Sunteți pe pagina 1din 237

MASTERAT CERCETRI CRIMINALISTICE APLICATE

IDENTIFICAREA PERSOANEI N MEDICINA LEGAL lect. univ. dr. Dogroiu Ctlin

Promovarea cercetrii tiinifice din domeniul criminalisticii n activitatea judiciar POSDRU/86/1.2/S/62307 Proiect cofinanat din Fondul Social European prin Programul Operaional Sectorial Dezvoltarea Resurselor Umane 2007-2013 Edituta AIT Laboratories, Bucureti, 2011 ISBN: 978-606-8363-03-5

Identificarea persoanei n medicina legal Descrierea CIP a Bibliotecii Naionale Romne Ctlin, DOGROIU

lect. univ. dr. Dogroiu Ctlin

Identificarea persoanei n medicina legal / Dogroiu Ctlin Bucureti: Editura AIT Laboratories s.r.l., decembrie 2011 ISBN: 978-606-8363-03-5

978-606-8363-03-5

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

CUPRINS
CUPRINS .............................................................................................................................. 5 ASPECTE INTRODUCTIVE ALE IDENTIFICARII PERSOANEI PRIN METODE MEDICO-LEGALE ............................................................................................. 7 ELEMENTE DE BIOLOGIE SI ANATOMIE A SCHELETULUI UMAN ...................... 17 METODOLOGIA DE LABORATOR A IDENTIFICARII MEDICOLEGALE - ODONTOSTOMATOLOGIE ........................................................................ 145 METODOLOGIA DE LABORATOR A IDENTIFICARII MEDICOLEGALE AMPRENTA GENETICA............................................................................. 171 IDENTIFICAREA MEDICO-LEGALA A VICTIMELOR DEZASTRELOR NATURALE, A CELOR PRODUSE DE OM SI A CRIMELOR IMPOTRIVA UMANTIATII. ........................................................................................... 207 REFERINE ..................................................................................................................... 228

978-606-8363-03-5

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 1
ASPECTE INTRODUCTIVE ALE IDENTIFICARII PERSOANEI PRIN METODE MEDICO-LEGALE Notiuni generale despre identificarea medico-legala
In termeni generali identitatea este ceea ce defineste o entitate si o face recognoscibila prin posesia unor calitati sau caracteristici care o diferentiaza de alte entitati. Prin urmare identificarea este actul de a stabili caracteristicile definitorii, proprii unei entitati.1(p1. Astfel la persoanele vii si la cadavre identificarea are rolul de a evidentia si grupa caracterele ce definesc unicitatea individului. Termenul de identitate deriva din cuvantul latin idem ce inseamna la fel sau identic. 1(p1) Identificarea persoanei este o activitate care se realizeaza in mod optim prin colaborarea intre medicina legala, antropologie, criminalistica si politia judiciara2(p566) colaborare concretizata prin metode de laborator (medico-legale, antropologice, serologice, genetice, traseologice, fizico-chimice) si metode investigative (testimoniale, cercetarea locului faptei, reconstituire). 2(p566) De exemplu, stabilirea identitatii presupune atat metode medico-legale cat si criminalistice (de exemplu recunoasterea imbracamintii, a documentelor de identitate si a bunurilor personale). De asemenea sunt metode de identificare criminalistica cu o importanta componenta medico-legala cum ar fi dactiloscopia sau in cazul identificarii obiectelor personale cum ar fi aparatele pentru imbunatatirea auzului, ochelari, medicamente, sau proteze dentare si chirurgicale.3(p98) Identificarea persoanelor, a cadavrelor si a resturilor umane in diferite stadii de descompunere este ceruta de organele judiciare, instantele de judecata si de alte institutii pentru: initierea cercetarilor in vederea descoperirii infractorului in cazuri de omucidere, obtinerea unor date de ancheta in cazuri de sinucidere, accident sau morti suspecte. Atunci cand identitatea victimei nu se cunoaste obtinerea de date de ancheta despre circumstantele mortii persoanei respective sunt dificil de obtinut. identificarea persoanelor care isi ascund identitatea identificarea persoanelor disparute, mai ales in cazul victimelor dezastrelor (fie ca sunt produse de forte ale naturii sau prin interventie umana accidentala sau intetionala) sau ale crimelor de razboi, genocidului sau crimelor impotriva umanitatii, unde identificarea ramasitelor umane are un rol central atat din punct de vedere etic, umanitar cat si juridic. 1(p4),3(p98) inregistrarea oficiala a decesului individului in vederea inhumarii inregistrarea statistica a decesului individului obtinerea asigurarilor de viata, a pensiei de urmas.
978-606-8363-03-5 7

Masterat cercetri criminalistice aplicate

Identifcarea persoanei pe baze medicale si anatomice implica doua mari aspecte: 1. determinarea caracterelor generale ale ramasitelor umane: sexul, varsta, talia, rasa/etnia. Acestea au un rol de screening a potentialilor candidati pentru identificare, incadrand persoana intr-o anumita categorie de varsta, rasa, inaltime, etc. De asemenea dau un plus de certitudine identificarii facute pe baza caracteristicilor individuale. 2. Identificarea individuala se bazeaza pe existenta unor trasaturi sau elemente anatomice si/sau medicale specifice gasite la cadavrul neidentificat care vor fi comparate cu cele ale persoanei data disparuta. Metodele de identificare medico-legala se aplica atat in cazul omului viu cat si a cadavrelor in diferite stadii de putrefactie: cadavre intacte, fara sau in stadiu incipient de putrefactie. In aceasta situatia identificarea se poate face prin recunoastere vizuala directa a cadavrului de catre un membru al familiei/prieten sau prin comparare cu o poza efectuata antemortem. De asemenea, tot in aceasta situatie, culoarea parului, pigmentatia pielii, prezenta cicatricilor si a tatuajelor se poate face fara dificultate.3(p98) cadavre putrefiate identificarea vizuala este practic imposibila deoarece multe din caracteristicile individuale sunt total sau partial disparute, dar se pot obtine mai multe informatii decat de la ramasitele scheletizate. De exemplu se pot face masuratori directe ale cadavrului pentru determinarea inaltimii sau se pot gasi catricile unor interventii chirurgicale, tatuaje. 3(p98) cadavre dezmembrate, mutilate, incinerate, sau cu leziuni intinse si profunde produse prin impact sever. Identificarea va depinde de volumul si de localizarea tesutului si regiunii afectate. Daca nu au aparut modificarile specifice putrefactiei atunci se poate determina, spre exemplu pigmentatia pielii, dar nu se pot face masuratori directe a staturii. In anumite cazuri de omucidere se realizeaza in mod deliberat mutilarea selectiva a victimei (extragerea dintilor sau distrugerea amprentelor digitale) tocmai pentru a ingreuna identificarea. cadavre scheletizate identificarea se bazeaza numai pe examinarea osteologica si odontologica incluzand recunoasterea anumitor caracteristici anatomice sau a urmelor de vindecare a fracturilor, prezenta unor afectiuni patologice ale osului. Cursul va prezenta in principal metodele de identificare medico-legala a cadavrelor, aceste expertize avand doua obiective principale: o determinarea identitatii persoanei o furnizarea de detalii in vederea reconstituirii evenimentelor premergatoare mortii.4(p8)
8 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Etapele care trebuie parcurse de o expertiza ce include identificarea medicolegala sunt:2(p569) a. luarea la cunostinta a obiectivelor expertizei stabilite de organul judiciar b. inventarul pieselor supuse expertizei c. examinarea continutului dosarului, inclusiv a procesului verbal de cercetare a locului faptei d. stabilirea tehnicii si metodelor ce urmeaza a fi utilizate e. stabilirea specialitatilor ce sunt eventual necesare in cadrul expertizei. Examenul intrinsec se realizeaza se realizeaza prin metode specifice antroplogice medico-legale ce vor fi descrise ulterior. Expertul antropolog are un rol important atat in etapele initiale ale cercetarii la fata locului prin descoperirea si colectarea ramasitelor umane cat si in etapa ulterioara ce are loc in laborator unde se vor determina caracteristicile de grup (generale): varsta, sex, rasa/etnie, talie cat mai ales cele individuale (cele carel deosebesc pe individ de majoritatea semenilor sai), de exemplu: particularitati ale schemei dentare, urme lasate de vindecarea unor leziuni traumatice, prezenta unor materiale utilizate in diferite interventii chirurgicale-ortopedice, iar la omul viu particularitati morfologice normale sau patologice, unice sau rare prin marimea, conformatia pozitia lor (de exemplu, nevi pigmentari) sau configuratii morfologice care, prin complexitatea lor nu au decat o posibilitate foarte redusa de a se repeta intcomai la alti indivizi (configurarea crestelor papilare, fizionomia fetei, forma corpului, pavilionul urechii, etc). 5(p779) Antropologia medico-legala (de la cuvintele grecesti antropos = om, logos = stiinta, studiu), reprezinta aplicarea antropologiei fizice cu urmatoarele scopuri: identificarii ramasitelor scheletizate sau in stare avansata de descompunere in context juridic sau umanitar6, incluzand: - determinarea sexului, varstei, rasei/etniei, taliei - identificare pozitiva bazata pe aspecte unice ale morfologiei osoase si dentare diferentierea leziunilor perimortem de cele antemortem sau postmortem explicarea mecanismului lezional perimortem estimarea intervalului postmortem asistenta in descoperirea si colectarea ramasitelor umane Antropologia fizica este ramura antropologiei care se ocupa cu studiul corpului uman.

Scurt istoric al identificarii medico-legale antropologice


Dezvoltarea identificarii antropologice poate fi impartita in 3 etape si anume: perioada de formare (1800-1938), consolidare (1939 - 1971) si perioada moderna (incepand din 1972 si pana in prezent).7(p315) Inceputurile antropologiei medico-legale moderne isi are originile in preocuparile stiintifice ale anatomistilor si antropologilor Europei secolelor 18 si
978-606-8363-03-5 9

Masterat cercetri criminalistice aplicate

19 care au aplicat cunostiintele lor stiintifice pentru a raspunde problemelor ridicate de justitie.8(pp41,44) Una din cele mai timpurii contributii a fost adusa de Jean-Joseph Sue, instructor de anatomie artistica la muzeul Luvru, care in 1755 a publicat un studiu privind masurarea cadavrelor cu varste pornind de la fetusi pana la adulti tineri furninzand detalii cu privire la proportiile corporale si cum acestea se modifica cu varsta. Activitatea lui Sue a fost continuata si dezvoltata de Joseph Orfila la inceputul secolului 19. Ambele baze de date antropometrice au fost utilizate mult timp pentru estimarea staturii pornind de la resturi scheletale.8(p41),9(p5) In 1856 Paul Broca a fondat la Paris, prima societate de antropologie fizica denumita Societatea de Antropologie. De asemenea Broca a inventat instrumente de masurare scheletala (goniometrul, stereograful). 8(p42),9(p5) Paul Topinard, succesorul lui Broca, a inclus in tratatul sau de antropologie fizica (Elements dAnthropologie Generale 1885) si un capitol referitor la estimarea staturii, efortul sau fiind continuat de Etienne Rollet care a prezentat comparativ sub forma de tabel lungimea oaselor lungi cu cea a corpului la cadavrele a 50 de barbati si 50 de femei, tabel ce a fost utilizat ulterior in mod extensiv in antropologia medico-legala. 8(p42),9(p5) Thomas Dwight autorul eseului The Identification of the Human Skeleton: A Medico-Legal Study (1878) este primul care traseaza directiile de dezvoltare a antropologiei medico-legale subliniind necesitatea dezvoltarii unor metode de estimare a varstei victimei la moarte, a sexului si staturii. 8(p42) Un alt nume cu rezonanta in domeniul identificarii este George A. Dorsey care aratat importanta cunostintelor osteologice in domeniul identificarii medicolegale. De asemenea, Dorsey a fost primul expert care a depus marturie intr-un proces de omucidere care a avut loc in Chicago intre anii 1897-1898 si care presupunea si identificarea unor fragmente osoase. 8(p42) O contributie deosebita la dezvoltarea identificarii antropologice a fost adusa de Ales Hrdlicka (1869-1943) care a fondat in 1918 American Journal of Physical Anthropology si Asociatia Americana de Antropologie Fizica. Interesele sale stiintifice au inclus: identificarea individului facuta pe piese scheletale, interpretarea leziunilor osoase si a fost autorul primelor incercari de identificare craniofaciala prin supraproiectie fotografica. 8(p42). De asemenea, Hrdlicka a initiat colaborarea in campul identificarii antropologice dintre Smithsonian Institute si FBI. Achizitii moderne in antropologia medico-legala au fost aduse in special in SUA incepand cu Wilton Krogman care a publicat in 1939 Ghid de identificare a materialului scheletic uman care a constituit pentru o buna perioada de timp materialul de referinta in special pentru expertii care lucrau la identificarea militarilor morti in cel de-al doilea razboi mondial si in cel din Coreea. Aceasta activitate a permis obtinerea unei experiente deosebite in identifcarea umana pe material scheletal care, implicit, a dus la imbunatatiri metodologice (de exemplu publicarea de catre Dale Stewart in 1970 a tratatului despre investigarea dezastrelor cu multiple victime). 8(p43)
10 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

In 1972 datorita recunoasterii importantei criminalistice de care s-a bucurat identificarea medico-legala s-a infiintat Sectia de Antropologie Fizica a Academiei Americane de Criminalistica si care cativa ani mai tarziu i s-a conferit dreptul de a certifica specialistii din acest domeniu (pentru certificare candidatul trebuie sa aiba doctorat in antropologie, experienta in domeniu si trebuie sa treaca un examen).
8(p43)

In anul 2003 s-a infiintat Societatea Europeana de Antropologie MedicoLegala ca subsectie a Academiei Internationale de Medicina Legala, rolul acestei organizatii este de a sprijinii dezvoltarea specialitatii intr-o maniera asemanatoare Societatii Americane.10(p10) Perioada moderna a dezvoltarii identificarii antropologice medico-legale se caracterizeaza prin aplicarea acestei stiinte la investigarea violarii drepturilor omului, cazuri care au fost scoase la iveala odata cu instaurarea guvernelor democratice in unele tari din America Latina, Africa, Orientul Mijlociu si Europa de Est.7(p315) In tara noastra, un rol major in dezvoltarea identificarii antropologice medico-legale ca de altfel a intregii specialitati de medicina legala, l-a avut Prof. Mina Minovici care in Tratatul Complet de Medicina Legala publicat in 1930 a detaliat metodele de identificare atat ale persoanelor vii cat si ale cadavrelor, care constau din: portretul vorbit dupa metoda Bertillon, dactiloscopia, metode de identificare ale cadavrelor proaspete, neputrefiate, metode de identificare ale cadavrelor scheletizate, carbonizate metode de identificare ale cadavrelor dezmembrate. Toate aceste metode poarta amprenta scolii europene de antropologie a acelei perioade puternic influentate de Rollet, Manouvrier si Toldt. Fratele profesorului Mina Minovici, Nicolae, a avut de asemenea preocupari in domeniul osteologiei medico-legale, acesta contribuind alaturi de Mihail Kernbach la elaborarea manualului de Osteologie Medico-Legala. In septembrie 1937 profesorul Nicolae Minovici a organizat lucrarile celui de-al XVII-lea Congres International de Antropologie care s-a tinut la Bucuresti.5(p42) In perioada moderna figura marcanta a indentificarii medico-legale antropologice din Romania a detinut-o profesorul Viorel Panaitescu, om de stiinta cu pregatire plurivalenta in specialitatile: anatomie, osteologie, antropologie si medicina legala, care a fondat in cadrul Institutului de Medicina Legala Mina Minovici primul Laborator de Identificare Antropologica. Nu trebuie uitata contributia profesorului Francisc Rainer la dezvoltarea antropologie prin infiintarea in 1926 a Scolii de Antropologie din Bucuresti care in 1942 va deveni Institutul de Antropologie din cadrul Universitatii Bucuresti, adapostind cea mai mare colectie osteologica din Europa.11,12

978-606-8363-03-5

11

Masterat cercetri criminalistice aplicate

Pregatirea de specialitate in Europa


Pregatirea universitara in aceasta specialitate este deficitara in Europa, exista doar cateva universitati care au in programa lor predarea antropologiei medico-legale, aceastea fiind in Marea Britanie, universitatile din Dundee si Bradford sau Liverpool John Moores; in Spania doar universitatea din Granada ofera cursuri intensive de antropologie medico-legala iar in Portugalia aceasta disciplina intra in curiculla de invatamant a programelor de master in medicina legala sau criminalistica. In Itaila doar in universitatea din Milano se preda aceasta specializare. In Romania invatamantul antropologic medico-legal intr-o forma organizata este aproape inexistent, aceast subiect fiind tratat in mod neomogen si sporadic in cadrul pregatirii de specialitate a medicilor rezidenti de medicina legala. Astfel ca cei mai multi medici legisti au doar cunostinte generale despre osteologie si antropologia medico-legala. Pentru a promovarea si dezvoltarea invatamantului acestei specialitati biocriminalistice a fost infiintata Societatea de Antropologie Medico-Legala din Europa care face parte din Academia Internationala de Medicina Legala, care are si rol de certificare a expertilor in acest domeniu. In Europa, in multe cazuri de identificare a ramasitelor scheletale sunt solicitati sa raspunda specialisti in antropologie fizica, acestia putand sa raspunda multor intrebari ale expertizei antropologice, de exemplu determinarea varstei, sexului, staturii, etc dar sunt depasiti de problematica criminalistica de stabilire a mecanismului de producere a leziunilor, patologiei osoase preexistente, diagnostic diferential intre leziunile osoase perimortem si cele post mortem. De asemena acesti specialisti nu pot sa raspunda obiectivelor expertizelor din cazuri mai complexe cand cadavrul este in stare avansata de putrefactie sau nu este complet scheletizat si prezinta urmele unei morti violente. Reiese faptul ca expertul antropolog trebuie sa aiba, in mod ideal, pregatire teroretica si practica in osteologie si antropologie fizica dublata de o temeinica experienta de asemenea teoretica si practica in medicina legala, modus pensandi medico-legal fiind crucial in rezolvarea expertizelor antropologice medico-legale.

Rolul expertului antropolog


Medicul legist face parte din echipa operativa care se deplaseaza la locul faptei. Sunt insa situatii in care cunostintele medicului legist sunt depasite fiind necesara expertiza unui antropolog mai ales in situatia identificarii si ridicarii ramasitelor umane ingropate unde este necesara o metodologie arheologica de exhumare, sau in cazul ramasitelor scheletizate sau partial scheletizate cum sunt cele gasite pe suprafata solului sau carbonizate. In cazul fragmentelor osoase situate pe suprafata solului, osteologul este cel mai in masura sa identifice si sa recupereze toate elementele osoase ale scheletului care de obicei sunt imprastiate de animale sau factori geo-climatici. De asemenea in cazul scheletului de copil, elementele componente sunt foarte mici astfel incat o
12 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

persoana fara pregatire osteologica poate sa nu le observe sau sa nu le recunoasca ca atare, rezultand in mod implicit si o pierdere de informatie ce ar fi putut ajuta la identificare sau la precizarea circumstantelor perimortem. Expertul antropolog trebuie sa aiba cunostinte temeinice de osteologie normala cat si a variantelor anatomice care daca nu sunt cunoscute si interpretate corespunzator pot fi considerate in mod eronat ca fiind fracturi sau alte modificari patologice. De exemplu, o varianta anatomica relativ des intalnita este persistenta suturii frontale sau metopice, osul frontal se dezvolta ca doua jumatati separate de sutura metopica.13 Aceasta sutura dispare recent dupa nastere prin osificarea ligamentului sutural rezultand in unificarea celor doua jumatati osoase intr-un singur os frontal. Sutura metopica poate fi insa intalnita la adulti intr-un procent de 0.93 38.17% .14,15,16,17

Sutura metopica18(p565) O varianta anatomica mai rara este osul zigomatic bipartit sau tripartit care poate fi in mod gresit interpretat ca fracturi zigomatice

Os zigomatic tripartit18(p565)

978-606-8363-03-5

13

Masterat cercetri criminalistice aplicate

Orificiul sternal este o varianta anatomica clasica care poate fi interpretata ca orificiu de intrare a glontului sau plaga injunghiata sau intepata.

Orificiu sternal congenital18(p565) In cazul ramasitelor umane carbonizate, opinia expertala a osteologului este cruciala deoarece el este singurul capabil sa identifice fragmentele de os distruse termic printre resturile de alte obiecte calcinate, permitand astfel colectarea lor in totalitate. In cazul cadavrelor ingropate este necesara o strategie de dezgropare stratigrafica imprumutata din stiintele arheologice. Medicul legist datorita lipsei de pregatire in acest domeniu al excavarii arheologice trebuie sa fie inlocuit de un antropolog. Daca dezgroparea nu se face dupa metodele arheologice atunci se vor putea pierde sau distruge fragmente de os, nu se va putea utiliza informatia stratigrafica utila pentru determinarea intervalului post mortem.19(p46)

Concluziile expertizei medico-legale de identificare a persoanei


Raspunsurile la obiectivele expertizei trebuie precise si sa reflecte adevarul stiintific. Sunt trei categorii de raspunsuri care se pot exprima in concluzii:
20(pp570,571)

a. Concluzii certe care sunt de doua feluri: pozitie si negative. In cazul concluziei pozitive certe totalitatea asemanarilor constatate la ramasitele umane si la documentatia antemortem sunt irepetabile si unice. In cazul concluziei cert negative diferentele dintre caracteristicile ramasitelor umane si documentatia antemortem sunt fundamentale si nu pot fi explicate prin interventia unor factori modificatori, fapt care exclude identitatea. b. Concluziile de probabilitate pot fi in sens pozitiv sau negativ, dar care sunt incerte. Acest tip de concluzie se formuleaza atunci cand totalitatea caracterelor generale si individuale prezentate de elemtenele examinate nu au valoarea absoluta, deci cand nu se exclude posibilitatea de a se regasi aceste caracteristici la alt individ.. c. Concluzia de excludere se formuleaza cand valoarea probatorie a datelor obtinute este extrem de scazuta deci cand identitatea nu se poate stabili sau infirma
14 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

nici macar cu probabilitate. Ea rezulta atunci cand cantitatea materialului supus expertizei este redusa sau cand nu se constata elemente cu valoare de identificare.

Acuratetea si precizia estimarilor in domeniul identificarii antropologice


Acuratetea se refera la cat de aproape o masuratoare sau observatie se apropie de valoarea reala, stiind ca ambele elemente pot fi supuse erorilor. Precizia, denumita si reproductibilitate sau repetabilitate, este gradul in care masuratori sau observatii repetate realizate in conditii identice arata acelasi rezultat. Parametrii biologici ai identificarii (varsta, sexul, talia, etnicitate) sunt elemente supuse probabilitatii, astfel posibilitatea ca o identifcare sa fie acurata depinde de un numar de factori diferiti:22(pp360,361)

Acuratete versus precizie21 Acuratetea si precizia identificarii depind de categoriile de varsta. Varsta indviziilor tineri poate fi determinata mai precis decat a celor in varsta, deoarece cresterea oaselor si dintilor este progresiva parcurgand anumite etape care prezinta anumite particularitati morfologice (de exemplu epifizele oaselor lungi se osifica la anumite varste, de asemenea eruptia dintiilor se face la anumite varste). Dupa ce aceste procese de crestere inceteza nu mai sunt sau sunt extrem de putine modificari scheletale care pot fi monitorizate in raport cu varsta. Spre deosebite de stabilirea varstei pe criterii osteologice si dentare care devine dificila odata cu inaintarea in varsta, determinarea sexului este facila pe material scheletal adult, deoarece particularitatile sexuale sunt evidente cand maturitatea sexuala a fost atinsa. Acuratetea si precizia identificarii depinde si de ce material scheletal este la dispozitie, unele furnizand mai multe sau date mai exacte decat altele. De exemplu eruptia dintilor indica mai exact varsta decat inchiderea suturilor craniene; anumite
978-606-8363-03-5 15

Masterat cercetri criminalistice aplicate

oase prezinta diferentiere sexuala, de exemplul osul pubian, alte oase nu aceste caracteristici; unele oase prezinta un grad mare de corelatie cu statura, de exemplu femurul, alte oase nu pot fi utilizate pentru estimarea staturii. Acuratetea si precizia identificarii depinde si de metodele analitice folosite, unele avand o siguranta mai mare a determinarii varstei si sexului, de exemplu determinarea sexului folosind osul pubian supus testului Phenice (metoda vizuala de determinare a sexului folosind osul pubian) este mai acurata decat examinarea incizurii ischiatice. Acuratetea si precizia identificarii depinde de aplicabilitatea metodelor analitice la scheletul sau resturile scheletale neidentificate. Metodele standard utilizate pentru determinarea sexului si a varstei resturilor scheletale au fost elaborate utilizand specimene scheletale Europene si Nord Americane, dar s-a demonstrat ca aceste standarde nu se aplica intotdeauna populatiilor altor parti ale lumii. De asemenea exista variatii in rata de maturizare scheleltala atat in cadrul unei singure populatii cat si intre diferite populatii. Acuratetea si precizia identificarii depide si de contextul si intrebarile puse. Gradul acuratetii de care este nevoie intr-o anumita examinare depinde de intrebarile care sunt puse cat si de elementele ce trebuie analizate. De exemplu, daca obiectivul expertizei este de a separa mandibule de adult de cele de copil acuratetea va fi de 100%. Daca obiectivul expertizei este este de a separa mandibule unor adulti de 35 de ani de cele ale unor adulti de 36 de ani, nicio metoda cunoscuta nu va prezenta acuratete.

16

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 2
ELEMENTE DE BIOLOGIE SI ANATOMIE A SCHELETULUI UMAN
Identificarea medico-legala a resturilor scheletale se bazaeaza pe stiinta denumita osteologie ce are ca obiect studiul oaselor. Oasele sunt tesuturi dure, rezistente la compresiune, tensiune si deformare, de culoare alb-galbuie care impreuna cu aritculatiile formeaza scheletul uman. Sunt in numar de circa 206 oase23(p116),22(p48) avand urmatoarele roluri: cele mai importante elemente structurale de sprijin pentru tesuturile moi si pentru intreg corpul, formeaza cavitati ce adapostesc si protejeaza organe vitale (de exemplu craniul care adaposteste creierul), au rol in locomotie prin insertiile musculare situate pe suprafata lor, determina forma, dimensiunile si proportiile corpului si ale diferitelor segmente, au rol de rezervor de substante minerale. 24(p7),25(p 4) Clasificarea oaselor umane Tipurile de oase sunt: 1. lungi, 2. scurte, 3. neregulate, 4. plane 5. sesamoide. 1. Oasele lungi: sunt oasele membrelor, lungimea lor fiind mai mare decat latimea. La acest tip de oase se descriu: doua extremitati numite epifize, in general mai proeminente, care se articuleaza cu osul subjacent printr-o suprafata articulara acoperita de cartilaj, tesutul compact perferic este subtire imbracand o masa de tesut spongios. In epifizele copilului se gaseste maduva osoasa rosie care la adult va fi inlocuita in cea mai mare parte cu maduva osoasa galbena. corpul osului sau diafiza, are forma cilindrica avnd un canal central denumit cavitate medulara care contine maduva osoasa galbena care este in cea mai mare parte tesut adipos. in perioada de crestere diafiza si epifizele sunt separate de metafiza ce contine cartilajul epifizar sau de crestere care se osifica cand cresterea s-a incheiat.23(p116) Oasele lungi sunt aproape in intregime acoperite de o membrana vasculara denumita periost de care se insera tendoane si ofera protectie osului. Periostul este format dintr-o membrana interna cu rol osteogenic ce contine osteoblaste dar si
978-606-8363-03-5 17

Masterat cercetri criminalistice aplicate

osteoclaste (cu rol in remodelarea oaselor). Cavitatea medulara si arcadele substantei spongioase sunt acoperite de un tesut conjunctiv subtire numit endost.

Os lung matur partial sectionat.26(p388) 2. Oasele scurte, neregulate sunt formate din doua lame subtiri de substanta osoasa compacta ce delimiteaza un strat de tesut osos spongios de grosimi diferite care contine maduva osoasa rosie. Ele sunt acoperite de periost. La oasele scurte cele trei dimensiuni sunt aproape egale intre ele avand astfel o forma aproape cubica. Ele sunt reprezentate de oasele carpului si tarsului unde este nevoie de o soliditate mare intr-o regiune unde se realizeaza miscari variate dar de amplitudine mica.24(p7) 3. Oasele plane sunt cele ale cutiei craniene, bazinului, scapula, oasele cutiei toracice. La acestea lungimea si latimea depasesc cu mult grosimea. Prezinta doua fete si un numar variabil de margini si unghiuri. Sunt acoperite de periost cu exceptia fetei interne a oaselor craniului care este acoperit de duramater. 4. Oasele pneumatice (de exemplu osul maxilar, frontal) sunt neregulate si contin in interiorul lor cavitati pline cu aer. 5. Oasele sesamoide, sunt mici lentiforme se dezvolta in vecinatatea unor articulatii sau intratendinos (de exemplu patela). 6. Oasele suturale sau oase wormiene, fac parte din categoria oaselor plane dar sunt mici si inconstante. Apar la nivelul suturilor craniului. 7. Oasele neregulate au o forma complexa neputand fi incadrate in niciuna din categoriile mentionate anterior (oasele bazei craniului, vertebrele). 23(p116)
18 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Structura celulara a osului


Osul matur este format din celule osoase denumite osteocite, inconjurate de o matrice extracelulara care contine fibre de colagen (25-30%) si saruri anorganice (50%), apa (20-25%).23(p81) Colagenul este o proteina care asigura flexibilitatea si elasticitatea osului. Osteocitele au rolul de a echilibra cantitatrea de calciu care este eliberata in sange de la nivelul matricei osoase cu cea depozitata in acest loc. Sarurile anorganice sunt reprezentate in special de carbonatul de calciu CaCO3 si fosfatul de calciu Ca3(PO4)2 care sunt prezente in matrice sub forma cristalina conferind duritatea si rigiditatea caracteristica osului. Cele doua tipuri de constituenti (organice si anorganice) se intrepatrund in mod intim astfel ca ei pot sa fie diferentiati numai prin examinare microscopica.23(p81) Celelalte tipuri de celule osoase sunt:26 (p389) Osteoblaste acestea sunt celule osteoformatoare care secreta colagen si alti constituienti ai tesutului osos. Sunt prezente: - la nivelul fetei interne a periostului - in nucleii de osificare a osului imatur - la nivelul cartilajului epifizar - la locul fracturilor Osteoclastele au functia de resorbtie a osului si de a-i mentine forma optima. Aceste celule se intalnesc la nivelul suprafetelor osoase: - sub periost, unde au rolul: o de a mentine forma oaselor in timpul cresterii o de a elimina excesul de calus ce se formeaza in timpul vindecarii fracturilor - in jurul peretilor canalului medular in timpul cresterii osoase. Echilibrul dintre activitatea osteoblastelor si osteoclastelor mentine strucura si functionalitatea osului.

Tipuri de tesut osos


Din punct de vedere structural sunt doua tipuri de oase: imatur si matur. Osul imatur: - este prezent in perioada prenatala - se intalneste la locul de vindecare a fracturilor - se intalneste in diferite tipuri de tumori osoase. Contine un numar mai mare de celule osoase (osteocite) decat osul matur, iar fibrele de colagen sunt aranjate neuniform. Pe masura dezvoltarii scheletului acest tip de os este inlocuit cu osul matur. Osul adult sau matur prezinta doua componente structurale A. tesut osos compact sau cortical B. tesut osos spongios. A. Tesutul osos compact sau substanta compacta: se gaseste in special in peretii diafizari si la exteriorul oaselor,
978-606-8363-03-5 19

Masterat cercetri criminalistice aplicate

este omogena, dura, formata din osteoane sau sisteme haversiene care sunt cilindri microscopici cu perete lamelar format din matrice osoasa si osteocite, dispusi in numar de 10-20 in cercuri concentrice in jurul unui canal central, denumit canal haversian care contine vase de sange, limfatice si nervi. Osteoanele comunica intre ele prin intermediul unor canalicule microscopice (canale Volkmann) care contin vase de sange si care se deschid in vasele din canalul havers. Un osteon are circa 1 cm lungime. Structura tubulara a osteonului confera osului rezistenta caracteristica.27(p106)

Aspectul microscopic al osteoanelor. 28(p36)

Structura microscopica a osului compact.26(p389) B. Tesutul osos spongios sau substanta spongioasa, se gaseste in corpurile vertebrale, in epifizele oaselor lungi, are tot o structura lamelara dar lamelele sunt dispuse astfel incat dau un aspect poros asemanator unui fagure. In spatiile delimitate de aceste lamele (denumite trabecule, cuvant ce provine din latina raza/barna scurta) se gaseste maduva osoasa rosie. Lamelele osoase de la acest nivel sunt f subtiri circa 0.5mm27(p106) permitand prin difuziune schimbul de substante cu rol nutritiv intre maduva rosie si osteocite. Elementele structurale (osteocitele, matricea, vasele de sange) nu sunt aranjate in sisteme haversiene. tesutul spongios din oasele scheletului in crestere si din oasele mici, plate si epifizele oaselor lungi ale adultului contint maduva rosie cu rol in
20 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

producerea celulelor rosii, albe si ale trombocitelor. Maduva galbena se gaseste in cavitatea medulara a oaselor lungi ale adultilor ea aparand prin inlocuirea treptata a maduvei rosii pe masura inaintarii in varsta. Culoarea este data e continutul bogat in celule grase de unde rezulta si unul din rolurile maduvei galbene si anume cel de rezerva de grasime pentru organism.

Tesutul spongios din oase plate si neregulate.26(p389) Dezvoltarea osoasa Osteogeneza sau osificarea sunt procese care incep in luna a 3-a de viata intrauterina si se produc prin doua mecansime, diferenta dintre acestea fiind doar tesutul initial de la care se initiaza osificarea:22(p46) 1. Osificarea intramembranara caracteristica oaselor boltei craniului si fetei se realizeaza pornind de la o matrice de tesut fibros care se osifica in mod centrifug. Procesul de osificare nu este complet la nastere, noul nascut avand zone de tesut fibros intre oasele craniului care se numesc fontanele (rolul fiind de a permite comprimarea capului copilului in momentul nasterii fara fracturarea oaselor subtiri ale craniului, cat si de a permite dezvoltarea in volum a creierului dupa nastere). Aceste fontanele se osifica pana la varsta de 2 ani. 27(p108) 2. Osificarea endocondrala in care oasele sunt precedate de un precursor cartilaginos denumit model cartilaginos. Acest tip de osificare este intalnit la: coaste, vertebre, baza craniului oasele membrelor. Aceste oase au doua tipuri de centri de osificare: primare (principale) si secundare. Centrul primar se gaseste in modelul cartilaginos al osului sau scheletul cartilaginos primordial care contine in special colagen o substanta flexibila ce poate asigura o crestere rapida in conditii in care functia de sprijin specifica scheletului osos nu este necesara.22(p46) Procesul de osificare: este realizat de osteoblaste
978-606-8363-03-5 21

Masterat cercetri criminalistice aplicate

incepe pentru oasele lung din luna a 3-a de viata intrauterina27(p108 in nucleele primare sau centrele primare de osificare prezente in fiecare categorie de os:

Procesul de osficare al unui os lung.27(p110) nucleii primari de osificare se gasesc in centrul diafizelor oaselor lungi si in centrul oaselor scurte, plate si neregulate. ulterior artera nutritiva patrunde in os si se dezvolta astfel ca de la fiecare nucleu primar de osificare osul creste in sens centrifug pe masura ce sarurile de calciu aduse de artera sunt depozitate in matricea cartilaginoasa primordiala, in acest fel tesutul osos va inlocui progresiv tesutul cartilaginos intital. in ultima perioada de viata intrauterina se dezvolta nucleii secundari de osificare la nivelul epifizelor iar canalul medular se formeaza prin intermediul osteoclastelor care vor resorbi materialul osos situat in centrul diafizei oaselor lungi, unde se vor dezvolta vase de sange si maduva osoasa rosie ce va fi inlocuita dupa nastere cu maduva osoasa galbena. La 11 saptamani inainte de nastere sunt de obicei 800 nuclei de osificare iar la nastere mai raman 450. La nastere procesul de osificare nu este complet si va continua pe parcursul copilariei. In oasele lungi cresterea are loc la nivelul cartilajelor de crestere epifizare situate la jonctiunea intre diafiza si fiecare epifiza.
22 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Osul creste in lungime pe masura ce mai mult cartilaj se produce inspre partea epifizara. In partea diafizara osteoblastele produc tesut osos ce il inlocuieste pe cel cartilaginos. Intre varstele 16 25 (depinzand de nivelul de estrogen sau testosteron) toate cartilajele epifizare sunt inolcuite de tesut osos cand are loc oprirea cresterii in lungime. 27(p108) Creterea in grosime a osului - se realizeaza prin intermediul periostului: acesta este o membrana fibroasa ce inveleste oasele si prezinta o fata interna si una externa, fata interna ce priveste spre os avand calitati osteoformatoare ce produce tesut osos care este depus strat cu strat.. aportul de os de la nivelul periferiei este compensat de o distructie la nivelul axului central al osului sub influenta unor celule speciale numite osteoclaste. Astfel, diametrul osului crete dar corticala pastreaza o grosime relativ constanta. spre deosebire de cresterea in lungime, aceasta osificare periostica se realizeaza pe toata durata vietii de aa maniera inct oasele nu se maresc, pastreaza aceeai forma dar sunt permanent inlocuite. 25(p9) Factorii care afecteaza cresterea osoasa. Osul este un tesut viu a carui formare si remaniere permanenta depinde de urmatorii factori:. nutritivi, reprezentati de aportul alimentar de: -saruri minerale (calciu, fosfor), proteine, -vitamine (in special vitamina D necesara pentru absorptia intestinala a calciului, vitamina A si C necesare pentru procesul de osificare) endocrini: -hormonul de crestere, -hormonii tiroidieni, -hormonii sexuali (estrogen si testosteron). exercitiul fizic (de exemplu, presiune mecanica exercitata pe oase prin mers) in lipsa acestuia oasele vor pierde calciu mai repede decat este inlocuit. Consolidarea fracturilor Fractura reprezinta intreruperea continuittii unui os asupra cruia au actionat agenti traumatici mecanici. Procesul de reparare incepe imediat dupa producerea fracturii. In cadrul acestui traumatism vasele de sange din canalele haversiene, periostul si maduva sunt de obicei afectate de fracura. Sangele se va acumula in focarul de fractura formand un prin acumulare un hematom, sangerarea se opreste datorita hemostazei naturale. Periostul este rupt la nivelul focarului de factura fiind desprins de pe capetele fracturate. Acest fapt stimuleaza stratul osteogenic al periostului ce determina formarea calusului osos ce reprezinta tesutul de reparare a fracturii:
978-606-8363-03-5 23

Masterat cercetri criminalistice aplicate

initial calusul este format din tesut fibros care leaga cele doua suprafete fracturate. dupa circa doua zile si pe parcursul a circa 6 saptamani osteoblastele mineralizeaza calusul formand calusul osos primar.22(p 48) dupa aceasta perioada de timp are loc transformarea in calus definitiv care are structura lamelara. Schematic etapele consolidarii unei fracturi sunt: 1.aparitia hematomului intre capetele osoase fracturate 2. liza hematomului si dezvoltarea tesutului de granulatie 3. osteoblastele incep sa formeze calusul 4. calusul formeaza o punte intre capetele osoase fracturate, continua procesul de mineralizare al acestuia. 5. fractura este consolidata, osteoclastele remodeleaza osul. Daca pozitionarea capetelor fracturate este identica cu starea naturala si daca miscarile in focarul de fractura sunt limitate (prin imobilizare) calusul poate fi remodelat in asemenea maniera incat frcatura mai poate fi evidentiata, eventual, numai pe radiografii. 22(p 48) Elementele anatomice descriptive ale oaselor Datorita tractiunii muschilor, presiunea organelor invecinate, pulsatiile arterelor si actiunea fortei gravitationale suprafata oaselor este modelata prezentand detalii anatomice importante pentru recunoasterea oaselor, orientarea lor si anume:24(p8) 1. proeminente, 2. cavitati, 3. gauri 4. canale 1. Proeminentele sunt articulare si nearticulare Proeminentele articulare corespund cavitatilor articulare opuse. Proeminentele nearticulare sunt determinate de tractiunea exercitata de muschi, cu cat forta de tractiune este mai puternica cu atat proeminenta este mai dezvoltata, astfel ca aceste proeminente sunt mai dezvoltate la barbati si la indivzii robusti. 24(p8) 2. Cavitatile sunt determinate de forte de presiune sunt articulare si nearticulare. Cavitatile articulare corespund proeminentelor articulare ale osului opus impreuna cu care formeaza articulatiile. Cavitatile nearticulare pot fi locuri de insertie pentru tendoane si ligamente, pot avea forma unor santuri unde se gasesc tendoane, vase si nervi sau formeaza cavitati de protectie pentru organe. 3. Gaurile sunt de trecere si de nutritie gaurile de trecere sunt strabatute de vase sanguine, nervi iar gaurile nutritive sunt strabatute de vase sanguine
24 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

4. Canalele sunt de trecere si de nutritie canalele de trecere sunt strabatute de vase sanguine, nervi iar canalele nutritive sunt strabatute de vase sanguine . Terminologia asociata anatomiei scheletului (planuri de referinta, orientare anatomica) Descrierea elementelor anatomice si a raporturilor lor se face in functie de pozitia standard anatomica, si anume: invidul in picioare (ortostatism), cu privirea inainte, picioarele apropiate si orientate inainte, palmele trebuie sa priveasca inainte cu degetul mare orientat in exterior. Termenii de stanga si dreapta se refera la partile subiectului care este examinat si nu la cele ale observatorului Axe

Axul longitudinal (vertical) - dreapta care uneste verstexul cu planul de sustinere Axe transversale - sunt orientate de la dreapta la stnga i perpendiculare pe cel longitudinal. Axe sagitale - sunt orientate antero-posterior (ventro-dorsal) i sunt perpendiculare pe cel longitudinal

Planuri de referinta In osteologie se utilizeaza 3 planuri de referinta. 1. Planul sagital sau median imparte corpul in doua jumatati simetrice, stanga si dreapta. Orice alt plan paralel cu planul sagital se numeste parasagital. 2. Planul frontal sau coronal imparte corpul intr-o jumatate anterioara si una posterioara si este perpendicular pe planul sagital. 3. Planul transvers (orizontal) este paralel cu planul plantelor si si poate fi considerat la orice nivel dar intotdeauna va fi perpendicular pe planurile descrise anterior. Termeni de directie A. Generali Superior - catre extremitatea cefalica a corpului omenesc. - sinonime: cefalic si cranial. Inferior - opus termenului superior, - reprezinta partea de corp indepartata de extremitatea cefalica - sinonim: caudal, se foloseste si in anatomia descriptiva a patrupedelor.
25

978-606-8363-03-5

Masterat cercetri criminalistice aplicate

Anterior

- catre fata corpului (sternul este situat anterior fata de coloana vertebrala) - sinonim: ventral - opusul termenului anterior, - semnifica catre spatele individului (de exemplu scapula este situata pe fata posterioara a cutiei toracice). Sinonim: dorsal. - catre axul longitudinal (central). (degetul mic este situat medial fata de inelar) - opus termenului medial, - indepartat de axul longitudinal (degetul mare este lateral fata de aratator in pozitia anatomica) - se foloseste in special pentru oasele membrelor - reprezinta cel mai apropiat de scheletul axial: capul proximal al humerusului este portiunea ce intra in alcatuirea articulatiei umarului. - opus termenului distal, - reprezinta cel mai indepartat de scheletul axial (capatul distal al humerusului intra in componenta articulatiei cotului) - situat in afara (cutia craniana reprezinta invelisul extern al creierului) - situat inauntru (fata interna a osului parietal prezinta santuri pentru vasele de sange)

Posterior

Medial: Lateral:

Proximal

Distal

Extern Intern

26

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Axe si planuri anatomice.23(p115) Termeni de directie ai dintilor 1. Mezial catre punctul median al arcului dentar unde incisivi centrali intra in contact 2. Distal opus termenului mesial (jumatatea distala a premolarului reprezinta portiunea posterioara a dintelui) 3. Lingual- catre limba. Suprafata linguala a coroanei dintilor nu se observa atunci cand persoana zambeste. 4. Labial opus termenului lingual, catre buze si se refera de obicei la incisivi si canini (suprafata labiala a incisivilor se observa cand persoana zambeste). 5. Bucal opus termenului lingual, catre obraz. Se foloseste pentru prmolari si molari. 6. Ocluzal suprafata dintilor folosita in masticatie 7. Incizal se refera la incisivi, marginea cu care se musca.

978-606-8363-03-5

27

Masterat cercetri criminalistice aplicate

Orientarea fetelor coronare ale dintilor.29(p51)

Termeni de orientare odotologici.30(p112)

Elemente de osteologie umana


Scheletul uman se imparte in: 1. Scheletul cranian-oasele capului 2. Sceheltul postcranian - coloana vertebrala - toracele osos - oasele membrelor Scheletul cranian - Oasele capului este alcatuita din 23 de oase care, cu exceptia mandibulei si hioidului, sunt fixe, conectate prin suturi.24(p32) sunt oase ale neurocraniului (care adaposteste creierul) oase ale fetei sau viscerocraniul. Craniul - are o mare importanta pentru identificarea medico-legala a varstei, sexului si rasei.
28 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Modul de manipulare a craniului in cadrul procesului de examinare medico-legala: trebuie examinat pe o suprafata moale stabilizat asa incat sa nu se rostogoleasca (cu ajutorul unor rulouri de material textil dispuse de jur imprejur). atunci cand mandibula va fi fixata in pozitia ei anatomica trebuie sa se aiba in vedere ca suprafetele ocluzale ale dintilor se pot fragmenta prin lovire una fata de alta. in cazul depozitarii craniului cu mandibula atasata este necesar ca intre dintii de pe arcada dentara si superioara trebuie pus fragmente de material textil sau burete. se manipuleaza cu ambele maini, se va evita apucarea craniului prin introducerea degetlor in orbite sau arcadele zigomatice care sunt mai fragile (se pot introduce degetele in foramen magnum deoarece prezinta o structura rezistenta) atunci cand dintii se disloca vor fi imediat fixati in alveolele dentare corespunzatoare. se poate intampla ca in timpul manipularii si examinarii, mai ales a oaselor vechi, acestea sa se fragmenteze, in aceasta situatie fragmentele respective vor fi reatasate si lipite la intreg.22(p72) A. Neurocraniul este format din: 1. calota sau bolta craniana 2. baza craniului. 1. Bolta craniana: este partea superioara a neurocraniului, are un aspect semiovoidal, cu axul mare sagital si extremitatea mai lata posterior fata externa este convexa, fata interna este concava si vine in raport cu emisferele cerebrale. diametrul sagital utilizat in antropologie si se intinde intre punctele craniometrice denumite nasion (punctul median de la nivelul radacinii nasului) si inion (corespunde protuberantei occipitale externe). Masoara circa 18 20 de cm diametrul maxim transversal trece prin bosele parietale dreapta si stanga fiind de 14 16cm. este formata din: - osul frontal, - doua oase parietale, - portiunea solzoasa a celor doua oase temporale, - fetele temporale de pe aripile mari ale sfenoidelor - portiunea superioasa a solzului occipitalului. - anterior, cele doua oase parietale sunt unite cu osul frontal prin sutura coronala.
978-606-8363-03-5 29

Masterat cercetri criminalistice aplicate

posterior, cele doua oase parietale sunt unite cu occipitalul prin sutura lambdoida. - sutura sagitala uneste cele doua oase parietale intinzandu-se de la sutura coronala la cea lambdoida. - sutura scuamoasa uneste scuama temporalului cu osul parietal si aripa mare a osului sfenoid. La noul nascut, suturile dintre oasele boltei craniene nu sunt complet formate existand intre acestea zone de tesut fibros ce poarta denumirea de fontanele. Prezenta fontanelelor permite aprecierea varstei deoarece: fontanela anterioara de forma rombica intre oasele parietale si frontal se inchide complet la 36 de luni de viata.23(p187) fontanela posterioara de forma trunghiulara prezenta intre parietale si occipital se inchide prima in cea de-a 3-a luna de viata. 23(p187) Alte elemente anatomice importante ale calotei craniene: arcurile sau arcadele sprancenoase - proeminente arcuite deasupra marginilior supraorbitale de fiecare parte a planului median. glabela sau bosa frontala mediana situata intre arcurile sprancenoase bosele frontale laterale superior de fiecare arc sprancenos bosele parietale proeminente situate pe fetele externe ale oaselor parietale.

30

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Craniu vedere laterala dreapta si vedere anterioara.27(p115)

978-606-8363-03-5

31

Masterat cercetri criminalistice aplicate

Fontanele craniului nou nascutului.27(p109) 2. Baza craniului Prezinta doua suprafete externa ce poate fi examinata din exteriorul craniului - regiunea anterioara este reprezentata plafonul cavitatii orale si baza cavitaii nazale (faller. 190). - regiunea posterioara prezinta un orificiu cu un diametru mare numit foramen magnum (gaura mare) de fiecare parte prezentand fatete articulare occipitale (sau condili occipitali) prin intermediul carora craniul se articuleaza cu prima vertebra atlas, formand articulatia atlanto-occipitala. Fosele (cavitatile) articulare pentru articulatia temporomandibulara se afla imediat anterior de procesele mastoide.

Vedere inferioara a craniului dupa inlaturarea mandibulei.27(116)


32 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

interna ce poate fi examinata numai dupa indepartarea calotei. regiunea anterioara este reprezentata portiunea osului frontal care formeaza plafonul celor doua orbite. Intre acestea se gaseste osul etmoid care se poate identifica cu usurinta datorita lamei ciuruite ce prezinta 25-30 de orificii24(p34) prin care trec filetele nervului olfactiv. Plafonul orbital impreuna cu etmoidul si aripa mica a sfenoidului formeaza etajul anterior (fosa) anterioara a bazei creierului. Posterior de plafonul orbital si etmoid se gaseste osul sfenoid iar posterior de acesta este osul occipital. In ambele parti laterale ale bazei se gasesc oasele temporale. Osul sfenoid prezinta: - un corp care pe fata sa superioara prezinta saua turceasca - care adaposteste glanda hipofizara. - doua aripi mici care intra in alcatuirea etajului anterior al - bazei - doua aripi mari care intra in alcatuirea etajului mijlociu al - bazei. Etajul anterior este separat de etajul mijlociu prin mariginea posterioara a aripilor mari ale sfenoidului si marginea postro-superioara a stancii osului temporal. Partea posterioara a etajului mijlociu este format de peretii anteriori ai portiunii pietroase (stanca) a oaselor temporale, ce adapostesc urechea medie si interna. Etajul mijlociu este separata de etajul posterior prin marginea postero-superioara a stancii osului temporal Cea mai mare parte din etajul (fosa) posterior este reprezentat de osul occipital in mijlocul caruia sa gaseste gaura mare prin care creierul este legat de maduva spinarii. Anterior si lateral participa la formarea etajului posterior fata posterioara a stancilor oaselor temporale.

978-606-8363-03-5

33

Masterat cercetri criminalistice aplicate

Baza craniului vedere interna.27(p117)

Etajele bazei craniului.26(p393) B. Scheletul fetei sau viscerocraniul Este compus din opt oase: a. Oase pereche: maxilare participa la formarea orbitelor, cavitatii nazale si plafonul cavitatii bucale (prin palatul dur) si adaposteste sinusul maxilar. in procesul alveolar care este situat in portiunea inferioara a maxilei se
34 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

gasesc cavitatile de receptie ale dintilor numite alveole dentare care contin radacinile dintilor. zigomatice, nazale, lacrimale, palatine b. Oase nepereche: vomer (se gaseste in cavitatea nazala), mandibula este si singurul os mobil al scheletului capului. Prezinta: - un corp, care are - margine superioara sau marginea alveolarain care se gasesc 16 alveolele dentare unde patrund radacinile dintilor - margine inferioara sau baza mandibulei. - doua ramuri (stanga si dreapta). In portiunea superioara fiecare ramura prezinta: - procesul condiliar care se articuleaza cu osul temporal in cadrul articulatiei temporomandibulare - procesul coronoid pe care se insera muschi. - locul unde corpul se continua cu ramura se numeste unghiul mandibulei.

Mandibula.26(p396) Scheletul postcranian Coloana vertebrala are 33-34 de vertebre din care: 7 cervicale, 12 toracice, 5 lombare, 5 sacarele 4-5 coccigeale. Prezinta doua curburi in forma de S (lordoza cervicala si lombara si cifoza toracala si sacrala). Canalul vertebral contine maduva spinarii. Partile consituente ale unei vertebre sunt: - corpul vertebral
978-606-8363-03-5 35

Masterat cercetri criminalistice aplicate

este situat anterior dimensiunile variaza in functie de regiune (cele mai mici sunt in regiunea cervicala, cele mai mare in cea lombara)

Structura unei vertebre.26(p398) arcul vertebral impreuna cu corpul vertebral delimiteaza gaura vertebrala prin suprapunerea vertebrelor, gaurile vertebrale formeaza canalul medular care adaposteste coloana vertebrala. Este format din doua pedicule si doua lame La locul de unire a pediculilor si lamelor se gasesc procesele transverse proiectate lateral fata de acestea. La locul de unire a lamelor vertebrale pe linia mediana posterioara se gaseste procesul spinos. prezinta patru procese articulare, doua prin care se articuleaza cu vertebra de deasupra si doua prin care se articuleaza cu vertebra de desubt.

Osul sacru este un os median nepereche este format din fuzionarea a 5 vertebre sacrate situat in continuarea coloanei lombare deasupra coccigelui si infipt ca o pana intre cele doua oase iliace. are forma tiunghiulara cu baza orientata superior si varful inferior, cu fata anterioara concava marginea anterioa se numeste promontoriu si protruzioneaza in cavitatea pelviana Orientare: se pune in sus baza, iar inainte fata concava.

36

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Sacru si coccisul A. vedere anterioara, B vedere laterala.26(p398) Toracele osos Protejeaza organele toracice fiind alcatuit din 1 stern, 12 perechi de coaste 12 vertebbre toracice. Sternul este un os plat situat pe linia mediana a toracelui anterior este format din - manubriu (maner), este segmentul superior si se articuleaza cu clavicula si cu primele doua perechi de coaste - corp, este segmentul de mijloc se articuleaza cu coastele - procesul xifoid esste segmentul inferior, are de diferite forme. Orientare se pune inainte fata convexa si in sus baza

978-606-8363-03-5

37

Masterat cercetri criminalistice aplicate

Sternul.26(p401) Coastele sunt oase lungi si arcuate o sunt in numar de 12 perechi. o se articuleaza posterior cu vertebrele toracice

Torace.26(p400) o primele 7 perechi denumite si coaste adevarate sunt legate direct de stern prin cartilaje costale. o de la a 8-a pana la a 10-a pereche (denumite coaste false) care desi nu ajung la stern in mod direct se articuleaza prin extremitatea lor anterioara cu unul
38 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

din cartilajele costale situate deasupra, intrand in componenta marginii costale a toracelui. o cea de-a 11-a si a 12-a pereche au extremeitatea anterioara nearticulata fiind denumite si coaste flotante. Fiecare coasta are: o un cap prin care coasta se articuleaza posterior cu corpurile a doua vertebre toracice adiacente. o gat o un corp care continua cu cartilajul costal prin intermediul caruia coastele se articuleaza cu sternul. Orientare: se aseaza lateral fata convexa, inapoi se aseaza capul coastei si in jos marginea prevazuta cu un sant.

Coasta. 26(p401) Oasele membrelor embrele superioare si inferioare sunt legate de trunchi printr-o centura a membrului. Oasele membrului superior A. Centura membrului superior formeza scheletul umarului si leaga oasele membrului superior cu toracele osos. consta din doua perechi de oase: clavicula si scapula. 1. Clavicula: -os lung, -os pereche,
978-606-8363-03-5 39

Masterat cercetri criminalistice aplicate

-are forma literei S culcat -cuprinsa intre manubriul sternal si acromionul scapulei. Formata din: -corp, -doua margini -doua extremitati: -acromiala situata lateral, este aplatizata -sternala situata medial de forma unei prisme triunghiulare Orientare: superior fata neteda ; lateral extremitatea mai aplatizata

2. Scapula:

Clavicula.26(p402) os plat triunghiular os pereche asimetric, situat in partea postero-superioara a toracelui intre coastele a II-a si a VII-a

Formata din: a) fete: fata costala (anterioara) este concava si prezinta o depresiune numita fosa subscapulara fata posterioara este convexa si prezinta: spina scapulei - proeminenta de forma triunghiulara care se continua lateral cu acromionul. - separa fosa supraspinoasa (situata superior) si infraspionasa (situata inferior) acromionul este o prelungire a spinei scapulei - orientata antero-supero-lateral - legat printr-un ligament de procesul coracoid formand plafonul articulatiei umarului (fornix humeri). b) margini: laterala mediala superioara prezinta incizursa suprascapulara c) unghiuri inferior (se proiecteaza pe coasta VII sau spatiul intercostal VII) superior la jonctiunea dintre marginea superioara si cea mediala lateral la jonctiunea dintre marginea superioara si cea laterala. Prezinta: cavitatea glenoida
40 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

- ovalara - putin profunda colul scapulei proces coracoid - se afla pe suprafata superioara a colului scapulei si prezinta un segment vertical si unul orizontal.

Scapula.26(p402) Orientare: lateral cavitatea glenoida; superior marginea cea mai scurta, anterior fata concava. Scheletul bratului 1. Humerus os lung os pereche Format din: corp - cilindric in portiunea superioara - prismatic triunghiular in cea inferioara. doua epifize: - proximala prezinta - capul humerusului apare sub forma a unei treimi de sfera se articuleaza cu scapula la nivelul cavitatii glenoide. este orientat supero-postero-medial. axul sau face un unghi de 130 cu axul osului. - colul anatomic la baza capului
978-606-8363-03-5 41

Masterat cercetri criminalistice aplicate

- tuberculul mare situat antero lateral - tuberculul mic proeminenta osoasa - situata medial de tuberculul mare si inferior de capul humeral - distala prezinta: - o formatiune hemisferica numita capitulum ce se articuleaza cu radiusul fiind situata lateral la nivelul epifiziei distale formand articulatia humero-radiala (in cadrul articulatiei cotului) - trohlea humerusului, situata medial de capitul, are forma unei jumatati de scripete, se articuleaza cu ulna formand articulatia humero-ulnara (in cadrul articulatiei cotului). Orientare: se aseaza in sus extremitatea cu cap hemisferic, medial suprafata ei articulara, anterior santul profund pe carea aceasta extremitate il prezinta.

Humerus.26(p402) Scheletul antebratului Consta din radius si ulna. 1. Ulna o os lung, format din diafiza si doua epifize o situat in partea mediala a antebratului (in prelungirea degetului mic). o diafiza este prismatica triunghiulara,
42 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

o epifiza proximala prezinta -o cavitate articulara de forma unui carlig denumita incizura trohleara care searticuleaza cu trohlea humerusului. -incizura trohleara este delimitata superior de olecran (o proeminenta de forma unui cioc de pasare) si inferior de procesul coronoid (o proeminenta de forma unei piramide patrulatere). o in partea inferioaral ulna se ingusteaza formand epifiza distala care prezinta -un cap -un proces stiloid situat in partea mediala si care este mai coborat decat procesul stiloid al radiusului. Orientare: superior partea mai voluminoasa, lateral-marginea mai ascutita si anterior incizura de la nivelul extremitatii mai voluminoase. 2. Radiusul o os lung o situat in partea laterala a antebratului in dreptul policelui. o corpul (diafiza) este prismatic triunghiular. o epifiza proximala prezinta este un mic segment de cilindru care se articuleaza superior cu capitulul humerusului si medial cu ulna. o epifiza distala - este mai voluminoasa, - are forma unui trunchi de piramida ce se articuleaza medial cu ulna., iar baza se articuleaza oasele carpului. - fata laterala se prelungeste inferior cu o proeminenta numita proces stiloid. Orientatare: inferior extremitatea mai voluminoasa, medial marginea mai ascutita, posterior fata strabatuta de santuri.

978-606-8363-03-5

43

Masterat cercetri criminalistice aplicate

Radiusul si ulna.26(p403) Oasele mainii Sunt trei grupe cuprinzand 27 de oase: 1. carpul, 2. metacarpul 3. oasele degetelor. Carpul este un ansamblu osos intercalat intre oasele antebratului si metcarp si este format din 8 oase cuboide dispuse pe doua randuri: randul proximal consta din: scafoid care se articuleaza cu epifiza distala a radiusului la fel ca si urmatorul os carpian, semilunarul, piramidalul (triquetrum) care se articuleaza cu capul ulnei si pisiformul. randul distal (dinspre radial catre ulnar) trapezul, trapezoidul, osul capitat osul cu carlig (hamat).

44

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Oasele mainii.26(p403) Metacarpul formeaza scheletul palmei si a dorsului mainii si are 5 oase metacarpiene (numerotarea lor se face latero-medial de la I la V). Acestea sunt oase lungi care au un corp, o baza mai voluminoasa care articuleaza cu oasele carpului si un cap mai rotunjit care se articuleaza cu falanga proximala. Oasele degetelor, in numar de cinci, numerotate latero-medial de la I la V: I police II indice III- mediu IV - inelar V mic Sunt alcatuite din falange care au un corp, o baza si un cap. Fiecare deget are 3 falange (falanga proximala, mijlocie, distala) cu exceptia policelui care are doua. Oasele membrului inferior Centura membrului inferior sau pelvisul osos (bazinul) Este formata din cele doua oase coxale care se articuleaza anterior la nivelul simfizei pubiene si posterior cu osul sacru prin articulatiile sacro-iliace. Oasele coxale se unesc anterior intre ele prin simfiza pubiana iar posterior se unesc cu sacrul si coccisul marginind astfel o cavitate denumita pelvis. Coxalul os plan voluminos, neregulat sub forma de elice
978-606-8363-03-5 45

Masterat cercetri criminalistice aplicate

este format initial din trei piese oasoase distincte care se sudeaza definitiv la varsta de 14-16 ani formand astfel un singur os: 23(p146) 1. Ilionul este situat in portiunea superioara a osului si prezinta: -un corp care intra in alcatuirea acetabulului (la adult limita inferioara a ilionului este o linie conventionala carre trece prin 1/3 superioara a acetabulului) -aripa osului iliac.- portiunea superioara si turtita. 2. Ischionul situat postero-inferior, este format din -corp care participa la formarea portiunii postero-inferioare a acetabulului -ramura care continua corpul. La limita dintre corp si ramura se gaseste tuberozitatea ischiadica. 3. Pubisul este situat anteroinferior, este format din -corp - participa la formarea portiunii antero-inferioare a acetabulului. La locul de unie cu ilionul se gaseste eminenta iliopubiana. -doua ramuri: de la corp pleaca inainte ramura superioara, care apoi formeaza un unghi ascutit (unghiul pubisului) si se continua cu ramura inferioara care se uneste cu ramura ischionului. Pe fata laterala a coxalului se gaseste acetabulul este o cavitate adanca, emisferica prin care se realizaeaza articulatia cu capul femurului. Dedesubtul acetabulului se gaseste un orificiu mare denumit gaura obturata. Orientare: fata cu acetabulul infero-lateral, marginea cu marea incizura ischiadica inferior si partea cu gaura obturatorie inferior

Osul coxal.26(p403)
46 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Pelvisul osos sau bazinul este format din cele doua coxale, sacru si coccis .are forma unui trunchi de con cu baza mare in sus cu cea mica in jos. este situat cu aproximatie la mijlocul corpului adultului. Circumferinta superioara sau baza mare a pelvisului osos esteformata din: baza sacrului creasta iliaca marginea anterioara a coxalului marginea superioara a simfizei pubiene Diviziunile pelvisului: Pelvisul este impartit in pelvisul mare (pelvisul fals) si pelvisul mic (pelvisul adevarat) prin apertura pelvina superioara delimitata de linia terminala care este formata de liniile arcuate ale celor doua coxale marginea superioara a a simfizei pubiene si discul dintre cea de a 5 vertebra lombara si sacru (promontoriu). pelvisul mare -este marginit in sus de circumferinta superioara si inferior de apertura pelvina superioara -apartine topografic abdomenului continand viscerele abdominale. -este delimitata: anterior de peretele abdominal, lateral de fosele iliace, posterior de vertebra lombara 5 si sacrala 1. pelvisul mic - contine viscerele pelvine. -este marginit apertura pelvina superioara si apertura pelvina inferioara (sau baza mica a pelvisului osos) aceasta este delimtata de coccis, -tuberozitatile ischiadice, ramurile inferioare ale oaselor pubiene si simfiza pubiana. -Peretii pelvisului mic: -peretele posterior este format de fetele anterioare ale sacrului si coccisului, - peretele anterior este format de simfiza pubiana si oasele pubiene, - peretele lateral este reprezentat de suprafata plana corespunde acetabulului si gaurii obturate Dimorfismul sexual al bazinului Aspectul pelvisului, forma ambelor aperturi si diametrele pevine prezinta marcate diferente sexuale: oasele sunt mai groase si proeminentele mai evidente la barbati. Diametre (exemple):31(p13) diametrul pelvin transversal (distanta maxima intre doua puncte opuse pe liniile arcuate) la femeie este mai mare 13.1cm fata de 12cm la barbat. diametrul pelvin antero-posterioare (intre promontoriu si marginea superioasa a simfizei pubiene) la femeie este de 11.5 iar la barbat de 10cm. diametrul infero-posterior al bazinului mic (intre a 3-a vertebra sacrata si fata posterioara a simfizei pubiene) este la femeie de 13cm la barbat de 10.5cm.
978-606-8363-03-5 47

Masterat cercetri criminalistice aplicate

la femei pelvisul este mai inclinat decat la barbati arcul pubian este mai deschis la femeie decat la barbat gaura obturata la femeie este ovala, la barbat aproape rotunda.

Pelvisul.26(p404)

Apertura pevina superioara are forma ovala la femei (stanga) si la barbati forma de inima (dreapta).26(p404)

Forma pelvisului osos si unghiul pubian subpubian. 23(p168) Oasele membrului inferior Scheletul coapsei este reprezentat de femur care este cel mai lung os al scheletului uman.
48 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Este format din: diafiza sau corpul femural este prismatic triunghiular (marginea posterioara este reprezentata de linia aspra) epifiza superioara se descriu: -capul femural care are forma a doua treimi de sfera, -colul sau gatul femural care uneste capul cu corpul femurului, formeaza la adult un unghi de 125-126 grade cu corpul femural. -doua tuberozitati numite trohanterul mare si mic

Femur. Vedere posterioara.26(p405) epifiza inferioara: - are dimensiuni mai mari in sens transversal decat anteroposterior. - este formata din doua proeminente articulare numite condili. Anterior cei doi condili converg formand supafata patelara pe care patela (rotula) aluneca in timpul flexiei genunchiului. - posterior cei doi condili sunt separati de o fosa adanca denumita fosa intercondilara. Orientare: capul femural spre supero-medial, linia aspra spre posterior Rotula sau patela
978-606-8363-03-5 49

Masterat cercetri criminalistice aplicate

Este situata anterior de suprafata patelara a femurului in grosimea tendonului muschiului cvadriceps femural. Este cel mai mare os sesamoid. Scheletul gambei este format din: Tibia situata medial, este un os lung corp prismatic triunghiular.

Oasele gambei.26(p405) epifiza superioara este o masa osoasa voluminoasa alungita in sens transversal care prezinta fata articulara superioara formata dintr-un condil medial si unul lateral prin intermediul carei tibia se articuleaza cu fenurul. epifiza inferioara este mai putin voluminoasa, medial se prelungeste cu un proces cu un proces puternic care se numeste maleola mediala. Aceasta prezinta o fata articulara pentru talus. Orientare: superior extremitatea mai voluminoasa, medial maleola mediala, posterior marginea ascutita. Fibula sau peroneul este situata lateral este un os lung care pare torsionat in axul longitudinal. Este formata din: Corpul fibulei, prismatic triunghiular.
50 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Epifiza superioara reprezentata de capul fibulei care se articuleaza cu tibia. Epifiza inferioara apare ca o proeminenta turtita numita maleola laterala ce coboara mai mult decat maleola mediala. Prezinta o fata articulara pentru tibie si talus. Orientare: inferior extremitatea mai turtita si mai voluminoasa, posterior santul de pe aceasta extremitate, medial fata articulara de pe aceasta extremitate. Oasele piciorului sunt in numar de 26 dispuse in 3 grupe: I. tars, II. metatars III. oasele degetelor. Oasele tarsiene in numar de 7 din care talusul, navicularul si cele 3 oase cuneiforme sunt dispuse medial, iar calcaneul si cuboidul sunt dispuse lateral. Sunt asezate pe doua randuri: proximal talus, calcaneu distal cuboid, cuneiforme (medial, intermediar si lateral) si navicular Calcaneul este cel mai mare os al piciorului, tuberculul calcanean formand calcaiul. Oasele metatarsiene in numar de 5 localizate intre oasele tarsului si falange, numerotarea se face dinspre medial spre lateral de la I la V, prezinta un corp, o baza, si un cap. Metatarsianul I este cel mai voluminos. Oasele degetelor (numerotate de la I la V dinspre medial spre lateral) sunt format din falange fiecare deget avand 3 falange cu exceptia degetului I care are doua. Degetul I se numeste haluce iar degetul V se numeste degetul mic. Fata de falangele degetelor mainii sunt mai reduse ca dimensiuni. Cele trei falange sunt: falanga proximala, mijlocie si distala care corespunde unghiei.

Oasele piciorului vedere laterala.26(p406)

978-606-8363-03-5

51

Masterat cercetri criminalistice aplicate

Diferente anatomice intre oasele umane si cele animale


Morfologia si structura interna si externa sunt elementele pe baza carora se pune diagnosticul de os si de specie. Este o interdependenta bidirectionala intre forma (morfologia) osului si functia sa: forma osului este determinata de functia pe care trebuie sa o indeplineasca si functia este determinata de forma sa.32(p3) De exemplu membrele superioare la om sunt folosite pentru a manipula sau transporta obiecte, la ierbivore membrele ventrale sunt folosite pentru locomotie si pentru a sustine jumatatea craniala a corpului, astfel ca oasele membrelor ventrale vor fi mai masive si vor avea un grad mai redus miscare decat cele umane. De asemenea oasele umane si cele de alte mamifere sunt destul de asemanatoare ca morfologie fiind relativ usor sa se determine daca osul este ulna sau femur. Astfel ca daca examinatorul identifica tipul de os atunci determinarea apartenentei umane sau non umane devine usoara32(p3) . In vederea stabilirii apartenentei umane sau non umane este important sa se examineze, identifice si sa se diferentieze urmatoarele elemente anatomice: suprafetele articulare, suprafetele pentru insertia sau originea musculara suprafetele relativ netede care nu sunt nici articulare nici de insertie/origine musculara. 32(p3) Suprafetele articulare vor fi netede, locul de origine sau insertie a unui tendon muscular sau ligament este neregulat si de obicei se prezinta sub forma unei excrescente care este cu atat mai voluminoasa cu cat muschiul este mai puternic. De exemplu protuberanta occipitala a cerbului este mult mai mare decat cea umana, in cazul cerbului muschiul care se insera la acest nivel trebuie sa mentina un cap foarte voluminos, pe cand la om capul se gaseste la partea superioara a coloanei vertebrale si nu necesita muschi foarte puternici pentru a-l mentine in pozitie ( in general cu cat un muschi este mai masiv si mai puternic cu atat este nevoie de o arie osoasa mai mare pentru insertia sa). Dupa determinarea tipului de os (de exemplu femur sau humers), a suprafetelor articulare si a suprafetelor de insertie musculare se poate determina daca osul este de patruped sau de om: oasele care prezinta reliefuri anatomice accentuate sunt de patruped. Suprafetele articulare ce au numeroase reliefuri au un grad redus de mobilitate, iar suprafetele ce prezinta putine reliefuri confera un grad mare de mobilitate. Diferentele intre caracteristicile locomotorii ale patrupedelor se reflecta in morfologia scheletului. De exemplu, scheletul de cerb reflecta nevoia unui animal de dimensiuni medii de a se misca rapid. Vaca este un animal masiv care nu se misca rapid, astfel ca scheletul ei trebuie sa suporte o greutate considerabila fara nevoia de viteza. Caii sunt animale mari dar care se misca rapid, scheletul fiind adaptat acestor elemente. Oile si caprele sunt animale de talie relativ mica care au o greutate semnificativa in raport cu inaltimea lor si prezentand o moderata nevoie pentru viteza. Cainii si in special pisicile sunt animale rapide cu greutate mica.
52 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 3
MODIFICARILE POSTMORTALE ALE CADAVRULUI SI SCHELETULUI
Moartea este definita in The Uniform Determination of Death Act, The National Conference of Commissioners on Uniform State Laws (1980): 33(p16) 1) oprirea ireversibila a functiei cardiocirculatorii si respiratorii 2) oprirea ireversibila a tuturor functiilor cerebrale incluzind pe cele ale trunchiului cerebral Conventional se descriu doua faze ale mortii care nu se produc concomitent:34(p14) 1) Moartea somatica cauzata de leziuni cerebrale ireversibile (moarte cerebrala) extinctia ireversibila a personalitati tesuturile si celulele organismului exceptand pe cele lezate de la nivel cerebral sunt viabile fie spontan sau prin mentinerea artificiala a respiratiei si circulatiei 2) Moartea celulara se produce dupa moartea somatica la diferite intervale de timp in functie de capacitatea tesutului de a supravietui fara oxigen (de exemplu moartea creierul se produce in 3-4 minute fara oxigen). se manifesta prin modificarile postmortale Modificarile postmortale Importanta medico-legala si criminalistica: Estimarea timpului scurs de la moarte Determinarea posibilei manipulari a cadavrului Pozitia probabila a cadavrului in momentul mortii Indicatia anumitor cauze de moarte Modificari oculare Cornea capata un aspect cetos, opac (corneal clouding) Scaderea tensiunii intraoculare Inmuierea globului ocular Dilatare pupilara Petele Liarche apar prin deshidratare la nivelul ochilor sub forma de triunghi cafeniu-cenusiu, la cadavrele care raman cu ochii deschisi Autoliza Proces intravital evolueaza localizat - asigura turn-over-ul celular (reinnoirea celulelor) - apare pe fond patologic in cadrul proceselor de necroza sau reactie inflamatorie.
978-606-8363-03-5 53

Masterat cercetri criminalistice aplicate

Proces postmortal caracterizat prin: autodigestie enzimatica a celulelor - aseptic - creeaza conditii pentru dezvoltarea germenilor si dezvoltarea putrefactiei

Racirea (Algor Mortis) Moartea se insoteste de oprirea metabolismului care determina oprirea productiei de caldura asa incat corpul va pierde progresiv caldura pana va ajunge la temperatura mediului inconjurator. Temperatura cadavrului impreuna cu celelalte modificari postmortal permit estimarea timpului scurs de la moarte. Estimarea timpului postmortal pe baza temperaturii cadavrului are o acuratete redusa, racirea depinzand de numerosi factori: 1) Intrinseci: temperatura initiala a corpului cadavrele persoanelor care au decedat datorita unui proces infectios insotit de temperatura corporala mare, se vor raci mai greu raportul dintre suprafata corpului si masa corpului (size/weight ratio) de exemplu cadavrele de copii se racesc mai usor pentru ca au o suprafata corporal mai mare in raport cu greutatea. starea de nutritie cadavrele care prezinta un strat de tesut adipos mai dezvoltat se racesc mai greu. 2) Extrinseci: imbracaminte o imbracaminte izolatoare impiedica pierderea de caldura postura corpului pozitia fetala (ghemuita) a cadavrului impiedica pierderea de caldura temperatura mediului inconjurator temperatura atmosferica scazuta favorizeaza pierderea de caldura miscarea aerului, gradul de umiditate cresterea lor favorizeaza pierderea de caldura mediul inconjurator (aer vs apa) apa este mai bun conducator de caldura, favorizand racirea cadavrului. Racirea este un proces neuniform in timp In conditii standard racirea este de: - 1,5C/ora in primele 6 ore - 1C/ora in urmatoarele 6 pina la 12 ore Formule utilizate pentru calcularea temperaturii cadavrului TM = 37.2C temperatura rectala/ rata orara de scadere a temperaturii TM = 37C temperatura rectala (C) + 3 TM timpul mortii Temperatura cadavrului se ia fie cu termometru chimic sau cu o sonda termocuplu, intrarectal sau intrahepatic dupa o incizie efectuata subrebordul costal drept.
54 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Lividitatiile (Livor Mortis) Definitie - acumularea singelui in zonele declive ale corpului sub actiunea gravitatiei in conditiile incetarii circulatiei. Culoare - violacee - rosu-aprins se intalneste in intoxicatia cu CO, refirgeratie - roz = cianuri - maronii = nitriti methemoglobinizanti - galbene = acid picric Etape (perioadele variaza in functie de temperatura mediului) 1. hipostaza -2ore- 8-12ore la digitopresiune dispar complet si reapar. datorata fluiditatii sangelui si pastrarii pigmentului hemoglobinic in vas. la sectiune curge singe pasiv din vas. 2. Difuziune: (8-12) ore- 18 ore palesc la digitopresiune prin (difuzarea) transendoteliala a pigmentului hemoglobinic in tesuturi; la sectiune curge pasiv sange in cantiate redusa. 3. Imbibitie: dupa 18-24 ore nu dispar la digitopresiune hemoglobina paraseste in totalitate vasele capilare si se dispune interstitial schimbarea pozitiei nu mai duce la modificarea pozitiei lividitatilor catre noile pozitii declive. la sectiune nu mai curge sange din vase Diagnostic diferential cu echimozele - culori diferite de la albastrui la galben, - forme diferite, - in general de marime redusa cm-, - dipuse nu numai decliv, - asociate si cu alte leziuni traumatice, - pe sectiune prezinta infiltrat hemoragic in grosimea tesutului Rigiditatea cadaverica (rigor mortis) Mecanism: disparitia ATP din muschi ATP sursa de energie ptr contractia musculara - produce relaxarea musculara dupa moarte se opreste productia de ATP in absenta ATP miosina si actina formeaza un complex permanent disparitia prin autoliza fibrelor musculare Caracteristici: debuteaza la 2-4 ore de la moarte completa in 6-12 ore simultan la toti muschii
978-606-8363-03-5 55

Masterat cercetri criminalistice aplicate


este mai evidenta la inceput la nivelul muschilor mici (m. masticatori). efort anterior mortii (alergare, convulsii) determina consum intravital accentuat de ATP rigiditatea precoce instalare tardiva la casectici, copii spasmul cadaveric = instalare brusca si completa a rigiditati - intilnit in conditii de razboi - leziuni ale diencefalului

Stadii: 1. Instalare (2-4 ore de moarte) daca se invinge fortat rigiditatea se va reinstala 2. Stare (dupa 14 24 ore de la moarte) - totala si completa - odata invinsa nu se mai reface - cadavrul este fixat in pozitia in care a fost lasat 3. Rezolutie (dupa 1-2 zile de la moarte) disparitia treptata Importanta medico-legala semn al mortii reale, stabilirea datei mortii - prin corelare cu alte semne de moarte reala pastreaza pozitia corpului (daca nu a fost modificata inainte de instalarea rigiditatii Deshidratarea Pierdere de lichide prin evaporare determina deshidratarea tisulara. Este mai evidenta in zonele cu tesut cornos subtire: - anatomic: buze, virful degetelor, scrot - posttraumatic intravital (excoriatii, echimoze, plagi, dupa manevere de reanimare) pergamentarea tegumentului (acesta va avea un aspect intarit, cartonat de culoare galbuie cafenie) - postmortal lovirea cadavrului in timpul manipularii (nu exista infiltrat hemoragic subiacent PUTREFACTIA Descompunerea corpului omenesc incepe relativ rapid dupa moarte primul proces distructiv care se instaleaza este autoliza. Dupa cum s-a aratat, aceasta este un proces de distrugere aseptica a celulelor si tesuturilor, sub actiunea propriilor enzime. Sangele este unul dintre primele tesuturi care se autolizeaza, alte organe care au o autoliza precoce fiind: suprarenala, pancreasul, stomacul. Autoliza creeaza conditiile pentru dezvoltarea germenilor si aparitia putrefactiei. Momentul inceperii putrefactiei este influentat atat de factori interni ce tin de cadavru si circumstantele mortii cat mai ales de factori externi de ordin climatic si geografic. Knight estimeaza ca in conditiile unui climat temperat (18oC) putrefactia apare la circa 3 zile de la moarte3(p64) la cadavrele nerefrigerate, DiMaio plaseaza acest moment la 24 36 de ore de la moarte.35(p11)
56 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

In cazul putrefactiei cadaverice se pot aplica urmatoarele reguli care arata evolutia acestui fenomen postmortal in functie de factorii climatici sezonieri si de mediul in care se gaseste cadavrul: 1. Regula Devergie: iarna, cifrele care indica zilele intervalului postmortem corespund cifrelor care indica pe timp de vara orele. 2. Regula Casper: 1 saptamana de evolutie a putrefactiei in aer este egala cu 2 saptamani de evolutie in apa si cu 8 saptamani in sol. Din punct de vedere al mecanismului biologic si chimic, putrefactia este un proces distructiv de descompunere a proteinelor sub influenta bacteriana si enzimatica. In primele 2 zile dupa moarte au loc in special procese de fermentatie dar acestea au un rol redus in descompunerea organismului deoarece carbohidratii reprezinta doar 1% din greutatea corpului.5(p75) Rolul cel mai important in descompunerea cadavrului il au insa procesele de distructie proteica sub actiune microbiana acestea apar dupa primele doua zile de la moarte.5(p75) Etapele procesului de putrefactie 1. Etapa gazoasa Are loc sub actiunea microbilor aerobi si facultativ aerobi (bacterie care prefera mediul lipsit de oxigen dar s-a adaptat si la prezenta acestuia). Dupa consumarea O2 procesul de descompunere este continuat de microbii anaerobi (microbi ce se dezvolta in medii lipsite de oxigen) cand se vor produce gaze in cantitate mare (hidrogen sulfurat, metan) si substante urat mirositoare (putresceina si cadaverina). Putrefactia incepe la nivelul regiunii cecale a intestinului gros datorita abundentei florei microbiene existente la acest nivel inca din timpul vietii, proces ce se observa la suprafata cadavrului prin aparitia petei verzi de putrefactie la nivelul fosei iliace drepte. In aceasta regiune cecul intra in contact direct cu peretele abdominal. Procesele proteolitice de la acest nivel determina formarea de hidrogen sulfurat care difuzeaza in peretii cecului si formeaza impreuna cu hemoglobina din sange, sulfhemoglobina care are culoarea verde.

978-606-8363-03-5

57

Masterat cercetri criminalistice aplicate

Pata verde de putrefactie Acestui proces i se suprapune si distrugerea postmortala a hemoglobinei cu eliberarea fierului din structura sa, care se combina cu hidrogenul sulfurat determinand formarea sulfurii de fier care va da cu timpul o tenta cenusie petei verzi. Pata verde apare de obicei la circa 20 de ore.5(p75) in conditii de temperatura standard (18C3(p64)), in timpul iernii ea apare la 48 72 de ore sau chiar la cateva saptamani dupa moarte in functie de cat de scazuta este temperatura atmosferica.5(p75) Pata verde de putrefactie va cuprinde treptat intreg abdomenul si apoi toracele, umerii, gatul, capul. Bacteriile de putrefactie care provin in principal din intestin si plaman se colonizeaza organismul prin intermediul fluidelor astfel ca ele vor coloniza sistemul venos.3(p65) unde hemoglobina impreuna cu hidrogenul sulfurat produce sulfhemoglobina care difuzeaza si coloreaza peretii vaselor cat si tesuturile inconjuratoare. In cazul retelei venoase superficiale subtegumentare fenomenul se manifesta si se observa sub forma circulatiei postume care apare ca dungi de culoare cafenie-verzuie, vizbila in special la nivelul coapselor, umerilor, partilor laterale ale abdomenului si toracelui. Acest fenomen este vizbil la aproximativ o saptamana de la momentul mortii la o temperatura a mediului inconjurator de 1820C.3(p65)

58

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Circulatie postuma Tot in aceast interval de timp apar si flictenele (vezicule) de putrefactie, care au un continut gazos sau lichidian seros, rosietic sau negricios. De asemenea stratul superficial al tegumentului (epidermul) se detaseaza daca se aplica o forta de frictiune, permitand vizualizarea mai clara a cicatricilor si tatuajelor (la cadavrele neidentificate putrefiate se recomanda detasarea epidermului unde se banuieste existenta unui tatuaj pentru evidentierea clara a sa).

Tatuaj vizibil dupa decolarea epidermului.18(p559) Acumularea gazelor determina marirea de volum a adomenului, scrotului si penisului, gatul si fata se vor umfla in mod grotesc facand identificarea vizuala aproape imposibila. Presiunea exercitata de gaze determina protruzia globilor oculari si a limbii, eliminarea de materii fecale, urina si de lichide de putrefactie (este de fapt tesut lichefiat colorat rosietic-negricios datorita hemolizei) care se scurge prin orice orificiu (gura, nari, anus, vagin).

978-606-8363-03-5

59

Masterat cercetri criminalistice aplicate

Identificarea vizuala este dificila in cazul cadavrelor putrefiate In aceast perioada culoarea cadavrului este verzuie-negricioasa. Caracteristicile putrefactiei enumerate mai sus se intalnesc de obicei cand timpul scurs de la moarte este de 2-3 saptamani (in conditii de temperatura standard).

Destinderea de gaze a scrotului Putrefactia are un ritm mai lent la nivelul organelor interne decat la suprafata corpului: 3(p66) sange este spumos de culoare negricioasa, organele parenchimatoase au o consistenta scazuta, cu aspect emfizematos, prezentand numeroase bule de gaze, fata interna a peretilor organelor cavitare are o culoare visinie. 2. Faza de lichefiere are loc sub actiunea microbilor anaerobi organele parenchimatoase capata tente tot mai bruna, se lichefiaza treptat, cu timpul se transforma in detritus foliaceu acoperit de mucegai si apoi dispar. ansele intestinale sunt inegrite, uscate, dispar in timp.
60 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

organele cu continut mic de apa (oasele, parul, tendoanele si cartilajele, uterul negravid) sunt mai rezistente la putrefactie.5(p77) Popularea cu viermi se face rapid in perioadele calde, acestea consuma tegumentul si tesuturile atat direct cat si prin secretia de enzime proteolitice care accelereaza distructia. In etapele tarzii ale procesului, putrefactia determina distrugerea peretilor toracelui si abdomenului, fapt accelerat si de actiunea viermilor si uneori a altor vietuitoare (caini, sobolani). De multe ori zone de tegument sunt inca prezente in special in zonele protejate de haine sau unde cadavrul a intrat in contact cu o suprafata de suport.

Cadavru in faza de lichefiere Scheletizarea Scheletizarea asa cum sugereaza si denumirea, reprezinta disparitia totala a tesutului moale din jurul osului. Chiar si in aceasta situatie pentru o perioada de timp vor fi prezente ligamente si cartilaje asociate oaselor. Timpul necesar scheletizarii este variabil depinzand de interventia factorilor care actioneaza si in cazul putrefactiei, dar in acest caz rolul principal avandu-l factorii externi.

978-606-8363-03-5

61

Masterat cercetri criminalistice aplicate

Etapele descompunerii cadaverice.36(p89) Se poate estima ca procesul de scheletizare, in care scheletul mai prezinta cartilaje si ligamente, al unui cadavru in aer liber la o temperatura de 18-20 de grade se face in 12-18 luni, iar scheletizarea completa se face in circa 3 ani.3(p66) Au fost raportate cazuri extreme cand scheletizarea a fost completa in 3 zile in conditii de umiditate crescuta si activitate intensa a insectelor.36(p112) Factorii care influenteaza procesuld de putrefactie si scheletizare a cadavrelor Putrefactia si implicit scheletizarea sunt influentate de factorii care afecteza rapiditatea colonizarii si distrugerii cadavrului de catre bacterii, fungi, insecte si alte nevertebrate cat si vertebrate. 1. factorii meteo-climatici (temperatura, umiditatea, ventilatie): temperatura favorabila dezvoltarii putrefactiei este de 20-35 grade, sub 0oC putrefactia este oprita. umiditatea grabeste descompunerea. temperaturile ridicate si uscaciunea scad rata decompunerii, deoarece grabesc evaporarea iar deshidratarea tisulara are un efect inhibitor al dezvoltarii bacteriilor. incalzirea cadavrului prin expunerea la soare accelereaza activitatea bacteriana si implicit putrefactia, dar daca aceasta expunere este insotita de uscaciune si de vant puternic atunci cadavrul se deshidrateaza rapid ceea ce poate opri putrefactia, cadavrul mumificandu-se.
62 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

lipsa oxigenului incetineste putrefactia 2. Natura solului, felul sicriului si imbracamintea cadavrului influenteaza patrunderea aerului si a umiditatii, factori favorizanti ai putrefactiei. cu cat permeabilitatea solului pentru aer si apa este mai mare (de exemplu, granulatia mare a particulelor de pamant) cu atat putrefactia evouleaza mai rapid. o solurile lutoase, argiloase sunt slab aerate determinant o rata scazuta a putrrefactiei. o solurile acide scad actvitatea microbiana dar distrugerea tisulara si osoasa este realizata de pH-ul foarte mic. continutul ridicat de calciu al solului inhiba distrugerea chimica a osului dar nu impiedica atacul microbian. adancimea gropii determina incetinirea putrefactiei prin afectarea negativa a factorilor amintiti anterior (oxigen, umezeala). natura solului afecteaza rata descompunerii in mod: o direct prin actiune chimica o indirect prin efectul asupra abundentei si activitatii microorganismelor prezente. De exemplu in straturile superficiale ale solului exista o concentratie bacteriana de circa 2 x 109 pe gram iar la adancimi de 1-8 metrii concetratia este de 108.37(p31) sicriul incetineste putrefactia cat timp este intact (de exemplu in cazul sicrielor metalice putrefactia este mult incetinita). imbracamintea de nylon, lana sau matase, materiale care au rol izolant scade rata de evolutie a putrefactiei.59(p78) Victimele omuciderilor pot fi infasurate in covoare, folii de plastic sau bagate in portbagaje, valize, sub pardoseala sau pot fi zidite sau bagate in ciment. Toate aceste posibilitati de a transporta si ascunde un cadavru sunt cu atat mai eficiente in a incetinii descompunerea cadavrului cu cat nu permit accesul oxigenului, a nevertebratelor si vertebratelor.37(p30) Mirosul gazelor de putrefactie atrage insecte sau carnivore care reusesc sa isi faca acces la cadavru, de exemplu mustele pot ajunge la un cadavru inchis in portbagaj sau cainii pot rupe folia sau materialul cu care este infasurat cadavrul.37(p30) Chiar si in cazul includerii cadavrului in ciment, mirosul produs de putrefactie poate fi detectat si in acest caz particular analiza petrografica a cimentului poate da detalii despre data si locul producerii cimentului informatie utila pentru determinarea circumstantelor in care s-a produs decesul. In cazul in care cadavrele sunt inhumate in gropi putin adanci, mirosul este detectat de canide sau rozatoare care dezgroapa cadavrul astfel incat acesta va fi supus dezmembrarii. 3. Putrefactia cadavrelor de nou-nascuti morti este incetinita datorita lipsei florei bacteriene din tubul digestiv. Patrundere bacteriilor in aceste cazuri se face prin orificiile naturale si prin piele.5(p78)
978-606-8363-03-5 63

Masterat cercetri criminalistice aplicate

4. Cadavrele cu masa corporala mare se descompun mai incet. 5. La cadavrele indivizilor casectici putrefactia evolueaza mai incet datorita lipsei de apa si proteine. 6. Putrefactia este mai rapida la cei care au decedata datorita septicemiei sau a altor infectii (colonizarea bacteriana este masiva, inca din timpul vietii). 7. Un cadavru dezmembrat se descompune mai incet, prin deshidratarea mai intensa a fragmentelor decat cea care decurge la nivelul corpului intreg. 8. Putrefactia cadavrelor in apa este mai lenta de 2 ori decat a celor de pe sol asta datorita lipsei oxigenului si a temperaturilor mai reduse. 9. Tratament chimic postmortal: tratarea chimica a cadavrului in cazul omuciderilor se realizaeaza fie pentru a accelera rata descompunerii sau pentru a distruge cadavrul. Este o conceptie gresita ca tratarea cadavrului cu var nestins (oxid de calciu) va conduce la distrugerea rapida si totala a cadavrului situatia fiind inversa tratarea contribuind la conservarea cadavrului. Intr-adevar oxidul de calciu reacioneaza cu apa rezultand o reactie puternic exotermica care produce anumite arsuri tegumentare dar determina si deshidratarea corpului oprind astfel descompunerea.37(p34) De asemenea prezenta stratului coroziv previne popularea cadavrului cu insecte sau distrugerea sa de catre carnivore. asezarea cadavrului intr-o baie cu acid, va distruge toate testurile moi si oasele, eficienta si rapiditatea procesului fiind influentate de continutul apos al tesuturilor. imbalsamarea este tratamentul chimic aplicat cadavrelor pentru a preveni sau intarzia descompunerea. In Romania imbalsamarea se face cu o solutie de formol 10%, injectata cu presiune in vena femurala. la cadavrele inhumate imbalsamarea prin introducerea de formol conserva cadavrul pana cand se produce o inlaturare a substantei chimice prin spalare ce are loc odata cu distrugerea sicriului si patrunderea apelor de infiltratie.5(p78) substantele folosite la imbalsamare interfera cu testele toxicologice putand da rezultate fals pozitive sau negative pentru anumite substante. Descompunerea oaselor Putrefactia afecteaza si oasele printr-un proces denumit diageneza37(p28) prin care sub influenta mircobiana si a factorilor de mediu este afectata structura chimica si microscopica a osului. Degradarea osoasa incepe la scurt timp dupa moarte prin invazia bacteriana a osului prin pori. 37(p28) Oasele situate in apropierea organelor abdominale vor suferi un atac microbian mai important. Probleme medico-legale ale proceselor distructive postmortale conserva anumite leziuni (sant spinzurare, fracturi) modifica caracteristicile plagilor distruge caracterul vital reactii fals pozitive pentru alcaloizi, alcool
64 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

limitarea examenelor bacteriologice si celor chimice prezenta si stadiul de dezvoltare al insectelor ofera un plus de precizie estimarii datei mortii

Modificari cadaverice conservatoare a. naturale: 1. mumificarea putrefactia este oprita de deshidratarea rapida care se produce prin curenti puternici de aer umiditate scazuta sau absenta temperatura ridicata Aspectul cadavrului: uscat, piele incretita, pergamentata, castanie negricioasa viscerele au aspectul unor magme negrcioase uscate

Mumificare cadavrul are o greutate redusa 2. adipoceara (adeps = grasime, cera = ceara) Este un proces care are loc la cadavrele aflate in medii umede cu continut scazut in O2. temperaturi ridicate ape statatoare (balti, mlastini, fantini, latrine) In aceste situtaii, grasimea cadavrului se descompune in acizi grasi (acid palmitic, stearic) care in prezenta sarurilor de Ca si Mg vor produce reactiea de saponificare. Va rezulta o substanta: culoare alba cenusie sau alba galbuie consistenta destul de redusa miros de branza ranceda pastreaza trasaturile cadavrului Saponificarea apare dupa 3 - 4 luni si este completa in 12 luni.

978-606-8363-03-5

65

Masterat cercetri criminalistice aplicate

Adipoceara pe mana unui cadavru inhumat intr-un sol cu umiditate crescuta 3. lignifierea (tabacierea) Apare in cazul cadavrelor inhumate in soulri cu pH acid, slab oxigenate, bogate in acid tanic si humic (turbarii, mlastini acide). Acesti acizi patrund in epiderm inhiband putrefactiei prin distrugerea microbilor Aspectul cadavrului: scaderea in volum a corpului pielea tabacita, dura, bruna conservarea fanerelor, cartilajelor oase brune decalcifiate viscere ratatinate conservare indefinita a cadavrului 4. inghetarea - conservare indefinita a cadavrului b. conservarea artificiala: inghetarea artificiala. imbalsamarea (solutii de formaldehida 10%). tanatopraxia reprezinta suma ingrijirilor ce se acorda cadavrului pentru a putea fi prezentat intr-un mod demn apartinatorilor, inclusiv imbalsamarea.

Modificarile osoase postmortale


Agentii care actioneaza postmortal independent sau in comun asupra osului producand modificari se impart in urmatoarele categorii: factori mecanici factori biologici, factori fizico-chimici actiunea omului. Aceste categorii trebuie identificate pentru a se putea reconstitui circumstantele premergatoare mortii cat si a altor evenimente postmortale.
66 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Modificari produse de factori mecanici - Fracturile osoase postmortale Una din obiectivele expertizei medico-legale antropologice este identificarea modificarilor produse de agenti patologici (care actioneaza in timpul vietii individului) si de factorii care actioneaza postmortal. Din acest punct de vedere trebuie diferentiate fracturile care au fost produse la intervale de timp variate atat antemortem, perimortem cat si postmortem (de exemplu, un os poate fi fracturat cu 1 an inaintea mortii, cu o ora inaintea mortii, imediat dupa moarte sau in timpul dezgroparii). Fracturile postmortale se produc de obicei in timpul manipularii elementelor scheletale in diferitele etape ale examinarii, stiind faptul ca oasele vechi sunt fragile. Oasele care sunt expuse factorilor de mediu o vreme indelungata au o culoare maronie astfel ca, daca fractura se produce in momentul sapaturilor, colectarii sau transportului atunci suprafata fracturii are o culoare mai deschisa decat a restului osului si nu prezinta particule de sol. Daca fractura s-a produs in momentul mortii, atunci suprafetele capetelor fracturate vor avea aceeasi culoare ca si a restului osului si este foarte probabil sa existe particule de sol la nivelul capetelor fracturate.4(p153) Capetele fracturilor care se produc perimortem au marginile drepte si ascutite. In cazul oaselor fosilizate care au fost fracturate in timpul procesului de dezgropare, colectare sau examinare au marginile neregulate, zimtate. Fracturile care s-au produs in timpul vietii si au avut la dispozitie o perioada de timp pentru vindecare vor avea capetele rotunjite. Fracturile postmortale se produc si in cazul scheletelor inhumate in cosciug. Datorita deteriorarii, cosciugul se prabuseste astfel ca asupra scheletului isi va exercita presiunea un volum foarte mare de pamant, cel mai afectat element osos fiind craniul. Acesta va apare deformat datorita fragmentelor de calota impinse in cavitatea craniana sau va prezenta linii de fractura de-a lungul partilor laterale ale calotei. Cand se produce acest fenomen cavitatea craniana va fi cel putin partial umpluta cu pamant.4(p154)

Prabusirea capacului cosciugului observata in cazul unei exhumari medico-legale.

Caracteristicile structurale ale oaselor influenteaza si posibilitatea fracturarii postmortale, de exemplu diafiza femurala este mai rezistenta la fracturare decat sternul care este un os fragil.22(p51)

978-606-8363-03-5

67

Masterat cercetri criminalistice aplicate

Modificari osoase postmortale produse de agenti fizico-chimici Acestea pot varia de la modificari minore ale proteinelor osoase pana la distrugeri structurale si chimice complexe. Factorii care afecteaza integritatea osoasa sunt: aciditatea si permeabilitatea solului, umiditatea, temperatura actiunea microorganismelor. O buna conservare a oaselor este realizata in regiuni temperate in zone in care nivelul apei freatice este redus, pH-ul solului este neutru sau usor alcalin.22(p52) Expunerea osului la radiatii solare sau ploaie determina deteriorarea suprafetei osoase si pierderea continutului organic, cu aparitia initiala a unor crapaturi superficiale liniare paralele pe suprafata osoasa. Acestea se adancesc si se largesc odata cu trecerea timpului. De asemenea ciclul inghetare topire produce distrugeri osoase. Microparticolele solide purtate de vant sau apa au efect abraziv producand reducerea reliefului osos. Incinerarea criminala a cadavrului Este o modalitate prin care suspectului doreste sa distruga complet cadavrul si implicit sa ii ascunda identitatea si urmele unei morti violente. Fairgrieve citand si alti autori38(p8) arata ca o distrugere completa a cadavrului este aproape imposibil de realizat mai ales cand incinerarea are loc in spatiu deschis. Dupa incinerare, cadavrele pot fi ingropate fie in alt loc fie in groapa special facuta pentru a favoriza distrugerea termica a cadavrului. O alta posibilitate intalnita in practica criminalistica este incendierea unei arii impadurite pentru distrugerea unui cadavru care fie a fost ucis in acel loc sau a fost transportat din alta parte. De obicei in astfel de cazuri nu se poate produce o incinerare completa, organele interne ale cadavrului putand sa pastreze urmele unor leziuni traumatice si se pot recolata probe pentru examene toxicologice. Sunt situatii cand cadavrul este incendiat in interiorul vehicului, se intalnesc de la arsuri intinse si profunde pana distrugeri complete a tesuturilor moi si carbonizare. Experitza medico-legala trebuie sa determine caracterul vital al leziunilor de arsura (examen microscopic, examen toxicologic pentru determinarea carboxihemoglobinemiei), cauza medicala a mortii si mecanismul de producere a leziunilor traumatice si de asemenea sa ajute la identifcarea cadavrului. Cadavrele pot si supuse incendierii criminale si in interiorul cladirilor. Culoarea oaselor arse depinde de temperatura agentului termic si de perioada de expunere la foc. Daca temperatura este joasa si cantitatea de oxigen redusa atunci culoarea este galben cafenie, rezultand din degradarea termica a grasimilor osoase, de asemenea greutatea si structura osului sunt afectate in proportie redusa componenta organica a oaselor nefiind complet distrusa.38(p47),39(p103) Temperatura scazuta si aportul de oxigen scazut caracterizeaza incendierea cadavrelor in spatii deschise.
68 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Daca perioada de expunere la agentul termic creste atunci va apare o culoare albastra-negricioasa datorita distrugerii incomplete a componentei organice a osului.38(p48),39(p103) Temperatura osului (si nu a mediului inconjurator) cand apare aceasta culoare este de 300oC. 38(p48) La o temperatura a osului de cel putin 600oC acesta va capata o culoare gri care arata un nivel de distrugere si mai mare a componentei organice. De la aceasta temperatura se vor forma mici cristale sferice cu dimensiuni de 0.060.007m (Holden citat de Fairgrive38(p48)) iar cresterea in continuare a temperaturii va modifica dimensiunea si forma acestor cristale. S-a observat ca varsta individului are un efect important asupra dimensiunilor cristalelor formate in astfel de conditii (cu cat varsta este mai inaintata, cristalele au dimensiuni mai reduse). Cand temperatura osului atinge cel putin 800C atunci se va produce colorarea albicioasa cenusie a acestuia prin distrugerea totala a componentei organice a osului.38(p48),39(p103) La aceasta temperatura cristalele au o forma hexagonala cu dimensiuni cuprinse intre 0.25 0.07m pana la 0.410.09m.

Oase umane calcinate ale unui cadavru ucis prin lovituri de topor si apoi incinerat intr-o groapa Fracturile si fisurile oaselor expuse flacarii se produc datorita evaporarii apei, deci continutul lichidian anterior expunerii la flacara determina aspectul fisurilor. Astfel, osul uscat sub actiunea flacarii va prezenta fisuri longitudinale superficiale; osul cu tesut moale in jur va prezenta atat fisuri adanci transversale cat si longitudinale.39(p127) Fisurarea se poate produce si prin expunerea la directa la radiatia solara sau la alte conditii care determina pierderea rapida de apa. Scurtarea osoasa este un alt efect al incinerarii si depinde de temperatura si de perioada de expunere la foc. Temperaturile de 700-800oC determina o scurtare osoasa de circa 1-2% care nu va afecta in mod important rezultatele examinarii antropologice. Dar temperaturi de peste 800oC produce scurtari marcate cu pana la 25% ce determina rezultate false in cazul determinarii sexului si a taliei pe materialul osos.39(p127) Informatiile obtinute dupa examinarea oaselor expuse actiunii flacarii sunt deosebit de importante:40(p128) se poate determina apartenenta umana sau animala
978-606-8363-03-5 69

Masterat cercetri criminalistice aplicate

se poate determina daca ramasitele au fost arse in locul unde au fost gasite sau in alta parte se poate determina numarul victimelor ajuta la reconstructia faptei dand detalii despre intensitatea focului, durata.

Modificari osoase postmortale produse prin actiunea factorilor biologici nonumani Canidele in special cainii si lupii produc distrugeri importante materialului scheletal deoarece sparg oasele cu dintii in dorinta de a a ajunge la grasimea si maduva din interiorul lor. Regiunile bogate in tesut osos spongios sunt preferate de aceste animale. Actiunea distructiva produsa de canide se recunoaste dupa modificarile produse de dinti asupra oaselor, cu creearea de orificii care intereseaza fie toata sau numai o portiune (indentatii) din grosimea osului in special prin actiunea caninilor. Orificiile complete se intalnesc de obicei in oasele subtiri cum este scapula. .

Distrugerea cadavrului de catre caini Dimensiunile, forma si distributia orificiilor pot furniza detalii cu privire la marimea animalului care le-a produs. Indentatiile se produc cand osul este doar apucat intre dinti. Zgarieturile apar sub forma de santuri paralele superficiale produse prin alunecarea dintilor pe suprafata osoasa. Santurile sunt mai profunde si de obicei sunt dispuse longitudinal pe suprafata oaselor lungi cum este femurul si sunt produse de molari si premolari. Cand un canid roade un os o perioada lunga de timp, acesta este intors de multe ori rezultand un numar de santuri si indentatii unde este greu sa se individualizeze amprenta dentara.37(p288) Toate aceste modificari produse de animale pot fi diferentiate cu usurinta de leziunile osoase produse prin actiunea de taiere sau fierastruire, de asemenea dintii animalelor nu produc orificii sub forma de trunchi de con cum sunt cele produse de gloante si nici nu produc fracturi care iradiaza cum sunt cele produse de lovirea cu obiecte contondonte. Canidele mananca fara discriminare din cadavru astfel ca impreuna cu tesuturile moi consuma si fragmente de haine sau alte obiecte, care vor fi eliminate
70 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

in materiile fecale, astfel ca este util ca acestea sa se examineze pentru identificarea fibrelor textile sau chiar a bijuteriilor. Scheletul copiilor este distrus mai usor, oasele fiind subtiri iar mediul acid gastric are un efect mult mai distructiv asupra oaselor de copil pentru ca acestea au un continut mai redus de calciu. Oasele vechi uscate sunt roase de ierbivore si de rozatoare pentru satisfacerea nevoilor de substante minerale.39(p123) Actiunea animalelor se manifesta in special cand accesul la cadavre este facil, fir patrunderea in locuinte prin usi ferestre deschise fie cadavrele sunt dispuse pe suprafata solului sau acoperite de un strat subtire de pamant. Etapele distrugerii cadavrului de catre canide sunt: initial se produce consumarea tesutului moale fara afectare osoasa. distrugerea fetei anterioare a cutiei toracice cu avulsia membrelor superioare si a scapulelor. dezarticularea partiala sau completa a membrelor inferioare. ultimele elemente osoase care vor fi separate sunt vertebrele. In zona de campie, cainii, vulpile, pot sa imprastie elementele osoase si pe o raza de 16km, aceasta suprafata fiind mai redusa in zonele impadurite.39(p123) Perioada de timp in care au loc aceste etape distructive este influentata de factori care tin de animale, numarul lor si gradul de infometare cat si de factorii care influenteaza conservarea corpului (animalele se hranesc, pleaca apoi se reintorc repetand aceste etape de mai multe ori pana cand tesuturile moi devin necomestibile datorita putrefactiei). Rozatoarele produc pe os doua santuri paralele separate printr-o zona indemna, latimea santurilor indica dimensiunile incisivilor si astfel marimea si specia de rozatoare. Oasele pot fi distruse de animale si prin calcare (in special de catre animalele cu copite). Modificarile osoase produse in situatiile de mai sus pot masca leziuni osoase antemortem, uneori diferentierea lor fiind dificila necesitand cunoasterea tipurilor de modificari produse de animale si o atenta reconstructie a locului.

Orificii si distrugere a aripii iliace produse de dentitia cainelui.18(p600)

978-606-8363-03-5

71

Masterat cercetri criminalistice aplicate

Epifiza distala a humerusului roasa de caine. 18(p600) Modificarile osoase postmortale produse de plante Radacinile plantelor secreta acizi care pot grava santuri superficiale pe suprafata osului, acestea fiind mai deschise la culoare decat osul inconjurator datorita decalcifierii produse de acid.22(p57) Indicatori ai mediului in care s-au aflat oasele O importanta criminalistica deosebita este determinarea mediului unde s-au aflat oasele, astfel Ubelaker descrie urmatorii indicatori postmortali ai mediului de depozitare:41(p81) prezenta briofitelor (muschiului) se intalneste pe oasele care au stat in locuri umbrite si umede particulele de sol in orificiile oaselor gasite pe sol arata o inhumare anterioara albirea suprafetei arata o expunere prelungita la soare sau in apa sarata. adipocerea indica un mediu umed. Aceste observatii reflecta conditiile care caracterizeaza locul unde oasele au fost descoperite, astfel: panza de paianjen poate fi gasita intr-un craniu gasit intr-o magazie, oasele ale caror orificii contin particule de sol si care au suprafata albita arata ca osul respectiv a fost scos de la locul de inhumare si expus la soare timp indelungat. De asemenea se poate determina inhumarea intr-un cimitir prin prezenta substantelor de imbalsamare, a artefactelor apartinand cosciugului. Modificari osoase produse de oameni prin mijloace mecanice. Dezmembrarea sau depesajul se realizeaza cu urmatoarele scopuri:39(p129) de a nu permite identificarea unui cadavru prin dermatoglife sau metode odontostomatologice, acesta fiind decapitat si se indeparteaza mainile si picioarele. pentru a permite ascunderea intr-un spatiu de dimensiuni mici sau transportul cadavrului intr-un anumit container. mutilarea corpului datorita unor impulsuri emotionale. Instrumentele folosite in acest scop sunt de obicei fierastraul, cutitul sau toporul. Este posibil sa se determina anumite caracteristici ale instrumentului folosit prin examinarea urmelor lasate de acesta pe suprafata de sectiune a osului. Din acest punct de vedere foarte utile sunt sectionarile incomplete (denumite de
72 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Klepinger sectionari false) ale osului sau articulatiei, locul unde se opreste sectiunea putand da informatii cu privire la caracteristicile lamei: baza sectionarilor incomplete produse de fierastrau este plana. Ambele suprafete de sectiune trebuie examinate deoarece striurile prezente la acest nivel dau detalii cu privire la tipul de fierastrau folosit, starea dintilor si directia de sectionare. sectionarea incompleta produsa de cutit are forma literei V, este mai ingusta decat cea produsa de fierastrau. Pierderea de material prin producerea de praf osos (ceva asemanator rumegusului) este mai redusa decat in cazul folosirii fierastraului, capetele sectionate se imbina mai bine iar dimensiunile osului astfel reconstruit se apropie de cele originale. sectionarea produsa de topor are deasemenea forma literei V, dar latimea sectiuni este mai mare si rezulta cantitate mai mare de resturi osoase. Decapitarea facuta cu un cutit poduce de obicei la nivelul vertebrelor cervicale 4 sau 5 dar este intalnita si la nivelul vertebrelor 3 sau 6.39(p130) Doar o portiune din vertebra sectionata este atasata craniului restul ramanand la trunchi. Sectiunile incomplete se pot intalni si in aceasta situatie. In cazul decapitarii cu fierastraul, un fragment a bazei craniului poate fi sectionata.

Detasarea calotei craniene cu ajutorul unei macete. 18(p594)

Dezmembrare cu ajutorul unui fierstrau. 18(p594)


978-606-8363-03-5 73

Masterat cercetri criminalistice aplicate

74

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 4
EXAMINAREA CRIMINALISTICA A LOCULUI UNDE SE PRESUPUNE EXISTENTA RESTURILOR DE NATURA UMANA.
Desi in practica cazurile care presupun examinarea de ramasite umane, sunt diferite unul fata de altul, rezolvarea acestora parcurge aceleasi etape fiecare avand un anumit specific metodologic si expertal. In general aceste etape sunt: descoperirea osemintelor, documentarea, colectarea lor si a altor probe materiale asociate, ambalarea si expedierea la laboratorul de identificare antropologica unde acestea vor fi examinate. In final informatiile furnizate de anchetatori si de examenele de laborator vor fi sintetizate intr-un raport de expertiza antropologica care va furniza o explicatie logica si o reconstructie a evenimentelor perimortem cat si identificarea ramasitelor umane. Din aceste motive o colectare corespunzatoare si completa a ramasitelor umane este cruciala pentru interpretarea obiectiva a cazului. Ramasitele osoase pot fi descoperite in mod accidental sau prin cercetare criminalistica efectuate ca urmare a unei sesizari (plangere, denunt sau din oficiu). Incercarea de ascunderea a unui cadavru este in putine cazuri eficienta, in special cele ale adultilor care sunt grele si dificil de manipulat. Din aceasta cauza cadavrele sunt lasate la locul unde s-a produs incidentul, fie sunt tarate sau transportate intrun vehicul si lasate intr-un loc ascuns, unde sunt descoperite in mod accidental. Cand cadavrul este ingropat de obicei groapa nu este adanca si se afla in apropierea locului unde s-a produs incidentul. In unele situatii cercetarea criminalistica pe piese osoase se face si in cazul sit-urilor arheologice sau cimitirelor vandalizate. Cercetarea criminalistica are drept scop descoperirea si localizarea gropilor clandestine, a ramasitelor umane situate pe suprafata solului, ramasite ce pot fi reprezentate de: cadavre in diferite stare de descompunere, fragmente de cadavru, schelete sau oase separate. Pe langa ramasitele umane cercetarea criminalistica are in vedere si procesarea probele materiale asociate acestora. Clasificarea zonelor unde se pot gasi ramasite umane Zonele in care se desfasura activitati de cercetare si localizare a ramasitelor umane se impart in 3 categorii.40(24) 1. suprafete deschise unde se pot folosi metode vizuale, fotografii aeriene, metode geofizice. Acesta sunt de obicei campiile si alte terenuri plane sau orice teren a carui camp de vizibilitate este de 360 grade. 2. zonele obstructionate denumite astfel de catre Gunn37(p31), includ urmatoarele: zone urbane, impadurite, pesterile sau zone in care prezenta unor forme de relief impiedica cercetarea vizuala, efectuarea de fotografii aeriene sau determina interferente cu metodele geofizice. 3. suprafete scufundate care necesita personal si echipament specializat.
978-606-8363-03-5 75

Masterat cercetri criminalistice aplicate

Actiuni preliminare in vederea cercetarii la fata locului a) identificarea factorilor cu potential negativ asupra desfasurarii cercetarii la fata locului: factori de relief, factori meteo-climatici, disponibilitatea de personal si instrumente, utilaje. b) planificarea operatiunilor de identificare, colectare, ambalare si transport al probelor materiale c) se vor determina limitele zonei care va fi supusa cautarii. b) se va stabili un punct de reper permanent in functie de care se vor face toate masuratorile, de obicei un marker imobil fie preexistent fie plasat de investigatori. d) locul se va sectoriza, pe perimetrul suprafetei se vor infinge tarusi la distante egale iar intre ei se vor intinde sfori care vor fi paralele si perpendiculare intre ele delimitand arii rectangulare cu laturi cuprinse intre 3 si 6 metrii18(567) orientate in planul nord-sud. Dupa sectorizare, se va creea o schita detaliata a locului in care este prezentata orientarea gropii si a altor elemente importante ale locului in functie de caroiaj si distanta acestora fata de de punctul de reper. Documentarea probelor se va face fotografic si prin schite. e) stabilirea unei cai unice de acces catre zona de care trebuie dezgropata. f) se va nota existenta de frunze, crengi sau alte materiale care au fost asezate in mod voit in acel loc aratand intentia de ascunde, camufla groapa.

Exemplu de sectorizare a ariei de teren unde se va efectua dezgropare.18(p567) g) se va selecta metoda ce va fi folosita pentru cautare. In aceste doua etape, hartile si fotografiile aeriene sunt foarte utile: permit observarea caracteristicilor geografice si astfel se poate face o selectie a metodei optime de cautare a zonei respective. arata eventualele modificari geografice, ale vegetatiei, sau cele produse de om (constructii de cladiri, sosele) care au avut loc in zona respectiva odata cu trecerea timpului, de exemplu:40(p24) compararea hartilor sau fotografiilor aeriene la momentul in care se considera ca a fost inhumat cadavrul cu cele prezente poate arata modificarile de relief si daca presupusul loc se gaseste intr-o zona accesibila. d) se face inventarul necesarului de personal si echipament.
76 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

e) obtinerea de informatii de la suspect sau martori. Dupras si colaboratorii40(p25) au elaborat o lista cu intrebari specifice cercetarii antropologice care trebuie puse suspectului sau martorilor inainte de a incepe cautarea: cand s-a produs incidentul la ce adancime a fost ingropat cadavrul daca, cadavrul a fost infasurat in vreun material sau daca era imbracat daca deasupra cadavrului a fost pus ceva (placa din lemn, ciment, metal, un alt cadavru) inainte ca groapa sa fie umpluta. care au fost conditiile meteoclimatice (pamant uscat sau umed, zona impadurita sau despadurita) daca deasupra gropii a fost pus ceva pentru a ascunde sau camufla locul (boscheti, crengi, gunoi). daca exista repere in vecinatatea gropii care ar ajuta la localizarea acesteia. daca relieful a fost schimbat de cand cadavrul a fost ingropat. Metodele de cautare si descoperire a ramasitelor umane, sunt de doua tipuri: neinvazive si invazive:40(p23) 1. Metodele neinvazive sunt nedistructive pentru ramasitele umane sau probele materiale asociate si includ: examinarea vizuala: o a elementelor de la suprafata solului ce caracterizeaza locul unde este ingropat un cadavru o prezenta de piese osoase imprastiate pe suprafata solului, cad cadavrul nu a fost ingropat fotografii aeriene care vor evidentia locul unde solul si vegetatia prezinta modificari fotografii in infrarosu care suprind caldura degajata de procesele de putrefactie ale cadavrul. utilizarea cainilor de cautare a cadavrelor. metodele de geofizice de prospectare 2. Metodele invazive sunt distructive atat pentru resturile umane cat si pentru eventualele probe materiale. Ele se folosesc cand metodele neinvazive nu au dat niciun rezultat si constau din: sondarea terenului executarea de sapaturi test folosirea echipamentelor grele de excavare. I. Cautarea vizuala este o metoda nedistructiva de localizare a ramasitelor umane si a gropii clandestine. Se vor determina limitele zonei de cautare acestea putand fi naturale (de exemplu: ape curgatoare, dealuri, stanci) si facute de om (cladiri, garduri, sosele, locuri de parcare). Cand suprafata de teren care trebuie investigata are o intindere mare va trebui sa fie impartita in zone mai mici care pot fi acoperite in cel mult o zi. Metodele cele mai eficiente de cautare pe o suprafeta de teren mare sunt: metoda cautarii pe fasii dreptunghiulare:
978-606-8363-03-5 77

Masterat cercetri criminalistice aplicate

o permite o totala acoperire a suprafetei. o membrii echipei de cautare vor fi aliniati in linie la o distanta unul fata de celalalt astfel incat campurile vizuale a doua persoane alaturate sa se suprapuna.

Metoda cautarii pe fasii dreptunghiulare. 40(p26) o daca suprafata de cautat este mare sau numarul de membrii ai echipei este mic atunci dupa ce s-a terminat o fasie intr-o directie se va examina fasia alaturata dar urmand o directie opusa. o seful echipei va coordona membrii fie fiind asezat in spatele liniei formata de acestia fie in rand cu ei. Seful echipei se va asigura ca: ritmul de inaintare este optim pentru a permite fiecarui membru sa inspecteze vizual aria sa de lucru si ca echipa se deplaseaza in linie. o membrii echipei vor avea la ei stegulete de semnalizare pentru a marca orice poate fi important pentru cazul respectiv. o cand un membru al echipei gaseste o eventuala proba materiala atunci va anunta intreaga echipa sa se opreasca urmand ca toti sa efectueze o cercetare detaliata a zonelor invecinate. Dupa ce cercetarea detaliata s-a incheiat seful echipei dispune reasezarea in linie si reinceperea activitatii. metoda grilajului o dupa ce o fasie de teren este cercetata, echipa va cauta aceeasi zona dar in directie perpendiculara: astfel suprafata va fi cercetata de doua ori din doua directii si unghiuri diferite. o folosind acesta metoda creste probabilitatea de a descoperi material scheletal sau proba materiala care nu a putut fi observata dintr-un unghi vizual anterior.

Metoda grilajului . 40(p26)

78

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

metoda circulara sau spirala o este folosita atunci cand echipa si suprafata de cercetat sunt mici sau daca cercetarea incepe din varful unui deal. o Killam citat de Dupras40(p27) recomanda ca aceasta metoda sa fie aplicata spatiilor mici si efectuata de catre o singura persoana care se deplaseaza in cercuri concentrice cu diametrul descrescator dinspre exterior spre interior, aceasta directie previne distrugerea eventualelor probe materiale care ar avea loc in momentul deplasarii initiale a investigatorului catre centrul zonei. o in anumite situatii este utila inversarea directiei de cercetare si anume investigatorul se misca din interiorul zonei catre exterior in cercuri concentrice crescande. Aceasta dirtectie se aplica atunci cand se cunoaste locul initial de depozitare a oaselor care insa au fost imprastiate de catre animale in diferite directii.

Metoda circulara sau spirala. 40(p26) Indicatori ai prezentei materialului scheletal 1. Localizarea materialului scheletal aflat la suprafata solului materialul scheletal poate fi descoperit prin localizarea vizuala a oaselor, a tesuturilor moi, a obiectelor personale sau a materialului in care a fost infasurat cadavrul (pungi de plastic, covoare, paturi, etc). ramasitele umane pot fi localizate si cu ajutorul cainilor de detectie a cadavrelor. Acestia pot alerta stapanul cand simt prezenta de cadavre proaspat ingropate care nu au intrat in putrefactie, cadavre putrefiate, resturi scheletale (Rebmann citat de Dupras 40(p41)). De asemenea acesti caini pot detecta cadavrele in submersie. Cautarea cu caini a cadavrelor ingropate se desfasoara optim la o temperatura de 4-16oC, pamant si atmosfera umeda si o viteza a vantului de cel putin 8km/ora.37(p36) activitatea de cautare si descoperire a elementelor scheletale si a probelor materiale asociate, aflate la suprafata solului este ingreunata de deteriorarea lor ce are loc odata cu trecerea timpului distrugerea si imprastierea lor de catre animale, in plus osemintele pot fi acoperite de frrunzele uscate sau ingropate partial sau total de pamantul adus de ploi. Localizarea ramasitelor dezarticulate si dispersate pe suprafata solului De cele mai multe ori, materialul scheletal aflat la suprafata solului va prezenta un anumit grad de dispersie, produs de activitatea umana sau animala,
978-606-8363-03-5 79

Masterat cercetri criminalistice aplicate

gravitatie (cand cadavrul se afla la partea superioara a unui plan inclinat), curenti de apa, procesele de formare a solului (prin caderea de frunze sau crengi, alternanta inghetare topire a pamantului, prabusirea straturilor solului).40(p29)

Prezenta oaselor umane pe suprafata pamantului semnalizata prin stegulete.40(p568) Daca locul de depozitare primara a unui cadavru este in panta atunci dupa scheletizare este foarte posibil ca o parte din oase sa fie luate de torentele de apa de ploaie sau de gravitatie si transportate pana la baza pantei. De cele mai multe ori, insa, imprastierea pe o suprafata de teren mare a materialului scheletic este facuta de catre animele. Oase si fragmente de oase trebuie cautate in tufisuri, in jurul cailor de acces si in ascunzatorile animalelor stiind ca au obiceiul sa depoziteze resturile in aceste locuri sau in apropierea lor. 2. Localizarea elementelor scheletale ingropate Cadavrele ingropate sunt mult mai dificil, uneori chiar imposibil de localizat in absenta unor informatii asupra coordonatelor exacte. In lipsa acestora se vor utiliza pentru localizarea gropii clandestine urmatorii indicatori prezenti la suprafata solului:40(p38) pamantul dislocat pentru a face groapa nu a fost pus la loc, excesul gasinduse in jurul ei. movila de pamant situata deasupra gropii datorata faptului ca pamantul afanat isi modifica volumul cat si a dislocarii unui anumit volum de pamant de catre cadavrul inhumat. in cazul gropilor putin adanci se vor gasi in jurul acesteia gropi suplimentare din care s-a scos pamant pentru a acoperi groapa unde se afla cadavrul.

a) pamant in exces b) depresiune corespunzatoare gropii40(p38)


80 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

modificari locale de culoare ale pamantului prin amestecarea diferitelor straturi de sol. suprafata de pamant care nu prezinta vegetatie fiind inconjurata de vegetatie adancitura in pamant rezultata din compactarea pamantului afanat care a fost pus deasupra cadavrului cat si colapsul toracelui si abdomenului datorate descompunerii. pamantul afanat cat si substantele nutritive rezultate in urma putrefactiei favorizeaza dezvoltarea vegetatiei care creste direct deasupra gropii. Uneori factorii nutritivi nu ajung la radacinile plantelor cadavrul fiind in fasurat in diferite materiale sau groapa este foarte adanca, astfel incat nu se va observa o dezvoltare desoebita a vegetatiei. in cazul gropilor putin adanci, animalele detecteaza mirosul cadavrului in putrefactie si incearca sa-l dezgroape, astfel ca se vor observa mai multe sapaturi de adancimi diferite facute de animale in anumite cazuri se pot gasi uneltele de sapat si/sau arme lasate sau pierdute/uitate de cel care a facut groapa.

a) Vegetatie abundenta deasupra gropii b) vegetatie saraca cand cadavrul este inclus intr-un container.40(p39) II. Metode geofizice de cautare Constau in localizarea nedistructiva a obiectelor sub pamant sau in apa. Se foloseste pentru suprafete mai mici si de obicei ca o completare a metodei de inspectie vizuala. Un avantaj fata de celelalte metode este ca se poate folosi si in cazul suprafetelor de beton sau asfalt cat si in cazul examinarii initiale a fundatiei unei cladiri. Sunt doua categorii de metode geofizice de cautare: pasive si active (Reynolds citat de Dupras 40(p51)). Principiul tehnologiei active este de a trimite un semnal electromagnetic in pamant de catre un transmitator si apoi masurarea semnalului de intoarcere de catre un receptor iar tehnologia pasiva se realizeaza doar cu ajutorul unui receptor care va masura campul magnetic sau gravitational care sunt produse de obiectele metalice ingropate.40(p52) Din metodele geofizice de cautare Ground Penetrating Radar este cea mai buna optiune pentru cautarea neinvaziva a cadavrelor ingropate. Aceasta metoda presupune transmiterea in sol prin intermediul unei antene de microunde electromagnetice de frecventa inalta sub forma de impulsuri si
978-606-8363-03-5 81

Masterat cercetri criminalistice aplicate

masurarea amplitudinii si a timpului de propagare al undelor de raspuns care sunt modificate de conductivitatea si proprietatiile dielectrice ale obiectelor. Proprietatile dielectrice ale mediilor determina viteza undei electromagnetice iar conductivitatea determina modul de transmitere al semnalului si calitatea acestuia. Astfel, mediile caracterizate de conductivitate mare vor favoriza imprastierea semnalului transmis prin transformarea energiei electromagnetice in caldura (efect similat celui dintr-un cuptor cu microunde). Antenele folosite de sistemul GPR variaza in functie de adancimea de investigare si marimea obiectului investigatiei. Frecventa de emisie a antenei este invers proportionala cu adancimea si direct proportionala cu marimea obiectului de investigatie. Astfel, cu cat creste rezolutia si deci acuratetea datelor obtinute, cu atat scade adancimea de investigare.41

Ground Penetrating Radar.54(p68)

Vizualizarea prin GPR a rezistivitatii electrice a corpurilor ingropate.42 Lichidele de putrefactie se amesteca cu apele de infilitratie determinand un mediu conducator de electricitate foarte bun. Astfel GPR care masoara rezistivitatea electrica vor permite identificare si localizarea cadavrelor ingropate in curs de descompunere. In imaginea de mai sus in chenarul rosu este un cadavrul de animal ingropat, in chenarul verde nu se gaseste nimic ingropat iar in chenarul negru se gaseste un cadavru de animal infasurat in material impermeabil.42
82 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Avantajele metodei GPR: rezultatele sunt afisate in timp real, rezolutie excelenta, se poate estima adancimea la care se afla obiectelor de interes, poate fi folosit pentru a cauta atat morminte clandestine sau obiecte metalice care pot fi asociate unui cadavru. GPR funtcioneaza optim pe soluri uscate si nisipoase dar poate fi folosit si pentru suprafete acoperite cu ciment, pavaj, soluri compacte, nu este recomanda folosirea directa pe suprafata apei (ci prin intermediul unei ambarcatiuni). Dezavantaje: o este un instrument scump o necesita un operator cu experienta pentru a-l manipula si interpreta rezultatele; suprafata locului investigat trebuie sa fie neteda, fara multe radacini o sa existe putine obiecte metalice ingropate (aceastea pot da rezultate fals pozitive pentru un corp inhumat). Metode invazive sau distructive de cautare a cadavrelor ingropate Dupa ce toate metodele neinvazive au fost epuizate se vor folosi metodele invazive care aduc modificari substantiale si ireversibile locului de cercetat, deci decizia de a le utiliza trebuie sa fie facuta cu mare atentie. Cautarea cu sondele Este cea mai comuna metoda invaziva pentru localizarea gropilor clandestine cat si pentru determinarea limitelor acestora. Sondele se asociaza cautarii sub form de grilaj a locului. Sondele au forma literei T bratul orizontal fiind manerul, sunt facute din metal sau fibra de sticla si au varful ascutit. Au o lungime de 1.2m si o grosime de 1-1.5cm.40(p44) Sunt impinse in sol la distante egale si cu o forta egala de fiecare data. Principiul detectarii se bazeza pe faptul ca solul afanat caracteristic unei grop are o densitate mai mica si opune o rezistenta mai mica patrunderii sondei, ceea ce este perceput de catre investigator. Locurile care sunt detectate astfel se vor nota pe harta locului, pentru o investigarea ulterioara. Un alt tip de sonda care poate fi folosita este penetrometrul care masoara cantitativ si forta de impingere, este utilizat de obicei in agricultura sau constructii de drumuri.

Penetrometru.43

978-606-8363-03-5

83

Masterat cercetri criminalistice aplicate

Se pot utiliza si sonde care recolteaza pamant pentru a se determina stratigrafia solului si nu densitatea acestuia. Astfel de sonda este introdusa in pamant circa 0.9 1.2m si la retragere va contine si un cilindru de sol cu o grosime de 1 cm si lungime de 17 23cm care se va examina din punct de vedere al straturilor sau a amestecului acestora caz ca a fost sapata o groapa in locul respectiv.

Sonda ce permite vizualizarea stratigrafica a solului pe o lungime de 30,4cm.44

Atunci cand este folosita sonda locul cercetat se va sectoriza in patrulatere cu latura cuprinsa intre 30cm si 1 m.40(p47) O persoana va folosi sonda iar o a doua persoana va nota rezultatele pe schita locului. Stegulete de atentionare vor fi plasate in zonele care necesita investigare mai in detaliu. Dezavantaje: metoda dificil de utilizat pentru suprafete mari. nu se poate folosi in cazul terenurilor nisipoase unde nu se poate percepe o diferenta de densitate dintre solul proaspat sapat si cel batatorit. sonda poate sa distruga oasele inhumate, producand leziuni ce pot fi intepretate ca fiind produse perimortem. Saparea Este o metoda foarte invaziva cu potential distructiv ridicat al probelor, se foloseste numai atunci cand celelalte metode nu au dat niciun rezultat. Cu ajutorul unei lopeti se fac mici gropi pentru a se gasi dovezi ale prezentei inhumarii clandestine. Tot pamantul sapat va fi examinat si eventual trecut printr-o sita pentru a se putea retine eventualele elemente mici osoase sau alte obiecte. In momentul in care aceste dovezi apar atunci se va utiliza o cazma ascutita pentru a se face delimitarea gropii. Inlaturarea pamantului nu se face prin sapare propriu-zisa ci printr-o miscare tangentiala la sol inlaturandu-se strat dupa strat in grosime de doar cativa centimetrii.40(p47)

Modul de sapare pentru dezgroparea ramasitelor umane. 40(p48)

84

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Folosirea de utilaje grele Nu este o metoda ideala pentru cautarea materialului scheletal inhumat. Avantajul metodei este rapiditatea saparii. Se va folosi cand absolut toate celelalte metode nu au avut niciun rezultat si mai ales pentru terenuri foarte largi sau terenuri inundate. Atunci cand se recurge la aceasta metoda se va folosi un excavator cu cupa fara dinti.40(p47) Se va incerca sa se sape cat de superficial posibil. O persoana va trebui sa examineze suprafata ramasa dupa scoaterea pamantului de fiecare cupa, iar alta persoana examineaza pamantul excavat. Nu se va folosi buldozerul pentru ca acesta distruge in mod semnificativ orice proba materiala, prin actiunea specifica de impingere care amesteca straturile de sol intre ele si exercita presiune pe eventualele elemente scheletale distrugandule. Procesarea mormantului clandestin Tipuri de morminte clandestine.40(p110) 1. Depozite de suprafata cadavrul este abandonat pe suprafata pamantului unde se va descompune sub actiunea factorilor de mediu si meteoclimatici, prin actiunea animalelor si insectelor. 2. Gropi primare sunt cele mai des intalnite in context criminalistic, cadavrul va fi gasit in pozitia in care a fost ingropat, oasele sunt in pozitia anatomica unul fata de celalalt la groapa nu s-a umblat dupa inhumarea cadavrului, pana in momentul descoperirii. 3. Gropi la care s-a umblat la un moment dat dupa inhumare, dar ramasitele umane nu au fost mutate: animalele, eroziunea solului, utilajele grele sau activitatea umana pot produce alterari ale mormantului primar. de obicei cateva elemente osoase lipsesc dar restul oaselor sunt in pozitie anatomica unul fata de celalalt. foarte important pentru activitatea de cercetare criminalistica este identificarea si interpretarea activitatii umane in raport cu mormantul primar, de exemplu, suspectul se reintoarce la groapa sa scoata sau sa adauge un anumit obiect. 4. Gropi secundare: sunt rezultatul activitatii umane, resturile scheletale fiind mutate din locul initial de inhumare. daca aceasta activitate are loc dupa ce s-a produs scheletizarea atunci raporturile anatomice al oaselor dezarticulate vor fi pierdute astfel incat mormantul secundar consta din resturile osoase dispuse in gramada. de multe ori vor lipsi elemente osoase. 5. Groapa comuna (detalii in capitolul 8): groapa ce contine ramasitele a doua sau mai multe persoane.
978-606-8363-03-5 85

Masterat cercetri criminalistice aplicate

acestea au fost ingropate in acelasi timp in cadrul unui mormant primar sau o combinatie de mormant primar si secundar cand s-au mai adaugat ramasite umane peste cele initiale. se intalnesc in situatiile de genocid, crime de razboi sau crime impotriva umanitatii. 6. Incinerarea criminala sau distrugerea termica cadavrului pentru ca este nevoie de o temperatura foarte mare pentru a distrugerea scheletului in totalitate (peste 1600oC40(p112)) se vor gasi si oase incomplet arse fiind aproape imposibil ca intreg cadavrul sa fie complet distrus. Chiar si in conditiile incinerarii legale in cadrul crematoriului reducerea la cenusa a cadavrului se face prin procesarea mecanica ulterioara a oaselor calcinate. Caracteristicile gropilor primare Atunci cand se sapa o groapa, pamantul scos este in mod normal asezat langa groapa astfel ca acesta se va amesteca cu solul de suprafata, vegetatie sau alte materiale. De obicei lungimea gropii va fi de aproximativ aceeasi lungime cu cea a cadavrului iar latimea de doua ori mai mare decat cea a cadavrului. Tipul de sol si teren cat si de efortul fizic depus pentru sapat vor influenta adancimea gropii. De obicei gropile facute pentru a ascunde un cadavru nu sunt adanci avand doar adancimea necesara pentru a acoperi cadavrul. Dupa asezarea cadavrului in groapa aceasta se va reumple, dar intotdeauna va ramane un exces de pamant datorita afanarii pamantului cat si a volumului cadavrului care disloca un volum de pamant corespunzator. Excesul de pamant poate fi imprastiat in jurul gropii sau va fi lasat pe loc fara sa se incerce nivelarea lui. Dupras si colaboratorii citandu-l pe Killam40(p110) arata ca cei mai multi infractori se debaraseaza de cadavre intr-unul din urmatoarele doua feluri: cadavrul va fi ingropat la repezeala intr-o zona putin cunoscuta sau necunoscuta suspectului cadavrul va fi ingropat intr-o zona bine cunoscuta suspectului, fie ca este proprietatea sa sau este o zona des vizitata de acesta. Dezgroparea ramasitelor scheletale (dupa Dupras si colaboratorii 40 pp118-126) Sunt doua metode care pot fi adoptate in functie de identificarea limitelor gropii: 1. daca limitele sunt evidente atunci saparea va avea loc intre aceste limite 2. daca nu se pot determina limitele gropii atunci se va proceda in felul urmator: se incepe dintr-un colt al suprafetei sectorizate si se continua in diagonala prin dislocarea cu ajutorul unei mistrii a unui volum de pamant cu o grosime de 5 cm din fiecare patrulater al sectorizarii. se va mentine aceeasi adancime in toate patrulaterele. saparea se va face printr-o miscare de radere, strat cu strat, cu marginea laterala a mistriei in directia catre investigator. materialul dislocat se va examina separat pentru fiecare patrulater in vederea evidentierii probelor materiale sau a fragementelor osoase.
86 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

In urma acestui proces de sapare progresiva se vor identifica marginile gropii, urmand etapa de dezgropare. Metodologia de sapare in vederea dezgroparii ramasitelor umane este: saparea va incepe in patrulaterul situat deasupra centrului gropii continuand centrifug pana la 3-5 cm fata de marginea gropii. Aceasta margine va fi examinata ulterior pentru prezenta de urme de sapare sau a altor probe materiale. se va sapa pe o adancime de 5 cm, pe rand, in fiecare patrulater, mentinand la orice moment, aceeasi adancime in toate patrulaterele. pamantul rezultat va fi examinat separat pentru fiecare patrulater in parte pentru prezenta probelor materiale. dupa ce au fost sapati in adancime primii 20-30cm se vor indeparta cu grija si cei 3-5cm de pamant de pe perete pana se va ajunge la marginea intiala a gropii. Se va nota prezenta urmelor lasate de instrumentele folosite la sapatul gropii. se va documenta prezenta eventualelor obiecte sau probe materiale inainte de a se continua saparea urmatorului strat. Se va examina peretele si pentru determinarea diferitelor tipuri de straturi, care vor fi marcate. Dupa ce toate aceste activitati au fost incheiate se trece la urmatoarea etapa de expunere prin dezgropare a fragmentelor osoase: pentru a nu se distruge oasele sau obiectele mai delicate, nu se va sta in perimetrul gropii pana cand nu se cunoaste cu exactitate pozitia ramasitelor umane prin expunerea tuturor fragmentelor osoase din motivul amintit mai sus, saparea se va face: - stand in exteriorul marginii gropii: - folosind placi de lemn care sunt puse peste deschiderea gropii, sprijinite pe marginile acesteia. Utilizarea lor se face numai dupa ce eventualele urme de sapare sau alte urme au fost documentate. daca adancimea gropii devine improprie unei sapari eficiente si in siguranta, atunci pe una din marginile gropii si in exteriorul ei se va sapa o platforma de unde personalul va continua dezgroparea mormantului clandestin. Inaltimea acestei platforme va fi intotdeauna mai mare decat suprafata de dezgropat. Se va mari adancimea platformei progresiv cu adancirea gropii ce ascunde ramasitele umane. Se va avea grija ca intotdeauna sa se examineze peretii rezultati prin adancirea progresiva a gropii. se va sapa cu atentie doar jumatate din groapa pana incep sa apara urmele ramasitelor scheletale sau a containerului in care a fost introdus cadavrul sau a materialelor in care acesta a fost infasurat, astfel ca se va putea aprecia pozitia si orientarea scheletului. Totul va fi fotografiat si reprezentat in schita, dupa care se va trece la saparea celeilalte jumatati a gropii. solul compact, argilos, imbibat cu apa se va spala printr-o sita pentru a se putea retine fragmentele de os sau probe material de mici dimensiuni.

978-606-8363-03-5

87

Masterat cercetri criminalistice aplicate

Dezgroparea cadavrului facuta de pe platforma.18(p122)

Examminarea separata a solului dislocat pentru fiecare patrulater al sectorizarii.18(568)

88

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Folosirea sitelor pentru a retine obiectele de mici dimensiuni. 18(568) procesul de dezgropare graduala a ramasitelor umane in situ se va face astfel incat sa se conserve postura scheletului si relatia spatiala a oaselor cu eventualele probe materiale prezente.

Dezgroparea ramasitelor umane.54(p113) se vor folosi unelte de mici dimensiuni pentru a expune in totalitate ramasitele umane. atunci cand indepartarea solului se face in apropierea materialului osos se recomanda sa se foloseasca unelte din plastic pentru a nu produce urme pe suprafata osoasa. in aceasta etapa se va lucra dinspre partea expusa catre zonele ce necesita dezgropare pentru a preveni distrugerea eventualelor obiecte. containerele sau materialele folosite la infasurarea cadavrului se vor dezgropa si expune prin aceleasi metode folosite in cazul oaselor. cu exceptia obiectelor mici care pot impiedica inaintarea saparii, in aceasta etapa oasele si probele materiale se vor lasa pe loc. expunerea zonelor corespunzatoare regiunilor abdominale si pelvine cand se banuieste prezenta unui schelet de femeie trebuie facuta cu mare grija, deoarece se pot gasi ramasite scheletale fetale care sunt de mici dimensiuni si foarte fragile. se vor recolta pentru examenele toxicologice sau entomologice probe de sol din zonele corespunzatoare cavitatilor toracice si abdominale, pentru ca
89

978-606-8363-03-5

Masterat cercetri criminalistice aplicate

solul de la acest nivel poate contine urme de insecte sau alte substante chimice. ramasitele scheletale trebuie trecute pe schita si se va nota adancimea si distanta fata de punctul de reper situat la suprafata solului a elementelor osoase ce apartin extremitatii cefalice, bazin, coate, genunchi, umeri, maini si picioare cat si a tutroro obiectelor gasite.. atat elementele osoase cat si celelate probe materiale vor fi documentate corespunzator trebuie sa se aiba in vedere ca datorita procesului de expunere a elementelor osoase, prezenta unor probe materiale poate fi trecuta cu vederea si anume: lentile de contact, pacemaker, proteze si materiale asociate interventilor chirurgicale, cu rol desoebit de important in identificarea individuala.

Colectarea ramasitelor umane A) Colectarea ramasitelor si probelor materiale aflate pe suprafata solului 40(115) De obicei astfel de ramasite sunt dispersate prin modurile descrise anterior, astfel ca una din obiectivele cercetarii la fata locului este descoperirea tuturor elementelor osoase. Documentarea si intocmirea schitelor locului sunt etape importante pentru intelegerea de ansamblu si reconstituirea evenimentelor ce au avut loc perimortem si postmortal. Identificarea factorilor cu potential negativ asupra desfasurarii cercetarii la fata locului: factori de relief, meteo-climatici, disponibilitatea de personal si instrumente, utilaje. Planificarea operatiunilor de identificare, colectare, ambalare si transport al probelor materiale Determinarea perimetrului suprafetei locului ce trebuie cercetat. Stabilirea unei cai unice de acces catre zona de unde au fost identificate resturile umane. Documentarea si efectuarea schitei locului unde au fost gasite resturile osoase. Impartirea locului in sectoare cu ajutorul unor fire dispuse deasupra si paralel cu solul care delimiteaza patrulatere de dimensiuni egale. O atentie deosebita trebuie acordata etapei de curatire si expunere a suprafetei locului unde se banuiesti prezenta de resturi scheletale, pentru a nu se pierde fragmente mici de oase, dinti sau chiar fire de par. Se vor indeparta resturile de frunze, crengi uscate, gunoi sau alte materiale din cate un patrulater o data nu inainte de a se cauta cu atentie prezenta de elemente osoase sau alte probe materiale. Se va cauta zona respectiva si cu detectorul de metale B. Colectarea cadavrelor ingropate Metoda18(p124) care va fi prezentata este folosita pentru cadavre scheletizate complet dar poate fi adaptata si pentru cele in diferite stadii de descompunere. ordinea colectarii oaselor cand scheletul este in intins in decubit dorsal (intins pe spate) este urmatoarea:
90 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

1. se vor colecta mai intai oasele mainilor si picioarelor, pentru a preveni distrugerea datorita dimensiunilor mai mici si a fragilitatii, 2. oasele membrelor superioare, inferioare si coastele 3. oasele bazinului si vertebrele 4. craniul ordinea de colectare a oaselor se va adapta in functie de pozitia scheletului, mai ales atunci cand exista oase suprapuse. se va avea grija la ridicarea craniului si mandibulei pentru a nu se pierde dintii din alveolele dentare si sa nu se produca alterari acestor oase. craniul va fi manipulat cu ambele maini avandu-se grija sa nu se apice o presiune prea mare. Nu se va manipula craniul prin introducerea degetelor in orbite sau alte orificii craniene pentru ca marginile acestora sunt fragile. se va examina zona dedesubtul craniului si imprejur, pentru a se gasi fire de par de la nivelul scalpului sau facial. cand se vor colecta craniul, oasele bazinului, scapulele trebuie avut in vedere posibilitatea prezentei tesuturilor moi sau a resturilor de imbracaminte dispuse intre aceste oase si suprafata pe care se sprijina. se vor cauta bijuterii sau alte podoabe (inele, verighete, bratari, cercei, lantisoare) in jurul elementelor osoase. ramasitele mentinute in pozitie anatomica de imbracamintea conservata (camasi, pantaloni, ciorapi, pantofi) se vor colecta cu totul urmand sa fie examinate in conditii de laborator. elementele scheletale care nu sunt continute de imbracaminte se vor colecta si ambala separat. oasele fracturate nu vor fi reconstituite pe teren, fragmentele vor fi ambalate impreuna. metoda ieftina si eficienta de proteja oasele si a le pastra integritatea este invelirea acestora in folie de aluminiu.22(p18) se va face o lista a elementelor scheletale colectate. daca elementele osoase sunt stratificate sau sunt mai mult de doua schelete suprapuse, se va documenta si examina fiecare strat pe rand dupa care se vor colecta: - fragmentele osoase, - probe materiale - probe botanice sau entomologice - proba din suprafata de pamant care era situata imediat sub ramasitele scheletale. zona de interes va fi reexaminata pentru a fi siguri ca toate probele materiale au fost colectate. Baza gropii este gresit considerata ca fiind ultimul nivel unde se mai pot gasi probe materiale: pot fi obiecte sau substante care au patruns sub acest nivel, cum ar fi gloante sau substante chimice care au fost folosite pentru distrugerea cadavrului.
978-606-8363-03-5 91

Masterat cercetri criminalistice aplicate

se vor colecta probe de sol pe o adancime de cativa centimetrii sub nivelul bazei gropii. folosind o sapaliga se va rade baza si peretii gropii pana cand se ajunge la steril. este recomandata folosirea unui detector de metale pentru cercetarea bazei gropii. dupa ce au fost documentate si colectate toate probele materiale se va decide daca groapa va fi astupata in acel moment. Astuparea se va face cu solul dislocat.

Pozitia si orientarea ramasitelor umane Se descriu in functie de pozitia membrelor superioare, inferioare, a capului unul fata de celalalt si fata de trunchi40(p113) si nu se vor raporta la groapa, punctele cardinale sau alte puncte de reper. Pozitia ramasitelor umane dintr-o groapa primara se descrie ca fiind: in extensie: picioarele sunt intinse formand un unghi de 180 grade cu trunchiul. Corpul poate sa fie in decubit dorsal sau ventral. in flexie: unghiul dintre trunchi si membrele inferioare este de 90 grade sau mai putin in semiflexie: unghiul dintre trunchi si memebrele inferioare este intre 90 si 180 de grade. Este important sa se noteze pozitia membrelor fata de trunchi exprimata in grade, de exemplu daca scheletul membrelor superioare apar ca pozitionate in spatele trunchiului aceasta poate sa sugereze ca, cadavrul era legat cu mainile la spate cand a fost asezat in groapa, iar cu timpul legaturile s-au distrus. In cazul craniului trebuie sa se noteze daca este in: flexie, extensie, viscero-craniul (fata) orientat anterior sau lateral stanga sau dreapta. Pozitia scheletului poate sa dea detalii cu privire la stadiul postmortal al cadavrului in momentul ingroparii:40(p114) daca rigidatea era completa si generalizata atunci este putin probabil ca suspectul sa modifice pozitia cadavrului asezandu-l in groapa in pozitie flectata sau ghemuita. Pozitia ghemuita arata ca victima a fost asezata in groapa inainte de instalarea rigiditatii sau rigiditatea a fost rupta sau pozitia ghemuita a fost fixata de rigiditate inainte de inhumare. Colectarea ramasitelor umane nescheletizate Colectarea cadavrelor partial scheletizate se va face in mod asemanator celor scheletizate complet. Pentru a fi ridicat, cadavrul expus, nu trebuie tras in mod fortat pentru ca exista pericolul ca articulatii slabite prin procesul de putrefactie sa cedeze, astfel ca se pot pierde elemente importante cum ar fi leziuni de aparare sau produse prin legare.
92 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Pentru a ridica astfel de cadavre, se vor dezgropa de jur imprejur si se va slabi contactul dintre cadavru si baza gropii, urmand ca acesta sa fie ridicat ca un intreg fie cu ajutorul unei targi fie de mai multe persoane care actioneaza in acelasi timp. Se vor colecta cu instrumente curate probe pentru examene biochimice si histopatologice ce vor fi puse in containere sterile. Colectarea ramasitelor umane carbonizate Acestea se gasesc de obicei la suprafata solului, in gropi putin adanci sau in diferite containere. Trebuie ridicate cu mare atentie pentru ca oasele cabonizate sunt foarte fragile, urmandu-se metodologia descrisa la capitolele respective. Ambalarea si depozitarea ramasitelor scheletale Oasele care nu prezinta tesut osos moale se vor ambala in pungi de hartie. Nu se vor eticheta direct elementele osoase, etichetele se vor pune atat in interior cat si pe amabalaj consemnandu-se cel putin urmatoarele date: 1. locul de unde au fost colectate prin utilizarea coordonatelor pentru fiecare patrulater al sectorizarii, 2. continutul ambalajului, 3. numarul cazului, 4. numele celui care a facut colectarea. Sistemul de numerotare al etichetelor trebuie duplicat si in notitele investigatorilor. Gura pungii se va indoi de cel putin doua ori si se va capsa pentru a prevenii desfacerea in timpul transportului. Daca exista pericolul fragmentarii oaselor se vor ambala in material protector (material textil din bumbac, pungi de plastic sau ziare), de asemenea pachetele nu se vor aseza unul deasupra celuilalt. Craniul si mandibula vor fi ambalate separat de restul oaselor pentru a preveni distrugerea lor, pierderea dintilor si pentru a pastra pamantul sau alte elemente care se gasesc in interiorul craniului. De asemenea oasele bazinului se vor ambala separat. Atunci cand e posibil, oasele de pe partea dreapta (membre, coaste) se vor ambala separat de partea stanga. Resturile umane aflate in stare avansata de putrefactie, se vor ambala pentru a preveni scurgerea lichidelor de putrefactie. Se vor infasura fragmentele umane in material textil de bumbac si apoi se vor introduce in saci de plastic penntru cadavre. Toate probele materiale asociate resturilor umane se vor ambala corespunzator. Transportul ramasitelor umane Se face cu ce vehicule sunt la dispozitie si se va avea in vedere sa nu se produca distrugeri, contaminare sau amestec al elementelor osoase.

978-606-8363-03-5

93

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 5
METODOLOGIA DE LABORATOR A IDENTIFICARII MEDICO-LEGALE - ANTROPOLOGIE
Identificarea persoanei are multiple aspecte atat de ordin bio-medical cat criminalistic (de exemplu identificarea hainelor, actelor, obiectelor personale). Sunt si metode de identificare criminalisticea a caror principii au o componenta medicala importanta: identificarea amprentelor si obiectelor personale de uz medical: proteze auditive si stomatologice, ochelari, medicamente, sau proteze chirurgicale. Identificarea anatomica si medico-legala cuprinde: 45.(pp82-90) 1. Stabilirea unor caracteristici majore de grup, si anume: sexul, talia, rasa si varsta. Acestea pot fi determinate exclusiv din ramasitele corporale disponibile, dar se pot lua in consideratie si corobora si datele obtinute prin alte metode. Un exemplu elocvent poate fi determinarea sexului, dupa haine si bijuterii, dar nu intotdeauna aceste date sunt absolut certe. 2. Stabilirea identitatii (individualizarea) prin compararea ramasitelor cu informatii antemortem care se considera ca apartin victimei; aceasta numai in conditiile in care exista materiale disponibile de comparat.

Identificarea cadavrelor intacte


Urmatoarele criterii de identificare se aplica cadavrelor intacte (nu sunt dezmembrate, mutilate, arse, procesele de descompunere postmortala sunt intr-un stadiu incipient) sau cadavrelor la care mediul in care s-au aflat au creat conditiile dezvoltarii unor procese conservatoare postmortale.: 1. Expresia faciala Chiar si la cadavrele proaspete, recunoasterea poate fi uneori dificila, datorita alterarii fizionomiei determinata de procesele postmortale: rigiditatea musculara, paloarea, deshidratarea pielii. Exista situatii in care rudele apropiate sa aiba indoieli sau chiar sa nege identitatea persoanei decedate. Cu toate ca stresul si emotia joaca un rol important, modificarile in aspectul figurii pot fi profunde. Identificarea vizuala a persoanei vii se bazeaza si pe o componenta dinamica a trasaturilor faciale ce include tonusul facial muscular, grimasa fetei, expresia ochilor si miscarile acestora, care toate sunt absente la decedat. 2. Culoarea ochilor La cadavrele proaspete, acesta corespunde cu cea vitala, dar se deterioreaza repede. Pierderea presiunii intraoculare si deshidratarea corneei se dezvolta
978-606-8363-03-5 95

Masterat cercetri criminalistice aplicate

progresiv in cateva ore, facand irisul greu de observat. Colapsul polului anterior al ochiului apare in intervalul de 1-2 zile si odata cu aparitia putrefactiei, toti irisii au tendinta sa ia o tenta maronie-negricioasa. Dupa citeva zile de la deces, culoarea irisului este un criteriu nesigur de identificare; uneori cu mult mai devreme, in cazul in care conditiile de mediu grabesc descompunerea. 3. Culoarea tegumentului Melanocitele sunt celule care se gasesc in piele si ochi si care produc un pigment numit melanina ce da culoarea pielii si a ochilor. Numarul de melanocite este acelasi la toate rasele dar incarcarea cu pigment difera. La cadavrele neputrefiate si nemodificate traumatic diferentele etnice majore privind pigmentatia pielii sunt evidente, cu toate ca moderata crestere de melanina a asanumitelor rase galbene din Asia este imposibil de diferentiat de rasele mediteraneene si din Orientul Mijlociu. Cand apare putrefactia, tegumentul se decoleaza progresiv, facand mai putin evidente straturile de pigment, ceea ce duce la o identificare mai dificila a culorii tegumentului si la incadrarea persoanei ca apartinind unei anumite categorii etnicorasiale, cu toate ca melanina poate fi inca depistata in stratul bazal al epidermului restant. Stratul de tegument pigmentat este distrus in cazul arsurilor mai profunde sau poate sa fie camuflat de depozitarea funinginei sau alti produsi de combustie. Identificarea regiunii corporale din care face parte un fragment de tegument se bazeaza pe urmatoarele criterii: grosimea epidermului: este in medie de 0,7-0,12 mm, variind de la 0,8 mm la nivelul palmelor, pina la 1,4 mm la nivelul plantelor; grosimea dermului: este in medie de 1-2mm, fiind de 0,6mm la nivelul pleoapelor si preputului, si > 3mm la palme si plante; frecventa glandelor sebacee: prezente peste tot cu exceptia plantelor, fetelor laterale ale picioarelor si palmelor; sunt in general asociate cu foliculi pilosi cu exceptia comisurilor bucale, glandului, preputului si labiilor mici; frecventa glandelor sudoripare: foarte frecvente axilar si perianal, acestea sunt absente la nivelul glandului, marginilor buzelor si patului unghial; frecventa corpusculilor tactili (determinati microscopic): corpusculi Pacini frecventi pe plante si organe genitale; corpusculii Meissner frecventi pe palme si pulpele degetelor; frecventa melanocitelor: este maxima pe scrot; frecventa fibrelor elastice: absente pe ceafa, scalp, dorsul miinilor si picioarelor, torace, abdomen; prezente in celelalte regiuni anatomice (10/cm2 = fata, membrele superioare, 17/cm2 = gambe). 4. Caracteristicile parul A. Culoarea parului Parul capului, pubian si axilar reprezinta un element de identificare dintre cele mai rezistente, putandu-se conserva uneori timp de milenii in conditii de mediu favorabile. Culoarea originala se poate totusi modifica dupa ingropare
96 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

devenind maroniu-roscata sau de culoarea blanii de vulpe, intr-un timp mai scurt de 3 luni. De asemenea, culoarea parului poate fi modificata, datorita murdariei sau prin tratamente cosmetice, fiind necesara uneori restabilirea culorii originale printrun tratament specific, facuta de obicei de catre un biolog. De asemenea analiza chimica poate detrmina daca parul a fost colorat chimic sau oxigenat. B. Morfologia si structura parului Examinarea firului de par se face de catre biolog sau antropolog, scopurile examinarii fiind: a. determinarea originii umane b. determinarea circumstantelor detasarii firului de par; c. compararea firului de par cu fire de la victima/suspecti. a) Determinarea originii umane Caracteristicile firului de par uman: - diametrul firului de par este de 50-125 microni (scalp 80 microni, barba >100 microni); - indicele medular (este raportul dintre diametrul canalului medular si diametrul total al firului de par <0,38 (>0,50 la animale); - medulara e fina, granulara, inconstanta; - corticala groasa, cu granule pigmentare dispersate; - solzii cuticulei sunt putin vizibili. b) Determinarea rasei -parul negroid este brunet inchis si carliontat, de forma eliptica la sectionare. Au un diametru mai mare ca al altor grupuri rasiale. Particolele de pigment sunt distribuite neuniform, aglomerate in mase de forme si dimensiuni diferite. Uneori pot fi atat de numeroase si dense incat sa faca opac firul de par. Canalul medular are un diametru care variaza de-a lungul firului. - parul mongoloid: mai putin pigmentat, drept, pe sectiune cilindric. Firele sunt aspre, Medulara este continua si mai lata. Particulele de pigment sunt in general mai mari ca la caucazieni si cel mai frecvent sunt aglutinate formand mase neuniforme. - parul caucazienilor: rotund sau ovoid pe sectiune, cu mare variabilitate a culorii si morfologiei comparativ cu primele doua rase; au o duritate mica spre medie. Aspectul pe sectiune al tulpinei variaza rotund si oval. Particulele pigmentare sunt de dimensiuni mici-medii si sunt uniform distribuite. Parul sprancenelor este triunghiular pe sectiune; cel pubian este aplatizat. Negri Caucazieni Mongoloizi Ondulare +++ +/+ Sectiune aplatizat oval rotund Diametru 60-90 microni 70-100 microni 90-120 microni

c) Determinarea grupei AB0 este posibila dar neconcludenta in multe cazuri. d) Determinarea sexului - indicele medular la barbati este de 0.25 0.35 iar la femei este mai mic de 0.20.
978-606-8363-03-5 97

Masterat cercetri criminalistice aplicate

e) Determinarea zonei de provenienta a firului de par, poate fi determinat dupa variatia caracteristicilor acestuia in functie de zona topografica: - pielea capului: d = 80 microni, maduva inconstanta; - barba: diametrul > 100 microni, maduva +/- constanta; - gene/sprincene: diametrul = 80 microni, lungimea < 3cm; - membre: diametrul < 60 microni, lungimea < 3 cm; - trunchi: diametrul >60 microni, lungimea = 2-6 cm; - pubis: lungimea = 3-8 cm, ondulat. 5. Tatuaje Reprezinta ornamentarea deliberata a tegumentului prin introducerea unui anumit pigment sub epiderm. - multi barbati si femei din majoritatea tarilor au tatuaje. Acestea au un rol importan in procesul de identificare; - sunt folositi diversi pigmenti dar si substante mai putin obisnuite, cum ar fi funinginea sau praful de pusca; - pigmentul este introdus in dermul superficial cu un instrument ascutit, de obicei un ac folosit manual sau printr-un vibrator electric; - culorile albastru, verde sau rosu pot fi eliminate prin fagocitoza de celulele tisulare si transportate in ganglionii limfatici dupa un numar de ani. Pigmentii negri, de obicei particulele de carbon din cerneala indiana, sunt atit de rezistenti incat persista practic toata viata, cu toate ca o parte poate fi transportata in ganglionii limfatici. Tipurile de tatuaje sunt atat de numeroase si variate, incat nu se poate face o clasificare a acestora. Aplicabilitatea tatuajelor pentru identificare necesita cunostinte etnice, culturale, religioase si ale practicilor sociale, astfel incat sa poata fi facuta o legatura intre un anumit tatuaj si un grup etnic particular. In societatea vestica, popularitatea tatuajelor se schimba periodic: in trecut tatuajele se intalneau mai ales la nivelul paturilor sarace ale populatiei, mai ales la marinari, soferi. La femei se intalneau mai ales in randul prostituatelor, avand o semnificatie si localizare specifica. Anumite tatuaje au o semnificatie particulara: nr 13 pe fata interna a buzei inferioare apare frecvent la utilizatorii de droguri; o pasare albastra tatuata pe suprafata de extensie a membranei interdigitala de la baza policelui se intalneste de obicei la homosexuali. In zilele noastre tatuajele sunt frecvente si la populatia obisnuita, iar modelul poate sa fie este completat si cu un nume, sau initiale, de exemplu: barbatii isi tatueaza prenumele partenerelor sexuale, sau initialele propriului nume iar la femei se numele tatuate sunt cele ale iubitilor). Putrefactia ingreuneaza vizualizarea tatuajelor, care pot fi reevidentiate numai dupa indepartarea veziculelor de putrefactie (deci in cazul putrefactiei incipiente). Odata cu transformarea culorii tegumentelor spre verde-cenusiu dispare si posibilitatea de evidentiere a tatuajelor.
98 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Exista posibilitatea indepartarii deliberate a tatuajelor, la maturitate prin regretarea entuziasmului tineretii sau a momentelor de betie, sau pentru a ingreuna sau a face imposibila identificarea. Metodele folosite pentru aceasta sunt: excizii chirurgicale, arsuri chimice cu soda caustica, electroliza, raschetare cu materiale abrazive. Toate metodele se bazeaza pe lezarea epidermului si dermului, cu formarea consecutiva a inflamatiei si cicatricilor. 6. Amprente digitale, palmare, plantare si ale buzelor Rolul medicului este, ca si la tatuaje, de a facilita luarea amprentelor de catre criminalist. 7. Cicatrici ca elemente de identificare trebuie interpretate in contextul rezultatelor celorlalte metode de identificare. daca o cicatrice este de o forma sau dispozitie neobisnuita sau unica, atunci valoarea acesteia creste foarte mult in identificare ajuta la identificarea corpurilor necunoscute fiind vizibile si in perioadele de debut ale putrefactiei (cicatrici postoperatorii, cicatrici posttraumatice) specificitatea cicatricilor variaza in limite foarte largi: foarte multi oameni prezinta cicatrici postapendicectomie, multe femei au cicatrici dupa histerectomie sau alte operatii in zona pelvina unele cicatrici sunt produse intentionat, ca urmare a unor traditii etnice sau religioase, cum ar fi unele cicatrici faciale ale unor triburi africane: lobul urechii sau buzele deformate sau perforate cicatricile vechi la nivelul antebratului sau a portiunii anterioare cervicale sunt caracteristice pentru tentative de suicid arii largi cicatriceale ale trunchiului sau membrelor care au dispozitii paralele sugereaza leziuni produse probabil intr-un accident rutier leziunile produse de cutit se pot cicatriza sub forma eliptica, uneori si unghiurile acesteia fiind caracteristice: unul bont, celalalt ascutit arsurile dau cicatrici caracteristice, cheloide, mai ales atunci cind sunt intinse si profunde. cicatrici multiple pe fata anterioara a membrelor inferioare pot indica un alcoolic cronic, care cade frecvent sau se loveste de mobila Vechimea cicatricilor o este dificil de apreciat, deoarece odata ce devine matura (definitiva anatomo-patologic) nu se mai modifica toata viata o in general, o plaga liniara se vindeca in decursul unei saptamani (daca nu se complica infectios); cicatricea are o culoare cafenie-rosietica si ramane vascularizata cateva luni, in functie de profunzimea sa o cicatricea devine alba in 4-6 luni o colagenul se mai formeaza timp de aproximativ un an, dupa acest interval cicatricea este alb-sidefie si ramine sub aceasta forma timp nedefinit
978-606-8363-03-5 99

Masterat cercetri criminalistice aplicate

o aceste etape sunt variabile in functie de caracteristicile tegumentului, pigmentatie, partea corpului afectata o histologia nu ajuta la cronologia cicatricilor ci doar la confirmarea lor ca atare; de asemenea, la nivelul cicatricilor nu exista foliculi pilosi, glande sebacee sau sudoripare 8. Stigmate ocupationale anumite obiceiuri i profesii produc modificari ale unor regiuni corporale, sau ale tegumentului. In ultimul timp au scazut extrem de mult in frecventa si importanta lor in identificare se cunoaste cicatricea albastra a minerilor, care reprezinta un tatuaj involuntar, cauzat de praful patruns in micile zone de eroziune ale tegumentului mainilor si fetei. unii mineri si pietrari au de asemenea unele mici cicatrici datorate imprastierii difuze a pietrelor din timpul exploziilor otelarii si turnatorii au mici cicatrici de ardere pe ariile expuse datorita stropilor de metal topit. in termeni foarte generali, examinarea mainilor decedatului ne da informatii asupra tipului muncii (manuale sau sedentare) a acestuia cicatricile, taieturile, hipercheratoza mainilor sunt in general caracteristice pentru o munca grea manuala 9. Talia (lungimea) unui cadavru intact masurarea corecta ese face de la calcai la vertex (crestetul capului) nu coincide neaparat cu cea din timpul vietii talia cadavrelor poate fi mai mare sau mai mica decat a persoanei in viata, cu toate ca de obicei este mai mare prin pierderea completa a tonusului muscular imediat postmortem, datorita relaxarii articulatiilor mari (coapsa si genunchi) si pierderii efectului tonic al musculaturii paravertebrale asupra discurilor intervertebrale, are loc alungirea corpului cu 2-3 cm rigiditatea cadaverica poate restabili tonusul muscular, scurtand corpul si ducand la flexia usoara a membrelor inferioare la aparitia putrefactiei articulatiile se relaxeaza din nou. din toate datele prezentate anterior reiese ca exista multi factori de eroare in stabilirea exacta a lungimii postmortem a cadavrului 10. Determinarea sexului la corpurile nescheletizate rareori exista probleme, acestea apar numai in cazurile de intersexualitati si hermafroditism in general, sexul cadavrelor ramane identificabil pana in stadiile avansate ale putrefactiei ; caracteristice sunt glandele mamare, forma generala a corpului, parul pubian (la femei este triunghiular cu varful in jos, la barbati are forma romboida, uneori pana la ombilic)
100 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

prezenta sau nu a circumciziei peniene orienteaza catre apartenenta la unele grupe etnice/religioase: evrei sau musulmani in cazul putrefactiei avansate se examineaza organele interne: prostata si mai ales uterul sunt foarte rezistente la putrefactie daca putrefactia este intr-un stadiu foarte avansat, cu lichefierea totala a organelor interne, se poate apreciea sexul pe baza conformatiei radiologice a pelvisului osos. examinarea citologica a nucleilor celulari pentru identificarea cromatinei sexuale (drumstick- betigasul de toba) al celulelor polimorfonucleare si corpusculii Barr in celulele epiteliale (ex din mucoasa bucala) pot indica sexul, dar in materialele descompuse este deosebit de dificil, daca nu imposibil de evidentiat. hainele, lungimea parului, coafura, culoarea parului, cerceii si alte bijuterii nu mai reprezinta in zilele noastre un indicator cert al sexului feminin

Identificare antropologica pe material osos


Obiectivul principal al expertizei medico-legale antropologice a ramasitelor umane descompuse sau scheletizate este identificarea persoanei decedate. In cadrul acestui obiectiv examinarea va furniza: informatii demografice cu privire la rasa, sex, varsta si talia persoanei decedate elemente unice ale identitatii cum ar fi modificari terapeutice, patologice sau traumatice ale oaselor si dintilor, caracteristici distincte ale morfologiei oasoase. Expertiza medico-legala antropologica se realizeaza prin: A. metode metrice sau obiective - au la baza masuratorile elementelor osoase intre puncte osteometrice bine definite. Datele astfel obtinute vor fi introduse in ecuatii matematice rezultand estimari cu privire la caracteristicile demografice ale ramasitelor scheletale. B. metode non-metrice sau subiective - vor determina caracteristicile osoase asociate unei anumite rase, varste, sau sex. Ambele tipuri de analize (metrica si non-metrica) prezinta un anumit nivel intrinsec de eroare, astfel ca rezultatele examinarii antropologice trebuie formulat in termenii unui interval de probabilitate si nu sub forma unor date certe. Principiile biologice ale identificarii medico-legale pe piese scheletale Oasele si dintii difera in populatie atat ca forma cat si ca dimensiuni definindu-se astfel doua tipuri de variabile: unele masurabile si poarta denumirea de variabile metrice si unele care sunt reprezentate de mici diferente sau anomalii morfologice denumite variabile non metrice.46(p73) Aceste variabile care stau la baza metodologiei de identificare medico-legala antropologica sunt rezultatul urmatorilor factori:22(p32)
978-606-8363-03-5 101

Masterat cercetri criminalistice aplicate

1. factori ontogenici sau de crestere in perioada de crestere a individului de la fetus la adult exista variatii scheletale atat dimensionale cat si morfologice pe baza carora se poate estima varsta ramasitelor scheletale. 2. dimorfismul sexual reprezinta o a doua sursa de variatie a scheletului uman. Dimorfismul sexual se manifesta atat sub forma unor dimensiuni scheletale in general mai reduse la femei cat si a unor diferente morfologice pe baza carora se poate determina apartenenta de sex a ramasitelor scheletale. 3. Cea de a treia sursa de variatie este reprezentata de apartenenta la un grup etnic sau diferente de rasa ale scheletului. 4. Variatia individuala sau idiosincratica a scheletelor chiar si la indivizii de aceeasi varsta, sex sau rasa exista diferente atat in ceea ce priveste dimensiunile cat si forma elementelor ce alcatuiesc scheletul. Etape preliminarii in identificarea antropologica medico-legala Cercetarea de la fata locului se extinde cu examinarea in laborator a elementelor scheletale ridicate in prima etapa. Pentru o desfasurare optima a procedeelor de identificare antropologica trebuie ca locul unde se face examinarea sa indeplineasca urmatoarele cerinte: 1. iluminare corespunzatoare lumina fluorescenta emisa de lampi fixate pe tavan nu este suficienta. Pentru observarea detaliilor osteologice se recomanda utilizarea unei lampi la care se poate modifica directia razei luminoase produse de un bec incandescent. 2. examinarea se face deasupra unei suprafete capitonate. 3. se va avea grija ca oasele examinate sa nu fie distruse fie prin manipulare neglijenta ce poate produce rostogolirea si caderea pe podea sau prin utilizarea necorespunzatoare a instrumentelor de laborator. 4. se va avea in vedere ca elementele osoase supuse examinarii pot prezenta pericol biologic sau chimic, se vor lua masurile necesare pentru prevenirea contaminarii personalului si a mediului in care se desfasoara activitatea de examinare. Personalul va purta halat, manusi si ochelari de protectie, masca. Conservarea si consolidarea oaselor ce urmeaza sa fie examinate Se pot face folosind substante solubile in apa sau in acetona, de exemplu:22(p334) polivinil acetat (PVA), bitumen acrilat (Paraloid B72), rasini acrilice (Bedacryl), rasina de polivinil butiral (Butvar) Din aceste substante se va prepara o solutie cu concentratie de 5-10% in care se va introduce in totalitate osul, dupa care este lasat sa se usuce. In cazul in care specimenul este foarte fragil se va picura solutia pe suprafata acestuia.
102 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Adezivii cu cianoacrilat pot fi folositi in special in consolidarea dintilor in alveolele dentare ale mandibulei si maxilarului. Prepararea si curatirea oaselor Daca osul este intr-o stare buna atunci acesta se poate spala in apa calduta fara detergenti, folosind perii si sonde din lemn sau plastic. In bazinul unde se face spalarea se va aseza o sita pentru a retine fragmentele mici de os. Dupa spalare oasele se vor lasa sa se usuce timp de 24-48 de ore. Uscarea nu se va face prin expunere la soare sau prin folosirea unei surse de caldure ce pot determina exfolierea osului.

Curatirea oaselor care prezinta tesut moale Tesutul moale (resturi de tegument, muschi, etc) se va indeparta cu grija folosind cutite, bisturie, foarfeci. In aceasta etapa tebuie avut grija ca osul sa nu fie zgariat si de asemenea sa se identifice si sa recolteze eventualele larve de insecte. In urmatoarea etapa osul este fiert cu sau fara adaos de substante chimice cum sunt detergenti pe baza de enzime, pentru a fi complet curatat de urmele de tesut moale. O metoda eficienta de curatire a oaselor de tesut moale si fara ca acest proces sa influenteze rezultatele examenelor genetice este fierberea oaselor cu un amestec de detergenti de rufe si carbonat de sodiu timp de 4 ore.47 Restaurarea materialului osos Consta din reconstituirea osului din fragmentele fracturate. Principiile restaurarii osoase sunt:22(p338) se foloseste adeziv care poate fi dizolvat in caz ca exista erori de restaurare se restaureaza separat viscerocraniul si neurocraniul inainte de a le asambla impreuna trebuie avut grija ca fragmentele fracturate sa fie uscate si curate, fara particule sau fragmente de diferite materiale atasate capetelor fracturate. nu se adauga adeziv pana cand nu se obtine o imbinare perfecta a capetelor osoase. Se poate folosi lupa pentru verificare. pentru a imbina fragmentele de os corespunzatoare trebuie ca acestea sa aiba aceeasi textura, culoarea si sa formeze un tot anatomic. nu se vor lipi dintii in alveolele dentare pana nu este sigura pozitionarea lor corecta. reconstructia osului unde lipsesc fragmente, spre deosebire de restaurare, se face numai daca e necesara si aceasta datorita subiectivitatii metodei in sine; fragmentele lipsa de os se pot reconstitui folosind ipsos sau un amestec 50:50 de ipsos si ceara lichefiata prin incalzire pe o plita incinsa. Acest material este usor de utilizat si de indepartat. atunci cand contactul intre capetele fracturate este limitat si slab se vor folosi atele din lemn sau fibra de sticla pentru fixare.

978-606-8363-03-5

103

Masterat cercetri criminalistice aplicate

Sortarea ramasitelor scheletale Elementele care arata prezenta mai multor schelete sunt urmatoarele: - oase ce prezinta diferente evidente morfologice datorate varstei, sexului, taliei - articularea nefireasca a oaselor Cand se gasesc mai multe ramasite scheletale unul din obiectivele expertizei medico-legale antropologice este de a determina numarul de indivizi a caror oase au fost gasite (subiectul va fi discutat la obiectivele expertizei antropologice). Efectuarea masuratorilor Instrumentele de masurare utilizate sunt: compasul antropometric, banda metrica, plansa osteometrica (pentru masurarea oaselor lungi), compasul de grosime, sublerul sau rigla antropometrica. Instrumentele de masurare moderne sunt conectate la computere permitand stocarea unui numar mare de date. Instrumentul cel mai des utilizat pentru efectuarea masuratorilor craniene este compasul antropometric care este alcatuit din doua brate metalice indoite in partea superioara si unite intre ele printr-o articulatie. Unul dintre brate, cel drept, este mobil si aluneca pe o scala metalica divizata in centimetri. Bratul mobil este prevazut cu un surub care il poate fixa pe scala, facilitand citirea corecta a dimensiunilor masurate. Instrumentul este folosit pentru masurarea distantelor liniare curbe ale craniului.

Compas antropometric48 si plansa osteometrica49

Mandibulometru50 si subler dentar51


104 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

In cazul masuratorilor efectuate cu instrumente metalice trebuie avut grija ca acestea sa nu deterioreze suprafata osului prin zgariere sau perforare. Masuratorile se exprima in sistemul metric si se efectueaza intre anumite repere anatomice sau puncte virtuale situate pe materialul osos care descriu arce, coarde sau volume iar prin combinarea acestora se obtin indicii osteometrici care exprima in mod convenabil printr-o singura variabila forma unui element osos, de exemplu: indicele cranian este dat de raportul dintre diametrul transvers maxim masurat intre punctele craniometrice denumite eurion si diametrul longitudinal maxim masurat intre glabella si opistocranion, inmultit cu 100; un craniu mai lat avand un indice mai mare decat un craniu mai ingust si mai lung. Buikstra si Ubelaker52 recomanda folosirea a 34 de masuratori standard craniene si a 44 postcraniene pe scheletele intacte. Instrumentul de electie pentru efectuarea masuarorilor craniene este compasul antropometric. Selectia punctelor craniometrice s-a facut pe baza urmatoarelor criterii: a) proiectia maxima a craniului intr-o anumita directie (de exemplu, glabela este punctul cel mai proeminent situat intre arcadele supraorbitale) b) locul de intersectie a unor suturi craniene (de exemplu, bregma este punctul situat la intersectia suturii coronale cu cea sagitala) c) puncte care corespund unor formatiuni anatomice (de exemplu proeminentele osoase pentru insertia musculara) In cazul oaselor lungi masuratorile determina lungimea si latimea diafizei sau a suprafetelor articulare. Lungimea se masoara cu plansa osteometrica (formata dintr-o plansa cu suprafata plana, gradata in centimetri si doua placi perpendiculare, una fixa si cealalta mobila). Latimea diafizelor se masoara cu sublerul iar circumferinta cu banda osteometrica. Suprafetele articulare se masoara in plan medio-lateral sau antero-posterior. Punctele osteometrice ale scheletului postcranial s-au selectat dupa urmatoarele criterii: 1. punct cu localizare proportionala (de exemplu la mijlocul diafizei) 2. punct corespunzator unei formatiuni anatomice Masuratorile se pot face si pe filme radiografice fie automat (in cazul radiografiilor digitizate) fie cu ajutorul compasului.53(p128) Obiectivele expertizei antropologice pe material scheletal 1. Daca elementul gasit este os sau alt material Oasele intacte sunt usor de recunoscut chiar si de nespecialisti. Deoarece multe obiecte cu structura chimica organica sau anorganica sunt asemanatoare macroscopic cu oasele, recunoasterea acestora devine dificila atunci cand sunt fragmentate putand fi confundate cu obiecte din plastic sau fragmente de radacini. Confuzia poate fi accentuata si de modificarile de culoare ale fragmentului de os, putand capata o tenta inchisa daca este ingropat in pamant de culoare neagra sau poate deveni albicios daca este expus la soare. Mai mult, daca oasele sunt calcinate identificarea este cu atat mai dificila necesitand opinia unui expert.

978-606-8363-03-5

105

Masterat cercetri criminalistice aplicate

Fibrele din compozitia unor materiale izolatoare folosite in constructii pot fi confundate cu firele de par. De asemenea fragmente mici, plate din obiecte de ceramica nesmaltuite pot fi confundate cu fragmente de bolta craniana.

Fragmentul din imagine a fost ridicat de la locul unui incendiu cu victime, avea grosimea, curbura si structura asemanatoare peretelui cranian (tesut osos compact si spongios). Ulterior s-a dovedit a fi un fragment de material plastic care supus actiunii focului a format bule de diferite diametre dand impresia de tesut osos spongios.4(p 94)

Femur (specimenul de sus), fragment de lemn (mijloc), fragment de os expus intemperiilor o perioada lunga de timp (jos).32(p1)

Bucata de lemn ce poate fi confundata cu un os lung.37(p142)


106 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

2. Originea umana sau non-umana a osului Apartenenta umana a unui schelet este usor de determinat atunci cand: este complet si componentele osoase se gasesc in pozitie anatomica. prezenta de tesut moale sau fire de par prezenta de dinti avand lucrari dentare Craniul uman prezinta caracteristici inconfundabile, de exemplu, calota rotunda si viscerocraniul plat. Mandibula animalelor vazuta de sus sau de jos are forma literei V si este separata pe linia mediana. Mandibula umana are forma literei U fara separare mediana. La om este prezenta barbia care este absenta la animale. Craniul uman este orientat in axul vertical si orbitele sunt localizate inaintea si deasupra aperturii nazale, cu o orientare anterioara, la animale orbitele sunt localizate inapoia si lateral de apertura nazala. Proiectia nazala este minima la om, semnificativa la animale.55 Diferente ale scheletului postcranian:55 oasele membrului superior la om sunt mai putin robuste ca cele corespunzatoare la animal. la om radiusul si ulna sunt separate, la animale adesea sunt fuzionate. la om corpul vertebral este plan cu diametru mare cu procese spinoase scurte, la animale corpul vertebral este mic cu suprafete concave/convexe si procese spinoase lungi. sacrul uman este scurt si lat format din 5 vertebre fuzionate, cel de animale este ingust si lung format din 3 4 vertebre fuzionate. la om pelvisul osos este lat si putin inalt, in forma de cupa, la animale este lung si ingust sub forma de lama. femurul este cel mai lung os la om, pe cand la animale are lungime similara cu celelalte oase ae membrelor. la om tibia si fibula sunt separate la animale deseori sunt fuzionate. piciorul este lung si ingust, purtand greutatea pe calcai si degete, la animale este lat, poarta greutatea pe degete. De asemenea exista diferente si in structura macroscopica si microscopica a oaselor de animale si umane, de exemplu: o corticala la om este mai poroasa decat la animal si reperezinta din grosimea osului lung pe cand la animal reprezinta din grosime. o structura microscopica a corticalei osului uman prezinta osteoane dispersate si uniform spatiate pe cand la animale osteoanele tind sa se sa se alinieze pe randuri sau sa formeze structuri recatngulare (os plexiform).55 Dificultati de identificare a speciei apar atunci cand: exista oase separate mai ales in cazul vertebrelor, coastelor, oaselor lungi si cele ale bazinului, mainilor si picioarelor. Acestea au unele caracteristici anatomice comune atat la oameni cat si la animale. De exemplu, scheletul labelor de urs poate fi confundat cu cel al mainii.

978-606-8363-03-5

107

Masterat cercetri criminalistice aplicate

Radiografie a mainii (stanga) si radiografie a labei de urs (dreapta).39(p 22)

Coaste de vaca (stanga) si coaste umane (dreapta).32(p10) grad crescut de fragmentare cu lipsa regiunilor pe baza carora se identifica osul (de exemplu, absenta epifizelor in cazul oaselor lungi) dintii umani sunt usor de diferentiat fata de dintii diferitelor specii de animale, probleme de apartenenta la specii apar atunci cand dintii sunt fragmentati. oasele de sugari si de copii mici pot fi confundate usor cu oasele de diferite animale sau pasari. Oasele fetusilor si cele ale nou nascutilor sunt de dimensiuni foarte mici si nu prezinta toate caracteristicile de forma ale oaselor adulte.

Femur de sugar (dreapta) femur de pui de gaina (stanga).32(p18)


108 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Dimensiunile oaselor craniului unui fetus de 5 saptamani in comparatie cu o moneda de 1 cent (stanga) si dimensiunile femurului (de jos in sus) la un sugar de 6 luni, la un copil de doi ani si la unul de 8 ani in comparatie cu moneda de 1 cent.59(p180) 3. Determinarea tipurilor de oase prezente si aprecierea numarului de indivizi Pentru identificarea oaselor, medicul legist sau expertul antropolog trebuie sa aiba temeinice cunostinte de osteologie iar indeplinirea cu succes a acestei primei parti a obiectivului expertizei va permite o apreciere cat mai exacta a numarului de indivizi care au contribuit la elementele scheletale gasite. In aprecierea acestui numar se are in vedere ca scheletul uman este format din oase pereche si nepereche, in plus fragmentarea oaselor creeaza dificultati in aprecierea numarului de indivizi scheletizati, de exemplu, daca se gasesc separate o epifiza humerala proximala si una distala (lipsind diafiza), se pot realiza doua scenarii:22(p338) 1) amandoua epifize apartin humerusului unui singur individ 2) epifiza sa apartina unui individ si cealalta unui al doilea individ. Pentru aprecierea numarului de indivizi se va utiliza metoda de cuantificare denumita Numar Minim de Indivizi (MNI - Minimum Number of Individuals) 22(p339),56(p241) si care, dupa cum ii spune si numele, reprezinta numarul minim estimat de indivizi care au contribuit la formarea ansamblului scheletal. Trebuie subliniat ca MNI nu reprezinta cel mai probabil numar de indivizi. 22(p339),56(p241) Sunt mai multe metode folosite pentru calcularea MNI, forma cea mai simpla fiind: cel mai frecvent os care se intalneste dupa sortarea oaselor pe tipuri anatomice si pe parte, stanga sau dreapta. 56(p244) O alta metoda de estimare a MNI este urmatorul: 22(p338),56(p244) pentru fiecarui tip de os de partea dreapta se determina numarul minim de indivizi ce il reprezinta (notat cu D) se face acelasi lucru si pentru partea stanga (numar notat cu S) se determina apoi numarul de perechi ce pot fi formate prin imperecherea oaselor de ambele parti (notat cu P)

978-606-8363-03-5

109

Masterat cercetri criminalistice aplicate

Se va calcula folosind acesti parametri cel mai mare minim dat de formula D+SP care prezinta un grad mai bun al estimarii fata de MNI (se consdiera ca oasele nepereche de cele doua parti apartin la indivizi diferiti). De exemplu, intr-o groapa comuna, humerusul este cel mai numeros os, fiind in numar de 10 de partea dreapta si 6 de partea stanga iar in acest grup sunt 4 perechi. In aceasta situatie MNI este 10 iar cel mai mare minim este este 10 + 6 4 = 12. 4. Determinarea sexului Deoarece metodele pentru estimarea varstei si a taliei sunt dependente de sexului ramasitelor scheletale, de obicei determinarea sexului este prima etapa in procesul de identificare. Inainte de examinarea de laborator a resturilor osoase trebuie avut in vedere ca la locul unde acestea sunt descoperite pot fi gasite si fragmente conservate de articole de imbracaminte care pot sugera sexul persoanei respective, de exemplu daca se gasesc resturi de sutien si fusta atunci, de regula, se poate concluziona ca ramasitele scheletale apartin unei femei. Pentru determinarea sexului pe baza vestimentatiei este necesar ca subiectul sa fie examinat in situ, putand exista doua scenarii: 1) este descoperit un schelet iar examinarea releva prezenta sutienului in jurul peretelui sternocostal fapt ce sugereaza sexul feminin al persoanei respective 2) fragmentele de imbracamainte si oasele sunt ridicate separat in vederea examinarii de laborator unde nu se mai poate spune daca persoana in cauza chiar purta acel articol de imbracaminte sau prezenta imbracamintii la locul respectiv este doar o coincidenta. Imbracamintea unisex este foarte comuna si genereaza probleme de identifcare. Uneori bijuteriile pot indica sexul persoanei desi atat femeile cat si barbatii poarta cercei sau piercing-uri, bratari, etc. De asemenea, continutul buzunarelor, gentilor, portofelelor pot indica sexul sau chiar identitatea decedatului. Chiar si in cazul gasirii acestor obiecte, determinarea sexului pe baze antropologice este obligatorie. La baza metodelor de determinare a sexului pe material osos sta dimorfismul sexual termen ce defineste diferentele morfologice ale scheletelor celor doua sexe produse de catre hormonii sexuali diferiti la barbat si la femeie.57 Ca regula generala scheletul de barbat este mai dezvoltat decat cel al femeii, de asemenea dezvoltarea musculara este mai importanta la barbati decat la femei, muschii mai puternici determinand locuri de insertie osoasa mai reliefate. La femei exista caracteristici specifice ale bazinului adaptate procesului nasterii. In determinarea sexului ramasitelor scheletale, se porneste de la o acuratete de 50% (probabilitatea de a ghici este de 50%). Datorita dimorfismului sexual accentuat, craniul si pelvisul se folosesc pentru determinarea sexului, astfel ca in
110 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

cazul craniului luat singur acuratetea determinarii este de 80% iar in cazul pelvisului de 90%.1(p203) Cand se folosesc ambele oase in vederea determinarii sexului, acuratetea este de 97%.46(p38) Acuratetea determinarii sexului va fi mai mica atunci cand aceste fragmente sunt distruse sau parti din ele lipsesc. In medie in cazurile medico-legale exactitatea determinarii sexului este de 85% ceea ce inseamna ca la 1 din 7 cazuri sexul este determinat incorect ceea ce din punct de vedere legal nu este acceptabil, astfel ca nivelul minim de exactitate a determinarilor sexului ar trebui sa fie de 95%.58(p230) Atunci cand, datorita distrugerii elementelor osoase sau a lipsei lor, exactitatea determinarii sexului are de suferit atunci concluziile examinarii trebuie sa specifice probabilitatea ca elementele osoase sa fie de sex masculin sau feminin. Atunci cand craniul sau pelvisul lipsesc, gradul de certitudine al determinarii sexului este foarte scazut. Din fericire, determinarea sexului in context medico-legal a fost schimbat fundamental prin aplicarea tehnicilor de biologie moleculara pe materialul osos, astfel incat daca se poate extrage ADN-ul din fragmentele osoase atunci se poate determina cu mare pricizie sexul individului respectiv. 4.1. Determinarea sexului la subadulti Determinarea sexului la copii si adolescenti prezinta dificultati importante deoarece dimorfismul sexual scheletal devine manifest dupa perioada adolescentei. Astfel ca determinarea sexului la scheletele de sub-adulti se face pe baza comparatiei cu bazele de datele statistice ce includ masuratori ale oaselor lungi si ale bazinului pe diferite categorii de varsta. Unele cercetari au aratat ca pe baza morfologiei mandibulare se poate determina corect sexul in 82% din cazuri, de exemplu s-a observat ca barbia baietilor este rectangulara, la fete este rotunjita.60 De asemenea morfologia fetei auriculare a ilionului poate fi folosita pentru determinarea sexului cu o acuratete de 85% a fetusilor si pana la 6 luni dupa nastere dar numai in cazul sexului masculin, aceasta metoda dand rezultate slabe in cazul sexului feminin (acuratete de doar 57% cu putin mai mare decat simpla ghicire). 61,62 4.2. Determinarea sexului la adulti A) Pe baza caracterelor morfologice ale bazinului. Bazinul femeii este adaptat nasterii astfel prezinta un pronuntat dimorfism sexual. Bazinul femeii este mai lat si mai putin inalt iar al barbatului este mai ingust si mai inalt. La femeie predomina diametrele transversale la barbati cele anteroposterioare si la femeie diametrele aperturii pelvine superioare si inferioare sunt mai mari. Apertura pelvina superioara are un diametru transversal mai mare dand o forma ovala aperturii, la barbat apertura pelvina superioara este mai ingusta si are forma unei inimi.
978-606-8363-03-5 111

Masterat cercetri criminalistice aplicate

Femeile au o apertura pelvina inferioara mai lata decat la barbati. Micul bazin are la femei o forma cilindrica iar la barbat are forma de trunchi de con cu baza mare superior. Osul sacru este mai lat la femei decat la barbati Unghiul subpubian (format din ramurile pubiene inferioare) este mai deschis la femei (90-100grade) decat la barbati. Marea incizura ischiadica este mai larga si mai putin adanca la femei decat la barbati.

Osul sacru mai lat la femei (stanga) mai ingust la barbati (dreapta).18(pp578,579) Indexul ischiopubian este util in estimarea sexului ramasitelor scheletale, avand formula:45(p95) IP = (lungimea pubisului x 100) / lungimea ischionului unde: o lungimea pubisului: de la planul simfizei pina la acetabulum o lungimea ischionului: de la acetabulum pina la marginea distala a ischionului o punctul de referinta este locul de fuziune al celor 3 elemente osoase imature, de obicei marcat printr-o creasta pe suprafata articulara Daca indexul ischiopubian (la rasele albe) este mai mic de 90, atunci pelvisul este barbatesc, daca este mai mare de 95 este femeiesc.

Marea incizura ischiadica la femeie (stanga) si la barbat (dreapta). 18(pp578,579)


112 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Femeile au un pubis mai lat si ramura ischiatica este alungita si ingusta iar la barbati pubisul este mai ingust si mai gros iar ramura ischiatica este mai scurta. Gaura obturata la femei are o formal trunghiulara cu varful orientat anterior la barbati are o forma ovala.

Schite privind diferentele dintre pelvisul feminin si cel masculin.63(p75) Acetabulul: este mai larg la barbati; are aprox 52 mm in diametru la barbati, comparativ cu cca 46 mm la femei.45(p95) Fata articulara acetabulara la barbati priveste lateral, fata de pelvisul feminin, la care are tendinta de a privi spre anterior.

B. Pe baza caracterelor morfologice ale craniului Determinarea sexului numai pe baza craniului este mai putin exacta decat cea efectuata numai pe baza pelvisului. Pentru o determinare a sexului cat mai exacta este optim sa se foloseasca ambele elemente osoase. Craniul masculin este mai robust si in general insertiile musculare sunt mai pronuntate. La barbati: glabela, marginile supraorbitale, procesele mastoide, protuberanta occipitala externa, liniile nucale, procesele mastoide sunt mai proeminente si mai robuste decat la femeie. La barbat neurocraniul este mai putin boltit, la femei este mai rotunjit, La barbat osul frontal este mai inclinat cu un unghi fronto-nazal mai adancit, la femeie fruntea este verticala. Orbitele sunt mai rotunjite la femeie si au margini mai ascutite, la barbati orbitele tind sa aiba o forma patrulatera. Palatul mai mare si cu forma de U regulat la barbati; la femei este mai mic si tinde sa aiba o forma parabolica. Apertura nazala este mai inalta si mai ascutita la barbati si are margini ascutite. Oasele nazale sint mai mari si proemina anterior, formind un unghi mai ascutit decit la femei.45(p94)
978-606-8363-03-5 113

Masterat cercetri criminalistice aplicate

Mentonul este patrulater la barbati la femei este rotunjit iar unhiul mandibular este mai putin obtuz la barbati decat la femei, zonele de insertie muscualara pe mandibula sunt mai rugoase la barbati decat la femei.

Craniu de barbat (stanga) si de femeie (dreapta).18(p581)

Menton masculin (stanga) si feminin (dreapta). 18(p582) Criteriile prezentate anterior sunt aplicabile indivizilor cu varsta intre 20 55ani si nu sunt valabile la sub-adult sau la maturul varstnic.45(94) C. Determinarea sexului pe baza scheletului potscranial o Oasele lungi au in general o lungime si diametru la mai mare la barbati decat la femei. o Zonele de insertii musculare sunt mai proeminenee la barbati. femei. Estimarea sexului pe baza oaselor lungi se face prin masurare si analiza statistica ce presupune compararea datelor obtinute la cazul examinat cu datele din tabele rezultate prin mutiple masuratori pe schelete de sex cunoscut. Din acest punct vedere diametrele capului humeral si femural sunt foarte utile, astfel:diametrul vertical este mai mare de 45 mm la barbati; iar la femei este mai mic de 41 mm, inregistrand valori extreme: 43 56mm la barbati si 37-46mm la femei.45(p96)

114

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

5. Estimarea varstei persoanei in momentul mortii Varsta biologica (si nu cea cronologica) poate fi apreciata pe baza varstei scheletale si dentare si va fi exprimata de expert sub forma unui interval (de exemplu 30 40 de ani) si niciodata ca varsta exacta (35 de ani). In acest capitol vor fi detaliate metodele de apreciere a varstei pe baza examinarii elementelor osoase. Estimarea varstei in perioadele de inceput ale vietii se bazeaza pe modificarile produse prin crestere (marirea dimensiunilor) si devoltare osoasa (schimbari de forma si/sau functie). Estimarea varstei adulte se bazeaza pe modificarile involutive ale oaselor. Cu cat individul este mai tanar cu atat intervalul de varsta estimat este mai restrans si cu cat individul este mai in varsta cu atat intervalul de varsta estimat este mai intins. Scaderea intervalului de varsta estimat o data cu scaderea varstei individului este determinata de bogatia modificarilor care au loc la nivelul oaselor la intervale de timp destul de regulate si in proportii relativ uniforme. Dupa depasirea maturitatii biologice aceste modificari sunt mult incetinite pana la incetare in schimb isi vor face aparitia si se vor dezvolta modificarile degenerative osoase. Acuratetea estimarii varstei copiilor sub 3 ani este reprezentata de un interval de 3 4 luni, pentru copii cu varste intre 3 si 15 ani acest interval este de 6 18 luni, intre 15 -25 de ani intervalul este de 1 3 ani, iar pentru varste de 35 40 de ani intervalul este de 5 10 ani.4(p90) Clasificarea varstelor: O clasificare avarstelor in functie de perioadele de dezvoltarea scheletala a fost realizata de Knusmann dupa Martin si Saller citat de Scheuer:64(p469) - Infans 1 sau prima copilarie: de la nastere pana la varsta de 7 ani (eruptia primilor molari permanenti) - Infans 1a de la nastere pana la vrasta de 2 ani - Infans 2b de la 2 la 7 ani - Infans 2 sau a doua copilarie: intre 7 si 14 ani (intre eruptia molarilor unu si doi permanenti) - Juvenis sau varsta juvenila de la eruptia molarilor doi permanenti pana la inchiderea sincondrozei sfeno occipitala (18 22 de ani) - Adultus varsta adulta inceputul inchiderii suturilor. Aceasta clasificare nu este lipsita de critici, in principal datorita faptului ca inceputul varstei adulte este considerata ca va coincide cu inchiderea sincondrozei sfeno-occipitale pe care literatura anatomica de specialitate o plaseaza in perioada de varsta 17 25 de ani ceea ce se pare ca este eronat pentru ca lucrari bazate pe examinare directa a craniilor, cadavrelor, examinare microscopica si radiologica au raportat ca aceasta inchidere are loc in perioada de varsta curpinsa intre 11 si 15 ani (in perioada de eruptie a molarilor doi permanenti).64(p466) Din punct de vedere al antropologiei medico-legale varstele ramasitelor umane sunt incadrate in urmatoarele categorii:52 o Fetus inainte de nastere
978-606-8363-03-5 115

Masterat cercetri criminalistice aplicate

Infant de la nastere la 3 ani Copil intre 3 si 12 ani Adolescent intre 12 si 20 de ani Adult tanar intre 20 si 35 de ani Adult matur intre 35 si 50 de ani Adult varstnic peste 50 de ani O alta clasificare a varstelor mai ampla este:65(p14) Fetus de la conceptie pana la nastere Nou-nascut primele 28 de zile de viata Sugar de la 4 saptamani la 1 an. Copil (juvenil)- intre 1 si 12 ani Adolescent sau puber intre 13 17 ani Adult tanar intre 18 -25 de ani Varsta adulta de mijloc: a) Tanara intre 26 35 de ani b) Tarzie intre 36 45 ani Adult matur peste 46 de ani Adult varstnic peste 80 de ani In literatura anglo saxona termenul non-adult sau sub-adult iar mai recent juvenil include toate categoriile de varsta pana la cea adulta.64(p469) o o o o o o 5.1. Estimarea varstei resturilor scheletale fetale Este de o importanta cruciala cand trebuie determinata viabilitatea produsului de conceptie, in cazurile de pruncucidere sau avort ilegal. Varsta scheletala fetala si a copilului mic se estimeaza prin: momentul aparitiei nucleilor de osificare primari si secundari (epifizari) caracteristicile morfologice ai acestor nuclei (forma si dimensiuni) momentul fuzionarii nucleului secundar cu cel primar de osificare. 64(p6),66 lungimea diafizelor oaselor lungi (lewis 44). Pentru estimarea lungimii fatului se foloseste de regula lungimea femurului. Aceasta se masoara intre suprafata externa a epifizei proximale (marele trohanter) si capatul distal al femurului (neincluzand epifiza distala).67(p324) Cunoscand lungimea femurului se poate determina varsta acestuia aplicand ecuatia liniara de regresie elaborata de Scheuer si colaboratorii.64(p394) Vrsta (sptmni) = (0.3303 x femur) + 13.5583 2.08 Alte ecuatii pentru determinarea varstei iau in considerare talia (lungimea) fatului, aceasta poate fi calculata dupa formula: Lungimea ftului = (lungimea femurului n cm x 6.44) + 4.51(68)

116

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Precizia estimarii lungimii fatului prin aceasta metoda este de +/- 1cm daca este aplicata fatului cu o varsta intrauterina de 36 saptamani. Lungimea fatului va fi folosita in ecuatiile clasice: 1) Balthazard Dervieux.69(p1303) Varsta (zile) = talia x 5.6 2) ecuatia de regresie a lui Olivier si Pineau.70(p149)

Log Varsta = 0.01148 x talia + 0.4258cm

La 3 luni de viata intrauterina oasele lungi sunt tubulare fara insertii musculare, iar sutura metopica si mentala nu sunt fuzionate.

978-606-8363-03-5

117

Masterat cercetri criminalistice aplicate

Lungimea femurului la varste exprimate din 6 an 6 luni (cu exceptia primului an cand varsta este exprimata din 2 in 2 luni.64(p394) La sfarsitul perioadei intrauterine nucleii primari de osificare pot fi identificati in toate oasele iar la nastere doar cativa nuclei de osificare secundari pot fi identificati (cum sunt cei de la nivelul epifizei distale a femurului, epifizei proximale a tibiei si de la nivelul calcaneului si talusului), prezenta acestora avand importanta medico-legala si criminalistica, punand diagnosticul de fat nascut la termen. Nucleul de osificare de la nivelul epifizei distale a femurului a fost descris de Beclard in 1819 se intalneste la 98% din copii nascuti la termen, are o culoare rosietica si un diametru de 4-5 mm.69(p665) Majoritatea nucleilor secundari se dezvolta postnatal.66 Nucleii de osificare apar sub forma unor noduli ososi sferici sau ovoizi cu o structura macroscopica
118 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

amorfa identificabili doar prin pozitia lor anatomica. Utilitatea lor pentru determinarea varstei in cazurile practice medico-legale este destul de limitata depinzand de prezenta tesuturilor moi care sa ii mentina fixati in pozitia anatomica. 5.2. Estimarea varstei resturilor scheletale de subadulti Lungimea oaselor lungi poate fi folosita pentru estimarea varstei la subadulti (vezi tabelul de mai sus). Fontanela anterioara se inchide in primii doi ani iar cea posterioara in primul an postnatal, sutura metopica se inchide de asemenea in primul an dar aceasta inchidere poate fi partiala putand persista un numar de ani astfel incat daca varsta copilului indicata de alte elemente osoase este mai mare de 2 ani, atunci prezenta suturii metopice nu se va lua in considerare ca factor de estimare a varstei. Unirea celor doua jumatati de mandibula are loc in jurul varstei de 1 an.64(147) Fuzionarea epifizo-diafizara care de obicei incepe in cea de a doua decada a vietii este o metoda utila de estimare varstei, principiul se bazeaza pe faptul ca epifizele diferitelor oase fuzioneaza la anumite varste.18(p587) Estimarea trebuie sa tina cont de urmatoarele aspecte: Fuzionarea epifizo-diafizara se face mai devreme cu circa doi ani la sexul feminin fata de cel masculin Examenul radiologic al oaselor trebuie intotdeauna sa insoteasca examenul macroscopic deoarece evidentiaza epifize care nu sunt fuzionate cu diafiza, aspect care uneori nu poate fi determinat prin simpla examinare vizuala. Pot exista variatii importante de fuzionare epifizara in cadrul populatiilor de aceeasi varsta, rasa si sex.

*se citeste 15 ani si 9 luni Varsta (ani) de incepere a fuzionarii epifizo-diafizare, dupa diferiti autori. 39(51)
978-606-8363-03-5 119

Masterat cercetri criminalistice aplicate

*se citeste 19 ani si 2 luni Varsta (ani) de terminare a fuzionarii epifizo-diafizare.39(51) Fuziunea diafizo-epifizara are loc in 3 etape: 1. separarea totala dintre epifiza si metafiza. Suprafata metafizei este bogat vascularizata avand un aspect rugos, granular sau striat. 2. fuzionare partiala, trabecule din metafiza traverseaza cartliajul de crestere care initiaza fuzionarea osoasa cu epifiza, ce devine, cu timpul ferm atasata la metafiza dar inca exista un sant corespunzator periferiei jonctiunii. 3. fuzionare completa intre epifiza si metafiza, cand acel sant dispare complet suprafata osului este neteda, fin granulara Macroscopic, suprafata epifizara a oaselor de subadult apare usor ondulata sau incretita:

Marginea epifizara a vertebrei lombare este incretita. 18(p587)


120 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Fuziunea epifizo-diafizara este completa in proportie de 75% indicand o varsta catre limita superioara data de intervalului de fuzionare epifizo-diafizara humerala.18(p587) In timpul copilariei oasele coxale sunt formate din 3 parti. Ramura ischiopubiana fuzioneaza prima la varste cuprinse intre 5 si 8 ani, osificarea cartilajului triradiat acetabular incepe la fete la varste intre 10-11 ani si e complet la 13-15 iar la baieti este complet la 17 ani.39(p48) De asemenea corpul sternului este format din 4 segmente, segmentele inferioare incep sa fuzioneze la varsta de 4 ani, fuzionarea celor de mijloc la varste intre 11 16 ani, iar cele doua superioare fuzioneaza la varsta de 20 de ani. 39(p48) Sacrul este format pana la varsta de 5 6 ani din 5 vertebre sacrale separate. Elementele laterale fuzioneaza in adolescenta timpurie, iar portiunea centrala fuzioneaza de jos in sus incepand din adolescenta tarzie sau adultul tanar astfel ca fuzionarea vertebrelor sacrale 1 si 2 poate sa se realizeze la varsta de 32 de ani. 39(p48)

978-606-8363-03-5

121

Masterat cercetri criminalistice aplicate

Varstele la care se produce fuzionarea epifizo-diafizara pe sexe.46(p48) 5.3. Estimarea varstei scheletale la adulti Metodele se bazeaza pe: modificarile morfologice in anumite articulatii unde miscarile intre oase sunt limitate sau absente s modificari ale structurii oaselor odata cu inaintarea in varsta A. Obliterarea suturilor craniene. Oasele care alcatuiesc craniul sunt legate prin tesut conjunctiv fibros in articulatii imobile care se numes suturi. Odata cu inaintarea in varsta a individului tesutul de legatura intre oasele craniene se osifica progresiv determinand obliterarea suturilor. Diferentierea craniului de adult de cel de subadult se face pe baza osificarii suturii sfenooccipitale. In copilarie si adolescenta intre aceste doua oase se gaseste un cartilaj cu o latime redusa. Osificarea acestui cartilaj are loc intre 18 -22 de ani (vezi discutia anterioara) transformandu-se intr-o sinostoza sfeno-occiptala.

122

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

. Sincondroza sfeno-occipitala si osificarea sincondrozei sfeno-occipitale.18(585) Osificarea suturilor se face dinspre interior (endocranian) spre exterior (ectocranian). Cele mai multe metode de estimare a varstei prin osificarea suturilor craniene utilizeaza examinarea portiunii ectocraniene astfel incat exista pericolul subestimarii varstei. Chiar si in cazul studierii suturilor endocraniene rezultatele au un grad foarte redus de precizie, se considera ca pe baza acestui criteriu indivizii in grupa de varsta 20 50 se pot incadra in decada de varsta corespunzatoare, la craniile persoanelor mai in varsta variabilitatea criteriului fiind si mai mare. Exemple de intervale de varsta pentru obliteraraea suturilor: 69(p1305) sagitala are loc intre 22 si 35 de ani, sfeno-frontala intre 22 si 65 de ani, parieto-mastoidiana 37 si 81 ani.

Suturile la un craniu de copil si la un craniu de adult tanar.18(p586)

Suturile craniene la un adult matur si la un adult varstnic. 18(p586) B. Estimarea varstei pe baza examinarii fetei simfizare a oaselor pubiene Osul pubian stang si drept sunt legate intre ele pe linia mediana printr-un disc fibro-cartilaginos formand o articulatie ce poarta denumirea de simfiza
978-606-8363-03-5 123

Masterat cercetri criminalistice aplicate

pubiana. Configuratia suprafetelor osoase care intra in alcatuirea simfizei pubiene prezinta modificari care au loc odata cu inaintarea in varsta:46(p53) La tanar suprafata simfizara a fiecarui os pubian prezinta creste si santuri La adult santurile devin mai putin adanci si crestele mai putin proeminente iar o margine osoasa se formeaza in jurul suprafetei La adultul varstnic disparea marginea osoasa iar suprafata simfizara devine poroasa cu granulatii fine si porozitati.

Suprafata simfizara: dreapta la un individ de 18 19 ani si stanga la un individ 50+ ani.18(p583) Probleme de interpretare a suprafetei simfizare in raport cu varsta apar la femei unde nasterea pe cale naturala produce santuri neregulate astfel incat in vederea estimarii varstei standardele masculine ale aspectului macroscopic al acestor suprafete nu pot fi aplicate la femei si viceversa. C. Estimarea varstei prin examinarea extremitatii sternale a coastelor, metoda descrisa de Iscan si colaboratorii.71,72 Intial suprafata acesteia este relativ plana dar cu inaintarea in varsta aceasta se va adanci fiind strajuita de o margine care devine din ce in ce mai neregulata. D. Estimarea varstei prin examinarea fetei auriculare a osului iliac - metoda elaborata de Lovejoy.73 Fata auriculara a sacrului se articuleaza cu fata auriculara a a coxalului formand articulatia sacro-iliaca. La adultii tineri suprafata auriculara este granulara cu inaintarea in varsta devenind progesiv mai neteda. La adultul varstnic suprafata devine poroasa fiind inconjurata de o creasta osoasa. E. Examenul microscopic al sectiunilor facute prin diafiza oaselor lungi. Pe aceste preparate microscopice se observa numarul de osteoane si fragmentele de osteoane. Datorita permanentei remodelari a microstructurii osoase, tesutul osos imbatranit este partial resorbit si inlocuit de noi osteoane care au o dispozitie modificata. Odata cu inaintarea in varsta numarul de osteoane creste la fel ca si numarul de fragmente de osteoane (care sunt ramasite ale osteoanelor remodelate). F. Estimarea varstei prin intermediul modificarilor degenerative osoase. La tineri suprafetele articulare ale oaselor sunt rotunjite, netede. La persoanele adulte apar osteofitele pe marginile vertebrelor si la locul unde se insera tendoanele sau ligamentele. De asemenea varsta inaintata este caracterizata de resorbtia tesutului
124 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

osos spongios din toate oasele scheletului. Osteoporoza senila (reducerea densitatii minerale a osului) este evidenta la nivelul epifizei proximale a femurului, vertebrelor. 6. Estimarea taliei ramasitelor scheletale Pentru aceasta trerbuie ca anumite elemente osoase sa fie masurate cu ajutorul plansei osteometrice. Daca osul este intreg, masuratorile trebuie sa fie cat mai precise prin masurarea intregii lungimi a osului respectiv, exceptie de la aceasta regula fiind tibia unde lungimea se determina intre portiunea mediala a platoului tibial si fata inferioara articulara (excluzand maleola mediala). Talia persoanei corespunzatoare lungimii osului gasit va fi aflata din tabele in care se reda corespondenta dintre lungimea oaselor examinate si talie. Aceste tabele sunt rezultatul aplicarii unor ecuatii matematice pe un numar mare de masuratori osoase. Tabelele dau numai o valoare medie a taliei astfel incat in cazurile practice estimarea taliei va fi sub forma unui interval dimensional si nu a unei dimensiuni exacte. Pentru o estimare optima a taliei trebuie sa se tina cont de varsta si sexul ramasitelor scheletale. De asemenea estimarea taliei pe baza oaselor lungi ale membrelor inferioare este mai buna decat cea pe baza oaselor lungi ale membrelor superioare. Talia se poate estima cu o acuratete foarte scazuta pe baza unor ecuatii matematice si pe fragmente sau pe portiuni specifice ale oaselor lungi. I. Masurarea directa a taliei scheletului in situ Este cel mai elementar mod de estimare a staturii, Se poate aplica numai scheletelor in extensie completa, avand craniul si osele membrelor inferioare intacte si in pozitie anatomica (trebuie avut in vedere ca datorita presiunii exercitate de sol oasele se pot fragmenta iar in urma procesului de descompunere oasele se pot imprastia, mai ales in cazul cadavrelor inhumate in cosciug). Masuratorile se fac inainte de ridicarea scheletului, talia determinandu-se prin masurarea scheletul din vertex pana la nivelul planului picioarelor (plantelor). Datorita disparitiei tesuturilor moi epicraniene si calcaneene, a discurilor intervertebrale si cartilajelor articulare, pentru estimarea taliei individului viu trebuie adaugati 4 -8 cm dupa Knight3(p114) sau 4-6 cm dupa Calabuig.69(p1306) II. Estimarea taliei pe schelete incomplete, cand pot exista unul sau mai multe oase. Oasele pe baza carora se estimeaza talia sunt, in ordinea preciziei estimarilor taliei: femur, tibia, humerus si radius.3(p114) Au fost elaborate numeroase formule pentru estimarea taliei pe baza lungimii oaselor mentionate.

978-606-8363-03-5

125

Masterat cercetri criminalistice aplicate

Formule pentru determinarea taliei.18(p590)

Talia estimata in functie de lungimea principalelor oase lungi.3(p113) Estimarile trebuie sa aiba in vedere ca oasele vechi si uscate sau cele supuse actiunii focului sunt mai scurte cu circa 2 mm decat oasele vitale.3(p114) De asemenea trebuie tinut cont ca factorii rasiali si nutritionali induc variatii semnificative ale taliei. Odata cu inaintarea in varsta, datorita modificarilor tesutului osos si moale exista o scadere a taliei. Tinand cont ca aceste modificari insotite de scadere in inaltime au loc mai ales la nivelul coloanei vertebrale, talia estimata pe baza lungimii oaselor lungi vor da rezultate eronate daca nu se aplica corectiile necesare. Giles citat de Klepinger39(p85) a aratat ca folosirea corectiilor aduse taliei nu este necesara la varste sub 50 de ani, la indivizii peste aceasta varsta din talia maxima estimata se va scadea corectia in centimetrii prezentata in tabelul urmator:
126 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Varsta Barbati Femei 50 0.4 0 55 0.7 0.3 60 1.2 0.7 65 1.6 1.3 70 2.2 2.0 75 2.9 2.9 80 3.6 3.8 85 4.3 4.9 Centimetrii care trebuie sa fie scazuti din talia estimata la diferite varste. 39(p85) 7. Estimarea rasei Prin rasa se intelege o populatie umana mai mult sau mai putin distincta prin caracteristici fizice transmise genetic. Din punct de vedere medico-legal rasele sunt de trei feluri: caucazoida, negroida si mongoloida. Cel mai bun element osos in estimarea rasei este craniul si in special regiunea mediofaciala. Caracteristicile craniului caucazoid: o aperturi nazale inguste, cu margini inferioare ascutite, o oase nazale si spina nazala, glabela si regiuni supraorbitale proeminente, o pometi mai putin proeminenti. Caracteristicile craniului de negroid: o distanta mare interorbitala, o orbite rectangulare, o apertura nazala larga, o pronuntat prognatism al regiunii inferioare a viscerocraniului. Caracteristicile craniului de mongoloid: o oase nazale inguste si concave, o pometi proeminenti, o orbite circulare, o incisivi in forma de lopata. Caracteristice morfologice ale craniului la cele trei rase sunt grupate in urmatorul tabel:4(p83) Caucazoid Mongoloid Negroid Lungimea redusa pronuntata pronuntata craniului Latimea craniului pronuntata pronuntata redusa Inaltimea craniului pronuntata medie joasa Conturul boltei Arcuita Arcuita Aplatizata Latimea fetei Pronuntata Foarte redusa pronuntata Inaltimea fetei Pronuntata Pronuntata redusa Forma orbitelor Rotunjita Rotunjita Rectangulara Apertura nazala Latime moderata Ingusta Foarte lata Oasele nazale Inguste, arcuite Late, aplatizate Inguste
978-606-8363-03-5 127

Masterat cercetri criminalistice aplicate

Marginea nazala inferioara Profilul facial Forma palatului Incisivi in forma de lopata Forma generala

Ascutita Drept Latime moderata La mai putin de 5% din indivizi Rotund, voluminos, cu moderate rugozitati

Ascutita Drept Latime moderata la peste 90% din indivizi Neted, voluminos

In forma de jgheab Inclinat inspre partea inferioara Forma literei U La mai putin de 5% din indivizi Elongat, neted

Craniu caucazoid.18(p573)

Craniu mongoloid. 18(p574)

Craniu negroid si jgheabul marginii inferioare a aperturii nazale. 18(p576)


128 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Utilizarea oaselor lungi in estimarea rasei este mai limitata, se folosesc: indexul brahial (lungimea radiusului X 100/lungimea humerusului) indexul crural (lungimea tibiei X 100/lungimea femurului). Aceste indexuri, luate separat, nu au valoare diagnostica de rasa ci ele trebuie interpretate in corobarare cu alte elemente. Caracteristici non-metrice ale oaselor care sugereaza aparteneta de rasa:45(p101) femurul este mai drept la rasa neagra, curba antero-posterioara fiind mai putin pronuntata oasele membrelor inferioare ale negroizilor sunt mai lungi decat ale caucazienilor sau mongoloizilor; chiar si in cazul lungimii totale a corpului, proportia membrelor inferioare este mai mare; radiusul si tibia sunt relativ mai lungi la negroizi decat la celelalte doua rase. Determinarea rasei la sub-adulti este unul din cele mai dificile si controversate subiecte ale antropologiei medico-legale deoarece multe din caracteristicile diferentierii rasiale devin aparente in adolescenta tarzie. 8. Datarea ramasitelor osoase Atunci cand se gasesc ramasite scheletale un obiectiv important al expertizei pe langa identificarea ramasitelor si a prezentei de leziuni perimortem este estimarea timpului postmortal sau de inhumare. Pentru cazurile medico-legale stabilirea limitei 20 de ani a intervalului postmortal este important din punct de vedere juridic (ART. 162 din noul Cod Penal: termenul de prescriptie a executarii pedepsei pentru persoana fizica este de 20 de ani, cnd pedeapsa care urmeaza a fi executata este detentiunea pe viata sau inchisoarea mai mare de 15 ani). Ramasitele osoase care depasesc aceasta limita de inhumare sunt de interes istoric sau arheologic. Perioada de inhumare este reprezentata de timpul dintre momentul inhumarii cadavrului si momentul descoperirii ramasitelor cadaverice. In majoritatea cazurilor, circumstantele in care sunt gasite ramasitele scheletale, localizarea lor cat si prezenta unor obiecte pot da indicatii cu privire la perioada cand cadavrul a fost inhumat. Prin consultarea unor harti vechi sau documente oficiale se poate identifica prezenta unui fost cimitir pe locul unde s-au gasit ramasitele osoase. Criterii pe baza carora se poate stabili prezenta unui cimitir: orientarea si alinierea ramasitelor scheletale dezgropate, prezenta de fragmente metalice din strucutra cosciugului sau obiecte personale. De asemenea fragmentele de imbracaminte, ziare, documente, monezi, containere din plastic gasite impreuna cu ramasitele osoase pot ajuta la estimarea intervalului de inhumare. Estimarea timpului de inhumare la cadavrele nescheletizate se face pe baza modificarilor tisulare ce au loc in cadrul proceselor distructive postmortale (discutate in capitolul anterior). In cazul ramasitelor scheletizate estimarea timpului de inhumare trebuie sa aiba in vedere mai multi factori.
978-606-8363-03-5 129

Masterat cercetri criminalistice aplicate

Unul din cele mai importante elemente este felul solului in care cadavrul este inhumat:74(p551) Tipul de sol Gradul de conservare al oaselor Loess (sol poros, contine nisip fin si Conservare buna, oase intregi praf argilos) wiki Sol namolos Saparea dificila, oasele au consistenta scazuta Sol pietros Oase dispersate sau distrusse de roci Sol ce contine calcita (carbonat de Oasele sunt foarte fragile, friabile si moi calciu) - kastanoziom Sol ce contine minerale si oxid de calciu Conservare buna a oaselor, fosilizarea oaselor daca exista suficient fier si magneziu Sol mlastinos, turba Decalcifiere rapida a oaselor cu conservarea structurii organice, conservarea morfologiei si a taliei Sol acidic Conservarea oaselor practic inexistenta insotita de disparitia lor totala Sol nisipos calcar Conservare buna, fosilizare accentuata Sol nisipos uscat Conservare buna, mumificarea cadavrului Oasele iluminate cu o lampa cu ultraviolete vor prezenta o florescenta albastruie a suprafetei de sectiune in functie de vechimea lor, astfel odata cu trecerea timpului florescenta dispare dinspre exterior concentrandu-se in jurul canalul medular:45(p103)

Fluorescenta in lumina UV a sectiunii transversale a unui femur cu varsta postmortala de 5 ani (stanga) si cu o varsta postmortala de 50 de ani (dreapta).59(2091) (a) timp de cateva decade dupa moarte, intreaga suprafata de sectiune are o fluorescenta uniforma (b) intre 3-80 ani, depinzind in foarte mare masura de conditiile mediului in care se face inhumarea, zona externa a osului si zona din jurul canalului medular incep sasi piarda progresiv fluorescenta
130 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

(c) dupa aproximativ o suta de ani, fluorescenta reziduala se concentreaza intr-un mic inel in centrul substantei osoase, care va disparea in cele din urma cu totul.45(p103) Proteine umane identificabile Prezenta de lipide in spongioasa Tesuturi moi inca vizibile Adipoceara in canalul medular Reactia cu benzidina pozitiva Continut organic medular Azot total 3,5 mg% + 7 AA identificabili Fluorecenta in ultraviolet Rezistenta (se fragmenteaza greu) Vechime (ani) +++ + +++ + +++ ++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ 0-5

+ + + +++ +++ +++

+/-

+ + +++ +/+++

+++

5102050-100 10020010 20 50 200 500 Tabel cu modificarile strucuturale, fizico-chimice si serologice ale oaselor in functie de perioada de inhumare.45(p104)

Determinarea pe baze odontologice a timpului de inhumare este prezentata in cursul de odontologie medico-legala 8. Identificarea persoanei dupa ramasitele scheletale si a probelor materiale asociate Dupa estimarea rasei, sexului, taliei si varstei, pe materialul osos un alt obiectiv al expertizei medico-legale antropologice este gasirea unor elemente pe baza carora sa se poata face identificarea individului. Aceste elemente sunt: modificari scheletale sub forma calusurilor post fractura, modificari patologice anomaliilor congenitale osoase, prezentei unor implanturi chirurgicale de genul suruburilor, tijelor, placilor, protezelor. Pentru a fi utile identificarii aceste elemente trebuie sa fi fost documentate medical (de obicei radiologic) in timpul vietii, aceasta documentatie medicala va fi comparata cu ce cea postmortem in vederea confirmarii sau infirmarii identitatii.

978-606-8363-03-5

131

Masterat cercetri criminalistice aplicate

Radiografia postmortem prezentand calus la nivelul tibiei si fibulei (stanga) si radiografie antemortem prezentand modificare identica (dreapta).18(p561) De asemenea afectiuni care modifica strucutura si morfologia osul si care au fost documentate in timpul vietii pot ajuta la identificarea individului, de exemplu infectiile osoase, tuberculoza, scorbutul produc anomalii osoase care sunt caracteristice fiecarui individ afectat. Unele implanturi chirugicale sau ortopedice au un cod care poate fi regasit in fisa medicala a persoanei:

Proteza de sold la un cadavru, care prezinta un cod regasit in fisa medicala. 18(p561 Pe baza compararii conformatiei radiografice a sinusurilor frontale efectuate antemortem si postmortem se poate stabili identitatea cu o certitudine similara celei facute pe baza amprentelor digitale, fiind unice pentru fiecare individ chiar si pentru gemenii homozigoti.75(p373)

In stanga radiografia postmortem in dreapta radiografia antemortem. Se observa forma identica a sinusurilor frontale. 75(p374)
132 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Cand alte metode de identificare individuala nu au dat rezultate concludente atunci se poate incerca suprapunerea fotografica: este nevoie de o fotografie antemortem, de preferabil zambind, a persoanei a carei identitate trebuie confirmata. se fotografiaza craniul din acelasi unghi din care este facuta fotografia. in urmatoarea etapa cu ajutorul programelor de calculator se vor suprapune cele doua imagini prin intermediul reperelor anatomice importante: nasionul, marginile supraorbitare, unghiul manibular, apertura nazala, meatul auditiv extern si mai ales dinti.45(p104) Aceeasi metoda se poate aplica si la suprapunerea radiografiilor de craniu antemortem peste cele postmortem. Reconstructia craniofaciala Este metoda de identificare prin care se recreeaza infatisarea individului pornind de la suportul cranian peste care, in cazul metodei traditionale, tinand cont de grosimea medie a tesuturilor moi faciale expertul aseaza si modeleaza materialul de umplutura conturand astfel faciesul individului. Este o metoda dificila care necesita foarte mult timp, talent artistic din partea expertului iar rezultatele sunt destul de modeste, rata de succes fiind in jur de 50% (mai ales datorita dificulatiilor determinante in cunoasterea grosimii tesutului subcutanat la persoana vie sau a caracteristicilor ochilor, nasului si buzelor). O alta metoda moderna se bazeaza sistemele grafice computerizate. Principiul metodei: craniul este scanat tridimensional, imaginea 3D este transferata intr-un computer unde ruleaza un program special ce permite unui instrument haptic (haptic provine din greceste si se refera la simtul atingerii) sa aiba acces tridimensional la imaginea craniului stocata in computer peste care adauga digital tesut moale in proportii regasite in baze de date antropologice. Avantajele metodei: este rapida, usor de utilizat si eficienta in generarea mai multor variante ale faciesului individului crescand astfel considerabil rata de succes a identificarii prin aceea ca una din multiplele variantele generate va aproxima foarte bine infatisarea individului facilitand astfel recunoasterea sa vizuala de catre rude, prieteni, etc.

Instrument haptic76
978-606-8363-03-5 133

Masterat cercetri criminalistice aplicate

Rezultatul scanarii craniului: imagine digitala 3D. Sagetile prezinta punctele craniene importante pentru adaugarea digitala a stratului de tesut moale.77

Reconstructie cranio-faciala digitala 3D.78 Articolele de vestimentatie Pot fi mai mult sau mai putin intregi si in diferite stari de degradare. Se pot gasi la locul unde sunt descoperite cadavre in stare avansata de descompunere sau scheleteizate. Acestea reprezinta probe circumstantiale care coroborate cu metodele antropologice descrise anterior por contribui la indentificarea individului. Imbracamintea persoanei neidentificate poate fi recunoscuta de rude sau prieteni. De cele mai multe ori producatorul este specificat pe etichete atasate articolelor de imbracaminte, iar acesta pe baza modelului poate indica interval de timp cand acesta a fost produs. Nasturii si fermoarele pot fi folosite de asemenea pentru aflarea perioadei de timp in care acestea au fost produse. Imbracamintea are un rol important si in stabilirea cauzei si mecanismului mortii, mai ales la ramasitele umane scheletizate cand leziunile tesuturilor moi se pot deduce in mod indirect prin examinarea distrugerile imbracamintii. De exemplu, leziunile prin injunghiere se pot deduce prin prezenta orificiilor caracteristice in imbracaminte, inconjurate de pete de sange. 9. Leziuni traumtice osoase Oasele pot fi afectate printr-o multitudine de agenti traumatici mecanici a caror clasificare este urmatoarea: 1. Corpuri contondente - in functie de marimea suprafetei de contact, se impart in: - obiecte contondente cu suprafata mica (sub 16cm2)
134 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

- obiecte contondente cu suprafata mare (peste 16cm2) - in functie de suprafata, se impart in: - obiecte contondente cu suprafata neregulata - obiecte contondente cu suprafete plane si muchii drepte 2. Obiecte cu virfuri sau lame ascutite a. Obiecte intepatoare - cuie, andrele b. Obiecte taietoare - brice, lame de ras c. Obiecte taietoare-intepatoare - cutite d. Obiecte taietoare-despicatoare - topoare, securi, satire 3. Proiectile se caracterizeaza prin viteza foarte mare (mai mult de 50 m/s) Tipuri de mecanism de actiune - lovire activa (lovirea victimei cu un corp dur) - lovire pasiva (lovire victimei de un corp sau plan dur) - comprimare intre 2 planuri dure - mecanisme complexe (lovire activa si pasiva: lovire cu si de corpuri planuri/dure) I. Leziuni osoase produse prin lovirea cu/de obiecte contondente Fracturile osoase sunt rezultatul aplicarii unei forte intr-un anumit mod sau intensitate incat depaseste rezistenta elastica a osului producand intreruperea continuitatii acestuia. Atfel ca producerea fracturilor si caracteristicile lor depind de energia cinetica a obiectului vulnerant (care la randul ei este functie de masa si viteza obiectului), forma obiectului, eventualele afectiuni patologice ale osului care il fac mai fragil. Aspectul fracturilor este important atat din punct de vedere medico-legal cat si criminalistic deoarece permite stabilirea mecanismului de producere.2(p425) Clasificarile fracturilor oaselor lungi A. Din punct de vedere al mecanismului de producere, fracturile pot fi clasificate in: directe - fractura osului apare la locul de impact Prin indoire se produce o fractura transversala sau prin strivire intre dou planuri dure se produce o fractura cominutiva. Oasele afectate cel mai des prin acest mecanism sunt cele situate superficial sub tegument: - diafiza ulnara in cadrul reflexului de aparare - diafiza tibiala in cadrul activitatilor sportive, acciente rutiere - fractura claviculara prin lovire cu corp contondent indirecte, cnd fractura apare la distant fata de locul de impact al agentului traumatic. Acest loc se numeste punctul slab al osului si difera de la un element osos la altul. - inflexiunea - indoirea diafizei prin aplicarea fortelor la nivelul epifizelor producand fractura transversala diafizara; - torsiunea, determinnd fracturi spiroide; - tractiune sau smulgere, cnd se produc fracturi parcelare prin tractiunea puternica pe os produsa de un tendon sau ligament.

978-606-8363-03-5

135

Masterat cercetri criminalistice aplicate

compresiunea presupune o comprimare axial in ambele extremitti ale osului. In practica fracturile se produc prin asociere de forte: compresiunea cu inflexiune, care determina o fractura partial transversala avnd asociat un fragment separat, in aripa de fluture cat si fractura cominutiva; combinatie de: torsiune, inflexiune i compresiune, care determina o fractura cu traiect oblic sau oblic si spiroid.

Fracturi produse prin asocierea asocierea fortelor de compresiune i inflexiune compresiune 1, 2 fractura in aripa de fluture; 3 comminutiva spiriod.
25(p76)

Fracturi produse prin fortelor de torsiune, i inflexiune 1 traiect oblic 2 traiect

oblic

B. In functie de sediul fracturii: epifizare, diafizoepifizare, diafizare intra-articulare C. In functie de aspectul morfologic fracturile pot fi: fracturi incomplete: -inflexiuni osoase diafizare la copii -infundarea mai ales la oasele late -fracturi in lemn verde (la copii) -fisuri - cu pstrarea formei osului -rupturi trabeculare fracturi complete: -simple: - transversale
136 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

- oblice - in vrf de clarinet - spiroide - in form de T, V, N, fluture -multiple -cominutive -orificiale (de obicei la oasele late)

Tipuri de fracturi: a) transversala, b) spiroida, c) oblica, d) cominutiva, e) prin comprimare, f) in lemn verde. 53(p238) C. in functie de de osul afectat: fracturi ale oaselor sanatoase - cele mai frecvente (prezentate anterior) fracturi de oboseala - datorate unor solicitari mecanice repetate ale oaselor cu o intensitate la limita superioara a elasticitatii osului; oasele cel mai des afectate: tibia, fibula si oasele metatarsiene. Apar in special la atleti, dansatori sau militari care efectueaza maruri lungi fracturi pe os patologice - in care fortele ce actioneaza asupra osului sunt normale dar rezistenta mecanica a sa este mult slabita datorita unor afectiuni patologice (osteoporoza, tumori). Fracturile craniene pot fi:79(pp85,86) Directe: fracturi ale boltei craniene a caror morfologie este in functie de suprafata agentului vulnerant: a) suprafata sub 4cm2 - apare fractura infundata, cu margini regulate si cu contur asemanator cu cel al obiectului contondent (stantare) b) suprafata de 4-16cm2 - se produce fractura cominutiva infundata cu citeva iradieri, nu se mai poate determina forma suprafetei de impact a obiectului
978-606-8363-03-5 137

Masterat cercetri criminalistice aplicate

c) suprafata mai mare de 16cm2 - apar fracturi liniare lungi, ecuatoriale sa meridionale

a)

b) Fracturi directe ale boltei craniului.45(p85)

c)

fracturi ale bazei craniului - pot fi: - nemediate, situate la locul de actiune al agentului vulnerant (impuscarea in gura) - mediate, situate la distanta de locul actiunii agentului vulnerant forta transmitandu-se printr-un element osos, de exemplu: in lovirea submandibulara se produce fractura de baza de craniu sau in cazul caderilor in picioare sau ischioane, daca membrele sau coloana vertebrala nu cedeaza, se produce o fractura circulara in jurul gaurii mari a occipitalului prin infundare a coloanei cervicale la acest nivel (fractura prin telescopare) Indirecte sunt cauzate de iradierea liniei de fractura, de obicei pe directii paralele cu axul de compresiune la nivelul bazei craniului, iradierea respecta zonele cu rezistenta crescuta (stancile temporale, aripile mari ale sfenoidului) in compresiunile bipolare, liniile de iradiere trec dintr-o parte in cealalta a craniului in cazul impuscarii cu teava lipita se produce "explozia" cutiei craniene datorita undei de soc si patrunderii gazelor de ardere. Fractura hioidului Hioidul este un os un os nepereche de dimensiuni mici in forma de potcoava, aezat in partea anterioara i superioara a gtului. Fractura lui se poate produce in lovirile cu obiect contondent sau prin comprimarea gatului (spanzurare, strangulare sau sugrumare). II. Leziuni osoase produse prin obiecte taietoare intepatoare si despicatoare In cazul ramasitelor umane in stare avansata de putrefactie sau scheletizate, examinarea in vederea identificarii si descrierii leziunilor produse prin obiecte
138 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

taietoare intepatoare este cruciala deoarece este cel mai adesea singura modalitate de a stabili cauza si mecanismul de producere a mortii cat si pentru obtinerea unor date de importanta criminalsitica. Leziunile osoase pot furniza detalii despre obiectul care le-a produs, stiind ca urmele lasate in os de catre obiectele taietoareintepatoare sunt mai reprezentative din punct de vedere dimensional decat leziunile la nivelul tegumentului sau tesuturilor moi. Obiectele despicatoare (topor, maceta sau chiar elicea unei ambarcatiuni) actioneaza atat prin greutatea lor mare cat si prin lama ascutita producand distrugeri osoase masive, cu fracturi cominutive sau dezmembrare. III. Leziuni osoase produse prin arme de foc La locul de intrare in os proiectilul creeaza o lipsa de substanta osoasa relativ circulara sau ovalara (in functie de directia de tragere) la locul de iesire din os diametrul orificiului va fi mai mare, formandu-se un trunchi de con cu baza mica la nivelul intrarii in os si baza mare la nivelul iesirii din os. Acest fenomen se intalneste in special la nivelul oaselor plate (craniu, coxal). In cazul oselor lungi se produce o fragmentare a osului pe o zona mult mai mare decat calibrul proiectilului. Succesiunea impuscarilor in cazul oaselor plane (craniu, coxal, scapula) se stabileste astfel: de la nivelul primului orificu de impuscare iradiaza traiecte de fractura iar traiectele liniilor de fractura produse de impuscarile ulterioare se vor opri in primele.

Orificiu de iesire al glontului.18(595)

978-606-8363-03-5

139

Masterat cercetri criminalistice aplicate

EXEMPLU DE RAPORT DE EXPERTIZA MEDICO-LEGALA ANTROPOLOGICA


Rezolutia mottivata .. Dispun: Efectuarea in cauza a unei expertize medico-legale Constatarea tehnico-stiintifica va fi efectuata de catre specialisti din cadrul ....................... Specialistii vor raspunde la urmatoarele intrebari: 1. Care este natura si cauza mortii 2. Identificarea traumatismelor osoase produse antemortem si perimortem 3. Care este data de instalare a decesului. Pentru efectuarea constatarii, specialistii vor lua cunostinta de urmatoarele materiale osoase apartinand numitului.., ambalate in colet nr.1 si sigilat cu sigiliu MAI nr.. Scurt istoric: La data de ...... am fost sesizati de catre numitul IA despre faptul ca un angajat al sau a disparut din incinta fermei unde locuia si lucra. Din verificari am stabilit ca persoana disparuta era bolnav sub tratament, cunoscut cu multe afectiuni, printre care si cardio-vasculare. Identificarea persoanei a fost facuta pe baza recunoasterii obiectelor de imbracaminte si a unor chei care, prin experiment judiciar s-a constatat ca apartin yalelor de la usile locuintei persoanei disparute.

140

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

LABORATOR ANTROPOLOGIE164 Catre,..................... La adresa dvs. nr. ........ si rezolutia motivata nr. ...... din ......., va inaintam raportul de expertiza medico-legala antropologica asupra fragmentelor osoase gasite la data de........... pe raza comunei ............., judetul.............. Taxa de expertiza in valoare de ........ RON a fost achitata de catre............ RAPORT DE EXPERTIZA MEDICO-LEGALA ANTROPOLOGICA Avand in vedere adresa nr...........si rezolutia nr. ......... din ........... a IPJ ..........., prin care solicitati efectuarea unei expertize medico-legale antropologice asupra fragmentelor osoase descoperite pe raza comunei ......... judetul ............, la data de ........, am procedat azi, .......... la examinarea materialului osos inaintat, constatand urmatoarele: Obiectivele expertizei: stabilite in rezolutia motivata sus - mentionata sunt: daca fragmentele osoase sunt de natura umana; in masura posibilitatilor se va stabili varsta aproximativa la care a survenit decesul, cauza mortii, precum si date antropologice si sex. Istoric: Din rezolutia motivata sus-menfionata si din procesul verbal de cercetare la fata locului reiese ca piesele scheletice au fost descoperite la data de ......... pe raza comunei ............., judetul ..........., cu ocazia efectuarii unor lucrari de excavare in curtea imobilului numitului XX. Oasele, lipsite de parti moi, extrem de friabile, erau ingropate la o adancime de 0,5 m . Constatari: Materialul osos examinat este de culoare galbuie, nu prezinta parti moi, este acoperit pe alocuri de pamant uscat si prezinta un grad accentual de fragmentare si porozitate. Dupa caracteristicile morfologice, el poate fi grupat in doua seturi: A. Piese osoase provenind de la scheletul unui barbat Ele sunt reprezentate de: vertebra atlas; 4 fragmente costale, intens erodate, cu marginile zonei de intrerupere a continuitatii osoase de culoare albicioasa (artefact de exhumare); 4/5 distale ale humerusului stang, avand circumferinta la nivelul tuberozitatii deltoidiene de 6,5 cm; proeminentele pentru insertiile musculare bine reprezentate; marginile zonei de intrerupere a continuitatii osoase sunt neregulate, albicioase; 2/3 proximale ale ulnei stangi, avand proeminentele pentru insertiile musculare bine reprezentate; la jumatatea diafizei prezinta un calus voluminos, cu usoara angulare a fragmentelor (post-fractura veche, consolidate vicios); 2/3 distale ale diafizei radiusului stang, cu proeminentele pentru insertiile
978-606-8363-03-5 141

Masterat cercetri criminalistice aplicate

musculare bine reprezentate si cu marginile zonei de intrerupere a continuitatii osoase neregulate, de culoare albicioasa (aspect datorat manevrelor improprii de exhumare); 2/3 anterioare ale aripii iliace, provenind de la un os coxal stang; proeminentele pentru insertiile musculare sunt bine reprezentate; 4 fragmente care reconstituie cea mai mare parte a femurului stang (lipseste o parte din epifiza proximala); circumferinta la jumatatea diafizei = 8,8 cm; proeminentele pentru insertiile musculare sunt bine reprezentate; cea mai mare parte a doua tibii perechi (dreapta, stanga), avand proeminentele pentru insertiile musculare bine reprezentate; din ambele oase lipsesc epifizele distale; epifiza proximala a tibiei stangi este reconstituita aproape in totalitate din trei fragmente; tibia dreapta prezinta in 1/3 proximala a diafizei (pe fata antero-mediala) o lipsa de substanta osoasa, de 4/2,8 cm, cu axul mare vertical, lasand sa se vada canalul medular; zona restanta prezinta margin! neregulate, albicioase (aspect datorat manevrelor improprii de exhumare); cea mai mare parte a diafizelor provenind de la doua fibule perechi (dreapta, stanga), cu proeminentele pentru insertiile musculare bine reprezentate; un cartilaj tiroid osificat; un craniu, cu mandibula detasata, ambele fara leziuni traumatice sau de alta natura; Caracteristici antropometrice ale craniului: diametral longitudinal = 18,8 cm; latimea maxima a craniului = 14,7 cm, circumferinta = 54,5 cm; latimea orbitei stangi = 4,1 cm; malfimea nasului = 5,2 cm; lungimea gaurii occipitale = 3,4 cm; diametrul bimastoidian =10,7 cm; diametrul bizigomatic = 13,5cm; Caracteristici antroposcopice ale craniului: proeminentele pentru insertiile musculare bine reprezentate; vertex aplatizat, glabela si arcadele sprancenoase proeminente; fruntea Tnclinata, cu unghiul nazo-frontal adanc; orbitele patrulatere, cu unghiurile rotunjite; fosa lacrimala si tavanul orbitei adanci; procesele mastoide voluminoase; bolta palatina lata si adanca; sutura coronala obliterata, sutura sagitala obliterata partial (la nivelul oblionului si bregma), suturile scumoase, usor dehiscente;
142 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

In alveolele arcadei dentare superioare sunt prezenti dintii: 1 1 , 12, 13, 14, 15,18 (cu carie pe fata bucala), 22, 23, 24, 25, 26, 27 si 28; dintii sunt mobili, cu abraziune accentuata; alveolele corespunzatoare dintilor 16 si 17 sunt inchise prin punti osoase (edentatie veche); alveola pentru dintele 21 este goala, cu margini ascutite (ceea ce denota caderea postmortem a acestuia); mandibula, tara leziuni traumatice, cu gonionul = 130; fata articulara a procesului condilar este congruenta cu fosa condiliana a craniului; proeminentele pentru insertiile musculare sunt bine reprezentate; in alveole sunt prezenti dintii: 32, 33, 34, 35, 38, 41 (cu depozit de tartru), 42, 43, 44, 45, 46, 47, 48; dintii sunt mobili, cu abraziune accentuata; alveolele corespunzatoare lui 36 si 37 sunt goale, cu margini ascutite (caderea postmortem a dintilor). B. Piese osoase provenind de la scheletul unei femei Ele constau din: doua fragmente care reconstituie cea mai mare parte a humerusului drept (lipseste epifiza distala); circumferinta la nivelul tuberozitatii deltoidiene = 6 cm; fragment (cu lungimea = 10 cm) provenind de la o ulna stanga; fragment diafizar, apartinand radiusului stang; cea mai mare parte a femurului drept (lipsesc trohanterul mare si partea rnediala a condilului medial); lungimea osului = 44,lcm; circumferinta la jumatatea diafizei = 8 cm; 10 fragmente craniene, intre care 6 reconstituie integral calota craniana (os frontal, ambele parietale, occipital, ambele temporale), iar 4 fragmente apartin bazei craniului; oasele componente ale boltii se afronteaza perfect la nivelul suturilor (ceea ce denota ca s-au detasat prin dehiscenta acestora, datorita sederii indelungate in sol); dupa reasamblare. Circumferinta craniana = 50,5 cm; latimea orbitei stangi = 3,9 cm; marginea superioara a orbitelor este ascutita, fruntea verticala, glabela putin proeminenta; la nivelul fetei endocraniene a craniului, se evidentiaza resturi vegetale filiforme, aderente, uscate, dintre care unele strabat oriflciile naturale ale acestuia (radacini de plante); un fragment de mandibula, constituit din 1/3 laterala a hemimandibulei stangi avand lipsa ramura; zona de intrerupere a continuitatii osoase este taiata piezis, cu margini regulate, albicioase (aspect datorat manevrelor improprii de exhumare); dintele 37 este prezent in alveola, cu mobilitate si abraziune accentuata; alveolele corespunzatoare dintilor 36 si 38 sunt inchise prin punti osoase (edentatie veche). Concluzii: fragmentele osoase examinate sunt de origine umana;
978-606-8363-03-5 143

Masterat cercetri criminalistice aplicate

ele provin de la scheletele a doua persoane: una de sex masculin (setul A de oase) si una de sex feminin (setul B de oase); s-a putut determina numai talia acesteia din urma (prin masurarea unui singur os: femurul drept) = 1,66-1,67 m; pe baza examenului odontostomatologic si a examinarii craniului si a fragmentelor craniene, se poate concluziona ca ambele persoane aveau varsta de aproximativ 40-50 de ani; materialul osos expertizat nu prezinta leziuni traumatice sau de alta natura, astfel incat nu se pot face aprecieri asupra felului si cauzei mortii; lipsa unei mari parti a componentelor scheletice, coroborata cu rezultatele examenului antropologic (fragmente erodate, cu friabilitate si porozitate accentuata), ne permit sa concluzionam ca vechimea oaselor este de peste 100 de ani.

144

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 6
METODOLOGIA DE LABORATOR A IDENTIFICARII MEDICO-LEGALE - ODONTOSTOMATOLOGIE
Odontostomatologia medico-legala a fost definita de Keiser Nielsen in 1970, ca fiind ramura ondontologiei care se ocupa de evaluarea corespunzatoare, interpretarea si prezentarea probelor rezultate din examinarea dentara in interesul justitiei.80(P16) Prima utilizare documentata a odontostomatologiei medico-legale a avut loc in anul 1850 in SUA in cazul Commonweatlh of Massachusetts vs. Webster: dr. J.W. Webster l-a ucis si apoi incinerat pe Dr. G. Parkman, ramasitele acestuia fiind identificate de catre stomatologul sau care i-a confectionat proteza dentara.81(p263) Rolul odontostomatologiei medico-legale in activitatea de investigatie criminalistica consta din: 1.Examinarea aparatului dento-bucomaxilofacial pentru evaluarea leziunilor posttraumatice si ca rezultat al malpracticii dentare. 2. Analiza, interpretarea si compararea plagilor muscate in vederea identificarii suspectului. 3.Identificarea pe baza caracteristicilor dintilor si lucrarilor dentare a cadavrelor in diferite stadii de descompunere, scheletizate, desfigurate, incinerate. Acest tip de identificare joaca un rol foarte important in cazul identificarii victimelor dezastrelor. De asemenea examinarea odontologica ajuta la confirmarea identitatii si la persoanele vii in cazuri de imigrare ilegala sau persoane cu pierdere de memorie sau boala Alzheimer. Principiul identificarii odontostomatologice se bazeaza pe unicitatea aparatului dento-maxilar a fiecarui individ (chiar si in cazul gemenilor identici dentitia are caracteristici diferite) si pe faptul ca dintii sunt cele mai rezistente structuri ale organismului rezistand la actiunea focului, desicare, descompunere si imersie prelungita in apa.82 Elemente de anatomie si terminologie odontologica Clasificarea dentitiei: 1. Dentitia umana este heteordonta ceea ce inseamna ca este compusa din diferite tipuri de dinti care indeplinesc diferitele functii ale procesului de masticatie. 2. Dentitia umana este diplodonta ceea ce inseamna ca omul are doua seturi separate de dentitii si anume: dentitia temporara sau primara (popular denumiti dinti de lapte). Sunt 20 de dinti care incep sa erupa de la varsta de 6 luni pana la varsta de doi ani. dentitia permanenta, adulta sau secundara. Sunt 32 de dinti care erup incepand de la varsta de 6 ani pana in jur de 21 de ani. mai exista si dentitia mixta in aceasra poerioada coexista dinti temporari si permanenti, dureaza intre al 6-lea si al 12-lea an de viata
978-606-8363-03-5 145

Masterat cercetri criminalistice aplicate

Morfologia dentara Morfologic si functional dintii sunt alctuiti din coroan, rdcin si colet:29(pp48-50) 1. Coroana dentar. este portiunea extraalveolar a dintelui, acoperit de smalt, vizibil in cavitatea bucal deasupra gingiei are o forma asemanatoare unei piramide pentru dintii frontali si de prisme pentru cei laterali este alcatuita din smalt, dentina si camera pulpara: o Smaltul este substanta cu structura anorganica (aproximativ 98%) formata in principal din hidroxiapatita si structura organica reprezentata de proteine, care acoper coroana dintelui si care se prezint sub form de prisme microscopice legate intre ele printr-o substant organic. Este cel mai dur tesut al organismului avand o duritate putin inferioar celei a diamantului sau carborundului, (materiale abrazive folosite pentru slefuirea dintilor). Devine mai fragil cand lipseste dentina subiacenta. Culoarea smaltului depinde de transluciditate si variaza de la galben la gri si gri-albastru (cu cat e mai translucid cu atat dentina galbena se poate vedea mai bine). Grosimea acestuia este de circa 2.5mm la nivelul cuspizilor premolari de 2 mm la nivelul marginii incizale a dintilor incisivi si de 0.2 mm la nivelul coletului. o Dentina contine 75% substante anorganice (in principal hidroxiapatita) si organice in procent mai ridicat decat al smaltului. Formeaz partea principala a dintelui conferindu-i forma de baz. Intra in structura att a coroanei ct si a rdcinii. Inconjuara camera pulpara si este inconjurata de smalt.. Este de culoare galbena, mai putin dura decat smaltul dar mai dura ca osul sau cementul. o Cavitatea pulpara este cavitatea interna a dintelui care contine pulpa dentara. Aceasta este un tesutul moale ce contine vase de sange si fibre nervoase. 2. Rdcina. este portiunea intraalveolar a dintelui acoperit de cement care nu se vede dect pe radiografie sau cnd dintele este extras. o Cementul este substanta organo-mineral, asemntoare osului, care acoper in strat subtire rdcina pe toat suprafata ei. In mod normal nu este vizibil, ci doar atunci cind dintele este extras sau gingia s-a retras foarte mult. Cementul particip la fixarea dintelui in alveol. 3. Apexul. Reprezint vrful rdcinii si este locul de comunicare a continutului dentar (pulpa dentar) cu tesuturile inconjurtoare care contribuie la nutritia, inervatia si mentinerea dintelui in alveol. 4. Coletul. Reprezint linia de separare dintre coroan si rdcin. 5. Paradontiul - totalitatea tesuturilor (din care fac parte si ligamentele periodontale) de sustinere si fixare a dintelui in alveola dentara.

146

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Anatomia dintelui schema si preparat dentar.83 Structurile principale de suport ale dintelui Procesul alveolar. Este portiunea din mandibula si maxilar unde se gasesc alveolele dentare Alveola. Este cavitatea din osul mandibular si maxilar in care este fixata rdcina dintelui. Pentru fiecare rdcin exist cte o alveol. La cele dou maxilare pot exista intre 52-66 de alveole. Suprafetele dintilor .Dintii adulti prezinta in total 160 de suprafete, care au caracteristici individuale la care se adauga pozitia dintilor sau/si modificarile specifice aduse de eventualele tratamente dentare, astfel ca din acest ansamblu de caracteristici unice rezulta calitatiile deosebite a probelor dentare in identificarea persoanei. a. Dinti anteriori coroanele dintilor anteriori prezinta 4 suprafete si si o margine: suprafata meziala catre linia mediana suprafata distala in partea opusa liniei mediane suprafata labiala suprafata externa ce priveste catre buze suprafata linguala suprafata interna care priveste catre limba. In cazul dintilor anteriori maxilari aceasta suprafata se mai numeste si palatala. margine incizala - marginea cu care se realizeaza muscarea b. Dinti posteriori coroana acestora are 5 suprafete: suprafata meziala, distala si linguala se definesc ca si cele dela dintii anteriori suprafata bucala suprafata externa carepriveste spre obraz corespunzand suprafetei labiale a dintilor anteriori. Termenul de suprafat faciala poate fi folosit atat pentru suprafata bucala cat si pentru cea labiala. suprafata oculzala suprafata cu care se realizeaza mestecarea alimentelor. Tipuri de dinti In functie de pozitia lor pe arcada dintii se impart in doua grupuri:
978-606-8363-03-5 147

Masterat cercetri criminalistice aplicate

1. anterior (frontal): canini si incisivi 2. posteriori (lateral): premolari si molari Persoanele adulte au 32 de dinti, fiecare arcada dentara poate fi impartita in jumatati drepte si stangi. Arcada dentara reprezint totalitatea dintilor de la nivelul mandibulei si maxilarului. Arcada dentar poate avea form de parabol (mai frecvent la mandibul) sau elips (mai frecvent la maxilar). Fiecare jumatate de arcada prezinta: Doi incisivi Un canin Doi premolari Trei molari Incisivii sunt cei doi dinti ai fiecarei aracade care sunt cel mai aproape de linia mediana. sunt denumiti incisiv central si lateral.. aspectul general al coroanei poate fi comparat cu o lopat sau cu o scaf; au o singura radacina si folosesc la muscare, taierea alimentelor.

Incisiv84(p14) si canin84(p16) Caninii este cel de al treilea dinte dinspre linia mediana a fiecarei hemiarcade. sunt mai lungi de cat incisivii, coroana are form piramidal apropiat de cea a unui vrf de lance sau dalta. au o singura radacina mai lunga si mai puternica decat a incisivilor. folosesc la taierea, sfasierea, perforarea alimentelor. Premolari sunt cei de ai patrulea si al cincilea dinti dinspre linia mediana. sunt denumiti primul si al doilea premolar. au un volum mai mare dect al dintilor frontali dar mai mic dect volumul molarilor. coroana este bicuspida, prezentand doi cuspizi piramidali unul extern sau bucal si celalalt intern sau lingual.
148 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

radacina lor este aplatizata si prezinta un sant adanc, determinand tendinta la bifurcarea radacini. In masticatie intervin in sfasierea, sfaramarea alimentelor

Premolar85 si molar superior.84(p20) Molari sunt cei de ai saselea, saptelea si optulea dintre dinspre linia mediana. sunt cei mai voluminosi dinti. prezint fete ocluzale cu 4 sau 5 cupsizi si au o suprafata mare ce permite triturararea alimentelor. au 2 sau 3 radacini (molarii inferiori au de obicei 2 radacini cu exceptia molarului 3 care de obicei are 3 radacini). molarii 3 superiori si inferiori sunt numiti si masele de minte, sunt cei mai mici dintre molari si adesea erup tarziu sau chiar deloc. rolul molarilor in masticatie este de sfaramarea alimentelor Tipurile de dintii temporari Fiecare jumatate de arcada prezinta: 2 incisivi central si lateral. Au coroane si radacini mai mici comparate cu cei permanenti 1 canin sunt mai mici decat cei permanenti, cu o radacina proportional mai lunga. 2 molari primul si al doilea molar. Atat coroana cat si radacina sunt mai mci decat cei permanenti. Radacinile sunt mai subtiri, mai curbate cu divergenta accentuata decat la radacinile molarilor permanenti. Functiile acestora sunt aceleasi ca la dintii adulti corespunzatori. Notarea dintilor Identificarea si notarea standardizata a dintilor a fost generata de nevoia unui limbaj comun de specialitate pentru comunicare eficienta att verbala ct si grafica. Exista mai multe sisteme de notare a dintilor, care au in comun patru elemente: 1. Cele dou arcade dentare, maxilar si mandibular se impart in 4 sectoare: drept superior si inferior, stng superior si inferior, prin dou linii perpendiculare ce reprezint planul medio-sagital si planul de ocluzie.
978-606-8363-03-5 149

Masterat cercetri criminalistice aplicate

2. Identificarea hemiarcadei se face printr-o cifr, liter sau a unui semn matematic 3. Desenul sau schema reprezint imaginea pacientului asezat in fata examinatorului, dreapta schemei corespunznd prtii stngi a examinatorului. 4. Dintii unei hemiarcade se noteaz cu cifre arabe sau romane de la linia median spre extremitatea distal a arcadei marcnd pozitia dintelui pe hemiarcad. Se deosebesc sistemele de notare a dintilor permanenti si temporari. Notarea dintilor permanenti.29(p68) Sistemul international (FDI) Federatia Dentar International a stabilit la sesiunea anual ce s-a desfsurat la Bucuresti in 1971 ca fiecare hemiarcad s fie desemnat cu cifre de la 1 la 4 in sensul acelor ceasornicului. Notarea dintilor se face adugnd lnga cifra corespunztoare hemiarcadei cifra care marcheaz pozitia dintelui pe hemiarcad. Astfel incisivul central superior drept 1.1, incisivul central inferior drept 4.1, premolarul doi superior stng 2.5, molarul prim inferior stng 3.6 Aceast notare are avantajul posibilittii de a se putea analiza sistematic datele cu ajutorul sistemelor cibernetice de calcul. Notarea dintilor temporari.29(65) Sistemul international (FDI) Hemiarcadele sunt notate cu cifre 5, 6, 7, 8 in sensul acelor de ceasornic. La aceste cifre se adaug cifrele corespunztoare pozitiei dintelui in cauz, cifre de la 1-5. Astfel incisivul central inferior drept temporar 81, molarul doi superior stng este 65

Notarea dintilor permanenti si temporari conform FDI.86

150

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Principiile si etapele examinarii odontostomalogice a ramasitelor umane Asa cum s-a afirmat identificarea odonto-stomatologica joaca un rol important in identificarea postmortem, fiind de multe ori singura metoda prin care se poate realiza sau exclude identificarea. Obiectivele expertizei odontologice postmortale sunt localizarea, identificarea, documentarea structurilor anatomice dentare, a tratamentelor si restaurarilor dentare si examinarea acestora in vederea identificarii persoanei. Descoperirea dintilor sau fragmentelor dentare la locul incidentului este o activitate care cere multa atentie si spirit de observatie, mai ales daca incidentul s-a produs intr-un loc deschis, pe pamant, cand probele dentare pot fi confundate cu bucati de cuart sau granit.. In cazul cand dintii au cazut in urma lovirii victimei cu un obiect contondent, trebuie sa se aiba in vedere ca acestia pot fi propulsati la distante de mai multi metrii. Dupa ce materialul dentar a fost localizat si identificat, acesta trebuie documentat, apoi colectat ambalat si trimis la laborator. In cazul victimelor incinerate, datorita expunerii la agentul termic, dintii pot sa isi fi pierdut duritatea devenind fragili astfel incat trebuie manipulati cu atentie. Se recomanda utilizarea de spray cu adeziv transparent sau chiar fixativ de par pentru a preveni fragmentarea pieselor dentare.

Localizarea probelor dentare la locul incidentului poate fi dificila: coroana dentara gasita la locul prabusirii unui avion. 84(p50) Activitatea de localizare si identificare a structurilor dentare care are loc in morga, este evident simpla in cazul cadavrelor intregi fara leziuni la nivelul viscerocraniului dar poate deveni complexa in cazul cadavrelor fragmentate de explozii sau distruse prin zdrobire, impact puternic sau incinerate. Trebuie avut in vedere ca dinti sau lucrari dentare care s-au desprins din alveolele dentare pot fi gasiti in faringele, traheea, esofagul victimei sau in sacul de transport cadavre.59(p1892) Obtinerea documentatiei dentare postmortem In raportul de expertiza odontologica se va nota in mod obligatoriu urmatoarele elemente: numarul ordonanatei si cine a emis-o, obiectivele expertzei,
978-606-8363-03-5 151

Masterat cercetri criminalistice aplicate

date de istoric (identitatea posibila a victimei, varsta aproximativa, sex, starea cadavrului, circumstantele in care a fost gasita). Instrumentarul minim pentru o examinare dentara postmortala include: Oglinzi dentare Sonde metalice Bisturiu, foarfece, pensete de diferite marimi Fieratsrau Pensule, bureti Sursa de lumina ultravioleta pentru a se putea detecta restaurarile dentare Aparat foto digital Instrumentar radiografic. Materiale pentru obtinerea de mulaje In laborator materialului dentar va fi fotografiat, examinat din punct de vedere odontologic, radiografiat si se va realiza odontograma. Sacul de transport al cadavrului va fi inspectat atent pentru prezenta eventualilor dinti sau materiale protetice care s-au desprins. Atunci cand este necesara o examinare in detaliu a structurilor dentare se poate face si rezectie de mandibula. Fotografiile dentare se vor face inaintea celorlalte etape ale procesului examinarii. Se vor fotografia structurile dentare, o atentie deosebita fiind acordata fotografierii dintilor anteriori superiori si inferiori, pentru compararea ulterioara cu fotografii in care persoana zambeste.. Inainte de a face ultimul set de fotografii dintii vor fi curatati. ABFO87(p121) recomanda efectuare fotografiilor dentare postmortem in felul urmator: se va face fotografia fetei cu buzele retractate (cu ajutorul unui retractor de obraz) fotografie de detaliu a dintilor anteriori fotografie laterala cu arcadele dentare in pozitie usor intredeschisa si in ocluzie fotografie ocluzala a dintilor superiori si inferiori Recomandari cu privire la efectuarea si tipul radiografiilor dentare:84(pp10,168),87(p145) trebuie facute din unghiuri si pozitii asemanatoare celor care se utilizeaza in cabinetele stomatologice. se fac mai multe radiografii din mai multe incidente posibile. daca conditiile permit este recomandata efectuarea unei radiografii muscate (bitewing) care evidentiaza coroanele dintilor, aratand in acelasi timp relatia spatiala dintre dintele maxilar si cel corespunzator mandibular.

152

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Comparatia radiografiilor bitewing ante si postmortem.88 cel mai util tip de radiografie in vederea comparatiei este radiografia periapicala completa (surprinde in intregime toate componentele anatomice a 2-4 dinti alaturati si suportul osos, vizaulizandu-se astfel morfologia coroanei si a radacinii cat si tratamentele sau restaurarile dentare) radiografia panoramica surprinde pe un singur film majoritatea partilor inferioare ale fetei (mandibula si unghiurile acesteia, maxilarul, sinusurile osoase, cavitatea nazala, protiunea inferioara a oribitelor). Radiografia se face cu capul fixat cu ajutorul unui suport. radiografii medicale care se fac pentru diagnosticul traumatismelor crnaiene sau probleme ale sinusurilor. se poate face si radiografia intregului craniu (laterala, anterioara si posterioara) radiografia digitala este cea mai buna tehnica de lucru in astfel de cazuri deoarece se pot face serii de radiografii cu vizualizarea lor instantanee eliminandu-se timpii morti necesari pentru developarea filmului. in cazurile de cadavre cu un inalt grad de fragmentate, radiografia poate evidentia structurile radiopace dentare permitand localizarea acestora in cadrul specimenului examinat.

Radiografie periapicala completa.89


978-606-8363-03-5 153

Masterat cercetri criminalistice aplicate

Caracteristicile dentare care trebuie documentate cu ocazia efectuarii odontogramei:84(pp52,53) Dintii prezenti si lipsa Restaurarile dentare a fiecarui dinte. Se dau detalii despre tipul si materialul folosit. Prezenta plombelor, la care se vor consemna dimensiuni si localizarea pe dinte, materialul din care sunt facute. Abraziuni, eroziuni, carii, sau alte anomalii dentare Dinti malpozitionati, anomalii congenitale (dinti lipsa sau supranumerari) Prezenta coroanelor Prezenta puntilor dentare Prezenta protezelor (partiale, totale sau fixe) Tratamente cosmetice dentare, de exemplu fatetele de portelan. Prezenta urmelor de tratament ale canalului radacinii (vizibile pe radiografie) Forma radacinii si caracteristicile anatomice ale structurii osoase de sustinere (la fel, vizibile pe radiografie) Leziuni traumatice ale dintilor sau modificari postmortale. Caracteristici ale dintilor care pot indica unele obiceiuri (fumatul pipei, bulimia sau regurgitare gastrica cand se produc eroziuni dentare cu pierderea smaltului) Se va utiliza sistemul de numerotare a dintilor FDI. Se va descrie tipul dentitiei (primara, permanenta sau mixta) si suprafetele dintilor. Documentatia dentara antemortem Gradul de certitudine al identificarii depinde de existenta si de calitatea documentatiei antemortem (clara, intocmita cu acuratete, calitate buna a radiografiilor sau pozelor). Este adesea dificil de obtinut deoarece medicul stomatolog al victimei trebuie identificat si localizat.. Uneori circumstantele in care se produce incidentul fatal furnizeaza date ce pot orienta activitatea de identificare, obtinandu-se in acest fel fisa dentara de la stomatologul victimei. Medicii stomatologi au obligatia sa intocmeasca o fisa dentara pentru fiecare pacient, unde vor consemna statusul dentar si tratamentul aplicat. Aceasta documentatie dentara antemortem poate lipsi atunci cand: o persoana nu s-a prezentat niciodata la un consult stomatologic (in Romania 12% din populatie nu a solicitat niciodata serviciile stomatologice90) o medicul stomatolog nu poate fi localizat, mai ales cand este vorba de persoane din alte tari. o in anumite tari, unele perosane recurg la serviciile unor medici stomatologi necalificati, care nu intocmesc documentatia dentara.
154 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Documentatia dentara antemortem cuprinde: 1. radiografii dentare (originale sau duplicate)- sunt cele mai importante documente medicale in vederea identificarii (prin comparatie cu radiografiile postmortale), mai ales daca prezinta restaurari dentare (cum ar fi plombele). Tipuri de radiografii antemortem ce pot fi folosite in identificare: bitewing, periapicale, oculzale (permite vizualizarea aranjarii spatiale a dintilor)., ortopantomograma (se vizualizeaza structurile dentare coronare si radiculare, pozitia si relatia lor spatiala, mugurii dentari inca neerupti, structura oaselor maxilare, aspectul tesuturilor de sustinere dentare cat si a sinusurilor maxilare). 2. odontograma este utila daca este intocmite cu atentie si acuratete de catre stomatolog. Utile pentru identificare sunt si urmatoarele date antemortem cu privire la: rotatia dintilor, spatierea naturala dintre dinti, fracturi coronare sau lipsa unor mici portiuni din coroana, colorarea intrinseca a dintilor, bijuterii dentare. 3. Modele dentare de studiu si documentare din ghips obisnuit, ghips Moldano sau sintetic. 4. Fotografii intra si extraorale (frontala si de profil) sau fotogafii sau inregistrari video prezentand diferite stadii ale tratamentului 5. Fotografii ale presupusei persoane zambind (fotografii zambitoare), acestea pot face parte din fisa dentara (vezi mai sus) sau cel mai adesea pot fi obtinute de la rude sau cunostinte. Aceste fotografii coroborate cu date obtinute prin alte mijloace de identificare pot sa ajute la identificare sau de excludere.

Fotografie intraorala si extraorala.91

Coloratia dintilor data de tratamentul cu tetraciclina.92

978-606-8363-03-5

155

Masterat cercetri criminalistice aplicate

Incisiv rotat.93

Bijuterii dentare.94

Dinti supranumerari.96 Compararea datelor antemortem cu cele postmortem Datele antemortem pot sa fie obtinute dupa perioade de timp diferite incapand de la saptamani sau luni de zile, pana la ani. Dupa ce toate datele antemortem si postmortem au fost obtinute urmeaza procesul de comparare a acestora. Compararea se face manual dar cand sunt mult mai multe victime de identificat se poate recurge la ajutorul programelor de calculator. Win ID Dental Identification System 87(p152),96 este unul din aceste programe cu rol de screening, a carui principiu de functionare este clasificarea dintilor pe baza a doua coduri: primar si secundar. Cel primar codifica restaurarile facute suprafetelor dentare iar cel secundar codifica elemente precum: tipul dentitiei (de ex. permanenta), integritatea coroanei, plomba din rasini compozite sau din amalgam, canal obturat, etc. Aceasta permite compararea digitala a datelor antemortem cu cele postmortem cu datele din baza de date furnizand o lista cu potentiale potriviri, care vor fi ulterior examinate de catre specialist. Pentru comparare se vor folosi urmatoarele elemente dentare:87(p132) dinti prezenti, dinti lipsa, tipul dentitiei,
156 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

pozitia dintilor, morfologia si patologia coroanei si a radacinii, morfologia si patologia camerei pulpare si a canalului radacinii, restaurari dentare, morfologia si patologia gingiei si a ligamentelor periodontale caracteristici anatomice si patologia maxilarului si mandibulei Discrepantele majore ce nu pot fi explicate, intre aceste doua seturi de documente exclud identitatea:84(p53) o in documentatia postmortem exista un dinte care lipseste in cea antemortem. o in documentatia postmortem dintele nu prezinta urme de restaurare care se regaseste (plomba sau punte) in cea antemortem. o in documentatia postmortem exista un dinte cu un canal neobturat, in documentatia antemortem un dinte corespunzator are canalul obturat. o documentatia postmortem arata un dinte cu radacini curbate iar in documentatia antemortem radacinile sunt drepte.

Restaurarile dentare si tratamentele dentare joaca un rol importan in identificare.88

Radiografia bitewing postmortem (stanga) si antemortem (dreapta) plombele sunt identice in ambele radiografii atat ca material, localizare, forma si dimensiuni.18(p607)

978-606-8363-03-5

157

Masterat cercetri criminalistice aplicate

In urma compararii datelor ante cu cele postmortem pot exista urmatoarele tipuri de concluzii:87(p134) 1. Identificare pozitiva datele antemortem corespund celor postmortem in detalii suficiente (de exermplu un singur dinte poate fi folosit in identificare daca contine suficiente caracteristici unice). De asemenea nu exista discrepante ce nu pot fi explicate. 2. Identificare probabila: datele antemortem si cele postmortem corespund in detalii suficiente dar datorita calitatii fie a ramasitelor postmortem sau a probelor antemortem nu este posibil sa se stabileasca cu certitudine identitatea. 3. Date insuficiente: informatia rezultata din comparatie este insuficienta pentru a se formula o concluzie 4. Excludere datele ante si postmortem nu preziinta in mod clar corespondente. Interpretarea statistica a datelor obtinute Keiser-Nielsen a elaborat o formula matematica pentru a cuantifica probabilitate ca doi indivizi sa prezinte aceeasi combinatie de dinti lipsa si dinti restaurati sau nerestaurati.84(p173) Pentru situatia fundamentala de lipsa sau prezenta a dintilor formula matematica este: ( )

unde M = numarul total de dinti ( de regula 32) X = numarul de dinti lipsa (formula se poate aplica in cazul oricarei altei caracteristici dentare cum ar fi dintii cu restaurari dentare). Se ia ca exemplu cazul in care un individ are 4 dinti lipsa si din cei 28 ramasi are 4 restaurati. Aplicand formula lui Keiser Nielsen pentru dintii lipsa rezulta ca numarul posibil de combinatii pentru acesti dinti lipsa este:

Pentru dintii restaurati din cei 28 de dinti ramasi rezulta numarul total de combinatii pentru acesti dinti restaurati:

Multiplicand cele doua rezultate (regula produsului) reiese ca numarul de combinati in cazul unei persoane care prezinta 4 dinti lipsa si 4 dinti restaurati este de 736.281.000.
158 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Cu alte cuvinte probabilitatea ca doua persoane sa aiba aceeasi 4 dinti lipsa si aceeasi dinti plombati (fara sa se ia in considerare si care suprafata este plombata) este de 1 la aproximativ 736 de milioane adica de circa 34 de de ori populatia Romaniei. Identificarea odontostomatologica a persoanelor fara date medicale antemortem Cand radiografiile sau odontograma antemortem nu pot fi pusa la dispozitie atunci se pot folosi in incercarea de identificare pozele in care presupusa persoana zambeste (pozele zambitoare). Se va utiliza meotdei suprapunerii digitale (computerizate) a dintilor vizibili in poza cu poza mulajului danturii cadavrului neidentificat, existand posibilitatea excluderii sau determinarea potrivirii acestor elemente dentare. Exemplu de folosire a acestor poze in identificare:18(p611) in urma unor sapaturi se gasesc fragmente osoase umane. Maxilarul si mandibula prezentau intregul set de dinti, fara urme de restaurare, dar cu semne de afectare osoasa ce indica un stadiu incipient de afectiune periodontala (sau a tesutului de suport al dintelui). Examinarea antropologica a estimat varsta persoanei ca fiind de 25 35 de anii, sexul masculin si rasa caucaziana. Cautand in baza de date de persoane disparute s-a facut o lista de barbati ce corespundeau acestor elemente. O poza a presupusei persoanei zambind a fost obtinuta de la familie. Prin marirea pozei s-a putut face o comparatie intre structurile dentare infatisate in poza si cele postmortem, determinandu-se un inalt grad de potrivire. Datele de istoric oferite de familie precizau ca individul nu a avut nici o plomba, nu a avut nici un dinte extras dar a urmat un tratament pentru o afectiune gingivala. Datele de ancheta coroborate cu rezultatele examinarii odontostomatologice, antropologice si cu istoricul furnizat de familie au dus la identificarea pozitiva a victimei.

Identificarea victimei dupa poza.18(p612) Marcarea protezelor s-a observat ca protezele dentare raman intacte sau usor avariate chiar si atunci cand victima sufera un traumatism violent, fie ca e zdrobire, explozie sau incinerare, de asemenea fiind confectionate din materiale
978-606-8363-03-5 159

Masterat cercetri criminalistice aplicate

rezistente nu se descompun in conditiile inhumarii sau in cadrul modificarilor postmortale ale victimei.. Daca sunt marcate, protezele dentare pot fi de ajutor in identificare (nu trebuie supraestimata valoarea lor in identificare, deoarece fiind mobile nu pot proba identitatea cu acelasi grad de certitudine ca cel al dintilor sau amprentelor digitale). Si la noi in tara s-a propus marcarea protezelor mobile fie cu codul de parafa a medicului sau cu codul numeric personal al persoanei.97

Marcarea protezei.97 Cand documentatia medicala antemortem nu poate fi obtinuta, expertul poate totusi sa furnizeze date utile investigatiei in vederea identificarii persoanei. 1. Apartenenta de specie Dentitia este difertita in mod semnificativ la om si animale. Ea reflecta adaptarea speciei la diferite tipuri de hrana, omul fiind omnivor iar animalele pot fi carnivore, ierbivore sau omnivore:98 o pe fiecare hemiarcada omul are 2 incisivi, un canin, 2 premolari si 3 molari o hemiarcada celor mai multe specii de mamifere prezinta 3 incisivi, un canin, 4 premolari si 3 molari. o incisivii maxilari ai omului sunt proportionali mai mari decat ai altor mamifere in afara de cal care are incisivii mai mari. o la om caninii sunt mici, carnivorele au canini de dimensiuni mari, si forma conica, iar ierbivorele nu au canini sau sunt mici. o premolarii si molarii omului au cuspizi rotunjiti separati prin santuri distincte. carnivorele au masele cu varf ascutit iar ierbivorele au maselele cu suprafata ocluzala lata si plana cu santuri si ridicaturi paralele 2. Apartenenta de rasa Rasele umane prezinta anumite diferente morfologice dentare dar pe baza acestora nu se poate stabili cu certitudine provenienta rasiala a unor ramasite umane: incisivii mongolozilor au forma de lopata (suprafata linguala a acestora este excavata), de asemena primul molar inferior are trei radacini.

160

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Incisivi in forma de lopata la rasa mongoloida.18(575)

Tubercul Carabelli.8(p290) tuberculul Carabelli care este un cuspid (protruzie) suplimentar situat pe fata meziopalatinala (antero-interna) a molarului 1 maxilar se intalneste la rasa caucazoida.99(p97),29(p142) pentru negroizi nu exista caracteristici caracteristici dentara specifice de rasa, desi unii autori au descris ca molarii ar fi mai mari, suprafata incisivilor este crenelata si diastema (spatiul dintre cei doi incisivi centrali) este mai frecventa originea persoanei poate fi sugerata de tipul si materialul folosit la lucrarile dentare care pot indica locul unde fost realizate.

3. Estimarea sexului o Utilitatea dintilor in stabilirea apartenetei de sex este foarte redusa deoarece dintii nu prezinta dimorfism sexual. o S-a observat ca dimensiunile coroanei dintilor tinde sa fie mai mare la barbatilor decat la femei. o In cazul dintiilor apartenenta de sex se poate determina genetic prin testul pentru cromozomul Y. 4. Estimarea varstei O estimare cu acuratete a varstei unui cadavru neidentificat are o contributie deosebita in simplificarea procesului de identificare. Aceasta estimare se face prin compararea stadiului de dezvoltare a dentitiei unei persoane cu varsta necunoscuta cu tabele ale caracteristicilor dezvoltarii dentare pe fiecare varsta in parte.
978-606-8363-03-5 161

Masterat cercetri criminalistice aplicate

Estimarea varstei copiilor (incluzand si fetusii si nou-nascutii) se face cu destula precizie si acuratete pe baza examinarii dezvoltarii dentitiei primare si mixte. Dintii anteriori incep sa se formeze si sa se mineralizeze la 16 saptamani de viata intrauterina.37(p152),100(p84) Mineralizarea incepe la nivelul coroanei, gradul aacesteia putandu-se observa pe radiografie si astfel se poate aprecia varsta fatului. La dintii temporari si primul molar permanent apare o linie accentuat denumita linia neonatala localizata intre smaltul format inainte de nastere si cel format ulterior. Se datoreaza tulburarilor in formarea smaltului aprut la nastere, tulburari datorate schimbrilor de nutritie si de mediu inconjurtor. Are importanta medico-legala aratand supravietuirea nou nascutului dupa nastere. Primii dintii primari incep sa erupa (sa strapunga gingia putand fi observati in cavitatea bucala) la varsta de 6 luni dupa nastere. Apoi continua sa erupa toti dintii primari la anumite intervale de timp pana cand dentitia primara este completa aceasta intamplandu-se in jurul varstei de 2 ani. In jurul varstei de 6 ani dintii primari incep sa cada fiind inlocuiti cu dintii permanenti, procesul de cadere al dintilor primari fiind complet la varsta de 12 ani. Intre varsta de 6 si 12 ani coexista ambele tipuri de dentitii (permanenta si primara) purtand numele de dentitie mixta. In jurul varstei de 8 ani molarul 3 incepe sa se mineralizeze dar nu va erupe decat in jurul varstei de 18 ani, iar dezvoltarea completa a radacinii avand loc in jurul varstei de 21 de ani.100(p86) Stadiul de eruptie al dintilor la cadavrele de copii neidentificati este comparat cu tabele ale stadiului de eruptie dentara in functie de varsta, determinandu-se astfel varsta. Exemplu de tabel utlizat in determinarea varstei este cel elaborat de Ubelaker (1989).

Eruptia dintilor pe varste.101(P94,95)


162 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Tip dentitie

Eruptia maxilara Eurptia mandibulara (varsta) (varsta) Primara Incisiv central 7.5 12 luni 6 8 luni Incisiv lateral 12 24 luni 12 15 luni Canin 16 24 luni 16 24 luni Primul molar 12 16 luni 12 16 luni Al doilea molar 24 32 lluni 24 32 luni Permanenta Incisiv central 7 8 ani 7 8 ani Incisiv lateral 8 - 9 ani 7 8 ani Canin 11 12 ani 9 10 ani Primul premolar 9 10 ani 9 10 ani Al doilea premolar 10 12 ani 11 12 ani Primul molar 6 7 ani 6 7 ani Al doilea molar 12 13 ani 11 13 ani Al treilea molar 17 21 17 - 21 Varstele la care erup dintii temporari si permanenti.37(152) Estimarea varstei la adulti da rezultate mai slabe in ceea ce priveste acuratetea. Prima metoda de estimare a varstei adulte pe baza examinarii dentitiei a fost conceputa de Gustafson in 1950. Tehnica prevedea efectuarea de sectiuni subtiri longitudinale buco-linguale ale dintelui. Cu ajutorul microscopului sau stereomicroscopului, pe aceste sectiuni se urmareau sase tipuri de modificari asociate cu inaintarea in varsta carora li s-a dat un scor de pe o scara de la 0 la 3 in functie de gradul modificarilor.102(p282): Uzura suprafetelor ocluzale datorate alimentatiei (notata cu A) Gradul de paradontoza (afectiune ce consta din degenerarea paradontiului, tesut prin care sunt fixati dintii in alveolele dentare, ce determina retractia gingiilor, dezvelirea pronuntata a dintilor si caderea lor) notata cu P Apozitia (depunerea) de dentina secundara (notata cu S) depunerea de dentina secundara odata cu inaintarea in varsta determina in final ocluzia camerei pulpare. Gradul de ocluzie se vizualizeaza radiografic. Apozitia de cement (notata cu C) grosimea stratului de cement creste odata cu inaintarea in varsta. Regiunile dentare unde stratul de cement este in general cel mai subtire sunt: jonctiunea cement-smalt si in treimea apicala a radacinii. Rezorbtia radiculara (notata cu R) este progresiva cu varsta. Transparenta sau transluciditatea radacinii (notata cu T) incepe la nivel apical si progreseaza in sens coronar, se datoreaza ocluziei cu subtsante minerale a tubulilor de dentina cu generarea unei dentine sclerotice care este transparenta.

Dinte

978-606-8363-03-5

163

Masterat cercetri criminalistice aplicate


Tip de modificare A Scorul pentru fiecare modificare A0 A1 A2 A3 P0 P1 P2 P3 S0 S1 S2 S3 C0 C1 C2 C3 R0 R1 R2 R3 T0 T1 T2 T3 Semnificatia modificarii

Absenta uzurii Uzura intereseaza doar smaltul Uzura intereseaza dentina Uzura intereseaza i pulpa dentara Absenta parodontozei Debutul parodontozei dar fara pierdere osoasa Parodontoza depaete 1/3 din radacina inferioara Parodontoza a depait 2/3 din radacina inferioara Absenta apozitiei secundare de dentina Apozitie de dentina intereseaza portiunea superioara a cavitatii pulpare Apozitia de dentina umple 2/3 a cavitatii pulpare Cavitatea pulpara este umpluta complet Grosime normala a stratului de cement Grosimea relativ crescuta fata de normal Grosime crescuta in apropierea apexului radacinii Grosime crescuta pe toata lungimea apexului radacinii Absenta rezorbtiei radiculare Rezorbtie radiculara in puncte izolate Rezorbtie cementului Rezorbtia extensiva a cementului si dentinei Absenta transluciditatii radiculare Transluciditate radiculara decelabila Transluciditatea depaete 1/3 din apexul radacinii Transluciditatea depaete 2/3 din apexul radacinii

Scorurile acordate modificarilor dentare si semnificatia lor.103(pp71,72),104

Uzura (A): in stanga fara uzura (A0), mijloc uzura smaltului(A1), dreapta uzura intereseaza si dentina (A2)

164

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Transluciditatea (de la stanga la dreapta): fara transluciditate (T0), Transluciditate in 1/3 inferioara (T1), transluciditate in 2/3 a radacinii (T2), transluciditatea intregii radacini (T3).105 Formula de regresie aplicata de Gustafson pentru calcularea varstei pe baza scorului total obtinut prin insumarea scorurilor la modificarile dentare observate este:106,107(p885) Vrsta n ani = 4.56 x Scorul total +11.43 Autorul aprecia eroarea estimarii varstei prin aceasta ecauatia ca fiind de 3.6ani. Alti autori, precum Whittaker108(p96) apreciaza ca aeasta metoda poate determina varsta cu o eroare de 7 ani. Dezavantaje metodei: presupune distrugerea partiala a dintelui (proba materiala) pentru obtinerea de sectiuni subtiri demineralizarea se poate produce nu numai cu inaintarea in varsta dar si datorita unor afectiuni patologice Johanson a a adus imbunatiri formulei lui Gustafson, luand in considerare 7 stadii ale ale acelorasi modificarilor in loc de 4:109

Cele 7 stadii ale metodei Johanson.109


978-606-8363-03-5 165

Masterat cercetri criminalistice aplicate

Vrsta = 11.02 + (5.14 x A) +(2.3 x S) + (4.14 x P) + (3.71 x C) + (5.57 x R) + (8..98 x T)

Lamendin a propus in 1992 o meotda mai simpla si nedistructiva pentru determinarea varstei unui adult pornind de la un singur dinte cu radacina. Ecuatia elaborata are doar doua doi parametri: 39(p58),70(p14) 1. gradul paradontozei 2. transparenta radacinii prin transiluminare A = (0.18 x P) + (0.41 x T) +25.53 Unde A este varsta in ani P este gradul de paradontoza care se calculeaza dupa formula:

Inaltimea paradontozei (in mm) se observa pe suprafata dintelui si se masoara cu sublerul dentar pe fata labiala intre jonctiunea smalt-cement si marcajul ligamentulului peridontal. T este transluciditatea sau transparenta radiculara care se masoara (in mm) de asemenea pe fata labiala a dintelui intre apex si locul unde dispare transparenta. Dintele trebuie transiluminat cu o sursa luminoasa de max 60W.70(p14) Inaltimea radacini se masoara de la apex pana la jonciunea smalt-cement.

Dinte al unui barbat de 66 de ani prezentand transparenta radiculara si regresie paaradontala.110(p16) Pentru indivizii intre 40 si 80 de ani eroarea (diferenta medie intre varsta estimata si cea reala) acestei metode etse de 8.9 2.2. Nu se recomanda folosirea
publicat online: www.itcode.ro

166

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

acestei formule pentru indivzi in afara intervalului de varsta 40 80 de ani datorita erorilor mari ce apar in estimari.39(p59) Prince si Ubleaker au modificat ecuatia lui Lamendin incluzand inaltimea radacinii (RH root height) in ecuatii separate pentru sexul masculin si feminin cat si pentru rasa negroida si caucazoida. Variabilele adaugate au scazut eroarea medie rezultand o meotda mai buna de estimare a varstei decat ecuatia Lamendin:70(p14) Barbati caucazieni: varsta = 0.15(RH) + 0.29(P) + 0.39(T) + 23.17 eroare medie 7.255.93 ani Femei caucaziene: varsta = 1.10(RH) + 0.31(P) + 0.39(T) + 11.82 eroare medie 8.116.22 ani Barbati negroizi: varsta = 1.04(RH) + 0.31(P) + 0.47(T) + 1.70 eroare medie 7.15 5.93 Femei negroide: varsta = 1.63(RH) + 0.48(P) + 0.48(T) 8.41 eroare medie 9.19 7.17 ani O metoda biochimica de estimare a varstei este gradul de racemizare (transformarea unui compus chimic optic activ in antipodul sau pana la obtinerea unui amestec egal) al acidului aspartic (un aminoacid) in dentina coroanei dentare.111 Aminoacizii (compusi chimici din structura proteinelor) se prezinta sub doua forme L si D aminoacizi in functie de cum rotesc planul luminii polarizate (L = levogir roteste planul catre stanga si D = dextro gir, il roteste catre dreapta). Aminoacizii din proteinele umane sunt toti L aminoacizi (cu exceptia glicinei). Ei tind sa se transforme spontan in forma D, apoi la randul ei tinde sa se reintoarca la forma L pana se atinge un echilibru intre cele doua forme. Procesul prin care un L aminoacid se transforma intr-un amestec de L si D aminocizi se numeste racemizare, care este completa cand exista un echilibru intre cantitatea de L si D aminoacizi. Multi aminoacizi din structura proteinelor corneei, creierului, discurilor vertebrale si dintilor, racemizeaza. Forma L a amincoacizilor se transforma de-a lungul vietii intr-un ritm lent in forma D (altfel spus acidul D-aspartic se acumuleaza cu varsta), astfel ca acest grad al conversiei poate sa fie folosit in determinarea varstei persoanei in momentul mortii (de asemenea ritmul racemizarii decurge foarte lent dupa moarte deci poate fi folosit si pentru stabilirea timpului postmortal). Pentru efectuarea acestei metoda a fost selectat acidul aspartic care intra in structura colagenului dentinei si are un inalt grad de racemizare. Dupa cum s-a spus metoda cuantifica instrumental (HPLC high performance liquid cromtaography) proportia de forme D si L (stiind ca in timp forma L se transforma in forma D). Pentru a se putea estima varsta s-a determinat gradul de racemizarea a acidului aspartic din dentina dintilor de cadavre care s-a comparat cu cel din dentina dintilor proveniti de la persoane cu vrste cunoscute. Acuratetea acestei metode raportata de Mornstad este de 3 ani.112

978-606-8363-03-5

167

Masterat cercetri criminalistice aplicate

Alte detalii utile investigatiei, ce se pot obtine din examinarea dentitiei:1(195) 84(p8) Sunt unele modificari sau caracteristici ale dentitiei pe baza carora nu se poate face identificare pozitiva a individului dar dau relatii despre obiceiurile personale, profesie si statusul socio-economic: o un indiciu al statusului socioeconomic se obtine din examinarea calitatii si tipului de lucrari dentare cat si a materialului folosit pentru aceastea (amalgam sau rasini compozite pentru plombe, metale pretioase ca bijuterii dentare, implanturi ceramice, proteze cu infrastructura metalica de aliaj de Crom-Cobalt, etc) o obiceiuri persoane pot fi deduse din anumite caracteristici dentare: daca persoana era fumator sau nefumator, fumator de pipa, bautor de cafea, ceai sau vin rosu. o de asemenea lucrari de indreptare a dintilor (lucrari ortodontice) arata un nivel mai ridicat socioeconomic (este un tratament electiv) o vechimea plombele poate sugera momentul in care persoana s-a prezentat la stomatolog fata de momentul examinarii. o dintii albiti prin procedee cosmetice dentare sau prezenta fatetelor de portelan arata ca persoana era preocupata de aspectul sau fizic si avea resurse financiare pentru a-si permite astfel de lucrari. o dintii lipsa sau deteriorati arata ca persoana nu beneficia de tratament sotmatologic regulat. o coroanele din metal, sau acrilat sunt mai ieftine decat cele din portelan. o anumite metale si materiale folosite in lucrarile dentare pot fi identificate ca loc de origine al manufacturarii (regiuni, tara). o uzura sau pierderea smaltului prin erodare poate fi un indiciu al obicieurilor culinare sau problemelor psihologice (bulimia, anorexia nervoasa, alcoolism), a unor probleme medicale precum este hernia hiatala care determina reflux gastroesofagian. Toate determina ca sucul gastric cu continutul sau acid sa poata patrunde in cavitatea bucala in mod pasiv, determinand erodarea smaltului. o electricieni utilizeaza dintii anteriori pentru a dezizola cablurile electrice, prezentand la acest nivel o un mic sant, acelasi aspect se poate intalni si la lemnari care tin cuie intre dinti. o dintii pot indica prezenta unor afectiuni patologice suferite de individ la un anumit moment in viata sa. De exemplu tetraciclina la copii se absoarbe in dintii in dezvoltare determinandu-le o colorare intrinseca maroniu-galbuie o forma dintilor poate sa sugereze o anumita patologice de exemplu dintii Hutchinson (incisivi bombati cu baza larga, ascutiti) si molarul Mulberry (cuspizi multiplii rotunjiti cu aspect rudimentar pe suprafata ocluzala a primului molar permanent) se intalnesc in sifilisul congenital. o fluoroza dentara apare la copii in perioada de dezvoltare a dintilor permanenti prin consumul (inghitirea) de pasta de dinti in exces. Apar pete rugoase galben maronii pe smaltul dintinilor. Fluoroza poate apare si la indivizii care au trait in regiuni unde exista exces de fluor in dieta. Prin
168 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

examinarea chimica a petelor de smalt se poate determina tara de origine a individului respectiv.

Fluoroza dentara.113 Leziunile traumatice dentare Un obiectiv al expertizei odontostomatologice medico-legale este sa identifice leziunile traumatice dento-alveolare si sa explice mecanismul de producere a acestora. In general, dintii arcadei maxilare sunt mai expusi traumatismelor datorita pozitiei anatomice specifice fata de dintii arcadei mandibulare. Leziunile traumatice ale molarilor i premolarilor se produc prin trauamtisme de intensitate mai mare astfel ca sunt de obicei asociate cu fracturi ale osului maxilar i mandibular. Mecanismele de producere a leziunilor dento-alveolare: 1. Lovirea directa a dintilor frontali (incisivi, canini) sau a partilor anterioare ale arcadelor alveolare cu obiect contondent, taietor-intepator, gloante. Se poate face prin: o mecanism activ: lovirea corpului cu un obiect in miscare o mecanism pasiv corpul in miscare se loveste de un plan sau corp fix o mecanism complex: lovire cu si de corpuri dure 2. Lovirea indirecta a formatiunilor dentare forta traumatica este transmisa la acest nivel prin intermediul mandibulei in cazul lovirii sau caderii pe menton sau corpul mandibulei. Clasificarea leziunilor traumatice dento-alveolare:114 fisuri dentare fractura incompleta a coroanei, care intereseaza numai smaltul fara pierdere de substanta dentara fracturi necomplicate ale smaltului fracturi necomplicate ale smaltului si dentinei, fara sa implice pulpa fracturi complicate ale smaltului si dentinei cu expunerea pulpei fractura corono-radiculara inrtereseaza smaltul, dentina coronara si radiculara si cementul fractura radiculara intereseaza dentina, cementul, si pulpei fracturi multiple care intereseaza mai multi dinti deteriorarea lucrarilor dentare anterioare.
978-606-8363-03-5 169

Masterat cercetri criminalistice aplicate

subluxatia leziuni ale strucutrilor de fixare si suport ale dintelui eterminand mobilitatea dintelui in alveola fara pierderea acestuia luxatia cu extruzie avulsia partiala a dintelui din alveola dentara luxatia cu intruzie deplasarea dintelui in alveola cu fracturarea acesteia. luxatia laterala deplasarea dintelui in orice directie in afara de cea axiala. Este insotita de fractura alveolei. avulsia dentara pierderea dintelui din alveola dentara.

170

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 7
METODOLOGIA DE LABORATOR A IDENTIFICARII MEDICO-LEGALE AMPRENTA GENETICA
Scurt istoric si importanta geneticii judiciare Principiul identificarii genetice a fost elaborat in 1984 de Alex Jeffreys pe baza unor regiuni ale ADN-ului formate din anumite secvente care sunt repetate de mai multe ori. Numarul de repetari difera de la un individ la altul generADN un profil genetic sau amprenta genetica unica pentru fiecare individ. Amprenta genetica a fost utilizata prima data in Marea Britanie in anul 1985 pentru un test de paternitate intr-un caz de imigrare 115 iar in anul 1986 si-a dovedit utilitatea in identificarea lui Colin Pitchfork autorul violului si omorului a doua tinere din Leicestershire, Marea Britanie.116(p1) In anii urmatori amprenta genetica a fost folosita si pentru identificarea ramasitelor scheletale, cel mai celebru caz fiind identificarea scheletului lui Josef Mengele in Argentina.117 In prezent in tarile dezvoltate amprenta genetica este un examen de laborator de rutina cerut de justitie. De asemenea sunt multe tari care si-au creat baze de date genetice unde sunt stocate un numar impresionant de profile genetice. Obiectivele geneticii judiciare sunt: 1. identificarea persoanei in urmatoarele situatii: omucidere, delicte sexuale, catastrofe cu multiple victime, resturi scheletale, 2. stabilirea paternitatii, 3. construirea de baze de date genetice, 4. verificarea obiectivitatii unor sentinte judecatoresti care s-au facut pe baza unor probe biologice care nu au fost examinate genetic deoarece tehnologia era inexistenta la acea data. In toate situatiile amintite anterior, expertiza medico-legala genetica parcurge aceleasi etape: Extractia ADN-ului din probele biologice Generarea profilului ADN a probelor neidientificate si a celor de referinta. Compararea profilelor genetice obtinute Interpretarea statistica a rezultatelor Intocmirea raportului de expertiza genetica Notiuni generale de biologie moleculara Celulele umane au un singur nucleu si un numar variabil de mitocondrii care poate ajunge pana la cateva sute. Sunt doua tipuri de ADN in celulele umane: ADN nuclear si mitocondrial (mitocondriile sunt organite celulare care au forma de vezicule alungite si au rol in generarea energiei necesara functionarii celulei).

978-606-8363-03-5

171

Masterat cercetri criminalistice aplicate

Sectiune prin celula umana.118 ADN-ul nuclear se gaseste in nucleul celulei facand parte din structura cromozomilor. Are doua roluri: 1. de a se replica formand copii de ADN identice astfel ca celulele care se divid sa aiba aceeasi copie a ADN. 2. sa contina instructiunile pe baza carora sa se sintetizeze proteinele necesare dezvoltarii si functionarii organismului Informatia este mostenita din generatie in generatie jumatate de la parintele patern si cealalta de la cel matern. ADN-ul mitocondrial are rolul de sinteza a unor proteine esentiale dezvoltarii organismului si este transmis din generatie in generatie pe linie materna. Ambele tipuri de ADN sunt folosite pentru identificarea genetica, desi ADN-ul nuclear avand o variabilitate mai mare este mult mai util identificarii. Structura ADN ADN-ul sau acidul dezoxiribonucleic este o molecula complexa care contine codul genetic al organismului. Aceasta molecula este formata din subunitati care se numesc nucleotide. Fiecare nucleotida este formata din trei elemente: 1. baza azotata (elementul care difera in structura nulceotidelor), 2. molecula de glucid (dezoxiriboza) 3. un rest de fosfat anorganic.

172

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Structura nucleotidei.119(p29) Fiecare nucleotid contine una din cele patru baze azotate care sunt numite adenina, citozina, guanina si timina si sunt abreviate A, C, G, T. Denumirea nucleotidelor corespunzatoare este: acid deoxiadenilic, deoxiguanilic, deoxicitidilic, deoxitimidilic. Molecula de ADN este formata din doua lanturi antiparalele (antiparalel = lanturile sunt paralele dar secventele nucleotidice ale acestora sunt in sensuri opuse) legate intre ele prin intermediul bazelor azotate sub forma unui dublu helix. Fiecare lant in parte este alcatuit din nucleotide legate una de alta prin intermediul glucidului si gruparii fosfat.

Strucutra unui lant din ADN (stanga) si cele doua lanturi ale moleculei de ADN (dreapta).120(pp173,174) Diametrul helixului este de 20A (2x10-7mm), bazele vecine se gasesc la o distanta de 3.4A una de alta.119(p38) Structura de dublu helix a moleculei de ADN poate fi imaginata prin analogie cu o scara care este astfel torsionata incat sa formeze o spirala. Stalpii laterali ai scarii sunt formati din legaturile fosfodiesterice (intre glucid si gruparea fosfat) dintre nucleotidele adiacente. Fiecare treapta a scarii este formata din legaturile intre doua baze care sunt orientate catre centrul helixului, cate o baza atasata de fiecare stalp lateral. Bazele unui lant de ADN se leaga in mod complementar cu bazele celuilalt lant. Astfel A se leaga sau face pereche numai cu T si C numai cu G. Aceasta complementaritate prespune faptul ca daca A de pe un lant este proiectat in centrul helixului atunci in pozitia corespunzatoare de pe celalalt lant trebuie sa fie proiectat inspre centru T si la fel pentru C si G. Secventa bazelor azotate a nucleotidelor celor doua lanturi de ADN reprezinta codul genetic a fiecarei din cele aproximativ 100 mii de proteine diferite
978-606-8363-03-5 173

Masterat cercetri criminalistice aplicate

pe care o celula le produce in decursul vietii sale. 121(p8) (intr-un exemplu foarte simplu succesiunea AAT de pe un lant si respectiv TTA de pe celalalt vor codifica o proteina diferita de secventa GTT de pe un lant si CAA de pe celalalt lant). Informatia genetica este codificata in secventa celor 4 baze asa cum un computer codifica informatia in mod binar printr-o lant de secvente de 1 si 0. Pentru intelegerea principiului stiintific al testelor ADN este important ca strcutura moelculei de ADN sa fie vazuta ca o secventa de perechi de baze azotate, ignorandu-se prezenta lantului fosfat-glucid. Reprezentarea unui segment de ADN se face de obicei reprezentarea secventei de perechi de baze a celor doua lanturi:

CTTAGCCATAGCCTA GAATCGGTATCGGAT

Structura dublu helixului ADN.120(p177) Proprietatile moleculei de ADN 1. Hibridizarea este procesul de imperechere pe baza complementaritatii bazelor din structura lanturilor sau regiunilor din lanturile de ADN provenite din diferite surse (de exemplu un marker care are secventa AGGTCT se va lega de regiunea care prezinta secventa complementara TCCAGA de pe lantul de ADN tinta). 2. Denaturarea este procesul prin care dublul helix ADN sub actiunea caldurii este separat in lanturile complementare. Denatuarea este un proces reversibil, dupa racire cele doua lanturi de ADN se vor reuni sau rehibridiza pe baza complementaritatii bazelor formand din nou dublul helix intital. Molecula de ADN uman (care poate ajunge la o lungime de 7 cm) este impachetata in structuri numite cromozomi cu o lungime de 10m.121(p8) Daca vom considera ca bazele azotate ca fiind litere atunci fiecare cromozom este ca o carte scrisa cu ajutorul acestui alfabet format din 4 litere. Tinand cont ca exista circa 3 miliarde de nucleotide in genom si ca sunt 4 variante de nucleotide rezulta ca poate exista unu numar extrem de mare de combinatii de nucleotide. Genomul uman reprezinta totalitatea informatiei genetice purtate de molecula de ADN din celulele umane, altfel spus, toate celulele unui individ contin copiile aceluiasi set de carti care formeaza biblioteca denumita genomul uman. Aceasta paralela intre informatiei genetica si informatia transmisa de materialul scris a fost facuta de Buttler:122(p20)
174 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Informatia scrisa Informatia genetica Litera Nucleotide Cuvant Secventa scurta de nucleotide Paragraf Gena Capitol Nucleul celulei Carte Celula Biblioteca Organismul uman Comparatia dintre nivelurile de informaties crisa si genetica.122(p20) Procesul prin care se initiaza producerea de miliarde de celule din structura tesuturilor si organelor, toate avand acelasi genom incepe prin unirea celulelor sexuale (spermatozoid si ovul) cu formarea zigotului. Fiecare celula sexuala contine cate un set de 23 de cromozomi (dintre care 22 se numesc autozomi si unul este cromozom sexual X sau Y) astfel zigotul (celula fertilizata) va contine 23 de perechi de cromozomi sau 46 de cromozomi in total. Fiecare celula a organismului (in afara celulelor sexuale care contin un singur set de cromozomi) contine in nucleul sau 23 de perechi de cromozomi din care 22 de perechi sunt autozomi si care poarta informatia necesara dezvoltarii corpului si o pereche de cromozomi sexuali (femeile au doi cromozomi X iar barbatii un cromzom X si unul Y) care controleaza dezvoltarea organelor interne si externe ale reproducerii. Tatal doneaza jumatate din cromozomi si mama cealalta jumatate (sau continuand exemplul de mai sus, tatal doneaza jumatate din colectia de carti si mama cealalta). Celula fertilizata se divide apoi in doua celule fiecare din ea continand copii identice a setului de 46 de cromozomi. Apoi cele doua celule se divid pentru a forma patru celule, apoi cele patru vor forma opt si asa mai departe. Odata cu evolutia sarcinii diferitele celule se vor diferentia si vor forma tesuturi si organe. In acest mod fiecare individ va avea un imens numar de copii a perechii originale de 23 de cromozomi a oului fertilizat (o parte a fiecarei perechi este mostenita de la mama cealalta de la tata). In practica, identificarea genetica se face pe baza cromozomilor autozomi iar determinarea sexului pe baza cromozomilor sexuali. ADN-ul care alcatuieste cromozomii este compus din doua tipuri de regiuni: unele care codifica (denumite regiuni codante) si altele care nu codifica (regiuni non-codante) sinteza de proteine. Regiunile codante poarta denumirea de gene. ADN ul nuclear are 21500 de gene123 iar cel mitocondrial 16.569 base si 37 de gene. Genele ocupa un anumit loc in lantul ADN denumit locus (plural loci) si sunt formate din cateva mii pana la cateva zeci de mii de perechi de baze. Proteinele sintetizate pe baza informatiei transmise de gene determina spre exemplu talia si conformatia corpului si a segmentelor sale, culoarea parului sau a ochiilor, enzimele care au rol in digestia alimentelor, etc. (diferentele intre indivizi se datoreaza mutatiilor si recombiniarilor materialului genetic astfel ca este posibil
978-606-8363-03-5 175

Masterat cercetri criminalistice aplicate

ca o gena sa aiba diferite versiuni ale secventei de codificare asa incat sa produca proteine putin diferite intre ele dar care sa se prezinte si sa functioneze la parametrii normali determinand astfel diferentele intre indivizi. Fara mutatii sau recombinari toata populatia Pamantului ar fi avut exact aceeasi informatie genetica si deci indivizii ar fi semanat intre ei). Doar o mica portiune din genom circa 5% codifica proteine (regiuni codante)1(p9),122(p25) restul fiind reprezentat de regiuni non-codante repetitive care prezinta un inalt grrad de variabilitate intre indivizi. Tocmai datorita acestui fapt regiunile non-codante sunt supuse analizei in scopul identificarii genetice. Cromozomii pereche sunt denumti cromozomi omologi pentru ca sunt identici ca marime, forma i continut genetic.Un cromozom din pereche este mostenit de la mama altul de la tata. O copie din fiecare gena se gaseste in aceeasi pozitie (locus) pe fiecare din cromozomii omologi. Dar fiecare gena poate exista in doua forme alternative denumite alele fiind cate o alela pe fiecare cromozom din perechea de cromozomi. Daca examinarea de laborator pune in evidenta o singura alela inseamna ca persoana a mostenit exact aceeasi alela de la ambii parinti, si va purta numele de homozigot. Daca sunt doua alele atunci una a fost mostenita de la un parinte iar alta de la celalalt parinte si va purta denumirea de heterozigot. Diferentele intre alele prezente in loci identici sunt esentiale pentru identificarea umana. Genotipul indica diferitele alelelor prezente intr-un locus. De exemplu, daca sunt doua alele A si a intr-un locus atunci sunt posibile 3 genotipuri pentru acele alele: AA, Aa si aa. Genotipurile AA si aa sunt homozigote si genotipul Aa este heterozigot. In practica, in cazul a doua alele una prezentand 15 unitati repetitive iar cealalta 19 unitati atunci genotipul este desemnat ca 15,19 usurand astfel comparararea genotipurilor mai multor probe. Profilul ADN sau genetic este o combinatie de genotipuri obtinute pentru mai multi loci. Tiparea ADN-ului sau genotiparea (termen adaptat de la DNA typing) este procesul prin care se determina genotipul prezent la loci specifici de-a lungul moleculei de ADN. In cazurile practice nu se poate face tiparea intregii secvente a moleculei de ADN din probele biologice deoarece acest proces ar necesita un timp foarte indelungat si costuri foarte mari, in schimb se vor analiza si aceasta pentru: a reduce posibilitatea potrivirii genetice aleatorii intre indivizi neinruditi, a creste gradul de incredere atunci cand se concluzioneaza ca doua profile genetice provin din aceeasi sursa biologica in final sa se concluzioneze daca doua probele biologice sunt identice sau diferite. Rezultatul este foarte aproape de certitudine deoarece probabilitatea ca doua probe sa fie identice in mode intamplator este extrem de redusa. Butler, pentru o intelegere mai usoara corelatiei dintre numarul de loci analizati (markeri) si gradul de certitudine a identificarii face analogie cu modul de cartare a populatiei de catre Serviciul Postal din SUA:122(p30) Populatia SUA are peste 260 milioane de indivizi dar daca se inscrie pe plic codul postal, statul, orasul, strada, numarul imobilului si numele destinatarului, scrisoarea se va inmna unui singur individ. La fel, cu ct sunt mai multi markeri ADN cu att proba
176 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

ridicata de la fata locului poate fi atribuita unui singur individ. Daca markerii 1, 2, 3, etc., ai probei ridicate de la fata locului, sunt identici cu cei ai probei ADN ridicate de la un individ se poate afirma cu un anumit grad de certitudine ca cele doua probe ADN provin din aceeasi sursa. Certitudinea identificarii creste odata cu cresterea numarului de markeri . Polimorfismul moelculei de ADN, principiul identificarii genetice (polimorfismul ADN-ului este proprietatea anumitor regiuni ale ADN de a se prezenta sub mai multe forme, din latinul poly = mai multe si morf = forma) Majoritatea ADN-ului, 99.7%122(p29) este identic intre indivizi. Doar 0.3% difera, conferind unicitatea indivizilor. Deoarce scopul expertizei medico-legale genetice este de face diferenta intre indivizi atunci vor fi examinate reginiunile polimorfice ale genomului, regiuni care sunt diferite de la un individ la altul Tpurile de polimorfism genetic cu aplicabilitate in identificare strebuie sa se caracterizeze prin:1(p9),116(p16) variabilitate ridicata intre indivizi interpretare simpla a rezultatelor rata de mutatie scazuta pretabil unei tehinici ieftine Sunt doua tipuri de polimorfism: de secventa si de lungime 1. Polimorfism de secventa: ATCAGCAAT ATTAGCGAT

2. Polimorfism de lungime: (AGTT)(AGTT)(AGTT)(AGTT) 4 secvente repetitive (AGTT)(AGTT) 2 secvente repetitive

In urma cercetarilor din cadrul proiectului Genomul Uman s-a descoperit ca exista si o alta posibilitate de variabilitate genetica cunoscuta sub numele de Variantele Numarului de Copii (copy number variants sau copy number variation, abreviat CNVs) acestea sunt regiuni intinse de ADN care pot sa fie duplicate, sterse, sa li se inverseze orientarea sau mutate in alte locuri ale genomului.122(p29) Polimorfismul de lungime Tipul de polimorfism utilizat cu predilectie in identificarea genetica este variabilitatea numarului de repetitii in tandem a anumitor regiuni a ADN. Aceastea sunt denumite generic ADN satelit si sunt localizate in jurul centromerului (regiune centrala a cromozomului).
978-606-8363-03-5 177

Masterat cercetri criminalistice aplicate

VNTR (abreviere de la variable number tandem repeats) sau minisateliti a fost prima clasa de tandemuri repetitive folosite pentru identificarea genetica. Unul din dezavantajele lor este cantitatea mare de ADN nedegradat de care este nevoie, cerinta care de multe ori nu este satisfacuta de probele biologice colectate de la locul faptei (acestea sunt de obicei in cantitate mica si degradate) VNTR Au fost inlocuite cu fragmentele scurte repetitive in tandem abreviate STR (short tandem repeats) denumite si microsateliti. Acestea constau dintr-o secventa de 1-5 perechi de baze repetate de mai multe ori de-a lungul ADNului fara interpunerea altor secvente. Un STR tipic pentru identificarea umana este cel care are secventa repetitiva formata din 4 perechi de baze (tetranucleotid) determinand prin repetitie un fragment cu o lungime totala de 100-350 perechi de baze. Pentru ca loci STR sunt foarte polimorfici1(p9) si dimensiunile mici ale secventei repetitive ii face indicati in utilizarea lor in cazurile medico-legale cand cantitatea si calitatea ADN-ului din probele colectate de la locul faptei este de obicei slaba. De asemenea metodele tehnice care se bazeaza pe STR sunt rapide si automatizate. Exemplu de polimorfism alelic al unui tetranucleotid:124(p18)
CGGT reprezinta un tetranucleotid GCCA

TCTGGATGCCGCGGTCGGTCGGTAGTATCTTAGC AGACCTACGGAGCCAGCCAGCCATCATAGAATCG

Alela 1 contine trei repterai a secventei

CGGT GCCA

GGATGCCGCGGTCGGTCGGTCGGTCGGTAGTATCTT CCTACGGAGCCAGCCAGCCAGCCAGCCATCATAGAA

Alela 2 contine 5 repetari a secventei

CGGT GCCA

Polimorfism de secventa Cea mai simpla forma de variabilitate genetica de secventa este polimorfismul de unica nucleotida (SNP single nucleotide polimorphism). Se refera la faptul ca la un individ intr-un anumit locus se gaseste A iar la alt individ in acelasi locus se gaseste C, G sau T. La fiecare individ exista peste 1 milion de de SNP prezentand astfel un bun potential pentru utilizarea in genetica judiciara. Obiectivele expertizelor biocriminalistice genetice Ordonanta sau rezolutia motivata dispusa pentru efectuarea de expertize genetice trebuie sa aiba urmatoarea structura generala:125(p137)
178 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

1. Datele de indentificare a institutiei care emite ordonanta 2. Cauza pentru care este dispusa 3. Tipul de expertiza solicitata (in aceasta situatie fiind expertiza genetica) 4. Istoricul evenimentului sau infractiunii. Sunt foarte importante pentru desfasurarea optima si eficienta a activitatii expertale, deoarece acestea sugereaza localizarea si tipul urmelor biologice pe obiectele examinate si permit expertului sa aleaga metoda potrivita pentru procesarea acestora. 5. Obiective. In general, obiectivele unei expertize genetice sunt: determinarea profilelor genetice ale ADN din probele in litigiu determinarea profilelor genetice ale ADN din probele de referinta (victima si suspect) compararea profilelor genetice ale ADN din probele de referinta cu cele din probele in litigiu interpretarea biostatistica a rezultatelor Obiectivele trebuie insa adaptate fiecarui caz in parte in functie de particularitatile acestuia cat si a probelor in litigiu. 6. Probele materiale care se pun la dispozitie pentru efectuarea expertizei genetice. 7. Metoda de securizare a ambalajelor. Din momentul in care probele au intrat in custodia expertului acesta va raspunde de integritatea si conservarea lot, avand obligatia sa mentioneze in raportul de expertiza conditiile in care au fost primite probele prin verificarea si fotografierea integritatii sigiliilor. Etapele analizei genetice Colectarea probelor materiale

Extractia ADN

Cuantificarea ADN

Amplificarea PCR

Detectia produsilor de amplificare (generarea profilului ADN)

Amaliza si interpretarea datelor

Evaluarea statistica a rezultatlui

Intocmirea raportul de expertiza

978-606-8363-03-5

179

Masterat cercetri criminalistice aplicate

Sursele de ADN La locul faptei ADN-ul este prezent in fiecare celula nucleata (celule rosii ale sangelui sau hematiile fiind anucleate nu pot fi sursa de ADN nuclear). Pentru ca toate celulele organismului provin prin divizarea succesiva a zigotului (sau ovulul fertilizat) ele contin acelasi material genetic deci rezultatul analizei ADN este acelasi indiferent de tipul de celule examinate. La locul faptei sursele potentiale de ADN sunt variate astfel se pot colecta:126 1. sange (lichid sau in stare uscata) poate fi gasit: pe corpul sau imbracamintea suspectului si a victimei in zona imediat invecinata locului unde se gaseste victima, pe diferite obiecte sau suporturi existente la fata locului, pe obiectele prin care s-a savarsit infractiunea (obeicte contondente, taietoare-intepatoare, etc), vehicule (bara de protectie, capota, parbriz, volan, airbag, etc), ace de seringi. 2. sperma sau secretii vaginale (lichide sau in stare uscata) pot fi gasite: pe corpul sau imbracamintea suspectului si a victimei, pe diferite obiecte si suporturi din incinta sau zona adiacenta desfasurarii infractiunii (lenjerie de pat, pe obiecte de uz igienic si sanitar, prezervative). 3. Saliva sau secretii nazale pot fi gasite pe filtrele tigarilor, guma de mestecat, alimente din care s-a consumat, batiste, servetele si prosoape folosite, plicuri si timbre folosite, tacamuri, cani, pahare, sticle si cutii de bauturi intrebuintate, la nivelul plagilor muscate, pe instrumente de suflat, calusuri 4. fire de par cu radacina, capilar sau corporal (se poate aplica analiza genetica mitocondriala), pot fi gasite: pe corpul victimei sau suspectului, imbracaminte, palarii, perii sau piepteni, la locul faptei pe obiecte din acel perimetru 5. fragmente de tesut tegumentar, muscular, oase, dinti si organe se pot gasi pe obiectele prin care s-a savarsit infractiunea (obeicte contondente, taietoareintepatoare, etc), imbracamintea victimei sau suspectului, vehicule (bara de protectie, capota, parbriz, volan, airbag, etc), la locul faptei sau pe obiecte din acel perimetru 6. unghii, fragmente de unghii pot proveni de la suspect sau victima in cadrul faptelor comise cu violenta, infractiuni sexuale.
180 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

7. probe biologice de pe diferite suporturi rezultate din contactul cu pielea sau secretii sudoripare sau sebacee. Celulele epiteliale pot fi transferate prin contact tegumentar pe: obiecte prin care s-a savarsit infractiunea, imbracaminte, incaltaminte, manusi, palarii, amprente, diferite elemente de comanda a vehiculului, lame de barbierit, bratara ceasului, pansamente adezive.. 8. urina, materii fecale si lichid de varsatura desi obtinerea de ADN din materiile fecale este dificila deoarece constituientii bacterieni si chimici interfera cu metodele de extractia si analiza a ADN, compania Qiagen a pus la punct un kit de extractie a ADN din fecale.127 Urina nu contine in mod normal celule din care sa se poata extrage ADN, decat daca persoana sufera de afectiuni infectioase al rinichiului sau cailor urinare. Este mai usor sa se obtina un profil ADN complet din urina femeilor decat din cea a barbatilor datorita continutului mai mare in celule epiteliale.128 Probe de referinta Probe de referinta se recolteaza de la suspect si de la victima pentru a fi comparate cu probe neidentificate recoltate de la locul faptei cat si pentru identifcarea profilelor in cazul amestecului de lichide biologice. Probele care se recolteaza de la suspect pentru comparatie cu cele gasite la locul faptei sunt: 1. Sange venos (5ml folosind EDTA acid etilendiamintetraacetic - ca anticoagulant sau utilizarea cardurilor FTA129 care au simplificat colectarea, transportul si depozitarea probelor biologice lichide si tisulare. (Aceste carduri contin substante chimice care lizeaza (distrug, desfac) celulele din proba si imobilizeaza, stabilizeaza si conserva ADN-ul eliberat permitand conservarea si depozitarea lui la temperatura camerei pentru perioade lungi de timp. Lichidele biologice se adauga sub forma de picatura pe card, sau pot fi absorbite prin tamponament ; tesuturile se preseaza pe card, apoi se lasa sa se usuce dupa care pot fi ambalate, transportate, supuse examinarii sau depozitate. Cardul poate fi introdus intr-un plic special unde se introduce un desicant pentru a preveni umiditatea dupa care se scoate aerul).

978-606-8363-03-5

181

Masterat cercetri criminalistice aplicate

Carduri FTA (Whatman International Ltd)129

Adaugarea sangelui pe card (CODIS Laboratory Marshall University) Tampon bucal Fire de par cu radacina Conform legii (76/2008 art.7)130 prelevarea probelor biologice de la suspecti se realizeaza utiliznd truse de recoltare compuse din: a) ambalaj general; b) ambalaj pentru probe biologice; c) o pereche de manui chirurgicale, sterile, de unica folosinta; d) doua recoltoare cu cap detaabil sau doua recoltoare medical tip exudat; e) doua eprubete din material plastic care asigura conservarea probelor biologice recoltate; f) fia cu date personale; g) 4 etichete cu coduri de identificare generate de catre S.N.D.G.J.; h) instructiuni de utilizare a trusei de recoltare. De asemenea se pot recolta probe biologice si de la persoanele care au avut contact cu locul comiterii infractiunii in mod justificat sau accidental, in vederea excluderii acestora. Pentru identificare ramasitelor umane probele biologice care se recolteaza depind de stadiul descompunerii cadavrului: in cazul cadavrelor proaspete se recolteaza sange, tesut muscular, tegument, fire de par. La cadavrele unde
182 publicat online: www.itcode.ro

2. 3.

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

descompunerea nu mai permite recoltarea probelor amintite anterior sau sunt scheletizate atunci se va recolta os si dinti. Probele de referinta cu ajutorul carora prin comparatie se va incerca identifcarea ramasitelor umane se recolteaza sub forma sangelui venos sau tamponului bucal de la parinti, copii, rude. Butler131(p34) arata ca transferul direct de la un individ la altul sau pe un obiect poate fi folosit pentru a plasa suspectul la locul faptei. Transferul direct se poate intalni in una din urmatoarele situatii: ADN-ul suspectului depozitat pe victima (corp sau haine); ADN-ul suspectului depozitat pe un obiect; ADN-ul suspectului gasit la locul faptei; ADN-ul victimei depozitat pe suspect (corp sau haine); ADN-ul victimei depozitat pe un obiect; ADN-ul victimei aflat la locul faptei; ADN-ul martorilor aflat pe victima sau pe suspect; ADN-ul martorilor aflat pe un obiect; ADN-ul martorilor aflat la locul faptei. Cercetarea la fata locului efectuata in contextul prezentei probelor biologice ce urmeaza sa fie examinate din punct de vedere genetic. Daca probele biologice nu sunt documentate, colectate, ambalate, transportate si conservate corespunzator, acestea risca sa nu fie admise in justitie:125,137(pp23-35) daca probele biologice nu sunt documentate corespunzator, inaintea colectarii, originea acestora poate fi contestata. cand colectarea este incorecta, probele se pot distruge. daca ambalarea este incorecta, probele se pot contamina sau distruge. pastrarea in conditii necorespunzatoare poate duce la degradarea probelor. Se vor parcurge etapele tipice ale cercetarii probelor biologice (snge, sperma, saliva): identificare, documentare, colectare, dar la fiecare etapa se impun precautii suplimentare in vederea eliminarii riscului de contaminare a probelor:125,131(p38), 137(pp23-35) Inainte de colectare probele biologice vor fi documentate corespunzator (fotografiere/filmare, schitare, descriere). Colectarea probelor biologice de la locul savririi infractiunii se realizeaza, cu ajutorul truselor destinate acestui scop, de catre polititi criminaliti, la solicitarea organului de urmarire penala sau instantei de judecata (legea 76/2008 art .14(1)130). Obiectele sau portiuni ale acestora unde se presupune existenta de urme ADN se vor manipula numai cu manusi de latex. Manusile trebuie sa se schimbe de fiecare data cand se colecteaza o noua proba. Se vor folosi instrumente de unica folosinta sau sterile care se vor schimba intre colectarile diferitelor probe.
978-606-8363-03-5 183

Masterat cercetri criminalistice aplicate

Se va avea grija sa nu se tuseasca sau sa se stranute peste obiectele purtatoare de ADN. Se va purta costum de protectie inclusiv boneta si masca Fiecare proba trebuie ambalata separat Ambalajul consta din plicuri sau pungi de hartie. Pungile de plastic trebuie evitate deoarece condenseaza umezeala si favorizeaza aparitia mucegaiului care favorizeaza degradarea ADN. Ambalajele trebuie sigiliate si notate numarul cazului, numarul probei, data si numele celui care a facut colectarea. Materialele textile, obiectele transportabile si materialele folosite la recoltare care prezinta pete umede de sange, sperma sau de alte tipuri de lichide biologice trebuie sa fie uscate prin expunere la aer inainte de a fi ambalate. Uscarea nu se face prin expunere directa la soare (razele UV distrugand ADN-ul) si nici nu se face o uscare accelerata prin expunerea probei la o sursa de caldura. Cand cantitatea de lichid biologic este mare (balti de sange) acesta se poate recolta cu ajutorul unei pipete sau seringi sterile dupa care lichidul se introduce intr-o eprubeta de asemenea sterila care se refrigereaza. Lichidele biologice si frgamentele de tesut sau organe colectate se pastreaza la frigider si este recomandat sa fie expediate cat mai repede la laborator. Daca materialele textile si obiectele transportabile prezinta pete uscate, acestea vor fi colectate cu totul si trimise la laborator fara a se incerca recoltarea pe tampoane la locul faptei. In cazul petelor uscate de pe materiale textile netransportabile (covoare, tapiterii) acestea se decupeaza cu o foarfeca sau bisturiu steril si se ambaleaza corespunzator. De asemenea se recolteaza un fragment de control dintr-o zona ce nu prezinta pete biologice. Petele uscate de pe obiecte sau suprafete netransportabile vor fi transferate prin tamponament pe tampoane sterile de bumbac imbibate in prealabil cu apa distilata apoi se vor lasa sa se usuce la aer. Se va ambala fiecare tampon in ambalaj de hartie separat. Daca petele sunt umede se vor absorbi intr-un tampon uscat. Fragmentele de tesut se recolteza cu o penseta sterila sau de unica folosinta intr-un recipient curat care se pastreaza la frigider pana la expedierea rapida la laborator. Prelevarea probelor biologice de la cadavrele cu identitate necunoscuta, recoltarea probelor biologice cu ocazia efectuarii autopsiei, precum i prelevarea probelor biologice prin metode invazive se efectueaza de institutiile medico-legale (legea 76/2008 art.15(1)130 ). In laborator ADN-ul extras din probele biologice este pastrat pentru o durata scurta sau medie la frigider (-4oC) sau congelator (-20oC). Pentru
184 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

depozitare pe o perioada lunga de timp este recomandabil ca ADN-ul extras sa fie depozitat la -70oC. 122(p87) Molecule de ADN se pastreaza cel mai bine in stare uscata (ce previne hidroliza) si protejate de ADN-aze (enzime care distrug ADN) vezi discutia despre carduri FTA. Pastrarea i transportul probelor biologice se realizeaza cu mijloace i in conditii care asigura securitatea i integritatea acestora precum i securitatea persoanelor care intra in contact cu acestea.

Teste de de laborator prezumtive si confirmatoare Obiectele colectate de la locul faptei sunt examinate in laborator pentru a se identifica si selecta portiunea care va fi supusa testelor. Pentru a ecnonomisi timp si resurse financiare inainte de a se incepe procesul de analiza genetica a probei se vor realiza teste prezumtive cu scopul de a indica daca exista lichid biologic sau nu pe obiectul supus examinarii. Reactiile de prezumtive sunt simple si rapid de realizat, au nevoie doar de putina cantitate de produs biologic, in reactivii respectivi se introduce fie o crust sau fragment din materialul ptat, fie o pictur din maceratul obtinut din pat. . Dezavantajul lor este ca nu sunt specifice putand da rezultate pozitive si pentru alte substante din plante, fructe, lapte, pamant, rugina, etc. Reactii prezumtive pentru sange Sunt reactii de culoare a caror principiu este urmatorul: unele substante colorante sunt incolore in stare redus (leucobaze), iar in prezenta unui sistem de oxidare format dintr-un peroxid (ap oxigenat) si o peroxidaz (pigmentul sanguin - hemoglobina -) se recoloreaz.133(p640) Exemple: reactia Adler - reactivul contine benzidin, reactia pozitiva damd o culoare albastra; reactia Kastle-Meyer componenta de baza este fenolftaleina reactia pozitiva da o culoare rosie.134(pp217,218 Un alt test prezumtiv este utlizarea Luminolului.134(p219) care produce luminescenta in prezenta sangelui. Avantaje: 1. se pot examina suprafete intinse deoarece luminolul se poate imprastia sub forma de aerosol. Examinarea trebuie facuta insa la intuneric pentru ca florescenta sa poata fi observata usor. 2. pune in evidenta pete de sange care nu pot fi vazute cu ochiul liber in materiale textile, covoare, tapet, pardoseala. 3. localizaeaza microurme de sange care au fost diluate de pana la 10 milioane de ori.122(p91) Dezavantaje: da reactii pozitive si pentru peroxidaze vegetale de exemplu juice proaspat de portocale, metale si anumiti agenti de spalare care contin hipocloriti.

978-606-8363-03-5

185

Masterat cercetri criminalistice aplicate

Aplicarea de luminol a pus in evidenta pe lana balta de sange vizibila cu ochiul liber si pete de sange pe perete si produse prin tarare.135(fig,15)

Apartenenta de specia a sangelui Dupa ce s-a pus in evidenta prezenta sangelui in/pe probe, urmeaza sa se stabileasca apartenenta de specie a sangelui. Pentru aceasta se folosesc metode imunologice cu antigene specifice de specie. Reactii prezumtive pentru pete de sperma Vasilescu 133(p652) descrie aspectul macroscpic al petelor de sperma recente in felul urmator: pe material absorbant au o culoare alb-glbuie, cu aspect mat, scrobit, cu marginile bine delimitate. petele de pe obiectele splate au o culoare mai glbuie, difuz, fr a avea consistenta de scrobit. pe suporturile lucioase pata de sperm formeaz o pelicul scuamoas, usor strlucitoare, albicioas. Pata de sperm iluminata pe suport cu lumina ultravioleta va produce o fluorescent violeta spre albastru-verzui. Reacti microcristalografice care se observa la microscop rezultatul pozitiv consta in formarea de cristale de diferite culori si forme datorate reactiei componentilor din maceratul obtinut din pata de sperma cu diferiti reactivi: -Reactivul Florence: formeaza in prezenta spermei cristale alungite cu unul din capete despicate in coad de rndunic de culoare brun-acaju. -Reactivul Barberio: formeaza in prezenta spermei cristale aciculare de culoare galbena. Reactia fosfatazei acide aceasta este o substanta secretata de prostata care in prezenta reactivului Welker (alfanaftilfosfatul de sodiu) da o culoare rosie. Reactii prezumtive pentru saliva
186 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Pata de saliva este aproape invizibila pentru ochiul liber uneori pe unele suporturi poate avea o palida culoare alb galbuie. Testele prezumtive constau in determinarea amilazei salivare. Kit-uri pentru teste prezumtive Tehnica moderna a reactiilor prezumtive utilizeaza kit-uri produse de diverse companii. Aceste kit-uri sunt usor de folosit si interpretat. Kit ABAcard HemaTrace.136 Deasupra test pozitiv pentru sange. In ambele kituri se observa o banda de control care arata functionarea optima a kit-ului. In godeuri se pune maceratul din pata de sange. Testul identifica cantitati de sange de 0.07g/ml.137

Dezvoltarea tehnologica a permis chiar producerea de catre compania Independent Forensics de kit-uri cu care sa se stabileasca cu certitudine prezenta de sange, sperma, saliva si urina in pete.138

Kituri Rapid Stain Identification pentru sange care demonstreaza sensibilitatea testului.139 Extractia ADN din probele biologice Extractia cat si cuantificarea ADN din probele materiale sunt etape deosebit de importante pentru obtinerea unui ADN de buna calitate (nedegradat) si in cantitate suficienta pentru desfasurarea intregului proces tehnologic al identificarii genetice (Michaelis124(p27) rezuma importanta acesei etape prin cuvintele: gunoi intra, gunoi iese). Prima etapa a procesului analitic genetic este reprezentat de extractia ADN din probele materiale colectate de la fata locului sau recoltate de la persoanele implicate in cazul respectiv. In interiorul nucleului, ADN-ul este atasat de proteine si alte elemente celulare care au rol de a ii pastra integritatea dar care interfera cu procesul analitic, din acest motiv ADN-ului trebuie separat de restul componentelor celulare.
978-606-8363-03-5 187

Masterat cercetri criminalistice aplicate

Meotdele de extractie care se utilizeaza in cadrul Laboratorului de Genetica Judiciara din cadrul Institutului Criminalistic al Inspectoratului General al Politiei Romne, sunt adaptate diferitelor tipuri de probe analizate:140 izolarea ADN-ului din urmele biologice ridicate de la scena crimei - extractia organica cloroform / alcool izoamilic / fenol; izolarea ADN-ului din probe de snge i probe bucale - extractia cu raina chelex; izolarea ADN-ului din secretia vaginala . extractia diferentiala cu ajutorul proteinazei K i DTT (ditiotreitol) Principiul general al acestor metode este urmatorul: in prima etapa se rup membranele celulare pentru a se elibera continutul celular in solutie apoi proteinele celulare sunt denaturate astfel ca ADN-ul poate fi separat de restul elementelor celulare. In cazul oaselor extractia incepe prin triturarea mecanica a acestora cu formarea unei pudre fine pentru a permite materialuui celular sa se dizolve intr-o solutie apoasa, care va fi supusa procedeelor de extractie. Procesul de extractie este etapa in care pericolul de contaminare a probei de ADN este cel mai ridicat. Indiferent de metoda de extractie toate probele vor fi manipulate cu grija pentru a se evita contaminarea intre probe sau cu ADN din surse externe. Este recomandat ca probele de la fata locului si cele de comparatie sa fie procesate separat atat in timp cat si in alt loc al laboratorului.
Tip de proba biologica Sange lichid Pata de sange Tampon vaginal Par smuls cu radacina Par cazut cu radacina Saliva lichida Tampon bucal Urina Os Tesut Cantitate de ADN 20.000 40.000ng/ml 250 500ng/cm2 10 3000ng/tampon 1-750ng/radacina 1 10ng/radacina 1000 10.000ng/ml 100 1500ng/swab 1 20ng/ml 3 10ng/mg 50 500ng/mg

Cantitatile de ADN care poate fi extras din probele biologice.122(p 101) Materialului biologic din dinte, pentru examinarea genetica, se obtine prin sectionarea orizonatala a dintelui la jonctiunea smalt-cement sau prin sectionarea verticala interesand si apexul radacinii, dupa care se face raclarea sau aspiratia tesutului pulpar.141

188

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Etapele diferitelor metode de extractie a ADN.122(p101)

Extractie diferentiata a ADN masculin si feminin in cazul amestecului de lichide biologice in viol.122(p106),131(p46) Cuantificarea ADN Urmeaza etapei de extractie in care se masoara cantitatea si puritatea ADN extras in vedera utilizarii unei cantitati optime pentru urmatoare etapa a procesului (amplificarea PCR) stiindu-se ca o cantitate prea mare sau prea mica de ADN in procesul analitic va genera in final un profil genetic greu de interpretat.
978-606-8363-03-5 189

Masterat cercetri criminalistice aplicate

Cantitatea optima de ADN pentru amplificarea PCR este in jur de 1 ng.


122(112)

Influenta cantitatilor de ADN asupra rezultatelor analizei genetice.122(p112) Principiul clasic de cuantificare a ADN extras presupune utlizarea unor markeri care se leaga de lantul dublu al ADN si care produce fluorescenta la iluminarea cu o anumita lungime de unda. Se compara vizual intensitatea acestei florescente cu cea produsa de fragmente ADN etalon a caror cantitate este cunoscuta.

Cuantificarea ADN prin metoda slot blot.122(115) Placa de microtritrare Picogreen142 este o metoda rapida si mai sensibila de cuantificare a ADN dezvoltata de Invitrogen 143 capabila sa dozeze o cantitate de minimum 25 pg/ml de lant dublu ADN. In fiecare din cele 96 godeuri ale placii se adauga. Colorantul fluorescent PicoGreen care se amplifica semnificativ atunci cnd se intercaleaza intre bazale nucleotidice a ale dublui lant ADN. Real time PCR denumit si PCR cantitativ sau analiza cinetica122(p117) este o metoda foarte sensibila, relativ rapida care determina cu acuratete atat cantitatea cat si puritatea ADN extras din proba prin analiza de la ciclu la ciclu a schimbarilor in fluorescenta rezultata din amplificarea secventei tinta ADN in timpul PCR. Aceasta metoda este realizata prin introducerea in reactia PCR a unui colorant fluorescent care se intercaleaza in dublul lant ADN astfel ca pe masura ce numarul de secvente tinta de ADN se mareste se va constata o crestere proportionala a fluorescentei. La sfarsitul fiecarui ciclul de amplificare se poate estima catitatea de ADN rezultata prin multiplicare.
190 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Analiza porlimorfismul de lungime a ADN Se poate face prin doua metode bazate pe: 1. Analiza VNTR prin metoda polimorfismul lungimii fragmentelor (ADN) de restrictie (RFLP restriction lenght polimorfism). A intrat in uz incepand din mijlocul anilor 80 iar FBI-ul a introdus-o in practica in 1988.124(p50) Meotda RFLP consta din fragmentarea ADN extras cu enzime (de restrictie), separarea electroforetica a fragmentelor in functie de greutatea moleculara si identificarea acestora prin hibridizare cu sonde marcate radioactiv.

Autoradiografie RFLP. Suspectul numarul doi este identificat ca fiind sursa produsului biologic intr-un caz de viol.144 Datorita dezavantajelor, a fost rapid inlocuita de analiza STR. 2. Analiza STR prin metoda reactiei in lant a polimerazei (PCR polimerase chain reaction). Comparand cele doua metode rezulta ca: o timpul necesar pentru analiza: in cazul meotdei PCR este de cateva ore pana la cel mult 1 -2 zile iar pentru RFLP cu markeri marcati radioactiv timpul necesar unei analize este de 6-8 saptamni, iar cu markeri chemiluminiscenti decirca o luna. o cantitatea de ADN necesara testului: in cazul RFLP 50 500 ng de ADN dublu lant in forma nedegradata, pentru PCR 0.1 1ng de ADN sub forma de lant singular sau dublu lant, chiar si in stare foarte degradata. o metoda RFLP nu poate fi automatizata. o RFLP are o capacitate de diferentiare a profilului genetic intre persoane inrudite mult mai mica decat a PCR o rezultatele unei analize PCR pot fi usor comparate cu baze de date genetice.122(pp32,68)

978-606-8363-03-5

191

Masterat cercetri criminalistice aplicate

Amplificarea ADN reactia in lant a polimerazei PCR Aceasta metoda care a revolutionat biologia moleculara si genetica judiciara, functioneaza ca un fotocopiator care multiplica o regiune specifica a ADN tinta de miliarde de ori. (dupa 32 de cicluri fragmentul de ADN este multiplicat de peste 1 miliard de ori iar dupa 34 de cicluri de peste 4 miliarde de ori). In termeni genetici aceste proces este denumit amplificare iar fragmentul de ADN amplificat (multiplicat) se numeste amplicon. Deoarece probele biologice colectate de la locul faptei sunt de cele mai multe ori degradate si in cantitate redusa este cruciala multiplicarea continutul de ADN pana la un nivel optim analizei genetice. Componentii principali ai PCR:122(p130) ADN extras din proba biologica in cantitate de 1 10ng 2 amorse de reactie (sau primeri) sunt fragmente mici (18-30 de baze) de ADN obtinute prin sinteza chimica fiind sub forma unui singur lant. Se leaga de regiuni specifice a ADN-ului definind (flancand) zona tinta de amplificat (multiplicat) care de obicei este mai mica de 2000 de baze. Sunt adaugati in reactie in concetratie mare. Un colorant fluorescent este atasat de unul din cei doi primeri, astfel ca in procesul de amplificare PCR acest marker fluorescent se va regasi in fiecare noua copie de ADN tinta. Taq-polimeraza care este o enzima termo stabila (Taq este abrevierea de la termofilus acuaticus, bacterie ce traieste in ape termale). Cele 4 nucleotide A,G,C,T (acid deoxiadenilic, deoxiguanilic, deoxicitidilic, deoxitimidilic) in concentratie de 200 M fiecare. Acesti componenti sunt amestecati intr-un singur tub, volumul probei fiind intre 5 50l. Tubul va fi introdus intr-un termociclu, un instrument care cu acuratete si precizie incalzeste si raceste proba de ADN in cicluri controlate atat ca temperatura cat si ca interval de timp. Protocoalele pentru amplificare sunt diferite in functie de producatorii kit-urilor dar in general un ciclu este format din trei faze: 1. Denaturare temperatura sistemului este ridicata la 95oC. Aceasta determina separarea dublului lant a ADN in cele doua lanturi componente. 2. Temperatura sistemului este scazuta la 50o 60oC ceea ce permite cuplarea primerilor la capetele regiunii tinta ADN 3. Temperatura sistemului este ridicata la 72oC care este optima pentru functionarea Taq-polimerazei. Aceast adauga nucleotide la unul din capetele (3) fiecarui primer generand o noua sceventa de ADN cu strucutra nucleotidica complementara secventei tinta. Numarul optim de cicluri este intre 28 si 32. Numarul poate fi crescut la 34 atunci cand cantitatea de ADN extras este foarte scazuta. Peste acest numar de cicluri creste probabilitatea de contaminare a ADN-ului si de obtinere a unor artefacte.

192

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Etapa

Kit AmpFl STR (Applied Biosystems) Numar de cicluri 28 Incubare intiala La 95C pentru 11 minute Denaturare La 94C pentru 1 minut Cuplarea primerilor La 59C pentru 1 minut Extensia primerilor La 72C pentru 1 minut Extensia finala La 60C pentru 60 minute Etapa finala (daca se lasa probele in Intre 4 - 25C pana cADN probele sunt termociclu mai mult de 18 ore) scoase din termociclu Etapele unui ciclu PCR la kit AmpFl STR.145(p7) Multiplex PCR este denumirea metodei prin care se amplifica in acelasi proces doua sau mai multe regiuni (loci) ale ADN prin folosirea mai multor seturi de primeri. Analiza STR Urmeaza etapei de amplificare PCR a ADN-ului extras. Sunt comercializate kit-uri multiplex care analizeaza 13 loci (in SUA denumiti loci CODIS abreviere de la Combined DNA Index System.), 15 sau 16 loci, rezultand profile genetice cu o putere foarte mare de discriminare intre persoane. Dupa cum am mai spus STR sunt secvente scurte repetitive de ADN. Analiza genetica foloseste in special unitatea STR formata din 4 baze (tetranucleotide), determinand numarul de repetari ale acestei unitati la locuri specifice (loci) de pe lantul ADN. Prin compilatia numarul de repetari observat in fiecare din aceste locuri este generat profilul ADN. Se va compara profilul ADN rezultat din probele recoltate de la fata locului cu profilul ADN al indivizilor putandu-se astfel determina cine este sursa probelor biologice gasite la locul faptei. Dupa ce secventele tinta de ADN sunt amplificate prin PCR, trebuie ca acestea sa fie separate in functie de dimensiuni (dimensiunea fragmentelor tinta este data de numarul de repetari a secventei STR). Separarea se realizaeaza printrun proces denumit electroforeza care poate decurge in doua tipuri de medii cu structura poroasa: 1. gel de poliacrilamida dispus intre doua placi de sticla 2. polimer vascos asemanator gelului ce este injectat intr-un tub capilar de cuart (cu o lungime de 50 de cm si un diamteru intern de 50 de microni, astfel ca mediul de separare al capilarului poate fi imaginat ca o fasie ingusta si lunga ce permite trecerea cate unui singur fragment ADN odata). Principiul general al separarii electroforetice: se aplica curent electric sistemului ce contine mediul de separare si pentru ca ADN-ul are o molecula incarcata negativ acesta va migra catre electrodul pozitiv (catod). Mediul de separare este poros astfel ca fragmentele mai scurte de ADN vor migra mai rapid decat fragmentele mai lungi rezultand separarea fragmentelor pana la o diferenta de
978-606-8363-03-5 193

Masterat cercetri criminalistice aplicate

o baza. (moleculele mai mici trec mai repede prin porii mediului de separare si de aceea ajung la catod inaintea moleculelor mai mari). Fragmentele astfel separate vor fi detectate pe baza markerului fluorescent specific (emite lumina de o anumita lungime de unda) pentru fiecare tip de fragment ADN tinta. Cel mai folosit sistem de analiza genetica este cel bazat pe eletroforeza capilara deoarece: toate etapele procesului de electroforeza capilara pot fi automatizate necestia cantitati foarte mici de de proba metoda rapida (de ordinul minutelor) prin aplicarea unui curent eletric de inalta tensiune (15.000 V) analiza se poate repeta rezultatele analizei sunt salvate direct in format electronic

Schema instrumentului folosit pentru electroforeza capilara.122(p181) Capilarul este umplut cu o solutie vascoasa de polimer, porii acestuia vor juca rolul ochiurilor unei site prin care trebuie sa treaca fragmentele de ADN. Tuburile ce contin solutia cu ADN-ul amplificat sunt asezate pe un stativ de unde vor fi injectate in capilar prin aplicarea de curent electric (injectie electrocinetica).

194

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Detectia si separarea fragmentelor ADN prin electroforeza capilara.116(p71) Dupa injectare se aplica o tensiune inalta (15.000V) pe capilar care determina migrarea fragmentelor de ADN catre catod si separarea acestora in functie de dimensiuni. La capatul dinspre catod a tubului exista o ferestra prin care o raza laser excita colorantii fluorescenti atasati fiecarui fragment de ADN amplificat pe masura ce acestea trec prin fata ferestrei in procesul de migrare catre catod. Fragmentele mai mici vor ajunge la locul de iluminare laser inaintea frgamentelor mai mari. Fluorescenta emisa de coloranti este detectata automat si inregistrata producand o electroferograma. Fragmentele de ADN marcate vor aparea pe electroferograma sub forma de peak-uri (varfuri) in funcite de intensitatea semnalului fluorescent si de timpul pana la trecerea prin dreptul ferestrei capilare. Fiecare peak reprezinta cate o alela prezenta la un anumit locus. Daca persoana este heterozigot pentru un anumit locus, atunci vor apare doua peak-uri pe electroferograma reprezentand cele doua alele, daca apare un singur peak atunci acel locus este homozigot existand o singura alela. Totalitatea peakurilor alelice formeaza profilul genetic al persoanei respective. Pentru a putea intrepreta rezultatele electroferogramei trebuie ca software-ul sa calculeze dimensiunile peakurilor. Pentru aceasta se adauga in amestecul ce va fi supus amplificarii PCR un etalon (sau standard) dimensional intern format dintr-o serie de fragmente ADN cu dimensiune cunoscuta marcate cu un colorant diferit fata de cei folositi pentru marcarea fragmentelor de analizat (in cazul kitului AmpFl STR Identifier se foloseste un colorant rosu.146(p6-3)

978-606-8363-03-5

195

Masterat cercetri criminalistice aplicate

Standard dimensional intern.116(p73) Loci utilizati in genetica judiciara sau fost bine caracterizati, mai multe alele au fost secventializate pentru a li se determina structura si a se stabilii daca dimensiunile peak-urilor sunt un bun indicator al alelelor pe care le reprezinta. Deoarce standardul dimensional intern variaza usor sub influenta conditiilor in care se desfasoara electroforeza (de exemplu, temperatura) si pentru ca anumite alele STR difera doar printr-o singura pereche de baze, pentru a se asigura obtinerea unor rezultate acurate au fost adoptate scari alelice etalon care contin toate alelele comune fiecarui locus:116(p74)

Scara alelica etalon a kitului AmpFlSTR SGM Plus care contine toate alelele comune.116(p75) Compararea peak-urilor rezultate din ADN-ul din probe necunoscute cu scara alelica etalon se face fie manual fi cu ajutorul software-urilor (de exemplu pentru kiturile Applied Biosystems sunt programele: Genotyper sau GeneMapper ID). In cadrul acestui proces se vor compara alelele necunoscute ale profilului cu scara alelica etalon. Rezultatul ; final este un profil unde alelele au fost desemnate peak-urilor din profil.

196

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Compararea alelelor necunoscute cu scara alelica etalon permite alelelor din locusul TH01 sa fie clasificate ca fiind 7 si 9.3. (sus scara alelica etalon, jos alele din profilul necunoscut).116(p75)

Profil complet AmpFl STR SGM plus. Cei patru coloranti permit diferentierea alelelor de dimensiuni asemanatoare (de exemplu D3S1358 si D19S433 sunt foarte apropiate dar pot fi diferentiate deoarece D3S1358 este colorat albastru iar D19S433 este negru (de fapt este galben dar pentru claritate este aratat in negru). In profilul de mai sus patru loci sunt homozigoti D19S433, D8S1179, FGA, si D16S359 continanad doua copii a aceleiasi alele, ceilalti loci sunt heterozigoti avADN cate doua alele (reprezentate prin doua peakuri). Peakurile mici (care nu sunt hasurate) reprezinta stADNardul dimensional.1(p15) In electroferograma de mai jos sunt aratate rezultatele a 3 loci (kit SGM Plus): D8S1179, D21S11, ADN D18S51. Prin masurarea dimensiunilor alelelor se poata acorda fiecareia un numar. Acest numar reprezinta numarul de secvente repetitive prezente in alela. Locusul D21S11 are doua alele, una cu 27 de repetari a secventei si una cu 29, D18S51 are tot doua alele una cu 12 repetari ale secventei si alta cu 14. Intregul profil este codificat in acest fel.

978-606-8363-03-5

197

Masterat cercetri criminalistice aplicate

Identitatea alelelor este arata in dreptunghi. Locusul amelogeninei permite determinarea sexului (amelogenina este o proteina implicata in procesul de mineralizare smaltului dintilori, alele care codifica aceasta proteina se gasesc pe ambii cromozomi sexuali, dar cea de pe cromozomul X este mai scurta decat cea de pe Y cu 6 baze. Astfel profilul unui barbat va prezenta doua peakuri corespunzatoare alelei de pe cromzomul X si unul pentru cea de pe Y iar cel de femeie doar un peak femeia avADN aceeasi alela pe cromozomii X X) Profilul din imagine este cel al unui barbat. Locusul D8S1179 este homozigot iar loci D21S11 ADN D18S51 sunt heterozigoti. Peakurile mici care si nehasurate sunt stamdardul intern. 1(p16) Atunci cand dimensiunile alelelor sunt determinate pentru toti loci examinati se poate genera profilul ADN. (dupa cum am afirmat profiul ADN este o lista dimensiunilor tuturor alelelor pentru fiecare locus). In urmatoarea etapa profiul obtinut dintr-o proba in litigiu poate sa fie comparata cu profilul ADN a unei probe de referinta (de la victima, suspect, martor, sau ruda). Pot exista urmatoarele rezultate: o excludere cADN profilele sunt diferite aceasta inseamna ca proba colectata de la locul crimei nu apartine suspectului sau persoanei de referinta o includere daca profilele sunt la fel. In aceasta ultima varianta, rezultatul de identitate trebuie supus interpretarii statistice, pentru ca analiza STR utilizeaza un numar restrans de loci (de exemplu, 16 la kitul AmpFlSTR) putandu-se specula ca exista posibilitatea de identitate pentru alti loci ai moleculei de ADN care nu au fost testati. Prin metode statistice se va determina cat de comun este profilul ADN al probei intr-o populatie data.. Sunt baze de date pentru frecventa populationala a alelelor in fiecare locus. Aprecierea raritatii statistice a unui profil este data de numarul de loci testati si raritatea alelelor in acei loci. Daca calculul statistic al unui anumit profil depaseste o anumita limita atunci se poate afirma ca individul este sursa probei biologice. Calculul statistic, prezentat aici in forma cea mai simpla, decurge in felul urmator: 1. in prima etapa se determina care baza de date se potriveste profilului rasial si etnic al individului. 2. in etapa urmatoarei se estimeaza frecventa fiecarei alele care este identitica in proba in litigiu si in cea de la individul de referinta. Aceasta se calculeaza prin raportarea la baza de date selectata care a fost construita din profilele genetice a cel putin 100 de indivizi selectati din populatia respectiva, la care se calculeaza frecventa fiecarei alele. Pentru a se calcula frecventa unui anumit profil ADN in populatie se foloseste regula produsului: se inmultesc frecventele tuturor genotipurilor (alelelor) care intra in profilul respectiv.. Raportarea unui profil ADN se face sub forma unui tabel alelic, pentru exemplificare sa consideram urmatorul exemplu obtinut cu kitul ProfilerPlus:37(p98)
198 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal


D3S3158 Proba in litigiu Suspect 1 Suspect 2 Suspect 3 16,18 15,16 16,16 16,18 VWA 16,16 16,16 15,16 16,16 FGA 19,25 19,25 21,23 19,25 D8S1179 13,14 13,14 14,14 13,14 D21S11 29,30 29,30 27,28 29,30 D18S51 17,17 14,17 17,17 17,17 37(p98)

lect. univ. dr. Dogroiu Ctlin


D5S818 11,11 11,11 10,11 11,11 D13S317 10,11 10,11 8,9 10,11 D7S820 9,10 9,10 8,9 9,10 Amel XY XY XY XY

Tabel alelic.

o in randul de sus sunt trecuti loci analizati. o corespunzator fiecarui locus sunt reprezentate numeric alelele acestora. De exemplu in cazul suspectului 1 locusul D3S1358 este heterozigot fiind avand alelele 15 si 16 (alela cu 15 repetari a secventei si a doua alela cu 16 repetari), suspectul 2 este homozigot pentru acest locus, prezentand doar alela 16. o suspectul 1 si 2 au profile diferite fata de profilul probei in litigiu, deci in cazul lor rezultatul analizei genetice este de excludere. o profilul suspectului 3 este identic cu cel al petei de la fata locului, deci rezultatul este o includere. Se va calcula apoi frecventa statistica in populatie a combinatiei de alele prezente in profilul suspectului. De exemplu, Locus Negroizi Caucazieni pentru locusul VWA daca 8% din barbatii populatiei prezinta alelele 15 si 21.6% prezinta alela 16, frecventa perechii de alele va fi data de regula produsului fiind de 2 x 0.08 x 0.216 = 0.0346 sau 3.46% din barbatii populatiei vor avea in locusul VWA alelele 15-16. Mutiplicand frecventa tuturor locilor rezulta cai frecventa estimata a intregului profil ADN in populatie va fi foarte mica (de 1 la cateva sute de milioane).

Exemplu de freceventa a alelelor in populatia SUA.146(p14-3)

978-606-8363-03-5

199

Masterat cercetri criminalistice aplicate

Comparatia profilelor genetice intr-un viol. V=victima, S1 si S2 = suspectul 1 si 2, VSP = sperma recoltata din vagin si VSA = sperma recoltata din regiunea anala.147(p21) Modul de prezentare rezultatelor analizei genetice Modul de prezentare a rezultatelor analizei genetice va fi facuta cu ajutorul exemplului de mai sus (pagina ), unde calculul statistic a arata ca frecventa profilului in populatie este de 1 la 11.1111 (0.00009): 1(pp18,19) 1. Profilul ADN din proba in litigiu gasita la locul faptei se potriveste profilului ADN al suspectului. Probabilitatea de a gasi un profil ADN care sa se potriveasca cu proba in litigiu daca un alt barbat a fost sursa acelei probei de la locul faptei este de aproximativ 1 la 11.000. 2. Rezultatul este dat sub forma unei fractii dintre: - Suspectul este sursa probei biologice de la locul faptei. Probabilitatea ca profilele sa fie identice daca provin de la aceeasi persoana este 1 (sau 100%). - Altcineva decat suspectul este sursa probei biologice de la locul faptei, frecventa fiind data de frecventa profilului in populatie. In exemplul data fractia este 1/0.00009 = 11.1111 ce poate fi prezentata verbal ca: rezultatul analizei ADN este de aproximativ 11.000 de ori mai probabila daca proba biologica provine de la suspect decat daca ar proveni de la o persoana neinrudita cu suspectul. Probabilitatile calculate in urma analizei facuta cu sistemul SGM plus sunt de obicei in intervale intre 10 100 miliarde. ADN-ul mitocondrial Mitocondria este componenta intracelulara ce produce majoritatea energiei necesara proceselor celulare. Numarul de mitocondrii dintr-o celula este functie de nevoia de energie a acelei celule ajungand pana la 1000 in celula musculara sau 5000 in celula epiteliala. Fiecare mitocondrie contine intre 2 si 10 copii a ADN-ului mitocondrial (abreviat mtADN). Acesta este circular si format din doua lanturi care contin 16.569 baze si codifica 37 de gene.
200 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

mtADN este mostenit pe cale materna (capul spermatozoidului care nu contine mitocondrii este singurul care patrunde in ovul determinand fertilizarea) din acest motiv mtADN nu este unic pentru o anumita persoana, fiecare va avea acelasi mtADN cu mama si rudele materne, de unde rezulta si puterea de discriminare mult mai redusa ca a ADN-ului nuclear. Un alt dezavantaj este ca metoda de lucru a analizei mtADN este mare consumatoare de timp si de resurse financiare. Are insa cateva propietati care il face util in genetica judiciara: 1. forma circulara ii confera stabilitate si il face mai putin susceptibil degradarii. Din aceasta cauza este utilizat in identificarea probelor care constau din ramastie umane scheletizate, a altor probe biologice vechi sau care au fost expuse conditiilor externe extreme (cum sunt cele din cazul dezastrelor) si din care nu se mai poate extrage ADN nuclear. Oasele din care se poate face o extragere optima a mtADN sunt in ordine: femurul, tibia, humerus, fibula, ulna, radius, mamdibula cu dinti intacti, oasele picioarelor, craniu, oasele mainii, vertebre, coaste, coxale. 148 De asemenea din dinti se poate extrage mtADN, dupa calitatea ADN-ului extras, tipurile de dinti sunt in ordine: -dinti neresturati (fara plombe sau coroane): molari, premolari, canini, incisivi -dinti restaurati: molari, premolari, canini, incisivi 2. ca o consecinta a mostenirii pe cale materna, mtADN se poate folosi pentru identificarea victimelor dezastrelor, cand exista chiar si rude mai indepartate pe linie materna a presupusei persoane. Legea numarul 76/2008 art.16(1)130 prevede ca in vederea identificarii cadavrelor cu identitate necunoscuta, persoanelor disparute ori persoanelor decedate in urma catastrofelor naturale, a accidentelor in masa, a infractiunilor de omor sau a actelor de terorism, pot fi prelevate probe biologice de la rudele de gradele I i II ale acestora, in vederea stabilirii profilului genetic 3. mtADN se poate extrage din parul fara radacina, dar pentru ca puterea de discriminare este redusa, aceasta metoda se utilizeaza cand nu exista la dispozitie alte probe biologice. 4. mtADN este foarte abundent, fiecare mitocondrie putand contine pana la 10 copii de mtADN ceea ce inseamna ca o celula contine pana la cateva mii de copii de mtADN. Acesta este un avatantaj cand la locul faptei sunt gasite probe in cantitate foarte mica. Spre deosebire de analiza STR care examineaza polimorfismul de lungime a segmentelor repetitive de ADN, analiza mtADN compara secventa ADN intre indivizi. Genomul mitocondrial este foarte compact aproximativ 93% din acesta are secvente codante si numai 7% are regiuni noncodante, care se gasesc in regiunea de control denumita si bucla D (displacement loop). Datorita proportiei secventelor codante si non codante este evident ca sunt mult mai putine regiuni din mtADN decat in cel nuclear unde poate sa existe polimorfism al secventelor bazelor si de aici si utilitatea mai redusa a acestui tip de ADN in identificare.
978-606-8363-03-5 201

Masterat cercetri criminalistice aplicate

Bucla D consta din aproape 1100 de baze, desi nu contine gene are un rol foarte important in celula deoarece contine secvente de control pentru replicarea mtADN si pentru expresia genelor din regiunile sale codante. Din aceasta cauza secventele de control din bucla D nu pot sa varieze semnificativ deci nu sunt foarte polimorfice si nu pot fi folosite in identificare. Dar aceste secvente de control reprezinta doar o anumita portiune din bucla D restul fiind ocupat de 3 regiuni hipervariabile I, II si III (HVI, HVII si HVIII) care nu au rol de codificare a sintezei proteinelor si nici rol regulator al functiilor celulare, astfel ca ele varieza de la individ la individ fara sa apara tulburari in functiile celulare. Aceste regiuni sunt testate pentru diferentele in secventa bazelor.

ADN-ul mitocondrial. Lantul H (heavy = greu) contine un numar mai mare de nucleotide C-G decat lantul L (light = usor). 116(p156) Principiul identificarii pe baza mtADN este polimorfismul de secventa, iar tehnica folosita pentru evidentierea acesteia este secventializarea Sanger. Secvente mtADN de referinta ADN-ul mitocondrial uman a fost prima data secventializat in 1981 de catre Frederick Sanger intr-un laborator din Cambridge.122(pp377,378) reprezentand secventa de referinta (cu numele Cambridge Reference Sequence, abreviat CRS) cu care se comparau alte secvente de ADN mitocondrial. In anul 1999 mtADN a fost resecventializat si redenumit ca secventa de referinta Cambridge revizuita (the revised Cambridge reference sequence sau rCRS) fiind secventa de referinta etalon cu care se face compararea noilor secvente. Concluziile unei analize genetice mtADN se face in termenii variatiei fata de rCRS (de exemplu daca se observa o nucleotida C la pozitia 16.126 care in cazul rCRS contine un T atunci aceasta se va raporta ca 16126C. 122(p380) ). Pentru a facilita interpretarea, secventa mtADN din proba este comparata cu secventa de referinta rCRS si diferentele fata de aceasta sunt notate devenind profilul mtADN sau haplotipul mtADN.
202 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Haplotipul mtADN din proba in litigiu este comparat cu cel al probei de referinta (de la individ) determinandu-se daca individul este sursa mtADN din proba in litigiu. Daca exista o concordanta intre aceste doua profile atunci se va utiliza metoda statistica pentru a se determina frecventa haplotipului mtADN in populatie. mtADN are valoare in identificare numai atunci cand exista o proba de referinta pentru comparatie. Recomandarile SWGDAM (Scientific Working Group on DNA Analysis Methods) cu privire la formularea conculuziilor unei experize genetice mtADN:149 1. excludere daca diferenta intre porba in litigiu si cea de referinta (de la individ) este de doua sau mai multe nucleotide.

Compararea secventei nucleotidelor in proba in litigiu (Questioned) cu cea de referinta (Known) si modul de raportare a difrentelor utilizADN rCRS.122(p380) 2. rezultat inconcluziv: daca este o singura nucleotida diferenta intre proba in litigiu si cea de referinta. 3. esecul excluderii: daca secventele din proba in litigiu si cea de referinta au o nucleotida comuna la fiecare pozitie sau daca au o lungime comuna a regiunii HVII (HV2). In aceasta situatie se va face o estimare statistica in vederea aprecierii semnificatiei potrivirii profilelor mtADN. Analiza cromozomului Y Cromozomul Y este unul din cromozomii sexuali. Utilizarea in genetica judiciara: poarta gena SRY (sex determining region Y) care determina ca fetusul sa devina de sex masculin, acest cromozom este prezent numai la barbati. contine un numar mare de regiuni polimorfice de lungime cat si de secventa care pot fi utilizate in diferentierea intre indivizi. mostenirea pe cale paterna a acestui cromozom a facut ca acesta sa fie utlilizat in cazurile de stabilire a paternitati, mai ales cand presupusul tata lipseste, in locul lui fiind utilizate probele recoltate de la alti barbati inruditi pe linia paterna.
978-606-8363-03-5 203

Masterat cercetri criminalistice aplicate

tot pe baza acestui principiu, cromozomul Y poate fi folosit in identificarea ramasitelor umane. analiza componentei masculine din amestecuri de probe masculine si feminine cum se intampla in cazul violului. acest cromozom este util in amestecurile de probe provenind de la mai mult de 2 persoane, cand furnizeaza informatii cu privire la numarul de barbati. Un dezavantaj al acestui cromozom este ca se trasnmite uniparental pe linie paterna (de la tata la fiu), ceea ce inseamna ca nu face diferentiere intre rudele de sex masculin. Analiza cormozomului Y se face in mod asemanator cu analiza STR, cu diferenta ca primeri pentru analiza Y-STR sunt specifici pentru sexul masculin uman (si nu numai specific pentru om). Deoarece exista in populatie sute sau mii de barbati cu acelasi profil YSTR semnificatia unei potriviri dintre proba in litigiu si cea de referinta se face in mod asemanator mtDNA. Analiza genetica a SNP SNP (abreviere de la Single Nucleotide Polymorhism) reprezinta variatia ADN care intereseaza o singura nucleotida (A, T, C sau G) din genom, de exemplu AAGGCTAA si ATGGCTAA. Metoda poate fi aplicata probelor foarte degradate colectate de la locul faptei si poate fi folosita in urmatoarele scopuri: o pentru determinarea identitatii. In cazul anumitor victime ale atacurilor din 9/11 la care metodologia de identificare STR a esuat, SNP a fost folosita cu succes. o determinarea filiatiei, o determinarea rasei o determinarea fenotipului. Recent, a fost pusa la punct metodologia de identificare individuala folosind 92 de SNP, existand probabilitate extrem de mica ca doi indivizi sa aiba acelasi genotip. Baze de date ADN Exista urmatoarele tipuri de baze de date ADN: 4(p141),150 1. Baza de date a populatiei de referinta consta din testarea aleatorie a indvizilor unui grup populational pentru a determina frecventa unor alele si care va servi la estimarea prin calcul statistic a frecventei cu care un profil ADN dintr-o proba in litigiu se poate intalni in populatia respectiva. 2. Baza de date ce contine profile genetice a persoanelor condamnate pentru diferite infractiuni, cum ar fi omucidere sau agresiuni sexuale. Fiecare tara are legislatia proprie care reglementeaza tipurile de infractiuni de la faptasii carora se pot preleva probe biologice in vederea stabilirii profilului genetic. Accesul la aceste baze de date este restrictionat accesului public fiind permis numai politiei, organelor de justitie sau laboratorelor de profil.
publicat online: www.itcode.ro

204

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

3. Baze de date formata din profile genetice a cazurilor fara suspect. Este utilizata pentru a determina daca un profil ADN poate lega intre ele mai multe cazuri sau aceste profile pot fi cautate in baza de date anterioara (de la punctul 2). 4. Baza de date formata din profile genetice a ramasitelor umane neidentificate, persoanelor disparute sau a rudelor persoanelor disparute. Exemple de baze de date genetice CODIS (Combined DNA Index System) este un program dezvoltat de FBI reprezentand o baza de date genetica formata din profile ADN de la persoane condamnate si de la suspecti neidentificati, mentinuta la nivel statal si national (National DNA Index System abreviat NDIS). In iunie 2011 NDIS continea 9.878.881 profile genetice provenite de la persoane condamnate si 380.702 profile provenite probe biologice colectate in diverse cazuri. Profilele genetice au fost utilizate in mai mult de 141.300 de investigatii. 152 Baza de date a Marii Britanii, NDAD (the National DNA Database) a fost prima baza de date genetica din lume (implementata in 1995) unde sunt incluse: profilele genetice a tuturor persoanelor arestate pentru o infractiune care este inscrisa in cazierul judiciar. profile genetice ale victimelor profile genetice a unor persoane pe baza de voluntariat. Numarul total de probe in baza de date britanica a fost de 6.171.950 la date de 31.03.2011. De asemenea intre 01 aprilie 2010 si 31 martie 2011, s-au inregistrat concordante a profilelor in 106 cazuri de omor, 588 cazuri de viol si 29.959 de alte infractiuni.152 In Romania baza de date genetica a fost constituita in anul 2008 pe baza legii 76 privind organizarea si functionarea Sistemului National de Date Genetice Judiciare (S.N.D.G.J.). Legea nr. 76/2008 privind organizarea si functionarea Sistemului National de Date Genetice Judiciare publicata in Monitorul Oficial, Partea I nr. 289 din 14/04/2008 si Norme metodologice privind organizarea si functionarea Sistemului National de Date Genetice Judiciare publicate in Monitorul Oficial, Partea I nr 64 din 21.01.2011) Scopurile acestei baze de date genetice sunt: a) excluderea persoanelor din cercul de suspecti si identificarea autorilor urmatoarelor infractiuni: omor, omor calificat, omor deosebit de grav, pruncucidere, ucidere din culpa, determinarea sau inlesnirea sinuciderii, vatamare corporala, vatamare corporala grava, loviri sau vatamari cauzatoare de moarte, vatamare corporala din culpa, lipsire de libertate in mod ilegal, infractiunea de sclavie, viol, act sexual cu un minor, infractiunea de perversiune sexuala, coruptie sexuala, incest, talharie, tortura, nerespectarea a regimului materialelor nucleare sau al altor materii radioactive, nerespectarea a regimului materiilor explozive, rele tratamente aplicate minorului, propagADNa pentru razboi, genocid, tratamente neomenoase, distrugerea unor obiective si insusirea unor bunuri, distrugerea,
978-606-8363-03-5 205

Masterat cercetri criminalistice aplicate

jefuirea sau insusirea a unor valori culturale penal actele de terorism, infractiunile prevazute la art. 2, 3, 10 si 12 din Legea nr. 143/2000 privind combaterea traficului si consumului ilicit de droguri, cu modificarile si completarile ulterioare, nfractiunea prevazuta la art. 22 alin. (3) din Ordonanta de urgenta a Guvernului nr. 121/2006 privind regimul juridic al precursorilor de droguri, aprobata cu modificari prin Legea nr. 186/2007. b) stabilirea identitatii persoanelor - victime ale catastrofelor naturale, ale accidentelor in masa si ale actelor de terorism; c) realizarea schimbului de informatii cu celelalte state si combaterea criminalitatii transfrontaliere; d) identificarea participantilor la comiterea infractiunilor enumerate mai sus. S.N.D.G.J. contine profile genetice, corespunzatoare urmatoarelor categorii: a) suspecti - persoanele despre care exista date si informatii ca ar putea fi autori, instigatori sau complici ai infractiunilor enumerate mai sus; b) persoane condamnate definitiv la pedeapsa inchisorii pentru savarsirea infractiunilor de mai sus; c) urme biologice prelevate cu ocazia efectuarii cercetarii la fata locului; Toate intrarile, modificarile i ieirile datelor ce fac obiectul S.N.D.G.J. se realizeaza prin intermediul Institutului de Criminalistica din cadrul Inspectoratului General al Politiei Romne. Baze de date mtADN - FBI a facut publica in 2002 prima baza de date continADN 4829 de profile mtADN. 122(p384) Baza de date EMPOP dezvoltata de comunitatea de europeana a analizei genetice juridice a mtADN avea in august 2011 un numar de 9647 haplotipuri.153

206

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Curs 8
IDENTIFICAREA MEDICO-LEGALA A VICTIMELOR DEZASTRELOR NATURALE, A CELOR PRODUSE DE OM SI A CRIMELOR IMPOTRIVA UMANTIATII.
Definitia dezastrului se regaseste in legea nr. 481/2004 privind protectia civila, republicata in 2008154, acesta fiind un evenimentul datorat declansarii unor tipuri de riscuri, din cauze naturale sau provocate de om, generator de pierderi umane, materiale sau modificari ale mediului si care, prin amploare, intensitate si consecinte, atinge ori depaseste nivelurile specifice de gravitate stabilite prin regulamentele privind gestionarea situatiilor de urgenta, elaborate si aprobate potrivit legii. Conform INTERPOL155(p3) un dezastru este eveniment (accidente de trafic, calamitati naturale, accidente tehnice (incendii, explozii), atacuri teroriste sau evenimente ce se produc in contextul razboialeor) care produce moartea sau ranirea mai multor persoane. Din punct de vedere al investigatiei criminalistice si medico-legale termenul de dezastru poate fi inlocuit cu termenul incident cu multiple decese. Clasificarea dezastrelor:155(p3) 1. Dezastre deschise - rezulta in moartea unui numar necunoscut de persoane, de exemplu cazul atacului terorist din metroul londonez. In aceste situatii se asteapta sa se raporteze persoane disparute care ar fi putut sa se gaseasca acel loc. 2. Dezastre inchise - rezulta in moarrtea unui numar de indivizi care apartin unui grup fix si identificabil, de exemplu lista de pasageri in cazul prabusirii unui avion. In aceste tipuri de dezastre datele antemortem pot sa fie obtinute mai repede. 3. Forma mixta de dezastre rezultand din combinatia unui dezastru inchis cu unul deschis, de exemplu prabusirea unui avion intr-o zona rezidentiala. Clasificare dezastrelor in functie de cauza care le-a generat A. dezastre naturale: cutremure, inundatii, alunecari de teren, avalanse. De obicei apar pe neasteptate si iau prin surpindere populatia. B. accidente de transport includ transportul aerian, feroviar, rutier, maritim. C.accidente tehnice explozii, prabusirea unor constructii, incendii D. Acte de terorism - ce au drept tinta populatia civila. Se produc prin utilizarea unor mijloace de ucidere in masa (explozivi, radiatii sau agenti patogeni) Principii de identificare a victimelor dezastrelor Cercetarea locului dezastrului se face dupa principiile generale ale cercetarii locului faptei. Din punct de vedere al identificarii medico-legale cercetarea la fata locului are o importanta cruciala:
978-606-8363-03-5 207

Masterat cercetri criminalistice aplicate

1. pentru descoperirea si colectarea completa a ramasitelor umane. Aceste activitati sunt deosebit de dificile mai ales in cazul in care cadavrele sunt fragmentate si imprastiate pe suprafete mari de teren. 2. documentarea pozitiei ramasitelor umane in vederea reconstructiei incidentului. In acest capitol va fi prezentata metodologia de identificare numai din punct de vedere medico-legal. Cercetarea la locul dezastrului incepe dupa ce scena este declarata sigura si dupa ce toti supravietuitorii au fost salvati de catre echipajele medicale de urgenta. Acestora trebuie sa li se atraga atentia ca in deucrsul aplicarii procedeelor medicale de urgenta trebuie sa aiba grija ca in zona de activitate sa modifice cat mai putin pozitia cadavrelor sau a obiectelor. Daca un cadavru a fost mutat trebuie sa se stie de catre cine si locul de unde a fost mutat. Membrii echipelor de cercetare echipati corespunzator vor examina locul dezastrului impartit in sectoare. In componenta lor trebuie sa faca parte si medic legist pentru a ajuta la descoperirea si colectarea fragmentelor umane si in special a oaselor si dintilor. In activitatea de cercteare la locul dezastrului se vor avea in vedere urmatoarele principii generale: o Nu se va incerca potrivirea diferitelor fragmente umane, acestea se vor eticheta si ambala separat. o Nu se vor scoate si nici nu se vor introduce obiecte sau documente din si in imbracamintea victimei o Daca factorii externi sunt de asa natura (de exemplu, temperatura ridicata) incat sa favorizeze putrefactia atunci se vor colecta probe bilogice pentru examenele de laborator (genetice, toxicologice, etc) inainte ca ramasitele umane sa fie procesate. INTERPOLUL prevede ca echipa de cercetare la locul dezastrului sa aiba urmatoarele roluri: Localizarea cadavrelor sau fragmentelor de cadavru. Cu ajutorul utilajelor si personalului specializat se vor expune cadavrele care sunt ingropate sau prinse sub daramaturi. Ramasitele umane vor fi documentate corespunzator (poza, schita, descriere). De asemenea se va documenta si locul unde au fost gasite acestea. Fiecarui cadavru sau fragment de cadavru i se va atribui un numar de identificare unic care se va scrie in mod lizbil cu tus permanent pe o eticheta confectionata dintr-un material nedegradabil. Numarul de identificare va fi folosit pe parcusul intregului proces de identificare. Este recomandata completarea formularului Post Mortem pe care se trece numarul de identificare alocat. Ramasitele umane se vor introduce in sacul pentru cadavre impreuna cu obiectele gasite asupra lor. O eticheta se atasaeaza ramasitelor, o alta eticheta cu acelasi numar de identificare se ataseaza exteriorului sacului, care se va sigila. Numarul etichetei se va trece si in procesul verbal.
208 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Ramasitele umane impreuna cu documentele vor fi transferate Centrului de Colectare a Cadavrelor Obiectele personale care sunt gasite imprastiate la locul dezastrului, separate de cadavre sau fragmente ale acestora vor fi procesate in felul urmator: o se vor documenta, eticheta si ambala corespunzator, in cazul obiectelor mai voluminoase (cum ar fi valize) nu este nevoie sa sa ambaleze, eticheta se va atasa direct. o Impreuna cu documentatia aceste obiecte vor fi transferate Centrului de colectare a obiectelor persoanele si a altor probe materiale.

Organizarea celor doua centre de colectare 1. Centrul de colectare a a cadavrelor Va fi organizat in imediata apropiere a locului dezastrului. In anumite situatii poate sa aiba si rolul de morga.. Va asigura depozitarea temporara a ramasitelor umane colectate de echipele de cercetare, pana cand acestea vor fi trimise la morga pentru examinarea medico-legala. 2. Centrul de colectare a obiectelor personale si a altor probe materiale Trebuie, de asemenea, organizat in apropiera locului dezastrului. Obiectele se vor examina pentru a se selecta cele importante pentru identificare (obiecte de valoare, documente personale, etc). Obiectele se vor depozita in conditii corespunzatoare pana cand sunt trimise la laborator pentru cercetari suplimentare. Metode de identificare a victimelor dezastrelor Activitatea de identificare a victimelor este deosebit de dificila datorita urmatoarelor particularitati ale dezastrelor: o violenta si intensitate deosebit de mare a factorilor mecanici, fizici, chimici implicati in producerea lor o localizare in zone greu accesibile sau la departare fata de medii urbane importante, care intarzie initierea operatiunilor de identificare a victimelor, perioada de timp cand va avea loc progresia modificarilor distructive postmortale cu influenta negativa asupra tuturor tipurilor de metode de identificare. o victimile dezastrelor vor fi de cele mai multe ori sever mutilate, dezintegrate in fragmente de diverse dimensiuni imprastiate pe suprafete de obicei mari de teren, prezentand arsuri care adesea sunt de profunzime si intindere mare, mergand pana la carbonizarea corpului sau fragmentelor. o este afectat un grup heterogen de indivizi: ambele sexe, varste si medii socioeconomice de provenienta diferite si etnii/rase diferite o obiectele personale sau alte elemente care pot ajuta la identificare sunt adeseori alterate prin ardere, fragmentare, etc. Procesul de identificare a victimele dezastrelor se face prin coroborarea tuturor meotdelor de identificare aplicabile si adaptate in fiecare caz in functie de gradul de integritate a cadavrului, de gradul de descompunere si de tipul traumatismului suferit.
978-606-8363-03-5 209

Masterat cercetri criminalistice aplicate

Identificarea vizuala efectuata de catre rude pe baza fotografiilor cadavrului nu este sigura deoarece deseori victimele sunt desfigurate iar stress-ul emotional face ca rudele fie sa nu poata face fata vederii pozelor cadavrului fie nu sa confunde victima. Metodele primare acceptate de INTERPOL sunt:155(pp15-18) 1. Amprentele digitale elementele care le fac cruciale pentru identificarea persoanei sunt: unicitate (nu exista doua persoane cu acelasi desen papilar) nu se modifica pe parcursul vietii (se refac dupa traumatisme minore, traumatismele severe prin cicatricile rezultate pot produce modificari permanente) Pot fi clasificate si astfel comparate cu usurinta. 2. Examinarea odontostomatologica comparativa Se face pe baza caracteristicile individuale ale dintilor, suportului osos si prezenta lucrarilor dentare. Rezistenta deosebita a dintilor este un avantaj pentru identificare mai ales in cadrul dezastrelor produse prin explozii sau incendii. Interpol prezinta 5 posibilitati de concluzii in cazul examinrii odontostomatologice: I. Identificare - cand exista siguranta absoluta ca documentatia antemortem si postmortem provin de la aceeasi persoana II. Identificare probabila - caractersitci specifice corespund atat in documentatia postmortem si in cea antemortem dar fie documentatia antemortem sau postmortem sau ambele sunt minime III. Identificarea posibila nu exista nimc care sa excluda identitatea dar fie documentatia antemortem sau postmortem sau ambele sunt minime IV. Identitate exclusa documentatia ante si postmortem provin de la persoane diferite V. Nu se poate face nicio comparatie 3. Analiza genetica Analiza genetica se poate realiza si in cazul fragmentelor de cadavru sau a cadavrelor in stare avansata de putrefactie Potrivirea genetica este cel mai bun mod de a identifica fragmentele de cadavru Analiza genetica poate fi automatiza, prelucrandu-se un numar mare de probe, ceea ce reprezinta un avantaj in cazul dezastrelor cu multiple victime Se poate face identificare genetica pe baza probelor biologice prelevate de la rude sau de pe obiecte personale. 4. Prezenta materiale folosite in interventi chirurgicale purtand numere unice de identificare (de exemplu proteza de sold, pacemaker) Metodele non-primare au rolul de a contribui la identificare prin coroborare cu metodele descrise mai sus si de regula nu sunt suficiente ca probe unice pentru identificare.59(p768) o Caracteristici personale generale (varsta, sex, inaltime, rasa) si caracteristici specifice (cicatrici, tauaje). o Obiecte personale:
210 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

-articole de imbracaminte distincte, -documente de identitate, -bijuterii (sunt mai importante pentru identificare bijuteriile gravate sau atasate ferm de corpul cadavrului, cum este piercing-ul). -atat documentele de identitate cat si bijuteriile pot sa nu apartina cadavrului asupra caruia au fost gasite (actele pot fi tinute de alta persoana, sau o bijuterie sa fi fost furata sau imprumutata). o Cicatrici post traumatice, semne tegumentare din nastere, tatuaje, grupa de sange, deformitati si dezvoltare anormala a corpului o Identificare vizuala, suprapunerea fotografica, cicatrici chirurgicale, imbracaminte obisnuita, localizarea corpului (prin extrapolare se poate determina numarul locului din avion). Documentatia antemortem (AM) Etapa initiala consta din completarea listei de victime. In cazul incidentelor inchise acest lucru este usor de realizat. In cazul incidentelor deschise se va intocmi de catre centrul pentru raportarea persoanelor disparute, lista cu persoane declarate disparute de catre familie/prieteni, considerate ca fiind foarte probabil victime ale incidentului. Majoritatea documentatiei antemortem va fi obtinuta de la rudele sau cunoscutii victimei, aceasta constand din: A. Documentatie AM medicala si odontostomatologica: Documente medicale sau stomatologice aflate in posesia familiei sau cunostintelor Numele si adresa medicilor de diverse specialitati care au avut in observatie sau tratament persoana disparuta. Numele si adresa stomatologilor care au avut in observatie sau tratament persoana disparuta. Din aceste surse se va urmari obtinerea urmatoarelor documente medicale: o Fise dentare o Radiografii dentare o Mulaje dentare o Proteze dentare Date cu privire caracteristici fizice ale persoanei disparute: varsta, sex, inaltime, rasa, culoarea parului si a ochilor, prezenta de malformatii, proteze, patologia dentara sau medicala. De asemenea familia poate furniza detalii cu privire la tatuajele victimei, tipul de imbracaminte si bijuterii purtate, prezenta cicatricilor. Familiei i se va cere sa puna la dispozitie cel putin a unei poze cu persoana disparuta zambind (necesare conparatiei ondotologice). B. Probe genetice AM155(pp26-28) Pentu identificare este nevoie de o proba de referinta despre care se stie sigur ca a apartinut persoanei disparute care va fi comparata cu proba recoltata de la persoana a carei identitate trebuie confirmata.
978-606-8363-03-5 211

Masterat cercetri criminalistice aplicate

Probele genetice de referinta constau din: Tampoane bucale sau picaturi de sange extrase din pulpa degetului si obtinute de la rude, de preferat de la mai mult de una: o De la unul din gemenii identici o De la mama si tatal biologic si daca este posibil, de la un unchi sau matusa a victimei o De la copilul biologic al victimei si sotia/sotul victimei o De la fratele/sora victimei. situatie ideala dar rar intalnita este obtinerea unor probe biologice de referinta chiar de la presupusa victima, de exemplu probe biologice care au fost recoltate de la persoana pentru: screening neonatal al fenilcetonuriei, banca de sperma, determinarea paternitatii, specimene biologice pentru examen microscopic. Obiecte personale care au apartinut si au fost folosite de victima (exemple date de interpol) o Perie de dinti o Aparate de ras o Pieptene sau perie o Rujuri sau deodorante roll-on o Lenjerie intima purtata o Filtre de tigari sau pipe o Casti de motocilist, sepci, etc o Casti pentru urechi o Ochelari o Brata de ceas C. Amprente AM sau amprente de referinta Conform protocolului Interpol de cercetarea de dezastrelor sunt doua tipuri de amprente AM care vor juca rol de probe de referinta: 1. amprente luate in scopul identificarii: amprentele luate pentru intocmirea cazierului judiciar documente de imigrare sau de azil amprente plantare detinute de autoritati militare (de exemplu navale, aeriene) s-a observat ca in cadrul unor tipuri de incidente, piciorul incaltat in gheata militara este cel mai protejat fragment al corpului.. amprente folosite de baze de date de identificare biometrica 2. amprente care pot fi ridicate de pe obiecte personale, presupunandu-se ca numai persoana in cauza le-a utilizat, exemple:155(p25) reviste sau carti recent citite poze lucioase oglinda interioara a automobilului personal documente personale containere goale de diferite bauturi pahare, vesela, tacamuri baterii pentru diverse aparate personale
212 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

cd si dvd-uri impreuna cu coperta podeaua baii sau cea din apropierea patului (pentru amprente plantare) obiecte si suprafete la locul de munca

Documenatia postmortem (PM) - Centrul de identificare Concomitent cu procesul de obtinere a datelor AM se vor derula si operatiunile de obtinere a datelor PM care se vor desfasura in cadrul centrului de identificare. Daca incidentul are loc langa o morga atunci centrul de identificare va fi plasat aici. Atunci cand incidentul are loc intr-o zona izolata atunci se poate improviza o morga temporara. In toate situatiile trebuie avut in vedere ca factorii climatici precum temperatura inalta sau umiditatea, accelereaza procesul de descompunere care la randul sau are rol negativ asupra elementelor folosite in identificare. Din acest motiv atat transportul cat si depozitarea resturilor umane trebuie facuta in conditii de temperatura scazuta (4 - 6oC), daca depozitarea este pentru o perioada mai lunga de timp atunci temperatura mediului de depozitare trebuie sa fie sub 0oC. Exemple de locuri de depozitare a ramasitelor umane: subsoluri de cladiri abandonate, garaje subterane, vehicule sau containere prevazute cu sisteme de racire, sisteme portabile de aer contidionat. se poate folosi si gheata uscata (gheata carbonica) care insa nu va fi aplicata direct pe cadavre pentru ca provoaca arsuri tegumentare, se va amenaja un cort cu o inaltime de 50 de cm acoperit cu material impermeabil in care vor fi intrtoduse in jur de 10 cadavre, peste care se va presara gheata carbonica, necesarul fiind de circa 10kg/zi/cadavru.155(p31) Luarea amprentelor digitale se va face de catre specialisti care vor selecta metoda optima de amprentare pentru fiecare caz. Amprentarea se face inainte de dezbracarea cadavrului mai ales in cazul cadavrelor arse pentru a se preveni distrugerea tegumentului friabil. Daca este posibil se vor preleva si amprente plantare si palmare. Distrugerea epidermei prin factori termici sau mecanici face ridicarea amprentelor foarte dificila. In cazul absentei epidermei se poate incerca ridicarea amprentelor pe baza stratului dermic al tegumentului, desi amprentele obtinute astfel nu sunt foarte clare. Protocolul recomandat de Interpol pentru luarea amprentelor digitale: 155p37) - Mana cadavrului va fi spalata cu apa si sapun apoi uscata cu un prosop de bumbac sau de hartie. Curatirea cu alcool a mainilor a rezultat in obtinerea unor amprente de o calitate mai buna, deoarece alcoolul inmoaie piele si o face mai pliabila. - In functie de conditia in care se gaseste cadavrul se va lua amprenta digitala folosind urmatoarele structuri:
978-606-8363-03-5 213

Masterat cercetri criminalistice aplicate

tegumentul atasat la deget tegumentul digital detasat care se va fixa pe degetul specialistului stratul profund al tegumentului (dermul) in cazul in care stratul extern superficial este detasat si distrus Pentru amprentarea cadavrelor deazstrelor Interpolul155(p37) recomanda o tehnica asemanatoare cu cea utilizata in practica criminalistica romaneasca exceptie fiind folosirea pulberilor (in loc de tus) aplicate prin pudrare cu ajutorul pensulelor dactiloscopice de tipul Zephyr. In loc de fia dactiloscopic decadactilar se vor folosi cartonase de culoare alba, cu dimensiuni de 32/40mm care prezinta o fata adeziva si sunt acoperite de o folie de plastic subtire si transparenta (de genul, etichetelor adezive Herma). Se va ridica folia transparenta iar cartonasul se va aseza in spatula (lingura) de amprentat cadavre cu fata adeziva in sus. Apoi, pe cate un cartonas (fixat in spatula) se va rula intr-un singur sens cate un singur deget. Dupa care, fiecare cartonas se va atasa foliei transparente de plastic, rezultatul fiind un set de amprente pozitive si cu contrast bun pe un fond alb. Atunci cand epiderma este detasata se poate folosi urmatoarea metoda recomandata de Interpol:155(p38) se vor sterge mainile cadavrului cu alcool, apoi se vor introduce in apa fierbinte pentru maxim 10 secunde. Ulterior se va observa o imbunatatire evidenta a aspectului mainilor: pulpa getelor si palma va avea un aspect rotunjit, tegumentul va fi mai moale si mai extensibil, cutele produse prin deshidratarea postmortala vor dispare si desenul papilar va deveni vizibil.. Se va deschide mana victimei prin extensia degetelor, dupa care tegumentul se va curata cu acetona si apoi va fi pudrat cu pulbere. Amprentele se ridica folosind carton adeziv, dupa tehnica prezentata mai sus.. Detasarea degetelor pentru utilizarea unor metode speciale de amprentare se face numai cu autorizarea medicului legist. Dupa ce au fost obtinute, amprentele AM si PM se vor compara de catre specialist, identificarile se vor examina de un al doilea specialist. Daca nu exista amprente AM se va initia cautarea AFIS. Informatia PM va fi trecuta intr-un proces verbal sau se recomanda utilizarea formularelor PM ale Interpolului. Fotografia de identificare ramasitelor umane (interpol 33) o se vor fotografia etichetele atasate fiecarui caz o se va fotografia cadavrul in intregime (inainte si dupa toaletare) o fotografie semnalmente din fata, fotografiere din profil o fotografii la scara ale tatuajelor, cicatricilor, amputatilor vechi, alte semne particulare (se va include in imagine si regiunea corporala in care acestea se afla). o fotografii ale articolelor de imbracaminte si a obiectelor personale. Se pozeaza initial in situ si apoi curatate si fotografiate separat (fotografii de detaliu) o fotografii a unor elemente ce pot ajuta identificarea: etichete de imbracaminte, carti de credit. o in mod obligatoriu se vor face si fotografii dentare:
214 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

-vedere anterioara a ocluziei dentare (dintii maxilarului se afla in contact cu cei ai mandibulei) cu buzele indepartate cu un departator de obraji, -poze anterioare si laterale separate a dentitiei mandibulare si maxilare. -se vor face poze de detaliu a lucrarilor sau anomaliilor dentare. Examen radiologic Se vor face radiografii ale intregului corp si radiografii dentare. Radiografiile permit detectarea obiectelor (proteze metalice, bjiuterii, proiectile), pun diagnosticul fracturilor, ajuta la identificare prin compararea cu structurile osoase si dentare AM. Autopsia medico-legala Datorita numarului mare de cadavre se efectueaza numai o examinare externa amanuntita si doar in cazurile mai deosebite se poate face si o examinare interna. Scopul autopsiei medico-legale victimelor dezastrelor: Stabilirea cauzelor medicale ale mortii Identificarea victimei (la examenul extern se vor cauta eventualele cicatrici, tatuaje iar la examenul intern se vor identifica eventualele urme lasate de interventii chirugicale mai vechi) Explicarea mecanismului de producere a leziunilor Recoltarea de probe pentru: o examenul toxicologic (determinarea alcoolemiei, carboxihemoglobinemiei, prezenta de droguri in sangele personalului aeronavelor, trenurilor, vapoarelor, etc) o analiza genetica o analiza serologica (determinarea grupei de sange), o examen antropologic o examen microscopic Pentru examenul genetic se vor recolta urmatoarele probe in functie de conditia in care se gaseste cadavrul:155(p40) Pentru cadavrele integre neafectate de putrefactie se va recolta sange pe hartie FTA sau tampon bucal Pentru cadavrele mutilate dar neafectate de putrefactie se va recolta daca e posibil sange sau un mic fragment de circa 1g din stratul profund muscular. De asemenea se poate recolta fragment de organ sau tegument. In cazul cadavrelor integre sau fragmentelor de cadavru in stare avasanata de putrefactie se va recolta fie un fragment de 4-6cm din oasele lungi sau dinti sanatosi (preferabil molari) sau circa 10 g de alt tip de os care preferabil sa contina si tesut osos compact. In caz de cadavre arse se vor recolta aceleasi probe biologice ca mai sus sau tampon de mucoasa vezicala urinara. Pentru determinarea varstei prin metode antropologice se va recolta fragment de coasta (a 4-a) si dinte monoradicular si daca este posibil simfiza pubiana.9(p436)
978-606-8363-03-5 215

Masterat cercetri criminalistice aplicate

Informatiile rezultate in urma autopsiei vor fi trecuta intr-un proces verbal sau se recomanda utilizarea formularelor PM ale Interpolului.
Examinarea genetica:156(p25)

De preferat este ca analiza ADN a probelor rezultate in urma unui dezastru sa fie efectuata intr-un singur laborator pentru a reduce complicatiile generate de schimbul interlaboratoare de probe sau informatii. Atunci cand numarul de probe este foarte mare depasind capacitatea de procesare a unui singur laborator, probele pot fi analizate in mai multe laboratoare dar care sa aiba software-uri compatibile. Examinarea antropologica In cazul in care cadavrele sunt in stare foarte avansata de putrefactie, scheletizate sau sunt fragmentate, rolul expertizei antropologice va deveni mai important: descoperirea dintilor sau fragemtelor mici de oase la locul dezastrului, separarea resturilor non umane de cele umane evaluarea si documentarea conditiei ramasitelor umane: o cadavre intregi o cadavre fragmentate o cadavre afectata de procesuld e putrefactie o amestec de ramasite apartinand mai multor indivizi cand exista un ameste de fragmente umane apartinand mai multor indivizi se va aprecia numarul minim de indivizi si se va incerca reconstituirea fiecarui cadavru. determinarea caratceristiclor generale (varsta, sex, inaltime, rasa) cat si individuale (modificari sau patologie osoasa antemortem, leziuni traumatice perimortem, compararea radiografiilor, etc, vezi capitolul de identificare antropologica). Informatia PM va fi trecuta intr-un proces verbal sau se recomanda utilizarea formularelor PM ale Interpolului. Examinarea dentara Se va folosi numerotarea FDI, termenii, nomenclatura si abrevierile standard acceptate international. Se vor face: poze extra si intra orale, radiografii (conventionale sau digitale) Se va face examinarea clinica a dentitiei. Excizia si scoaterea maxilarului si sau mandibulei pentru o mai buna examinare a dentitiei se face doar atunci cand aceasta metoda este imperios necesara. Informatia PM va fi trecuta intr-un proces verbal sau se recomanda utilizarea formularelor PM ale Interpolului. Etapa de comparare a datelor AM cu cele PM. Identificarea victimelor
216 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

Se desfasoara in Centrul de comparare a datelor AM si PM care trebuie situat in apropiera sau in cadul unitatii unde se efectueza examinarea PM. Cele doua seturi de date se vor compara pentru a se obtine cea mai buna potrivire datele obtinute dupa examinarea victimei si una din persoanele disparute sau aflate pe lista de pasageri. In cadrul evenimentelor cu un numar foarte mare de victime cum a fost tsunamiul asiatic compararea manuala a formularelor AM cu cele PM nu este o metoda fezabila, astfel incat aceste date sunt introduse in computer si vor fi prelucrate si comparate de catre software-uri speciale, precum este Plassdata. Acesta este un software produs de compania americana Kenyon in care se introduc urmatoarele date:157 Datele AM (exemple): -datele despre persoana disparuta -datele medicale Datele postmortem (exemple): -dentitie -ADN -Tatuaje, cicatrici -Descrierea personala: inaltime, greutate, culoare ochilor si parului, etc Programul face comparatia a 92 de campuri distincte pentru aceste doua seturi de date158 si are capacitate de potrivire de 97%. Potrivirile semnalate de program trebuie verificate insa de un specialist, concluzia finala fiind a acestuia. Procesul verbal final de identificare consemneaza ca datele AM referitoare la persoana disprut comparate cu datele PM ale persoanei decedate neidentificate conduc la concluzia c este descris una i aceeai persoan. In final, medicul legist elibereaza certificatului medical constatator al decesului si ramasitele umane se elibereaza apartinatorilor. Identificarea victimelor genocidului si crimelor de razboi si a celor impotriva umanitatii Curtea Penala Internationala, in virtutea Conventiei de la Geneva din 1949. defineste, genocidul ca: orice acte comise cu intentia de a distruge, n tot sau n parte, un grup national, etnic, rasial sau religios prin: uciderea membrilor grupului . Prin crime de razboi se ntelege, n virtutea Conventiilor de la Geneva din 1949 privind dreptul umanitar si a altor conventii si cutume internationale: omuciderea intentionata; tortura sau tratamentele inumane, inclusiv experientele biologice; etc. Carta Tribunalului Militar International de la Nurnberg a definit crimele de razboi ca fiind: violarea legilor razboiului incluzand uciderea, relele tratamente sau deportarea civililor in teritoriile ocupate ; uciderea relele tratamente aplaicate prizonierilor de razboi, uciderea ostatecilor.159(p374) Tribunalul Penal International defineste crima impotriva umanitatii ca fiind oricare dintre actele urmatoare, atunci cand sunt comise n cadrul unui atac
978-606-8363-03-5 217

Masterat cercetri criminalistice aplicate

generalizat sau lansat sistematic asupra populatiei civile: ucidere, exterminare, sclavie, deportare sau transfer fortat de populatie, condamnarea la nchisoare sau alte forme de privare grava de libertate, tortura, viol, sclavie sexuala, prostitutie fortata, sarcina sau sterilizare fortata sau orice alta forma de violenta sexuala de gravitate comparabila, persecutarea unui grup pentru motive de ordin politic, rasial, national, etnic, cultural, religios sau bazat pe sex, sau n functie de alte criterii universal recunoscute ca inadmisibile n dreptul international, crima de apartheid si alte acte inumane cu un caracter similar, cauzatoare de suferinte puternice si care aduc atingere grava integritatii fizice sau mentale. Crima impotriva umanitatii se suprapune notiunii de crima de razboi si genocid, dar spre desoebire de crimele de razboi crimele impotriva umanitatii se pot produce si in timp de pace. Investigatia trebuie sa demonstreze ca incidentul face parte dintr-un atac sistematic si generalizat impotriva unui numar mare de persoane civile: Existenta gropii comune si localizarea rmasitelor umane este primul indicator ca in acel loc a avut loc un act criminal de proportii.59(p1678) Structura demografica a gropii poate sa sugereze un anumit tip de act: de exemplu daca ramasitele apartin unor barbati imbracati militar, atunci groapa a fost facuta cu scopul de a inhuma victimele unei lupte armate ; daca ramasitele apartin unor femei si copii atunci acest lucru arata ca au fost victimile unei crime impotriva umanitatii. de asemenea investigatia trebuie sa determine daca victimile au apartinut unui grup national, religios, etnic sau militar. Pentru acesta de mare importanta sunt: imbracamintea, documentele de identitate, bijuterii si alte obiecte personale. Gropile comune sunt foarte rare in cazuistica infractionala obisnuita. Ele sunt utlizate ca mod de inhumare a victimelor incidentelor naturale sau produse de om iar acestea din urma sunt crimele impotriva umanitatii, crimele de razboi si genocidul. Definitia gropilor comune data de FBI160(p7) - o groapa comuna contine mai mult de 4 indivizi care au fost ingropati in acelasi timp Definitia data de UN161 gropii comune este: locul unde 3 sau mai multe victime a unor executii sumare, arbitrare, extrajudiciare au fost ingropate si care nu au murit in lupta sau confruntare armata. Gropile comune nu sunt intotdeauna rezultatul unor actiuni criminale, ele pot fi facute pentru ingroparea unor combatanti pe timp de razboi sau a unor victime a dezastrelor naturale. Caratceristicile gropilor comune In functie de caracteristicile solului si de asezarea cadavrelor, gropile comune au caracteristici specifice care influenteaza evolutia proceselor cadaverice distructive postmortale. Astfel, gropile comune cu un numar mare de cadavre asezate pe mai multe straturi care nu au o buna scurgere a apei de infiltratie si a lichidelor cadaverice, tind sa retina umiditatea. Cadavrele se gasesc intr-un mediu umed favorizand aparitia saponificarii cu rol conservator al cadavrului. S-a observat ca, ramasitele umane din centrul gropii comune unde gradul de umiditate este ridicat, sunt mai
218 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

bine conservate decat cele de la periferie.59(p1675) Cu cat groapa este mai mare adapostind un numar mai mare de cadavre cu atat gama de tipuri de evolutii cadaverice postmortale poate fi mai mare, astfel, in functie si de gradul de umiditate in aceeasi groapa comuna pot exista cadavre mumificate, scheletizate sau saponificate. In stiuatia in care cadavrele sunt asezate in groapa pe un singur rand, evolutia descompunerii cadaverice este asemanatoare cu aceea a unui singur cadavru inhumat. Cercetarea gropilor comune 59(1676) Localizarea gropilor: se face de obicei prin informatii primite de la martori oculari datorita dimesniunilor, este foarte probabil sa apara in pozele aeriene exista probe materiale in apropierea gropii lasate de vehiculele cu care s-au transportat victimile, de numarul mare de persoane necesare pentru indeplinirea executiei, de armamentul utilizat . Ca si in cazul gropilor singulare, suprafata si limitele gropii vor trebui determinate. Trebuie sa se delimiteze cu exactitate suprafata gropii pentru ca altfel exista riscul ca pamantul excavat dintr-o parte a gropii sa fie depozitat in cealalta parte a sa (pentru determinarea limitelor gropii vedeti capitolul nr 3). Cand groapa a fost sapata cu un utilaj greu atunci si dezgroparea va trebui facuta cu un astfel de utilaj (pentru a determina limitele peretilor gropii este necesar sa se evidentieze urmele lasate de dintii cupei in sol). In anumite gropi comune cadavrele sunt asezate pe un singur rand, in linie, astfel incat acestea pot fi numarate cu usurinta, documentate si ridicate in ordinea in care sunt asezate. Atunci cand cadavrele au fost aruncate in groapa intr-un mod dezorganizat metoda optima de cercetare a acestora a fost descrisa de Haglund: 162 Se va lucra in doua echipe: una care efectueaza documentarea si cealalta ridicarea cadavrelor. Echipa dedicata documentarii isi va efectua activitatea pe loturi de 10 cadavre incepand dintr-unul din capetele gropii.. Cadavrele fiind asezate unul peste altul in mod dezorganizat atunci se va selecta cadavrul care sa fie ridicat primul in functie de cat de intercalata este dispunerea sa cu celelalte cadavre din jur. Numerotarea cadavrelor se face numai atunci cand acestea sunt gata pentru a fi ridicate, activitate care intra in atributia celei de a doua echipa. In cazul in care cadavrele nu sunt scheletizate, pentru a scoate un cadavru din groapa uneori este nevoie ca membrele cadavrelor din jur sa fie ridicate. Acest lucru nu se poate realiza in cazul cadavrelor scheletizate cand se va face documentarea unei portiuni din schelet apoi se va ridica pentru a se putea ajunge la scheletul de dedesubt. Nu se vor scoate mai mult de doua schelete partiale deodata dintr-o anumita zona, pentru a nu se creea erori si confuzii. In cazurile in care pentru ingroparea cadavrelor s-au folosit utliaje grele atunci deseori cadavrele vor fi fragmentate, fragmente care trebuie trecute intr-un registru separat fata de cadavrele intregi. Identificarea se face dupa metodele descrise in capitolul 3.
978-606-8363-03-5 219

Masterat cercetri criminalistice aplicate

Fisa Interpol pentru consemnarea datelor PM163 SECTIUNEA B0 se completeaza in timpul ridicarii ramasitelor umane de la locul dezastrului. Numarul fisei va fi cel al atasat cadavrului sau fragmentului de cadavru. nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Lista operaiunilor efectuate in morga: Fotografii: poza cadavrului din fa si din spate (mbrcat, dezbrcat), capul (fa, profil stg., profil dr.); Amprente digitale si palmare luate: Da, Nu, imposibil Autopsie medico-legala examinare medico-legala - Da, Nu autopsie completa - Da, Nu, Radiografii, Fotografii numele medicului legist, adresa si telefon Examinare dentar Completa: Da, Nu, Radiografii, Fotografii Mandibula si/sau maxilarul scos - Da, Nu, Radiografii, Fotografii Numele medicului stomatolog adresa si telefonul Probe biologice: colectate, trimise la analiza, rezultatele atasate, s-a dispus efectuarea de analiza ADN SECTIUNEA B nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Ridicarea cadavrului de la locul dezastrului vrsta aparent: minim, maxim, scris in litere data si locul unde a fost gsit cadavrul referire la harta si localizare GPS: coordonate fotografiile de la faa locului: Da, Nu, Digitale, Cu film, Alte tipuri starea cadavrului: complet, incomplet, identificabil vizual (Da, Nu), fragment de cadavru cap, gat, brat si antebrat stg si dr, mana st si dr, corp fata si spate, coapsa si gamab stg si dr, picior stg si dr: leziuni, ars, putrefiat, scheletizat, lipsa unui segment, detasat informatii importante privind identitatea persoana care a gsit cadavrul; cand cadavrul a fost gasit de o echipa se numeste seful echipei orice alta persoana: nume, adresa, telefon, ocupatie Sectiune completata de: nume, adresa, telefon, data semnatura
220 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

SECTIUNEA C1 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Imbracaminte si incaltaminte pentru fiecare articol si tip de mbrcminte, vestimentatie ce intereseaza fiecare parte a corpului (cap, gat, partea superioara si membre superioare, partea inferioara si membre inferioare, intregul corp) i pentru nclminte se consemneaz materialul din care este confecionat, culoarea, modelul, firma productoare, mrimea. Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA C2 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Obiecte personale Ceas: da, nu Tip (digital, analog, mixt): material, culoare, model, marca, inscriptionat Purtat pe mana stg, dreapta, exterior, interior Curea, brata: piele, metal, alt material Alt tip de ceas, unde este purtat Ochelari: da, nu rama: material, culoare, model, marca, inscriptionat lentile: colorate da, nu, dioptri dr si stg lentile forma rotunde, ovale, rectangulare, jumatate, fara rama lentile tip sticla, policarbonat, bifocale lentile de contact da, nu, culoare, dioptri dr si stg acte de identitate da, nu pasaport, carnet de conducere auto, carte de credit, carte de identitate, carte de donator, cecuri de calatorie, cecuri personale, carte de sanatate, altele tip, fotografie, amprenta, grup de sange obiecte transportabile da, nu portofel, geanta, curea pentru bani, chei, bani, telefon mobil, PDA, card SIM, bilet, apararat foto sau video, altele material, culoare, model, marca, inscriprionari Sectiune completata de: nume, adresa, telefon, data semnatura

978-606-8363-03-5

221

Masterat cercetri criminalistice aplicate

SECTIUNEA C3 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Bijuterii Verighete, inele, cercei, lanuri, bratari, pandantiv pentru lant, brosa, cercel pentru nas, bratara pentru glezna - materialul din care este confecionat, culoarea, modelul, inscripii, unde este purtat. Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA D1 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Descrierea cadavrului (efectuata la morga) starea cadavrului: complet, incomplet, identificabil vizual (Da, Nu); fragment cap, gat, brat si antebrat stg si dr, mana st si dr, corp fata si spate, coapsa si gamab stg si dr, picior stg si dr: leziuni, ars, putrefiat, scheletizat, lipsa unui segment, detasat varsta estimata min, max, metoda folosita talia (cm) min, max, metoda folosita greutatea (kg) min, max, metoda folosita constituia hipostenic, normostenic, hiperstenic forma capului vedere din fata oval, ascutit, piramidal, circular, rectangular, patrat forma capului vedere din profil putin accentuat, mediu, accentuat rasa: caucazian, mongoloid, negroid nuanei - deschis, mediu, nchis prul felul- natural, artificial, me, peruc, implantat, extensie lungimea scurt <6cm, mediu <12cm, lung> 12cm, ras culoarea - blond, castaniu, negru, rocat, crunt, alb nuana - deschis, mediu, nchis, grizonat, vopsit, vopsit suvite grosimea - subire, mediu, gros; stilul - drept, ondulat, cre, cu crare stg, dr, mijloc calviia - incipient, medie, avansat, frunte, parti laterale, vertez; alte Sectiune completata de: nume, adresa, telefon, data semnatura

222

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

SECTIUNEA D2 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Descrierea fizica a cadavrului (continuare) fruntea: nlimea (mic, medie, nalt); limea (ngust, medie, lat); nclinarea (bombat, verticala, retras uor / evident); sprncenele: forma (drepte, arcuite, unite); grosimea (subiri, medii, groase); particularitati: pensate, tatuate ochii: culoarea (albatri, cenuii, verzi, cprui, negri); nuana (deschis, mediu, nchis); distana ntre ochi (mic, medie mare; particulariti: strabism (convergent / divergent), ochi artificial (stg. / dr.); nasul: mrimea (mic, mediu, mare); forma (crn, roman, nas alcoolic); particulariti: urme de ochelari (Da / Nu), altele; curbura: concav, drept, convex, indreptat in jos, orizontal, indreptat in sus pilozitate facial: tip (fr, musta, cioc, favorii, barb); culoare (blond, castaniu, negru, rocat, crunt, alb); urechile: mrimea (mici, medii, mari); unghiul (apropiate, normale, proeminente); lobul urechii: ataat (Nu / Da), gurit (stg. / dr.); gura: mrimea (mic, medie, mare), altele; buzele: forma (subiri, medii, groase, rujate), altele; dinii: starea naturali, netratati, tratati, coroane, punti, implanturi spatii, dinti lipsa spatiu intre dintii frontali, dinti lipsa, edentat mandibula si maxilar proteze mobile maxilara, mandibulara, partiala, totala, numar de identificare fumtor pete gasite nu, dinti, buze, mustata, degete (stg, dr) Sectiune completata de: nume, adresa, telefon, data semnatura

978-606-8363-03-5

223

Masterat cercetri criminalistice aplicate

SECTIUNEA D3 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Descrierea fizica (continuare) brbia: mrime (mic, medie, mare); nclinare (retras, normal, protuzionat); form (ascuit, rotund, angulat, cu gropi, crestat gtul: lungime (scurt, mediu, lung); form (subire, mediu, gros); particulariti: gu, mrul lui Adam proeminent; nr. guler cma; circumferina (cm.); minile: form (nguste, medii, late); mrime (mici, medii, mari); lungimea unghiilor (scurte, medii, lungi); particulariti: roase, tiate, vopsite, artificiale, urme de nicotin (stg. / dr.); picioarele: form (nguste, medii, late); plat, arcuit mrime (nr. de la pantof lungime cm.); conditia: monturi, bataturi unghii: vopsite, modificari particulariti: pilozitatea corporal: extindere (absent, uoar, medie, pronunat); culoare (blond, castaniu, negru, rocat, crunt, alb); pilozitatea pubian: extindere (absent, uoar, medie, pronunat, epilat); culoare (blond, castaniu, negru, rocat, crunt, alb); detalii specifice: cap, gat, brat si antebrat stg si dr, mana st si dr, corp fata si spate, coapsa si gamba stg si dr, picior stg si dr - cicatrici, semne tegumentare, tatuaje, malformaii, amputaii, piercing; circumcis Da / Nu alte particulariti: Sectiune completata de: nume, adresa, telefon, data semnatura

224

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

SECTIUNEA D4 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Schie ale cadavrului Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA D5 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Amprente Amprentele luate de pe tip stratul tegumentar epiderm, derm Metoda folosita: - tehnica ce foloseste apa fiarta -manusa epidermica - mulaj -alt Metoda de relevare/fixare: pudra neagra, tus, fotografie, altele Amprente ridicate de pe - schita Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA E1 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, feminin, necunoscut) Examen intern Autopsie completa da, nu Numarul autopsiei Cap, gat, torace, abdomen, schelet, tesuturi moi constatari Alte constatri sarcina, fracturi consolidate, operatii chirurgicale Implanturi intrauterine in scop contraceptiv plastic, metal, descriere - alte plastic, metal, descriere Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA E2 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Concluzii medico-legale: determinarea sexului (masculin, feminin, nedeterminat); aprecierea vrstei; - minim, maxim, metoda folosita probe recoltate (coninut gastric, urin, snge cardiac, periferic, lichid biliar, umoare vitroasa, alte lichide, simfiz pubian, par, testut uscat, tesut in formol,
978-606-8363-03-5 225

Masterat cercetri criminalistice aplicate

probe biologice pentru ADN de unde s-au recoltat si numarul lor, alte probe) daca s-au recoltat, in ce scop, unde s-au depozitat, rezultate. Alte informatii utile identificarii alte informaii medicale; Semnatura medicului legist si data Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA E3 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Schita a scheletului Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA E4 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Analiza genetica Proba biologica: primita (data), eticheta, tip, conditia Profilele ADN D3S1358, VWA, D16S539, D2S1338, Amelogenin, D8S1179, D21S11, D18S51, D19S433, TH01, FGA, TPOX, CSF1PO, D13S317, D7S820, D5S818, Penta D, Penta E, FES, F13A1, F13B, SE33, CD4, GABA pentru fiecare proba Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA F1 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Constatari odontologice Maxilarul, mandibula prezente, fragmentate, dac s-au gsit dini izolai, localizarea specimenului, probele recoltate. Detalii suplimentare conditia cadavrului, a mandibulei si maxilarului, leziuni ale tesutului moale si osos, dintilor, mecanismul de producere a leziunilor Sectiune completata de: nume, adresa, telefon, data semnatura

226

publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

SECTIUNEA F2 nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, femin, necunoscut) Constatari in cazul dentitiei permanente (se vor mentiona dintii temporari in mod specific) descrierea coroanelor, punilor i protezelor;, implanturilor alte constatari - (ocluzie, atriie, anomalii, fumtor, starea peridoniului, etc.; radiografii efectuate tip si regiune examinri suplimentare; varsta estimata minim maxim, metoda Semntura odontostomatologului si data Sectiune completata de: nume, adresa, telefon, data semnatura SECTIUNEA G nr. fiei, natura dezastrului locul i data dezastrului, sexul victimei (masculin, feminin, necunoscut) Alte informatii - dac se refer la paginile anterioare se indic numrul sectiunii si item-ului).

978-606-8363-03-5

227

Masterat cercetri criminalistice aplicate

REFERINE
1. Thompson T, Black S. Human Identification. An Introduction. Boca Raton (USA): CRC Press;2007. 2. Belis V editor. Tratat de medicina legala. Bucuresti (Romania): Edit. Medicala;1995. 3. Saukko P, Knight B. Knights Forensic Pathology. 3rd ed. London (UK): A Hodder Arnold Publication;2004. 4. Pickering RB, Bachman D. The use of forensic anthropology. 2nd ed. Boca Raton (USA):CRC Press;2009. 5. Moraru I. editor. Medicina Legala. Bucuresti (Romania): Edit. Medicala; 1967. 6. American Board of Forensic Anthropolgy http://www.theabfa.org/ 7. Birx HJ, editor. 21st Century Anthropology. A Reference Handbook. Thousand Oaks(USA): SAGE Publications;2011. 8. Katzenberg MA, Saunders SR. Biological Anthropology of the Human Skeleton. 2nd ed. New Jersey (USA): Wiley;2008. 9. Schmitt A, Cunha E, Pinheiro J. Forensic Anthropology and Medicine. Complementary Sciences From Recovery to Cause of Death. New Jersey (USA): Humana Press;2006. 10. Ubelaker DH. Introduction to Forensic Anthropology. In Schmitt A, Cunha E, Pinheiro J. Forensic Anthropology and Medicine. Complementary Sciences From Recovery to Cause of Death. New Jersey (USA): Humana Press;2006. 11. Insitutul de Antropologie Francisc Rainer http://www.antropologia.ro/Istoric/breviaristorie 12. Insitutul de Antropologie Francisc Rainer http://www.antropologia.ro/. 13. Manzanares MC, Goret-Nicaise M, Dhem A. Metopic sutural closure in the human skull. J Anat 1988;161:20315 14. Agarwal SK, Malhotra VK, Tewari SP. Incidence of the metopic suture in adult Indian crania. Acta Anat (Basel) 1979;105(4):46974. 15. Ajmani ML, Mittal RK, Jain SP. Incidence of the metopic suture in adult Nigerian skulls. J Anat 1983;137 (Pt 1):17783. 16. Baaten PJ, Haddad M, Abi-Nader K, Abi-Ghosn A, Al-Kutoubi A, Jurjus AR. Incidence of metopism in the Lebanese population. Clin Anat 2003;16(2):148 51. 17. del Sol M, Binvignat O, Bolini PD, Prates JC. Metopism in Brazilians. Rev Paul Med 1989;107(2):1057. 18. Dolinak D, Matshes EW, Lew EO. Forensic Pathology. Principles and Practice. San Diego (USA): Elsevier Academic Press;2005. 19. Cunha E, Cattaneo C. Forensic Anthropology and Forensic Pathology.The State of the Art. In Schmitt A, Cunha E, Pinheiro J. Forensic Anthropology and Medicine. Complementarii Sciences From Recovery to Cause of Death. New Jersey (USA): Humana Press;2006. 20. Panaitescu V, Ionescu L. Notiuni generale asupra identificarii. In Belis V editor. Tratat de medicina legala. Bucuresti (Romania): Edit. Medicala;1995.
228 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

21. (http://celebrating200years.noaa.gov/magazine/tct/tct_side1.html) 22. White TD, Folkens PA. The Human Bone Manual. London (UK): Elsevier Academy Press;2005. 23. Faller A, Schnke M, Schnke G. The Human Body. An Introduction to Structure and Function. Stuttgart (Germany): Thieme Verlag;2004. 24. Papilian V. Anatomia Omului. Volumul 1. editia a 11-a. Bucuresti (Romania): BIC ALL;2006. 25. Botez P. Ortopedie. Iasi (Romania); Editura Bit;2001. 26. Waugh A, Grant A. Anatomy and Physiology in Health and Illness. London (UK): Elsevier;2004. 27. Scanlon VC, Sanders T. Essentials of Anatomy and Physiology. 5th ed. Philadelphia (USA): F.A. Davis Company;2007. 28. Ortner DJ. Identification of Pathological Conditions in Human Skeletal Remains. 2nd ed. San Diego (USA): Elsevier;2003. 29. Dumitru DV. Morfologie dentara. Curs. UMF Carol Davila. Bucuresti (Romania) ;2003. 30. Fuller JL, Denehy GE, Schulein TM. Concise Dental Anatomy and Morphology. 4th ed. University of Iowa;2001. 31. Podoleanu L, Burcin RI, Ivascu RV. Anatomia membrului inferior. Curs. UMF Carol Davila Bucuresti ;2000. 32. France DL. Human and Nonhuman Bone Identification. A Color Atlas. Boca Raton (USA): CRC Press;2009. 33. US Department of Health and Human Services, Public Health Services, Protection of Human Subjects; Reports of the Presidents Comission for the Study of Ethical Problems in Medicine and Biomedical and Behavioral Research; Notice of Availability and Request for Public Comment. Uniform Determination of Death Act. Federal Register Vol. 48, No. 146, 28.07.1983. 34. Dogaroiu C, Dermengiu D, Curca GC. Essentials of Forensic Medicine. Bucuresti (Romania): Editura Tehnoplast;2010. 35. DiMaio VJ, DiMaio D. Forensic Pathology. 2nd ed. Boca Raton (USA): CRC Press;2001 . 36. Pinheiro J. Decay Process of a Cadaver. In In Schmitt A, Cunha E, Pinheiro J. Forensic Anthropology and Medicine. Complementarii Sciences From Recovery to Cause of Death. New Jersey (USA): Humana Press;2006. 37. Gunn A. Essential Forensic Biology. 2nd ed. Oxford (UK): Wiley;2009. 38. Fairgrieve SI. Forensic Cremation Recovery and Analysis. Boca Raton (USA): CRC Press;2008. 39. Klepinger LL. Fundamentals of Forensic Anthropolgy. New Jersey (USA): Wiley;2006. 40. Dupras TL, Schultz JJ, Wheeler SM, Williams LJ. Forensic Recovery of Human Remains. Archeological Approaches. Boca Raton (USA): CRC Press;2006. 41. GeoProfesional. Investigarea solului. http://www.geoprofessional.ro/ro/metodagpr.html accesat 24.06.2011 42. IOP - Institute of Physics http://www.physics.org/featuredetail.asp?id=59
978-606-8363-03-5 229

Masterat cercetri criminalistice aplicate

43. MultiLab. Sisteme si Echipamente pentru Prelevare si Analiza Solului http://www.multilab.ro/MainPages/Key-Lab/GeoTehnica/Sol/Sol-Soil.htm 44. IBOTZ http://www.ibotz.com/biology/ecology-environmental/soiltesting/marine-viewer-1944.html 45. Dermengiu D. Patologie Medico-Legala. Bucuresti (Romania): Editura Viata Medicala Romaneasca ;2002. 46. Mays S. The Archeology of Human Bones. London (UK): Routledge ;1998. 47. Fenton T, Birkby W, Cornelison J. A fast and safe non-bleaching method for forensic skeletal preparation. J Forensic Sci 2003;48:27476. 48. Science Museum http://www.sciencemuseum.org.uk/broughttolife/objects/display.aspx?id=9318 6 49. Paleo-Tech Concepts http://paleo-tech.com/laboratoryosteometricboard.aspx 50. Paleo-Tech Concepts http://paleo-tech.com/paleo-techmandibulometer.aspx 51. Paleo-Tech Concepts http://paleo-tech.com/hillson-fitzgeralddentalcaliper.aspx 52. Buikstra JE, Ubelaker DH. Standards for Data Collection from Human Skeletal Remains. Arkansas Archaeological Survey Research Series No. 44. Fayetteville, AK: Arkansas Archaeological Survey;1994. 53. Mays S. The Archeology of Human Bones. London (UK): Routledge;2010. 54. Hochrein MJ. A Bibliography Related to Crime Scene Interpretation with Emphases in Forensic Geotaphonomic and Forensic Archaeological Field Techniques. 11th ed. Washington DC (USA): FBI Print Shop;2004. 55. Gilbert BM. Mammalian Osteology. Missouri Archeological Society;1990. 56. Adams BJ, Konigsberg LW. How Many People? Determining the Number of Individuals Represented by Commingled Human Remains. In Adam BJ, Byrd JE. Recovery, Analysis, and Identification of Commingled Human Remains. New Jersey (USA): Humana Press;2008. 57. Callewaert F, Sinnesael G, Gielen E, Boonen S, Vanderschueren D. Skeletal sexual dimorphism: relative contribution of sex steroids, GH IGF1, and mechanical loading. J Endocrinol 2010Nov; 207(2):127-34. 58. Bruzek J, Murail P. Methodology and Reliability of Sex Determination From the Skeleton. In Schmitt A, Cunha E, Pinheiro J. Forensic Anthropology and Medicine. Complementarii Sciences From Recovery to Cause of Death. New Jersey (USA): Humana Press;2006. 59. Jamieson A, Moenssens A. Wiley Encyclopedia of Forensic Science. Chichester (UK): Wiley;2009. 60. Loth SR, Henneberg M. Sexually dimorphic mandibular morphology in the first few years of life. Am J Phys Anthropol 2001;115(2):17986. 61. Weaver DS. Sex differences in the ilia of a known sex and age sample of fetal and infant skeletons. Am J Phys Anthropol 1980;52(2):1915. 62. Mittler DM, Sheridan SG. Sex determination in subadults using auricular surface morphology: a forensic science perspective. J Forensic Sci 1992;37(4):106875. 63. Richard S, Snell MD. Clinical Anatomy for Medical Students. London (UK): Little, Brown and Company;1995.
230 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

64. Scheuer L, Black S. Developmental Juvenile Osteology. Oxford (UK): Elsevier;2000. 65. Caffel A, Holst M. Osteological Analysis. The Church of St. Michael and St. Lawrence, Fewston, North Yorkshire. York Osteoarcheology;2010. 66. Scheuer L. Application of Osteology to Forensic Medicine. Clinical Anatomy 2002;15:297-312. 67. Greene MF, Creasy RK, Resnik R, Iams JD, Locwood CJ, Moore T. MaternalFetal Medicine: Principles and Practice. 6th ed. Philadelphia (USA): Saunders;2009. 68. Fazekas IG, Kosa K. Forensic fetal osteology. 1st Budapest Hungary Akademiai Kiado Publishers;1978. 69. Calabuig G, Canadas EV. Medicina Legala y Toxicologia. 6th ed. Madrid (Espana): Masson Elsevier;2006. 70. Latham KE, Finnegan M. Age Estimation of The Human Skeleton. Springfield (USA): Charles C. Thomas Publishers;2010. 71. Iscan MY, Loth SR, Wrigh RK. Metamorphosis at the Sternal Rib End: A New Method to Estimate Age at Death in White Males. American Journal of Physical Anthropology . 1984;65: 147156. 72. Iscan MY., Loth, S.R. & Wright, R.K. Age Estimation from the Rib by Phase Analysis: White Females. Journal of Forensic Sciences. 1985;30: 853863. 73. Lovejoy CO, Meindl RS, Pryzbeck TR, Mensforth RP. Chronological Metamorphosis of the Auricular Surface of the Ilium: A New Method of Determining Adult Age at Death. American Journal of Physical Anthropology. 1985;68: 1528. 74. Kunter M. Rekonstruktion, Konservierung und Reproduktion. In Knussmann R. Anthropologie, Vol. I. Stuttgart (Germany): Gustav Fischer;1988. 75. Cattaneo et al. Personal Identification of Cadavers and Human Remains. In Schmitt A, Cunha E, Pinheiro J. Forensic Anthropology and Medicine. Complementary Sciences From Recovery to Cause of Death. New Jersey (USA): Humana Press;2006. 76. http://medtechinsider.com/wp-content/uploads/2008/07/sensable_freeform.jpg 77. Park HK, Chung JW, Kho HS. Use of hand-held laser scanning in the assessment of craniometry. Forensic Science International 2006;(160): 200 206. 78. Sensable http://www.sensable.com/ 79. Dermengiu D. et al. Curs de Medicina Legala. Bucuresti (Romania): Universitatea de Medicina si Farmacie Carol Davila ;2005. 80. Leung CKK. Forensic Odontology. Dental Bulletin Vol.13 No.11. 11.2008. 81. Balfour AJC . Some Aspects of Forensic Dentistry [Report] United Services Section Meeting 2. December 1976, vol 70. 04.1977. 82. Robinson FG, Rueggeberg FA, Lockwood PE. Thermal stability of direct dental esthetic restorative materials at elevated temperatures. Journal of Forensic Sciences 1998;43(6): 11631167.

978-606-8363-03-5

231

Masterat cercetri criminalistice aplicate

83. The Structural Featturs of Teeth. http://medinfo.ufl.edu:8050/~dental/denhisto/lecture_materials/tooth2007b_nxp owerlite_.ppt) 84. Bowers CM.Forensic Dental Evidence: An Investigators Handbook. 1st ed. San Diego (USA): Elsevier;2004. 85. David M, David M. Implicatii clinice ale morfologiei radiculare in tratamentul endodontic al dintilor permanenti. http://www.lsmdb.ro/ 86. World Dental Federation http://www.fdiworldental.org/content/two-digitnotation 87. American Board of Forensic Odontology. Diplomates Reference Manual. 03.2011 88. Center for Education and Reasearch in Forensic. The University of Texas. http://www.utforensic.org/dentalID.asp 89. CEROG - Centro Especializado em Radiologia Odontolgica de Guarulhos. http://cerog.com.br/radiografiaintraorais.php 90. Communicate Medicale. http://www.comunicatemedicale.ro/comunicateoficiale/ 91. Crisans orthodontics. http://www.drcrisan.ro/wpcontent/uploads/2010/08/intraoral2.jpg http://www.drcrisan.ro/wp-content/uploads/2010/08/intraoral31.jpg 92. Oral Answers http://www.oralanswers.com/wpcontent/uploads/2010/09/tetracycline_staining _close_up.jpg 93. Growth Orthodontics. http://growthorthodontics.com/images/examples/Example4B.jpg 94. Implantodent. http://www.implantodent.ro/assets/galleries/64/119278581_31702b9408_o.jpg 95. Children Dental Health. http://www.childrensdentalhealth.com/images/supernumerary-tooth.jpg 96. WinID3 Dental Identification System. http://www.winid.com 97. Pauna M, Andrei OC, Dobrin B. Marcarea protezelor mobile o necesitate. Partea a 2-a. Dental target nr. 5 anul II , noiembrie 2007 p:6 9 98. Hillson S.: Teeth. Cambridge (UK): Cambridge University Press;1986. 99. Sherwood IA, Narayan L. Essentials of Operative Dentistry. New Delhi (India): Jaypee Brothers Medical Publishers; 2010. 100. Cox M, Mays S. Human Osteology In Archaeology and Forensic Science. 1st ed. Cambridge (UK): Greenwich Medical Media Limited;2000. 101. Schaefer M, Black S, Scheuer L. Juvenile Osteology. A Laboratory and Field Manual. San Diego (USA): Academic Press;2009. 102. Senn DR, Stimson PG. Forensic Dentistry. 2nd ed. Boca Raton (USA): CRC Press;2010. 103. Vij K. Textbook of Forensic Medicine and Toxicology. New York (USA): B.I.
Churchill Livingstone; 2002.

104. Singh A, Gorea RK, Singla U. Age estimation from physiological changes of teeth. JIAFM, 2004; 26(3):p94-96.
232 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

105. Singh A, Gupta VP, Das S. Physiological Changes in Teeth as a Tool to Estimate Age. The Pacific Journal of Science and Technology, 2009; 10(2):p956-965. 106. Gustafson G. Age determination on teeth. J Am Dent Assoc 1950; 41: 45-54. 107. Rajendran R, Sivapathasundaram B. Shafers Textbook of Oral Pathology. 6th ed. Nw Delhi (India): Elsevier;2009. 108. Whittaker D. Ageing from the dentition. In Cox M, Mays S. Human Osteology In Archaeology and Forensic Science. 1st ed. Cambridge (UK): Greenwich Medical Media Limited;2000. 109. Johanson G.. Age determination from human teeth. Odont Revy 1971 ;22:1 126. 110. Meinl A. The Application of Dental Age Estimation Methods: Comparative Validity and Problems in Practical Implementation Doctoral Dissertation Department of Anthropology University of Vienna;2008. 111. Ogino T, Ogino H, Nagy B. Application of amino acid racemization to forensic odontology post-mortem designation of age at death. Foren Sci Int 1989; 29: 259-267. 112. Mornstad H, Pfeiffer H, Teivens A. Estimation of dental age using HPLCtechnique to determine the degree of aspartic acid racemization. J Forensic Sci 1994;39:142531 113. Medici Stomatologi.http://www.medici-stomatologi.ro/infodent/fluorozadentara 114. Bakland LK, Andreasen JO. Dental traumatology: essential diagnosis and treatment planning. Endodontic Topics 2004;7:1434. 115. Jeffreys AJ, Brookfield JFY, Semenoff R. Positive identification of an immigration test-case using human DNA fingerprints, Nature. 1985; 317:818 819. 116. Goodwin W, Linacre A, Hadi S. An Introduction to Forensic Genetics. 2nd ed. London (UK): Wiley;2011. 117. Jeffrey AJ, Allen MJ, Hagelberg E, Sonnberg A. Identification of the skeletal remains of Mengele, Josef by DNA analysis. Forensic Sci Int 1992;56: 6576. 118. Medical Place. http://medicalplace.blogspot.com/2011/01/celula-umana.html 119. Passarge E. Color Altas of Genetics. 2nd ed. Stuttgart (Germany): Thieme;2001. 120. Lewis R. Human Genetics. Concepts and Applications. 9th ed. New York (USA): McGraw Hill;2010. 121. Silbernagl S, Despopoulos A. Color Atlas of Physiology. 6th ed. Stuttgart (Germany): Thieme;2009. 122. Butler JM. Fundamentals of Forensic DNA Typing. 3rd ed. San Diego (USA): Academic Press;2010. 123. National Human Genome Research Institute. http://www.genome.gov/12011238 124. Michaelis RC, Flanders RG, Wulf P. A Litigators Guide to DNA. From The Laboratory to The Courtroom. San Diego (USA): Elsevier;2008.

978-606-8363-03-5

233

Masterat cercetri criminalistice aplicate

125. Potorac R. Genetica Judiciara in Romania.. Simpozionul International Investigarea criminalistic a infractiunilor din domeniul crimei organizate 27-28 octombrie 2009 organizat de Asociatia Criminalistilor din Romnia. 126. Potorac R. Tactica identificarii si valorificarii probelor genetice din scena infractiunilor. Ministerul Public. Articole, Doctrina si Jurisprudenta:224-245. 127. Qiagen QIAamp DNA Stool Mini Kit. http://www.qiagen.com/products/genomicdnastabilizationpurification/qiaampsy stem/qiaampdnastoolminikit.aspx#Tabs=t0 128. Nakazono TO. et al. Successful DNA typing of urine stains using a DNA purification kit following dialfiltration. Journal of Forensic Sciences. 2005; 50:860 864. 129. Whatman FTA cards. http://www.whatman.com/FTANucleicAcidCollectionStorageADNPurification. aspx 130. Lege nr. 76/2008 privind organizarea si functionarea Sistemului National de Date Genetice Judiciare. Monitorul Oficial, Partea I nr. 289 din 14/04/2008 131. Butler JM. Forensic DNA Typing. Biology, Technology, and Genetics of STR Markers. 2nd ed. Burlington (USA): Elsevier;2005. 132. Potorac R, Potorac SM. Genetica judiciara. Vol 1. Bucuresti (Romania: Centrul Tehnic-Editorial al Armatei; 2005. 133. Vasilescu E. In. Belis V editor. Tratat de medicina legala. Bucuresti (Romania): Edit. Medicala;1995. 134. Newton M. The Encyclopedia of Crime Scene Investigation. New York (USA): Infobase Publishing;2008. 135. Bevel T. Gardner RM. Bloodstain Pattern Analysis. With an Introduction to Crime Scene Reconstruction. Boca Raton (USA): CRC Press;2002. 136. ABAcard HemaTrace. http://abacusdiagnostics.com/hematrace.htm 137. Bureau of Criminal Apprehension . A Division of the Minnesota Department of Public Safety. https://dps.mn.gov/divisions/bca/bca-divisions/forensicscience/Pages/forensic-programs-crime-scene-blood.aspx 138. Independent Forensics. http://www.ifi-test.com/rsid.php 139. Independent Forensics. RSID Document Center. http://www.ifi-test.com/rsid_doc_center_new.php 140. Ministerul Administratiei si Internelor. Genetica judiciara, varf de lance a criminalisticii. Buletin informativ MAI Nr. 1016 Bucureti, 25 noiembrie 2003. 141. Manjunath BC, Chandrashekar BR, Mahesh M., Vatchala Rani RM. DNA Profiling and forensic dentistry - A review of the recent concepts and trends. Journal of forensic and legal medicine. 07/2011; 18(5):191-7. 142. Invitrogen. Molecular Probes. Quant-iT PicoGreen dsDNA Reagent and Kits 143. Invitrogen. http://www.invitrogen.com/site/us/en/home.html 144. http://www.scientific.org/case-in point/articles/thompson/autorads.html 145. Applied Biosystems AmpFlSTR Identifiler PCR Amplification Kit Users Manual; 2011. 146. Applied Biosystems AmpFlSTR SGM Plus Userss Manual; 2011.
234 publicat online: www.itcode.ro

Identificarea persoanei n medicina legal

lect. univ. dr. Dogroiu Ctlin

147. Mozayani A, Noziglia C. The Forensic Laboratory Handbook Procedures and Practice. 2nd ed. New York (USA): Springer;2011. 148. Federal Bureau of Investigation. Laboratory Services. http://www.fbi.gov/about-us/lab/national-missing-persons-dna-database-nmpdd 149. Federal Bureau of Investigation. Laboratory Services. http://www.fbi.gov/about-us/lab/forensic-science communications/fsc/april2003/swgdammitodna.htm/ 150. DNA Initiative. Advancing Criminal Justice Through DNA Technology. http://www.dna.gov/dna-databases/types 151. Federal Bureau of Investigation. Laboratory Services. http://www.fbi.gov/about-us/lab/codis/ndis-statistics 152. NPIA National Policing Improvement Agency. http://www.npia.police.uk/en/13338.htm 153. Mithocondrial DNA Control Region Database. http://empop.org/modules/overview/. 154. Legea nr. 481/2004 privind protectia civila, republicata 2008. Monitorul Oficial, Partea I nr. 554 din 22/07/2008. 155. Interpol. Disaster Victim Identification Guide. 2009. 156. U.S. Department of Justice Office of Justice Programs . Mass Fatality Incidents: A Guide for Human Forensic Identification Technical Working Group for Mass Fatality Forensic Identification; 2005. 157. Kenyon International Emergency Services. A World Wide Disaster Management Company. http://www.kenyoninternational.com/contact.htm 158. Kenyon International Emergency Services. A World Wide Disaster Management Company. http://www.kenyoninternational.com/PDF/PlassData.pdf 159. Ratner SR . Categories of war crimes. In Gutman R, Reiff D. Crimes of War: What the Public Should Know. New York (USA): W.W. Norton & Company;!999. 160. Douglas JE, Burgess AW, Burgess AG, Ressler RK. Crime Classification Manual: A Standard System for Investigating and Classifying Violent Crimes. San Francisco (USA): Jossey-Bass Publishers;1992. 161. United Nations. Manual on the Effective Prevention and Investigation of ExtraLegal, Arbitrary and Summary Executions. New York (USA);1991. 162. Haglund WD, Connor MA, Scott DD. The archaeology of contemporary mass graves, Historical Archaeology 2001;35(1), 5769. 163. Interpol. Disaster Victim Identification Form, version 2008 164. Rosu M. Raport de expertiza medico-legala antropologica. Sectorul de Antropologie, Laborator de Identificare Medico-Legala, INML Mina Minovici.

978-606-8363-03-5

235

S-ar putea să vă placă și