcus 4 n.r. 16 64 64 1 1 4 2 4 Leuconostoc 2 n.r. 16 16 64 1 1 4 8 4 Lc. lactis 2 4 32 64 64 2 4 4 8 8 AMP: ampicillin; VAN: vancomycin; GEN: gentamicin; KAN: kanamycin; STR; streptomycin; ERY: erythromycin; CLI: clindamycin; Q+D: Quinupristin + dalfopristin; TET: tetracycline; CHL: chloramphenicol; n.r., not required.

Species/group

The Lactobacillus species have been found susceptible to m any cell w all synthesis inhibitors, like penicillins and am picillin (Danielsen and Wind 2003, Coppola et al. 2005), in contrast to glycopeptides such as vancom ycin, m ost Lactobacillus species, exclud ing obligate heteroferm entative species, have been found to be resistant to these types of antibiotics. H ow ever, the resistance tow ard s vancom ycin has been d em onstrated being as intrinsic (Tynkkynen et al. 1998) and should not be com pared w ith transm issible, plasm id -med iated resistance found in enterococci (Leclercq et al. 1992). Lactobacillus species are usually susceptible to chloram phenicol, erythrom ycin and clind am ycin, antibiotics that inhibit protein synthesis, (Coppola et al. 2005, Klare et al. 2007). In ad d ition, resistance against inhibitors of nucleic acid synthesis, such as trim ethoprim , seem s to be intrinsic, although further characterizations are required on this topic (Am m or et al. 2007). Resistance to tetracycline has been observed m ore often am ong Lactobacillus species, and it has been show n to have a w id e range of MICs (Korhonen et al. 2008), also w ith a m ultim od al distribution of MICs, probably d ue to the extensive variability of tetracycline resistance m echanisms conferring d iverse levels of susceptibility (Roberts 2005). Especially w ith tetracycline, m olecular m ethod s should be applied in ord er to revea l the nature of resistance, i.e. is it d ue to intrinsic m echanisms, m utation or ad d ed , mobile genes. Resistance against am inoglycosid es, such as neom ycin, kana m ycin, streptom ycin and gentam icin has been observed m ore frequently am ong lactobacilli (Danielsen and Wind 2003, Coppola et al. 2005, Zhou et al. 2005). The m ed ium of choice has been d em onstrated to significantly affect to the classification of LAB as being either susceptible or resistant (H uys et al. 2002), especially w ith am inoglycosid es and MRS m ed ium .

28

2.3.2 Genot y pic antibiot ic resist ance of LAB When a strain clearly d eviates from other strains of that particular species , as d eterm ined w ith phenotypic m ethod s, the antibiotic resistance need s to be further stud ied w ith genotypic m ethod s. The potentially transferable genes in LAB have been d escribed in m ultiple stud ies and have been review ed in Am m or et al. 2007. Tw o of the m ost com m only observed resistance genes in LAB found so far are tet(M) for tetracycline resistance and erm(B) for erythrom ycin, follow ed w ith cat genes cod ing for chloram phenicol resistance (Lin et al. 1996, Danielsen 2002, Gevers et al. 2003, Cataloluk and Gogebakan 2004).

2.3.3 Horiz ont al t ransferabilit y of ant ibiot ic resist ance from LAB in t he food chain H orizontal transfer of genetic m aterial m ay happen via three d ifferent mechanisms: transd uction, transformation or conjugation. In transd uction, the DN A is transferred from one bacterium to another via bacteriophages. The im portance of bacteriophages in d isseminating antibiotic d eterminants is, how ever, questionable, because the phages are often highly species -specific. In transform ation, the DN A is released from a bacterium and taken up by another. Sim ilar to the situation w ith transd uction, transform ation is not believed to be a very im portant m echanism of transfer of antibiotic resistance (Am m or et al. 2007). In contrast, conjugation, i.e. the d irect cell-to-cell contact, potentially can achieve horizontal gene transfer, as it has been show n to be a m echanism of transfer of genetic inform ation w ith a broad host range (Courvalin 1994). The possible transfer of antibiotic resistance genes betw een bacterial species have been stud ied m ostly in harm ful or pathogenic species , but also recently w ith LAB. The vast m ajority of the experim ents have been mad e in vitro, using m ethod s such as filter-m ating (Gevers et al. 2003, Klare et al. 2007, Ouoba et al. 2008), although these in vitro m ethod s d o not m imic the circum stances in nature, and results obtained cannot be com pared w ith the results achieved or expected using in vivo m ethod s. The transferability of antibiotic resistance genes in the gastrointestinal tract (GIT) from LAB is not straightforw ard , since the GIT is a hostile environm ent to m any allochthonous bacteria. Moreover, stud ies m ad e in vivo usually are based on w orst-case scenario, sim ulating very high d aily intake of food prod ucts containing the resistant bacteria (Jacobsen et al. 2007). One w ell-characterized resistance gene in LAB, originally d etected in Enterococcus faecalis is the broad -host range plasm id pAM1, w hich has been transferred from Streptococcus lactis (Lactococcus lactis at present) to Lb. reuteri and betw een lactobacilli (Tannock 1987), and also from Lc. lactis to Enterococccus and Lactobacillus species (both in vitro and in vivo in the m ouse gastrointestinal tract) (Morelli et al. 1988, Gruzza et al. 1993, Igim i et al. 1996). In the recent stud y of Devirgiliis et al. (2009), tetracycline-resistant Lb. paracasei strains w ere

29

id entified in sam ples of m ilk and natural w hey starter cultures . A transposon Tn916 includ ing tet(M) w as transferred to E. faecalis strain JH 2-2 in mating experim ents, but only at a low conjugation frequency (Devirgiliis et al. 2009). Recently, experim ents of antibiotic resistance transferability in vivo w ere also cond ucted from Lb. plantarum to E. faecalis (Jacobsen et al. 2007). The transfer frequencies have been observed to increase w hen the anim als have received the antibiotic in question at subtherapeutic levels (Igim i et al. 1996, Salyers and Shoem aker 1996, Licht et al. 2003) in their d rinking w ater or feed , suggesting that increasing the antibiotic pressure can amplify the transfer of antibiotic resistance betw een bacterial species. All of these above stud ies ind icate that antibiotic resistant factors m ay be transferred from food related bacterium species to other, potentially pathogenic species, such as enterococci. Another interesting point of view is that intestinal bacteria m ight also interact w ith bacteria that are just passing through the colon (comm ensal bacteria), allow ing these bacteria to acquire and transm it antibiotic resistance genes (Salyers et al. 2004).

30

3. Aims of t he st udy
The m ain objective of th is thesis w as to ad d ress the antim icrobial resistance patterns of LAB. The w ork started w ith the isolation and characterization of LAB from anim al and hum an origins, and continued w ith the a ccurate species id entification follow ed by the d eterm ination of antim icrobial susceptibility profiles of antim icrobial substances from different classes. H orizontal transferability of antibiotic resistance gene tet(S) cod ing for tetracycline w as also exam ined betw een Lactococcus and Listeria species. The specific aim s of the ind ivid ual stud ies w ere: To isolate, id entify and define the distribution of the Lactobacillus species in w eaning piglets (I); To d eterm ine the susceptibility phenotype to antibiotics in lactobacilli species isolated from piglet faecal sam ples (I); To isolate, identify and d efine the d istribution of LAB species in young calves (II); To d eterm ine the susceptibility phenotype to antibiotics in LAB isolated from calf faecal sam ples (II); To d eterm ine the MICs of Lactobacillus rhamnosus strains m ostly from hum an and food isolates and to stud y the prevalence of antimicrobial resistance genes w ith m icroarray analysis (III); To sum m arize phenotypic d ata of antimicrobial resistances and to d evise tentative m icrobiological cut-off values for fourteen Lactobacillus species (IV); To stud y the transfer of plasm id d erived antibiotic resistance to tetracycline from Lactococcus garvieae to Listeria monocytogenes (V).

31

4. Mat erials and met hods

4.1 BIOLOGICAL ORIGINS OF LAB STRAINS (I-V)

The biological origins of LAB strains used in the antibiotic susceptibility tests in stud ies I-IV are show n in Table 4.
Table 4. Biological origins of the LAB species.

Number of strains Biological origin Study I Animals Pig Calf Poultry Other Humans Food Dairy Meat Plant Other Other/unknown Total 129 104 2 6 75 38 675 57 9 129 104 1 18 29 148 220 66 111 Study II Study III Study IV 45

The biological origins of the strains used in stud y V w ere: intestinal sam ple of salmonid fish (Oncorhynchus mykiss), Lc. lactis ssp. lactis strain KYA7; kid ney of yellow tail, (Seriola lalandi), Lc. lactis ssp. garvieae strain DSMZ 6783; hum an, Listeria monocytogenes strain ATCC 7644; w ater in aquaculture, Listeria monocytogenes strains LMK8 and LMK16.

32

4.2 ISOLATION AND IDENTIFICATION OF LAB (I-IV)

The LAB isolates w ere id entified w ith conventional, cu lture based m ethod s (m orphology and sugar ferm entation profiles) and further w ith m olecular biology based m ethod s (16S rDN A based PCR, species-specific PCR, RAPD). 4.2.1 Sampling and cult uring of LAB from faecal samples (I-III) Fresh faecal sam ples w ere collected from piglets, calves and hum an volunteers and stored refrigerated until analysis (Stud ies I, II and III, respectively). The piglet faecal sam ples (n=78) w ere received from MTT (Agrifood Research Finland), H yvink, Finland and the calf faecal sam ples (n= 36) w ere collected from the area of N orthern Savo, Finland . Som e of the hum an sam ples (n = 19, total n = 75) w ere from ad ult volunteers living in Kuopio, Finland , w hile other hum an sam ples had been gathered in earlier stud ies. The fresh sam ples w ere -8 serially d iluted in 0.1% peptone saline suspension to a final d ilution of 10 . Appropriate d ilutions w ere then plated onto MRS and/ or LAMVAB (H artemink et al. 1997) agar plates and incubated anaerobically at 37C for 48 h. 4.2.2 Ident ificat ion w it h biochemical met hods (I-III) The isolated LAB w ere selected from the MRS plates on the basis of their m orphology, gram -staining and sugar ferm entation profiling, using com m ercial API CH L (Lactobacillus species) and API Strep (Lactococcus and Streptococcus species) kits w ith APIWEB d atabase, bioMerieux SA, France. 4.2.3 Ident ificat ion w it h molecular biology met hods (I-III, V) Biochemically id entified LAB isolates w ere further character ized w ith m olecular biology m ethod s. The DNAs from the pure isolates w ere extracted using lysozym e, proteinase K, chloroform extraction and ethanol precipitation. The DN A w as used as a tem plate for partial 16S rDN A sequencing targeting for a 676-bp fragm ent of the 16S rDN A gene (stud ies (I-II). The prim ers used w ere 9f (5GAGTTTGATCCTGGCTCAGGA3) (Chagnaud et al. 2001) and 685r (5TCTACGCATTTCACCGCTAC3) (E. coli num bering system). The purified am plification prod ucts w ere subjected to sequencing, and the results achieved com pared w ith the EMBL nucleotide d atabase using the BLAST d atabase sequence search engine. With Lb. rhamnosus strains (III), a partial 16S rDN A sequence (fragm ent size 863 bp) w as applied in verifying the species as Lb. rhamnosus. In stud y II, species-specific PCR m ethod s w ere used for Lb. rhamnosus (Aland er et al. 1999) (used also in stud y III), Lb. brevis (Guarneri et al. 2001), Lb. curvatus (Lee et al. 2004), Lb. farciminis (Rachm an et al. 2003), and Lb. plantarum group, namely Lb. pentosus, Lb. plantarum, and Lb. paraplantarum (m ultiplexPCR, Torriani et al. 2001). In stud y V, total genom ic DN A from Lactococcus and Listeria strains w as extracted using the N ucleoSpin Tissue kit (Macherey -N agel, Germ any) and the plasmid DN A using the Wizard Plus SV Minipreps DN A Purification System

33

kit (Prom ega, Madison, U.S.A.) enhanced w ith the lysozym e technique. For Southern hybrid ization, prim ers tetS-FW (5GGAGTACAGTCACAAACTCG3) and tetS-RW (5GGATATAAGGAGCAACTTTG3) targeting for a PCR prod uct of 335 bp in size w ere u sed .

4.2.4 LAB st rain charact eriz at ion (I-II) The LAB isolates of piglet and calf origin w ere further analyzed w ith RAPD m ethod using prim er P1 (5ACGCGCCCT3) in ord er to d ifferentiate the strains and to avoid d uplicates of isolates w ithin a certain species in the antim icrobial susceptibility tests. The RAPD fingerprints w ere analyzed using the GELCOMPAR II softw are from Applied Maths, Belgium .

4.3 MICROARRAY ASSAY FOR LB. RHAMNOSUS (III)

L. rhamnosus strains w ere stud ied w ith the microarray m ethod in order to id entify the potential erythrom ycin, streptom ycin and tetracycline resistance genes in m ore d etail. Genes cod ing for chloramphenicol resistance w ere also includ ed in the m icroarray (not tested by phenotypic m ethod s). The antibiotic resistance genes represented on the oligonucleotid es m icroarray are given below (also presented in Mtt et al. 2007 and van H oek and Aarts 2008b). Am inoglycosid e resistance genes: aac(3)-Ia; aac(3)-Ib; aac(3)-IIa; aac(3)IIIb; aac(3)-IIIc; aac(3)-V II; aac(6' )-aph(2' ); aac(6' )-Ib; aac(6' )-Il; aac(6' )-Iq; aac(6' )-Iy; aac(6)-II; aac(6)-IIb; aac(6)-IIc; aacA 1; aacA 4; aacA 5; aacA 7; aacC1; aacC2; aacC3; aacC9; aadA 1; aadA 2; aadA 6; aadA 10; aadA 11; aadA 13; aadB; aadD; aadE; aph(2' )-Ib; aph(2' )-Ic; aph(2' )-Id; aph(3' )-Id; aph(3' )-IIa; aphA 1; aphA 1-IA B; aphA 2; aphA 3; aphA 6; aphA 7; aphE; nptII; sat2; sat3; sat4; strA; strB. -lactam resistance genes (for exam ple blaACC-01_03 m eans that blaACC-01, blaACC-02 and blaACC-03 are represented on the m icroarray): blaACC-01_03; blaACT; blaCARB-04_09; blaCMY-01,09_11,19; blaCTX-M-01 group; blaCTX-M-02 group; blaCTX-M-09 group; 01,02 blaDH A-01_02; blaFOX; blaIMP; blaKPC; blaMIR; blaMOR; blaMOX-01; blaOXA; blaPER-01_03; blaPSE-01; blaROB-01; blaTEM ; blaVIM-01_11,14; blaZEG01_07,10,13_17,19_35,37,40,47_49,56,72_74,101,102 . 01 Chloram phenicol resistance genes: cat; cat(pC194); cat-TC; catII; catIII; catA 1; catA 3; catB; catB2; catB3; catB6; catB8; catB9; catD; catP; catQ; cmlA ; cmlA 1; cmlA 4; cmlA 5; cmlA 6; cmlA 7; cmlB; floR. Macrolid es lincosamid e and streptogram in resistance genes: ere(A); ere(A2); ere(B); erm(A); erm(B); erm(C); erm(D); erm(F); erm(FS); erm(FU); erm(G;) erm(GM); erm(GT); erm(J); erm(K); erm(Q); erm(T); mef(A); mef(E);

34

mph(A); mph(BM); mph(C); mph(K); msr(A); msr(B); msr(SA); sat(A); sat(G); vat; vat(A); vat(B); vat(C); vat(D); vat(E); vat(E3_E8); vga; vga(A); vga(A)LC; vgb; vgb(B). Sulfonamid e resistance genes: sul1; sul2; sulA . Tetracycline resistance genes: otr(A); otr(B); tet(30); tet(31); tet(32); tet(33); tet(34); tet(35); tet(36); tet(37); tet(A); tet(A(P)); tet(B); tet(B(P)); tet(C); tet(D); tet(E); tet(G); tet(H ); tet(J); tet(K); tet(L); tet(M); tet(O); tet(Q); tet(S); tet(T); tet(U); tet(V); tet(W); tet(X); tet(Y); tet(Z). Trim ethoprim resistance genes: dfrA ; dfrA 1; dfrA2; dfrA 3; dfrA 5; dfrA 6; dfrA 7; dfrA 8; dfrA 9; dfrA 10; dfrA 12; dfrA 14; dfrA 15; dfrA 16; dfrA 17; dfrA 19; dfrA 21; dfrA 22; dfrA 23; dfrB2; dfrB3; dfrC; dfrD. Vancom ycin resistance genes: vanA ; vanB; vanC1; vanC2/ C3; vanD; vanE.

4.4 PLASMID TRANSFORMATION AND MATING PROTOCOL OF LACTOCOCCUS SPECIES (V)

In stud y V, Lc. garvieae strain DSMZ 6783 w as used as a recipient in electroporation for plasm id located tet(S) gene d erived from L. lactis ssp. lactis strain KYA-7. Plasm id located tet(S) gene from Lc. lactis ssp. lactis KYA7 strain w as transform ed by electroporation to Lc. garvieae DSMZ 6783 by the m ethod d escribed in H olo and Nes 1989. Pure culture of strain DSMZ 6783 w as grow n on M17 m ed ium w ith 0.5 M sucrose and 1 % glycine, and w ashed tw ice w ith electroporation buffer. This suspension w as m ixed w ith purified plasm id DN A and exposed to an electrical pulse (Bio-Rad Laboratories, CA, USA). Transform ants (TF) w ere counted from tetracy cline selective (5 g/ m l) plates after incubation at 30 C for 72 h, and verified using species-specific prim ers (Pu et al. 2002). Furtherm ore, the ability of transform ed Lc. garvieae DSMZ 6783 (TF-) to transfer the tet(S) resistance gene w as exam ined by filter m ating. Recipients in these conjugation stud ies for tet(S) gene w ere Listeria monocytogenes strains ATCC 7644, LMK8 and LMK16. Overnight grow n bacterial cells w ere m ixed w ith a 1:10 ratio (d onor:recipient), collected on a filter, w ashed w ith 0,9 % saline suspension (2 m l) and incubated on BH I agar plate w ith 0,2 g/ m l of tetracycline at 37 C overnight. After incubation , serial d ilutions w ere m ad e on PALCAM Listeria selective agar w ith 10g/ m l of tetracycline and incubated at 37 C for 72 h. Transconjugants (TCs) w ere id entified by the API Listeria test (bioMerieux, SA, France).

35

4.5 ANTIMICROBIAL RESISTANCE DETERMINATIONS (I-IV)

Antim icrobial resistance d eterm inations w ere m ad e w ith three d ifferent m ethod s. In stud ies I and II, the d eterm inations w ere m ad e by agar d ilution , in stud y III by agar dilution, broth m icrod ilution and Etest, in stud y IV by broth m icrod ilution and Etest m ethod s and in stud y V by broth m icrod ilution . The m ed ium used w as LSM (Lactic acid bacteria susceptibility m ed ium , Klare et al. 2005), w hich has been especially d esigned to d etect antibiotic resistances in LAB, except for experim ents w ith Listeria monocytogenes (stud y V), w here the cation adjusted Mller-H inton (CAMBH , Difco) w as used . Antibiotics used in stud ies I-IV are listed in Table 5.

Table 5. Antimicrobial agents for phenotypic susceptibility determination used in studies I - IV. Antibiotic Study I (Piglets)
9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9

Study II (Calves)
9 9 9 9 9 9 9 9 9 9

Study III (Lb. rhamnosus)

9 9 9 9 9 9

Study IV (Lactobacillus ssp.)

9 9 9 9 9 9

Ampicillin Clindamycin Erythromycin Gentamicin Streptomycin Tetracycline Chloramphenicol Kanamycin Trimethoprim Vancomycin Ciprofloxacin Amoxicillin Enrofloxacin Lincomycin Neomycin Penicillin Tylosin

4.5.1 Agar dilut ion met hod (I-III) Single pure colonies were suspended in sterile 0.9 % saline and the density was adjusted with spectrophotometry to an OD625 of 0.16 0.20, which is estimated to correspond to McFarland standard 1 or 3 108 CFU/ml. Subsequently, 1 l aliquots of bacterial suspensions were spotted onto the LSM agar along with the antibiotics. The appropriate dilutions (see table 6, Ericsson and Sherris 1971) of the antibiotic solutions were prepared in a twofold series in LSM agar and plates were used within a week of their preparation to avoid any loss of antibiotic activity. With certain antibiotics, solvents (methanol, ethanol, DMSO or NaOH) were used to dilute the substances. The

36

effect of solvent agents was controlled in susceptibility tests. The growth of the bacteria was compared to the growth on LSM plates without any antibiotic agent. The LSM plates were then allowed to dry for 15 30 min and incubated in anaerobic atmosphere at 37 C for 24 and 48 hours.
Table 6. Antibiotic dilution procedure. Modified from Ericsson and Sherris, 1971.
Step Concentration (g/ml) 5120 5120 5120 1280 1280 1280 160 160 160 20 20 20 2,5 Source Vol. (ml) 2 1 2 1 1 2 1 1 2 1 1 2 Dist. H2O (ml) 2 3 2 3 7 2 3 7 2 3 7 2 Intermediate concentration (g/ml) 5120 2560 1280 640 320 160 80 40 20 10 5 2,5 1,25 Final concentration (g/ml) 512 256 128 64 32 16 8 4 2 1 0,5 0,25 0,125

1 2 3 4 5 6 7 8 9 10 11 12 13

stock step1 step 1 step 3 step 3 step 3 step 6 step 6 step 6 step 9 step 9 step 9 step 12

4.5.2 Brot h microdilut ion met hod (III-V) The bacterial cell suspension d escribed in the agar d ilution m ethod w as diluted 5 1:1000 to obtain a concentration of 3 10 CFU/ m l. An aliquot of 100 l of the inoculum s w as ad d ed to each w ell of tailor-m ad e VetMIC ACE-ART m icrod ilution plates (National Veterinary Institute, Uppsala, Sw ed en). The m icrod ilution plates contained the follow ing six antibiotics: tetracycline (0.5128 g/ m l), erythromycin (0.12-16 g/ ml), streptom ycin (2-256 g/ m l), gentam icin (0.5-32 g/ m l), clind am ycin (0.12-8 g/ m l) and am picillin (0.12-8 g/ m l) in tw ofold d ilutions. The 96-w ell plates w ere incubated as d escribed in the agar dilution m ethod , except for the Lactococcus species and L. monocytogenes (stud y V), w hich w ere incubated aerobically at 30 C or 37 C for 24 h, respectively.

4.5.3 Et est met hod (III-IV) The sam e bacterial cell suspension d ensity as in agar d ilution m ethod (3 10 8 CFU/ ml) w as used in Etests (Ab Biom erieux, Solna, Sw ed en). A sterile cotton sw ab w as d ipped in the inoculum and sw abbed using a plate turntable or by sw abbing the surface of agar in three d irections. The LSM plates w ith bacteria w ere allow ed to d ry, after w hich the Etest strip w as applied . All strips had a concentration range 0.016 -256 g/ m l. The plates w ere incubated as d escribed for the agar d ilution m ethod .

37

5. Result s and discussion

5.1 SPECIES DISTRIBUTION AMONG THE FAECAL SAMPLES OF PIGLETS AND CALVES (I-II)

From the 129 isolates of piglet origin (Stud y I), 67 isolates w ere chosen for further stud y based on their API-profiles and partial 16S rDNA sequencing. Accord ing to 16S rDN A sequence, the m ajor Lactobacillus groups in piglets w ere Lb. reuteri (n = 45), Lb. salivarius (n = 15) and Lb. acidophilus (n = 7). In piglets, Lb. reuteri has been found as a com m on Lactobacillus species in colonizing intestine also in previous stud ies (Axelsson and Lind gren 1987, Leser 2002). H ow ever, the role of this bacterium species has rem ained d ebatable, and the clarification of its possible ad hesive or probiotic properties d em and s further stud y. Interestingly, Lb. salivarius is rarely d etected in the faeces of ad ult pigs, so this bacterium species might have an age-d epend ent occurrence, as also suggested in som e hum an stud ies (H eilig et al. 2002). A sim ilar d istribution of Lactobacillus species has been reported from d ifferent geographical locations (Japan, United Kingd om and Finland ) and w ith d ifferent breed s of piglets, so these factors apparently have no m ajor effect on the Lactobacillus species com position in piglet faecal sam ples (Tannock et al. 1990, N aito et al. 1995, Korhonen et al. 2007). In faecal sam ples of calves (Stud y II), the LAB species distribution w as found to be considerably larger (Figure 3). On average, the num ber of colony 6 form ing units (CFU) in calf faecal sam ples w as 2.5 7.6 10 CFU/ g. The am ounts of total Lactobacillus populations have been show n to vary rem arkably d epend ing on the age of the anim al (Karney et al. 1986, Agarw al et al. 2002). In ad d ition to Lactobacillus species, the other species found in calf faecal sam ples w ere W eissella ssp. (n = 15), Streptococcus bovis/infantarius (n = 13), Enterococcus ssp. (n = 13), Lactococcus lactis ssp. cremoris (n = 2), Lactococcus garvieae (n = 1), Pediococcus pentosaceus (n = 2) and Leuconostoc mesenteroides (n = 1). A novel finding in our stud y w ith calves w as the identification of W eissella ssp (n = 15), w hich w ere present in ten sam ples. As far as w e are aw are, this is the first stud y d em onstrating this LAB genus to be present in faecal sam ples of calves. In ad d ition to w eissellas, another interesting find ing w as the id entification of a single Lc. garvieae isolate, since this bacterium species has been associated w ith m astitis in cow s (Devriese 1999), although in relatively rare cases.

38

30 25 20 15 10 5 0

28
15 8 7 4

2
Lb. casei

Lb. reuteri

Lb. plantarum

Lb. buchneri

Lb. salivarius Lb. acidophilus

Figure 3. The Lactobacillus species distribution of calf faecal samples.

5.2 RAPD FINGERPRINTS OF PIGLET AND CALF ISOLATES (I-II)

In piglets, the Lactobacillus isolates (n = 67) w ere grouped into eight m ajor clusters (Figure 4, next page). All the isolates id entified as Lb. reuteri w ere in four clusters and no other species w ere d etected in these clusters. The only Lb. vaginalis isolate, w hich belongs to the Lb. reuteri group , d id not cluster w ith Lb. reuteri isolates, but w ith Lb. johnsonii group. Lb. reuteri and Lb. salivarius isolates w ere clearly d istinct from each other in the RAPD-PCR used in the piglet stud y. In calves, the LAB isolates (n = 104) w ere also stud ied w ith RAPD -PCR, but no clear clusters could be created accord ing to the species. H ow ever, the RAPD-PCR w as found to be useful in distinguishing the bacterial strains from each other. In figures 5a-e, the LAB isolates are d ivid ed in to six d ifferent analyses based on their m orphology, sugar ferm entation pathw ays and 16S rDN A analysis. The strain characterization is crucial in antimicrobial susceptibility d eterminations; hence the use of d uplicate isolates could skew the susceptibility d ata.

39

Figure 4. RAPD-PCR profiles of Lactobacillus group bacteria from piglets. (A) Lb. agilis, (G) Lb. gallinarum, (J) Lb. johnsonii, (M) Lb. mucosae, (R) Lb. reuteri, (S) Lb. salivarius and (V) Lb. vaginalis; (P) Lactobacillus isolate number.

40

Figure 5a. Cluster analysis of RAPD patterns of obligately heterofermentative Lactobacillus species.

41

Figure 5b. Cluster analysis of RAPD patterns of facultatively heterofermentative Lactobacillus species.

The obligately heteroferm entative Lactobacillus species (Fig. 5a) w ere clustered accord ing to species, w ith the exception of one Lb. mucosae strain. With respect to the closely related Lb. plantarum and Lb. pentosus (Fig 6b), RAPD-PCR w as also show n to be d iscrim inatory, although only tw o Lb. pentosus strains w ere used . To verify the d iscrim inatory pow er for Lb. plantarum and Lb. pentosus, m ore strains need to be tested w ith this m ethod .

Figure 5c. Cluster analysis of RAPD patterns of homofermentative Lactobacillus species.

42

Figure 5d. Cluster analysis of RAPD patterns of Weissella ssp. species.

Figure 5e. Cluster analysis of RAPD patterns of cocciform species.

43

5.3 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LACTOBACILLUS SPECIES OF PIGLET ORIGIN (I)

The d istribution of the m inim um inhibitory concentrations (MICs) is show n in Figure 6a-k.

a
50 40 30 20 10 0 <0.5 3

vancomycin
45

b
50 40 30 15 4 20 10 0 7 12 12

trimethoprim

12 1

5 1 16 - 32

11 >128

0.5 - 1

1-2

2-4

4-8

8 - 16

> 16

<4

4-8

8 - 16

32 - 64 64 - 128

concentration (g/ml)

concentration (g/ml)

c
50 40 30 20 10 0 <0.5 5 1 6

ciprofloxacin*

d
50 40 24 30 20 12 6 45

erythromycin

17

112 1-2 2-4

1 4-8

2 1 8 - 16

2 > 16

10 0

2 1 <0.5 0.5 - 1 1-2 2-4 4-8 8 - 16

1 > 16

0.5 - 1

concentration (g/ml)

concentration (g/ml)

e
50 40 30 20 10 0 <2 2-4 4 12 3

tetracycline

f
50 40

chloramphenicol
42

25

30 20 12 1 <2 3 1 4-8

11 11 4-8 1 8 - 16 3 3 4 1 1 32 - 64 33

10 0

4 2 2 8 - 16 16 - 32 32 - 64 >64

16 - 32

>64

2-4

concentration (g/ml)

concentration (g/ml)

44

g
50 40 30 20 10 0 <0.25 0.25 0.5 1 15 8 3 3 1

ampicillin

h
50 40 42

clindamycin

27

30 20 1 3 23 1-2 2-4 4-8 >8 10 0 12 2 13 <0.25 0.25 0.5 1 1 3 1 2-4 4-8 1 >8

0.5 - 1

0.5 - 1

1-2

concentration (g/ml)

concentration (g/ml)

i
50 40 30 20 10 0 <4 4-8

kanamycin

j
50 40 30 20

streptomycin

33

33

6 1 1 1 2 8 - 16 2 16 - 32 2

7 5

5 2 >128

9 10 0 4 <4 13 4-8 1

12 2 16 - 32 32 - 64 64 - 128 2 >128

32 - 64 64 - 128

8 - 16

concentration (g/ml)

concentration (g/ml)

k
50 40 30 20 10 0 <1 1-2 1 10

gentamycin
42

5 2 2-4 4-8 8 - 16 16 - 32 >32

concentration (g/ml)

Figure 6a-k. The distribution of MICs of Lactobacillus species according to groups. () Lb. reuteri group; () Lb. salivarius group; () Lb. acidophilus group; ( ) MICs for obligate homofermentative and heterofermentative Lactobacillus determined by FEEDAP (European Commission 2005); * MIC not determined by FEEDAP.

All the Lb. reuteri, Lb. salivarius and Lb. agilis isolates w ere highly resistant to vancom ycin (MIC >16 g/ m l), w hile both Lb. johnsonii and Lb. gallinarum w ere sensitive w ith MIC <0.5 g/ m l (Fig 6a). In all, 31 of the total 67 isolates w ere observed to be resistant to trim ethoprim (Fig. 6b) accord ing to FEEDAP (2005) breakpoint (8g/ ml). The tw o trim ethoprim -resistant Lb. acidophilus group bacteria w ere both Lb. johnsonii. With respect to ciprofloxacin (Fig 6c), MICs >16 g/ m l w ere d etected w ith Lb. reuteri, Lb. mucosae, Lb. johnsonii and Lb. gallinarum. The vast m ajority of the isolates w ere resistant to tetracycline (Fig.

45

6e), but w ere grouped in the vicinity of the FEEDAP (European Com m ission 2005) breakpoint (8 g/ m l). When am picillin and gentam icin w ere exam ined (Fig 6g and 6k, respectively), all the 67 isolates w ere found to be susceptible. Only sporad ic resistances w ere observed w ith erythrom ycin, clind amycin and streptom ycin (Fig 6d , 6h and 6j, respectively). A very high level of resistance w as typical of erythrom ycin and streptom ycin resistant isolates. In the Lb. salivarius group, m ost of the isolates (n = 13) w ere resistant to kanam ycin, w ith only tw o (P57 and P62) being susceptible (Fig 6i). The sam e tw o Lb. salivarius isolates w ere m ultiresistant, show ing sim ultaneous resistance to vancom ycin, streptom ycin, clind am ycin and tetracycline; P57 w as ad d itionally resistant to erythrom ycin and P62 to trim ethoprim and chloram phenicol. In conclusion, exceptional antibiotic resistances w ere rare am ong the isolates stud ied , and the vast m ajority of the MIC values w ere below the FEEDAP (European Com ission 2005) breakpoints. Based on these phenotypic tests, the situation of resistance/ susceptibility of lactobacilli from piglet faecal sam ples is relatively good . H ow ever, in ord er to scientifically guarantee the absence of acquired resistance genes m olecular tools should also be applied d ue to the d iscrepancies observed betw een phenotypic and genotypic test m ethod s (H um m el et al. 2007, van H oek et al. 2008c)
5.4 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LAB SPECIES OF CALF ORIGIN (II)

The MICs against d ifferent antibiotics tested are show n in Tables 7a-7d . All the strains had a MIC value 4 g/ ml for am oxicillin, w hile w ith penicillin and am picillin the highest MIC observed w as 8 g/ ml. As expected, the majority of the Lactobacillus strains w ere highly vancom ycin resistant, w ith the exception of all four Lb. johnsonii strains. One Lb. ruminis isolate (C216) w as highly susceptible to vancom ycin. All the W eissella ssp. species w ere vancom ycin resistant. On the other hand , cocciform bacteria w ere sensitive, w ith the exception of one Str. bovis/ infantarius (C112) and the only Ln. mesenteroides (C187) isolate (Table 7a). The highest MICs for am inoglycosid es w ere observed w ith kanam ycin. One strain of Str. bovis/infantarius (C118) and one strain of Enterococcus spp. (C113) w ere found to be highly resistant outliers from the other m em bers of the respective groups of bacteria (MIC 128 g/ ml for kanam ycin) (Table 7b). H igh resistances tow ard s erythrom ycin (MIC 64 g/ m l) and tylosin (MIC 256 g/ m l) w ere observed w ith one strain of Lb. farciminis (C234). Only one Str. bovis/infantarius (C112, MIC 64 g/ ml) and one Lc. garvieae (C176, MIC 128 g/ m l) isolate w ere found resistant to tetracycline (Table 7c). Clindam ycin resistances am ong the strains w ere rarely observed (Table 7d). The tw o clind am ycin resistant Lb. plantarum group strains w ere both Lb. farciminis (C257, MIC 8 g/ m l and C234, MIC 256 g/ m l). Other strains resistant to clind am ycin w ere P. pentosaceus (C110 and C228), Enterococcus ssp. (C223 and C225), and Lc. garvieae (C176).

46

With trim ethoprim (similar to the situation in feacal sam ples from piglets) and lincom ycin, the d eterm ination s of m eaningful MICs w ere im practical, d ue to the broad range of MICs. N o m ultiresistant (resistance to m ore than tw o antibiotics) strains w ere found accord ing to the m icrobiological breakpoints given by FEEDAP (European Com m ission 2008) in LAB from calves.

47

Table 7a. Distribution of MICs of penicillins and vancomycin from calf samples. n.g., not given; E., Enterococcus; Lc., Lactococcus; Ln., Leuconostoc; P., Pediococcus. Microbiological breakpoint for 1enterococci, 2lactococci, 3leuconostoc, and 4 pediococci, according to FEEDAP Panel (European Commission 2008). Strains with MICs higher than the breakpoints are considered resistant. Test agent Bacterial group FEEDAP breakpoint n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. 2 2 2 4 1 4 1 1 22,3, 41,4 n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. 2 n.g. 2 2 41,2, n.g.3,4 g/ml 0.125 0.25 0.5 1 2 4 8 16 32 64 128 256 4 1 5 1 14 12 10 8 10 10 2 1 2 3 5 1 1 1 6 4 2 1 1 2 1 1 1 6 5 3 2 1 1 1 1 2 1

Amoxicillin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

1 1 4 11 1 1 2 1 1 7 1 2 1 2 1 3 4 7 2 4 1 5

Ampicillin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

5 1 13 12 10 1

1 6 7 2 1 2 4 1 6 1 1 1

Penicillin C
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

2 3 12 12 8

2 1 1 1 1 26 15 8 6 2 15 1 1

Vancomycin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

1 1

9 1

2 2

1 6 2

48

Table 7b. Distribution of MICs of aminoglycosides from calf samples. n.g., not given; E., Enterococcus; Lc., Lactococcus; Ln., Leuconostoc; P., Pediococcus. Microbiological breakpoint for 1enterococci, 2lactococci, 3leuconostoc, and 4 pediococci, according to FEEDAP Panel (European Commission 2008). Strains with MICs higher than the breakpoints are considered resistant. Test agent Bacterial group FEEDAP breakpoint 8 16 16 16 16 16 4 4 163,4, 321,2 16 64 16 64 16 64 16 16 163, 642,4, 5121 n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. 64 n.g. 64 64 16 32 8 8 642,3,4, 1281
3 6 0.125 0.25 4 0.5 12 1 8 14 1 4 4 1 2 3 1 4 1 2 1 3 1 6 1 6 1 2 3 3 5 4 4 1 1 1 1 1 4 3 6 2 4 1 10 12 3 3 2 2 1 1 1 6 3 1 3 1 1 2 1 2 1 1 2 2 1 9 5 15 1 1 1 3 1 4 6 3 3 4 2 3 7 8 3 2 2 1 8 6 1 1 1 3 6 3 1 2 2 3 2 6 3 1 1 1 1 4 2 2 6 1 13 1 3 3 1 8 2 1 2 1 1 3 2 2 1 1 5 9 3 1 1 2 2 1

g/ml
4 1 8 16 32 64 128 256

Gentamicin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

Kanamycin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

Neomycin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

Streptomycin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

49

Table 7c. Distribution of MICs of chloramphenicol, tetracycline and macrolides from calf samples. n.g., not given; E., Enterococcus; Lc., Lactococcus; Ln., Leuconostoc; P., Pediococcus. Microbiological breakpoint for 1enterococci, 2lactococci, 3leuconostoc, and 4pediococci, according to FEEDAP Panel (European Commission 2008). Strains with MICs higher than the breakpoints are considered resistant. Test agent Bacterial group FEEDA P 4 8 4 4 4 4 2 2 43,4, 81,2 1 1 1 1 1 1 0.5 0.5 13,4, 16 32 8 8 4 8 2 2 2 1, n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g.
17 1 1 3 2 5 12 5 0.125 0.25 0.5 1 2 2 1 1 2 1 8 4 3

g/ml
4 19 14 8 6 2 1 6 1 7 8 7 16 32 64 128 256

Chloramphenicol
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 8) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

1 1 1

2 1

Erythromycin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)
11 13 7 5 1 9 3 1 1 1 1

1 1 1 1 2 2 1 2 2 2 8 1 4 1 1 1 10 1 1 3 1 8 1 1 8 12 5 1 1 1 5 1 5 1 1 1 1 1 4 14 11 5 3 1 4 1 1 5 2

22,

Tetracycline
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)

42,

8 9 1

4 1 9 1 2 2

Tylosin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)
1

1 2

1 11 1 4

50

Table 7d. Distribution of MICs of lincosamides, quinolone and sulphonamide from calf samples. n.g., not given; E., Enterococcus; Lc., Lactococcus; Ln., Leuconostoc; P., Pediococcus. Microbiological breakpoint for 1enterococci, 2lactococci, 3leuconostoc, and 4pediococci, according to FEEDAP Panel (European Commission 2008). Strains with MICs higher than the breakpoints are considered resistant. Test agent Bacterial group FEEDAP breakpoint 1 1 1 1 1 1 0.25 0.25 13,4, 41,2 n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g. n.g.
0.125 0.25 24 6 2 6 3 1 9 13 4 4 3 4 1 1 4 2 1 5 1 1 1 9 1 3 10 7 1 3 1 2 1 1 3 4 4 1 1 2 4 9 5 7 3 1 3 1 1 4 0.5 1 2

g/ml
4 8 16 32 64 128 256

Clindamycin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)
3 1 1 1 1 1 1

Enrofloxacin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)
1 1

4 13 9 1 1 2 4 1 1 2 3 5 3 1

8 2 1

1 3 2

Lincomycin
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)
1 1 1 1 3 1 2 4 1 2 2 4 2 2 1 1 2 1 1 1 5 2 2 1 1 1 8 2 3 2 1 1 1 1 1 8 3 1 1 5 1 4 3 1 1 1 1 2 4 1 1 6 1 1 1 2 1 6 2 1

2 1 7 7 2

Trimethoprim
Lb. reuteri (n = 28) Lb. plantarum (n = 15) Lb. buchneri (n = 8) Lb. salivarius (n = 7) Lb. acidophilus (n = 4) Lb. rhamnosus (n = 2) Weissella ssp. (n = 15) Str. bovis/infantarius (n = 13) E., Lc., Ln., and P. (n = 12)
2

51

5.5 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LACTOBACILLUS RHAMNOSUS AND PROPOSED MICROBIOLOGICAL CUT-OFF VALUES (III)

The results of the susceptibility tests are show n in Table 8. For all six antibiotics, histogram s of the corresp ond ing MIC d ata show ed a unim od al, bell-shaped curve, w ith a few clearly resistant outliers (resistant strains). The only exception w as tetracycline w ith Etest, w hich d isplayed a bim od al curve w ith intermed iate resistant strains (four strains w ith MIC 8 -16 g/ m l). Four m ulti-resistant strains (resistant to m ore than one antim icrobial substance) w ere also detected . Accord ing to the m icrobiological breakpoints given by FEEDAP panel (European Com m ission 2008), tw o of the strains w ere resistant to clind am ycin, erythrom ycin and streptom ycin (strains L0544 and L0545 from starter culture and feed , respectively), one strain to am picillin and tetracycline (L0543, probiotic strain) d eterm ined w ith all three m ethods, and one strain to streptom ycin and tetracycline (L0905 from hum an vagina) as d eterm ined w ith agar d ilution and broth m icrodilution m ethod s (intermed iate resistance w ith Etest).
Table 8. Distribution of MICs and proposed microbiological cutoff values. Test ranges are shaded in grey. Strains with MICs higher than the cutoff values are considered as resistant, the MICs of the wild type population are the indicated value. Resistant strains according to FEEDAP breakpoints (European Commission 2008) in bold. AD: agar dilution; BMD: broth microdilution. a 32 g/ml.
Test range (g/ml) 0.125 0.25 0.5 1 2 4 8 16 32 64 128 256 Proposed cutoff (g/ml)

Test agent

Method

Ampicillin

Clindamycin

Erythromycin

Gentamicin

Streptomycin

Tetracycline

AD BMD Etest AD BMD Etest AD BMD Etest AD BMD Etest AD BMD Etest AD BMD Etest

1 1 32 2 18 73 59 71 1 41 1 32 12 2 3 3 28 22 2

32 46 33 42 1

37 22 35

3 2 2

2 2 2 2 2 2a 2a 2

2 1 1

5 23 8 7 15 22 63

56 40 50 41 19 43 5

12 8 16 18 30 9

3 5 15 4 4 4 4 1 4 1 1 1

7 3

1 44

47 2 26

8 8 4 0.25 1 1 0.125 0.5 0.25 8 16 8 16 32 16 2 4 1

The m icroarray screening d id not d etect resistance d eterm inants for erythrom ycin, streptomycin and tetracycline am ong the phenotypically resistant strains. It is possible that the responsible genes w ere missing on the m icroarray, although over 70 antibiotic resistance genes w ere represented . This highlights the need to includ e both phen otypic and m olecular biology m ethod s

52

in the safety evaluation of antibiotic resistances in bacteria intend ed for hum an consumption.
5.6 ANTIMICROBIAL SUSCEPTIBILITY PROFILES OF LACTOBACILLUS SPECIES AND PROPOSED MICROBIOLOGICAL CUT-OFF VALUES (IV)

The d istribution of MIC for am picillin, tetracycline, erythrom ycin, clind amycin, streptom ycin and gentam icin are show n in Tables 9a-f.
Table 9a. Distribution of MICs for ampicillin. Fields shaded in grey indicate range of MICs tested for each antibiotic. MICs above the range are given as the concentration closest to the range. MICs below the range are given as the lowest concentration. Lb. paracasei includes one Lb. casei strain. Number of strains tested in parentheses. MDIL: Broth microdilution. a 32 g/ml.
Distribution of MICs (g/ml) with ampicillin Species (total n) L. acidophilus (11) L. amylovorus (31) L. crispatus (7) L. delbrueckii (44) L. gallinarum (8) L. gasseri (36) L. helveticus (27) L. johnsonii (26) L. fermentum (21) L. reuteri (56) L. reuteri (56) L. paracasei (66) L. paracasei (66) L. rhamnosus (75) L. rhamnosus (75) L. plantarum (66) L. plantarum (54) L. sakei (83) Method 0.12 0.25 0.5 1 Etest Etest Etest Etest Etest Etest Etest Etest Etest Etest MDIL Etest MDIL Etest MDIL Etest MDIL MDIL 2 4 8 16 32 64 128 256

1 3

2 15

6 11 5

1 1 2 1

41 1 4 21 2 14 1

3 5 14 6 10 7 9 22 7 3 24 23 9 33 46 1 10 32 44 35 22 2 2 39 35 3 2 2 11 2 2 2 1 2 1 9 16
a

18

13 1

5 1

3 3

3 6

39 12

19 3 27 7 6

Generally, the Etest and broth microd ilution method s w ere in good agreem ent in d ifferentiating the susceptible strains from their resistant counterparts. For several species-antibiotic com binations, how ever, MICs d eterm ined w ith the m icrod ilution m ethod w ere higher than those estim ated w ith Etest, especially w hen Lb. reuteri, Lb. paracasei, Lb. rhamnosus and Lb. plantarum w ere tested w ith tetracycline. H ow ever, the opposite results w ere also observed , for exam ple Lb. paracasei w ith erythrom ycin. Certain Lactobacillus strains have been observed to

53

grow better in broth than in agar, and also the d iffusion rate of the antibiotic substance in the Etest strips m ay vary from com pound to com pound .
Table 9b. Distribution of MICs for tetracycline. Fields shaded in grey indicate range of MICs tested for each antibiotic. MICs above the range are given as the concentration closest to the range. MICs below the range are given as the lowest concentration. Lb. paracasei includes one Lb. casei strain. Number of strains tested in parentheses. MDIL: Broth microdilution.
Distribution of MICs (g/ml) with tetracycline Species (total n) L. acidophilus (11) L. amylovorus (31) L. crispatus (7) L. delbrueckii (44) L. gallinarum (8) L. gasseri (36) L. helveticus (27) L. johnsonii (26) L. fermentum (56) L. reuteri (56) L. reuteri (56) L. paracasei (66) L. paracasei (66 L. rhamnosus (75) L. rhamnosus (75) L. plantarum (121) L. plantarum (81) L. sakei (83) Method 0.12 Etest Etest Etest Etest Etest Etest Etest Etest Etest Etest MDIL Etest MDIL Etest MDIL Etest MDIL MDIL 4 27 29 15 45 43 44 2 18 1 26 2 63 1 5 13 44 51 54 16 8 24 3 1 1 6 1 12 2 8 1 5 0.25 0.5 1 4 3 2 10 1 1 7 2 1 10 21 2 4 1 38 2 17 1 6 1 1 1 3 1 4 1 1 2 3 3 14 5 6 20 1 1 1 1 2 1 4 1 1 25 28 1 1 1 1 11 3 1 2 7 3 16 4 1 4 3 2 3 2 1 3 4 8 16 32 64 128 256 1 15 1

A w id e range of high MICs w as obtained w ith tetracycline, w hich may be explained by the high variability of tetracycline resistance m echanism s conferring d iverse levels of susceptibility (review ed in Roberts 1996). Tetracyclines have been used extensively in humans and anim als for m ore than 50 years for clinical purposes, as prophylactics and for prom oting grow th in food anim als. Interestingly, the closely related Lb. reuteri and Lb. fermentum d isplayed high and low MICs, respectively. The m ajority of the Lb. fermentum strains w ere of d airy origin, w hile Lb. reuteri strains w ere m ainly anim al isolates.

54

Table 9c. Distribution of MICs for erythromycin. Fields shaded in grey indicate range of MICs tested for each antibiotic. MICs above the range are given as the concentration closest to the range. MICs below the range are given as the lowest concentration. Lb. paracasei includes one Lb. casei strain. Number of strains tested in parentheses. MDIL: Broth microdilution. a 32 g/ml.
Distribution of MICs (g/ml) with erythromycin Species (total n) L. acidophilus (11) L. amylovorus (31) L. crispatus (7) L. delbrueckii (44) L. gallinarum (8) L. gasseri (36) L. helveticus (27) L. johnsonii (26) L. fermentum (56) L. reuteri (56) L. reuteri (56) L. paracasei (66) L. paracasei (66) L. rhamnosus (75) L. rhamnosus (75) L. plantarum (121) L. plantarum (81) L. sakei (83) Method 0.12 0.25 Etest Etest Etest Etest Etest Etest Etest Etest Etest Etest MDIL Etest MDIL Etest MDIL Etest MDIL MDIL 1 4 16 71 59 7 7 24 6 31 8 11 26 9 1 19 1 9 9 2 3 4 36 2 12 18 4 6 2 38 31 43 42 16 46 28 2 2 1a 2a 4 20 8 34 29 12 23 2 30 10 13 26 1 2a 2 6a 2 1 6 4 5 1 3 3 1 6 5 1 1 1 0.5 1 2 4 8 16 32 64 128 256 1 3

Altogether 11 strains from Lb. paracasei, Lb. rhamnosus, Lb. reuteri and Lb. sakei w ere found to have high MICs to erythrom ycin and clindam ycin (both belong to the MLSB group, m acrolid e-lincosam id e-streptogram in B). In several other stud ies, erm genes have been d eterm ined in Lactobacillus strains phenotypically resistant not only to erythrom ycin, but also to other MLSB group antibiotics (Gfeller et al. 2003, Martel et al. 2003).

55

Table 9d. Distribution of MICs for clindamycin. Fields shaded in grey indicate range of MICs tested for each antibiotic. MICs above the range are given as the concentration closest to the range. MICs below the range are given as the lowest concentration. Lb. paracasei includes one Lb. casei strain. Number of strains tested in parentheses. MDIL: Broth microdilution. a 16 g/ml.
Distribution of MICsa (g/ml) with clindamycin Species (total n) L. acidophilus (11) L. amylovorus (31) L. crispatus (7) L. delbrueckii (44) L. gallinarum (8) L. gasseri (36) L. helveticus (27) L. johnsonii (26) L. fermentum (21) L. reuteri (56) L. reuteri (56) L. paracasei (66) L. paracasei (66) L. rhamnosus (75) L. rhamnosus (75) L. plantarum (73) L. plantarum (54) L. sakei (83) Method 0.12 Etest Etest Etest Etest Etest Etest Etest Etest Etest Etest MDIL Etest MDIL Etest MDIL Etest MDIL MDIL 18 2 15 10 34 22 2 17 4 28 7 1 7 4 21 43 21 5 26 1 4 32 1 15 1 1 5 31 22 28 7 3 6 1 1 1 11 1 2a 2 2 4 9 5 6 8 19 2 1a 6a 6 6 2 4 3 4 3 9 4 2 2 2 1 1 5 4 2 3 3 5 4 4 1 1 5 7 3 11 0.25 0.5 1 2 3 2 1 1 4 2 8 3 16 32 64 128 256 1 4

14 35 22 6 1 42 13 11 13 7

56

Table 9e. Distribution of MICs for streptomycin. Fields shaded in grey indicate range of MICs tested for each antibiotic. MICs above the range are given as the concentration closest to the range. MICs below the range are given as the lowest concentration. Lb. paracasei includes one Lb. casei strain. Number of strains tested in parentheses. MDIL: Broth microdilution.
Distribution of MICsa (g/ml) with streptomycin Species (total n) L. acidophilus (11) L. amylovorus (31) L. crispatus (7) L. delbrueckii (44) L. gallinarum (8) L. gasseri (36) L. helveticus (27) L. johnsonii (26) L. fermentum (56) L. reuteri (56) L. reuteri (56) L. paracasei (66) L. paracasei (66) L. rhamnosus (75) L. rhamnosus (75) L. plantarum (121) L. plantarum (81) L. sakei (83) Method 0.12 0.25 0.5 1 Etest Etest Etest Etest Etest Etest Etest Etest Etest Etest MDIL Etest MDIL Etest MDIL Etest MDIL MDIL 1 15 43 19 2 9 30 7 1 4 15 20 3 7 18 13 1 27 24 2 31 31 27 2 1 1 15 1 1 2 8 3 1 7 3 8 8 1 3 1 2 3 3 4 4 9 1 15 1 11 18 8 3 6 4 12 16 1 3 1 4 1 2 2 3 9 9 12 1 28 35 26 1 10 2 16 9 17 3 43 10 12 4 4 6 6 53 52 1 2 3 1 1 3 1 1 8 32 64 128 256

Since d iscrepancies w ere d em onstrated betw een phenotypic and genotypic characterization in the stud y w ith Lb. rhamnosus (stud y III), it is recom m end ed to includ e also genotypic approaches in all stud ies of antibiotic resistance, w hen their safety is being assessed .

57

Table 9f. Distribution of MICs for gentamicin. Fields shaded in grey indicate range of MICs tested for each antibiotic. MICs above the range are given as the concentration closest to the range. MICs below the range are given as the lowest concentration. Lb. paracasei includes one Lb. casei strain. Number of strains tested in parentheses. MDIL: Broth microdilution. a 64 g/ml.
Distribution of MICs (g/ml) with gentamicin Species (total n) L. acidophilus (11) L. amylovorus (31) L. crispatus (7) L. delbrueckii (44) L. gallinarum (8) L. gasseri (36) L. helveticus (27) L. johnsonii (26) L. fermentum (21) L. reuteri (56) L. reuteri (56) L. paracasei (66) L. paracasei (66) L. rhamnosus (75) L. rhamnosus (75) L. plantarum (66) L. plantarum (54) L. sakei (83) Method 0.12 Etest Etest Etest Etest Etest Etest Etest Etest Etest Etest MDIL Etest MDIL Etest MDIL Etest MDIL MDIL 3 3 1 1 2 5 8 23 13 9 3 50 40 31 15 3 13 16 8 14 19 3 6 31 42 4a 3 1 1 8 35 1 4 5 2 0.25 0.5 1 1 2 1 1 9 4 5 11 4 1 1 2 4 4 4 3 13 3 17 1 7 9 11 15 12 26 6 31 7 19 19 26 8 18 2 5 6 6 6 8 1 12 1 12 16 1 1 1 32 64 128 256

12 17

5.7 ANTAGONISTIC ACTIVITY AND TRANSFORMATION OF LACTOCOCCUS SPECIES (V)

In the m ating experim ents, the cell d ensities w ere severely red uced w hen Lc. garvieae DSMZ 6783 and L. monocytogenes w ere grow n along w ith Lc. lactis ssp. lactis KYA7 strain. This w as ind icative of antagonistic activity, w hich is w id ely noted am ong LAB (Abriouel et al. 2005). This phenom enon could have represented a m ethod ological limitation d uring the conjugation experim ent in vitro, so the tet(S) gene w as electroporated from KYA7 strain to Lc. garvieae DSMZ 6783. The transfer of the tet(S) gene w as d etected w ith Southern hybrid ization, show ing a positive signal of approxim ately 30 kbp in size (Figure 7). The transfer of the plasmid w as also confirm ed w ith an increase of MIC for tetracycline from 0.25 g/ m l before the transform ation to 256 g/ m l in the transform ants.

58

Figure 7. Agarose gel electrophoresis analyses of plasmids isolated from Lc. lactis ssp. lactis KYA-7, Lc. garvieae DSM 6783 strains before and after tet(S) plasmid transformation by (a) electroporation, and (b) Southern hybridization analysis with tet(S) probe. Lanes: M, DNA Molecular Weight Marker II, DIG- labeled (Roche); 1, supercoiled DNA ladder (Promega); 2, plasmid DNA of Lc. lactis ssp. cremoris DSM 4645 as plasmid DNA size marker, 3, Lc. lactis ssp. lactis KYA-7; 4, Lc. garvieae DSM 6783 before electroporation; 5, Lc. garvieae DSM 6783 TF-a after electroporation. 5.8 TRANSFER OF THE TET(S) GENE FROM LACTOCOCCUS TO L. MONOCYTOGENES (V)

Although there are m any d ifferent theoretical w ays for transferring of the genes in laboratory cond itions e.g. genes cod ing for antibiotic resistance (transform ation, transduction, conjugation), only conjugation appears to be significant in vivo if one consid ers transfer betw een d ifferent bacterium species and genera (van Elsas 1992). The filter m ating proced ure w as applied to d etect the transferability of the tet(S) gene from Lactococcus to tetracycline susceptible L. monocytogenes strains (Table 10).
Table 10. Conjugal transfer of tetracycline resistance from Lc. garvieae to L. monocytogenes.
Donor Recipients Transfer frequency (TC per recipient) 7 10-7 < 10-10 4 10-7 Tetracycline MIC (g/ml) for tet(S) positive TCs 64 128

L. garvieae DSMZ 6783 TF

L. monocytogenes LMK8 L. monocytogenes LMK16 L. monocytogenes ATCC 7644

The results ind icate that the transfer of resistance from Lactococcus to Listeria m ight occur in the aquatic environm ent e.g. in fish especially in situations w hen subinhibitory levels of tetracycline are present d ue to use of m edicated feed .

59

6. Conclusions
LAB SPECIES DISTRIBUTION IN PIGLETS AND CALVES

Lactobacillus species d istribution w as found to be m ore variable in faecal sam ples of calves than in piglets. Our stud y w ith piglets confirm ed that Lb. reuteri is the d om inant lactobacilli in piglets after w eaning. The m od erately high proportion of Lb. salivarius isolates in piglet faecal sam ples m ay be evid ence for an age-d epend ent occurrence, since this species is rarely d etected in faeces of ad ult pigs. A novel find ing w as the id entification of W eissella ssp. in faecal sam ples from calves. Previously W eissella have been isolated from field grass, w hich m ost likely is the origin of the isolated w eissellas in our sam ples. Another interesting finding w as the id entification of Lactococcus garvieae in faecal sam ples taken from calves, since this species has previously been associated w ith mastitis in cow s.

SUITABILITY OF RAPD-PCR METHOD IN STRAIN CHARACTERIZATION

RAPD-PCR m ethod w as found to be a useful tool in separating isolates from each other. In piglet isolates, the RAPD-PCR w as able to cluster Lb. reuteri from Lb. salivarius isolates. With LAB from calves, the RAPD-PCR failed to cluster d ifferent bacterial species into separate clusters. H ow ever, the RAPD-PCR w as able to d iscrim inate strains from each other, w hich w as the m ain target for this application.

ANTIMICROBIAL SUSCEPTIBILITY OF LAB

Most of the Lactobacillus isolates w ere susceptible to all of the antibiotics exam ined in this thesis. All the strains isolated from piglets w ere susceptible to chloram phenicol, am picillin and gentamicin. Tw o Lb. salivarius strains

60

w ere m ultiresistant to vancom ycin, streptom ycin, clind am ycin and tetracycline, and furtherm ore the first strain w as also resistant to erythrom ycin and the second ad ditionally to trim ethoprim and chloram phenicol. In specimens from calves, the m ost often encountered resistance w as against tetracycline together w ith kanam ycin in Lactobacillus species, but no m ultid rug resistances w ere found.

In Lb. rhamnosus, tw o of the 75 exam ined strains w ere phenotypically resistant to clind am ycin, erythrom ycin and streptom ycin, one strain to am picillin and tetracycline, and one strain to streptom ycin and tetracycline. The genotypic susceptibility tests cond ucted w ith the microarray m ethod gave contradictory results to those obtained w ith the phenotypic patterns of the tested species. This ind icates that phenotypically susceptible strains m ay harbor silent antibiotic resistant genes, and their transferability betw een bacterial species need s to be clarified .

PROPOSED MICROBIOLOGICAL CUT-OFF VALUES

Several factors can influence the d eterm ination of m inim um inhibitory concentrations, e.g. the inoculum volum e, incubation tim e and tem perature, m ethod for cultivation (agar vs. broth applications) and not least, the grow th med ium . If one w ants to be able to com pare the results obtained in different laboratories, the m icr obiological cut-off values should be given accord ing to the species (not genera) and method used , w ith standard ized med ium and test proced ures. The LSM agar and broth w as found to be suitable in d eterm ining the MIC values of LAB, provid ing a sufficient grow th environm ent for all LAB exam ined in this thesis.

TRANSFER OF ANTIBIOTIC RESISTANCE BETWEEN BACTERIAL SPECIES

A gene coding for tetracycline resistance tet(S) w as able to be transferred from a fish pathogen Lc. garvieae to a hum an pathogen , L. monocytogenes, by conjugation in vitro.

61

7. References
Abriouel, H ., Lucas, R., Ben Om ar, N ., Vald ivia, E., Maqued a, M., Martinez Canam ero, M. and Galvez, A. (2005) Enterocin AS-48RJ: a variant of enterocin AS-48 chrom osom ally encod ed by Enterococcus faecium RJ16 isolated from food . Syst A ppl M icrobiol 28, 383-397. Agarw al, N ., Kam ra, D.N ., Chaud hary, L.C., Agarw al, I., Sahoo, A. and Pathak, N .N . (2002) Microbial status and rum en enzym e profile of crossbred calves fed on d ifferent m icrobial feed ad d itives. Lett A ppl M icrobiol 34, 329-336. Aland er, M., Satokari, R., Korpela, R., Saxelin, M., Vilpponen -Salm ela, T., Mattila-Sand holm , T. and von Wright, A. (1999) Persistence of colonization of hum an colonic m ucosa by a probiotic strain, Lactobacillus rhamnosus GG, after oral consum ption. A ppl Environ M icrobiol 65, 351354. Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipm an, D.J. (1990) Basic local alignm ent search tool. J M ol Biol 215, 403-410. Am m or, M.S., Florez, A.B. and Mayo, B. (2007) Antibiotic resistance in non enterococcal lactic acid bacteria and bifid obacteria. Food M icrobiol 24, 559-570. Am m or, M.S., Florez, A.B., van H oek, A.H ., d e Los Reyes-Gavilan, C.G., Aarts, H .J., Margolles, A. and Mayo, B. (2008) Molecular characterization of intrinsic and acquired antibiotic resistance in lactic acid bacteria and bifid obacteria. J M ol M icrobiol Biotechnol 14, 6-15. Anonym . (1969) Report of the Joint Com m ittee on the use of Antibiotics in Anim al H usband ry and Veterinary Medicine. Cm nd 4190, N ov. 1969. Anonym . (2004) Antibiotic Resistance. GAO-04-490 Antibiotic Use in Animals. Anonym . (2007) Methods for Antim icrobial Susceptibility Testing of Anaerobic Bacteria. Approved Stand ard . CLSI d ocum ent M11-A7. Aquilanti, L., Silvestri, G., Zan nini, E., Osim ani, A., Santarelli, S. and Clem enti, F. (2007) Phenotypic, genotypic and technological characterization of pred om inant lactic acid bacteria in Pecorino cheese from central Italy. J A ppl M icrobiol 103, 948-960. Axelsson, L. (2004) Lactic Acid Bacteria: Classification and Physiology. In Lactic A cid Bacteria. M icrobiological and Functional A spects ed . Salminen, S., von Wright, A. and Ouw ehand , A. pp. 1-66. N ew York: Marcel Dekker Inc. Axelsson, L. and Lind gren, S. (1987) Characterization and D N A hom ology of Lactobacillus strains isolated from pig intestine. J A ppl Bacteriol 62, 433440. Barton, M.D. (2000) Antibiotic use in anim al feed and its im pact on hum an healt. N utr Res Rev 13, 279-299.

62

Batt, C.A. (2000) Lactococcus: Introd uction. In Encyclopedia of Food M icrobiology ed . Robinson, R.K., Batt, C.A. and Patel, P.D. pp. 1164-1166. Lond on, U.K.: Acad em ic Press. Bernard eau, M., Vernoux, J.P., H enri-Dubernet, S. and Gueguen, M. (2008) Safety assessm ent of d airy m icroorganism s: the Lactobacillus genus. Int J Food M icrobiol 126, 278-285. Busconi, M., Reggi, S. and Fogher, C. (2008) Evaluation of biod iversity of lactic acid bacteria m icrobiota in the calf intestinal tracts. A ntonie V an Leeuwenhoek 94, 145-155. Canchaya, C., Claesson, M.J., Fitzgerald , G.F., van Sind eren, D. and O'Toole, P.W. (2006) Diversity of the genus Lactobacillus revealed by com parative genom ics of five species. M icrobiology 152, 3185-3196. Cannon, J.P., Lee, T.A., Bolanos, J.T. and Danziger, L.H . (2005) Pathogenic relevance of Lactobacillus: a retrospective review of over 200 cases. Eur J Clin M icrobiol Infect Dis 24, 31-40. Cataloluk, O. and Gogebakan, B. (2004) Presence of d rug resistance in intestinal lactobacilli of d airy and hum an origin in Turkey. FEM S M icrobiol Lett 236, 7-12. Chagnaud , P., Machinis, K., Coutte, L.A., Marecat, A. and Mercenier, A. (2001) Rapid PCR-based proced ure to id entify lactic acid bacteria: application to six com m on Lactobacillus species. J M icrobiol M ethods 44, 139-148. Claesson, M.J., van Sind eren, D. and O'Toole, P.W. (2008) Lactobacillus phylogenom ics--tow ard s a reclassification of the genus. Int J Syst Evol M icrobiol 58, 2945-2954. Claycam p, H .G. and H ooberm an, B.H . (2004) Antim icrobial resistance risk assessm ent in food safety. J Food Prot 67, 2063-2071. Collins, M.D., Rod rigues, U., Ash, C., Aguirre, M., Farrow , J.A.E., Martinez Murcia, A., Phillips, B.A., Williams, A.M. and Wallbanks, S. (1991) Phylogenetic analysis of the genus Lactobacillus and related lactic acid bacteria as d eterm ined by reverse transcriptase sequencing of 16S rRN A. FEM S M icrobiol Lett 77, 5-12. Coppola, R., Succi, M., Trem onte, P., Reale, A., Salzano, G. and Sorrentino, E. (2005) Antibiotic susceptibility of Lactobacillus rhamnosus strains isolated from Parm igian o Reggiano cheese. Lait 85, 193-204. Coton, M., Berthier, F. and Coton, E. (2008) Rapid id entification of the three m ajor species of d airy obligate heteroferm enters Lactobacillus brevis, Lactobacillus fermentum and Lactobacillus parabuchneri by species-specific d uplex PCR. FEM S M icrobiol Lett 284, 150-157. Coud eyras, S., Marchand in, H ., Fajon, C. and Forestier, C. (2008) Taxonom ic and strain-specific id entification of the probiotic strain Lactobacillus rhamnosus 35 w ithin the Lactobacillus casei group. A ppl Environ M icrobiol 74, 2679-2689. Courtney, P.D. (2000) Lactococcus lactis Subspecies lactis and cremoris. In Encyclopedia of Food M icrobiology ed . Robinson, R.K., Batt, C.A. and Patel, P.D. pp. 1166-1171. London, U.K.: Acad emic Press.

63

Courvalin, P. (1994) Transfer of antibiotic resistance genes betw een gram positive and gram -negative bacteria. A ntimicrob A gents Chemother 38, 1447-1451. Dal Bello, F., Walter, J., H am m es, W.P. and H ertel, C. (2003) Increased com plexity of the species com position of lactic acid bacteria in hum an feces revealed by alternative incubation cond ition. M icrob Ecol 45, 455463. Danielsen, M. (2002) Characterization of the tetracycline resistance plasm id pMD5057 from Lactobacillus plantarum 5057 reveals a com posite structure. Plasmid 48, 98-103. Danielsen, M. and Wind , A. (2003) Susceptibility of Lactobacillus spp. to antimicrobial agents. Int J Food M icrobiol 82, 1-11. Dellaglio, F. and Felis, G.E. (2005) Taxonom y of Lactobacilli and Bifidobacteria. In Probiotics and Prebiotics: Scientific A spects. ed . Tannock, G.W. pp. 25-49. N orfolk, U.K.: Caister Acad em ic Press. Devirgiliis, C., Caravelli, A., Coppola, D., Barile, S. and Perozzi, G. (2008) Antibiotic resistance and microbial com position along the m anufacturing process of Mozzarella d i Bufala Cam pana. Int J Food M icrobiol 128, 378-384. Devirgiliis, C., Coppola, D., Barile, S., Colonna, B. and Perozzi, G. (2009) Characterization of the Tn916 conjugative transposon in a food -borne strain of Lactobacillus paracasei. A ppl Environ M icrobiol 75, 3866-3871. Devriese, L.A., H om mez, J., Laevens, H ., Pot, B., Vand am m e, P. and H aesebrouck, F. (1999) Id entification of aesculin -hyd rolyzing streptococci, lactococci, aerococci and enterococci from subclinical intram am mary infections in d airy cow s. V et M icrobiol 70, 87-94. Di Cagno, R., De Angelis, M., Lim itone, A., Minervini, F., Carnevali, P., Corsetti, A., Gaenzle, M., Ciati, R. and Gobbetti, M. (2006) Glucan and fructan prod uction by sourd ough W eissella cibaria and Lactobacillus plantarum. J A gric Food Chem 54, 9873-9881. Dicksved , J., Floistrup, H ., Bergstrom , A., Rosenquist, M., Pershagen, G., Scheynius, A., Roos, S., Alm , J.S., Engstrand , L., Braun -Fahrland er, C., von Mutius, E. and Jansson, J.K. (2007) Molecular fingerprinting of th e fecal microbiota of children raised accord ing to d ifferent lifestyles. A ppl Environ M icrobiol 73, 2284-2289. Donohue, D.C. (2004) Safety of N ovel Probiotic Bacteria. In Lactic A cid Bacteria. M icrobiological and Functional A spects ed . Salm inen, S., von Wright, A. and Ouw ehand , A. pp. 531-546. N ew York, U.S.A.: Marcel Dekker Inc. Egervarn, M., Lind m ark, H ., Roos, S., H uys, G. and Lind gren, S. (2007) Effects of inoculum size and incubation tim e on broth m icrod ilution susceptibility testing of lactic acid bacteria. A ntimicrob A gents Chemother 51, 394-396. End o, A. and Okad a, S. (2005) Monitoring the lactic acid bacterial d iversity d uring shochu ferm entation by PCR-d enaturing grad ient gel electrophoresis. J Biosci Bioeng 99, 216-221.

64

Ericsson, H .M. and Sherris, J.C. (1971) Antibiotic sensitivity testing. Report of an international collaborative stud y. A cta M icrobiol Scand 217, 1-90. European Com m ission. (2005) Opinion of the scientific panel on ad d itives and prod ucts or substances used in anim al feed on the upd ating of the criteria used in the assessm ent of bacteria for resistance to antibiotics of hum an or veterinary importance. The EFSA J 223, 1-12. European Com m ission. (2007) Opinion of the Scientific Com mittee on a request from EFSA on the introd uction of a Qualified Presum ption of Safety (QPS) approach for assessm ent of selected m icroorganism s referred to EFSA. The EFSA J 587, 1-16. European Com m ission. (2008) Technical guid ance prepared by the Panel on Ad d itives and Prod ucts or Substances used in Anim al Feed (FEEDAP) on the upd ate of the criteria used in th e assessm ent of bacterial resistance to antibiotics of hum an or veterinary im portance. The EFSA J, 1-15. Felis, G.E. and Dellaglio, F. (2007) Taxonom y of lactobacilli and bifid obacteria. Curr Issues Intest M icrobiol 8, 44-61. Florez, A.B., Delgad o, S. and Mayo, B. (2005) Antim icrobial susceptibility of lactic acid bacteria isolated from a cheese environm ent. Can J M icrobiol 51, 51-58. Foschino, R., N ucera, D., Volponi, G., Picozzi, C., Ortoffi, M. an d Bottero, M.T. (2008) Com parison of Lactococcus garvieae strains isolated in northern Italy from d airy prod ucts and fishes through molecular typing. J A ppl M icrobiol 105, 652-662. Gatesoupe, F.J. (2008) Upd ating the im portance of lactic acid bacteria in fish farm ing: natural occurrence and probiotic treatm ents. J M ol M icrobiol Biotechnol 14, 107-114. Gevers, D., H uys, G., Devlieghere, F., Uyttend aele, M., Debevere, J. and Sw ings, J. (2000) Isolation and id entification of tetracycline resistant lactic acid bacteria from pre-packed sliced meat prod ucts. Syst A ppl M icrobiol 23, 279-284. Gevers, D., H uys, G. and Sw ings, J. (2003) In vitro conjugal transfer of tetracycline resistance from Lactobacillus isolates to other Gram -positive bacteria. FEM S M icrobiol Lett 225, 125-130. Gfeller, K.Y., Roth, M., Meile, L. and Teuber, M. (2003) Sequence and genetic organization of the 19.3-kb erythrom ycin- and d alfopristin-resistance plasm id pLME300 from Lactobacillus fermentum ROT1. Plasmid 50, 190201. Gruzza, M., Langella, P., Duval-Iflah, Y. and Ducluzeau, R. (1993) Gene transfer from engineered Lactococcus lactis strains to Enterococcus faecalis in the d igestive tract of gnotobiotic m ice. M icrob Releases 2, 121-125. Guarneri, T., Rossetti, L. and Giraffa, G. (2001) Rapid id entification of Lactobacillus brevis using the polymerase chain reaction. Lett A ppl M icrobiol 33, 377-381.

65

H aakensen, M., Vickers, D.M. and Ziola, B. (2009) Susceptibility of Pediococcus isolates to antim icrobial com pound s in relation to hop -resistance and beer-spoilage. BM C M icrobiol 9, 190. H am m es, W.P. and H ertel, C. (2006) The Genera Lactobacillus and Carnobacterium. In The Procaryotes. A handbook on the Biology of Bacteria. Bacteria: Firmicutes, Cyanobacteria. ed . Dw orkin, M., Falkow , S., Rosenberg, E., Schleifer, K.H . and Stackebrand t, E. pp. 320-403. N ew York: Springer. H am m es, W.P. and Vogel, R.F. (1995) The genus Lactobacillus. In The Genera of Lactic A cid Bacteria ed . Wood , B.J.B. and H olzapfel, W.H . pp. 19-54. Lond on, U.K.: Chapm an & H all. H artem ink, R., Dom enech, V.R. and Rom bouts, F.M. (1997) LAMVAB -A new selective m ed ium for the isolation of lactobacilli from feaces. J M icrobiol M ethods 29, 77-84. H eilig, H .G., Zoetend al, E.G., Vaughan, E.E., Marteau, P., Akkerm ans, A.D. and d e Vos, W.M. (2002) Molecular d iversity of Lactobacillus spp. and other lactic acid bacteria in the hum an intestine as d eterm ined by specific am plification of 16S ribosom al DN A. A ppl Environ M icrobiol 68, 114-123. H olo, H . and N es, I.F. (1989) H igh -Frequency Transform ation, by Electroporation, of Lactococcus lactis subsp. cremoris Grow n w ith Glycine in Osm otically Stabilized Med ia. A ppl Environ M icrobiol 55, 3119-3123. H olzapfel, W.H ., H aberer, P., Geisen, R., Bjrkroth, J. and Schillinger, U. (2001) Taxonom y and im portant features of probiotic m icroorganisms in food and nutrition. A m J Clin N utr 73, 365S-73S. H um m el, A.S., H ertel, C., H olzapfel, W.H . and Franz, C.M. (2007) Antibiotic resistances of starter and probiotic strains of lactic acid bacteria. A ppl Environ M icrobiol 73, 730-739. H uys, G., DH aene, K., Danielsen, M.M., J., Egervrn, M. and Vand amm e, P. (2008) Phenotypic and m olecular assessm ent of antim icrobial resistance in Lactobacillus paracasei strains of food origin. J Food Prot 71, 339-344. H uys, G., D'H aene, K. and Sw ings, J. (2002) Influence of the culture medium on antibiotic susceptibility testing of food -associated lactic acid bacteria w ith the agar overlay d isc d iffusion m ethod . Lett A ppl M icrobiol 34, 402406. Igim i, S., Ryu, C.H ., Park, S.H ., Sasaki, Y., Sasaki, T. and Kum agai, S. (1996) Transfer of conjugative plasm id pAM beta 1 from Lactococcus lactis to m ouse intestinal bacteria. Lett A ppl M icrobiol 23, 31-35. Ishibashi, N . and Yam azaki, S. (2001) Probiotics and safety. Am J Clin N utr 73, 465S-470S. Jacobsen, L., Wilcks, A., H am m er, K., H uys, G., Gevers, D. and And ersen, S.R. (2007) H orizontal transfer of tet(M) and erm (B) resistance plasm ids from food strains of Lactobacillus plantarum to Enterococcus faecalis JH 2-2 in the gastrointestinal tract of gnotobiotic rats. FEM S M icrobiol Ecol 59, 158-166.

66

Jay, J.M. (2000) Ferm entation and Ferm ented Dairy Prod ucts. In M odern Food M icrobiology ed . Anonym ous pp. 113-130. Gaithersburg, Maryland: Aspen Publishers, Inc. Kandler, O. (1983) Carbohyd rate m etabolism in lactic acid bacteria. A ntonie V an Leeuwenhoek 49, 209-224. Kang, M.S., Chung, J., Kim , S.M., Yang, K.H . and Oh, J.S. (2006) Effect of W eissella cibaria isolates on the form ation of Streptococcus mutans biofilm. Caries Res 40, 418-425. Karney, T.L., Johnson, M.G. and Ray, B. (1986) Changes in the lactobacilli and coliform populations in the intestinal tract of calves from birth to w eaning. J Sci Food A gric 73, 231-236. Khachatourians, G.G. (1998) Agricultural use of antibiotics and t he evolution and transfer of antibiotic-resistant bacteria. Can M edic A ssoc J 159, 11291136. Klare, I., Konstabel, C., Muller-Bertling, S., Reissbrod t, R., H uys, G., Vancanneyt, M., Sw ings, J., Goossens, H . and Witte, W. (2005) Evaluation of new broth m edia for m icrod ilution antibiotic susceptibility testing of Lactobacilli, Pediococci, Lactococci, and Bifid obacteria. A ppl Environ M icrobiol 71, 8982-8986. Klare, I., Konstabel, C., Werner, G., H uys, G., Vankerckhoven, V., Kahlm eter, G., H ild ebrand t, B., Muller-Bertling, S., Witte, W. and Goossens, H . (2007) Antimicrobial susceptibilities of Lactobacillus, Pediococcus and Lactococcus hum an isolates and cultures intend ed for probiotic or nutritional use. J A ntimicrob Chemother 59, 900-912. Korhonen, J.M., Danielsen, M., Mayo, B., Egervrn, M., Axelsson, L., H uys, G. and von Wright, A. (2008) Antim icrobial susceptibility and proposed m icrobiological cut-off values of lactobacilli by phenotypic d eterm ination. Int J Prob Preb 3, 257-268. Korhonen, J.M., Sclivagnotis, Y. and von Wright, A. (2007) Characterization of d om inant cultivable lactobacilli and their antibiotic resistance profiles from faecal sam ples of w eaning piglets. J A ppl M icrobiol 103, 2496-2503. Kostinek, M., Specht, I., Ed w ard , V.A., Pinto, C., Egounlety, M., Sossa, C., Mbugua, S., Dortu, C., Thonart, P., Taljaard , L., Mengu, M., Franz, C.M. and H olzapfel, W.H . (2007) Characterisation and biochem ical properties of pred om inant lactic acid bacteria from ferm enting cassava for selection as starter cultures. Int J Food M icrobiol 114, 342-351. Kushiro, A., Chervaux, C., Cools-Portier, S., Perony, A., Legrain -Raspaud , S., Obis, D., Onoue, M. and van d e Moer, A. (2009) Antimicrobial susceptibility testing of lactic acid bacteria and bifid obacteria by br oth m icrod ilution m ethod and Etest. Int J Food M icrobiol 132, 54-58. Leclercq, R., Dutka-Malen, S., Brisson-N oel, A., Molinas, C., Derlot, E., Arthur, M., Duval, J. and Courvalin, P. (1992) Resistance of enterococci to am inoglycosid es and glycopeptid es. Clin Infect Dis 15, 495-501. Lee, J., Jang, J., Kim , B., Kim , J., Jeong, G. and H an, H . (2004) Id entification of Lactobacillus sakei and Lactobacillus curvatus by m ultiplex PCR-based restriction enzym e analysis. J M icrobiol M ethods 59, 1-6.

67

Leser, T.D., Am enuvor, J.Z., Jensen, T.K., Lind ecrona, R.H ., Boye, M. and Moller, K. (2002) Culture-ind epend ent analysis of gut bacteria: the pig gastrointestinal tract m icrobiota revisited . A ppl Environ M icrobiol 68, 673-690. Levy, S.B. and Marshall, B. (2004) Antibacterial resistance w orldw id e: causes, challenges and responses. N at M ed 10, S122-9. Licht, T.R., Struve, C., Christensen, B.B., Poulsen, R.L., Molin, S. and Krogfelt, K.A. (2003) Evidence of increased spread and establishm ent of plasm id RP4 in the intestin e und er sub-inhibitory tetracycline concentrations. FEM S M icrobiol Ecol 44, 217-223. Lin, C.F., Fung, Z.F., Wu, C.L. and Chung, T.C. (1996) Molecular characterization of a plasm id -borne (pTC82) chloram phenicol resistance d eterm inant (cat-TC) from Lactobacillus reuteri G4. Plasmid 36, 116-124. Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A., Pavlova, N ., Karam ychev, V., Polouchine, N ., Shakhova, V., Grigoriev, I., Lou, Y., Rohksar, D., Lucas, S., H uang, K., Good stein, D.M., H aw kins, T., Plengvid hya, V., Welker, D., H ughes, J., Goh, Y., Benson, A., Bald w in, K., Lee, J.H ., Diaz-Muniz, I., Dosti, B., Sm eianov, V., Wechter, W., Barabote, R., Lorca, G., Altermann, E., Barrangou, R., Ganesan, B., Xie, Y., Raw sthorne, H ., Tam ir, D., Parker, C., Breid t, F., Broad bent, J., H utkins, R., O'Sullivan, D., Steele, J., Unlu, G., Saier, M., Klaenham m er, T., Richard son, P., Kozyavkin, S., Weim er, B. and Mills, D. (2006) Com parative genom ics of the lactic acid bacteria. Proc N atl A cad Sci U S A 103, 15611-15616. Martel, A., Meulenaere, V., Devriese, L.A., Decostere, A. and H aesebrouck, F. (2003) Macrolid e and lincosam id e resistance in the gram -positive nasal and tonsillar flora of pigs. M icrob Drug Resist 9, 293-297. Mtt, J., van H oek, A.H ., Dom ig, K.J., Saarela, M., Florez, A.B., Brockm ann, E., Am tm ann, E., Mayo, B., Aarts, H .J. and Danielsen, M. (2007) Susceptibility of hum an and probiotic Bifidobacterium spp. to selected antibiotics as d etermined by the Etest m ethod . Int Dairy J 17, 1123-1131. Mitsuoka, T. (1992) The hum an gastrointestinal tract. In The Lactic A cid Bacteria. The Lactic A cid Bacteria in Health and Disease. ed . Wood , B.J.B. pp. 49-114. Lond on, U.K.: Elsevier Applied Science. Morelli, L., Sarra, P.G. and Bottazzi, V. (1988) In vivo transfer of pAM beta 1 from Lactobacillus reuteri to Enterococcus faecalis. J A ppl Bacteriol 65, 371375. Myllyniem i, A., Pitkl, A., H eiska, H ., Kivilahti-Mntyl, K., Kaartinen, L. and Koppinen, J. (2007) FIN -RES-Vet 2005-2006. Finnish veterinary antimicrobial resistance m onitoring and consumption of antim icrobial agents. Evira publications 22, 1-56. N aito, S., H ayashid ani, H ., Kaneko, K., Ogaw a, M. and Benno, Y. (1995) Developm ent of intestinal lactobacilli in norm al piglets. J A ppl Bacteriol 79, 230-236. N am , H ., Whang, K. and Lee, Y. (2007) Analysis of vaginal lactic acid prod ucing bacteria in healthy w om en. J M icrobiol 45, 515-520.

68

N eu, H .C. (1992) The crisis in antibiotic resistance. Science 257, 1064-1073. N ousiainen, J., Javanainen, P., Setl, J. and von Wright, A. (2004) Lactic acid bacteria as anim al probiotics. In Lactic A cid Bacteria. M icrobiological and Functional A spects. ed . Salm inen, S., von Wright, A. and Ouw ehand , A. pp. 547-580. N ew York, U.S.A.: Marcel Dekker Inc. Ouoba, L.I., Lei, V. and Jensen, L.B. (2008) Resistance of potential probiotic lactic acid bacteria and bifid obacteria of African and European origin to antimicrobials: d eterm ination and transferability of the resistance genes to other bacteria. Int J Food M icrobiol 121, 217-224. Patterson, A.J., Rincon, M.T., Flint, H .J. and Scott, K.P. (2007) Mosaic tetracycline resistance genes are w id espread in hum an and anim al fecal sam ples. A ntim A gents Chemother 51, 1115-1118. Plengvidhya, V., Breidt, F.,Jr, Lu, Z. and Flem ing, H .P. (2007) DN A fingerprinting of lactic acid bacteria in sauerkraut ferm entations. A ppl Environ M icrobiol 73, 7697-7702. Pu, Z.Y., Dobos, M., Lim sow tin, G.K. and Pow ell, I.B. (2002) Integrated polymerase chain reaction -based proced ures for th e d etection and id entification of species and subspecies of the Gram -positive bacterial genus Lactococcus. J A ppl M icrobiol 93, 353-361. Rachm an, C.N ., Kabad jova, P., Prevost, H . and Dousset, X. (2003) Id entification of Lactobacillus alimentarius and Lactobacillus farciminis w ith 16S-23S rDN A intergenic spacer region polym orphism and PCR am plification using species-specific oligonucleotide. J A ppl M icrobiol 95, 1207-1216. Ravelo, C., Magarinos, B., Lopez-Rom ald e, S., Toranzo, A.E. and Rom alde, J.L. (2003) Molecular fingerprinting of fish -pathogenic Lactococcus garvieae strains by rand om am plified polym orphic DN A analysis. J Clin M icrobiol 41, 751-756. Reuter, G. (2001) The Lactobacillus and Bifidobacterium m icroflora of the hum an intestine: com position an d succession. Curr Issues Intest M icrobiol 2, 4353. Ring, E. and Gatesoupe, F. (1998) Lactic acid bacteria in fish: a review . A quaculture 160, 177-203. Roberts, M.C. (1996) Tetracycline resistance d eterm inants: m echanism s of action, regulation of expression, genetic m obility, and d istribution. FEM S M icrobiol Rev 19, 1-24. Roberts, M.C. (2005) Upd ate on acquired tetracycline resistance genes. FEM S M icrobiol Lett 245, 195-203. Rossetti, L., Carm inati, D., Zago, M. and Giraffa, G. (2009) A qualified presum ption of safety approach for the safety assessm ent of Grana Pad ano w hey starters. Int J Food M icrobiol 130, 70-73. Salyers, A.A., Gupta, A. and Wang, Y. (2004) H um an intestinal bacteria as reservoirs for antibiotic resistance genes. Trends M icrobiol 12, 412-416. Salyers, A.A. and Shoemaker, N .B. (1996) Resistance gene transfer in anaerobes: new insights, new problem s. Clin Infect Dis 23 Suppl 1, S36-43.

69

Santos, E.M., Jaim e, I., Rovira, J., Lyhs, U., Korkeala, H . and Bjorkroth, J. (2005) Characterization and id entification of lactic acid bacteria in "m orcilla d e Burgos". Int J Food M icrobiol 97, 285-296. Schillinger, U., Boehringer, B., Wallbaum , S., Caroline, L., Gonfa, A., H u ch N ee Kostinek, M., H olzapfel, W.H . and Franz, C.M. (2008) A genus-specific PCR m ethod for d ifferentiation betw een Leuconostoc and W eissella and its application in id entification of heteroferm entative lactic acid bacteria from coffee ferm entation. FEM S M icrobiol Lett 286, 222-226. Schleifer and Lud w ig (1995) Phylogeny of the genus Lactobacillus and related genera. Syst A ppl M icrobiol 18, 461-467. Singer, R.S., Finch, R., Wegener, H .C., Byw ater, R., Walters, J. and Lipsitch, M. (2003) Antibiotic resistance--the interplay betw een antibiotic use in anim als and hum an beings. Lancet Infect Dis 3, 47-51. Stiles, M.E. and H olzapfel, W.H . (1997) Lactic acid bacteria of food s and their current taxonom y. Int J Food M icrobiol 36, 1-29. Tannock, G.W. (1987) Conjugal transfer of plasm id pAM beta 1 in Lactobacillus reuteri and betw een lactobacilli and Enterococcus faecalis. A ppl Environ M icrobiol 53, 2693-2695. Tannock, G.W. (2004) A special fondness for lactobacilli. A ppl Environ M icrobiol 70, 3189-3194. Tannock, G.W., Fuller, R. and Ped ersen, K. (1990) Lactobacillus succession in the piglet d igestive tract d emonstrated by plasmid profiling. A ppl Environ M icrobiol 56, 1310-1316. Teale, C.J. (2002) Antim icrobial resistance and the food chain. J A ppl M icrobiol 92 Suppl, 85S-9S. Tem m erm an, R., H uys, G. and Sw ings, J. (2004) Id entification of lactic acid bacteria: culture-d ependent and culture-ind epend ent method s. Trends Food Sci Tech 15, 348-359. Torriani, S., Felis, G.E. and Dellaglio, F. (2001) Differentiation of Lactobacillus plantarum, L. pentosus, and L. paraplantarum by recA gene sequence analysis and m ultiplex PCR assay w ith recA gene-d erived prim ers. A ppl Environ M icrobiol 67, 3450-3454. Tynkkynen, S., Singh, K.V. and Varm anen, P. (1998) Vancom ycin resistance factor of Lactobacillus rhamnosus GG in relation to enterococcal vancom ycin resistance (van) genes. Int J Food M icrobiol 41, 195-204. Urso, R., Com i, G. and Cocolin, L. (2006) Ecology of lactic acid bacteria in Italian ferm ented sausages: isolation, id en tification and m olecular characterization. Syst A ppl M icrobiol 29, 671-680. van d en Bogaard , A.E. and Stobberingh, E.E. (1996) Tim e to ban all antibiotics as anim al grow th-prom oting agents? Lancet 348, 619. van Elsas, J.D. (1992) Antibiotic resistance gene transfer in the environm ent: an overview . In Genetic Interactions A mong M icroorganisms in the N atural Environment. ed . Wellington, E.M. and van Elsas, J.D. pp. 17-39. Oxford , United Kingdom: Pergamon Press. van H oek, A.H ., Mayrhofer, S., Dom ig, K.J., Florez, A.B., Am m or, M.S., Mayo, B. and Aarts, H .J. (2008a) Mosaic tetracycline resistance genes and their

70

flanking regions in Bifidobacterium thermophilum and Lactobacillus johnsonii. A ntimicrob A gents Chemother 52, 248-252. van H oek, A.H .A.M. and Aarts, H .J.M. (2008b) Microarray based d etection of antibiotic resistance genes in Salmonella. Food A nal M ethods 1, 95-108. van H oek, A.H ., Margolles, A., Domig, K.J., Korhonen, J., yska -Krzesiska, J., Bard ow ski, J., Danielsen. M., H uys, G., Morelli, L. and Aa rts, H . (2008c) Molecular assessm ent of erythrom ycin and tetrcycline resistance genes in lactic acid bacteria and bifid obacteria and their relation to the phenotypic resistance. Int J Prob Preb 3, 271-280. Walter, J. In Probiotics and Prebiotics. Scientific A spects ed . Tannock, G.W. pp. 5182: Caister Acad emic Press. Walter, J., H ertel, C., Tannock, G.W., Lis, C.M., Munro, K. and H am m es, W. (2001) Detection of Lactobacillus, Pediococcus, Leuconostoc and W eissella species in hum an feces by using group -specific PCR prim ers and d enaturing grad ient gel electrophoresis. A ppl Env M icrob 67, 2578-2585. Yin, Q. and Zheng, Q. (2005) Isolation and id entification of the d om inant Lactobacillus in gut and faeces of pigs using carbohyd rate ferm entation and 16S rDN A analysis. J Biosci Bioeng 99, 68-71. Yun, J.H ., Lee, K.B., Sung, Y.K., Kim , E.B., Lee, H .G. and Choi, Y.J. (2009) Isolation and characterization of potential probiotic lactobacilli from pig feces. J Basic M icrobiol 49, 220-226. Zhou, J.S., Pillid ge, C.J., Gopal, P.K. and Gill, H .S. (2005) Antibiotic susceptibility profiles of new probiotic Lactobacillus and Bifidobacterium strains. Int J Food M icrobiol 98, 211-217.

71

Jenni Korhonen Antibiotic Resistance of Lactic Acid Bacteria

Resistance to antibiotics is a common characteristic in the world of bacteria. Hitherto, only little attention has been paid to the antimicrobial susceptibilities of beneficial lactic acid bacteria, on the opposite to several pathogenic bacterial species. However, there is some concern that antibiotic resistance in lactic acid bacteria could be transferred to pathogenic bacterial species, complicating the treatment of a diesease or infection and lead to the spread of antibiotic-resistant bacteria. Studies were conducted to isolate and identify lactic acid bacteria of animal and human origins, to evaluate their antimicrobial resistance patterns and to propose minimum inhibitory concentrations for Lactobacillus species.

Publications of the University of Eastern Finland Dissertations in Forestry and Natural Sciences isbn 978-952-61-0096-8