Gateway Cloning Manual

GATEWAY Cloning Technology
Version 1
Note: This product is covered by a Limited Label License (see Section 1.3).The consideration paid for this product grants a Limited License with a paid up royalty to use the product pursuant to the terms set forth in the accompanying Limited Label License. By use of this product, you accept the terms and conditions of the Limited Label License.
Table of Contents
1. Notices to Customer..... 1 1.1 Important Information.... 1 1.2 Precautions..... 1 1.3 Limited Label License.... 1 Overview... 3 2.1 Two Reactions Constitute the GATEWAY Cloning System....... 4 2.2 Basis of GATEWAY Recombination Reactions.. 5 2.3 Details of the GATEWAY Cloning Reactions6 2.4 Entry Vectors and Entry Clones.... 8 2.5 Destination Vectors...10 2.6 Protein Expression in the GATEWAY Cloning System. 11 2.7 Considerations in Designing Entry Clones.. 12 2.7.1 Location of Translation Start Sequences 12 2.7.2 Reading Frame. 13 2.7.3 Examples of Sequences for Different Protein Constructs... 13 2.7.4 Transcription from Entry Clones 15 2.8 Choosing the Right Entry Vector. 15 2.8.1 Features of the Entry Vectors. 15 2.8.2 Entry Vector pENTR11.. 16 2.9 GATEWAY Nomenclature...... 17 Methods... 18 3.1 General Comments... 18 3.2 Creating an Entry Clone....... 19 3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase19 3.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction Endonucleases and Ligase21 3.2.3 Transferring Genes from Expression Clones into Entry Vectors via the BP Reaction... 22 3.2.4 Cloning of attB-PCR Products via the BP Reaction.. 23 3.3 Creating Expression Clones (Transferring Genes from Entry Clones into Destination Vectors via the LR Reaction)........ 27 Troubleshooting.. 29 Additional Information... 34 5.1 Converting a Vector into a GATEWAY Destination Vector...... 34 5.2 Protocol for Making a Destination Vector....... 35 5.3 Using the Destination Vector in the GATEWAY Cloning System..... 38 5.4 "One-tube" Protocol: A Protocol for Cloning attB-PCR products directly into Destination Vectors ..... 39 5.5 Transferring Clones from cDNA Libraries Made in GATEWAY Vectors..... 40 5.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System..... 41 Related Products ..... 57
2.
3.
4. 5.
6.
Figures and Tables Figure 1. Transferring a DNA Segment (Gene) between an Entry Clone and Multiple Destination Vectors. ... .....................................................................................................................................3 Figure 2. GATEWAY Cloning Reactions: The LR Reaction. . ......................................................................4 Figure 3. GATEWAY Cloning Reactions: The BP Reaction. . .....................................................................5
www.lifetech.com/gateway
Figure 4. Bacteriophage Lambda Recombination in E. coli. . .....................................................................6 Figure 5. GATEWAY Cloning Technology as an Operating System for Cloning and Subcloning Genes. .. 6 Figure 6. Sequences of attB1 and attB2 Sites Flanking a Gene after Subcloning into a Destination Vector to Create an Expression Clone..........................................................................................7 Figure 7. DNA Molecules Participating in the LR Reaction. . ....................................................................8 Figure 8. Four Ways to Make Entry Clones.. ..............................................................................................9 Figure 9. Schematic of Available Entry Vectors. ......................................................................................10 Figure 10. Cloning A PCR Product by the BP Reaction............................................................................11 Figure 11. Examples of Different Protein Expression Constructs. ...........................................................13 Figure 12. Two Types of GATEWAY Protein Expression...........................................................................16 Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector. ............................24 Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. ................................34 Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. ...................................................36 Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassette for N-Terminal Fusions. . ...................................................................................................................................36 Figure 17. One-Tube Protocol for Cloning PCR Products Directly into Destination Vectors. ................39 Figure 18. Vector Map of Typical Entry Vector... 41 Figure 19. Cloning Sites of the Entry Vector pENTR1A...42 Figure 20. Cloning Sites of the Entry Vector pENTR2B...42 Figure 21. Cloning Sites of the Entry Vector pENTR3C...43 Figure 22. Cloning Sites of the Entry Vector pENTR4..43 Figure 23. Cloning Sites of the Entry Vector pENTR11....43 Figure 24. pDEST8.44 Figure 25. pDEST10...45 Figure 26. pDEST12.246 Figure 27. pDEST14.. 47 Figure 28. pDEST15.. 48 Figure 29. pDEST17.. 49 Figure 30. pDEST20.. 50 Figure 31. pDEST26.. 51 Figure 32. pDEST27.. 52 Figure 33. pDONR20156
Table 1. Available Entry Vectors.................................................................................................................9 Table 2. Available Destination Vectors .....................................................................................................12 Table 3. Location of Cleavage Sites for a Selection of Restriction Endonucleases. .................................35 Table 4. Restriction Endonucleases Restriction Endonucleases That Do Not Cleave the Destination Vectors, or Cleave Twice.. 53
BAC-TO-BAC, BENCHMARK, CELLFECTIN, CLONASE, CLONECHECKER, CONCERT, DH5, DB3.1, DH10BAC, GATEWAY, GENETICIN, FOCUS 1 Kb PLUS DNA LADDER, LIPOFECTAMINE, LIBRARY EFFICIENCY, MASS, MAX EFFICIENCY, pDEST, pDONR, pENTR, pFASTBAC, PLATINUM, PROQUEST, REACT, SUPERSCRIPT, TAQUENCH, TECH-LINESM, THERMOSCRIPT, and the Life Technologies logo are marks of Life Technologies, Inc. Kodak Digital Science is a trademark of Eastman Kodak Co. Falcon is a registered trademark of Becton Dickinson & Company.
1. Notices to Customer
1.1 Important Information This product is authorized for laboratory research use only. The product has not been qualified or found safe and effective for any human or animal diagnostic or therapeutic application. Uses for other than the labeled intended use may be a violation of applicable law. 1.2 Precautions
Warning: This product contains hazardous reagents. It is the end-users responsibility to consult the applicable MSDS(s) before using this product. Disposal of waste organics, acids, bases, and radioactive materials must comply with all appropriate federal, state, and local regulations. If you have any questions concerning the hazards associated with this product, please call the Life Technologies, Inc. Environmental Health and Safety Chemical Emergency hotline at (301) 431-8585. 1.3 Limited Label License
This product and its use is the subject of U.S. Patent 5,888,732 and other pending U.S. and foreign patent applications owned by Life Technologies, Inc. (LTI). Use of this product requires a license from LTI. Academic, Not-for-Profit and For-Profit institutions acquire certain limited nontransferable rights with the purchase of this product (see below). Academic and Not-For-Profit Institutions: The purchase price of this product includes limited, nontransferable rights for non-profit and academic institutions to use only the purchased amount of the product to practice recombinational cloning solely for internal research purposes, but does not provide rights to perform amplification using primers containing recombination sites or portions thereof. Rights for performing amplification using primers containing att recombination sites or portions thereof solely for internal research purposes may be obtained by purchasing such primers from LTI or from a licensed supplier of such primers. LTI reserves all other rights and in particular, the purchaser of this product can not transfer or otherwise sell this product or its components to a third party and no rights are conveyed to the purchaser to use the product or its components for commercial purposes as defined below. Academic and non-profit institutions must obtain a license from LTI to acquire rights to use this product for any purpose other than those permitted above. For-Profit Institutions: The purchase price of this product includes limited, nontransferable rights for forprofit institutions to use only the purchased amount of the product up to but no more than 5000 l of CLONASE products per year per site to practice recombinational cloning solely for internal research purposes, but does not provide rights to perform amplification using primers containing recombination sites or portions thereof. Rights for performing amplification using primers containing att recombination sites or portions thereof solely for internal research purposes may be obtained by purchasing such primers from LTI or from a licensed supplier of such primers. LTI reserves all other rights and in particular, the purchaser of this product can not transfer or otherwise sell this product or its components to a third party and no rights are conveyed to the purchaser to use the product or its components for commercial purposes as defined below. For-Profit institutions must obtain a license from LTI to use this product for any purpose other than those permitted above. Commercial purposes means any activity for which a party receives consideration and may include, but is not limited to, (1) use of the product or its components in manufacturing, (2) use of the product or its components to provide a service, information or data, (3) use of the product or its components for diagnostic purposes, (4) transfer or sell vectors, clones, or libraries made with the product or components of the product, or (5) resell the product or its components, whether or not such product or its components are resold for use in research.
If the purchaser is not willing to accept these use limitations, LTI is willing to accept return of the product for a full refund. For information on obtaining a license, contact the Director of Licensing, 9800 Medical Center Drive, Rockville, MD 20850, phone (301) 610-8000, fax (301) 610-8383. Products 11827-011, 11804-010, 11806-015, 11807-013 are sold under patent license from Monsanto for research purposes only and no license for commercial use is included. Requests for licenses for commercial manufacture or use should be directed to Director, Monsanto Corporate Research, 800 N. Lindbergh, St. Louis, MO 63167. Products 11822-012, 11823-010, 11826-013, 11827-011, 11803-012, 11806-015, 11809-019 are provided with a license for research use only. Information in respect of licenses to use the product for purposes other than research may be obtained from F. Hoffmann-LaRoche Ltd, Corporate Licensing, 4002 Basel Switzerland. Vectors containing the His6 affinity purification tag are manufactured for Life Technologies by QIAGEN, Inc. Ni-NTA resin may be purchased from QIAGEN, Inc., 9600 De Soto Ave., Chatsworth, CA 91311. (800-4268157). The composition and/or use of the BL21-SI COMPETENT CELL is claimed in patents and patent applications licensed to Life Technologies, Inc. ("LTI") (i) by Brookhaven Science Associates, LLC (U.S. Patent Nos. 4,952,496 and 5,693,489 and U.S. Submission 08/784,201) and (ii) by The Council of Scientific and Industrial Research ("CSIR") (U.S. Patent No. 5,830,690.) The "T7 expression system" and its improvements are based on technology developed at Brookhaven National Laboratory under contract with the U.S. Department of Energy and separately by CSIR, and are the subject of patents and patent applications assigned to Brookhaven Science Associates, LLC ("BSA", see above) and CSIR respectively. By provisions of the Distribution License Agreements granted to Life Technologies, Inc. covering said patents and patent applications, LTI grants you a non-exclusive sub-license for the use of this technology, including the enclosed materials, based upon the following conditions: (i) University/Academic and Not-for-Profit Institutions: The purchase of this product conveys to University, Academic and Not-for-Profit Institutions the right to use the BL21-SI C OMPETENT CELLS only for internal non-commercial research purposes. (ii) For-Profit Organizations: For-profit organizations inside the United States must obtain a license from Brookhaven Science Associates, LLC prior to purchasing and using the BL21-SI COMPETENT CELLS, for research or commercial purposes. For information about obtaining the required license to purchase, use and practice the "T7 expression system", please contact The Office of Technology Transfer, Brookhaven National Laboratory, Bldg. 475D, P.O. Box 5000, Upton, New York, 11973-5000, Telephone (516) 3447134. (iii) Commercial Use: Commercial use of this product may require an additional license to the improvements. For information about obtaining a commercial license to purchase, use and practice the improvements to the "T7 expression system", please contact The Centre for Cellular and Molecular Biology, Uppal Road, Hybderabad, 500 007, India, Attention: Director, Telecopier 91-40-717-1195. (iv) Usage Restrictions: No materials that contain the cloned copy of the T7 gene 1, the gene for T7 RNA polymerase, may be distributed further to third parties outside of your laboratory, unless the recipient receives a copy of this sub-license and agrees to be bound by its terms. This limitation applies to strains BL21(DE3), BL21(DE3)pLysS and BL21(DE3)pLysE, CE6, BL21-SI Competent Cells and any derivatives that are made of them.
2. Overview
GATEWAY Cloning Technology is a powerful new methodology that greatly facilitates protein expression, cloning of PCR products, and analysis of gene function by replacing restriction endonucleases and ligase with site-specific recombination. The GATEWAY Cloning Technology provides:
Gene Transfer, in parallel, of one or more DNA Gene Gene GST sequences into multiple types of vectors His 6 Trx (Figure 1). Rapid, efficient cloning and expression of PCR products, of a wide range of sizes. L2 Gene L1 Gene Faithful maintenance of orientation and Gene reading frame of the transferred DNA ptrc Your Entry Vector sequence. Clone Generation of a high percentage of correct colonies (usually >99%), minimizing the need Gene Gene for screening. Gene FastBac Robust reactions that are simple to perform 2-Hybrid CMV-neo (works well using miniprep DNA). A completely versatile system. Virtually any standard cloning or expression vector can be Figure 1. Transferring a DNA Segment (Gene) converted to a GATEWAY-compatible vector between an Entry Clone and Multiple (creating a Destination Vector). DNA segments can be Destination Vectors. An "operating system" for the exchange and transferred from an Entry Clone into any number of immediate use of validated clones and recipient vectors (Destination Vectors) to generate expression vectors between different Expression Clones, or from Expression Clones back laboratories. Once gene sequences are into Entry Clones. converted to Entry Clones, they can be subcloned into virtually any type of Destination Vector, maintaining reading frame and orientation. Maximum flexibility to easily transfer DNA sequences from one expression vector into another. This greatly speeds validation of clones, for example, in a two-hybrid screen. Reactions can be automated.
GATEWAY Cloning Technology provides a versatile system for transferring DNA segments between vectors. Once in the system, DNA segments can be transferred from an Entry Clone into numerous vectors (e.g., for protein expression) or from the Expression vector back into Entry Clones. Several options are available for creating Entry Clones. These include: GATEWAY cloning (via the BP Reaction) of PCR products flanked by attB recombination sites to generate Entry Clones. Cloning by standard recombinant DNA methods of restriction enzyme-generated fragments directly into Entry Vectors. GATEWAY cloning (via the BP Reaction) into Entry Vectors of genes from genomic or cDNA libraries prepared in attB-containing GATEWAY vectors. (See the following sections.)
2.1
Two Reactions Constitute the GATEWAY Cloning System
The first reaction, the LR Reaction, (Figure 2) is the main pathway of this system. The LR Reaction is a recombination reaction between an Entry Clone and a Destination Vector (pDESTTM), mediated by the LR CLONASE mix of recombination proteins. This reaction transfers DNA segments (e.g., cDNA, genomic DNA, or gene sequences) in the Entry Clone to the Destination Vector, to create an Expression Clone. The sites labeled L, R, B, and P are respectively the attL, attR, attB, and attP recombination sites for bacteriophage lambda () in E. coli (See Section 2.2). These sites are specifically recognized by the recombination proteins that constitute the CLONASE Enzyme Mix cocktails. The GATEWAY cloning reactions are equivalent to concerted, highly specific, cutting and ligation reactions. Viewed in this way, the recombination proteins cut to the left and right of the gene in the Entry Clone and ligate it into the Destination Vector, creating a new Expression Clone. During this process, reading frame is maintained. The gene in an Expression Clone is flanked by attB1 and attB2 sites. The orientation of the gene is maintained throughout the subcloning, because attL1 reacts only with attR1, and attL2 reacts only with attR2.
Entry Clone
L1 L2
Gene
100 bp 100 bp
pENTR-gene
Destination Vector
R1 R2
ccdB
125 bp
Knr
125 bp
pDEST
Ap r
LR CLONASE Enzyme Mix
(Int, IHF, Xis)
Incubate ~60 min at 25C
By-product
P1
ccdB
P2 200 bp
Expression Clone
B1 B2
200 bp
Gene
25 bp 25 bp
+
Knr
pEXP-gene
Ap r
Transform E. coli
Ap r Colonies Next Day (>90% Correct Clones)
When an aliquot from the recombination reaction is introduced into E. coli, the desired transformants can be selected on plates containing ampicillin. The unreacted Destination Vector does not give ampicillin-resistant colonies, even though it carries the ampicillin-resistance gene, because it contains a gene lethal to E. coli, ccdB. Thus selection for ampicillin resistance selects for E. coli cells that carry the desired product, which usually comprise >99% of the colonies on the ampicillin plate.
Figure 2. GATEWAY Cloning Reactions: The LR Reaction. An Entry Clone, containing a gene flanked by recombination sites, recombines with a Destination Vector to yield an Expression Clone and a by-product plasmid. The result is that a gene sequence in the Entry Clone is transferred into an Expression Vector, donated by the Destination Vector. The by-product plasmid contains the ccdB gene, and hence gives rise to no colonies when using standard strains of E. coli.
Expression Clones can express either native or fusion proteins. For native (non-fusion) proteins, the coding sequence together with its translational start and stop signals is flanked by attB recombination sites. As a consequence, the attB1 sequence resides in the 5 untranslated region of the mRNA. In Nterminal fusion proteins, in contrast, the 25 bp attB1 site becomes part of the coding sequence and inserts an additional eight amino acids between the fusion domain and the protein encoded by a gene. For Cterminal fusions, the attB2 sequence adds an additional eight codons between the gene and the Cterminal fusion sequence.
Expression Clone
B1 B2
Gene
25 bp 25 bp
pEXP-gene
Donor Vector
Ap r
P1
P2
ccdB
200 bp 200 bp
pDONR
Kn r
BP CLONASE
Enzyme Mix
(Int + IHF)
Incubate ~60 min at 25C
By-product
R1 125 bp
ccdB
R2 125 bp
The second major pathway of the GATEWAY Cloning System is the BP Reaction, shown in Figure 3. Essentially the reverse of the LR Reaction, the BP Reaction transfers the gene in the Expression Clone (between attB sites) into a Donor vector (containing attP sites), to produce a new Entry Clone (attL sites). This reaction is catalyzed by the BP CLONASE mix of recombination proteins. Once a gene is flanked by attL sites as an Entry Clone, it can be transferred into new expression vectors by recombination with Destination Vectors (via the LR Reaction). A major use of the BP Reaction is for cloning PCR products as Entry Clones. PCR products made with primers containing terminal attB sites (25 nucleotides + 4 Gs) are efficient substrates for the BP reaction. The result is an Entry Clone containing the PCR fragment. Such Entry Clones can be readily recombined with Destination Vectors (through the LR Reaction) to yield Expression Clones of the PCR product. 2.2 Basis of GATEWAY Recombination Reactions
Entry Clone
L1 L2
+
Ap r
Gene
100 bp 100 bp
pENTR-gene
Kn r
Transform E. coli
Kn r Colonies Next Day (>90% Correct Clones)
The recombination reactions of the GATEWAY Cloning Technology are based on the site-specific recombination reactions of bacteriophage in E. coli. Bacteriophage can grow as a lytic phage, in which case the host cell is lysed, with the release of progeny virus. Alternatively, lambda can integrate site-specifically into the genome of E. coli by a process called lysogenization. In this lysogenic state, the phage genome can be transmitted to daughter cells for many generations, until conditions arise that trigger its excision from the genome. At this point, the virus enters the lytic part of its life cycle. The control of the switch between the lytic and lysogenic pathways is one of the best understood processes in molecular biology (Ptashne, M (1992) A Genetic Switch, Cell Press, Cambridge). See Figure 4. The integrative and excisive recombination reactions of phage are mediated by proteins encoded by phage and E. coli. These recombination reactions, performed in vitro, are the basis of the GATEWAY Cloning Technology. They can be represented as follows: attB x attP attL x attR (where x signifies recombination). The four att sites contain binding sites for the proteins that mediate the reactions. The wild type attP, attB, attL, and attR sites contain 243, 25, 100, and 168 base pairs, respectively. The attB x attP reaction
Figure 3. GATEWAY Cloning Reactions: The BP Reaction. A gene in an Expression Clone can be transferred into an Entry Vector by the BP Reaction. Only plasmids without the ccdB gene that are also kanamycin resistant (Knr) will yield colonies.
(integration) is mediated by the proteins Int and IHF. The attL x attR reaction (excision) is mediated by the proteins Int, IHF, and Xis. Int (integrase) and Xis (excisionase) are encoded by the genome, while IHF (integration host factor) is an E. coli protein. [For a general review of lambda recombination, see Landy, A. (1989) Annu. Rev. Biochem. 58, 913.] By using a combination of the LR and BP reactions, a gene or DNA segment can be easily moved between Entry Clones and Expression Clones. This versatility provides an operating system in which genes can be transferred easily into different vector backbones. (See Figure 5) 2.3 Details of the GATEWAY Cloning Reactions
Phage Lambda
attP
(243 bp)
E. coli Genome
attB (25 bp)
Integration (Int, IHF)
Excision (Int,Xis,IHF)
E. coli Genome
attL
(100 bp)
attR
(168 bp)
Lambda Genome
Figure 4. Bacteriophage Lambda Recombination in E. coli.
The LR CLONASE Enzyme Mix that mediates the GATEWAY LR Reaction contains recombination proteins Int, Xis, and the E. coli-encoded protein IHF. In contrast, the BP CLONASE Enzyme Mix, which mediates the BP Reaction (Figure 3) contains Int and IHF, alone.
Restriction Enzyme and Ligase Cloning
By-Product ccdB
attR1 attR2 attL1
Entry Clone
GENE
attL2
Destination Vector
ccdB
attR1 attR2
BP Reaction Donor Vector

ccdB
attP1 attP2 attB1
LR Reaction Expression Clone

GENE
attB2 attP1
By-Product
ccdB
attP2
PCR Product
GENE
attB1 attB2
Figure 5. GATEWAY Cloning Technology as an Operating System for Cloning and Subcloning Genes. Once a DNA segment is cloned into the GATEWAY system, it can be easily transferred from an Entry Clone into a Destination Vector (via the LR reaction) to generate an Expression clone. A DNA segment in an Expression Clone can be easily transferred into an attP pDONR vector (via the BP reaction) to generate an Entry Clone and then into different Destination Vectors, all without the need for restriction enzymes and ligase.
Note that the recombination reaction is conservative, i.e., there is no net synthesis or loss of base pairs. The DNA segments that flank the recombination sites are merely switched. The wild type recombination sites have been modified for purposes of the GATEWAY Cloning System, as follows: A part (43 bp) of attR has been removed, to make the excisive reaction irreversible and more efficient [Bushman, W., Thompson, J.F., Vargas, L., and Landy, A. (1985), Science 230, 906). The attR sites in GATEWAY Cloning System Destination Vectors are 125 bp in length. Mutations have been made to the core regions of the att sites to eliminate stop codons and to ensure specificity of the recombination reactions (i.e., attR1 reacts only with attL1, attR2 reacts only with attL2). Other mutations have been introduced into the short (5 bp) regions flanking the 15-bp core regions of the attB sites to minimize secondary structure formation in single-stranded forms of attB plasmids, e.g., in phagemid ssDNA or in mRNA.
The recombination (att) sites of each vector comprise a hybrid sequence, donated by the parental vectors. The staggered lines dividing the two portions of each att site, in Figure 2, Figure 3, and Figure 6 represent the seven-base staggered cut produced by Int during the recombination reactions. This structure is shown in greater detail in Figure 6, which displays the recombination sequences of an attB Expression Clone, generated by recombination between the attL1 and attL2 sites of an Entry Clone and the attR1 and attR2 sites of a Destination Vector. The gene in the Expression Clone is flanked by attB sites: attB1 to the left (amino terminus) and attB2 to the right (carboxy terminus). As shown, the bases within the 25-bp attB site that are adjacent to the gene are donated by the attL sites of the Entry Vector; whereas the attB sequences distal to the gene derive from the Destination Vector (attR). Within the attB sites, these two regions are demarcated by the seven-base staggered cut produced by Int during the recombination reaction. The sequence of both attB sites is displayed (Figure 6) in triplets corresponding to one of three possible open reading frames.
Figure 6. Sequences of attB1 and attB2 Sites Flanking a Gene after Subcloning into a Destination Vector to Create an Expression Clone.
If the reading frame of the gene cloned in the Entry Vector is in phase with the reading frame shown for attB1 (note the AAA-AAA-), amino-terminal protein fusions can be made between the gene and any Destination Vector encoding an amino-terminal fusion domain. An analogous convention is followed for
Gene
attL1 attL2 attR1
ccdB
attR2
making C-terminal fusions with Destination Vectors encoding C-terminal fusion domains (See Sections 2.7.2 and 5.2). Figure 7 illustrates how an Entry Clone and a Destination Vector recombine in the LR Reaction to form a co-integrate, which resolves through a second reaction into two daughter molecules. A similar process occurs during the BP Reaction. The two daughter molecules have the same structure regardless of which pair of sites, attL1 and attR1 or attL2 and attR2, react first to form the co-integrate. The segments change partners by these reactions, regardless of whether the parental molecules are both circular, one is circular and one is linear, or both are linear. Selection for ampicillin resistance carried on the Destination Vector, which also carries the ccdB gene, ensures survival of only the desired attB product plasmid. 2.4 Entry Vectors and Entry Clones
Entry Clone
attL2 X attR2
Destination Vector
Apr
Knr
Gene
attL1 attB2
Apr Knr
Co-integrate
attR1 attP2 ccdB
Gene
ccdB
attL1 X attR1
attB1 attB2
Expression Clone
Apr
attP1
By-product
Knr
attP2
The LR Reaction allows transfer of a gene sequence into new expression vectors by recombining an Entry Clone with various Destination Vectors. To participate in the LR Reaction, the DNA segment of interest must be flanked by attL1 and attL2 sites to create an Entry Clone. Entry Clones can be made in one of four ways, as shown in Figure 8. The first approach is to clone the gene into one or more of the Entry Vectors, using standard recombinant DNA methods, with restriction endonucleases and ligase. The starting DNA fragment can be generated by restriction endonuclease digestion or as a PCR product. The fragment is cloned between the attL1 and attL2 recombination sites in the Entry Vector. Note that the ccdB gene, provided to minimize background colonies from incompletely digested Entry Vector, must be excised and replaced by your DNA. A schematic of the Entry Vectors and summary of their features is shown in Figure 9. Five Entry Vectors currently are available, providing an array of cloning options. All carry the kanamycin resistance gene. Table 1 provides information on the available Entry Vectors and details of their cloning sites. Choosing the right Entry Vector is discussed in depth in Section 2.7.2.
Figure 7. DNA Molecules Participating in the LR Reaction. Two different co-integrates form during the LR Reaction (only one of which is shown here), depending on whether attL1 and attR1 or attL2 and attR2 are first to recombine.
Table 1. Available Entry Vectors Name pENTR1A pENTR2B pENTR3C Cloning Features Alternative reading frame vectors for N-terminal fusions. Multiple cloning site (MCS) immediately follows attL1. First restriction endonuclease cut site yields blunt ends. Expression Features N-terminal or C-terminal fusions in E. coli or eukaryotic cells. Native expression and carboxy fusions require addition of ribosome recognition sequence and ATG translation initiation codon.
pENTR4 pENTR11
MCS immediately follows attL1. First C-terminal fusions require that no stop restriction endonuclease site is Nco I. codons precede attL2. Two good E. coli and eukaryotic Native, N-terminal or C-terminal fusions in ribosome binding sites (SD and Kozak) E. coli or eukaryotic cells. downstream of attL1. Blunt and Nco I C-terminal fusions require that no stop sites each preceded by SD and Kozak. codons precede attL2. A second way to obtain Entry Clones is to prepare a cDNA library in an Entry (attL) Vector. Individual Entry Clones, as well as populations of Entry Clones, can be transferred directly into the desired Destination Vectors. The third approach to making an Entry Clone (Figure 8) is by PCR. This method is diagrammed in Figure 10. The DNA sequence is first amplified with PCR, using primers containing the 25-bp attB sequences (plus four terminal Gs). The PCR product is then converted to an Entry Clone by performing a BP Reaction, in which the attB-PCR product recombines with a Donor Vector containing attP sites. Details of this approach and protocols for PCR fragment subcloning are provided in Section 3.2. The fourth approach to making Entry Clones (Figure 8) is to use Expression Clones. These can be obtained from cDNA libraries prepared in GATEWAY Expression Vectors or from the product of an LR Reaction. DNAs flanked by attB sites can be introduced into an Entry
Gene
+
L1
+ Restriction Enzymes and Ligase
L1
cDNA Library
L2
Entry Clone/Library
Kn r
L2
1
L1
Entry Vector
Knr
Gene
L2
Entry Clone
Kn r
BP Reaction 4
B1
Gene
B2
B1
B2
Gene
Expression Clone/Library
Apr
attB PCR Product
P1
ccdB
P2
Donor Vector
Knr
Figure 8. Four Ways to Make Entry Clones: 1. Using restriction endonucleases and ligase. 2. Starting with a cDNA library prepared in an attL Entry Vector. 3. Using an Expression Clone from a library prepared in an attB expression vector via the BP Reaction. 4. Recombinational cloning of PCR fragments with terminal attB sites, via the BP Reaction. Approaches 3 and 4 rely on recombination with a Donor Vector that provides the Entry Vector carrying Knr.
10
Vector by recombination with a Donor Vector, via the BP Reaction. The BP Reaction protocols are given in Section 3.2. Expression Clone cDNA libraries (attB) are available from Life Technologies in GATEWAY vectors pCMVSPORT 6 or pSPORT-P. All Entry Vectors and Destination Vectors are constructed so that the N-terminal region of a cDNA insert will be positioned next to the attL1 site. All Entry Vectors contain the rrnB transcriptional terminator, upstream of the attL1 site. This sequence ensures that expression of cloned genes is reliably "off" in E. coli, to increase the likelihood that even toxic genes can be successfully cloned. Thus in contrast to Expression Clones, Entry Clones are designed to be transcriptionally silent. 2.5 Destination Vectors
Sal I BamH I Variable Kpn I Region N EcoR I
Xba I EcoR V Xho I Not I EcoR I
ccdB
attL
att
L2
rrnB
Entry Vector
ori Knr
Variable Region N Options: Blunt site close to attL1 site, in three possible reading frames (pENTR1A, 2B, 3C) Nco I site close to attL1 site (pENTR4) Blunt (Xmn I) and Nco I sites each preceded by E. coli and eukaryotic ribosome recognition site (pENTR11)
Once a gene has been cloned into an Entry Vector, it is ready to be Variable Region N options are summarized in the lower half of moved into any of the available the figure. Destination Vectors or into a Destination Vector that you construct (see Section 5.1). The upper-right portion of Figure 2 shows a schematic of the Destination Vectors. The thick arrow represents some function (often transcription or translation) that will act on cloned DNA. During the recombination reaction, the region between the attR1 and attR2 sites, including the ccdB gene, is replaced by the DNA segment from the Entry Clone. Selection for recombinants that have acquired ampicillin resistance (carried on the Destination Vector) and also lost the ccdB gene ensures that a high percentage (usually >99%) of the resulting colonies will contain the correct insert. The genes ccdA and ccdB are the antidote and toxin genes respectively of the E. coli F plasmid [Bernard, P., Kezdy, K.E., Van Melderen, L., Steyaert, J., Wyns, L., Pato, M.L., Higgins, P.N., Couturier, M. (1993) J. Mol. Biol. 234, 534]. Together they ensure that daughter cells that do not receive a copy of F will not survive. The CcdB protein interferes with the rejoining step of DNA gyrase, causing the chromosome to be cut to pieces. Plasmids that contain the ccdB gene without the antidote gene (Entry Vectors and Destination Vectors) can be propagated in the gyrase mutant, gyrA462 [Miki, T., Park, J.A., Nagao, K., Murayama, N., and Horiuchi, T. (1992) J. Mol. Biol. 225, 39]. We have constructed a gyrA462 strain, DB3.1, for propagating Destination Vectors and Entry Vectors: DB3.1: E. coli RR1 gyrA462 endA (recA-).
Figure 9. Schematic of Available Entry Vectors. Shown at the top are restriction sites flanking the ccdB gene that are common to all Entry Vectors. In addition, each Entry Vector has its own selection of cloning sites and other options residing next to the attL1 site (Variable Region N).
11
B1
B2
Gene
25 bp 25 bp
attB-PCR Product
+
rrnB
P1
Death ccdB
P2
200 bp
200 bp
Destination Vectors carry an inactive copy of the ccdA gene (caused by a frame shift) as well as an active ccdB gene. Entry Vectors carry only the ccdB gene, with its own promoter (Figure 9). To move a gene into a Destination Vector, Destination Vector DNA is mixed with Entry Clone DNA and incubated with LR CLONASE Enzyme Mix, followed by transformation into any standard E. coli strain. LIBRARY EFFICIENCY DH5 Competent Cells are recommended. Section 3 provides further details and protocols. Destination Vectors presently available from Life Technologies are summarized in Table 2. Maps and cloning site information for Destination Vectors are provided in Section 5, as well as methods for converting most standard vectors into Destination Vectors. 2.6 Protein Expression in the GATEWAY Cloning System Proteins are expressed in vivo as a result of two processes, transcription (DNA into RNA), and translation (RNA into protein).
Donor Vector
Knr
BP CLONASE
(Int + IHF)
R1 R2
ccdB
125 bp
L1
rrnB
125 bp
L2
Gene
100 bp 100 bp
By-product
Entry Clone
Kn r
Figure 10. Cloning A PCR Product by the BP Reaction. A PCR product with 25-bp terminal attB sites (+ 4Gs) is shown as a substrate for the BP Reaction. Recombination between the attBPCR product of a gene and a Donor Vector (which donates an Entry Vector that carries Knr) results in an Entry Clone of the PCR product.
Ribosomes convert the information present in mRNA into protein. Ribosomes scan RNA molecules looking for methionine (AUG) codons, which begin nearly all nascent proteins. Ribosomes must, however, be able to distinguish between AUG codons that code for methionine in the middle of proteins from those at the start. Most often ribosomes choose AUGs that are 1) first in the RNA (toward the 5 end) and 2) have the proper sequence context. In E. coli the favored context [first recognized by Shine and Dalgarno, (1975) Eur. J. Biochem, 57, 221] is a run of purines (As and Gs) from five to 12 bases upstream of the initiating AUG, especially AGGAGG or some variant. In eukaryotes, a survey of translated mRNAs by Kozak [(1991) J. Biol. Chem. 266, 19867] has revealed a preferred sequence context: --- GCC ACC ATG G-- around the initiating methionine, with the A at -3 being most important, and a purine at +4 (where the A of the ATG is +1), preferably a guanine (G), being next most influential. Having an A at -3 is enough to make most ribosomes choose the first AUG of an mRNA in plants, insects, yeast, and mammals. [For a review of initiation of protein synthesis in eukaryotic cells, see Pain, V.M. (1996) Eur. J. Biochem. 236, 747.]
12
Table 2. Available Destination Vectors Name pDEST14 pDEST15 pDEST17 pDEST8 pDEST10 pDEST20 pDEST12.2 pDEST26 pDEST27 Expression in E. coli E. coli E. coli insect cells insect cells insect cells mammalian cells mammalian cells mammalian cells Features Native protein expression with T7 promoter ori pBR Antibiotic Resistance Amp Amp Amp Amp Amp Amp Amp Amp Amp
N-terminal Glutathione-S-transferase fusion expression pBR with T7 promoter N-terminal 6X histidine affinity tag fusion expression pBR with T7 promoter Native protein expression with polyhedron promoter for pUC baculovirus expression N-terminal 6X histidine affinity tag fusion expression pUC with polyhedron promoter for baculovirus expression N-terminal Glutathione-S-transferase fusion expression pUC with polyhedron promoter for baculovirus expression Native expression with SV40 promoter/ori and neo pUC resistance N-terminal 6X histidine affinity tag fusion expression pUC with SV40 promoter/ori and neo resistance N-terminal Glutathione-S-transferase fusion expression pUC with SV40 promoter/ori and neo resistance
2.7 Considerations in Designing Entry Clones 2.7.1 Location of Translation Start Sequences
Ribosome binding-site sequences (Shine-Dalgarno in E. coli and Kozak in eukaryotes) must lie close to the initiating ATG. The attB site is 25 base pairs long. Therefore, if translation is to initiate at the native ATG within a gene of interest, the ribosome binding site (RBS) sequence close to the ATG needs to be positioned between the attL1 and attL2 sites in the Entry Clone of that gene. If the Destination Vector provides a promoter but no N-terminal fusion sequence, protein synthesis will initiate exclusively at the translation start signals of the native open reading frame (ORF). If the Destination Vector encodes an N-terminal fusion peptide, however, protein synthesis may begin not only at the N-terminal fusion sequence, but to some degree at the internal, native ATG as well. Even though ribosomes most often initiate protein synthesis at the 5'-most ATG, internal ATGs can also serve to initiate protein synthesis. The better the translation context around the internal ATG, the more internal initiation of translation will be seen. Whether to construct different Entry Clones to express native protein and N-terminal fusion protein is an important consideration in designing Entry Clones. The presence of internal start sequences in N-terminal fusion constructs will sometimes result in a significant amount of native protein being made, contaminating and lowering the yield of the N-terminal fusion protein. This problem can be more pronounced with short N-terminal fusion tags, such as the 6X histidine affinity tag.
13
2.7.2
Reading frame
When making fusions it is essential to maintain the correct reading frame in the Entry Vectors. For native expression any reading frame is acceptable since translation starts and stops between the two att sites. For fusions the reading frame of the DNA cloned into all GATEWAY vectors must be in phase with the reading frame of the attB1 site shown in Figure 6, such that the six As of the site are split into two lysine codons (AAA - AAA). All of the Destination Vectors that make amino-terminal fusions have been constructed so that the attR1 site is in this reading frame. Figure 15 presents the attR1 and attR2 sequences present within the three GATEWAY Reading Frame Cassettes used to create new Destination Vectors. Therefore, if a gene is cloned into an Entry Vector so that the --- AAA - AAA --- reading frame within the attL1 site is in phase with the reading frame of the gene, amino terminal fusions will automatically be correctly phased, for all N-terminal fusion tags. Likewise, for C-terminal fusion Destination Vectors, the C-terminal coding sequences should be aligned in phase with the -TAC-AAA- sequence of the attR2 site, which translates into Tyr-Lys- (See Figure 6 and Figure 15). 2.7.3 Examples of Sequences for Different Protein Constructs
The following examples of Expression Clone sequences and attB-PCR primer sequences (for preparing Entry Clones) have been used successfully to express both native and fusion proteins in various cellular contexts using the GATEWAY Cloning System. Other sequence options and motif combinations are possible, and may be preferable in some situations. The examples below are offered only as a starting point for recombinant protein expression in the GATEWAY Cloning System.
Figure 11. Examples of Different Protein Expression Constructs
1. Native expression in prokaryotic, insect, and mammalian cells: A. Expression clone structure: attB1 (promoter)
RBS ATG
Open Reading Frame
Stop
attB2
B. Expression clone sequence:

Shine-Dalgarno Kozak Open reading frame (amino end) 5' - ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG NNN NNN NNN --3' - TGT TCA AAC ATG TTT TTT CGT CCG AAG GTT CCT CTA TCT TGG TAC NNN NNN NNN --attB1 Translation start* Open reading frame (carboxy end) --- NNN NNN NNN TAG GAC CCA GCT TTC TTG TAC AAA GTG GT - 3' --- NNN NNN NNN ATC CTG GGT CGA AAG AAC ATG TTT CAC CA - 5' Translation stop attB2
*Note: By placing the ATG in frame with the attB1sequence this construction can be used in both native and N-terminal fusion expression vectors.
14
C. Suggested oligonucleotides for attB-PCR cloning of gene for native expression

attB1 forward oligo: (attB1 sequence bold; translation start codon underlined; sequence includes SD and Kozak) 5' - GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAGGAGATAGAACCATG(18-25 gene-specific nucleotides in frame with start codon) - 3' attB2 reverse oligo: (attB2 sequence bold; translation stop codon [complement strand] underlined) 5' - GGGGACCACTTTGTACAAGAAAGCTGGGTCCTA(18-25 gene-specific nucleotides [complement strand] in frame with stop codon) - 3'
2. N-terminal and C-terminal fusion expression in prokaryotic, insect, and mammalian cells: A. Expression clone structure:
GST His6 Txn
attB1 Open Reading Frame
attB2 HA
Myc
(promoter)
RBS
ATG
Stop
B. Expression clone sequence:

Open reading frame (amino end) 5' ATG NNN --- --- NNN ACA AGT TTG TAC AAA AAA GCA GGC TTC NNN NNN NNN --3' TAC NNN --- --- NNN TGT TCA AAC ATG TTT TTT CGT CCG AAG NNN NNN NNN --N-fusion attB1
Open reading frame (carboxy end) --- NNN NNN NNN GAC CCA GCT TTC TTG TAC AAA GTG GTN NNN --- --- NNN (Stop) - 3' --- NNN NNN NNN CTG GGT CGA AAG AAC ATG TTT CAC CAN NNN --- --- NNN NNN - 5' attB2 C-fusion
C. Suggested oligonucleotides for attB-PCR cloning of gene for N-terminal and C-terminal fusion expression
attB1 forward oligo: (attB1 sequence bold) 5' - GGGGACAAGTTTGTACAAAAAAGCAGGCTTA (18-25 gene specific nucleotides in frame with attB1) - 3' attB2 reverse oligo: (attB2 sequence bold) 5' - GGGGACCACTTTGTACAAGAAAGCTGGGTC (18-25 gene specific nucleotides [complement strand] in frame with attB2) - 3'
Note: Other nucleotides may be substituted for the underlined sequences as long as the reading frame is maintained and the substituted sequences do not create a stop codon.
15
2.7.4
Transcription from Entry Clones
Many standard expression vectors use the lac promoter to control expression of cloned genes. Transcription from the lac promoter is turned on by adding the inducer IPTG. Even in the absence of inducer, however, a low level of mRNA is made, i.e., the lac promoter is never completely off. The result of this "leakiness" is that genes whose expression is harmful to E. coli may prove difficult or impossible to clone in vectors that contain the lac promoter, or they may be cloned only as inactive mutants. In contrast to other gene expression systems, genes cloned into an Entry Vector are designed not to be expressed. The presence of the strong transcriptional terminator rrnB [Orosz, A., Boros, I., and Venetianer, P. (1991) Eur. J. Biochem. 201, 653] just upstream of the attL1 site in Entry Vectors and Entry Clones is designed to prevent transcription from vector promoters from reaching the cloned gene. 2.8 Choosing the Right Entry Vector The choice of Entry Vector is dictated by the particular DNA and what is to be done with it (see sidebar). These factors are critical when transferring a gene from an Entry Clone to a Destination Vector, because all the base pairs between the gene and the Int cut sites in attL1 and attL2 (such as in Figure 6) move also.
Considerations in Choosing an Entry Vector: The DNA: Does it contain a gene? Is the sequence known? Is the reading frame known? Are there 5 and 3 untranslated regions? Do these regions contain stop codons? Does the gene fragment carry its own promoter and/or translation signals? Is the DNA a restriction fragment, or a PCR product? Are there unique restriction endonuclease sites at the amino and carboxy ends?
For example, translation start signals present in an Entry Clone will be translated into amino acids if an aminoterminal fusion to the gene is constructed. Deciding whether to express a gene as a fusion protein, native protein, or both How is the gene to be expressed? (See Figure 12), dictates whether In eukaryotes or in E. coli? translational start sequences must be As native protein, or as a fusion protein? included between the attL sites of the With or without a protease cleavage site? clone (native protein) or supplied by a Destination Vector (fusion protein). Entry Clones that include translational start sequences may prove less suitable for making fusion proteins, as internal initiation of translation at these sites can decrease the yield of N-terminal fusion protein, as discussed above. 2.8.1 Features of the Entry Vectors
All Entry vectors have restriction sites to the left and right of the ccdB gene to allow directional cloning of the DNA. Each vector enables amino or carboxy fusions when transferred into the appropriate Destination Vector if the cloned DNA maintains the reading frame registers shown in Figures 19-23. The cloning sites of the Entry Vectors are organized in two groups that flank a copy of the ccdB gene. The CcdB protein interferes with DNA gyrase and thereby inhibits growth of E. coli. The Entry Vectors are positive selection vectors; therefore, undigested or partially digested molecules will not generate
16
Native Protein Expression:

ATG Term
attB1
Pro
rbs
cDNA
attB2
transformants in standard E. coli strains (e.g., DH5). For carboxy-terminal fusions, stop codons must be absent from the cloned gene. Table 1 lists the available Entry Vectors, and more detailed sequence information. The location of cloning sites is presented in Figures 19-23. pENTR1A, pENTR2B, and pENTR3C are almost identical, except that the restriction sites at the 5'-end of the MCS (prior to the ccdB gene) are in different reading frames.
Ap r
Fusion Protein Expression:

ATG
rbs
attB1
cDNA
attB2
Term
Pro
His 6 GST Txn
Myc HA
Ap r
Figure 12. Two Types of GATEWAY Protein Expression. Native Protein Expression (upper figure): All the translational start signals are included between the attB1 and attB2 sites. Therefore these signals must be present in the starting Entry Clone. Fusion Protein Expression (lower figure): This example illustrates expression with both N-terminal and C-terminal fusion tags, so that ribosomes read through attB1 as well as attB2 to create the fusion protein. Unlike native protein expression vectors, N-terminal fusion vectors have their translational start signals upstream of the attB1 site. Likewise, C-terminal fusion vectors have the termination signals downstream of the attB2 site.
pENTR4 is essentially identical to 1A, except that the blunt Dra I site has been replaced with an Nco I site containing the ATG methionine codon. Genes that contain this site at the initiating ATG can be conveniently cloned in this Entry Vector. The Nco I site in pENTR4 is especially useful for expression of genes in eukaryotic cells, since it contains many of the bases that give efficient translation. pENTR11 is useful for expression of both native and fusion proteins in E. coli and eukaryotic cells. 2.8.2 Entry Vector pENTR11
As an example, consider pENTR11 (Figure 23). Here is what can be done with it:
Clone cDNAs from most commercially available libraries. The sites to the left and right of the ccdB gene have been chosen so that directional cloning is possible. Clone genes directionally: Sal I, BamH I, Xmn I (blunt), or Kpn I on the left of ccdB; Not I, Xho I, Xba I, or EcoR V (blunt), on the right. Clone genes or gene fragments with a blunt amino end at the Xmn I site. The Xmn I site has four of the six most favored bases for eukaryotic expression (see Section 2.6), so that if the first three bases of the DNA are ATG, the open reading frame will be expressed in mammalian, insect, yeast, etc., cells when it is transcribed in the appropriate Destination Vector. In addition, a Shine-Dalgarno sequence is situated 8 bp upstream, for initiating protein synthesis in E. coli at an ATG. Clone cDNAs that have an Nco I site at the initiating ATG into the Nco I site. Similar to the Xmn I site, this site has four of the six most favored bases for eukaryotic expression. Also, a ShineDalgarno sequence is situated 8 bp upstream, for initiating protein synthesis in E. coli using an ORF with a 5 ATG .
17
Select against uncut or singly cut Entry Vector molecules during cloning with restriction endonucleases and ligase. If the ccdB gene is not removed with a double digest, it will kill any recipient E. coli cell. Enable amino fusions with ORFs in all cloning sites. There are no stop codons (in the attL1 reading frame) upstream of the ccdB gene. Enable carboxy fusions with ORFs positioned in phase with the reading frame convention for Cterminal fusions, indicated in Figure 23. 2.9 GATEWAY Nomenclature
For subclones, the following naming convention has been adopted: the name of the vector is placed first, followed by the name of the transferred gene. Plasmid Type attL Vector attL subclone Descriptive Name Entry Vectors Entry Clones Individual Vector or Clone Names pENTR1,2,... (nos. 1-99) pENTR3-gus, .. ; pENTR201-gus (where the number 3 refers to the Entry Vector and 201 refers to the Donor Vector used to make the Entry subclone; gus is the subcloned gene) attR Vector attB Vector Destination Vectors Expression Vectors pDEST1,2,3,... pEXP501, 502, (nos. 501-599). These vectors are used to prepare Expression cDNA libraries. pEXP3-cat, ... [where 3 refers to the Destination Vector (pDEST3) used to make the expression subclone and cat is the subcloned gene] pDONR201
attB subclone
Expression Clones
attP Vector Other Names: Name LR Reaction BP Reaction
Donor Vectors
Reacting Sites attL x attR attB x attP
Catalyzed by
Desired Product
Structure of Desired Product attB1-gene-attB2 attL1-gene-attL2
LR CLONASE Expression Clone Enzyme Mix BP CLONASE Entry Clone Enzyme Mix
Examples: An LR Reaction: pENTR201-tet x pDEST10 pEXP10-tet Two BP Reactions: attB-p53 PCR product x pDONR205 pENTR205-p53 pEXP14-lacZ x pDONR201 pENTR201-lacZ
18
3. Methods
3.1 General Comments See www.lifetech.com/gateway for current information on additions/modifications to the protocols and an increasing selection of GATEWAY-compatible vectors and libraries. Purification of DNA: When preparing plasmid DNAs for use in the G ATEWAY System reactions, DNA purified by CONCERT Rapid Plasmid Systems is recommended. Miniprep DNA prepared by standard alkaline lysis protocols, with or without RNase treatment, can be used as well. During alkaline lysis treatment, we recommend a final concentration of NaOH no higher than 0.125 M, to minimize irreversible denaturation of the supercoiled plasmid DNA. DNA Topology: For LR reactions, the most efficient substrates are supercoiled, relaxed, or linear Entry Vectors (attL) and relaxed or linear Destination Vectors (attR). Reactions in which the Destination Vector is supercoiled give five to ten-fold fewer colonies. For BP Reactions, the attB vectors should be linear (PCR products or Expression Clones linearized by restriction endonucleases), while the attP-containing pDONR Vector must be supercoiled. Expression Clones (attB) can be used as supercoiled or relaxed (i.e., with Topoisomerase I) molecules, but will react less efficiently than linearized Expression Clones. Linearized Destination Vector can be obtained by cleaving at a restriction site within the region of the GATEWAY Cassette, taking care to avoid the ccdB gene. All Destination Vectors from Life Technologies are provided already linearized in this manner. When suitable single-cut restriction sites are unavailable or unknown, as with complex mixtures of plasmids or cDNA libraries, the DNA may be relaxed by brief treatment with Topoisomerase I. Primers: Primers for attB PCR should have 18-25 bases of gene-specific sequence and 29 bases attB sequence (includes four Gs). Generally, 50 nmol of standard purity oligos are adequate for most applications. Oligos should be dissolved to a concentration of 20-50 M and the concentration verified by spectrophotometry. For cloning of large PCR products (>5 kb), colony output can be increased if oligos (>65 bases) are further purified (i.e., HPLC or PAGE). Incubation time: In the following protocols we recommend incubating the GATEWAY reactions for 60 min at 25C. This will generally give sufficient colonies when transforming E. coli competent at 108 CFU/g or higher, virtually all of which should contain the correct subclone. In some circumstances, however, you may wish to convert a higher percentage of starting plasmid carrying your gene to product. This can be achieved by incubating for longer periods, such as for 4-6 h, or overnight. An overnight incubation often gives five-fold or more product than a one-hour incubation. Longer incubation times are recommended for LR and BP Reactions involving large plasmids (10 kb), for BP Cloning of large PCR products (5 kb), and for transfer of diverse populations of genes, such as cDNA libraries.
19
3.2
Creating an Entry Clone
Entry clones can be created in one of four ways: 1) Cloning into Entry Vectors with restriction endonucleases and ligase, 2) cloning cDNA libraries into Entry Vectors using restriction endonucleases and ligase, 3) transferring genes from Expression Clones into Entry Vectors via the BP Reaction, or 4) cloning attB-PCR products via the BP Reaction. Restriction endonuclease fragments or PCR products can be cloned into an Entry vector. The PCR fragment will be either cloned as a blunt-end fragment or require digestion with restriction endonucleases (e.g., at sites incorporated into the primer). All the Entry Vectors contain the ccdB gene as a stuffer between the left and right restriction sites. The advantage of this arrangement is that there is virtually no background from vector that has not been digested with both restriction endonucleases, because the presence of the ccdB gene will inhibit the growth of all standard E. coli strains. Thus, it is necessary to cut each Entry Vector twice in order to remove the ccdB gene fragment during cloning. It is strongly recommended that after digestion of the Entry Vector with the second restriction endonuclease, the reaction be treated with phosphatase (calf intestine alkaline phosphatase, CIAP or thermosensitive alkaline phosphatase, TSAP). The phosphatase can be added directly to the reaction mixture, incubated for an additional time, and inactivated. This step dephosphorylates both the vector and ccdB fragments, so that during subsequent ligation there is less competition between the ccdB fragment and the DNA of interest for the termini of the Entry Vector. 3.2.1 Cloning Genes into Entry Vectors using Restriction Endonucleases and Ligase
A. Cloning of a Restriction Endonuclease DNA Fragment: 1. Prepare Entry Vector and the DNA fragment to be cloned by digesting 0.5-1.0 g DNA with the selected restriction endonucleases under the appropriate conditions. 2. De-phosphorylate the Entry Vector DNA. 3. DNA fragments to be cloned can be purified by agarose gel electrophoresis and the fragments of interest recovered from the gel using the CONCERT Matrix Gel Extraction System. 4. Ligate the prepared Entry Vector and insert fragments under appropriate conditions. 5. Transform into LIBRARY EFFICIENCY DH5 Competent Cells using standard conditions and plate transformants on LB plates containing 50 g/ml kanamycin. B. Blunt Cloning of PCR products: Prepare the Entry Vector so that the cloning ends are blunt. Digest Entry Vector with appropriate restriction endonuclease as described in the previous section. If the restriction endonucleases are not blunt-cutters, make ends flush with either T4 DNA Polymerase or Klenow Fragment. Dephosphorylate the Entry Vector. Generally PCR products do not have 5 phosphates (because the primers are usually 5-OH), and they are not necessarily blunt. (On this latter point, see Brownstein, M.J., Carpten, J.D., and Smith, J.R. (1996) Biotechniques 20, 1004 for a discussion of how the sequence of the primers affects the addition of single 3 bases.) The following protocol repairs these two defects. 1. In a 0.5-ml tube, ethanol-precipitate about 40 ng of PCR product (as judged from an agarose gel).
20
2. Dissolve the precipitated DNA in 10 l comprising 1 l 10 mM rATP, 1 l mixed 2 mM dNTPs (i.e., 2 mM each dATP, dCTP, dTTP, and dGTP), 2 l 5X T4 Forward Reaction Buffer (350 mM Tris-HCl (pH 7.6), 50 mM MgCl2, 500 mM KCl, 5 mM 2-mercaptoethanol), 10 units T4 polynucleotide kinase, 1 l T4 DNA polymerase, and water to 10 l. 3. Incubate the tube at 37C for 10 min, then at 65C for 15 min, cool, centrifuge briefly to bring any condensate to the tip of the tube. 4. Add 5 l of 30% PEG 8000/30 mM MgCl2, mix and centrifuge at room temperature for 10 min. Carefully remove and discard supernatant. 5. Dissolve the invisible precipitate in 10 l containing 2 l 5X T4 DNA ligase buffer, 0.5 units T4 DNA ligase, and about 50 ng of blunt, dephosphorylated Entry Vector. 6. Incubate at 25C for 1 h, then at 65C for 10 min. 7. Add 40 l TE, transform 2 l into 100 l of of LIBRARY EFFICIENCY DH5 Competent Cells following the suggested protocol. [TE is 10 mM Tris-HCl (pH 7.5), 1 mM EDTA.] 8. Plate on LB plates containing 50 g/ml kanamycin. 9. Isolate miniprep DNA from single colonies (Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York). Treat the miniprep with RNase A and store in TE. Cut with the appropriate restriction endonuclease to determine the orientation of the PCR fragment. Choose clones with the attL1 site next to the amino end of the open reading frame. Note: In the above protocol, the ends of the PCR product are simultaneously polished (through the exo and polymerase activities of T4 DNA polymerase) and the 5' ends phosphorylated (using T4 polynucleotide kinase). It is necessary to inactivate the kinase, so that the blunt, dephosphorylated vector cannot self-ligate. The PEG precipitation removes all small molecules (primers, nucleotides), and can improve the colony output of cloned PCR product by 50-fold. C. Cloning PCR Products Digested with Restriction Endonucleases: The Entry Vector is prepared as described in Section A or B above. Efficient cloning of PCR products that have been digested with restriction endonucleases includes three steps: inactivation of Taq DNA polymerase, efficient restriction endonuclease cutting, and removal of small DNA fragments. Inactivation of Taq DNA Polymerase: Carryover of Taq DNA polymerase and dNTPs into a restriction endonuclease digestion significantly reduces the success in cloning a PCR product [Fox, D., Nathan, M., Natarajan, P., Bracete, A., and Mertz, L. (1998) FOCUS 20, 15], because Taq DNA polymerase can fill in sticky ends and add bases to blunt ends. Either TAQUENCH PCR Cloning Enhancer or extraction with phenol can be used to inactivate the Taq DNA polymerase. Option A: Inactivation with TAQUENCH PCR Cloning Enhancer A1. Add 2 l TAQUENCH PCR Cloning Enhancer. A2. Perform restriction digest, using 10 to 50 units of restriction endonuclease and standard protocols, and incubate for at least 1 h. A3. Dilute reaction four-fold with TE.
21
A4. Add 1/2 volume of 30% PEG 8000/30 mM MgCl2. Mix well and immediately centrifuge at room temperature for 10 min. Discard the supernatant (pellet is usually invisible), centrifuge again for a few seconds, and discard any remaining supernatant. A5. Dissolve the DNA in a suitable volume of TE (depending on the amount of PCR product in the original amplification reaction) and apply an aliquot to an agarose gel to confirm recovery. Apply to the same gel 20-100 ng of the appropriate Entry Vector that will be used for the cloning. Option B: Extraction with Phenol B1. Dilute the PCR reaction to 200 l with TE. Add an equal volume of phenol:chloroform:isoamyl alcohol, vortex vigorously for 20 s, and centrifuge for 1 min at room temperature. Discard the lower phase. Extract the phenol from the DNA and concentrate as follows: Add an equal volume of 2-butanol (colored red with Oil Red O from Aldrich, if desired), vortex briefly, centrifuge briefly at room temperature. Discard the upper butanol phase. Repeat the extraction with 2-butanol. This time the volume of the lower aqueous phase should decrease significantly. Discard the upper 2-butanol phase. Ethanol-precipitate the DNA from the aqueous phase of the above extractions. Dissolve in 200 l of a suitable restriction endonuclease buffer. Then digest with the appropriate restriction endonuclease, followed by inactivation of the restriction endonuclease, and ligation of the DNA to the Entry Vector.
B2.
B3.
Efficient Restriction Endonuclease Cutting: Extra bases on the 5-end of each PCR primer help the restriction endonucleases cut near ends of PCR products. With the availability of inexpensive primers, adding six to nine bases on the 5 sides of the restriction sites is a good investment to ensure that most of the ends are digested. Incubation of the DNA with a five-fold excess of restriction endonuclease for an hour or more helps ensure success. Removal of Small Molecules before Ligation: Primers, nucleotides, primer-dimers, and small fragments produced by the restriction endonuclease digestion, can all inhibit or compete with the desired ligation of the PCR product to the cloning vector. This protocol uses PEG precipitation to remove small molecules. 1. Add 150 l of TE to 50 l PCR reaction 2. Add 100 l 30% PEG 8000/30 mM MgCl2. Mix well and centrifuge immediately at 10,000 g for 10 min at room temperature. Remove the supernatant (pellet is clear and nearly invisible) 3. Dissolve the pellet in 50 l TE and check recovery on a gel. 3.2.2 Cloning cDNA Libraries into Entry Vectors using Restriction Endonucleases and Ligase
The cDNA library can be constructed using standard methodology such as the SUPERSCRIPT Plasmid System for cDNA Synthesis and Plasmid Cloning with an oligo(dT) primer adapter containing a Not I site for first strand synthesis and ligation of Sal I adapters after second strand synthesis. The Entry Vector is digested with Sal I and Not I which removes the ccdB gene and the cDNA library is ligated into the vector. The Sal I-Not I sites in the Entry vectors are oriented so that the 5'-end of the cDNA (Sal I end) is closest to the attL1 site.
22
3.2.3
Transferring DNA from an Expression Clone into an Entry Vector via the BP Reaction
The BP Reaction converts an Expression Clone to an Entry Clone. This reaction is useful when transferring a gene present in an attB Expression Clone into other expression vectors. After converting the gene into an attL Entry Clone, via the BP Reaction, the gene can be subcloned into new expression vectors by performing an LR Reaction, thereby obtaining new attB Expression Clones. An Expression Clone has the gene of interest flanked by attB sites. Expression Clones (attB) can be used as supercoiled or relaxed (i.e., nicked or treated with Topoisomerase I) molecules, but will react most efficiently when linearized. To linearize Expression Clones, the Expression Vector must cut outside the attB region. 1. Digest 1-2 g of the Expression Clone with a unique restriction endonuclease that does not cut within the gene of interest. 2. Ethanol-precipitate the DNA after digestion and dissolve DNA in TE. The most common cause of an unsuccessful BP Cloning Reaction is failure to plate the reaction transformations on plates containing kanamycin. Materials needed: BP Reaction Buffer attB Expression Clone DNA, 10 ng/l, in TE pEXP7-tet Positive Control, linearized with Sca I, 50 ng/l. The tetR insert is 1.4 kb, and includes its own promoter. pDONR201 Vector, 150 ng/l, supercoiled BP CLONASE Enzyme Mix (stored at -70C) Proteinase K Solution pUC19 DNA, 10 pg/l LIBRARY EFFICIENCY DH5 Competent Cells (1 108 CFU/g) S.O.C Medium for culturing transformations LB plates containing 50 g/ml kanamycin
23
Negative Control Component pEXP7-tet Positive Control, 50 ng/l attB Expression Clone DNA, linearized, 10 ng/l pDONR201 Vector, 150 ng/l BP Reaction Buffer TE BP CLONASE Enzyme Mix (store at -70C, add last) Total Volume Tube 1 2 l 4 l 10 l 4 l 20 l
Positive Control Tube 2 2 l 2 l 4 l 8 l 4 l 20 l
Test Tube 3 1 - 10 l 2 l 4 l To 16 l 4 l 20 l
Procedure: 1. Compose the reactions on ice. 2. Add TE, BP Reaction Buffer, Donor Vector, and attB DNAs, and mix well. 3. Remove the BP CLONASE Enzyme Mix from the -70C freezer and allow to thaw on ice (~2 min). 4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice. 5. Add 4 l of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to -70C freezer. 6. Incubate tubes at 25C for 60 min. 7. Add 2 l Proteinase K Solution. Incubate for 10 min at 37C. 8. Transform 1 l of BP Reaction into 50 l of LIBRARY EFFICIENCY DH5 Competent Cells using Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42C for 30 s. Place on ice for 1-2 min. Add 450 l S.O.C. Medium and incubate at 37C for 1 h. 9. Spread 10 l and 100 l on LB plates containing 50 g/ml kanamycin. (If the E. coli cells have a transformation efficiency of 108 CFU/g, the BP Reaction should give about 3,000 colonies if the entire transformation is plated.) 10. Also transform 2 l of pUC19 DNA into 50 l of LIBRARY EFFICIENCY DH5 Competent Cells, as above. Plate 10 l and 100 l on LB plates containing 100 g/ml ampicillin. (Cells with a tranformation efficiency of 108 CFU/g should yield about 2,000 colonies if the entire transformation is plated.) 3.2.4 Cloning of attB-PCR Products via the BP Reaction
Addition of 5-terminal attB sequences to PCR primers allows synthesis of a PCR product that is an efficient substrate for recombination with a Donor Vector in the presence of BP CLONASE Enzyme Mix. This reaction produces an Entry Clone of the PCR product (See Figure 10).
24
A. Preparation of attB-PCR Products: The attB1 and attB2 primer sequences are given in Figure 13. The four guanine (G) residues at the 5 end of these primers are required to make the minimal 25-bp attB sequences an efficient GATEWAY Cloning System substrate. Figure 13. attB Sequences to Add to Primers for PCR Cloning into an Entry Vector attB1: 5-GGGG -ACA-AGT-TTG -TAC-AAA-AAA-GCA-GGC-TNN--(template-specific sequence)-3
attB2: 5-GGGG -AC -CAC- TTT- GTA- CAA-GAA-AGC-TGG- GTN--(template-specific sequence)-3 Add the attB1 sequence to the amino (forward) primer and the attB2 sequence to the carboxy (reverse) primer. Note: These GATEWAY attB1 and attB2 modifications to primers are available from Life Technologies. Note: The attB1 primer ends with a single thymidine (T), which requires the donation of two additional nucleotides from the remainder of the primer sequence to maintain proper reading frame. These two nucleotides cannot be AA, AG, or GA, because these additions would create a termination codon. Similarly, for C-terminal fusions, the attB2 primer requires one nucleotide from the rest of the primer to maintain the proper reading frame into the attB2 region. For generating N-fusion proteins the attB1 site must maintain the reading frame register shown above. In this reading frame, the six As of the attB1 sequence are read as -AAA - AAA- , and translated into -LysLys-. Because all of the N-terminal fusion Destination Vectors available from Life Technologies adhere to this convention, all subclones into these Destination Vectors will automatically align the reading frame of the N-terminal coding sequence in phase with the correct reading frame of your gene. Likewise, to join the PCR product in the correct reading frame with a C-terminal fusion Destination Vector, the C-terminal coding sequences of these vectors must be aligned in phase with the -TTT-GTAsequence of the attB2 primer sequence, shown above. This means that the complementary strand, which is the sense strand, will be read as -TAC-AAA-, translating into Tyr-Lys- (See Figure 15). For this purpose, any in-phase termination codons present between the coding region of the PCR sequence and the attB2 region will also need to be eliminated. Note that it is possible to install a protease cleavage sequence, such as that for the highly specific TEV Protease, to permit the removal of N-terminal or C-terminal peptides from the fusion proteins. To do this, you will need to include such a sequence between the gene-specific portion and the attB portion of your PCR primers. As a result, the cleavage sequence will reside between the att sequence and the gene sequence, and consequently will always transfer together with the cDNA into various Destination Vectors. For examples of attB-PCR primer sequences used to construct native and fusion protein expression clones for use in different cellular contexts, refer to Section 2.7.3.) Standard PCR conditions and polymerases may be used to prepare the attB-PCR product. Likewise, genomic DNA, mRNA, cDNA libraries, and cloned DNA sequences have all been used successfully as substrates for amplification with attB-containing primers. The suggested polymerase for amplification of PCR products <5-6 kb is PLATINUM Pfx DNA Polymerase due to its high fidelity, robustness and
25
automatic "hot start" capabilities. For templates >5-6 kb, or those unsuccessfully amplified by the Pfx polymerase, PLATINUM Taq DNA Polymerase High Fidelity is recommended. Appropriate buffers and conditions for amplification that are provided with each polymerase should be utilized. Following the PCR reaction, apply 1-2 l to an agarose gel, together with size standards (1 Kb PLUS DNA LADDER) and appropriate quantitation standards (Low DNA MASS Ladder or Low DNA MASS Ladder), to assess the yield and uniformity of the product. If the starting PCR template is a plasmid that contains the gene for Kn r, it is advisable to treat the completed PCR reaction with the restriction endonuclease Dpn I to degrade the plasmid. Such plasmid is a potential source of false-positive colonies from the transformation of the GATEWAY Cloning System reaction. Adding 5 l of 10X REACT 4 Buffer plus ~5 units of Dpn I to the completed PCR reaction and incubating for 15 min at 37C will eliminate this potential problem. Heat-inactivate the Dpn I at 65C for 15 min before doing the PEG/MgCl2 purification, described below, or before using the PCR product in the GATEWAY Cloning System reaction. Purification of the PCR product is recommended to remove attB primer-dimers which can clone efficiently into the Entry Vector. The following protocol is fast and will remove DNA <300 bp in size: 1. Add 150 l of TE to 50 l PCR reaction. 2. Add 100 l 30% PEG 8000/30 mM MgCl2. Mix well and centrifuge immediately at 10,000 g for 15 min at room temperature. Remove the supernatant (pellet is clear and nearly invisible). 3. Dissolve the pellet in 50 l TE and check recovery on a gel. Longer centrifugation times and faster centrifugation speeds will increase the amount of PCR product recovered from the PEG precipitation. Note: Standard PCR product clean-up protocols don't efficiently remove large primer-dimer products and are therefore not recommended for cleaning up attB-PCR products. The conditions of the BP PCR Cloning reaction with an attB PCR substrate are similar to those of the BP Reaction (Section 3.2.3), except that the attB-PCR product substitutes for the Expression Clone. B. The BP Reaction with attB-PCR Products: Materials needed: The PCR product with terminal attB1 and attB2 sequences(>10 ng/l) In general, increasing the amount of PCR product results in proportionately more colonies (do not exceed ~500 ng/20 l reaction). As a starting point, use 40-100 fmol of PCR product/20 l reaction (where a 1-kb PCR product is ~0.65 ng/fmol). Note: For PCR products >4 kb, the number of colonies obtained per fmol of PCR DNA added decreases with increasing size. Thus for larger PCR products we recommend increasing the amount of DNA to at least 100 fmol of PCR product per 20-l reaction, and using incubations longer than one hour, such as 6 h or overnight. BP Reaction Buffer Donor Vector, pDONR201, 150 ng/l, supercoiled. pEXP7-tet Positive Control (linearized with Sca I), 50 ng/l. The tetR insert is 1.4 kb, and includes its own promoter.
26
BP CLONASE Enzyme Mix (stored at -70C) Proteinase K Solution pUC19 DNA, 10 pg/l (for transformation control) LIBRARY EFFICIENCY DH5 Competent Cells (1 108 CFU/g) S.O.C. Medium for culturing transformations LB plates containing 100 g/ml ampicillin LB plates containing 50 g/ml kanamycin
The most common cause of an unsuccessful BP Cloning Reaction is failure to plate the reaction transformations on plates containing kanamycin. Tube 1 Component BP Reaction Buffer attB-PCR product, 10 ng/l pEXP7-tet, Positive Control, 50 ng/l pDONR201, Donor Vector, 150 ng/l TE BP CLONASE Enzyme Mix Total Volume Negative Control 4 l 2 l 10 l 4 l 20 l Tube 2 Positive Control 4 l 2 l 2 l 8 l 4 l 20 l 2 l To 16 l 4 l 20 l Tube 3 Test 4 l 1-8 l
Procedure: 1. Compose reactions on ice. 2. Add TE, BP Reaction Buffer, Donor Vector, and appropriate attB-PCR DNA, and mix well. 3. Remove BP CLONASE Enzyme Mix and thaw on ice (~2 min). 4. Vortex BP CLONASE Enzyme Mix briefly (2 s) twice. 5. Add 4 l of BP CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return vial to -70C. 6. Incubate at 25C for 60 min. 7. Add 2 l Proteinase K Solution to all reactions. Incubate for 10 min at 37C. 8. Transform 1 l of BP Reaction into 50 l of LIBRARY EFFICIENCY DH5 Competent Cells using Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42C for 30 s. Place on ice for 1-2 min. Add 450 l S.O.C. Medium and incubate at 37C for 1 h. 9. Select on LB plates containing 50 g/ml kanamycin. (If the E. coli cells have a transformation efficiency of 108 CFU/g, the BP Reaction should give about 3,000 colonies if the entire transformation is plated.) 10. Also transform 2 l of pUC19 DNA into 50 l of LIBRARY EFFICIENCY DH5 Competent Cells, as above. Spread 10 l and 100 l on LB plates containing 100 g/ml ampicillin. (Cells with a tranformation efficiency of 108 CFU/g should yield about 2,000 colonies if the entire transformation is plated.) 11. If desired, the percent correct clones in the positive control reaction can be confirmed by streaking the kanamycin-resistant colonies onto LB plates containing 20 g/ml tetracycline.
27
Alternatively, electroporation can be used to transform 1-2 l of the BP Reaction, following addition of the Proteinase K Solution, directly into 25-40 l electocompetent E. coli. 3.3 Creating Expression Clones (Transferring Vectors via the LR Reaction) Genes from Entry Clones into Destination
The reaction of an Entry Clone (attL) with a Destination Vector (attR) creates a new Expression Clone (attB). Materials needed: LR Reaction Buffer Destination Vector (linearized) ~150 ng/l. Destination Vectors from Life Technologies are provided linearized and at a concentration of 150 ng/l. For preparation and use of Destination Vector DNA, see Section 5. Use approximately 300 ng per 20-l reaction. Entry Clone (30 ng/l). Use 100-300 ng of Entry Clone per 20-l reaction. pENTR-gus Positive Control at 50 ng/l. The coding sequence of gus has been cloned with translational start and stop signals permitting expression in E. coli, as well as in eukaryotic cells. LR CLONASE Enzyme Mix (stored at -70C) Proteinase K Solution pUC19 DNA, 10 pg/l LIBRARY EFFICIENCY DH5 (1 108 CFU/g) or BL21-SI Competent Cells (1 107 CFU/g) S.O.C. Medium LB Plates containing 100 g/ml ampicillin. Tube 1 Component LR Reaction Buffer pENTR-gus, 50 ng/l Entry Clone (100-300 ng/20-l reaction) Destination Vector for your gene, (~300 ng/20-l reaction) TE LR CLONASE Enzyme Mix Total Volume Neg. Control 4 l 1-11 l To 16 l 4 l 20 l Tube 2 Pos. Control 4 l 2 l 1-11 l To 16 l 4 l 20 l Tube 3 Your Clone 4 l 1-11 l 1-11 l To 16 l 4 l 20 l
Procedure: 1. Assemble reactions on ice. 2. Add TE, LR Reaction Buffer, and the appropriate Entry Clone and Destination Vector DNAs. Mix well. 3. Remove LR CLONASE Enzyme Mix from the -70C freezer, and thaw on ice (~2 min).
28
Vortex LR CLONASE Enzyme Mix briefly (2 s) twice. Add 4 l of LR CLONASE Enzyme Mix and mix well by vortexing briefly twice. Return LR CLONASE Enzyme Mix to -70C freezer. Incubate tubes at 25C for 60 min. Add 2 l of Proteinase K Solution to all reactions. Incubate for 10 min at 37C. Transform 1 l into 50 l LIBRARY EFFICIENCY DH5 or BL21-SI Competent Cells using Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42C for 30 s. Add 450 l S.O.C. Medium and incubate at 37C for 1 h. (If the E. coli cells have a transformation efficiency of 108 CFU/g, the LR Reaction should give about 8,500 colonies if the entire transformation is plated.) 10. Plate 20 l and 100 l on LB plates containing 100 g/ml ampicillin. 11. Also transform 2 l of pUC19 DNA into 50 l of LIBRARY EFFICIENCY DH5 or BL21-SI Competent Cells, as above. Spread 10 l and 100 l on LB plates containing 100 g/ml ampicillin. (Cells with a tranformation efficiency of 108 CFU/g should yield about 2,000 colonies if the entire transformation is plated.) Alternatively, electroporation can be used to transform 1-2 l of the LR Reaction, following addition of the Proteinase K Solution, directly into 25-40 l electrocompetent E. coli.
4. 5. 6. 7. 8. 9.
29
4. Troubleshooting
Problem
LR Reaction: Few or no colonies obtained from reaction; expected numbers of pUC19 control colonies obtained Transformation plated on LB plates with incorrect antibiotic Plate the reaction transformations on LB amp plates (required for reactions using all but a few types of Destination Vectors).
Possible Cause
Suggested Solution
Reaction not Proteinase K
treated
with
Repeat reaction using Proteinase K Solution. Repeat reactions using Entry Clone (attL) and Destination Vector (attR). Linearize within the attR Cassette, avoiding the ccdB gene. Test another aliquot or lot of LR CLONASE Enzyme Mix. Check that LR CLONASE Enzyme Mix is being stored at -70C. Prepare small aliquots of LR CLONASE Enzyme Mix that will each be refrozen and opened no more than ten times to minimize loss of activity.
Used attB and/or attP DNA instead of attL and attR DNAs Destination Vector not linearized LR CLONASE Enzyme Mix is inactive
Few or no colonies obtained either from LR Reaction or pUC19 control
Used BP CLONASE Enzyme Mix instead of LR CLONASE Enzyme Mix, transformation procedure performed incorrectly, or competent cells have lost efficiency or are dead Dilutions incorrectly were performed
Test transformation using pUC19 DNA and competent cells known to be active. Verify that competent cells are stored at -70C.
Repeat transformation paying special attention to dilution steps. Reduce the amount of Entry Clone from 300 ng to 100 ng per 20-l reaction. Also reduce the volume of sample used for transformation from 2 l to 1 l.
Two distinct types of colonies appear, large and small
Unreacted Entry Clone plasmid (co-transformed with Expression Clone) occasionally gives rise to colonies that grow slowly on LB amp plates. When these small colonies are restreaked onto LB kan (50-100 g/ml) and LB amp (100 g/ml) plates, they often will grow only on the LB kan plates. Plasmids carrying large genes and/or genes toxic to E. coli may be deleted during culture, leading to two populations of colonies. Generally the larger colonies contain the deleted plasmids.
Increase the concentration of ampicillin in the LB amp plates to 300 g/ml.
Incubate plates at 30C instead of at 37C. Confirm whether deletion is occurring by analyzing the DNA present in cultures derived from the colonies.
30
Problem
Tiny colonies appear after incubating the LB amp plates for more than 24 h
Possible Cause
Unreacted Entry Clone plasmid Plasmids carrying large or lethal genes Tiny satellite colonies appearing around larger ampR colonies that are releasing -lactamase
Suggested Solution
See above.
Increase the concentration of ampicillin in the LB amp plates to 300 g/ml. Test for plasmid contamination by transforming with aliquots of each of the separate solutions used in the LR Reaction. Test for bacterial contamination by plating an aliquot of each solution directly onto LB amp plates. Prepare miniprep DNA from one or more background colonies. Unstable Destination Vectors often reveal multiple bands on agarose gels. If this is the case, try using a different vector backbone in your Destination Vector.
High background in absence of Entry Clone.
Contamination of one or more solutions with another plasmid carrying the same antibiotic resistance marker, or by bacteria carrying a resistance plasmid Some Destination Vectors have an inherently higher background than others, possibly due to tendency to delete some or all of the ccdB gene
BP Reaction: Few or no colonies obtained using attB Expression Clone; attB positive control and pUC19 transformation control gave expected numbers of colonies Transformation of BP test reaction plated on LB plates with incorrect antibiotic Plate the BP Reaction transformations on LB kan plates.
Dilutions incorrectly
were
performed
Repeat transformation paying special attention to dilution steps. Linearize the attB Expression Clone outside the attB sites with an appropriate restriction endonuclease or relax with Topoisomerase I. Repeat reactions using supercoiled Donor Plasmid. Test another aliquot or lot of BP CLONASE Enzyme Mix. Check that BP CLONASE Enzyme Mix is being stored at -70C. Prepare small aliquots of BP CLONASE Enzyme Mix that will each be refrozen and opened no more than 10 times, to minimize loss of activity.
The attB Expression Clone is supercoiled, and therefore reacting less efficiently Linearized (attP) Donor Plasmid Few or no colonies obtained with either new attB plasmid or attB positive control; pUC19 transformation control yielded expected numbers of colonies. Few or no colonies obtained from either BP Reaction or pUC19 control BP CLONASE Enzyme Mix is inactive
Transformation procedure performed incorrectly, or competent cells have lost efficiency or are dead
Test transformation using pUC19 DNA and competent cells known to be active. Verify that competent cells are stored at 80C.
31
Problem
Two distinct types of colonies appear, large and small
Possible Cause
Plasmids carrying large genes and/or genes toxic to E. coli may be deleted during culture, leading to two populations of colonies. Generally the larger colonies contain the deleted plasmids. Confirm whether deletion is occurring by analyzing the DNA present in cultures derived from the colonies. Deletions or point mutations of the ccdB gene within the attP Plasmid can reduce the lethality of ccdB, allowing E. coli to grow, although at lower rates. In this case, a negative control reaction that omits the attBcontaining DNA will give a similar number of colonies.
Suggested Solution
BP Reaction or attB-PCR Cloning: Incubate plates at 30C instead of at 37C.
Obtain a new sample of attP Plasmid.
Tiny colonies appear after incubating the LB amp plates for more than 24 h
Unreacted Entry Clone plasmid or plasmids carrying large or lethal genes Tiny satellite colonies appearing around larger ampR colonies that are releasing -lactamase
See above.
Increase the concentration of ampicillin in the LB amp plates to 300 g/ml.
attB-PCR Cloning: Few or no colonies obtained from BP test reaction and attB positive control; pUC19 control gives expected number of colonies. Transformation of BP Reaction plated on LB plates with incorrect antibiotic Plate BP Reaction transformations on LB kan plates.
BP CLONASE Enzyme Mix is inactive
Test another aliquot or lot of BP CLONASE Enzyme Mix. Verify that BP CLONASE Enzyme Mix is being stored at -70C.
Few or no colonies obtained from BP Reaction with new attBPCR product; attBpositive control and pUC19 control give expected number of colonies.
attB-PCR primers have a mistake in the attB1 or attB2 sequences, or lack 5'-terminal four Gs
Replace with correct attB-PCR primers. Long (>70 nucleotides) attB-PCR primers should be purified by PAGE, due to higher likelihood of primers with incomplete sequence and primers with adducts resulting from repeated deprotection.
32
Problem
Few or no colonies obtained from either BP Reaction or pUC19 control.
Possible Cause
Transformation procedure performed incorrectly, or competent cells have lost efficiency Dilutions incorrectly were performed
Suggested Solution
Test transformation using pUC19 DNA and competent cells known to be active. Verify that competent cells are stored at -70C. Repeat transformation paying special attention to dilution steps. Confirm by either sequence analysis of Entry Clone or by demonstrating that Entry Clone is active in LR Reaction in presence of LR Clonase and Destination Vector. For PCR products >500 bp, purify by precipitating with one-half volume of 30% PEG 8000/30 mM MgCl2 Solution, excise the correct size DNA product band from an agarose gel, and use the eluted, purified DNA in BP Reaction. Use PLATINUM Taq DNA Polymerase High Fidelity, or use "hot-start PCR". Redesign primers to minimize potential mutual priming sites leading to primer-dimers.
Entry Clones appear to lack inserts, migrating as 2.2 kb supercoiled plasmids
BP recombination reaction may have cloned primer-dimers
Low cloning efficiency of attB- PCR products
AttB-PCR primers may contain a high percentage of incomplete or incorrect attB sites (most likely with primers > 60 nucleotides in length) Too few PCR molecules added to BP Reaction
For problematic primers >60 nucleotides in length, purify by PAGE. Alternatively, use nested primers, with the second set of primers containing the 25-bp attB sites plus 4 Gs at the 5'-terminus. Adjust the amount (ng) of PCR product used to 4080 fmol of PCR DNA per 20-l reaction. (For example, for an 8 kb DNA, 1 fmol ~ 5 ng.) Caution: >400 ng PCR DNA per 20-l reaction may inhibit the BP Reaction.
Very low cloning efficiency of large (>5 kb) attB PCR products
Incubation time needs to be increased for cloning large PCR products. Low yield of product from precipitation PCR PEG PCR product not diluted with TE before addition of 30% PEG 8000/30 mM MgCl2 Solution Centrifugation step too short or centrifugation speed too low Loss of PEG pellet
Increase incubation time to 6-18 h.
Dilute with 150 l TE before adding 30% PEG 8000/30 mM MgCl2 Solution. Increase time and speed of the centrifugation step. Take care when removing the tube from the microcentrifuge and keep track of the orientation of the outer edge of the tube where the pellet is located.
33
Problem
Few or no kanR colonies obtained; pUC19 positive control gave expected number of colonies.
Possible Cause
ccdB Cassette still present within Entry Vector
Suggested Solution
Excise with appropriate restriction endonuclease(s).
Preparing Entry Clones with Restriction Endonucleases and Ligase:
Ligation did not work
Include ligation positive control linearized plasmid, with and without ligase.
Protein Synthesis using attB Expression Clones: Protein is being degraded by No native protein band endogenous proteases of expected MW visible on SDS-PAGE
Use lon- strains of E. coli. Incubate plates at 30C instead of at 37C. Compare expression using different N-terminal and/or C-terminal fusion tags, and in other types of host cells, such as yeast, insect, or mammalian cells. Compare expression in other types of host cells, such as yeast, insect, or mammalian cells.
Protein contains secondary modifications that increase apparent MW No fusion protein band of expected MW visible on SDS-PAGE Incorrect reading frame of Entry Clone
Verify that attB PCR primers were designed with gene in correct reading frame. Verify that Entry Clone was constructed with gene in correct reading frame. Verify that Destination Vector was constructed with correct reading frame.
Proteins of MW>100 kDa may express poorly or as partially degraded protein in many laboratory strains of E. coli.
Perform transformation using BL21-SI Competent Cells.
34
5.
5.1
Additional Information
Converting a Vector into a GATEWAY Destination Vector
Destination Vectors function in the GATEWAY Cloning System because they have two recombination sites, attR1 and attR2, flanking a chloramphenicol resistance (CmR) gene and a ccdB gene. The GATEWAY Cloning System recombination reactions exchange the entire Cassette (except for the few bases that contribute to the attB sites) for the DNA segment of interest from the Entry Vector. Because attR1, CmR, ccdB gene, and attR2 are contiguous, they can be moved on a single DNA segment. If this cassette is cloned into a plasmid, the plasmid becomes a Destination Vector. Figure 14 shows a schematic of the three GATEWAY Cloning System Reading Frame Cassettes. Three cassettes are available to allow construction of Destination Vectors in any reading frame.
Mlu I (reading frame A, 897) Bgl II (reading frame B, 898) Xba I (reading frame C, 1040)
attR1
Cm r
Pvu II EcoR I
ccdB
Sma I AlwN I
attR2
Not I
Nco I
BssH I Sca I
Sfc I Sal I
a = 1.7 kb b = 1.7 kb c = 1.8 kb
Figure 14. Schematic of the GATEWAY Cloning System Reading Frame Cassettes. Three blunt-end cassettes are available to convert standard expression vectors into Destination Vectors. Each cassette contains an attR1 site at the 5'-end followed by the chloramphenicol resistance gene (Cmr) and ccdB gene. The attR2 site is at the 3'- end of the cassette. Each of the cassettes provides N-terminal and C-terminal fusions in one of three possible reading frames. The unique restriction sites listed above the line (Mlu I, Bgl II, and Xba I) distinguish the reading frame cassettes. Restriction endonucleases common to all the cassettes are presented in Table 3.
35
Table 3. Location of Cleavage Sites for a Selection of Restriction Endonucleases. Restriction Endonuclease Cleavage Site EcoR I Nco I Sca I BssH II AlwN I 450 751 865 944 1224 451 752 866 945 1225 593 894 100 1087 1367
DNA Rfa Rfb Rfc
Not I 129 130 131
Pvu II 348 349 491
Sma I 1319 1320 1462
Sfc I 1572 1573 1715
Sal I 1578 1579 1721
The protocol for constructing a Destination Vector is presented below. Keep in mind the following points: Destination Vectors must be constructed and propagated in a gyrA462 strain of E. coli, such as LIBRARY EFFICIENCY DB3.1 Competent Cells, available from Life Technologies, because the ccdB gene will be lethal to any other strain. If the Destination Vector will be used to make a fusion protein, a GATEWAY Cloning System Reading Frame Cassette with the correct translation reading frame must be used, as discussed in Section 5.2. The nucleotide sequences at the ends of the cassettes are shown in Figure 15. Note that each reading frame cassette has a different unique restriction site between the chloramphenicol resistance and ccdB genes (Mlu I for reading frame A, Bgl II for reading frame B, and Xba I for reading frame C). Because the reading frame cassettes are blunt-ended, they will clone in both orientations.
Most standard vectors can be converted to Destination Vectors, by inserting the GATEWAY Reading Frame Cassette into the multiple cloning site (MCS) of that vector. If you are converting a vector that encodes kanamycin resistance, you will need to use the resulting Destination Vector with Entry Clones that carry a selection marker other than kanR. For this purpose, you can make your Entry Clone in a BP Reaction using a Donor Vector with a marker other than kanR, such as tetR or genR (available by request).
5.2
Protocol for Making a Destination Vector
The following steps are required to construct a Destination Vector that will create N-terminal protein fusions to genes in Entry Clones, via an LR Reaction. 1. If the vector will make an amino-terminal fusion protein, it is necessary to keep the -AAA-AAAtriplets in attR1 (see Figure 15) in phase with the translation reading frame of the fusion protein, since this is the reading frame convention employed in all of the N-terminal fusion Destination Vectors available from Life Technologies and in the construction of attB Expression Clones and attB PCR products. Similar considerations are required to construct Destination Vectors that create C-terminal protein fusions. The C-terminal coding sequences of these vectors should be aligned in phase with -TACAAA- of the attR2 sequences as shown in Figure 15.
36
Figure 15. Sequences at Ends of GATEWAY Reading Frame Cassettes. The terminal sequences of the attR1-Cmr-ccdB-attR2 cassettes are shown, including the terminal portions of the flanking attR sites (boxed). The staggered cleavage sites for Int are indicated in the boxed regions. Following recombination with an Entry Clone, only the outer (unshaded) sequences in attR sites contribute to the resulting attB sites in the Expression Clone.
Figure 16. Examples of How to Choose the Correct GATEWAY Reading Frame Cassette for N-Terminal Fusions.
N-Fusion protein codon Reading Frame Cassette A
--- NNN NNN --- NNN NNN
ATC ACA AGT TTG TAC AAA AAA GCT --TAG TGT TCA AAC ATG TTT TTT CGA ---
attR 1 Reading Frame Cassette B
--- NNN NNN NNA TCA ACA AGT TTG TAC AAA AAA GCT ----- NNN NNN NNT AGT TGT TCA AAC ATG TTT TTT CGA --*cannot be TG or TA Reading Frame Cassette C
--- NNN NNN NAT CAA ACA AGT TTG TAC AAA AAA GCT --- NNN NNN NTA GTT TGT TCA AAC ATG TTT TTT CGA
----- www.lifetech.com/gateway
37
2. Determine which GATEWAY Cloning System Reading Frame Cassette to use as follows: Write out the nucleotide sequence of the existing vector near the restriction site into which the GATEWAY Cloning System Reading Frame Cassette will be cloned. These must be written in triplets corresponding to the amino acid sequence of the fusion domain. Draw a vertical line through the sequence that corresponds to the restriction site end, after it has been cut and made blunt, i.e., after filling in a protruding 5-end or polishing a protruding 3-end. For N-terminal fusions: If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading Frame Cassette A. (See Figure 16) If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the Reading Frame Cassette B. If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the Reading Frame Cassette C. For C-terminal fusions: If the coding sequence of the blunt end terminates after a complete codon triplet, use the Reading Frame Cassette B. (See Figure 16) If the coding sequence of the blunt end encodes two bases of a complete codon triplet, use the Reading Frame Cassette C. If the coding sequence of the blunt end encodes one base of a complete codon triplet, use the Reading Frame Cassette A. For preparing a vector that encodes both an N- and C-terminal fusion, care must be taken when choosing appropriate restriction enzymes for cutting the vector. The resultant ends (after generating blunt ends) need to be compatible with one of the three cassettes shown in Figure 16. 3. Cut one to five micrograms of the existing plasmid at the position where you wish your gene (flanked by att sites) to be after the recombination reactions. Note: It is better to remove as many of the MCS restriction sites as possible at this step. This makes it more likely that restriction endonuclease sites within the GATEWAY Cloning System Reading Frame Cassette will be unique in the new plasmid, which is important for linearizing the Destination Vector (Section 5.3). 4. If necessary, convert the ends of the vector to flush double-stranded DNA, so that the vector is compatible with the blunt ends of the cassette, using either T4 DNA Polymerase or Klenow Fragment (See protocol in Section 3.2.1B.) 5. Remove the 5 phosphates with alkaline phosphatase. This increases the probability of success by decreasing background associated with self-ligation of the vector. 6. Remove dNTPs and small DNA fragments by ethanol precipitation. Dissolve wet precipitate in 200 l TE, add 100 l of 30% PEG 8000/30 mM MgCl2, mix well, immediately centrifuge for 10 min at room temperature, discard supernatant, centrifuge again a few seconds, discard any residual liquid. 7. Dissolve the DNA to a final concentration of 10 - 50 ng per microliter. Apply 20 - 100 ng to a gel next to Low DNA MASS Ladder and linear size standards to confirm cutting and recovery. 8. In a 10-l ligation reaction combine 10 - 50 ng vector, 10 - 20 ng of GATEWAY Cloning System Reading Frame Cassette, and 1 unit T4 DNA ligase in ligase buffer. Incubate for 1 h at room temperature (or overnight at 16C, whichever is most convenient). Transform 1 l into 100 l DB3.1
38
Competent Cells. (The ccdB gene on the GATEWAY Cloning System Reading Frame Cassette will be lethal to any other strain.) 9. After expression in S.O.C. Medium, plate 10 l, 100 l, and remaining cells on agar plates containing 30 g/ml chloramphenicol; incubate at 37C for 16-20 h. 10. Isolate miniprep DNA from single colonies (Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York). Treat the miniprep with RNase A and store in TE. Cut with the appropriate restriction endonuclease to determine the orientation of the cassette. Choose clones with the attR1 site next to the amino end of the protein expression function of the plasmid. 11. To demonstrate that the ccdB gene is functioning properly in a newly constructed Destination Vector perform the following test. Transform equal amounts (10 - 50 pg) of Destination Vector into 100 l of LIBRARY EFFICIENCY DH5 and DB3.1 Competent Cells using the protocol provided with the cells. Plate dilutions onto LB plates containing the appropriate antibiotic. As a control for transformation efficiency, transform pUC19 (50 pg) into both strains. Plate dilutions onto LB plates containing 100 g/ml ampicillin. Normalize the transformation efficiency of both strains to the pUC19 positive control using the following calculation: Transformation efficiency (CFU/g) = colonies/pg of DNA (1 106 pg/g) dilution factor(s) For example, if 50 pg of pUC19 yields 100 colonies when 100 l of a 1:10 dilution of the transformation mix is plated, then: CFU/g = 100 CFU/50 pg (1 106 pg/g) (1 ml/0.1 ml plated) 10 = 2 108 Calculate the number of colonies obtained in both strains from transformations using the Destination Vector. An acceptable Destination Vector transformed into the permissive strain LIBRARY EFFICIENCY DB3.1 Competent Cells should give greater than 10,000 times the number of colonies that it will if transformed into LIBRARY EFFICIENCY DH5 Competent Cells. Any ratio less than 10,000 suggests contamination of the plasmid prep with another ampicillin-resistant plasmid, or an inactive ccdB gene, or both. DNA with lower ratios can be used, but higher background will likely be observed. 5.3 Using the Destination Vector in the GATEWAY Cloning System
About ten-fold more colonies result from a GATEWAY Cloning System reaction if the Destination Vector is linear or relaxed. If the competent cells used are highly competent (>108 per microgram), linearizing or relaxing the Destination Vector is less essential. The site or sites used for linearization must be within the GATEWAY Cloning System Reading Frame Cassette, but not within the ccdB gene. A sampling of the sites that cut within a cassette is shown in Figure 14. The complete sequence is available on the website. Mini-prep (alkaline lysis) DNA preparations are adequate for GATEWAY reactions; however, in general, such DNA can not be quantitated by UV absorbance due to contaminating RNA and nucleotides.
39
Concentrations can be estimated by gel electrophoresis in comparison with standard DNA, i.e., DNA MASS Ladder. Alternatively, DNA purified by CONCERT DNA purification systems is recommended.
5.4
"One-Tube" Protocol: A Protocol for Cloning attB-PCR Products Directly into Destination Vectors.
1. Perform the BP Reaction in 20 l at 25C as described in Section 3.2.4, except incubate for 3-4 h. 2. Following incubation add: 1 l of 0.75 M NaCl 3 l of Destination Vector (150 ng/l) 6 l of LR CLONASE Enzyme Mix The final volume should be 30 l.
Gene B1 P1 B2
+
r
P2 BP Reaction
pDONR Kn
L1
L2
(
R1 R2
Gene Entry Clone Kn r
ccdB
Destination Vector Apr LR Reaction
B2 Gene Expression Clone Stop reaction and Transform Apr
B1
3. Mix reaction. Immediately remove 5 l of the mixture to a separate tube and to this aliquot add 0.5 l of Proteinase K Solution. Incubate for 10 min at 37C. Label as Tube A; place on ice or store at -20C. This aliquot will be used to recover Entry Clones containing the cloned PCR product. Transform 1 l of this reaction into 50 l of LIBRARY EFFICIENCY DH5 Competent Cells using Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42C for 30 s. Add 450 l S.O.C. Medium and incubate at 37C for 1 h. Plate 20 l and 100 l on LB plates containing 50 g/ml kanamycin. 4. Incubate the remaining 25 l mixture at 25C for 1-2 h. 5. Add 2.5 l of Proteinase K Solution. Incubate for 10 min at 37C. Label as Tube B.
Figure 17. One-Tube Protocol for Cloning PCR Products Directly into Destination Vectors. PCR product made with attB oligonucleotides can be directly moved into an Expression Clone via a two-step reaction in one tube. Initially the BP Reaction transfers the attB-PCR product into an Entry Clone. Subsequent addition of Destination Vector and LR CLONASE Enzyme Mix generates an Expression Clone via the LR Reaction. No purification of the intermediate Entry Clone is required.
6. Transform 1 l of the completed reaction into 50 l LIBRARY EFFICIENCY DH5 or BL21-SI Competent Cells using Falcon 2059 tubes. Incubate on ice for 30 min. Heat-shock the cells at 42C for 30 s. Add 450 l S.O.C. Medium and incubate at 37C for 1 h.
40
7. Plate 100 l and 400 l on LB plates containing 100 g/ml ampicillin. 5.5 Transferring Clones from cDNA Libraries Made in GATEWAY Vectors
When working with a clone isolated from a cDNA library constructed in a GATEWAY vector, such as SUPERSCRIPT cDNA libraries supplied in pCMVSPORT6 (which contains attB sites), several considerations must be made before the cDNA clone can be used for protein expression. These include whether the clone is full-length and how it is to be expressed, either as a native protein, an aminoterminal (N-terminal) fusion protein, or as a carboxy-terminal (C-terminal) fusion protein. The following considerations must be kept in mind for expression of a native protein. Life Technologies supplies many libraries containing full-length open reading frames. Some clones, however, may contain only a partial reading frame, or may contain not only the entire ORF but 5' untranslated (5' UTR) sequence as well. Contained within the 5' UTR of a cDNA is the ribosome recognition sequence for the organism from which the cDNA was derived. Therefore, a full-length cDNA derived from mammalian cells can be used for native expression in mammalian cells without prior characterization but cannot be used for native expression in E. coli, as no Shine-Dalgarno sequence is present. When attempting to express a mammalian cDNA in E. coli, a Shine-Dalgarno sequence must be supplied. This can be done either by cloning the cDNA into an Entry Vector that contains a Shine-Dalgarno sequence, or by introducing a Shine-Dalgarno sequence by PCR when amplifying the cDNA with primers also containing attB sequences and cloning the PCR product by recombination. (See Section 3.2.4 for cloning of PCR products). The length and content of the clone is also important in expressing fusion proteins. If the cDNA is fulllength then the 5' UTR will also be translated as a part of the fusion protein. This may present problems as the additional codons may interfere with the expression or function of the protein. Additionally, the 5' UTR may contain stop codons, which would prevent expression of the protein of interest. If the ORF is not full-length then a truncated portion of the protein of interest will be expressed within the fusion. To express any cDNA isolated from a library as an N-terminal fusion protein, the reading frame of the gene must be in frame with the reading frame of the attB1 site (see Figure 13). In this case, there is one chance in three that the cDNA will be in frame with the attB1 site and therefore allow for fusion protein expression. A researcher can construct three Destination Vectors representing all three possible reading frames through the attB1 sites so that any give cDNA clone can be expressed in one of the three vectors. Alternatively, to assure that the ORF encoded by the cDNA will be in frame with an N-terminal fusion protein sequence, PCR may be used to install attB sites, so that the AAA-AAA sequence within attB1 is in phase with the ORF. The major consideration in generating C-terminal fusion proteins from cDNAs is the fact that all cDNAs will contain one or more stop codons, which must be removed before C-terminal fusion expression is possible. This may be done by subcloning the gene into an Entry Vector so that no stop codon is present. Alternatively, it may be done by amplifying the gene by PCR using attB primers where the stop codon has been eliminated from the gene specific sequence.
41
5.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System
Figure 18. Vector Map of Typical Entry Vector

All Entry Vectors consist of the same vector backbone (outside of the attL sites) but differ in the sequences and cloning sites provided between the attL sites. The vector map of pENTR1A, shown here, displays the single-cut restriction enzyme sites in this prototype vector.
42
NOTE: In the following figures the amino acids shown before the ccdB gene can be added to the Nterminus of your protein only if a translation start site is provided in the Destination Vector (such as with an N-terminal His6 or GST fusion). NOTE: If a blunt-ended fragment containing a 5-ATG is cloned into the Xmn I site of pENTR1A, 2B, 3C, or 4, the adenine at position 3 of the underlined ACC sites provides a Kozak eukaryotic ribosome recognition sequence for initiation of translation.
Figure 19. Cloning Sites of the Entry Vector pENTR1A
Figure 20. Cloning Sites of the Entry Vector pENTR2B
43
Figure 21 Cloning Sites of the Entry Vector pENTR3C
Figure 22. Cloning Sites of the Entry Vector pENTR4
Figure 23. Cloning Sites of the Entry Vector pENTR11
The underlined AAGGAG/A and ACC sites correspond to the Shine-Dalgarno (prokaryotes) and Kozak eukaryotic ribosome recognition sequences preceding the initiating ATG.
44
Figure 24. pDEST8 Polyhedron Promoter, Baculovirus Transfer Plasmid

Map of GATEWAY pDEST8 Vector. DNA from the Entry Clone replaces the region between nucleotides 168 and 1990.
Recombination Region of the Expression Clone resulting from pDEST8 Entry Clone:
Features of the Recombination Region: The sequence shown extends from nucleotides 60-167 and 1991-2069 on the pDEST8 map. The nucleotides marked with * and correspond to bases 167 and 1991, respectively, of the pDEST8 sequence. The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 24-64. The start of transcription is indicated by the arrow at nt 67. Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST8 by recombination. Non-shaded regions are derived from pDEST8.
The designated reading frame for attB1 and attB2 are provided in Figure 5. The sequence has not been confirmed by sequence analysis. It was assembled from the known sequence of fragments used to construct the vector. The sequence and the location of sites for restriction endonucleases that cleave up to ten times can be found in the TECH-ONLINESM section of Life Technologies' web page, http://www.lifetech.com.
45
Figure 25. pDEST10 Polyhedron Promoter with N-His6, Baculovirus Transfer Plasmid
Features of the Recombination Region: The sequence shown extends from nucleotides 155-344 and 2168-2226 on the pDEST10 map. The nucleotides marked with * and correspond to bases 344 and 2168, respectively, of the pDEST10 sequence. The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 116-156. The start of transcription is indicated by the arrow at nt 159. Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST10 by recombination. Non-shaded regions are derived from pDEST10. www.lifetech.com/gateway
46
Figure 26. pDEST12.2 CMV Promoter for Mammalian Expression, SV40 Promoter/ori for Neo Resistance
Map of GATEWAY pDEST12.2 Vector. DNA from the Entry Clone replaces the region between nucleotides 738 and 2419.
Recombination Region of the Expression Clone resulting from pDEST12.2 Entry Clone:
Features of the Recombination Region: The sequence shown extends from nucleotides 630-737 and 2420-2498 on the pDEST12.2 map. The nucleotides marked with * and correspond to bases 737 and 2420, respectively, of the pDEST12.2 sequence. The black box represents the sequence from nucleotides 15-629 and contains the CMV promoter (nt 15-535), the start of transcription at nt 537, and a portion of the 5'-untranslated region. Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST12.2 by recombination. Non-shaded regions are derived from pDEST12.2.
47
Figure 27. pDEST14 Native Protein Expression in E. coli, T7 Promoter

*
Features of the Recombination Region: The position of the T7 promoter is shown. The start of transcription is indicated by the arrow. Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST14 by recombination. Non-shaded regions are derived from pDEST14. The nucleotides marked with * and correspond to bases 74 and 1898, respectively, of the pDEST14 sequence.
48
Figure 28. pDEST15 Glutathione-S-transferase Amino-Fusion in E. coli, T7 Promoter

49
Figure 29 pDEST17 6X Histidine Affinity Tag Amino-Fusion in E. coli, T7 Promoter

50
Figure 30. pDEST20 Glutathione-S-transferase Amino-Fusion with Polyhedron Promoter for Baculovirus Expression
Features of the Recombination Region: The sequence shown extends from nucleotides 6295-6403, 7060-13, and 1696-1754 on the pDEST20 map. The nucleotides marked with * and correspond to bases 13 and 1696, respectively, of the pDEST20 sequence. The polyhedron promoter (pPolh), a portion of which is shown as a black box, extends from nt 6257-6297. The start of transcription is indicated by the arrow at nt 6300. Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST20 by recombination. Non-shaded regions are derived from pDEST20.
51
Figure 31. pDEST26 CMV Promoter for Mammalian Expression, 6X Histidine Affinity Tag Amino-Fusion SV40 Promoter/ori for Neo Resistance
Features of the Recombination Region: The sequence shown extends from nucleotides 615-678 and 2361-2499 on the pDEST26 map. The nucleotides marked with * and correspond to bases 678 and 2361, respectively, of the pDEST26 sequence. The black box represents the sequence from nucleotides 15-614 and contains the CMV promoter (nt 15-535), the start of transcription at nt 537, and a portion of the 5'-untranslated region. Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST26 by recombination. Non-shaded regions are derived from pDEST26.
52
Figure 32. pDEST27 CMV Promoter for Mammalian Expression, GlutathioneS-Transferase Amino-Fusion SV40 Promoter/ori for Neo Resistance
Features of the Recombination Region: The sequence shown extends from nucleotides 630-643, 1301-1320, and 3003-3081 on the pDEST27 map. The nucleotides marked with * and correspond to bases 1320 and 3003, respectively, of the pDEST27 sequence. The black box represents the sequence from nucleotides 15-619 and contains the CMV promoter (nt 15-535), the start of transcription at nt 537, and a portion of the 5'-untranslated region. Shaded regions correspond to those DNA sequences transferred from the Entry Clone into pDEST27 by recombination. Non-shaded regions are derived from pDEST27.
53
Table 4. Restriction Endonucleases That Do Not Cleave the Destination Vectors, or Cleave Twice
Restriction endonucleases that do not cleave pDEST8 DNA: Aat II Cla I Hind III Nsp V Afl II Cvn I Kpn I Pac I Apa I Eco47 III Nar I PinA I Asc I Eco72 I Nde I Pme I Bpu1102 I EcoN I Nhe I PshA I Bsg I EcoO109 I Nru I Psp5 II BstE II Fse I Nsi I Rsr II Restriction endonucleases that cleave pDEST8 DNA twice: 1521 4496 1280 AlwN I Bst1107 I 2 2837 4069 1728 5356 Ban I BstX I 5193 5663 2876 6224 Bgl II Dra III BspLU11 I 4910 5892 Eam1105 I 2522 4017 3353 4737 848 3932 BssS I Gsu I
SexA I Sfi I Sgf I SgrA I Spe I Sph I Sse8387 I
Sst I Stu I Sun I Swa I Xba I Xcm I Xho I
Nsp I PflM I Rca I Tfi I Xmn I
4910 406 3182 1097 3418
5892 973 4190 4936 6443
Restriction endonucleases that do not cleave pDEST10 DNA: Aat II Afl II Apa I Asc I Bpu1102 I Bsg I BstE II Cla I Cvn I Eco47 III Eco72 I EcoN I EcoO109 I Fse I Nar I Nde I Nhe I Nru I Nsi I Pac I PinA I Pme I PshA I Psp5 II SexA I Sfi I Sgf I SgrA I Sse8387 I Sun I Swa I Xcm I
Restriction endonucleases that cleave pDEST10 DNA twice: 1698 4770 1905 5630 AlwN I BstX I 1377 2191 3150 6498 BamH I Dra III 2220 3077 Ban II Eam1105 I 2795 4291 5467 5937 924 2198 Bgl II EcoR I 298 5743 BspLU11 I 5184 6166 EcoR V 3627 5011 1025 4206 BssS I Gsu I 1457 1225 2187 Bst1107 I 94 Nco I
Not I PflM I Pst I Rca I Sal I Xmn I
462 583 2046 3456 2052 9
2233 1150 2256 4464 2214 3692
Restriction endonucleases that do not cleave pDEST12.2 DNA: Apa I BstE II EcoR V PshA I Asc I Cvn I Fse I Psp5 II Bgl II Eco47 III Pac I Sgf I Bpu1102 I Eco72 I PinA I SgrA I Bsg I EcoN I Pme I Spe I Restriction endonucleases that cleave pDEST12.2 DNA twice: 1709 2304 3048 5066 Acc I Cla I 1623 7150 Afl III EcoO109 I 2781 5281 1950 6736 605 1172 AlwN I Kpn2 I 617 4092 719 3742 Avr II Kpn I 2179 6190 187 2662 Bsa I Nde I 1670 4683 BssH II NgoA IV 3301 4786 2157 5000 3132 5890 BstX I Pvu I
Sun I Swa I Xba I Xcm I Xho I
Sca I Sst I Stu I Vsp I Xma III
1591 518 669 3059 856
5779 7275 4089 6086 4192
54
Restriction endonucleases that do not cleave pDEST14 DNA: Afl II BstE II Kpn I PinA I Apa I Cvn I Mun I Pme I Asc I Dra III Nde I Rsr II Avr II Eco72 I Nsi I SexA I Bcl I Fse I Nsp V Sfi I BseR I Hpa I Pac I Sgf I Restriction endonucleases that cleave pDEST14 DNA twice: 1101 4313 Afl III Bst1107 I 1187 4544 1428 3899 4205 4620 AlwN I Drd I 654 2427 2631 4435 Apo I Ear I 1523 5363 2738 3786 Ava I Eco57 I 6307 6321 654 2427 Ban II EcoR I 345 4563 2049 2240 BsaA I EcoR V 1778 5725 5307 5349 BspM I Psp5 II 2581 4382 1776 3179 BsrB I Pst I
SnaB I Spe I Sse8387 I Sst I Sst II Stu I
Sun I Swa I Xcm I Xho I
Pvu I Pvu II Sca I Ssp I Vsp I Xma III Xmn I
3053 552 1069 964 19 193 2821
6139 4724 2942 2618 3249 5849 4755
Restriction endonucleases that do not cleave pDEST15 DNA: Afl II Apa I Asc I Avr II BseR I BstE II Cvn I Dra III Eco72 I Fse I Hpa I Kpn I Mlu I Mun I Nsi I Pac I PinA I Pme I Rsr II SexA I Sfi I Sgf I SnaB I Spe I Sse8387 I Sst I Sst II Stu I Sun I Xcm I Xho I
Restriction endonucleases that cleave pDEST15 DNA twice: Afl III AlwN I Apo I Ban II Bsg I BspLU11 I BspM I Bst1107 I Drd I 343 2012 1238 6902 370 343 2362 1771 4800 4908 4494 3022 6916 5733 4908 6320 5139 5215 Eco57 I EcoN I EcoR I EcoR V Esp3 I Nco I Psp5 II Pst I Pvu I 3333 111 1238 2644 1456 777 5902 2360 3648 4381 6760 3022 2835 5261 1539 5944 3774 6734 Pvu II Sap I Sma I Ssp I Vsp I Xba I Xma III 1136 189 2107 1548 23 63 918 5319 5030 2506 3213 3844 1685 6444
Restriction endonucleases that do not cleave pDEST17 DNA: Afl II Apa I Asc I Avr II Bcl I BseR I BstE II Cvn I Dra III Eco72 I Fse I Hpa I Kpn I Mlu I Mun I Nsi I Nsp V Pac I PinA I Pme I Rsr II SexA I Sfi I Sgf I SnaB I Spe I Sse8387 I Sst I Sst II Stu I Sun I Swa I Xcm I Xho I
Restriction endonucleases that cleave pDEST17 DNA twice: AlwN I Apo I Ava I BamH I Ban II Bgl II BspM I BsrB I 1360 586 1455 336 6239 1 1710 2513 3831 2359 5295 1039 6253 1033 5657 4314 Bst1107 I Drd I Ear I Eco57 I EcoR I EcoR V Esp3 I Psp5 II 1119 4137 2563 2670 586 1981 804 5239 4476 4552 4367 3718 2359 2172 4598 5281 Pst I Pvu I Pvu II Sca I Ssp I Vsp I Xma III Xmn I 1708 2985 484 1001 896 19 266 2753 3111 6071 4656 2874 2550 3181 5781 4687
55
Restriction endonucleases that do not cleave pDEST20 DNA: Aat II Afl II Apa I Asc I Bpu1102 I BstE II Cla I Cvn I Eco47 III Eco72 I Fse I Hind III Kpn I Mlu I Nar I Nde I Nhe I Nru I Nsi I Pac I PinA I Pme I PshA I Psp5 II Rsr II SexA I Sfi I Sgf I SgrA I Spe I Sph I Sse8387 I Sst I Stu I Sun I Xcm I Xho I
Restriction endonucleases that cleave pDEST20 DNA twice: AlwN I Bcl I Bgl II BsmF I BssS I 1226 1979 4900 1228 3060 4203 6825 5370 6368 4444 Bst1107 I BstX I Dra III Eam1105 I Esp3 I 985 1433 2583 2229 670 6235 5063 5931 3724 5529 Gsu I Nco I Rca I Sap I Tfi I 553 753 2889 4739 802 3639 6389 3997 6475 4643
Restriction endonucleases that do not cleave pDEST26 DNA: Apa I Cvn I Fse I Pme I Asc I Eco47 III Mlu I PshA I Bpu1102 I Eco72 I Nru I Psp5 II Bsg I EcoN I Pac I Sgf I BstE II EcoR V PinA I SgrA I Restriction endonucleases that cleave pDEST26 DNA twice: 1650 2245 2098 4942 Acc I BstX I 1891 6678 2990 5008 AlwN I Cla I 617 4034 605 1113 Avr II Kpn2 I 2120 6132 187 2604 Bsa I Nde I 1611 4625 BssH II NgoA IV 3243 4728
Spe I Sse8387 I Sun I Swa I Xcm I
Xho I
Pst I Pvu I Sca I Xma III
2239 3074 1532 797
4277 5832 5721 4134
Restriction endonucleases that do not cleave pDEST27 DNA: Apa I Eco47 III Nru I Psp5 II Asc I Eco72 I Pac I Sgf I Bpu1102 I EcoR V PinA I SgrA I BstE II Fse I Pme I Spe I Cvn I Mlu I PshA I Sse8387 I Restriction endonucleases that cleave pDEST27 DNA twice: 2292 2887 Acc I BspLU11 I 870 7734 870 7734 2253 5267 Afl III BssH II 2533 7320 2740 5584 AlwN I BstX I 617 4676 3632 5650 Avr II Cla I 1066 3393 605 1755 Bcl I Kpn2 I 2762 6774 187 3246 Bsa I Nde I
Sun I Xcm I Xho I
NgoA IV Nsp V Pst I Pvu I Xma III Xmn I
3885 1028 2881 3716 1439 1021
5370 5551 4919 6474 4776 6242
56
Figure 33. Donor Vector for BP Reactions: pDONR201
57
6. Related Products
Product Systems PCR Cloning System (with GATEWAY Technology)
(Contains: GATEWAY BP CLONASE Enzyme Mix, reaction buffers, pDONR201 vector, Proteinase K Solution, 30% PEG/Mg Solution, LIBRARY EFFICIENCY DH5 Competent Cells, positive control and protocol)
Size 20 reactions
Cat. No. 11821-014
E. coli Expression System (with GATEWAY Technology) (with LIBRARY 20 reactions

EFFICIENCY DH5 Competent Cells)
(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST14, pDEST15, pDEST17 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5 Competent Cells, positive control and protocol)
11822-012
E. coli Expression System (with GATEWAY Technology) (with BL21-SI 20 reactions

Competent Cells)
(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST14, pDEST15, pDEST17 vectors, Proteinase K Solution, BL21-SI Competent Cells, positive control and protocol)
11823-010
Mammalian Expression System (with GATEWAY Technology)

(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST12.2, pDEST26, pDEST27 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5 Competent Cells, positive control and protocol)
20 reactions
11826-013
Baculovirus Expression System (with GATEWAY Technology) 1

(Contains: GATEWAY LR CLONASE Enzyme Mix, reaction buffers, pDEST8, pDEST10, pDEST20 vectors, Proteinase K Solution, LIBRARY EFFICIENCY DH5 Competent Cells, positive control and protocol)
20 reactions
11827-011
GATEWAY Vector Conversion System

(Contains: GATEWAY rfA, rfB and rfC Cassettes, LIBRARY EFFICIENCY DB3.1 Competent Cells, positive control and protocol)
20 reactions
11828-019
PCR Cloning Vectors GATEWAY pDONR201 Vector

[attP sites, knr]
40 l (150 ng/l)
11798-014
Enzymes GATEWAY BP CLONASE Enzyme Mix

(Contains: enzyme mix, reaction buffer, Proteinase K Solution, and 30% PEG/Mg Solution)
20 reactions 20 reactions
11789-013 11791-019
GATEWAY LR CLONASE Enzyme Mix

(Contains: enzyme mix, reaction buffer, Proteinase K Solution)
The Baculovirus Expression System (with GATEWAY Technology) provides all the components necessary to construct the GATEWAY version of the pFASTBAC clone. Once constructed, this clone can be used in conjunction with the BAC-TO-BAC Baculovirus Expression System to generate (by in vivo recombination with a bacmid) a recombinant baculovirus vector for expression in insect cells. Components from the BAC-TO-BAC Baculovirus Expression System that are also required include MAX EFFICIENCY DH10BAC cells, CELLFECTIN Reagent, and insect cells for expression. Refer to the BAC-TO-BAC Baculovirus Expression System manual (which can be found on our web site) for more information regarding this system.
58 Product Size Cat. No.
Entry Vectors (for entry via restriction enzyme and ligase cloning) GATEWAY pENTR1A Vector
[attL sites, rf 0, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions in E. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene contains endogenous ribosome binding sites]
20 l
(500 ng/l)
11813-011
GATEWAY pENTR2B Vector

[attL sites, rf +1, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions in E. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene contains endogenous ribosome binding sites]
20 l
(500 ng/l)
11816-014
GATEWAY pENTR3C Vector

[attL sites, rf +2, 1st site blunt, no Shine-Dalgarno; for N-terminal or C-terminal fusions in E. coli or eukaryotic cells; native expression in E. coli or eukaryotic cells if gene contains endogenous ribosome binding sites]
20 l
(500 ng/l)
11817-012
GATEWAY pENTR4 Vector

[attL sites, 1st site Nco I, Kozak, no Shine-Dalgarno; for N-terminal or C-terminal fusions in E. coli or eukaryotic cells; native expression in eukaryotic cells; native expression in E. coli if gene contains endogenous ribosome binding sites]
20 l
(500 ng/l)
11818-010
GATEWAY pENTR11 Vector

[attL sites, blunt and Nco I sites both preceded by Shine-Dalgarno and Kozak, for native, Nterminal or C-terminal fusions in E. coli or eukaryotic cells]
20 l
(500 ng/l)
11819-018
Competent Cells
LIBRARY EFFICIENCY DB3.1 Competent Cells [For propagating plasmids containing the ccdB gene (e.g., Destination Vectors)]
5 0.2 ml
11782-018
Destination Vectors GATEWAY pDEST14 Vector [For native expression in E. coli: T7 promoter, attR sites] GATEWAY pDEST15 Vector [For prokaryotic expression: T7 promoter, N-terminal GST tag, attR sites] GATEWAY pDEST17 Vector [For prokaryotic expression: T7 promoter, N-terminal 6X histidine affinity tag, attR sites] GATEWAY pDEST8 Vector [For baculovirus expression: pFASTBAC vector with polyhedron promoter, attR sites] GATEWAY pDEST10 Vector
[For baculovirus expression: pFASTBAC HT vector with polyhedron promoter, N-terminal 6X histidine affinity tag, attR sites]
40 l 40 l 40 l 40 l 40 l 40 l 40 l 40 l 40 l
11801-016 11802-014 11803-012 11804-010 11806-015
GATEWAY pDEST20 Vector [For baculovirus expression: pFASTBAC vector with polyhedron promoter, N-terminal GST tag, attR sites] GATEWAY pDEST12.2 Vector [For mammalian expression: pCMVSPORT vector, neor, attR sites] GATEWAY pDEST26 Vector [For mammalian expression: pCMVSPORT vector, neor, N-terminal 6X histidine affinity tag, attR sites] GATEWAY pDEST27 Vector [For mammalian expression: pCMVSPORT vector, neor, N-terminal GST tag, attR sites]
11807-013
11808-011 11809-019
11812-013
59
Product Competent Cells, Media, and Antibiotics: LIBRARY EFFICIENCY DH5 Competent Cells BL21-SI Competent Cells MAX EFFICIENCY DH10BAC Competent Cells Bluo-gal X-gal IPTG S.O.C. Medium Ampicillin Sodium salt, lyophilized Kanamycin Sulfate Products for Mammalian and Insect Expression: BAC-TO-BAC Baculovirus Expression System LIPOFECTAMINE 2000 Reagent CELLFECTIN Reagent Sf-900 II SFM (1X), liquid Sf9 Cells, SFM Adapted Sf21 Cells, SFM Adapted CD-CHO Medium CHO-S Cells 293 SFM II 293-F Cells VP SFM COS-7L Cells Liquid GENETICIN PCR/RT-PCR Products: Custom Primers-Gateway attB modifications* PLATINUM Pfx DNA Polymerase PLATINUM Taq DNA Polymerase High Fidelity TAQUENCH PCR Cloning Enhancer THERMOSCRIPT RT-PCR System plus PLATINUM Taq DNA Polymerase High Fidelity DNA Purification Products: CONCERT High Purity Plasmid Miniprep System CONCERT High Purity Plasmid Midiprep System CONCERT High Purity Plasmid Maxiprep System Nucleic Acid Purification Rack CONCERT Rapid Plasmid Miniprep System CONCERT Rapid Plasmid Midiprep System CONCERT Rapid Plasmid Maxiprep System CONCERT Rapid Gel Extraction System CONCERT Matrix Gel Extraction System Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)
Size 5 0.2 ml 5 0.2 ml 5 0.1 ml 100 mg 100 mg 1g 10 10 ml 5 ml 1g
Cat. No. 18263-012 11665-015 10361-012 15519-010 15520-034 15529-019 15544-034 13075-015 11815-016
5 reactions 1.5 ml 1 ml 500 ml 3 ml 3 ml 500 ml 3 ml 500 ml 3 ml 1,000 ml 3 ml 20 ml
10359-016 11668-019 10362-010 10902-096 11496-015 11497-013 10743-011 11619-012 11686-011 11625-019 11681-020 11622-016 10131-035
50 units 500 units 100 units 100 reactions
11708-047 11304-029 11265-014 11146-040
25 reactions 25 reactions 10 reactions each 50 reactions 25 reactions 10 reactions 50 reactions 150 reactions 100 ml
11449-014 11451-010 11452-018 11494-010 11453-016 11454-014 11455-011 11456-019 11457-017 15593-031
60
Product Cloning Reagents: SUPERSCRIPT II RNase H- Reverse Transcriptase SUPERSCRIPT Plasmid System for cDNA Synthesis and Plasmid Cloning PROQUEST Two-Hybrid cDNA Libraries** SUPERSCRIPT cDNA Libraries** Calf Intestinal Alkaline Phosphatase (CIAP) Dpn I Nco I Thermosensitive Alkaline Phosphatase (TsAP) T4 DNA Ligase T4 DNA Polymerase T4 Polynucleotide Kinase Topoisomerase I Proteinase K Plasmid pUC19 DNA Analysis Products: CLONECHECKER System 1 Kb PLUS DNA LADDER Low DNA MASS Ladder High DNA MASS Ladder Low Melting Point Agarose Kodak Digital Science EDAS 120 System, Windows version Macintosh version Protein Analysis Products: BENCHMARK Protein Ladder BENCHMARK Prestained Protein Ladder
Size 10,000 units 3 reactions
Cat. No. 18064-014 18248-013
1,000 units 100 units 200 units 1,000 units 100 units 50 units 200 units 200 units 100 mg 10 g
18009-019 15242-019 15421-019 10534-014 15224-017 18005-017 18004-010 38042-016 25530-015 15364-011
100 reactions 250 g 200 l 200 l 50 g each each
11666-013 10787-018 10068-013 10496-016 15517-014 10947-042 10947-059
2 250 l 2 250 l
10747-012 10748-010
*See our website (lifetech.com) for information about Custom Primers. **See our website for an updated list of GATEWAY-compatible libraries. Additional sizes of these products are also available.

Gateway Cloning Manual

Încărcat de

Informații document

Descriere originală:

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

Gateway Cloning Manual

Încărcat de

Drepturi de autor:

Formate disponibile

GATEWAY Cloning Technology

Two Reactions Constitute the GATEWAY Cloning System

Incubate ~60 min at 25C

Ap r Colonies Next Day (>90% Correct Clones)

Incubate ~60 min at 25C

Kn r Colonies Next Day (>90% Correct Clones)

attB (25 bp)

Integration (Int, IHF)

Figure 4. Bacteriophage Lambda Recombination in E. coli.

Restriction Enzyme and Ligase Cloning

BP Reaction Donor Vector

LR Reaction Expression Clone

+ Restriction Enzymes and Ligase

attB PCR Product

Sal I BamH I Variable Kpn I Region N EcoR I

Xba I EcoR V Xho I Not I EcoR I

Open Reading Frame

B. Expression clone sequence:

C. Suggested oligonucleotides for attB-PCR cloning of gene for native expression

attB1 Open Reading Frame

B. Expression clone sequence:

Transcription from Entry Clones

Native Protein Expression:

Fusion Protein Expression:

His 6 GST Txn

attP Vector Other Names: Name LR Reaction BP Reaction

Reacting Sites attL x attR attB x attP

Structure of Desired Product attB1-gene-attB2 attL1-gene-attL2

Creating an Entry Clone

Positive Control Tube 2 2 l 2 l 4 l 8 l 4 l 20 l

Reaction not Proteinase K

Few or no colonies obtained either from LR Reaction or pUC19 control

Two distinct types of colonies appear, large and small

Increase the concentration of ampicillin in the LB amp plates to 300 g/ml.

High background in absence of Entry Clone.

BP Reaction or attB-PCR Cloning: Incubate plates at 30C instead of at 37C.

Obtain a new sample of attP Plasmid.

Increase the concentration of ampicillin in the LB amp plates to 300 g/ml.

BP CLONASE Enzyme Mix is inactive

Entry Clones appear to lack inserts, migrating as 2.2 kb supercoiled plasmids

BP recombination reaction may have cloned primer-dimers

Low cloning efficiency of attB- PCR products

Increase incubation time to 6-18 h.

Preparing Entry Clones with Restriction Endonucleases and Ligase:

Ligation did not work

Perform transformation using BL21-SI Competent Cells.

a = 1.7 kb b = 1.7 kb c = 1.8 kb

DNA Rfa Rfb Rfc

Not I 129 130 131

Pvu II 348 349 491

Sma I 1319 1320 1462

Sfc I 1572 1573 1715

Sal I 1578 1579 1721

Protocol for Making a Destination Vector

--- NNN NNN --- NNN NNN

attR 1 Reading Frame Cassette B

Gene Entry Clone Kn r

B2 Gene Expression Clone Stop reaction and Transform Apr

5.6 Detailed Descriptions of the Vectors of the GATEWAY Cloning System

Figure 18. Vector Map of Typical Entry Vector

Figure 19. Cloning Sites of the Entry Vector pENTR1A

Figure 20. Cloning Sites of the Entry Vector pENTR2B

Figure 21 Cloning Sites of the Entry Vector pENTR3C