Virus Research 62 (1999) 67 76 www.elsevier.

com/locate/virusres

Localization of foot-and-mouth disease virus RNA by in situ hybridization within bovine tissues
Mariana L. Prato Murphy a,b, Morag A. Forsyth a, Graham J. Belsham a,*, Jeremy S. Salt a,1
a

BBSRC Institute for Animal Health, Pirbright, Woking, Surrey GU24 ONF, UK b Institute of Virology, CICV-INTA, Moron, Argentina

Received 22 January 1999; received in revised form 29 April 1999; accepted 29 April 1999

Abstract Foot-and-mouth disease is a highly contagious disease of cloven hooved animals. In cattle, both acute and long-term persistent infections occur. Foot-and-mouth disease virus (FMDV), a picornavirus, has been shown, using virus isolation procedures, to replicate in the pharynx and soft palate of cattle. In this study, in situ hybridization has been used to detect FMDV RNA within the cells of tissues removed from infected bovines. A digoxigenin-labelled anti-sense RNA probe was prepared corresponding to a region of the FMDV genome encoding part of the RNA-dependent RNA polymerase (3D). The efcacy and specicity of this probe for in situ hybridisation was determined using virus-infected cells in tissue culture. Strong cytoplasmic staining was only detected in FMDV-infected cells. Various tissue samples were collected from FMDV-infected cattle between 5 and 17 days post-infection. Viral RNA was detected by in situ hybridisation within cells of the soft palate, tonsil and pharynx up to 17 days post-infection. This technique is useful for the study of FMDV localization in cattle both during and after the acute clinical phase of disease and may assist in identifying specic sites of virus persistence. 1999 Elsevier Science B.V. All rights reserved.
Keywords: In situ hybridization; Foot-and-mouth disease virus; RNA probe; Digoxigenin; Virus persistence

1. Introduction Foot-and-mouth disease virus (FMDV) is a member of the Picorna6iridae family. It causes a highly contagious disease of cloven-hooved animals (Bachrach, 1968; Pereira, 1981). The disease has great socioeconomic impact not only in those countries where it is endemic but also when outbreaks occur elsewhere. For example, the recent outbreaks of FMDV in Taiwan are estimated

* Corresponding author. Tel.: +01483-232441; fax: + 01483-232448. E-mail address: graham.belsham@bbsrc.ac.uk (G.J. Belsham) 1 Present address: Pzer, Animal Health Product Development, Central Research, Sandwich, Kent, CT13 9NJ, UK.

0168-1702/99/$ - see front matter 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 9 9 ) 0 0 0 5 0 - 7

68

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

to have cost several billion US dollars and resulted in the death of over 4 million pigs (Dunn and Donaldson, 1997). The virus has a singlestranded positive sense RNA genome of about 8.3 kilobases within an icosahedral capsid made up of 60 copies of each of four proteins VP1(1D), VP2 (1B), VP3 (1C) and VP4 (1A) (Belsham, 1993; Rueckert, 1996). In addition to causing acute disease, this virus induces a long-lasting persistent infection in a high proportion of animals and this might be an important factor in the epidemiology of FMD (Donaldson and Kitching, 1989; Salt, 1993; Dawe et al., 1994). The pathogenesis of FMD has been the subject of numerous investigations (Eskildsen, 1969; Sutmoller and McVicar, 1976; Yilma, 1980; Burrows et al., 1981; McVicar and Eisner, 1983). In particular, the sequential distribution of virus through the body has been examined in several studies using virus isolation (Sutmoller and McVicar, 1976; Burrows et al., 1981; McVicar and Eisner, 1983). Although the oropharynx has been identied as the major site for FMDV replication during acute and persistent infection (Burrows, 1966; Prato Murphy et al., 1994), no data are available on the cell types involved. Hybridization of viral nucleic acids is becoming an increasingly useful technique for the diagnosis of viral infections (Binder et al., 1986) and the application of in situ techniques allows rapid, sensitive, and specic detection of virus nucleic acid distribution in tissues.
Table 1 Sequences of the oligonucleoide primers used for PCR amplication Oligonucleotide designation OR31, forward OR43, reverse 3D1, forward 967, forward MM1, reverse MM2, forward MR2, reverse Sequence (5%3%)

The objective of the study reported here was to extend previous studies using in situ hybridization to identify sites of FMDV localization within tissues obtained from cattle during and after the acute phase of FMDV infection. Our results demonstrate that the viral RNA is localized in the soft palate and pharynx until at least 17 days post-infection, a period which extends beyond the normal time of virus clearance in non-persistently infected cattle.

2. Materials and methods

2.1. Preparation of infected cell cultures

Baby hamster kidney (BHK-21) cells were cultured on 13 mm diameter coverslips (BDH) in 12-well plates (Corning, NY) using Eagles minimum essential medium supplemented with 10% (v/v) bovine calf serum and antibiotics. When cells were conuent, duplicate wells were inoculated with FMDV strain O1 Lausanne. At 2 and 4 h post-infection, cultures were xed in 4% (w/v) buffered paraformaldehyde pH 8 overnight at 4C. Slides were stored in 70% ethanol at 4C.

2.2. Sample collection from cattle

Ten cattle were exposed to FMDV type O1 BFS by direct contact with a bovine showing clinical signs of FMD within high containment animal accommodation. Samples of soft palate, palatine tonsil and pharyngeal tissues were collected at post-mortem from cattle killed at 5 (n=3), 7 (n = 2), 10 (n= 1), 14 (n=2) and 17 (n= 2) days after exposure. Tissues were xed in 4% (w/v) buffered paraformaldehyde pH 8 for 18 h, washed in PBS and embedded in parafn wax. Negative controls included similar tissue sections from uninfected cattle (n= 2) processed identically to those taken from the FMDV-exposed animals.

GGGGGGAATTCCGGGTTGATTGTGGAC EcoRI GGGGAATTCTTACGCGTCACCGCACAC EcoRI CAGAGATGTGGAAGAGCGCG TTGCACCCACCGTTGCACAC TCAGGGTTGCAACCGACCGC GCGGTCGGTTGCAACCCTGA GTATGGTCCCACGGCGTGCA

2.3. Probe preparation and labelling

Plasmid pMR15 (Ryan et al., 1989) containing cDNA encoding the entire polyprotein of FMDV O1 Kaufbeuren was used as a template in a PCR

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

69

Fig. 1. Location of FMDV cDNAs and primers used in this study. The structure of the FMDV RNA genome, including a poly C tract and internal ribosome entry site (IRES), and the polyprotein it encodes are indicated. Synthesis of the polyprotein commences at two positions to produce two forms of the L protease, Lab and Lb. The approximate location of indicated oligonucleotide primers used in this study and their orientation are also shown. The construction of clones 6 and 30 is described in materials and methods. Transcription from the SP6 promoter of clone 6 produced the antisense riboprobe used for the detection of FMDV RNA. Restriction sites for EcoRI (RI) and BamHI are indicated.

using the primers OR31 and OR43 (see Table 1). Each primer contains an EcoRI restriction site sequence and together amplied the entire 3D region of the viral genome. The 3D protein is the RNA dependent RNA polymerase. The PCR product (1555 bases pairs) was isolated from an agarose gel, puried using the Wizard PCR prep kit (Promega), digested with EcoRI and ligated to similarly digested pGEM3Z vector (Promega). Following transformation of E. coli (JM109), plasmid DNA was isolated from amplied colonies and analysed by restriction enzyme digestion. Clone 30 contained the insert in the orientation which allowed the transcription of a positive sense RNA probe using the T7 promotor (see Fig. 1). A second construction was prepared which was suitable for the production of both positive and negative sense probes with unique lineariza-

tion sites. Plasmid DNA of clone 30 was digested with BamHI (see Fig. 1). The large fragment was isolated and self-ligated. After transformation of JM109, a plasmid of the correct structure (clone 6, see Fig. 1), as analysed by enzyme digestion, was selected and amplied. The DNA was linearized with EcoRI for use as template for the synthesis of the negative sense RNA probe incorporating digoxigenin-dUTP using SP6 RNA polymerase. A RNA SP6/T7 labelling kit (Boehringer-Mannheim) was used following the manufacturers instructions. Briey, the puried linear DNA (1 mg) was mixed with NTP Labelling Mixture (2 ml), 10X Transcription Buffer (2 ml) and water (to 18 ml) before the addition of SP6 RNA polymerase (2 ml, 20 U) and RNase Inhibitor (1 ml, 20 U). Following incubation at 37C for 2 h, the reaction was terminated by the addi-

70

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

tion of 0.2 M EDTA (2 ml), 4 M LiCl (2.5 ml) and ethanol (75 ml). The precipitated digoxigenin (DIG)-labelled RNA was resuspended in DEPCtreated water (50 ml) with RNase Inhibitor (1 ml, 20 U). A control DIG-labelled RNA probe corresponding to about 600 bases of swine vesicular disease virus (SVDV) genome coding for regions of the structural proteins 1C and 1D was prepared in the same way and kindly provided by Dr F. Lin (Pirbright). Briey, the template was prepared by RT-PCR amplication of SVDV RNA using primers GSVD-3 and GSVD-5 [as described by Lin et al. (1997)] and the fragment was inserted into pGEM-T (Promega). DIG-labelled RNA was prepared using T7 RNA polymerase with linearized plasmid template as described above.

Kaiser Jelly under a coverslip and cells were examined by microscopy.

2.5. In situ hybridization of tissue sections

Parafn embedded samples of xed tissues were cut into 4 mm thick sections, adhered onto superfrost microscope slides (BDH Laboratory Supplies), then deparafnized in xylene (15 min), and incubated (10 min each) in decreasing concentrations of ethanol (100, 70 and 40%). The tissue samples were washed in DEPC-treated water and incubated with proteinase K (5 mg/ml) in proteinase K dilution buffer (50 ml per slide) for 15 min at 37C. After digestion, the slides were washed in proteinase K inactivation buffer. Hybridization to the RNA probe was carried out following the protocol described above for cell cultures. The substrate development was stopped after 30 min incubation at 37C in a humidied chamber and the slides were mounted using Kaiser Jelly.

2.4. In situ hybridization of infected cell monolayers

Conuent BHK-21 cell monolayers on coverslips were treated with proteinase K (0.01 mg/ml, 50 ml; Boehringer-Mannheim) prepared in proteinase K dilution buffer (20 mM Tris HCl, pH 7.4, 2 mM CaCl2) for 15 min at 37C in a humidied chamber. The protease was inactivated in proteinase K inactivation buffer (100 mM glycine, 200 mM Tris HCl, pH 7.4) and the cells rinsed in water. For in situ hybridization the probe was diluted to 200 ng/ml and hybridised overnight at 37C in a humidied chamber as described by Woodbury et al. (1995). The samples were washed twice in 4X SSC and once in 1X SSC (10 min each) then incubated (30 min) in 2% (w/v) bovine serum albumin in 0.1X SSC. The Fab% fragment of an anti-DIG monoclonal antibody conjugated to alkaline phosphatase (1:200 dilution, Boehringer-Mannheim) was used for detection of the labelled probe by incubating in 2% (w/v) bovine serum albumin in 0.1X SSC for 30 min at 37C. The slides were washed (210 min) in Buffer 1 and incubated for 5 min in Buffer 3. Slides were covered with NBT/BCIP substrate solution in Buffer 3 (50 ml) and kept in the dark. The reaction was stopped after 5 min by rinsing the slide in TE Buffer (pH 8) for 5 min at room temperature. The slides were mounted using

3. Results A cDNA fragment corresponding to a portion of the FMDV 3D coding sequence was transcribed in vitro from clone 6 (see Fig. 1) to produce a single stranded, antisense DIG-labelled RNA molecule (ca. 800 nt) as described in Section 2. Within picornavirus-infected cells the positive sense viral RNA is present at a much higher level than the negative strand, thus selectivity for the positive strand is preferred for maximum sensitivity of detection. However, use of a probe specic for the negative strand would specically identify cells in which replication of the virus has occurred. Initially the probe was checked for its ability to bind specically to cDNA corresponding to the FMDV 3D sequences. Different fragments of FMDV cDNA were amplied from a plasmid template, pMR15 (Ryan et al., 1989), using a PCR with primers specic for the 3D coding region of FMDV (primer sets 3D1/MM1, 967/MM1 and MM2/MR2, see Fig. 1 and Table 1) or for the capsid coding region (primers P1/P2, Amaral-Doel et al., 1993). The fragments gener-

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

71

ated were denatured, immobilized on a membrane and hybridised to the 3D riboprobe. A strong signal was observed with each of the 3D fragments (including the fragment generated with primers MM2 and MR2 which is complementary to about 180 bases of the riboprobe) but no signicant signal was observed using the P1-2A sequence amplied by the P1/P2 primer set as expected (data not shown). Clearly a more stringent check on the probe was to determine its ability to detect FMDV RNA within cells. BHK cells were infected with FMDV or mock-infected. At 2 or 4 h post-infection samples were xed and subsequently hybridised to the FMDV 3D specic probe. At each time point microscopic examination of FMDV-infected BHK cells showed a dark and intense cytoplasmic staining that was mainly perinuclear (Fig. 2a). Infection was detected down to the dilution which represented an inoculation dose of 25 TCID50 per well. Mock-infected BHK cells did not show any staining (Fig. 2b). No staining was observed in the FMDV-infected cells when a RNA probe derived from an enterovirus, swine vesicular disease virus (SVDV), was used for in situ hybridization (data not shown). This probe (ca. 600 nt) corresponded to part of the SVDV capsid coding region. Additional controls demonstrated that DNase treatment of the cells did not

affect the positive signal obtained with the FMDV 3D riboprobe using FMDV-infected cells whereas RNase treatment abolished the signal from the infected cells (data not shown).

3.1. Analysis of foot-and-mouth disease 6irus RNA localization within tissue sections
Previous studies have shown that FMDV RNA could be detected using in situ hybridization in bovine tissues during the rst 5 days post infection (Brown et al., 1992; Woodbury et al., 1995; Brown et al., 1996). However there has been no attempt to examine the distribution of virus replication at later times post-infection. In this study samples from various tissues of FMDV-infected cattle have been analysed up to 17 days post-infection. Tissue samples removed post mortem were embedded in parafn and the distribution of viral RNA determined by in situ hybridization to the FMDV antisense 3D riboprobe. At 5 days post-infection, vesicular lesions were apparent on the FMDV-infected cattle. Samples of tissues were analysed as described in materials and methods. The tissue samples studied were from the dorsal and ventral soft palate, the tonsils and the pharynx. Sections of the soft palate and pharynx showed heavy deposits of the blueblack chromagen in the cytoplasm of cells in the stra-

Fig. 2. Specicity of FMDV 3D riboprobe hybridization within BHK cells. (a) Positive cytoplasmic staining following hybridization with the 3D-FMDV RNA probe of BHK-21 cells that were xed in 4% paraformaldehyde 4 h after infection with 105.5 TCID50 FMDV O1 Lausanne. (b) Lack of staining in mock-infected BHK-21 cells following hybridization with the 3D-FMDV RNA probe.

72

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

Fig. 3. Localization of FMDV RNA in tissues of virus infected cattle. Tissue samples were removed from cattle 5 days post infection and analysed for the presence of FMDV RNA using the 3D-FMDV RNA probe. Tissues analysed were: (a) pharynx; (b) ventral soft palate; (c) dorsal soft palate and (d) cells of pharynx (4 higher magnication). The location of the stratum germinativum (SG), stratum spinosum (SS) and lamina propria (LP) are indicated in panels (b) and (d).

tum germinativum of the epithelium (see Fig. 3a d) as observed previously by Woodbury et al. (1995). The viral RNA was not evident completely throughout this layer in some samples (see Fig. 3c), presumably some areas of the tissue remained uninfected. Within affected areas most of the cells in the stratum germinativum were infected (see Fig. 3d). It is interesting to note the presence of a small number of individual stained mononuclear cells within the lamina propria of the ventral soft palate (see Fig. 3b). It is possible these are dendritic cells migrating to lymphoid tissue. No signicant staining was observed, either in

neighbouring tissue sections from FMDV-infected cattle which were hybridized with the control SVDV RNA probe, or when samples from the uninfected bovine control tissues were hybridized with the 3D-FMDV RNA probe (see above). At 7, 10 and 14 days post-infection, a similar pattern of distinctive intracytoplasmic staining corresponding to FMDV RNA was again seen in the stratum germinativum and the stratum spinosum of the epithelium of the tissue samples (data not shown). Fig. 4 shows tonsil samples analysed at 14 days post infection. Staining localized to follicular structures within the tonsils from

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

73

the FMDV-infected bovine samples was evident (Fig. 4a, b). In contrast, no staining was seen in consecutive sections of the FMDV-infected tonsil tissue when analysed using a probe against the SVDV VP1 sequence (Fig. 4c). At 17 days post-infection, strong staining was still observed in the epithelial layers of the pharynx (Fig. 5a) and soft palate (Fig. 5b). In some sections of the soft palate it was apparent that the infected cells were separating from the intact tissue and in some areas the intact tissue appeared to be free from the presence of FMDV RNA (Fig. 5c). Staining of consecutive sections of the soft palate samples with the SVDV probe again proved negative (Fig. 5d). Similarly, samples of

soft palate from the uninfected cattle showed no signicant staining with the FMDV 3D riboprobe (Fig. 5e).

4. Discussion The FMDV riboprobe used in this study was capable of detecting FMDV RNA as sensitively in FMDV-infected BHK cells as an in situ RT-PCR procedure described previously (Prato Murphy et al., 1995). This hybridization was specic since no staining was observed when the probe was applied to uninfected cells. The antisense RNA probe derived from the 3D coding sequence was also

Fig. 4. FMDV RNA localization within follicles of tonsil. Tonsils were removed from a bovine, post mortem, at 14 days post infection and analysed using the FMDV (panels a, b) or SVDV (panel c) RNA probes. Note the staining within the follicle detected with the FMDV probe.

74

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

Fig. 5. Detection of FMDV RNA within tissues at 17 days post infection. Tissue samples were removed from bovines, post mortem, at 17 days post infection [samples (ad) or from an uninfected animal (panel e)] and analysed using the FMDV RNA probe [panels (ac and e) or with the SVDV RNA probe (panel d)]. Tissues were: (a) pharynx; (b) soft palate; (c) soft palate (with cell shedding); (d) neighbouring section of soft palate to that used in panel c); and (e) soft palate (from uninfected bovine).

successful in specically detecting FMDV infection in formalin-xed parafn-embedded tissue samples from FMDV-infected cattle. The RNA was strongly and reproducibly detected in the epithelial tissues of the crypts and mucosal epithelial reections surrounding lymphoid tissue. These studies conrmed previous results (Brown et al., 1992; Woodbury et al., 1995; Brown et al., 1996) which showed that in tissue taken from animals up to 5 days post infection FMDV RNA was localized in the stratum granulosum and spinosum of the soft palate, tonsil and pharynx. We have now extended these observations by

analysing the distribution of the viral RNA up to 17 days post-infection. Similar patterns of viral RNA distribution were observed throughout this time. Additional localization of viral RNA within follicles of the tonsil was also observed, consistent with earlier observations by Brown et al. (1996) of FMDV RNA localization within a follicle of the tracheo-bronchial lymph node. However, in other studies it has been apparent that non-specic staining of these follicles can occur (E. Woodbury and J.S. Salt, unpublished results) and this result should be conrmed by other assays. The presence of a small number of stained mononuclear

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776

75

cells within the lamina propria of the epithelium may be indicative of cells of the immune system migrating from the infected tissue. Presumably such cells may accumulate within the follicles of the tonsil or other lymph nodes which could explain the staining observed within these structures both in this study (see Fig. 4) and also by Brown et al. (1996). FMDV-infected cattle show clinical signs of disease from 2 to 14 days post infection and virus is normally considered to be cleared by about 14 days post-infection except when a persistent infection [dened as virus maintenance beyond 28 days post infection (Salt, 1993)] is established. Persistent infections are common in cattle following contact with live FMDV (over 50% of animals). In contrast, no evidence for persistent infections of pigs (another target of acute FMDV infection) has been found (Carrillo et al., 1990; Salt, 1998). The localization of RNA within tissues of cattle infected up to 17 days previously (beyond the normal period of time for clearance of infection) is strongly suggestive that these same sites are those infected in carrier cattle. The use of in situ hybridization and RT-PCR in situ hybridization techniques should facilitate the identication of specic cells in which FMDV RNA is maintained in persistently infected cattle.

Acknowledgements Dr Mariana Prato Murphy was supported with an external scholarship from CONICET, Buenos Aires, Argentina. We thank Dr Fengsheng Lin of the Pirbright Laboratory for supplying the SVDV RNA probe and Dr P. Kitching for helpful comments on the manuscript. This work was supported in part by MAFF project SE 2911.

References
Amaral-Doel, C.M.F., Owen, N.E., Ferris, N.P., Kitching, R.P., Doel, T.R., 1993. Detection of foot-and-mouth disease viral sequences in clinical specimens and ethyleneimine-inactivated preparations by the polymerase chain reaction. Vaccine 11, 415421.

Bachrach, H.L., 1968. Foot-and-mouth disease virus. Annu. Rev. Microbiol. 22, 201 244. Belsham, G.J., 1993. Distinctive features of foot-and-mouth disease virus, a member of the picornavirus family; aspects of virus protein synthesis, protein processing and structure. Prog. Biophys. Mol. Biol. 60, 241 260. Binder, M., Tourmente, S., Roth, J., Renaud, M., Gehring, W., 1986. In situ hybridization at the electron-microscope level-localization of transcripts on ultrathin sections of lowicryl K4M-embedded tissue using biotinylated and protein-A gold complexes. J. Cell. Biol. 102, 1646 1653. Brown, C.C., Meyer, R.F., Olander, H.J., House, C., Mebus, C.A., 1992. A pathogenesis study of foot-and-mouth disease in cattle using in situ hybridization. Can. J. Vet. Res. 56, 189 193. Brown, C.C., Piccone, M.E., Mason, P.W., McKenna, T.S.-C., Grubman, M.J., 1996. Pathogenesis of wild-type and Leaderless foot-and-mouth disease virus in cattle. J. Virol. 70, 5638 5641. Burrows, R., Mann, J.A., Garland, A.J.M., Greig, A., Goodridge, D., 1981. The pathogenesis of natural and simulated foot-and-mouth disease infection in cattle. J. Comp. Pathol. 91, 599 609. Burrows, R., 1966. Studies on the carrier state of cattle exposed to foot-and-mouth disease. J. Hyg. 64, 81 90. Carrillo, C., Plana, J., Mascarella, R., Bereada, J., Sobrino, F., 1990. Genetic and phenotypic variability during replication of foot and mouth disease in swine. Virology 179, 890 892. Dawe, P.S., Sorensen, K., Ferris, N.P., Barnett, I.T.R., Armstrong, R.M., Knowles, N.J., 1994. Experimental transmission of foot-and-mouth disease virus from carrier African buffalo (Sincerus caffer) to cattle in Zimbabwe. Vet. Rec. 45, 211 215. Donaldson, A.I., Kitching, R.P., 1989. Transmission of FMDV by vaccinated cattle following natural challenge. Res.Vet. Sci. 46, 9 14. Dunn, C.S., Donaldson, A.I., 1997. Natural adaptation to pigs of a Taiwanese isolate of foot-and-mouth disease virus. Vet. Rec. 141, 174 175. Eskildsen, M.K., 1969. Experimental pulmonary infection of cattle with foot-and-mouth disease virus. Nord. Vet. Med. 21, 86 91. McVicar, J.W., Eisner, R.J., 1983. Aerosol exposure of cattle to FMDV. J. Hyg. 91, 319 328. Lin, F., Mackay, D.K.J., Knowles, N.J., 1997. Detection of swine vesicular disease virus RNA by reverse transcriptionpolymerase chain reaction. J. Virol. Methods 65, 111 121. Pereira, H.G., 1981. Foot and mouth disease. In: Gibbs, E.P.J. (Ed.), Virus Diseases of Food Animals. Academic Press, London, 2, 333 363. Prato Murphy, M.L., Meyer, R.F., Mebus, C., Schudel, A.A., Rodriguez, M., 1994. Identication of sites of FMDV persistence in carrier cattle via the polymerase chain reaction. Arch.Vir. 136, 299 307. Prato Murphy, M.L., Rodriguez, M., Schudel, A.A., Meyer, R.F., 1995. Localization of foot and mouth disease virus

76

M.L. Prato Murphy et al. / Virus Research 62 (1999) 6776 (Eds.), Topics in Tropical Virology, vol. 1. Malhotra Publishing house, New Delhi 110018, India. Sutmoller, P., McVicar, J.W., 1976. Pathogenesis of footand-mouth disease: the lung as an additional portal of entry of the virus. J. Hyg. 77, 235 243. Woodbury, E.L., Ilott, M.C., Brown, C.C., Salt, J.S., 1995. Optimization of an in situ hybridization technique for the detection of foot-and-mouth disease virus in bovine tissues using the digoxigenin system. J. Virol. Methods 51, 89 94. Yilma, T., 1980. Morphogenesis of vesiculation in foot-andmouth disease. Am. J. Vet. Res. 41, 1537 1542.

RNA in tissue culture infected cells via in situ polymerase chain reaction. J. Virol. Methods 54, 173178. Rueckert, R.R., 1996. Picornaviridae: The viruses and their replication. In: Fields, B.N., Knipe, D.N., Howley, P.M., et al. (Eds.), Virology, 3rd ed. Philadelphia, LippincottRaven Publishers, pp. 609654. Ryan, M.D., Belsham, G.J., King, A.M.Q., 1989. Specicity of enzyme-substrate interactions in foot-and-mouth disease virus polyprotein processing. Virology 173, 3345. Salt, J.S., 1993. The carrier state in foot-and-mouth diseasean immunological review. B. Vet. J. 149, 207223. Salt, J.S., 1998. Persistent infection with foot-and-mouth disease virus. In: Black, D.N., Shukla, D.D., Rishi, N.