ARTICLE IN PRESS

Journal of Plant Physiology 165 (2008) 17831797

www.elsevier.de/jplph

Consumption of oxygen by astaxanthin biosynthesis: A protective mechanism against oxidative stress in Haematococcus pluvialis (Chlorophyceae)
Yantao Lia,b, Milton Sommerfelda, Feng Chenb,1, Qiang Hua,
a

Department of Applied Biological Sciences, Arizona State University, Polytechnic Campus, 7001 E. Williams Field Road, Mesa, AZ 85212, USA b Department of Botany, The University of Hong Kong, Pokfulam Road, Hong Kong, PR China Received 19 September 2007; received in revised form 21 December 2007; accepted 21 December 2007

KEYWORDS Astaxanthin; Carotenogenesis; Haematococcus pluvialis; MRNA expression; Oxidative stress

Summary
Haematococcus pluvialis, a unicellular green microalga, experiences photooxidative stress when exposed to excess photon ux density (PFD) relative to the capacity of photosynthesis, and particularly under other adverse environmental conditions (e.g., nutrient depletion, salinity, and excess heavy metals). Under stress, Haematococcus cells synthesize and accumulate large amounts of the secondary carotenoid astaxanthin stored in cytosolic lipid bodies. In this study, the transcriptional expression of ve astaxanthin biosynthesis genes and two plastid terminal oxidase (PTOX) genes either in high PFD or in the presence of excessive sodium acetate and/or iron was determined by real-time reverse transcription PCR, and astaxanthin accumulation was measured by HPLC. Photosynthetic oxygen evolution, lipid peroxidation, and cell mortality were also investigated under these stress conditions. Our results indicate that the astaxanthin biosynthesis pathway may consume as much as 9.94% of the molecular oxygen evolved from photosynthesis under stress via at least two distinct routes: (1) extensive oxygen-dependent processes leading to astaxanthin formation, and (2) conversion of molecular oxygen into water using electrons derived from carotenogenic desaturation steps to PTOX via the photosynthetic plastoquinone (PQ) pool. Reduction of reactive oxygen species (ROS) production by reducing subcellular molecular oxygen substrates through the astaxanthin biosynthesis pathway may represent a novel

Abbreviations: FE, ferrous sulfate; HL, high light; LL, low light; PFD, photon ux density; PQ, plastoquinone; PS, photosystem; PTOX, plastid terminal oxidase; ROS, reactive oxygen species; SA, sodium acetate. Corresponding author. Tel./fax: +1 480 727 1484. E-mail addresses: sfchen@hkusua.hku.hk (F. Chen), huqiang@asu.edu (Q. Hu). 1 Tel.: +852 2299 0309; fax: +852 2299 0311. 0176-1617/$ - see front matter & 2008 Elsevier GmbH. All rights reserved. doi:10.1016/j.jplph.2007.12.007

ARTICLE IN PRESS
1784 Y. Li et al.
protective mechanism to cope with oxidative stress. Reoxidation of the PQ pool by PTOX may further reduce photosynthetic electron transport chain-induced ROS formation. & 2008 Elsevier GmbH. All rights reserved.

Introduction
Reactive oxygen species (ROS), such as singlet oxygen, oxygen superoxide (O), hydrogen perox2 ide (H2O2) and the hydroxyl radical (OH), are continuously produced as by-products of photosynthesis by energy transfer or reduced electron transport components associated with photosystem (PS)I, PSII, and reactions linked to the photorespiratory pathway in the chloroplast (Asada, 1994; Klotz, 2002; Mittler, 2002). ROS can potentially react with major macromolecules such as DNA, lipids, and protein, resulting in cellular damage (Apostol et al., 1989; Asada, 1999). Algae may have evolved various strategies for nonenzymatic and enzymatic detoxication mechanisms to cope with the accumulation of these potentially toxic compounds under photooxidative stress. Nonenzymatic antioxidants can be carotenoids, glutathione, ascorbate, tocopherol, avonoids, and alkaloids (Luis et al., 2006). Many green algae, such as Haematococcus pluvialis (Goodwin and Jamikorn, 1954; Boussiba et al., 1999; Park and Lee, 2001), Chlorococcum sp. (Liu and Lee, 2000; Ma and Chen, 2001), Chlamydomonas nivalis (Bidigare et al., 1993; Remias et al., 2005), and Chlorella zongiensis (Orosa et al., 2000; Del Campo et al., 2004), can produce large amounts of the red carotenoid astaxanthin under photooxidative stress conditions. It is commonly perceived that the formation of large amounts of astaxanthin or other keto-carotenoids in the cell is a survival strategy of these organisms under photooxidative stress and other adverse environmental conditions, but the specic protective mechanism of astaxanthin as a nonenzymatic antioxidant against ROS remains undened. The mainstream hypothesis proposes that large accumulations of astaxanthin esters in cytoplasmic lipid bodies in H. pluvialis and many other green algae function as a sunscreen to reduce the amount of light striking the light-harvesting pigmentprotein complexes and the photosynthetic reaction centers, thus potentially limiting photosynthetic photoinhibition and photodamage caused by excess photon ux density (PFD) (Yong and Lee, 1991; Hagen et al., 1993; Wang et al., 2003). As such, the esterication of astaxanthin with fatty acids represents a possible mechanism by which

this chromophore can be concentrated within cytoplasmic globules to maximize its photoprotective efciency (Bidigare et al., 1993). As an alternative, Kobayashi et al. (1997, 1999) and Kobayashi (2003) proposed that astaxanthin in H. pluvialis functions as a protective agent against ROS. However, the spatial separation of the primary ROS production site, i.e., the chloroplast, and the site of astaxanthin deposition, i.e., cytoplasmic lipid bodies, makes the efciency of astaxanthin as an ROS scavenger questionable. Fan et al. (1998) suggested that astaxanthin is not itself the protective agent, but rather the intermediates in the process of astaxanthin biosynthesis which scavenge ROS. In this study, we re-examined, using realtime reverse transcription PCR and physiological and biochemical methods, the physiological role of astaxanthin biosynthesis in H. pluvialis exposed to excess PFD and PFD in combination with salt and/or iron stress. Our results indicated that consumption of large amounts of molecular oxygen by the astaxanthin biosynthesis pathway represents a mechanism by which H. pluvialis, and, perhaps many other green algae, reduce ROS production under oxidative stress. Thus, astaxanthin biosynthesis pathway may function in multiple roles in protecting the cell against oxidative stress.

Materials and methods

Organism, growth medium, and culture conditions
H. pluvialis Flotow NIES144 was obtained from the National Institute for Environmental Studies in Tsukuba, Japan. A basal growth medium described by Kobayashi et al. (1991) was used: 14.6 mM sodium acetate (SA); 2.7 mM L-asparagine; 2 g L1 yeast extract; 0.985 mM MgCl2; 0.135 mM CaCl2; 0.036 mM FeSO4; pH 6.8. The cells were grown in 250 mL Erlenmeyer asks containing 100 mL of growth medium. Cultures were incubated in a Percival growth chamber (model: 1-35LLVL; Boone, IA, USA) at 22 1C and 20 mmol photons m2 s1 of light (20 W white uorescent lamps) under a 12 h

ARTICLE IN PRESS
Reduction of oxidative stress by astaxanthin biosynthesis light:12 h dark cycle (optimal growth condition). Cultures were shaken manually twice daily. For induction of astaxanthin biosynthesis and red cyst formation, exponentially growing cultures (cell density of approximately 5 105 cells mL1) were exposed to continuous illumination of 250 mmol photons m2 s1 in the presence or absence of SA and ferrous sulfate (FE) at a nal concentration of 45 mM and 450 mM, respectively. As a control, some cultures were maintained throughout the experiment period in continuous, low light (LL) intensity of 20 mmol photons m2 s1. 1785

RNA isolation and cDNA preparation

Haematococcus cells were collected by centrifugation and the resulting cell pellet was frozen and subsequently ground under liquid nitrogen using a mortar and pestle. RNA was then isolated according to the miniprep RNA extraction procedure (Sokolowsky et al., 1990) with minor changes: RNA extract was treated with DNase-I (Invitrogen, Carlsbad, CA, USA) at 37 1C for 30 min, and then mixed thoroughly with equal volume of phenol:chloroform (1:1). After centrifuging (10,000 rpm, 10 min at 4 1C), 0.75 mL of 8 M LiCl was added for precipitation. Nuclear acids were quantied by NanoDrop 3.0.0 (NanoDrop, Wilmingon, DE, USA). For real-time RT-PCR analysis, rst strand cDNA synthesis was carried out using a Taqman Reverse Transcription system according to the manufacturers instructions (Applied Biosystems, Foster City, CA, USA). 250 ng of total RNA was used in a 10 mL reaction system. Controls received water instead of reverse transcriptase to assess any contamination from genomic DNA.

Cell enumeration and pigment analysis

Cell numbers in the cultures were determined using a hemacytometer under a light microscope (Olympus BH-2, Olympus, Tokyo, Japan). Pigment composition of the cells was analyzed by HPLC according to the method of Yuan et al. (2002). Briey, algal cells were harvested and extracted in the solvent mixture of dichloromethane and methanol (25:75, v/v). The pigment extracts (20 mL aliquots) were separated and analyzed by using a Beckman Ultrasphere C18 column (250 mm long, 4.6 mm i.d.; 5 mm; Beckman Instruments, Fullerton, CA, USA) at 25 1C. The mobile phase consisted of solvent A (dichloromethane/methanol/acetonitrile/water, 5.0:85.0:5.5:4.5, v/v) and solvent B (dichloromethane/methanol/acetonitrile/ water, 25.0:28.0:42.5:4.5, v/v). The ow rate was 1.0 mL min1. The three-dimensional chromatogram was monitored from 250 to 750 nm. Astaxanthin, lutein and b-carotene were measured at 480 nm and chlorophyll a and b were measured at 450 nm according to Yuan (1999). Chromatographic peaks were identied by comparing retention times and spectra against known standards or by comparing their spectra with published data.

Primer sequence selection

Primer sequences of 1825 nucleotides were chosen for ipi, psy, pds, crtO, and crtR, using the Primer Expresss Software Version 2.0 (Applied Biosystems, Foster City, CA, USA) and designed to produce 50160 bp PCR products with a melting temperature of about 60 1C. Primer sequences of 1718 nucleotides for pds were obtained from Grunewald et al. (2000) (Table 1). The following Haematococcus genes were applied to the primer design: phytoene synthase (EMBL/GenBank accession number AF305430), phytoene desaturase (EMBL/GenBank accession number X86783), carotenoids hydroxylase (EMBL/GenBank accession

Table 1. Gene

Gene-specic oligonucleotide sequences used in this work Accession Forward primer (50 30 ) Reverse primer (50 30 ) Primer number concentration (nm) 100 100 50 250 150 250 500 250

18S crtO crtR-b ipi psy pds ptox1 ptox2

AF159369 D45881 AF162276 AB019034 AF305430 X86783 DQ485457 DQ485458

TGCCTAGTAAGCGCGAGTCA ACGCCTACAAACCTCCAGCA GGGCTGAACTGGAGCAGTTG GGTACGTGACGCAGGAGGAG ACCAGACCTTCGACGAGCTG TCGCATCGGCCTGCTGC GAGCTGCACCACCTGCAGAT GAGCTGCACCACCTGCAGAT

CCCACCGCTAAAGTCAATCC AAAACACTGCGGTCCAGGTG GCGGAGTCATTGCTTCACAA TTCCCCAATCCTCGTGTTTG TGCCCATGACAGGCATAGTC GGCCAGGTGCTTGACGCT CTCTGAAAACGTGTACGCCAGGGA CTGCATGAAGTTGTACGCCACCTT

ARTICLE IN PRESS
1786 number AF162276), carotenoids ketolase (EMBL/ GenBank accession number D45881), isopentenyl diphosphate isomerase (EMBL/GenBank accession number AB019034), 18S ribosomal RNA gene (EMBL/GenBank accession number AF159369), plastid terminal oxidase (PTOX) 1 (EMBL/GenBank accession number DQ485457) and PTOX 2 (EMBL/ GenBank accession number DQ485458). Y. Li et al. were determined when specic amplication relative to primerdimers was maximal in a positive versus negative control experiment. After heating at 50 1C for 2 min and 95 1C for 10 min, PCR reactions proceeded via 40 cycles of 15 s at 95 1C and 15 s at 60 1C. Finally, dissociation stages of 15 s at 95 1C, 15 s at 60 1C and 15 s at 95 1C were used to detect any non-specic amplication products. The experiments (RNA isolation, cDNA synthesis followed with real-time PCR assay) were repeated three times independently, and the data were averaged.

Generation of gene-specic real-time PCR standards

Twenty-ve ng cDNA was amplied with 100 nm of specic primer pairs by conventional PCR (95 1C, 10 min; 94 1C, 1 min; 58 1C, 1 min; 72 1C, 1 min) with several repeats using the MasterTaq Kit (Eppendorf, USA). PCR fragments were run on a 3% agarose gel, excised and eluted using the Geneclean Kit (Q BIOgene, USA). One ShotsTOP chemically competent Escherichia coli (from TAClonings Kit, Invitrogen, Carlsbad, CA, USA) was used for PCR products cloning. DNA fragments containing the cDNA sequence of target genes were ligated to a pCR21 vector (Invitrogen, Carlsbad, CA) overnight at 14 1C. Transformation of ligates was carried out following the instructions of Invitrogen. Positive clones were screened on 50 mg mL1 Kam plates by white/blue selection and conrmed by whole cell PCR method with M13 primers, and the plasmid DNA was used to prepare the templates for the standards. The molar concentrations were calculated on the basis of the mass concentration and the length in base pairs of each fragment. Equimolar quantities of the standards were serially diluted 10-fold and used to generate standard curves. Specic amplication of the targeted cDNAs was conrmed by sequencing of the PCR products using the dideoxy-nucleotide terminator method with ABI Prism Dye-terminator system (PE Biosystems, Foster City, CA, USA).

Quantication and data analysis

Data were captured as amplication plots. Transcription levels of the target genes were calculated from the threshold cycle by interpolation from the standard curve. To standardize the results, the relative abundance of 18S rRNA was also determined and used as the internal standard. All calculations and statistical analyses were performed as described in the ABI 7900 sequence detection system User Bulletin 2 (Applied Biosystems, Foster City, CA, USA).

Oxygen evolution and consumption measurements

Green and red cells of Haematococcus were harvested by centrifugation (3000g, 2 min), and the pellets were re-suspended in fresh acetate basal medium to obtain either the same cell numbers or the same chlorophyll concentrations. Oxygen evolution rate of each sample was determined with an O2 Oxygraph (Hansatech Instruments Ltd., Norfolk, UK) at 30 1C, 2000 mmol photons m2 s1 using both red and white light, whereas oxygen consumption rate was measured in cultures maintained in the dark according to Vonshak et al. (1988). Chlorophyll concentration was about 10 mg L1.

Real-time quantitative PCR using SYBR Green

Real-time PCR was performed in triplicate on cDNA samples or control samples, which were used to conrm the absence of DNA or RNA contamination, on an ABI Prism 7900 sequence detection system (Applied Biosystems, Foster City, CA, USA). In each experiment, a standard dilution series of plasmids containing specic PCR fragments or 25 ng cDNA (total RNA equivalent) of unknown samples were amplied in a 20 mL reaction containing 1 SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and each primer. The primer concentrations are shown in Table 1, which

Lipid peroxidation analysis

The extent of lipid peroxidation in cells was estimated by measuring the formation of malondialdehyde (MDA) equivalents as described (Hodges et al., 1999). Samples were homogenized with inert sand in 1:25 (g FW:mL), 95:5 or 80:20 (v:v) ethanol:water, followed by centrifugation at 3000g for 10 min. A 1-mL aliquot of appropriately diluted sample was added to a test tube with 1 mL of either (i) TBA solution comprised of 20.0% (w/v) trichloroacetic acid and 0.01%

ARTICLE IN PRESS
Reduction of oxidative stress by astaxanthin biosynthesis butylated hydroxytoluene, or (ii) TBA solution containing the above plus 0.65% TBA. Samples were then mixed vigorously, heated at 95 1C in a block heater for 25 min, cooled, and centrifuged at 3000g for 10 min. Absorbances were read at 440, 532, and 600 nm. Malondialdehyde equivalents were calculated in the following manner: (1) [(Abs 532+TBA)(Abs 600+TBA)(Abs 532TBAAbs600TBA)] A. (2) [(Abs 440+TBAAbs 600+TBA) 0.0571] B. (3) MDA equivalents (nmol ml1) (AB/157,000) 106. 1787

Results
Transcriptional expression proles of carotenoid biosynthetic genes under different stress conditions
The time course of gene expression at high PFD in the presence/absence of iron and salt stress Haematococcus cells were maintained under the optimal growth conditions (e.g., 20 mmol photons 2 1 m s and 22 1C) for 4 days. Exponentially growing cells were then subjected to a high PFD of 250 mmol 2 1 photons m s (high light (HL)) for four more days. The transcriptional expression of ve carotenoid biosynthetic genes, i.e., ipi, psy, pds, crtO, and crtR-b, as affected by HL was monitored by realtime RT-PCR. As shown in Fig. 1, all the carotenoid genes studied were slightly up-regulated in the control culture at LL, and the maximum levels of the gene expression did not occur until the end of the experiment. A transient up-regulation of the carotenoid genes was observed in cultures grown at HL. The maximum transcript levels of ipi, psy, pds, crtO, and crtR-b were ca. 4.4-fold, 13.9-fold, 5.4fold, 4.8-fold, and 38.5-fold higher, respectively, than that at the onset of HL induction (0 h), and the maximum transcripts of the ve genes occurred at 12 h. It has been previously shown that SA and FE at a nal concentration of 45 mM and 450 mM, respectively, can effectively induce astaxanthin formation in H. pluvialis cells at HL (Kobayashi et al., 1991; Kobayashi et al., 1993; Steinbrenner and Linden, 2001; Wang et al., 2004, 2005). To further understand the response of individual carotenoid biosynthetic genes to multiple stressors, the time course of the carotenoid gene expression was performed under high PFD in the presence of SA and FE (HL+SA+FE) (Fig. 1). The mRNA expression of ipi and pds responded similarly following the onset of

HL+SA+FE treatment, and approximately 6-fold increase in the maximum transcript of the two genes was observed at 12 h. In contrast, mRNA transcripts of psy, crtO and crtR-b began to increase after 6 h; yet, the maximum level was not attained until 48 h. While the maximum transcripts of crtO were within similar range as that of ipi and pds (less than 6-fold), the transcript level of psy and crtR-b increased more than 24-fold at 48 h under HL+SA+FE, and the transcripts remained more than 10-fold higher after 96 h, as compared to 0 h. Because psy and crtR-b exhibited considerably higher expression rates at the transcriptional level than three other genes studied, these two genes were subjected to further investigation. Effect of various stressors on transcriptional expression of selected carotenoid genes Although SA and FE enhance the carotenoid biosynthetic gene expression and astaxanthin formation at HL, the relative contribution of the two individual factors to these changes was less understood. In this study, the effects of SA, FE, and HL, either singularly or in combination, on transcriptional expression of psy and crtR-b and the endproduct astaxanthin were determined and the results are shown in Table 2. At LL, addition of FE or SA resulted in a small and gradual increase in transcripts of psy and crtR-b. HL alone resulted in rapid increase in transcripts of the genes and the maximum transcript level occurred at 12 h. A higher transcript level was observed in cultures exposed to HL in the presence of SA or FE, but the maximum transcript levels were delayed to about 24 h. The highest amount of transcripts of psy or crtR-b was observed in cultures under HL+SA+FE, while at the same time the maximum transcript level was further delayed to 48 h. Under our experimental conditions, the extent to which the individual factors affected carotenoid gene expression increased in the following sequence:
LLoLL FEoLL SAoHLoHL FE=SAoHL SA FE.

Astaxanthin production under different stress conditions

A small, but noticeable occurrence of astaxanthin was observed in cultures under LL, resulting in the cellular content of ca. 5.63 pg astaxanthin cell1 after 72 h of cultivation (Fig. 2a), which consisted of ca. 13.1% of the total carotenoids (Fig. 2b). Rapid increase in astaxanthin

ARTICLE IN PRESS
1788
2.5
(ipi)

Y. Li et al.
1.2
(crtO)

2.0

1.0

Relative expression

Relative expression

0.8 0.6 0.4 0.2 0.0 160

1.5

1.0

0.5

0.0 7
(psy)

(crtR-b)

6 5

140 120

Relative expression

Relative expression

100 80 60 40 20 0 0 12 24

4 3 2 1 0 0.7
(pds)

36 48 60 72 Hours after induction

84

96

0.6

Relative expression

0.5 0.4 0.3 0.2 0.1 0.0 0 12 24 36 48 60 72 Hours after induction 84 96

Fig. 1. Relative expression prole of ve carotenoid biosynthetic genes in Haematococcus pluvialis at high light (250 mmol photons m2 s1) in the presence or absence of ferrous sulfate and SA. The ve genes included: (a) ipi; (b) psy; (c) pds; (d) crtO; and (e) crtR-b. As a control, the cells were maintained throughout the experiment period at continuous, LL intensity of 20 mmol photons m2 s1 (LL). Relative amounts were calculated and normalized with respect to one-thousandth of 18S gene transcript levels. Data shown represent mean values obtained from three independent amplication reactions, and the error bars indicate the SE of the mean. Note that different scales are used in graphs. During the rst 4 days, algae grew under 20 mmol photons m2 s1 of light in basal growth medium described by Kobayashi et al. (1991). For induction of astaxanthin biosynthesis and red cyst formation, exponentially growing cultures were spiked with or without SA and ferrous sulfate at a nal concentration of 45 mM and 450 mM, respectively. Cultures were then exposed to continuous illumination of 250 mmol photons m2 s1 (K HL+FE +SA, High light, m low light).

ARTICLE IN PRESS
Reduction of oxidative stress by astaxanthin biosynthesis 1789

Table 2. Maximum gene transcript level of phytoene synthase and carotenoid hydroxylase, astaxanthin concentrations, and cell numbers of Haematococcus pluvialis during the rst 48 h of growth under various stress conditions Different stress conditions LL LL+FE LL+SA HL HL+FE HL+SA HL+SA+FE Maximum psy transcript levela 0.26870.013 0.49570.02 1.28470.123 3.2370.141 3.41370.21 3.49770.67 5.670.65 Maximum crtR-b transcript levela 6.88770.886 11.97770.695 21.1371.136 71.2173.403 83.5572.868 92.7178.702 139.71176.177 Maximum expression pointb (h) 48 48 48 12 24 24 48 Astaxanthin concentrationc (mg g1 dry wt) 0.5970.083 1.1370.033 3.4870.19 6.470.33 8.5570.64 9.8670.41 9.1770.52 Cell numberd ( * 104 cells mL1) 51.271.06 46.8871.71 48.570.62 46.271.12 44.571.1 40.170.63 41.171.86

Relative amounts were calculated and normalized with respect to one-thousandth of 18S gene transcript levels. Data shown represent mean values obtained from three independent amplication reactions, and the error bars indicate the SD of the mean. a Gene transcript level was measured at 0, 12, 24 and 48 h. b Maximum expression point was expressed as hours after induction. c Astaxanthin was quantied after 48 h of induction. d Cell number was quantied after 48 h of induction.

100
80
Astaxanthin content (pg/cell)

80
Astaxanthin (% of

60

total carotenoids)

60

40

40

20

20

0 0 12 24 36 48 60 72
Hours after induction

0 0 12 24 36 48 60 72
Hours after induction

Fig. 2. Astaxanthin concentration (a) and percentage of astaxanthin relative to total carotenoids (b) of Haematococcus pluvialis under different stress conditions during the rst 72 h. (K HL+FE +SA, high light, m low light).

occurred in cultures exposed to HL, reaching 67.89 pg astaxanthin cell1 after 72 h of stress induction. The greatest increase in astaxanthin content was observed in cultures exposed to HL+SA+FE, resulting in 88.87 pg astaxanthin cell1 during the same time period (Fig. 2a). In the latter two cases, the percentage of astaxanthin relative to the total carotenoids increased to approximately 60.7% at HL and 93.5% at HL+SA+FE after 72 h (Fig. 2b). Note that the kinetics of astaxanthin accumulation in HL or in HL+SA+FE was somewhat different. During the rst 1224 h following stress induction, the increase in astaxanthin was more rapid in HL than in HL+SA+FE. Thereafter, however, the astaxanthin content under HL+SA+FE

surpassed that in HL. Higher transcript levels of psy and crtR-b were correlated with higher astaxanthin concentrations. As shown in Fig. 3, the maximum transcript levels of psy and crtR-b showed a linear relationship with cellular astaxanthin content with a correlation coefcient greater than 0.92, suggesting that astaxanthin biosynthesis is under tight transcriptional control of psy and crtR-b. Poor correlation (coefcient less than 0.8) of the maximum transcripts of ipi, pds, and crtO with astaxanthin content suggests that the expression of the latter genes for astaxanthin biosynthesis was mainly controlled at a translational rather than at a transcriptional level.

ARTICLE IN PRESS
1790
100 100

Y. Li et al.

Astaxanthin content (pg/cell)

Astaxanthin content (pg/cell)

80
R2=0.92

80
R2=0.95

60

60

40

40

20

20

0 0 1 2 3 4 5 Maximum transcripts of psy 6

0 0 20 40 60 80 100 120 140 Maximum transcripts of crtR-b 160

Fig. 3. Correlation between maximum psy and crtR-b transcripts and accumulation of astaxanthin after 48 h of different stress conditions. (a) psy and (b) crtR-b.

Oxygen consumption by astaxanthin biosynthesis

Carotenogenesis leading to astaxanthin formation involves oxygenation and hydroxylation steps that have been conrmed to be oxygen-dependent reactions (Breitenbach et al., 1996; Fraser et al., 1997). Also, the phytoene desaturation and subsequent zeta-carotene desaturation steps may provide electrons to reduce the plastoquinone (PQ) pool, which in turn reduces molecular oxygen into water catalyzed by PTOXs. A metabolic network model indicates that 21 mol of O2 is required per mol of astaxanthin synthesized (Kelly, 1990; Schroeder and Johnson, 1995). In order to determine oxygen consumption by astaxanthin biosynthesis, the oxygen evolution and consumption rate, as indicated by net photosynthetic oxygen evolution and dark respiration rate, respectively, and astaxanthin content were measured. On a per cell basis, the average oxygen evolution rates in cultures under LL, HL, and HL+SA+FE (HL++) were ca. 2, 1, and 0.3 pmol O2 cell1 h1, respectively, during the rst 48 h under stress (Fig. 4a, Table 3). The average oxygen consumption rates in cultures under LL, HL, and HL++ were ca. 0.13, 0.27, and 0.36 pmol O2 cell1 h1, respectively (Table 3). Then, the net oxygen molecules evolved under LL, HL, and HL++ were 96 pmol O2 cell1 (2 pmol O2 cell1 h1 48 h), 48 pmol O2 cell1 (1 pmol O2 cell1 h1 48 h), and 14.4 pmol O2 cell1 (0.3 pmol O2 cell1 h1 48 h), respectively. On the other hand, the total oxygen molecules consumed under LL, HL, and HL++ were 6.2 pmol O2 cell1 (0.13 pmol O2 cell1 h1 48 h),

13 pmol O2 cell1 (0.27 pmol O2 cell1 h1 48 h), and 17.3 pmol O2 cell1 (0.36 pmol O2 cell1 h1 48 h), respectively. Taken together, the total photosynthetic oxygen molecules evolved by photosynthesis under LL, HL, and HL++ were 102.2, 61, and 31.7 pmol O2 cell1, respectively. During the same period of time, cellular astaxanthin content measured in cultures under LL, HL, and HL++ were 0.0059, 0.1, and 0.15 pmol cell1 , respectively (Table 3). The astaxanthin content at HL was similar to that reported by others (Boussiba et al., 1999; Wang et al., 2003; Qiu and Li, 2006). Given that 21 mol of O2 is required for production of 1 mol of astaxanthin (Kelly, 1990; Schroeder and Johnson, 1995), the total amount of oxygen consumed by astaxanthin biosynthesis under LL, HL, and HL++ during the 48 h were 0.12 pmol O2 cell1 (i.e., 0.0059 pmol cell1 21 0.12 pmol cell1), 2.1 pmol O2 cell1 (i.e., 0.1 pmol cell1 21 2.1pmol cell1), and 3.15 pmol O2 cell1 (i.e., 0.15 pmolcell1 21 3.15 pmol cell1), respectively. As a result, astaxanthin biosynthesis consumed about 0.12%, 3.79%, and 9.94% of photosynthetically evolved oxygen under LL, HL, and HL+SA+FE, respectively (Table 3). These results suggest that the process of astaxanthin biosynthesis may reduce the amounts of molecular oxygen under oxidative stress, which would otherwise potentially be used as substrates for ROS production.

Relationship between lipid peroxidation and photosynthetic oxygen evolution

The photosynthetic activity, as indicated by net photosynthetic oxygen evolution, was measured in

Fig. 4. Oxygen evolution measurements. (a) Net oxygen evolution by Haematococcus pluvialis under various stress conditions. (b) Percentage loss of photosynthetic capacity relative to malondialdehyde (MDA) equivalents contents. Culture conditions were the same as described in Fig. 1. Open column: cultures grown under low light; Gray column: cultures grown under high light; dark column: cultures grown under HL+FE +SA (HL++).

cultures at LL, HL, and HL+SA+FE (HL++), while at the same time cellular lipid peroxidation was estimated by measuring the formation of malondialdehyde (MDA) equivalents, with higher MDA equivalents corresponding to higher levels of lipid peroxidation (Hodges et al., 1999). Photosynthetic oxygen evolution measured right before stress
Table 3. Treatments LL HL HL++ 0.0059 0.1 0.15

Reduction of oxidative stress by astaxanthin biosynthesis

Loss in photosynthesis capacity (%)

100

Net oxygen evolution rate (pmol cell-1 h-1)

0.0 0.5 1.0 1.5 2.0 2.5
6 h 2 h 4 h 8 h 6 h 2 h 4 h 8 h 6 h 2h 4h 8 h LL LL1 LL2 LL4 HL HL1 HL2 HL4 L++ ++1 ++2 ++4 H HL H L H L

20

40

60

80

0 0.0 0.2 0.4 0.6 0.8 MDA content (pmol/cell) 1.0

Percentage of O2 consumed by astaxanthin biosynthesis relative to total O2 evolved through photosynthesis during the rst 48 h of stress induction Astaxanthin content (pmol cell1) O2 consumption by astaxanthin biosynthesisa (pmol cell1) 0.124 2.1 3.15 Average O2 evolution rate (pmol cell1 h1) Average O2 uptake rate (pmol cell1 h1) Net O2 evolution (pmol cell1 h1 48 h) Total O2 uptake (pmol cell1 h1 48 h) O2 consumption by astaxanthin biosynthesis (% of total O2 evolved) (%) 0.12 3.44 9.94

R2=0.92

Treatments

ARTICLE IN PRESS

2 1 0.3

0.13 0.27 0.36

96 48 14.4

6.24 12.96 17.28

Cultures maintained at LL served as a control. O2 evolution or uptake rate was measured at 0, 6, 12, 24 and 48 h following the treatments, and the data averaged. Astaxanthin content was measured at 48 h. The SDs of the data were within 10%. O2 consumption rate by astaxanthin biosynthesis relative to total oxygen evolved was calculated as follows (see footnote a below): astaxanthin content (pmol cell1) 21 pmol O2 cell1/[net oxygen evolution (average oxygen evolution rate pmol O2 cell1 h1 48 h)+total oxygen uptake (average oxygen uptake rate pmol O2 cell1 h1 48 h)]. a It was assumed that 21 mol of O2 were consumed per mol of astaxanthin synthesized in the Haematococcus cell (Kelly, 1990; Schroeder and Johnson, 1995).

1791

ARTICLE IN PRESS
1792 induction was included as a control (ca. 2 pmol O2 cell1 h1). The loss in photosynthesis capacity was calculated as oxygen evolution in cultures under stress relative to the control (assuming the control value of 100%) (Fig. 4a,b). A linear relationship (R2 0.92, Fig. 4b) between the MDA level and loss in photosynthetic activity was observed in cultures maintained at HL, suggesting that a targeting site of photooxidative stress was the subcellular membrane system (e.g., thylakoid membranes), which in turn resulted in reduction or impairment of photosynthetic activities.
60 Onset of stress 50 Cell numbers ( x 104 cells ml-1)

Y. Li et al.

40

30

20

10

Relationship between lipid peroxidation and astaxanthin accumulation

A plot of the MDA level against cellular astaxanthin content, using the data presented in Figs. 2 and 4, also revealed a linear relationship (R2 0.81, Fig. 5), indicating that astaxanthin acts as a protective agent to cope with oxidative stress (Figs. 4, 5).

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Time (Days)

Fig. 6. Growth of Haematococcus pluvialis under various stresses. Culture conditions were the same as described in Fig. 1, (K HL+FE +SA, high light, m low light).

Cell mortality
Growth kinetics for H. pluvialis cultures were measured under various stress conditions (Fig. 6). Under LL, the cells continued to divide for the rst 6 days and the cell number increased to ca. 52 104 cells mL1. Afterward, the cell numbers remained constant for four more days, followed by a slight decline. When exposed to HL, the cell numbers remained roughly the same for day 1, and
100

then declined gradually thereafter. The most drastic decline in cell numbers was observed in the culture exposed to HL+SA+FE. After 10 days of stress induction, the cell number of cultures under HL and HL+SA+FE were ca. 24 104 and 13.6 104 cells mL1, respectively, which was ca. 49.5% and 28%, respectively, of that under LL. At HL or HL+SA+FE, the cells underwent transformation from the green agellates to red cysts. As a result, a majority of the cells (ca. 80%) changed from green agellates to red cysts within the rst 3 days under HL or HL+SA+FE. In contrast, the cells under LL remained mostly green agellates and nonmotile vegetative cells.

Astaxanthin content (pg/cell)

80

Response of ptox under stress conditions

R2=0.81

60

40

20

0 0.0

0.2

0.4 0.6 0.8 MDA content (pmol/cell)

1.0

Fig. 5. Cellular astaxanthin content in Haematococcus pluvialis in relation to MDA contents under various stress conditions.

Two genes, ptox1 and ptox2, encoding PTOX1 and PTOX2 were previously cloned from H. pluvialis (DQ485457 and DQ485458, respectively). In this study, the transcriptional expression of ptox1 and ptox2 was measured in H. pluvialis cultures under different stress conditions (Fig. 7). Both genes underwent transient up-regulation upon cultures being transferred from LL to HL, though the expression patterns of the two genes were somewhat different. The maximum transcripts of ptox2 occurred at 12 h, whereas that of ptox1 did not occur until 4872 h of HL induction. The maximum transcripts of ptox2 and ptox1 increased 1.6-fold and 3.84-fold, respectively. When subjected to HL+SA+FE, the time at which the maximum transcripts of ptox1 occurred was shortened to 12 h with a slight increase in

ARTICLE IN PRESS
Reduction of oxidative stress by astaxanthin biosynthesis
60 6

1793

(ptox1)
50 5

(ptox2)

Relative expression

40

30

20

10

0 0 12 24 36 48 60 72 84 96 Hours after induction

0 0 12 24 36 48 60 72 Hours after induction 84 96

Fig. 7. Transcript levels of ptox genes in response to different environmental stress conditions. Culture conditions were the same as described in Fig. 1. For isolation of RNA, samples were collected from different growth conditions at 0, 6, 12, 24, 48, 72 and 96 h; (a) ptox1, and (b) ptox2 (K HL+SA +FE, & high light, m low light).

transcripts. On the other hand, little change occurred to ptox2 in terms of the maximum transcripts and the time at which it occurred (Fig. 7).

Discussion
Regulation of carotenogenic genes in response to stress
By monitoring transcriptional expression of the carotenoid genes simultaneously using quantitative real-time RT-PCR, we were able to characterize carotenoid genes on a pathway level rather than an individual gene level, which has been investigated in some previous studies using a RNA blotting method (Kajiwara et al., 1995; Sun et al., 1998; Linden, 1999; Grunewald et al., 2000; Steinbrenner and Linden, 2001, 2003). In accordance with previous studies, our data indicated that the maximum transcript level of ipi occurs at about 612 h under HL, similar to the 8 h as suggested by Sun et al. (1998). Our results also agreed with Steinbrenner and Linden (2001) that the maximum transcripts of psy and crtR-b occur at 12 h after exposed to HL stress. Furthermore, the more sensitive real-time RT-PCR analysis was able to detect the expression of crtO and expression of crtR-b transcripts at the early stage of stress induction, which was not otherwise detected by

RNA blotting (Steinbrenner and Linden, 2001, 2003). Although ipi, psy, pds, crtO, and crtR-b all underwent transient up-regulation at the transcription level under HL or HL+SA+FE, the extent to which individual genes responded was different. Up-regulation of transcripts of all ve genes was within an order of magnitude; however, the maximum transcripts of psy and crtR-b were at least 2-fold greater than that of ipi, pds and crtO. Large amounts of psy transcripts may be responsible for preferentially converting GGPP, a common precursor for multiple pathways (e.g., chlorophyll or gibberellins biosynthesis pathways), to phytoene and thus ensuring that carotenoid/astaxanthin biosynthesis is the preferred pathway under stress. The rapid reduction in chlorophyll at the peak expression of psy may be the result of reduced availability of GGPP for chlorophyll biosynthesis. Indeed, psy has been previously indicated to act as a rate-limiting step for carotenoid biosynthesis during tomato fruit ripening (Fraser and Bramley, 2004), in a transgenic Synechocystis sp. strain PCC 6803 (Lagarde et al., 2000) and in Arabidopsis thaliana (Stalberg et al., 2003). Likewise, high transcripts of crtR-b seem to be responsible for the formation of astaxanthin as the single predominant carotenoid species under stress. Overexpression of the gene encoding crtRb was also observed in transgenic A. thaliana exposed to HL and high temperature, resulting in enhanced tolerance to the stress conditions

ARTICLE IN PRESS
1794 (Davison et al., 2002). In E. coli and a transgenic Synechocystis, overexpression of crtR-b was reported to result in increasing zeaxanthin content (Ruther et al., 1997; Lagarde et al., 2000). The fact that a linear relationship exists between the maximum transcripts of psy and crtR-b and the maximum astaxanthin concentration revealed in this study indicates that astaxanthin biosynthesis may be under direct control of psy and crtR-b at the transcriptional level. Previously, carotenoid biosynthesis genes, mainly crtO, cloned from Haematococcus cells were introduced to Synechococcus (Harker and Hirschberg, 1997; Albrecht et al., 2001), tobacco owers (Mann et al., 2000), potato tubes (Morris et al., 2006), and A. thaliana (Stalberg et al., 2003), with the aim of producing astaxanthin in these transgenic organisms. However, these efforts resulted in limited success due to the extremely low yield of astaxanthin. Based upon our results, we suggest that co-expression of psy and/or crtR-b along with crtO in a host organism may provide an alternative strategy for increasing astaxanthin yield. Y. Li et al. HL+FE+SA. However, the maximum expression of those enzymes lasted only 2448 h, followed by downregulation of these pathways (Wang et al., 2004). In the present study, the extent to which the expression of the carotenogenesis genes in cultures under HL+FE, HL+SA or HL+FE+SA, surpassed that of the culture under HL after 24 or 48 h was the result of the persistence of the multiple stressors on one hand and reduced enzymatic defense activities on the other, making the cells more reliant on carotenogenesis.

O2 consumption by carotenogenesis
Carotenogenesis leading to astaxanthin formation involves oxygenation and hydroxylation steps that have been conrmed to be oxygen-dependent reactions (Breitenbach et al., 1996; Fraser et al., 1997). Also, the phytoene desaturation and subsequent zeta-carotene desaturation steps may provide electrons to reduce the PQ pool, which in turn reduces molecular oxygen into water catalyzed by PTOX. A metabolic network model indicates that 21 mol of O2 is required per mol of astaxanthin synthesized (Kelly, 1990; Schroeder and Johnson, 1995). Provided that an estimated 1% of the total O2 consumption goes to ROS production in plants under normal growth conditions (Puntarulo et al. 1988; Moller 2001), the O2 consumption (as high as 9.94% of photosynthetically evolved oxygen, Table 3) through astaxanthin biosynthesis could considerably reduce the amounts of molecular oxygen, which could potentially be used as a substrate for ROS production. There is evidence that increased oxygen concentration derived from photosynthesis interacts with reduced forms of electron transport components to generate excess ROS under stress (Casano et al., 2000; Moller, 2001; Mittler, 2002). Therefore, we suggest that a physiological role of astaxanthin biosynthesis in the stress response in H. pluvialis is to reduce subcellular oxygen concentrations, in particular lowering oxygen tension surrounding the thylakoid membrane, which in turn reduces ROS formation.

Carotenogenesis is stressor-specic dependent

Our results demonstrated that HL was the strongest, whereas FE the weakest single stressor that affected carotenoid gene expression and astaxanthin production under our experimental conditions. It is worth noting that transcripts of the carotenoid genes were lower when two or three stressors were combined (i.e., HL+FE, HL+SA, or HL+FE+SA) compared with HL during the rst 12 h and resulted in lower astaxanthin formation (Figs. 1 and 2). An interpretation is that each individual stressor (e.g., HL, FE, or SA) may trigger specic stress-dependent molecular defense mechanism(s) (e.g., specic enzymatic defense pathways) in addition to inducing common, shared protective mechanism(s) (e.g., carotenogenesis, storage lipid biosynthesis, or secondary wall formation). HL may preferentially induce carotenogenesis, whereas SA and FE might preferentially trigger various enzymatic reactions. When HL in combination with SA or FE or both is applied to H. pluvialis cells, more individual-specic defense pathways could be activated than those triggered by HL alone, with each contributing to overall protection and thus may, to a lesser extent, depend upon carotenogenesis. This hypothesis is supported by a previous study (Wang et al., 2004) in which the multiple enzymatic pathways were activated as the early defense mechanisms in H. pluvialis cells under

PTOX versus ROS detoxication

PTOX was suggested to be a co-factor in carotenoid desaturation and also implicated as a safety valve to prevent the over-reduction of the PQ pool and formation of ROS in response to oxidative stress in several higher plants such as tobacco, Arabidopsis, and in the green alga Chlamydomonas reinhardtii (Carol et al., 1999; Wu et al., 1999; Niyogi, 2000; Rizhsky et al., 2002;

ARTICLE IN PRESS
Reduction of oxidative stress by astaxanthin biosynthesis Aluru and Rodermel, 2004; Baerr et al., 2005). We suggest that a similar role of PTOX occurs in Haematococcus in stress defense. As in C. reinhardtii (Moseley et al., 2006), two ptox genes were identied from H. pluvialis. The response of ptox2 to various stress conditions was similar to that of pds, both of which were induced promptly after the onset of HL or HL+SA+FE stress and reached a maximum transcript level at 12 h. However, the maximum transcript level of ptox1 was delayed to 72 h under HL compared with 12 h under HL+SA+FE. Since phytoene desaturase was suggested to be regulated at a transcriptional level in H. pluvialis (Grunewald et al., 2000), ptox2 may have encoded an enzyme that functionally coupled with carotenoid desaturation to remove excess electrons and molecular oxygen, while ptox1 was activated only when the stress condition was persistent or became more severe.
Phytoene e Phytofluene e -Carotene e Neurosporene e Lycopene Lumen PSII e -Carotene Stroma O2 ROS Astaxanthin esters Lipid bodies H2O PTOX H2O O2 ROS Chloroplast envelop PQ PQH2 e PSI Thylakoid membrane ZDS PDS Excess light/ Other stresses

1795

Astaxanthin esters Cytoplasmic membranes

Multilevel protective role of astaxanthin biosynthesis pathway against oxidative stress

Based upon our results, along with the evidence provided by others, we propose that astaxanthin biosynthesis, in conjunction with the photosynthetic electron transport chain coupled with PTOX, exerts multilevel protective mechanisms against oxidative stress. In addition to previously proposed physiological roles as a sunscreen, antioxidant and/or carbon and energy storage, the astaxanthin biosynthetic pathway and the end product astaxanthin have additional protective roles under stress (Fig. 8): The roles include reduction of ROS production by (1) reducing subcellular oxygen concentration via forming oxygen-rich astaxanthin molecules; and (2) converting chloroplast oxygen molecules into water via a concerted electron transport from carotenogenic desaturation steps to the photosynthetic PQ pool to PTOX. These roles consumed as high as ca. 9.94% of the total oxygen evolved by photosynthesis under photooxidative stress (Table 3). In this context, carotenogenesis in H. pluvialis has a similar protective mechanism as the alternative oxidases, which prevent electrons from reducing O2 to O and reduce the overall level 2 of O2, the substrate for ROS production (Mittler, 2002). In addition, the esterication of astaxanthin with fatty acids may be a strategy by which astaxanthin is sequestered into cytosolic lipid bodies where the pigment may serve as sunscreen to reduce light penetration into the chloroplast and thus reduce chloroplast-based ROS formation under stress. Reduction in polarity of astaxanthin esters

Fig. 8. Schematic of the multiple roles of the astaxanthin biosynthetic pathway and the end product astaxanthin in protecting Haematococcus pluvialis from oxidative stress. The roles include the pathways function in (1) reducing subcellular oxygen levels via forming oxygen-rich astaxanthin molecules; (2) converting photosynthetically evolved molecular oxygen into water via a concerted electron transport from carotenogenic desaturation steps to the photosynthetic PQ pool to PTOX; and producing astaxanthin, with the astaxanthin (3) functioning as a sunscreen to reduce excess PFD impinging on the chloroplast; (4) functioning as an antioxidant for ROS; and (5) forming astaxanthin esters, which serve as carbon and energy storage.

may further stabilize the structure and function of lipid bodies. However, the protective roles of astaxanthin biosynthesis can only reduce to a certain extent, but not eliminate or reverse the effect of oxidative stress on the cells. As stress persists, oxidative stress will eventually result in cell deterioration (Fig. 4, 5) and photooxidative death (Fig. 6). Therefore, the cellular content of astaxanthin may reect the extent to which Haematococcus suffers from oxidative stress, and also the extent to which the cells defend themselves under stress conditions.

Acknowledgments
We thank Dr. J. Wang (Arizona State University) for his valuable technical assistance. This work was partially supported by the Research Grants Council of Hong Kong, the University of Hong Kong Outstanding Young Researcher Award, Outstanding Research Student Supervisor Award, and the Science Foundation Arizonas Small Business Catalytic Program.

ARTICLE IN PRESS
1796 Y. Li et al.
Fraser PD, Bramley PM. The biosynthesis and nutritional uses of carotenoids. Prog Lipid Res 2004;43:22865. Fraser PD, Miura Y, Misawa N. In vitro characterization of astaxanthin biosynthetic enzymes. J Biol Chem 1997; 272:612835. Goodwin TW, Jamikorn M. Studies in carotenogenesis II. Carotenoid synthesis in the alga Haematococcus pluvialis. Biochem J 1954;57:37681. Grunewald K, Eckert M, Hirschberg J, Hagen C. Phytoene desaturase is localized exclusively in the chloroplast and up-regulated at the mRNA level during accumulation of secondary carotenoids in Haematococcus pluvialis (Volvocales, Chlorophyceae). Plant Physiol 2000;122:12618. Hagen C, Braune W, Vogel K, Hader DP. Functional aspects of secondary carotenoids in Haematococcus lacustris (Girod) Rostanski (Volvocales). V. Inuences on photomovement. Plant Cell Environ 1993;16:9915. Harker M, Hirschberg J. Biosynthesis of ketocarotenoids in transgenic cyanobacteria expressing the algal gene for beta-C-4-oxygenase, crtO. FEBS Lett 1997;404: 12934. Hodges DM, DeLong JM, Forney CF, Prange RK. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 1999;207:60411. Kajiwara S, Kakizono T, Saito T, Kondo K, Ohtani T, Nishio N, et al. Isolation and functional identication of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli. Plant Mol Biol 1995;29:34352. Kelly S. A design tool for the analysis of biochemical reaction networks utilizing stoichiometric structure. M.S. thesis. Madison: University of Wisconsin; 1990. Klotz LO. Oxidant-induced signaling: effects of peroxynitrite and singlet oxygen. Biol Chem 2002;383:44356. Kobayashi M. Astaxanthin biosynthesis enhanced by reactive oxygen species in the green alga Haematococcus pluvialis. Biotechnol Bioprocess Eng 2003;8: 32230. Kobayashi M, Kakizono T, Nagai S. Astaxanthin production by a green alga, Haematococcus pluvialis accompanied with morphological changes in acetate media. J Ferment Bioeng 1991;71:3359. Kobayashi M, Kakizono T, Nagai S. Enhanced carotenoid biosynthesis by oxidative stress in acetate-induced cyst cells of a green unicellular alga, Haematococcus pluvialis. Appl Environ Microbiol 1993;59:86773. Kobayashi M, Kakizono T, Nishio N, Nagai S, Kurimura Y, Tsuji Y. Antioxidant role of astaxanthin in the green alga Haematococcus pluvialis. Appl Microbiol Biotechnol 1997;48:3516. Lagarde D, Beuf L, Vermaas M. Increased production of zeaxanthin and other pigments by application of genetic engineering techniques to Synechocystis sp strain PCC 6803. Appl Environ Microbiol 2000;66: 6472. Linden H. Carotenoid hydroxylase from Haematococcus pluvialis: cDNA sequence, regulation and functional

References
Albrecht M, Steiger S, Sandmann G. Expression of a ketolase gene mediates the synthesis of canthaxanthin in Synechococcus leading to tolerance against photoinhibition, pigment degradation and UV-B sensitivity of photosynthesis. Photochem Photobiol 2001;73: 5515. Aluru MR, Rodermel SR. Control of chloroplast redox by the IMMUTANS terminal oxidase. Physiol Plant 2004;120:411. Apostol I, Heinstein PF, Low PS. Rapid stimulation of an oxidative burst during elicitation of cultured plant cells. Role in defense and signal transduction. Plant Physiol 1989;90:10916. Asada K. Production and action of active oxygen species in photosynthetic tissues. In: Foyer CH, Mullineaux PM, editors. Causes of photooxidative stress and amelioration of defense systems in plants. Boca Raton: CRC Press; 1994. p. 77104. Asada K. The water-water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons. Annu Rev Plant Physiol Plant Mol Biol 1999; 50:60139. Baerr JN, Thomas JD, Taylor BG, Rodermel SR, Gray GR. Differential photosynthetic compensatory mechanisms exist in the immutans mutant of Arabidopsis thaliana. Physiol Plant 2005;124:390402. Bidigare RR, Ondrusek ME, Kennicutt MC, Iturriaga R, Harvey HR, Hoham RW, et al. Evidence for a photoprotective function for secondary carotenoids of snow algae. J Phycol 1993;29:42734. Boussiba S, Bing W, Yuan JP, Zarka A, Chen F. Changes in pigments prole in the green alga Haematococcus pluvialis exposed to environmental stresses. Biotechnol Lett 1999;21:6014. Breitenbach J, Misawa N, Kajiwara S, Sandmann G. Expression in Escherichia coli and properties of the carotene ketolase from Haematococcus pluvialis. FEMS Microbiol Lett 1996;140:2416. Carol P, Stevenson D, Bisanz C, Breitenbach J, Sandmann G, Mache R, et al. Mutations in the Arabidopsis gene immutans cause a variegated phenotype by inactivating a chloroplast terminal oxidase associated with phytoene desaturation. Plant Cell 1999;11:5768. Casano LM, Zapata JM, Martin M, Sabater B. Chlororespiration and poising of cyclic electron transport plastoquinone as electron transporter between thylakoid NADH dehydrogenase and peroxidase. J Biol Chem 2000;275:9428. Davison PA, Hunter CN, Horton P. Overexpression of betacarotene hydroxylase enhances stress tolerance in Arabidopsis. Nature 2002;418:2036. Del Campo JA, Rodriguez H, Moreno J, Vargas MA, Rivas J, Guerrero MG. Accumulation of astaxanthin and lutein in Chlorella zongiensis (Chlorophyta). Appl Microbiol Biotechnol 2004;64:84854. Fan L, Vonshak A, Zarka A, Boussiba S. Does astaxanthin protect Haematococcus against light damage? Z Naturforsch(C) 1998;53:93100.

ARTICLE IN PRESS
Reduction of oxidative stress by astaxanthin biosynthesis
complementation. Biochim Biophys Acta Gene Struct Expression 1999;1446:20312. Liu BH, Lee YK. Secondary carotenoids formation by the green alga Chlorococcum sp. J Appl Phycol 2000;12: 3017. Luis P, Behnke K, Toepel J, Wilhelm C. Parallel analysis of transcript levels and physiological key parameters allows the identication of stress phase gene markers in Chlamydomonas reinhardtii under copper excess. Plant Cell Environ 2006;29:204354. Ma RYN, Chen F. Enhanced production of free transastaxanthin by oxidative stress in the cultures of the green microalga Chlorococcum sp. Process Biochem 2001;36:11759. Mann V, Harker M, Pecker I, Hirschberg J. Metabolic engineering of astaxanthin production in tobacco owers. Nat Biotechnol 2000;18:88892. Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 2002;7:40510. Moller IM. Plant mitochondria and oxidative stress: electron transport, NADPH turnover, and metabolism of reactive oxygen species. Annu Rev Plant Physiol Plant Mol Biol 2001;52:56191. Morris WL, Ducreux LJM, Fraser PD, Millam S, Taylor MA. Engineering ketocarotenoid biosynthesis in potato tubers. Metab Eng 2006;8:25363. Moseley JL, Chang CW, Grossman AR. Genome-based approaches to understanding phosphorus deprivation responses and PSR1 control in Chlamydomonas reinhardtii. Eukaryot Cell 2006;5:2644. Niyogi KK. Safety valves for photosynthesis. Curr Opin Plant Biol 2000;3:45560. Orosa M, Torres E, Fidalgo P, Abalde J. Production and analysis of secondary carotenoids in green algae. J Appl Phycol 2000;12:5536. Park EK, Lee CG. Astaxanthin production by Haematococcus pluvialis under various light intensities and wavelengths. J Microbiol Biotechnol 2001;11:102430. Puntarulo S, Sanchez RA, Boveris A. Hydrogen peroxide metabolism in Soybean embryonic axes at the onset of germination. Plant Physiol 1988;86:62630. Qiu BS, Li Y. Photosynthetic acclimation and photoprotective mechanism of Haematococcus pluvialis (Chlorophyceae) during the accumulation of secondary carotenoids at elevated irradiation. Phycologia 2006; 45:11726. Remias D, Lutz-Meindl U, Lutz C. Photosynthesis, pigments and ultrastructure of the alpine snow alga Chlamydomonas nivalis. Eur J Phycol 2005;40:25968. Rizhsky L, Hallak-Herr E, Van Breusegem F, Rachmilevitch S, Barr JE, Rodermel S, et al. Double antisense plants lacking ascorbate peroxidase and catalase are less sensitive to oxidative stress than single antisense plants lacking ascorbate peroxidase or catalase. Plant J 2002;32:32942.

1797

Ruther A, Misawa N, Boger P, Sandmann G. Production of zeaxanthin in Escherichia coli transformed with different carotenogenic plasmids. Appl Microbiol Biotechnol 1997;48:1627. Schroeder WA, Johnson EA. Singlet oxygen and peroxyl radicals regulate carotenoid biosynthesis in Phafa rhodozyma. J Biol Chem 1995;270:183749. Sokolowsky V, Kaldenhoff R, Ricci M, Russo V. Fast and reliable mini-prep RNA extraction from Neurospora crassa. Fungal Genet Newslett 1990;36:413. Stalberg K, Lindgren O, Ek B, Hoglund AS. Synthesis of ketocarotenoids in the seed of Arabidopsis thaliana. Plant J 2003;36:7719. Steinbrenner J, Linden H. Regulation of two carotenoid biosynthesis genes coding for phytoene synthase and carotenoid hydroxylase during stress-induced astaxanthin formation in the green alga Haematococcus pluvialis. Plant Physiol 2001;125:8107. Steinbrenner J, Linden H. Light induction of carotenoid biosynthesis genes in the green alga Haematococcus pluvialis: regulation by photosynthetic redox control. Plant Mol Biol 2003;52:34356. Sun Z, Cunningham FX, Gantt E. Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte. Proc Natl Acad Sci USA 1998;95:114828. Vonshak A, Guy R, Poplawsky R, Ohad I. Photoinhibition and its recovery in 2 strains of the cyanobacterium Spirulina platensis. Plant Cell Physiol 1988;29:7216. Wang B, Zarka A, Trebst A, Boussiba S. Astaxanthin accumulation in Haematococcus pluvialis (Chlorophyceae) as an active photoprotective process under high irradiance. J Phycol 2003;39:111624. Wang SB, Chen F, Sommerfeld M, Hu Q. Proteomic analysis of molecular response to oxidative stress by the green alga Haematococcus pluvialis (Chlorophyceae). Planta 2004;220:1729. Wang SB, Chen F, Sommerfeld M, Hu Q. Isolation and proteomic analysis of cell wall-decient Haematococcus pluvialis mutants. Proteomics 2005;5:483951. Wu DY, Wright DA, Wetzel C, Voytas DF, Rodermel S. The immutans variegation locus of Arabidopsis denes a mitochondrial alternative oxidase homolog that functions during early chloroplast biogenesis. Plant Cell 1999;11:4355. Yong YYR, Lee YK. Do carotenoids play a photoprotective role in the cytoplasm of Haematococcus lacustris (Chlorophyta)? Phycologia 1991;30:25761. Yuan JP. Characteristics and chromatographic separation of astaxanthin and its esters from the microalga Haematococcus pluvialis. Ph.D. thesis. Hong Kong: The University of Hong Kong; 1999. Yuan JP, Chen F, Liu X, Li XZ. Carotenoid composition in the green microalga Chlorococcum. Food Chem 2002; 76:31925.