Prevalence of ESBL among Esch. coli and Klebsiella spp.

in a tertiary care hospital and molecular detection of important ESBL producing genes by multiplex PCR.

Dr. Taslima Yasmin MBBS

Department of Microbiology & Immunology Mymensingh Medical College Mymensingh January 2012

Declaration
I hereby declare that the whole work submitted as a thesis entitled Prevalence of ESBL among Esch. coli and Klebsiella spp. in a tertiary care hospital and molecular detection of important ESBL producing genes by multiplex PCR. in the department of the microbiology at Mymensingh Medical College, Mymensingh, Dhaka University, for the Degree of Master of philosophy is the result of my own investigation and was carried out under the supervision of Professor Dr. Md. Akram Hossain. I, further declare this thesis or part thereof has not been concurrently submitted for the award of any Degree or Diploma anywhere.

Dr. Taslima Yasmin

TO WHOM IT MAY CONCERN

This is to certify that Dr. Taslima yasmin, a student of thesis part has completed the thesis entitled Prevalence of ESBL among Esch. coli and Klebsiella spp. in a tertiary care hospital and molecular detection of important ESBL producing genes by multiplex PCR. in the Department of Microbiology, Mymensingh Medical College under my guidance and supervision and this is up to my satisfaction. Her protocol was approved by protocol approval committee of the Department of Microbiology and Ethical review committee of Mymensingh Medical College.

Dated, Mymensingh The

Professor Dr. Md. Akram Hossain Head of the Department of Microbiology Mymensingh Medical College Mymensingh, Bangladesh

ACKNOWLEDGEMENTS
All praises belongs to Almighty Allah, the most merciful, the most beneficent and the most kind for giving me the opportunity, courage and enough energy to carry out and complete the entire thesis work. I am very grateful and deeply indebted to my honourable teacher and guide Professor Dr. Md. Akram Hossain, Head of the Department of Microbiology, Mymensingh Medical College. It is my great pleasure to express my deepest regards and whole hearted indebtedness to him for his inspiring encouragement, continuous guidance, active cooperation, constant supervision, valuable suggestions, constructive criticism and help in carrying out this work successfully. I would like to express my deepest regards and gratitude to my respected teacher Dr. Shaymol Kumar Paul, Assistant Professor, Department of Microbiology,

Mymensingh Medical College, Mymensingh, for his constructive criticism in correcting this thesis with his wise advice and active cooperation in correcting the manuscript. I owe my gratitude to respected teacher Md. Chand Mahamud, Assistant Professor, Department of Microbiology, Mymensingh Medical College, Mymensingh for valuable advice and cordial cooperation. I am cordially expressing my respect and complements to Dr. Md. Ashraful Alam, Assistant Professor, Department of Microbiology, Mymensingh Medical College, Mymensingh for his cordial cooperation, & thoughtful suggestions in my thesis work. I also grateful to Professor Nobumichi Kobayashi, Sapporo Medical University of Japan for providing with us primers of PCR and technical assistance for this study and

also greatful to Professor Jalaluddin Ashraful Hoque, Professor of BIRDEM and Ibrahim medical college for valuable advice. I like to express gratitude to all other teachers, M.Phil students, laboratory technologist and other staffs of Microbiology department, Mymensingh Medical College, Mymensingh for their constant help and sincere cooperation during the entire study period. I also grateful to Dr. Md.Aminul Haque, Ex. Principal, Mymensingh Medical College, Mymensingh for his kind cooperation & permitted me to complete this work. I express my gratitude to my parents, who always inspired me for higher studies and are my constant source of inspiration and encouragement in every step of my life. I remained incomplete if I do not express wholehearted thanks and gratitude to my elder sister Suraya yasmin, Sanjida yasmin, my younger sister Sharmin Yasmin and my brother for his all support about computer and for their blessings, affectionate support and spearing me so much time in this job from all sorts of social and familial responsibilities. I would like to convey my greatest regards and sincere thanks to my dear husband Dr. Md. Golam Mowla for his patience, devoted cooperation and assistance in collecting specimens and sensible sharing of my pains and pleasures. I would like to express love to my only sweet daughter Jarin Tasnim Maliha whom I could give very little time and attention during this work. Lastly I am indebted to all those persons from whom I have collected samples. May Allah help us? Thanks again.

Mymensingh, January 2012.

Dr. Taslima Yasmin

SUMMARY
Background: The development of antibiotic resistance in bacteria following introduction of antimicrobial agents has emerged as an important medical problem everywhere in the world including Bangladesh. Extended spectrum beta lactamases (ESBLs) are rapidly evolving group of beta lactamase enzymes produced by the Gram negative bacteria. At present, ESBLs has been increasing as a serious nosocomial and community pathogen having the property multidrug resistance.It is a great challenge for clinician to treat this bacteria. So, the present study was undertaken to detect the prevalence of these bacteria by different methods. The enzymes are predominantly plasmid mediated and are derived from broad spectrum beta lactamase TEM or SHV by a limited number of mutations. Very recently CTX-M genes are the most common -lactamases throughout the world. Methods: A total of 300 Gram negative isolates of Escherichia coli and Klebsiella pneumoniae obtained from various clinical samples; urine, skin wound. The isolates were screened for resistance to third generation Cephalosporins (3GCs) by disc diffusion test. The ESBL status was confirmed by double disc diffusion test (DDDT) comprising CAZ/CAZC, CTX/CTXC and minimum inhibitory concentration (MIC) by agar dilution method. Molecular characterization of the ESBL producing strains were done by multiplex PCR specific for TEM, SHV and CTX-M genes and clusters of CTX-M type (CTX-M -3,CTX-M-14). Results: The present study revealed a higher occurrence of multidrug resistant ESBL producing Klebsiella spp (80%), Proteus spp (72%), Enterobacter spp. (71.4%) E.coli (67.3%) and pseudomonas spp (88.8%) from various clinical isolates. Among the 300 isolates tested by two phenotypic methods 214 (71.3%) were ESBLs positive isolates.

In Among the 214 ESBL producing bacteria 90.1% (193/214) were positive by CAZ/CAZC method and 82.8% (176/214) were positive by CTX/CTXC method. In this study 3GCs sensitive drugs were also tested, among them 54.6% (35/64) were ESBL producing bacteria. TEM, CTX-M and SHV beta-lactamases were found 50.5%, 46.7% and 18.7% respectively. Among the CTX-M gene group-1 (CTX-M-3) and group-9 (CTX-M-14) gene were present 78.0% and 80.0% respectively. Conclusion: Results indicate that routine ESBL detection should be made mandatory by both combined methods and strains should be taken both 3GCs sensitive and resistant. .Irrational use of third generation cephalosporins must be discouraged to reduce multidrug resistant bacteria, to increase patients compliance and to make an antibiotic policy.

CONTENTS
Page No. LIST OF TABLE LIST OF PHOTOGRAPH LIST OF ABBREVIATION SUMMARY CHAPTER 1: CHAPTER 2: CHAPTER 3: CHAPTER 4: CHAPTER 5: INTRODUCTION & OBJECTIVE REVIEW OF LITERATURE METHODOLOGY RESULTS DISCUSSION CONCLUSION AND RECOMMENDATIONS LIMITATION LIST OF REFERRENCES PHOTOGRAPH APPENDICES vi vii viii III 1 6 53 66 85 95 96 97 I IX

List of table Table No I. II. III. IV. Title of table Distribution of sample from various specimens Detection rate of different isolates in the study population Pattern of organisms isolated from the community and hospital Showed distribution of E.coli, Klebsiella spp, Proteus spp and Pseudomonas spp. in different specimens both from hospital and community V. Antibiotic resistance pattern of Esch.coli and Klebsiella spp. isolated from community hospital and community by disc diffusion method VI. Rate of detection of ESBL production by DDDT from different organisms VII. Pattern of distribution of ESBL producing isolates in hospital and community VIII. Rate of isolation of ESBL positive Esch.coli, Klebsiella spp. Proteus spp.from different clinical specimen IX. Antimicrobial resistant pattern in hospital and community acquired ESBL positive strain X. Detection of ESBL by Double Disc Diffusion test as confirmatory test XI. Cross tabulation between CAZ/CAZC and CTX/CTXC of ESBL detection XII. Pattern of ESBL production among 3GCs sensitive and resisatant isolates XIII. XIV. Rate of ESBL positive by phenotypic and genotypic method Pattern of distribution of TEM, SHV and CTX-M genes among phenotypic confirmed ESBL producers XV. XVI. Pattern of CTX-M-3, CTX-M-14 distribution in different isolates Pattern of TEM, SHV and CTX-M gene distribution among hospital 83 84 81 82 80 79 79 78 77 76 75 74 Page 68 69 70 72

and community

List of photograph Figure Title of photograph No 1. Mechanism of drug resistance 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. Mechanism of drug resistance by horizontal transfer Showing beta lactam ring destruction by beta lactamases enzyme Structure of Beta lactamase enzyme Showing double disc synergy test Showing double disc diffusion test MacConkey agar media showing klebsiella pneumoniae MacConkey agar media showing Proteus spp. MacConkey ager media showing Esch. coli TSI ager media showing Esch. coli Citrate ager media showing Esch. coli Citrate ager media showing klebsiella pneumoniae Indole test showing Esch. coli Showing antibiogram of GNB Showing double disc diffusion test Showing MIC (by agar dilution method) test PCR of CTX M gene Multiplex PCR of TEM & SHV gene Multiplex PCR of CTX-M-3 & CTX-M-14 gene Steps of preparing & processing PCR Page 9 11 13 15 43 45 I I II II III III IV IV V V VI VII VII VIII

LIST OF ABBREVIATION

AmpC ATCC BA BEL BES bp BSAC CA CDC Cfu CLSI CMY CRE CTX-M CWT DDM DDST DNA dNTP E test EDTA EHEC

Ampicillin resistant gene American Type Culture Collection Blood Agar Belgium Extended-spectrum -Lactamase Brazilian Extended-Spectrum -lactamase Base pairs British Society for Antimicrobial Chemotherapy Clavulinic acid Center for Disease Control and Prevention Colony forming unit Clinical laboratory standard institute. Cphamycine carbapenem-resistant Enterobacteriaceae Cefotaxime resistant gene Cell wall transamidase Disc diffusion method Double disc synergy test Deoxyribonucleic acid Deoxynucleoside triphosphate Epsilon test Ethylene diamine tetraacetic acid Enterohaemorrhagic E. coli

EPEC ESBL ESC et al GES GNR HGT HUM bug HUS IBCs ICDDRB

Enteropathogenic E.coli Extended spectrum beta lactamase Extended spectrum cephalosporins at alia (all others) Guyana Extended-Spectrum -lactamases Gram negative rods Horizontal gene transfer Hydrocarbon-using microorganism Haemolytic uremic syndrome Intracellular bacterial communities International Center for Diarrrhoeal Diseses and Research Bangladesh

kbp KPC LPS MA MBL MDDDT MDR MHA MHC MIC MRSA NA

Kilo base pair Klebsiella pneumoniae Carbapenemase lipopolysaccharide MacConkeys agar Metalo beta lactamase Modified double disc diffusion test Multidrug resistant Mueller Hinton agar Major Histocompatibility Complex Minimum inhibitory concentration Methicillin resistant Staphylococcus aureus Nutrient agar

NAG NAM NCCLS OM OPD OXA PBP PBP PBS PCR PCR PER PRSP RFLPs SENTRY SHV SLT T2SS Taq TBE TEM TMP-SMX VEB VGT

N-acetylglucosamine N-acetylmuramic National Committee for Clinical Laboratory Standards Outer membrane Out patient department Oxacillinase gene Penicillin binding protein Penicillin binding protein Phosphate buffer saline Polymerase chain reaction Polymerase chain reaction Pseudomonas Extended Resistance Penicillin resistant Streptococcus pneumoniae Restriction fragment length polymorphimosm

Sulfhydril variable gene Shiga like toxine Type 2 Secretory system Thermus aquaticus Tris/Borate/EDTA Temoniera gene Trimethoprimsulfamethoxazole Vietnam Extended-spectrum -lactamase Vertical gene transfer

VIM VRE WHO

Verona integron-encoded metallo--lactamase Vancomycin-resistant enterococci World health organization

INTRODUCTION
B-Lactam antibiotics are commonly used to treat bacterial infections. The groups of antibiotics in this catagory include penicillins, cephalosporins, carbapenems & monobactams. Increased use of antibiotics, particularly the third generation of cephalosporins, has been associated with the emergence of -Lactamases mediated bacterial resistance, which subsequently led to the development of ESBL producing bacteria. ESBLs are enzymes that mediate resistance to extended spectrum e.g., third generation cephalosporins as well as monobactams such as aztreonam (CLSI, 2010). These enzymes catalyze the hydrolysis of the -lactam ring of antibiotic, thereby destroying the antimicrobial activity. ESBLs have been reported worldwide in many different genera of enterobactericeae and Pseudomonas aeroginosa (Friedman et al. 2008). However, these are most common in Klebsiella pneumoniae & E. coli (Agrawal et al. 2008). ESBL producing organisms are often resistant to several other classes of antibiotics, as the plasmids with the gene encoding ESBLs often carry other resistance determinants. Initially ESBL producing organisms were isolated from nosocomial infections but these organisms are now also being isolated from community (Pitout and Laupland 2008).The colonization rate for K. pneumoniae is low in healthy individuals in the general population. But it is increased in hospitalized patients especially with long care facilities, health care manipulations. e. g., use of catheters (Yushau et al. 2010). The first plasmid mediated -lactamase in Gram-negative bacteria, TEM-1, was described in the early 1960s (Datta 1965). Afterwards it was detected from Klebsiella in Europe 1980, in Germany 1983, and in France 1985 (Perez 2007). Genetic control

of beta-lactamase production resides either on plasmids or on the chromosome, while expression is either constitutive or inducible (Chiang and Liaw 2005). The development of extended spectrum cephalosporins in the early 1980 s was regarded as a major addition to our therapeutic armamentarium in the fight against beta-lactamase mediated bacterial resistance. The emergence of Escherichia coli and Klebsiella pneumoniae resistant to ceftazidime & other cephalosporins seriously compromised the efficacy of these life saving antibiotics (Perez et al. 2007). The new bacterial beta-lactamases present in these common enteric bacilli (the parent TEM -1 and SHV-1 enzymes) demonstrated unique hydrolytic properties (Shobha et al. 2007). ESBLs are inhibited in vitro by -lactamase inhibitors such as clavulanic acid and tazobactam. Some ESBLs are derived from earlier, broad-spectrum -lactamases (e.g., the TEM, SHV and OXA enzyme families) and differ from the parent enzyme by a few point mutations, which confer an extended spectrum of activity (Hawkey 2008). Point mutations in the SHV and TEM genes that resulted in single amino acid changes, (Gly 238 ser, Glu 240-Lys arg 164-ser, arg164- His, Asp 179- Asn & Gul (Asp) 104- Lys) ( Perez et al. 2007). More recently another family of ESBLs, the CTX-M types, has emerged and these ESBLs are becoming increasingly common (Hawkey 2008). ESBLs have been reported from all parts of the world. However, prevalence varies widely even in closely related regions. The true incidence is difficult to determine because of the difficulty in detecting ESBL production & due to inconsistencies in testing & reporting (Yushau et al. 2010). Prevelance of ESBL in many parts of the world was (10-40%) among E. coli and Klebsiella pneumoniae (Rupp and Paul 2003). The prevalence of ESBLs in Europe is higher than in the USA but lower than in Asia

and South America (Girlich et al. 2004). In 2007 in Asia pacific region was found to harbour plasmid borne ESBLs 62% and 75% in E. coli and Klebsiella spp. respectively (Bell et al. 2007). ESBL production rate was 43%, 73.8%, 96% and 70% in E. coli and 60% in Klebsiella spp. in Pakistan, Iraq, Iran and India respectively in 2009, 2011 and last two were in 2010 (Ali 2009; Al- Charrakh et al. 2011; Nasehi et al. 2010; Sharma et al. 2010). There were a limited number of studies on prevalence of ESBL showing a high rate in Bangladesh, where E. coli and K. pneumoniae were 43.2% and 39.5% respectively in 2004 (Rahman et al. 2004) and at Rajshahi in Bangladesh it was 57.89% in Klebsiella spp followed by Proteus spp. 50.0%, E. coli 47.83% and pseudomonas spp 31.35% in 2010 (Haque and Salam 2010). In France CTX-M-1, CTX-M-3 and CTX-M 14 lactamases from Enterobacteriaceae was isolated in 2002 (Dutour et al. 2002). Again in Iran SHV, CTX-M, TEM, PER were 26%, 24.5%, 18%, 7.5% respectively in 2010 (Nasehi et al. 2010). In India in 2006 CTX-M-15 was 73% in E. coli and 72% in Klebsiella spp. and in 2010 TEM and SHV were 30% and 38% respectively (Ensor et al. 2006; Sharma et al. 2010). Very recently in 2011 in India Manoharan and his collegues found TEM and CTX-M were

predominantly found in E. coli (39.2%) while, among the Klebsiella spp., TEM, SHV and CTX-M occurred together in 42.6% of the isolates. (Manoharan et al. 2011).Proper use of antibiotics is very important for various reasons. It reduces unnecessary expenses, reduces development of resistance to useful and life saving antibiotics, and minimizes many side effects. Bangladesh does not have any systematic program for studying the antibiotic resistance pattern. Proper use of antibiotics is ensured by formulating an antibiotic policy. ESBL screening as a routine test has not yet been practiced in Bangladesh. ESBL occurs at an alarming rate among

enterobactericeae isolates among the hospitalized patients which can result in an outbreak in the community that may be difficult to treat. To our knowledge so far, no data was published regarding gene detection of ESBL in Bangladesh. So, the present study was undertaken to see prevalence of ESBL by different phenotypic methods, which provided a base line survey of drug resistance pattern in Mymensingh and to see the molecular epidemiology of ESBL producing strains.

Objectives
General objective
To determine prevalence of extended spectrum beta lactamase (ESBL) among Escherichia coli and Klebsiella spp. in a tertiary care hospital and to detect main ESBL producing genes by multiplex PCR.

Specific objectives
1. To screen Escherichia coli and Klebsiella spp.resistant to 3rdgeneration cephalosporins by disc diffusion method. 2. To confirm ESBL by double disc diffusion test and minimum inhibitory concentration (MIC) by Agar dilution method. 3. To compare different double disc diffusion methods-e.g. Ceftazidime (CAZ) + Clavulinic acid Cefotaxime (CTX) + Clavulinic acid. 4. To detect TEM, SHV and CTX-M genes by multiplex PCR.

Review of Literature
Extended spectrum beta lactamase

Extended-spectrum b-lactamases (ESBLs) are rapidly evolving group of -lactamase enzymes, with the ability to hydrolyse and cause resistance to the oxyiminocephalosporins (i.e. cefotaxime, ceftazidime, ceftriaxone, cefuroxime and cefepime) and monobactams (i.e. aztreonam), but not the cephamycins (i.e. cefoxitin and cefotetan) or carbapenems (i.e. imipenem, meropenem, and ertapenem), produced by the Gram negative bacteria more commonly in Escherichea coli and Klebsiella pneumoniae (Lal et al. 2007; Rupp and Fey 2003; Peirano and Pitout 2010). Emergence of drug resistance Most of the resistance microbes which are now difficult to treat are of genetic origin and transferable between species and genera of bacteria (Rahman et al. 2004).The inappropriate use of antimicrobial agents does not achieve the desired therapeutic outcomes and is associated with the emergence of resistance. Lack of access, inadequate dosing, poor adherence and sub-standard antimicrobials may play as important a role as overuse. All antimicrobial agents have the potential to select drugresistant subpopulations of microorganisms. With the widespread use of antimicrobials, the prevalence of resistance to each new drug has increased. The prevalence of resistance varies between geographical regions and over time, but sooner or later resistance emerges to every antimicrobial (WHO 2001).Most of the resistance microbes which are now difficult to treat is of genetic origin and transferable between species and genera of bacteria.

Mechanism of resistance to antimicrobials

Resistance to antimicrobials is a natural biological phenomenon. The introduction of every antimicrobial agent into clinical practice has been followed by the detection in the laboratory of strains of microorganisms that are resistant, i.e. able to multiply in the presence of drug concentrations higher than the concentrations in humans receiving therapeutic doses. Such resistance may either be a characteristic associated with the entire species or emerge in strains of a normally susceptible species through mutation or gene transfer. Resistance genes encode various mechanisms which allow microorganisms to resist the inhibitory effects of specific antimicrobials. These mechanisms offer resistance to other antimicrobials of the same class and sometimes to several different antimicrobial classes (WHO). Gram negative bacteria use four mechanisms of resistance to survive to the antibiotic treatment: Efflux of antibiotics from bacteria Efflux pumps play a major role in antibiotic resistance and also serve other functions in bacteria such as the uptake of essential nutrients and ions, excretion of metabolic end products and deleterious substances as well as the communication between cells and environment (Li and Nikaido 2004). Outer membrane (OM) permiability The OM of Gram negative bacteria is a barrier to both hydrophobic and hydrophilic compounds. By combining a highly hydrophobic lipid bilayer with pore forming proteins of specific size-exclusion properties, the OM acts as a selective barrier. The permeability properties of this barrier have a major impact on the susceptibility of the microorganism to antibiotics, which are essentially targeted at intracellular processes. Small hydrophilic antibiotics, such as, -lactams, use the pore forming proteins (water filled channel proteins embedded in the outer membrane, e.g., OmpF in E. coli and

OprD in Pseudomonas aeroginosa) to gain access to the cell interior, while macrolides and other hydrophobic antibiotics diffuse across the lipid bilayer. The existance of antibiotic-resistant strains in a large number of bacterial species due to modifications in the lipid or protein composition of the OM indeed highlights the importance of the OM barrier in antibiotic sensitivity (den Engelsen et al.2009). Target modifications This mechanism is based on alterations of bacterial sites that are targeted by antibiotics and thus preventing the antibiotic from binding to its site of action. For example fluoroquinolone resistance is attributed to mutations within the drugs target (DNA gyrase and topoisomerase) (Livermore 2003). Enzymatic modification of the antibiotic Enzymes that modify antibacterial antibiotics are devided into two general classes: a) -lactamase that degrade antibiotics and b) others (including the macrolide and aminoglycoside-modifying proteins) that perform chemical transformations to render the antibiotic inefficient (Livermore 2003).

Fig. 1. Mechanism of drug resistance The acquisition and spread of antibiotic resistance in bacteria Multiple drug resistant strains of some bacteria have reached the proportion that virtually no antibiotics are available for treatment. Antibiotic resistance in bacteria may be an inherent trait of the organism (e.g. a particular type of cell wall structure) that renders it naturally resistant, or it may be acquired by means of mutation in its own DNA or acquisition of resistance-conferring DNA from another source (Toder 2008). Inherent (natural) resistance Bacteria may be inherently resistant to an antibiotic. For example, an organism lacks a transport system for an antibiotic; or an organism lacks the target of the antibiotic molecule; or, as in the case of Gram-negative bacteria, the cell wall is covered with an outer membrane that establishes a permeability barrier against the antibiotic.

Acquired resistance Several mechanisms are developed by bacteria in order to acquire resistance to antibiotics. All require either the modification of existing genetic material or the acquisition of new genetic material from another source. Vertical gene transfer The spontaneous mutation frequency for antibiotic resistance is on the order of about of about 10-8- 10-9. Once the resistance genes have developed, they are transferred directly to all the bacteria's progeny during DNA replication. This is known as vertical gene transfer or vertical evolution. Horizontal gene transfer Lateral or horizontal gene transfer (HGT) is a process where genetic material contained in small packets of DNA can be transferred between individual bacteria of the same species or even between different species.

There are at least three possible mechanisms of HGT, equivalent to the three processes of genetic exchange in bacteria. These are transduction, transformation or conjugation.

Conjugation Occurs when there is direct cell-cell contact between two bacteria (which need not be closely related) and transfer of small pieces of DNA called plasmids takes place. This is thought to be the main mechanism of HGT.

Transformation

It is a process where parts of DNA are taken up by the bacteria from the external environment. This DNA is normally present in the external environment due to the death and lysis of another bacterium.

Transduction

Occurs when bacteria-specific viruses (bacteriophages) transfer DNA between two closely related bacteria (Toder 2008).

Fig. 2. Mechanism of drug resistance by horizontal transfer

Beta lactam

Humans have been plagued with the threat of bacterial infection since before the dawn of recorded history, and have thus always had a keen interest in finding a

suitable treatment for these maladies. Folk medicine is replete with accounts of the use of various materials for the treatment of bacterial infection (moldy bread, moldy cheese, plant and animal preparations), which we now assume were effective due to the presence of some unknown antibacterial agent (Toder 2008).

In 1928 Alexander Fleming observed that culture plate on which Staphylococci were being grown had become contaminated with a mold of the genus Penicllium and that bacterial growth in the vicinity of the mold had been inhibited. He isolated the mold in pure culture and demonstrated that it produced an antibacterial substance Penicillin (Abraham and Chain1940). Abraham and Chain (1940) have shown that certain bacteria produce an enzyme named penicillinase, which destroy penicillin (Woodruff and Foster 1945).

With in a few years of introduction of penicillin into clinical use, penicillinase producing Staphylococcus aureus started to proliferate in hospitals. To overcome this problem, penicillinase resistant penicillins came into picture. Shortly afterward, the broad spectrum penicillins and first generation cephalosporins were introduced. They remained a first line of defense against microbes for over 20 years, before resistance due to -lactamases produced by gram negative bacilli became a serious problem (Medeiros 1997).To counter this threat, the pharmaceutical industry marketed six novel classes of lactam antibiotics (cephamycins, oxyimino cephalosporins, carbapenems, monobactams and clavam and penicillianic acid sulfone inhibitors) within a relatively short span of 7-8 years. Although, novel -lactamases had emerged gradually after the introduction of new lactam agents, their number and variety accelerated at an alarming rate (Chaudhary and Aggarwal 2004).

Beta lactam antimicrobials are the most common treatment for gram positive, gram negative and anaerobic bacterial infection (Ambler 1980; Kotra et al, 2002; Holten and Onusko 2000).Beta lactams are a family of antimicrobial agents consisting of four major groups: penicillins, cephalosporins, monobactum, and carbapenems (Kotra et al, 2002).

They all have a beta lactum ring, which can be hydrolyzed by beta lactamases.The groups differ from each other by additional rings e.g. Thiazolidine ring for penicillin, Cephem nucleus for cephalosporin, None for monobactum, Double ring structure for carbapenem (Levinson 2010) .They act on bacteria by two mechanisms: at first, they in corporate in bacterial cell wall and inhibit the action of transpeptidase, responsible for completion of cell wall. Secondly, they attach to the penicillin binding proteins (PBPs) that normally suppress cell wall hydrolases, thus freeing these hydrolases, which in turn act to lyses the bacterial cell wall. To by pass these antimicrobial mechanisms of action, bacteria resist by producing beta lactam inactivating enzymes (beta lactamases) (Samaha-Kfoury and Araj 2003).

Figure:3. Showing beta lactam ring destruction by beta lactamases enzyme

Beta lactamase enzyme Cell wall is comprised of peptidoglycan made up of repeating units of Nacetylglucosamine (NAG) and N-acetylmuramic acid (NAM) in polymeric chain form. The final step in cell wall biosynthesis is a transamidation reaction, catalyzed by cell wall transamidase (CWT) (Woster 2010). The crosslinking process is extremely sensitive to beta lactam antibiotics .CWT is also known as penicillin binding protein 1 (PBP-1). Various penicillins bind differently to different PBP's, producing a variety of effects. Binding to PBP-1 (a transpeptidase or transamidase) produces cell lysis, while binding to PBP-2 (also a transpeptidase) leads to oval cells which cannot divide (Woster 2010). Beta lactamases are enzymes that catalyze the hydrolysis of beta lactam. Presently, there are more then 500 different beta lactamases have been found in nature (CLSI 2010) .These versatile enzymes are present in both Gram positive and Gram negative bacteria (Holten and Onusko 2000). Beta lactamase producing Gram positive bacteria release the enzyme into the surroundings medium. But Gram negative bacteria release the enzyme into the periplasmic space. So, this is called group protection for Gram positive bacteria and individual protection for Gram negative bacteria (SamahaKfoury and Araj 2003). Beta-lactamases were present in bacteria long before the introduction of penicillins (Woodruff and Foster 1945), and genes encoding these ancient enzymes were originally located on the bacterial chromosome (Hanson et al.1999; Yushau et al. 2010). Furthermore, these enzymes are inducible and constitutively expressed in low quantities. In 1965, the first report of a plasmid-encoded beta-lactamase in a Gramnegative bacterium appeared from Greece (Datta and Kontomichalou 1965). -

lactamase producing bacteria are increasing in number and causing more sever infections (Shobha et al. 2007; Andrews 2009).

Figure: 4. Structure of Beta lactamase enzyme Extended spectrum cephalosporins (ESCs) The first generation cephalosporins are active primarily against gram positive cocci. Similar to penicillins; new cephalosporins were synthesized with expansion of activity against gram negative rods. These new cephalosporins were categorized into second, third, fourth generations, with each generations having expanded coverage against certain gram negative rods e.g.ceftazidime, cefotaxime and ceftriaxone (Levinson 2010).

Extended spectrum beta lactamase (ESBLs)

Extended spectrum lactamases (ESBLs) are a group of enzymes with the ability to hydrolyse and cause resistance to the oxymino-cephalosporins (i.e.cefotaxime, ceftazidime, ceftriaxone, cefuroxime and cefepime) monobactams (i.e. aztreonam) (Peirano and Pitout 2010).

Beta-lactamases are among the most heterogeneous group of resistance enzymes. These globular proteins are composed of alpha-helices and beta pleated sheets. Despite a significant amount of amino acid sequence variability, beta lactamases share a common overall topology (Perez et al. 2007).

Criteria

1. Are capable of inactivating extended spectrum cephalosporins (first, second, third, fourth-generations and the monobactam aztreonam).

2. Are inhibited by beta lactases inhibitors, such as clavulanic acid, cabapenemsulbactum,tozabactum and to temocillin (CLSI 2010). These new enzymes were given the name ESBLs that reflect the fact that they were the older beta lactamases and had a new capability to hydrolyze a broader spectrum of beta lactam drugs (Jacoby et al. 1988)

Mechanism of action

a) A common mechanism of bacterial resistance to beta-lactam antibiotics is the production of beta-lactamase enzymes that break down the structural beta-lactam ring of penicillin-like drugs (Chaudhary and Aggarwal R 2004; Paterson and Yu 1999).

b) A point mutation which alters the configuration around the active site of TEM and SHV type enzymes that specify resistance to ampicillin and had a new capability to hydrolyze a broader spectrum of beta lactam drugs (Philippon 1898).

c) Medical use of antibiotics can considerably accelerate the selection pressure for diversification and dissemination of mutant extended spectrum beta lactamase (Farkosh 2007).

d) ESBLs have serine at their active site and attack the amide bond in the lactam ring of antibiotics causing their hydrolysis (Chaudhary and Aggarwal 2004).

ESBL stands for extended-spectrum beta lactamase. ESBLs producing bacteria are different from other super bugs, because ESBL does not refer to one specific kind of bacteria. (For instance, MRSA refers specifically to methicillin-resistant strains of S. aureus.) Multiple drug resistant organisms that have been encountered include:

MRSA-Methicillin/oxacillin resistant Staphylococcus aureus. VRE Vancomycin-resistant enterococci ESBLs Extended spectrum beta lactamases PRSP-Penicillin resistant Streptococcus pneumoniae (Toder 2008). Synthesis and mode of transfer The synthesis of lactamases is either chromosomal (constitutive), as in Pseudomonas aeruginosa, or plasmid mediated (inducible), as in E.coli and Staphylococcus aureus (Livermore 1995; Rayamajhi et al. 2008; Rupp and Paul 2003). Plasmids are a major cause of bacterial resistance spreading (Peirano and Pitout 2010). The genes encoding these lactamases are often located on large plasmid (80kbp) that also encode genes for resistance to other antibiotics, including

aminoglycosides, tetracycline, sulfonamides, trimethoprime and chloramphenicol which can easily be transferred between isolates (Sasirekha et al 2010 ; Perez 2007). Evolution and Epidemiology Organisms encoding multiple antibiotic resistance genes are becoming increasingly prevalent (Hanson et al.1999). The first plasmid mediated -lactamase in Gramnegative bacteria, TEM-1, was described in the early 1960s (Turner 2005). In 1983, the first report came from Germany by Knothe et al. of a mutant of SHV-1 named SHV-2 in a K. pneumoniae strain, which was capable of hydrolysing oxyiminocephalosporins (Knothe et al.1983) .Two years later, SHV-2 was transferable between bacteria (Kliebe et al.1985). Just a few years later reports came from French hospitals of problems attributed to Enterobacteriaceae carrying mutated TEM-derivates which acted like SHV-2 (Brun-Buisson et al. 1987). The term extended broad- spectrum beta-lactamases was coined (Livermore 2008). The beta-lactamases had thereby an extended broadspectrum activity as compared with the broad-spectrum classic TEM and SHV enzymes. The term broad was lost and the term became extended spectrum -lactamases (ESBLs) are derived from earlier, broad-spectrum lactamases (eg, the TEM, SHV and OXA enzyme families) and differ from the parent enzyme by a few point mutations, which confer an extended spectrum of activity (Hawkey 2008). The amino acid substitutions responsible for the ESBL phenotype cluster around the active site of the enzyme and change its configuration, allowing access to oxyimino-beta-lactam substrates. Opening the active site to beta-lactam substrates also typically enhances the susceptibility of the enzyme to b-lactamase inhibitors, such as clavulanic acid. Single amino acid substitutions at positions 104, 164, 238, and 240 produce the ESBL phenotype, but ESBLs with the broadest

spectrum usually have more than a single amino acid substitution (Bradford 2001). The rapidity of the development and spread of resistance is a common process that is influenced by selective pressure, pre-existance of resistance genes and use of infection control measures (Rupp and Paul 2003). In CTX M-1 each of the amino acid changes contributes to resistance. By it self the change at position 102 mainly enhance resistance to ceftazidime, while changes at position 236 predominantly resistance to cefotaxime (Rahman et al.2004). Occurrence and distribution of ESBLs differs from country to country and from hospital to hospital (Ali 2009).Initially ESBL producing organisms were usually isolated from nosocomial infections but these organisms are now also being isolated from community (Helfand and Bonomo 2005.). The continuous pressure exerted by the use of newer expanded-spectrum beta-lactams promoted the development of new TEM and SHV derivates (Pin heiro et al. 2008). There are so many types of ESBLs like TEM, SHV, CTX-M, OXA, AmpC but majority of the ESBLs are derivatives of TEM or SHV enzymes and these enzymes are most commonly found in E.coli and K.pneumoniae (Sharma et al. 2010) and studies showed that new ones are being found every week. The rapid emergence of the ESBL-production among Enterobacteriaceae has already had serious clinical implications. ESBLs of the CTX-M type were rare until the end of the 1980s, but Japan,Argentina and Germany reported almost concomitantly findings of this ESBL type. Predominance of CTX-M -lactamases may be due to the selective pressure of increased use of ceftriaxone (Pin heiro et al. 2008; Samaha-Kfoury and Araj 2003). The genes encoding CTX-Ms have been mobilised from Klyuviera spp. by several

genetic events and mechanisms (Perez et al. 2007).With the emergence of the CTXM, there has been a marked shift in the epidemiology of ESBLs (Coque et al. 2006). The predominance of CTX-Ms has not only been observed in hospitals but also in the community, from nursing homes and long-term facilities.CTX-M-15 is the most commonly reported ESBL-enzyme in Europe (Pitout and Laupland 2008.). CTX-M15 is derived from CTXM-3 by a single amino acid substitution at position 240 (Asp

Gly). This substitution confers an increased catalytic activity against ceftazidime (Peirano and Pitout 2010). The CTX-M 14 gene was not mobilized by conjugation. The nucleotide sequences of CTX-M genes are highly related to the nucleotide sequence of Kluyvera spp. The results of the conjugation experiment showed that carried on a conjugative plasmid (Peirano and Pitout 2010). CTX-M type ESBLs typically hydrolyze Cefotaxime and Ceftriaxone more efficiently than Ceftazidime but point mutations around the active site belonging to the CTX-M1 and CTX-M-9 groups having ability to hydrolyze Ceftazidime significantly (Pitout 2010).Unlike most ESBLs that have been found in E.coli,K. pneumoniae and other Enterobacteriaceae, OXA type ESBLs have been found mainly in P.aerugenosa and only rarely Enterobacteriaceae (Girlich et al.2004). Although ESBLs still constitute the first cause of resistance to beta-lactams among Enterobacteriaceae, other new beta-lactamases conferring resistance to carbapenems, such as metallo-betalactamases (MBL) and KPC carbapenemases, or to cephamycins, such as CMY enzymes, have more recently emerged and are often associated with ESBLs (Coque et al. 2008 ). ESBLs should be distinguished from other beta lactamases capable of hydrolyzing extended spectrum Cephalosporins e.g. AmpC and Carbapenemases.
CTX-M-15

was

Carbapenemases maybe further grouped as either metallo-beta lactamases (class B) or serine carbapenemases (Class A and D ) (Jacoby 2009; Poirel et al. 2007 ). -lactamases (>500) > 50% ESBLs Plasmid encoded 1983 1985 1989 SHV-type (>130) TEM-type (> 180) CTX-M-type (> 100) ESBLs of growing The oldies

importance 1988 1991 1991 1996 SFO-1 Serratia FOnticola TLA-1 TLAhuicas (indian tribe) PER (7) Pseudomonas Extended Resistance VEB (7) Vietnam Extended-spectrum -lactamase

1996 1998 2005 2005 1998 1991

BES-1 Brazilian Extended-Spectrum -lactamase GES (16) Guyana Extended-Spectrum -lactamases BEL (2) Belgium Extended-spectrum -Lactamase TLA-2 ???? (Plasmid, waste water) KPC (10) Klebsiella pneumoniae Carbapenemase OXA-ESBL (18) (OXA-2, -10, -13 derivatives, OXA-18, OXA-45) PeculiarESBLs infrequent ESBLs

Epidemiology of ESBLs genes are rapidly changing and shows marked geographic differences in distribution of genotypes of CTX-M -lactamases (Coque et al. 2008). Rupp ME in 2003 encoded- in many parts of the world (10-40%) of strains of E. coli

and Klebsiella pneumoniae express ESBLs (Rupp and Paul 2003) also noted in the introduction, ESBLs were first described in 1983 from the Germany. The success of the CTX-Ms over the classical ESBL-enzymes SHVs and TEMs is linked to the way by which CTX-M enzymes are spread. Through mobile genetic elements, resistance genes disseminate within the same species and also between bacteria of different species (Coque et al. 2008).The prevalence of ESBLs in Europe is higher than in the USA but lower than in Asia and South America (Girlich et al. 2004). A study performed in Turkey showed a prevalence of 21% ESBL producers among E. coli causing community acquired urinary tract infection (UTI) during 2004 and 2005 (Coque et al. 2008). In Norway, a prospective survey of clinical E. coli isolates with reduced susceptibility to oxyimino-cephalosporins demonstrated the dominance of CTX-M-15 (46%) and CTX-M-9-like (30%) enzymes among ESBL-positive E. coli and of SHV-5 (47.4%) and SHV-2 (21.0%) among ESBL-positive K. pneumoniae isolates (Coque et al. 2008). In Italy, the prevalence of ESBL producers among clinical isolates has also increased over the past ten years. The most prevalent ESBLpositive species are E. coli among hospitalised patients and Proteus mirabilis among outpatients. A predominance of TEM enzymes (45.4%), SHV-12, and the emergence of non-TEM, non-SHV enzymes (CTX-M-type in E. coli and K. pneumoniae, and PER-type in P. mirabilis) has been described. More recent studies performed in single institutions showed the frequent recovery of CTX-M-15-producing E. coli and other variants from this group such as CTX-M-1 and CTX-M-32 (Caccamo et al.2006). The prevalence of ESBLs is over 10% in Hungary, Poland, Romania, Russia and Turkey. K. pneumoniae is the most frequent ESBL-producing species in Hungary and Russia, and an increase in the percentage of ESBL producers among K. pneumoniae

isolates has been reported from Poland, Turkey, Bulgaria, and Romania (Edelstein et al. 2003)The emergence and wide spread of the CTX-M-15 enzyme in most European countries, including those with previous low rates of ESBLs, is one of the most relevant findings associated with the current epidemiology of ESBL in Europe (Lytsy et al. 2008; Oteo et al. 2006 ). Percentage of organisms expressing ESBL phenotype in the Meropenem Yearly Susceptibility Test Information Collection study in 1997-2003, the highest rate among K. pneumoniae isolated is seen in Eastern Europe and South America, where more than 50% of isolates are potential ESBL producers this contrasts with North America and Northern Europe, where only 12.3% and 16.7% of the isolates, respectively, are potential ESBL producer (Turner et al. 2005).Asia probably has a long history of the occurrence of extended-spectrum -lactamase (ESBL)-producing bacteria (Kim et al. 2007). There were no comprehensive reports on the incidence of ESBLs from countries in the region in the 1980s and early 1990s. There were, a number of sporadic reports of ESBLs, notably of the SHV-2 type, from China in 1988 (Rupp et al. 2003), and the TOHO-1 ESBL produced by Escherichia coli from Japan in 1993 (Ishii et al. 1995) ESBL phenotypes were reported for three centres in northern Taiwan, contributing to the 19982002 SENTRY programme, with overall rates of ESBL production of 13.5% in K. pneumoniae and 5.6% in E. coli (Turner et al. 2005). ESBLs mediated resistance in Klebsiella spp. Ranged from 20-40% through out Southeast Asia, China and Japan (Rupp et al. 2003). CTX-M-15 has probably been present in India for some considerable time, and is present in both E. coli and Klebsiella spp. at a high frequency and it is assumed that spreads of CTX-M-15 from India to other countries is more likely. Two very early members of the CTX-M group

were identified in Japan: TOHO-1 and -2. These have not spread or evolved de novo outside Japan, except for one reported single isolate producing TOHO-1 from Argentina (Bonnet 2004) .The pattern of ESBL genotypes in Japan is quite different from that seen in surrounding countries, although universally successful types, e.g., CTX-M-14, have recently become more common (Hirakata et al. 2005) Both India and Pakistan have reported high rates of ESBLs since the 1990s (Grover et al.2006; Mathai et al.2002) With the populations of India and China these two countries surely represent the largest reservoirs of CTX-M ESBL genes in the world. Increasing travel and trade will contribute to the worldwide spread of locally evolved CTX-M genotypes (Hawkey et al. 2008). Prevalence of ESBLs vary from country to country, hospital to hospital even very closely related region. There were several studies in India in 2002, 2007, 2007, 2008 were 60%, 60.9%, 46.5%, 51.4% in E.coli respectively ( Mathai et al. 2002; Sharma et al.2007; Shivaprokasha et al. 2007; Varaiya et al 2008 ). In India in 2006 CTX-M -15 was 73%. In 2010 there were different studies from different countries e.g. in Iran it was 96%, ESBLs where SHV, CTX-M, TEM, PER was 26%, 24.5%, 18%, 7.5% respectively, in Corea E.coli and Klebsiella were 17.7% and 26.5% respectively. In India it was 61.1% and 40.6% for E.coli and Klebsiella respectively (Sasirekha 2010), another study in India ESBLs for 70% and 60% for E.coli and Klebsiella respectively, where TEM, SHV were 56% and 60% respectively (Sharma 2010). Classification Because of the diversity of enzymatic characteristics of the many lactamases discovered so far, many attempts have been made to categories and classify them

since the late 1960s. These classifications involve two major approaches: the first and older one is based on the biochemical and functional characteristics of the enzyme; the second approach is based on the molecular structure of the enzyme (Bush, Jacoby and Medeiros 1995). Evolution of functional classification of lactamases Year 1968 1973 Author Sawai et al Richmond and Sykes Basis of classification of lactamases Used cephalosporins versus penicillins as substrates Expanded substrate profile and suggested five major groups (Ia-d, II, III, IV, V) 1976 Sykes and Matthew Differentiated the plasmid mediated lactamases on the basis of isoelectric focusing 1981 Mitsuhachi and Inoue Added the category cefuroxime hydrolysing lactamase 1989 Bush Expanded further the substrate profile, added the reaction with EDTA, correlated between functional and molecular classification 1995 Bush, Jacoby, and Medeiros Expanded the Bush scheme and used biochemical properties, molecular structure, and nucleotide sequence.

Functional Classification

Group 1

CEPHALOSPORINASE, Molecular Class C (not inhibited by clavulanic acid) Group 1 is cephalosporinases not inhibited by clavulanic acid, belonging to the molecular class C Group 2

Group 2 are penicillinases, cephalosporinases, or both inhibited by clavulanic acid, corresponding to the molecular classes A and D reflecting the original TEM and SHV genes. However, because of the increasing number of TEM- and SHV-derived {beta}lactamases, they were divided into two subclasses, 2a and 2b.

GROUP 2a PENICILLINASE, Molecular Class A The 2a subgroup contains just penicillinases. GROUP 2b BROAD-SPECTRUM, Molecular Class A 2b Opposite to 2a, 2b are broad-spectrum {beta}-lactamases, meaning that they are capable of inactivating penicillins and cephalosporins at the same rate. Furthermore, new subgroups were segregated from subgroup 2b: GROUP 2be EXTENDED-SPECTRUM, Molecular Class A Subgroup 2be, with the letter "e" for extended spectrum of activity, represents the ESBLs, which are capable of inactivating third-generation cephalosporins

(ceftazidime, cefotaxime, and cefpodoxime) as well as monobactams (aztreonam) GROUP 2br INHIBITOR-RESISTANT, Molecular Class A (diminished inhibition by clavulanic acid) The 2br enzymes, with the letter "r" denoting reduced binding to clavulanic acid and sulbactam, are also called inhibitor-resistant TEM-derivative enzymes; nevertheless, they are commonly still susceptible to tazobactam, except where an amino acid replacement exists at position met69. GROUP 2c CARBENICILLINASE, Molecular Class A Latersubgroup 2c was segregated from group 2 because these enzymes inactivate carbenicillin more than benzylpenicillin, with some effect on cloxacillin. GROUP 2d CLOXACILANASE, Molecular Class D or A Subgroup 2d enzymes inactivate cloxacillin more than benzylpenicillin, with some activity against carbenicillin; these enzymes are poorly inhibited by clavulanic acid, and some of them are ESBLs. The correct term is "OXACILLINASE". These enzymes are able to inactivate the oxazolylpenicillins like oxacilli, cloxacilli, dicloxacillin. The enzymes belong to the molecular class D not molecular class A.

GROUP 2e CEPHALOSPORINASE, Molecular Class A Subgroup 2e enzymes are cephalosporinases that can also hydrolyse monobactams, and they are inhibited by clavulanic acid GROUP 2f CARBAPENAMASE, Molecular Class A Subgroup 2f was added because these are serine-based carbapenemases, in contrast to the zinc-based carbapenemases included in group 3. Group 3 METALLOENZYME, Molecular Class B (not inhibited by clavulanic acid) Group 3 are the zincbased or metallo {beta}-lactamases, corresponding to the molecular class B, which are the only enzymes acting by the metal ion zinc, as discussed above. Metallo B-lactamase is able to hydrolyse penicillins, cephalosporins, and carbapenems. Thus, carbapenems are inhibited by both group 2f (serine-based mechanism) and group 3 (zinc-based mechanism) Group 4 PENICILLINASE, No Molecular Class (not inhibited by clavulanic acid) Group 4 are penicillinases that are not inhibited by clavulanic acid, and they do not yet have a corresponding molecular class. Molecular classification The molecular classification of lactamases is based on the nucleotide and amino acid sequences in these enzymes. To date, four classes are recognised (A-D), correlating with the functional classification .Classes A, C, and D act by a serine based mechanism, whereas class B or metallo lactamases need zinc for their action.

Genes encoding ESBLs In the early years the most common beta lactamases were TEM and SHV varieties (Pitout et al.2010; Shobha et al. 2007; Florijn et al. 2002). TEM-2 and SHV-2 ESBL are derived from parental TEM-1 and SHV-1 by point mutation, which was mentioned before. TEM-1 and SHV-2 are non ESBL, but CTX-M enzymes are not derived from non ESBL and consequently all CTX-M enzymes are ESBL (Al-Agamy et al. 2009). Now, CTX-M enzymes are being discovered throughout the world and becoming the most prevalent beta lactamase (Xu et al. 2005).ESBLs (group 2be) are encoded on mutated TEM-1 and SHV-1 genes carried on plasmids that are readily transmissible to other organisms (Jemima and Verghese 2008). TEM and SHV The TEM -1 enzyme was first reported from an E.coli isolate in 1965 and is now the commenest beta lactemase found in Enterobactereceae(Fonze et al. 1995) and the older TEM is derived from Temoniera, a patient from whom the strain was first

isolated in Greece(Turner 2005). TEM-1 is the most commonly-encountered betalactamase in Gram-negative bacteria. Up to 90% of ampicillin resistance in E. coli is due to the production of TEM-1. Also responsible for the ampicillin and penicillin resistance that is seen in H. influenzae and N. gonorrhoeae in increasing numbers. Although TEM-type beta-lactamases are most often found in E. coli and K. pneumoniae, they are also found in other species of Gram-negative bacteria with increasing frequency. Based upon different combinations of changes, currently 195 TEM-type enzymes have been described. TEM-2,the first variant described, differed from TEM-1 through the substitution of a lysine for a glutamine at position 39 (Rupp et al. 2003). TEM and SHV are transferred by both plasmid and chromosome (Sharma 2010).TEM -3 most common in France (Livermore 1995). TEM-10, TEM-12, TEM-3 and TEM -26 seem most common in the USA (Farkosh 2007). SHV-1 shares 68 percent of its amino acids with TEM-1 and has a similar overall structure. SHV stands for Sulf hydril variable (Turner 2005). The SHV-1 betalactamase is most commonly found in K. pneumoniae and is responsible for up to 20% of the plasmid-mediated ampicillin resistance in this species. ESBLs in this family also have amino acid changes around the active site, most commonly at positions 238 or 238 and 240. More than 60 SHV varieties are known. They are the predominant ESBL type in Europe and the United States and are found worldwide. SHV-5 and SHV-12 are among the most common (Farkosh 2007). SHV varients are important worldwide (Rahman et al. 2004). Among the SHV type of -lactamases, SHV-5 was found to be responsible for outbreaks of nosocomial infection in several countries (Jmima and Verghes 2008).

CTX-M beta lactamases Acquired resistance to beta-lactams is mainly mediated by extended-spectrum betalactamases (ESBLs) that confer bacterial resistance to all beta-lactams except carbapenems and cephamycins, which are inhibited by other beta lactamase inhibitors such as clavulanic acid. A shift in the distribution of different ESBLs has recently occurred in Europe, with a dramatic increase of CTX-M enzymes over TEM and SHV variants (Coque et al. 2008; Livermore and Canton 2007). CTXM lactamases (i.e. active on CefoTaXime, first isolated in Munich) were first reported from Japan in 1986 (the enzyme was initially named TOHO-1 and was later changed to CTX-M) (Matsumoto 1988). During the 1990s, general dissemination and occasional nosocomial outbreak, mostly of CTX-M-2-producing Enterobacteriaceae, were reported from South America (especially Argentina) (Peirano and Pitout 2010). However, since 2000, E.coli producing CTX-M -lactamases have emerged worldwide as an important cause of community-onset urinary tract infections (UTIs) and this has been called the CTX-M pandemic(Gutkind and Ctedra de 2001). These enzymes were named for their greater activity against cefotaxime than other oxyimino-beta-lactam substrates (e.g., ceftazidime, ceftriaxone, or cefepime) (Pitout,et al, 2008). Rather than arising by mutation, they represent examples of plasmid acquisition of beta-lactamase genes normally found on the chromosome of Kluyvera species, a group of rarely pathogenic commensal organisms (Coque et al. 2008). These enzymes are not very closely related to TEM or SHV beta-lactamases in that they show only approximately 40% identity with these two commonly isolated beta-lactamases. The change at position 102 mainly enhances resistance to Ceftazidime, while the change at position 236 predominantly augments resistance to

Cefotaxime, with a slight effect for Ceftazidime (Rahman et al. 2004). More than 80 CTX-M enzymes are currently known, they are currently devided into 5 clusters on the basis of amino acid sequence: CTX-M-1,CTX-M-2, CTX-M-8, CTX-M-9 and CTX-M-25 ( Al-Agamy et al. 2009; Smet et al. 2010) named after the enzyme first discovered for each lineage (Pagani et al. 2003). Despite their name, a few are more active on ceftazidime than cefotaxime. CTX-M-15 belongs to the CTX-M-1 cluster and is derived from CTX-M-3 by one amino acid substitution at position 240 (AspGly); however, the flanking sequences of the -lactamases can be very different (Peirano et al 2010). The gene encoding CTX-M-14 differs from that encoding CTX-M-9 by only one amino acid change, at position 231 (Ala3Val), whereas CTX-M-13 differs from CTX-M-9 by four amino acid substitutions, at positions 3 (Val3Met), 53 (Val3Lys), 154 (Ala3Glu), and 231 (Ala3Val). Between CTX-M-13 and CTX-M-14, there are three amino acid substitutions at positions 3, 53, and 154 (Chanawong et al. 2002). The initial observation of infections caused by bacteria harboring ESBLs in hospitals would suggest that CTX-M arose in the nosocomial setting and spread to the community (Perez et al. 2007). The epidemiology of organisms producing CTX-M enzymes is very different from those that produce TEM-derived and SHV-derived ESBLs (Pitout et al 2008). Epidemiological reports demonstrate that some enzymes are more frequently reported than others, that predominant enzyme type varies with country and that diverse CTX-M types often exist within a single country (Ensor et al. 2006). CTX-M-15-producing E. coli are emerging worldwide, especially since 2003, as an important pathogen causing community-onset and hospital-acquired infections (Pirano et al 2010). CTX-M enzymes (most often CTX-M-14 and -27) have been

described in Asia especially since the late 1990s and early 2000s.Reports on the presence of CTX-M-15 in Asia remains relatively scarce outside of those studies from the subcontinent (i.e. India and Pakistan) (Hawkey P. M., 2008). Reports from India indicate that E. coli producingCTX-M-15 is very common in the community as well as hospital settings (Ensor et al 2006). India represents a significant reservoir and source of E. coli producing CTX-M-15 -lactamases (Pirano et al 2010). CTX-M-15 was found 73% in India in 2006 by (Ensor et al. 2006). A strain that is thought to be responsible for the pandemic dissemination of the CTX-M-15 enzyme (Coque et al. 2008). CTX-M-15 have been reported from most countries in Europe ,Asia, Africa, North America, South America and Australia ( Pirano et al. 2010). Group 9 (CTX-M9 and 14) enzyme is dominant in Spain and Group 1 enzymes (particularly CTX-M 3 and CTX-M-15) is everywhere (Livermore2007). The bowel is a rich environment for genetic exchange between commensal Enterobacteriaceae. Faecal carriage of CTX-M producing bacteria has been described. It is plausible to suggest that conditions of overcrowding and poor sanitation, and the selective pressure created by overuse of antibiotics in India has enabled such widespread dispersal of CTX-M-15 (Ensor et al. 2007). OXA beta-lactamases (class D) OXA beta-lactamases were long recognized as a less common but also plasmidmediated beta-lactamase variety that could hydrolyze oxacillin and related antistaphylococcal penicillins. These beta-lactamases differ from the TEM and SHV enzymes in that they belong to molecular class D and functional group 2d. The OXAtype beta-lactamases confer resistance to ampicillin and cephalothin and are characterized by their high hydrolytic activity against oxacillin and cloxacillin and the

fact that they are poorly inhibited by clavulanic acid. Amino acid substitutions in OXA enzymes can also give the ESBL phenotype (Wikipedia 2010). Others Other plasmid-mediated ESBLs, such as PER, VEB, GES, and IBC beta-lactamases, have been described but are uncommon and have been found mainly in P. aeruginosa and at a limited number of geographic sites. PER-1 in isolates in Turkey, France, and Italy; VEB-1 and VEB-2 in strains from Southeast Asia; and GES-1, GES-2, and IBC-2 in isolates from South Africa, France, and Greece (Wikipedia 2010).

Inhibitor-resistant -lactamases Although the inhibitor-resistant -lactamases are not ESBLs, they are often discussed with ESBLs because they are also derivatives of the classical TEM- or SHV-type enzymes. These enzymes were at first given the designation IRT for inhibitor-resistant TEM -lactamase; however, all have subsequently been renamed with numerical TEM designations. There are at least 19 distinct inhibitor-resistant TEM -lactamases. These beta-lactamases have primarily been detected in France and a few other locations within Europe (Wikipedia 2010).

AmpC-type -lactamases (Class C) AmpC type -lactamases are commonly isolated from extended-spectrum cephalosporin-resistant Gram-negative bacteria. AmpC -lactamases (also termed class C or group 1) are typically encoded on the chromosome of many Gram-negative bacteria including Citrobacter, Serratia and Enterobacter species where its expression is usually inducible; it may also occur on Escherichia coli but is not

usually inducible, although it can be hyperexpressed. AmpC type -lactamases may also be carried on plasmids (Wikipedia 2010).

Carbapenemases

Carbapenems are famously stable to AmpC -lactamases and extended-spectrum-lactamases. Carbapenemases are a diverse group of b-lactamases that are active not only against the oxyimino-cephalosporins and cephamycins but also against the carbapenems. VIM (Verona integron-encoded metallo--lactamase) A second growing family of carbapenemases, the VIM family, was reported from Italy in 1999 and now includes 10 members, which have a wide geographic distribution in Europe, South America, and the Far East and have been found in the United States. VIM-1 was discovered in P. aeruginosa in Italy in 1996 (Wikipedia 2010). OXA (oxacillinase) group of -lactamases (Class D) The OXA group of -lactamases occurs mainly in Acinetobacter species and is divided into two clusters. OXA carbapenemases also tend to have a reduced hydrolytic efficiency towards penicillins and cephalosporins (Wikipedia 2010).

KPC (K. pneumoniae carbapenemase) (Class A)

A few class A enzymes, most noted the plasmid-mediated KPC enzymes, are effective carbapenemases as well. Three variants are known, distinguished by one or two amino-acid substitutions. KPC-1 was found in North Carolina, KPC-2 in Baltimore

and KPC-3 in New York. Plasmid borne KPC enzymes are emerging among K. pneumoniae and other Enterobactericeae(13). The class A Klebsiella pneumoniae carbapenemase (KPC) is currently the most common carbapenemase, which was first detected in North Carolina, USA, in 1996 and has since spread worldwide.A later publication indicated that Enterobacteriaceae that produce KPC were becoming common in the United States (Rhee 2010).

NDM-1 (New Delhi metallo--lactamase)

Originally described from New Delhi in 2009, this gene is now widespread in Escherichia coli and Klebsiella pneumoniae from India and Pakistan. As of mid-2010, NDM-1 carrying bacteria have been introduced to other countries (including the USA and UK), presumably by medical tourists undergoing surgery in India. InhibitorResistant -Lactamases (Wikipedia 2010). Organism responsible for ESBL:

ESBLs are most common in E.coli and Klebsiella pneumoniae but do occure in other Enterobacteroceae specially Enterobacter, Proteus, Pseudomonas aeroginosa, Morganella morganii (Shobha 2007; Sasirekha et al. 2010; Peirano et al. 2010).

Risk group Patients at high-risk for ESBL include:

Neutropenic patients

Transplant recipients

Premature neonates

Elderly persons

 Prolonged/extensive antibiotic use (e.g., cephalosporins) Post-gastrointestinal surgery Consider screening all admissions to high risk units. High risk units include: Intensive care units

Hematology/oncology units

Transplantation units

Long term/ chronic care facility (Peirano et al. 2010; Farkosh 2007). Use of extended spectrum antibiotics exerts a selective pressure for emergence of ESBL producing Gram negative rods (GNR) (Farkosh et al. 2007).

ESBL CARRIAGE Patients with known ESBL carriage should have their records flagged consistent with established policies. Upon readmission consider screening for ESBL. Sites most often sampled for carriage are those where the microorganisms are typically found perianal/rectal and urine (Champs et al. 1989). Patients with persistent carriage (e.g., 3 consecutive positive samples taken at least a week apart and the continuation of ESBL-associated risk factors) do not require continued screening during an admission. It is need to re-screen during the admission if there are changes in ESBL-associated risk factors. Re-screening should be determined on an individual patient basis. Factors to consider include: continuing use of antibiotics, predicted invasive interventions, or proposed removal of precautions (Friedman et al. 2004; Shobha et al. 2007). During discharge the antibiotics should be informed about a patients ESBL-carriage as with any antimicrobial-resistant microorganism (Friedman et al. 2004).

Reservour Most colonized patients are asymptomatic and may be a source of transmisssion to others (Friedman et al. 2004) .The bowel is a rich environment for genetic exchange between commensal Enterobacteriaceae (Ensor et al. 2006). Transmission CTX-M gene mobilizes 10x more frequently than SHV & TEM gene (CLSI 2010). The molecular epidemiology of ESBL outbreaks indicates that the mechanism of spread may be clonal strain dissemination, clonal plasmid dissemination and selection among polyclonal strains or both (Perez et al. 2007). The typical method of transmission includes clonal dissemination of an ESBL producer strain or the dissemination of a plasmid carrying an ESBL gene (Coque et al. 2008). Selective antibiotic pressure then leads to colonization of patients bowel and skin with a risk of subsequent infection. Thus, fecal colonization may play a critical role in facilitating spread (Ensor et al. 2007). Outbreaks associated with procedures, e.g., catheterization, and contamination of medical devices has been reported (Pitout et al. 2008). Spread then appears to occur mainly through healthcare personnel hands. Endemic strains may persist in health care settings for years because of patient colonization, environmental contamination, and hand transmission (Friedman et al. 2004). Patient to patient transfer of microorganisms via the hands of healthcare workers is thought to be the main mode of transmission for ESBLs, although some ESBL outbreaks have been attributed to contaminated medical devices (e.g., ultrasound gel). Thus hand hygiene should be the most effective preventive measure (Friedman et al. 2004).

Prevention Hand hygiene is a simple and effective infection control intervention. Dirty or contaminated hands can transmit microorganisms which may cause infection .Hand washing with soap and water is effective (Friedman et al. 2004). Contact precautions in addition to other infection prevention measures, e.g., hand hygiene, environmental cleaning, and restriction of antibiotics, have been shown to be effective in preventing transmission in outbreak situations, use of gloves and aprons/gowns. No additional precautions are required in outpatient or home care settings (Friedman et al. 2004). Patient placement Single (private) room is preferred. Spatial separation may be used. Cohorting of known cases, particularly in clusters/outbreaks, is acceptable. If there are limited single room accommodations in a facility or if sharing a room with a non-ESBL patient is required (e.g., long-term care facility, nursing homes, residential home), consideration should be given to the following: ensure the non-ESBL patient does not have risk factors, such as indwelling devices, neutropenia, history of transplantation, etc., and the non-ESBL patient has good hygiene practices (Friedman et al. 2004). Monitoring and control of usage of extended spectrum cephalosporins and regular surveillance of antibiotic resistance patterns as well as efforts to decrease use as empirical therapy is indicated (Rupp et al. 2003). Laboratory procedure The methods for detection of ESBLs can be broadly divided into two groups: phenotypic methods that use non-molecular techniques, which detect the ability of the ESBL enzymes to hydrolyse different cephalosporins; and genotypic methods, which

use molecular techniques to detect the gene responsible for the production of the ESBL. Clinical diagnostic laboratories use mostly phenotypic methods because these tests are easy to perform and are cost effective also. Many different techniques exist for confirming ESBL production but those utilizing similar methodology to standard susceptibility tests are the most convenient for the routine diagnostic laboratory. These all depend on detecting synergy between clavulanic acid and the indicator cephalosporins used in the primary screening. Failure to detect ESBL production by routine disk-diffusion tests has been well documented (Tenover et al. 1999; Paterson et al. 1999). The current CLSI recommendations (2010) for detection of ESBL's in Klebsiella spp. and E. Coli includes an initial screening test with any two of the following betalactam antibiotics: cefpodoxime, ceftazidime, aztreonam, cefotaxime, or ceftriaxone. Isolates exhibiting a MIC > 1g/ml should be confirmed phenotypically using ceftazidime plus ceftazidime/clavulanic acid and cefotaxime plus

cefotaxime/clavulanic acid. Screening test for ESBLs Disc diffusion method According to the CLSIs guidelines, isolates showing inhibition zone size of 22 mm with Ceftazidime (30 g), 25 mm with Ceftriaxone (30 g), 27 mm with Cefotaxime (30 g) , 27 mm with Aztreonam (30 g) and 22 mm with Cefpodoxime (10 g), was identified as potential ESBL producers and short listed for confirmation of ESBL production. Recently ,chromogenic media designed specifically for screening and identification of ESBLs producing Enterobacteriaceae,

have become comercially available (Black et al. 2005).The use of Cefotaxime, Ceftazidime and Ceftriaxone individually as the indicator of ESBLs screening can no longer be recommended. If only one indicator antibiotic would be used for screening, Cefpodoxime has proven to be the best molecule for screening all types ESBLs producers in clinical sample (CLSI 2010). MIC (Minimum inhibitory concentration): It is done by tow test: Agar dilution method and Broth dilution method. Advantages and disadvantages have in both method e.g. Agar versus Broth dilution method: By using an inoculums replicating apparatus, a fairly large number of strains (25-36) , may be tested at a time by agar dilution method. Microbial concentration, if any, can be detected, more easily, as compared to broth dilution method. In agar dilution method for particular type of organism blood and blood product can be easily mixed, which cannot reliably be done in broth dilution method. The disadvantage of agar dilution method is the time consuming and labour intensive task of preparing the plates and inoculums. Table showing MIC and Inhibition Zone criteria for the detection of ESBLs in K .pneumoniae and Esch. coli (CLSI 2010) (Appendix-XII).

Confirmatory tests for ESBLs Many methods for the detection of ESBLs , plasmid mediated AmpC -lactamases and carbapenemases have been proposed, but some procedures are technically demanding and time consuming, others are hard to interpret and still others require. Double disc synergy test The disc synergy test (DDST) is the oldest method for phenotypic confirmation of ESBLs producing organisms, first proposed in 1980 (Jarlier et al. 1988). A ceftazidim 30 mg disc and amoxycillin/ clavulanic acid 20+ 10 mg disc will be placed 25 -30 mm apart, centre to centre. Following overnight incubation in an air at 370 C, ESBL production is inferred when the zone of inhibition around the ceftazidim disc is expanded by the clavulanate.

Fig. 5. Showing double disc synergy test The disc on the left is cefotaxime (30mg): the disc in the centre is coamoxyclav(20+10 mg): the disc on theright is ceftazidime (30 mg). Note the expansion of the zones around the cefotaxime and ceftazidime discs adjacent to the co-amoxyclav. Modified double disc diffusion test Mueller Hinton agar media will be inoculated with standardized inoculum (corresponding to 0.5 McFarland tube) using sterile cotton swab . Augmentin (20 g amoxycillin and 10 g clavulinic acid AMC ) disc will be placed in the center of the plate and test discs of 3 rd generation cephalosporins (Ceftazidim CA,-30 g

,Ceftriaxone-CRO 30g, Cefotaxime CTX 30 g , Aztreonam ATM -30 g) discs will be placed at 15 mm distance from the Augmentin disc. The plate will be incubated overnight at 37o C . ESBL pproduction will be considered positive if the zone of inhibition around the test discs increased towards the Augmentin disc or neither disc will be inhibitory alone but bacterial growth will be inhibited where the two antibiotics diffuse together. Enhancement of the zone of inhibition around one or more of the -lactam-containing discs towards the clavulanic acid-containing disc is

indicative of ESBL production. Precise placement of discs is important (a distance of 15mm between the discs is recommended) and interpretation is subjective.

Fig. 5. Showing modified double disc diffusion test Disc replacement method for ESBL confirmation Two amoxyclav (AMC 30) discs will be placed on Mueller Hinton agar inoculated with the bacterial isolates. After 1 hour at room temperature, the discs were removed and replaced with Ceftazidim (RP-30) and Ceftriaxone (AUF -30). Each Cephalosporin disc will be placed independent of the initial augmentin discs and the plates will be incubated at 370 C for 18-24 hours and read for evidence of ESBL production. Positive disc replacement method will be indicated by an increase in inhibition zone of 5 mm and above between the inhibition zones formed by the augmentin- replaced cephalosporin discs and those placed independently. The following two procedures will be carried out in the present study as per CLSI guidelines:

Phenotypic confirmatory test with combination disk

This test requires the use of a third-generation cephalosporin antibiotic disk alone and in combination with clavulanic acid. In this study, two combinations will be used, firstly a disk of Ceftazidime (30g) alone and a disk of Ceftazidime + Clavulanic acid (30 g/10 Cefotaxime+Clavulanic acid g) and secondly Cefotexime(30g) alone and a disc of

(30g/10g) will be used. Both the disks will be placed at least 25 mm apart, center to center, on a lawn culture of the test isolate on Mueller Hinton Agar (MHA) plate and incubated overnight at 37C. Difference in zone diameters with and without clavulanic acid was measured.

Fig. 6. Showing double disc diffusion test

Interpretation: When there is an increase of 5 mm in inhibition zone diameter around combination disk of Ceftazidime + Clavulanic acid versus the inhibition zone diameter around Ceftazidime disk alone, it confirms ESBL production.

Control strain used to validate susceptibility tests will be E. coli ATCC 25922.

Vitek ESBL cards Laboratories using conventional Vitek cards risk incorrectly reporting ESBL producing organisms as susceptible to cephalosporins when MICs are 8 g/ml. The Vitek ESBL test (bioMerieux Vitek, Hazelton, Missouri) utilize cefotaxime and ceftazidime, alone (at 0.5 g/ml), and in combination with clavulanic acid (0.4 g/ml). Inoculation of the cards is identical to that performed for regular Vitek cards. Analysis of all wells is performed automatically, once the growth control well reached a set threshold (4 to 15 hr of incubation). A predetermined reduction in the growth of the cefotaxime or ceftazidime wells containing clavulinic acid, compared with the level of growth in the well with the cephalosporin alone, indicates a positive result. Sensitivity and specificity of the method exceed 90%. BD Phonex Automated Microbiology System Bacton Dickison Biosciences (Sparks, Md) have introduced a short incubation systemfor bacterial identification and susceptibility testing, known as BD Phoenix. The Phoenix ESBL test uses growth response to cefpodoxime, ceftazidime, ceftriaxone and cefotaxime, with or without clavulinic acid, to detect the production of ESBLS. The test organism has been identified by Sanguinetli et al. (2003). Results are usually available within 6 hours. The E test method (Epsilon test) Produced by AB Biodisk (Solna, Sweden) and Bio-Stat (Stockport, UK) is a plastic drug-impregnated strip, one end of which generates a stable concentration gradient of cephalosporin (i.e., ceftazidime 0.532 g/ml, cefotaxime and cefepime 0.2516 g/ml) and the remaining end of which generates a gradient of cephalosporin (i.e.,

ceftazidime and cefepime 0.0644 g/ml, cefotaxime 0.0161 g/ml) plus a constant concentration of clavulanate (4 g/ml). ESBL production is inferred if the MIC ratio for cephalosporin alone/cephalosporin plus clavulanate MIC is 8 (Health Protection Agency, 2005). Accurate and precise (but more expensive than combination disks) these tests are suggested by the BSAC as a confirmatory test for ESBL production. Significantly, BASC recommends the cefepime/clavulanate Etest for Enterobacter spp. (Health Protection Agency, 2005). In fact, neither ceftazidime/clavulanate nor cefotaxime/clavulanate Etest strips are able to detect the ESBLs in Enterobacter spp. In contrast, the cefepime/clavulanate strip is the only commercially available and highly reliable test that permits accurate detection of ESBLs within this group of organisms (Rupp, et al, 2003). Florigin, et al, found that E- test was more sensitive than the disc diffusion test ( Florigin, et al, 2002). Currently CLSI does not recommend any specific tests to detect AmpC production in Enterobacteriaceae. Several phenotypic tests for detection of these enzymes have been described but at this time no assay has been sufficiently evaluated for CLSI to make a recommendation to test for AmpC beta-lactamase. Like ESBL detection assays, AmpC detection assays are not recommended by CLSI for making treatment decisions (CLSI 2010). Phenotypic ESBL confermation tests for routine are based on in vitro inhibition of ESBL by clavulinic acid (CA). These tests are tailored to detect ESBLs in Klebsiella spp. but are equally applicable to other Enterobactriaceae with little or no chromosomal - lactamase activity, such as E.coli and Proteus mirabilis. False negative result can be obtained e.g.

Strains that coproduce an inducible chromosomal or plasmid mediated AmpC beta lactamase. Because AmpC enzymes may be induced by clavulanate (which inhibit them poorly) and may then attack the cephalosporins , masking synergy arising from inhibition of the ESBL (Pfaller et al. 2006). Also false positive results are obtained using inhibitor based ESBL detection: Mainly in Klebsiella oxytoca isolates, hyperproducing the chromosomal -lactamase (Wiegand et al. 2007). The phenotypic detection of ESBLs in bacteria other than E coli, Klebsiella spp, and Proteus spp remains a problematic and controversial issue. The reason for this is that the clavulanate effect noticed with these ESBL-producing species is not always present in species such as enterobacter and citrobacter (Pitout et al. 2008). Genotypic detection Phenotypic methods are not able to distinguish between the specific enzymes responsible for ESBL production (SHV, TEM, and CTX-M types). Several research or reference laboratories use genotypic methods for the identification of the specific gene responsible for the production of the ESBL, which have the additional ability to detect low-level resistance (i.e, can be missed by phenotypic methods). Furthermore, molecular assays also have the potential to be done directly on clinical specimens without culturing the bacteria, with subsequent reduction of detection time. The determination of whether a specific ESBL present in a clinical isolate is related to TEM and SHV enzymes is a complicated process because point mutations around the active sites of the TEM and SHV sequences have led to amino acid changes that increase the spectrum of activity of the parent enzymes, such as in TEM-1, TEM-2, and SHV-1 (Farkosh 2007). The molecular method commonly used is the PCR

amplification of the TEM and SHV genes with oligonucleotide primers, followed by sequencing. Sequencing is essential to discriminate between the non-ESBL parent enzymes (eg, TEM-1, TEM-2, or SHV-1) and different variants of TEM or SHV ESBLs (eg, TEM-3, SHV-2, etc). Molecular methods that do not use sequencing have been developed to characterise ESBLs and include PCR with RFLPs, PCR with single-strand conformational polymorphism, ligase chain reaction, restriction site insertion PCR, and real-time PCR. PCR amplification followed by nucleotide sequencing remains the gold standard for the identification of specific point mutation of TEM or SHV ESBL genes. This is not always straightforward and cost effective because clinical isolates often have multiple copies of ESBL genes. Sequencing is the only method for identifying CTX-M genes, which is labourintensive, time-consuming and expensive. Xu and his collegues report the development of a rapid and accurate multiplex PCR assay for simultaneous amplification of all CTX-M genes and differentiation of the five clusters (Xu, et al, 2005). Treatment The presence of ESBLs complicates the selection of antibiotics, particularly in patients with serious infections such as bacteraemia. The reason for this is that ESBLproducing bacteria are often multiresistant to various antibiotics, and CTX-Mproducing isolates are co-resistant to the fluoroquinolones. Antibiotics that are regularly used for empirical therapy of serious community-onset infections, such as the third-generation cephalosporins (eg, cefotaxime and ceftriaxone), are often not effective against ESBL-producing bacteria. This multiple drug resistance has major implications for the selection of adequate empirical therapy regimens. Empirical

therapy is prescribed at the time when an infection is clinically diagnosed, while the results of cultures and antimicrobial susceptibility profiles are awaited. Infections caused by ESBL-producing bacteria. A major challenge when selecting an empirical regimen is to choose an agent that has adequate activity against the infecting organism(s). Empirical antibiotic choices should be individualized based on institutional antibiograms. Beta lactam /Beta lactamases inhibitor As ESBL producing Enterobacteriaceae are frequently susceptible in vitro to Beta lactam/ Beta lactamase inhibitor combinations, it is logical to assume these combinations would also be clinically effective .But here we have to know that AmpC enzymes are normally resists. Carbanepem (e.g., imipenem,meropenem,ertapenem) choice of drug for treating the ESBL producing bacteria (Samaha-Kfoury and Araj 2003). Quinolones If there is in vitro susceptible to ciprofloxacin, a satisfactory clinical response can be achieved by using quinolones (Samaha-Kfoury and Araj 2003). Aminoglycosides As in the case with quinolones, aminoglycosides are effective therapy against ESBL producing pathogens .Susceptibility to amikacin seems to be preserved, in contrast to gentamicin and tobramycin, thus justifying its use as empiric therapy (Samaha-Kfoury and Araj 2003).

Tigecycline Tigecycline, a novel, first in class glycycline and an analogue of the semisynthetic antibiotic minocycline, is a potent, broad spectrum antibiotic that acts by inhibition of protein translation in bacteria by binding to the 30S ribosomal subunit and blocking the entry of amino-acyl to RNA molecules into the A site of the ribosome (Amaya et al. 2009).CLSI criteria to interpret susceptibility testing of tigecycline are not yet established. In vitro data supports the notion that tigecycline can be considered an alternative to carbapenems for treatment of infections due to ESBL-producing Enterobacteriaceae. However, clinical experience with tigecycline is still evolving (Rupp and Fey 2003). Fosfomycin Fosfomycin tromethamine is a soluble salt of fosfomycin with improved bioavailability over fosfomycin. It inactivates the enzyme pyruvyltransferase, which is required for the synthesis of the bacterial cell wall peptidoglycan (Amaya et al. 2009). The excellent in vitro activity of fosfomycin against ESBL-producing E. coli and K. pneumoniae strains has been recently reported. Further studies are required to assess the efficacy of fosfomycin for the treatment of UTIs caused by ESBLproducing enterobacteria (Rupp and Fey 2003). Colistin Although once considered a toxic antibiotic, clinicians have now turned to colistin as a last resort agent for the treatment of infections caused by multidrug resistant gramnegative bacteria, against which this cationic detergent-like compound remains active.The antimicrobial target of colistin is the bacterial cell membrane,where the polycationic peptide ring interacts with the lipid A of Lipopolysacharides, allowing

penetration through the outer membrane by displacing Ca

and Mg

. Insertion

between the phospholipids of the cytoplasomic membrane leads to loss of membrane integrity and to bacterial cell death (Amaya et al. 2009). As mentioned above, carbapenem resistance mediated by KPC is emerging among enterobacteria. Their implication in outbreaks, as seen in hospitals in New York City, has created a context in which the empiric use of colistin is necessary. The cephamycins, including cefoxitin and cefotetan, are stable to hydrolysis by ESBL producing Enterobactericeae. However, there is a general reluctance to use these agents because of the relative ease by which some isolates may decrease the expression of outer membrane proteins, thus creating resistance to these agents during therapy.

Materials and methods

Study design Descriptive type cross sectional study. Place of study Department of Microbiology, Mymensingh Medical College, Mymensingh. Period of study The study was carried out form july 2010 to June 2011. Study population All clinical isolates of Gram negative bacilli, from urine, pus and wound swab from the in patients of Gynae, Surgery, Medicine and Orthopedics ward and from community. Sample size Three hundreds (300). Data collection By a predesigned data sheet. Sampling technique Non probability purposive type of sampling. Data analysis Data were analyzed by using computer based programmed excel and statistical package for social science (SPSS) version 16.0.

Sample size determination= Z2 pq n = -------------d2 n = Desired sample size, p= Prevalence of the disease / problem in community, q= (1-p), d= Degree of accuracy (it is .05), z= Confidence interval (usually we take 95% CI, in which z= 1.96), n = (1.96) 2 0.47 0.53 (0.05)2 = 3.840.47 0.53 0.0025 = 0.956 0.0025 = 382

Collection of urine sample Patients included in the study were given a sterile, dry, test tube and request for 10-20 ml specimen. The first urine passed by the patient at the beginning of the day was collected for examination (clean catch, mid stream). The female patients were advised to clean the area around the urethral opening with clean water, dry the area and collect the urine with the labia apart .The male patients were advised to wash the hands before collecting the specimen (Cheesbrough 2006). Collection of skin wound A sterile technique was applied to aspirate or collect pus or wound swab from abscess or wound infection, either by disposable syringe or by sterile swab stick. Specimen was collected in a sterile test tube plugged with cotton, before an antiseptic dressing is applied. Special care was taken to avoid contamination with commensal organisms from the skin (Cheesbrough 2006).

Inoculation of samples All samples were routinely cultured on MacConkey and blood agar plates. These plates were routinely incubated at 370C aerobically and after overnight incubation, they were checked for bacterial growth. The organisms were identified by their colony morphology, staining characters, pigment production, motility and other relevant biochemical tests as per standard laboratory methods of identification. Isolation and identification of organisms Suspected Gram negative organisms were identified by colony characteristics, motility, oxidase reaction, citrate utilization, indole and gas production and sugar fermentation reactions .Triple sugar iron agar was used for H2S production, sugar fermentation. Grams staining A drop of normal saline was taken on the centre of a clear glass slide and a colony was taken by a sterilized inoculating loop to make a thinemulsion. A very thin film was prepared by spreading the emulsion uniformly. This film was fixed by passing it over the flame for two or three times. Smear was covered with crystal violet stain for 30 -60 seconds. Then stain was washed with distilled water and cover with Lugols iodine for 30-60- seconds. Again stain was washed with distilled water and decolourize with acetone alcohol and washed with distilled water .The back of the slide was wiped and placed it in a draining rack, for the smear to air dry .Test specimen was examined and compared with positive and negative control under microscope (Cheesbrough 2006).

Spot Oxidase test (Cytochrome oxidase) This test was used to identify the organisms, which produce the enzyme oxidase. A strip of filter paper was impregnated with 1% w/v aqueous tetra methyl p-phenylene diamin dihydrochloride solution. A speck of culture from the primary plate was immediately rubbed on it with a sterile toothpick. A positive reaction indicates by a deep purple blue within 5-10 seconds (Baily and Scott 2006). Motility test Motility test medium was used to test the motility of the bacteria. Semisolid media (0.5%) was used for this purpose. The organism was inoculated by stabbing a

straight wire carrying the inoculums once vertically into the center of the agar butt. After overnight incubation, motility was shown by a spreading turbidity from the stab line or turbidity through out the medium (Baily and Scott 2006). Citrate utilization test Simons citrate agar media was used for differentiating the intestinal bacteria and other micro organisms on the basis of citrate utilization. Very light inoculums were picked with a straight wire and the organism was inoculated to the surface of Simons citrate agar slant. Citrate utilization is followed by alkaline reaction e.g., change of color from light green to blue (Baily and Scott 2006). Test for indole production Indole production was tested for some bacteria, which has the ability to degrade tryptophan to indole. Indole production was detected by Kovacs reagent (4-dimethyl amino benzaldehyde, isoamyl alcohol, hydrochloric acid). The test organism was cultured in peptone broth which contains tryptophan. This broth was inoculated at 350C for overnight and Kovacs reagent was added. Development of red colour ring

over the surface in the broth within 10 minutes indicates positive test (Cheesbrough 2006). Triple sugar iron agar (TSI) This media was used for initial identification of Gram negative bacilli, particularly members of enterobacteriaceae. Three primary characteristics of a bacterium was detected by this media, include ability to ferment carbohydrate (lactose, sucrose, glucose,), ability to produce gas, and the production of hydrogen sulfide gas. To inoculate a slope and butt medium, a small amount of growth from a pure culture colony was picked onto a straight wire and inoculated to this media by stabbing the butt and streaking the surface of the slant slope in a zigzag pattern of the tube all the way to the bottom. This tube was incubated at 350 C for over night to observe the colour change of the slant and butt for differentiation of enterobacteriaceae (Baily and Scott 2010) as mentioned in the appendix (Appendix - VII). Maintenance and preservation of culture strains Organisms grown in appropriate media for 18 hours were preserved in a nutrient agar slant at 2-80 C in a refrigerator and this culture was used within two weeks for routine laboratory works. For long term preservation, strains were stored in brain heart infusion broth with 20% glycerol and stored frozen without significant loss of viability at -200 C until further study (Cheesbrough 2006). Antimicrobial susceptibility test done by modified Kirby-Bauer sensitivity testing method Inoculation of isolated bacteria and placement of discs Modified Kirby-Bauer sensitivity testing method was used for this purpose. Muller Hinton agar media was used, which has PH 7.2-7.4. Media was transfer in to 90 mm diameter sterile Petri dishes to a depth of 4 (four) mm. The surface was lightly and

uniformly inoculated by cotton swab in three directions rotating the plate approximately 600, to ensure even distribution. Prior to inoculation, the swab stick was dipped into bacterial suspension having visually equivalent turbidity to 0.5 McFarland standards (Appendix-XIV). The swab stick was then took out and squeezed on the wall of the test tube to discard extra suspension. Inoculated plates were incubated at 37 0C for 24 hours. On the next day, plates were read by taking measurement of zone of inhibition. Antimicrobial discs used for Gram negative bacteria were Ampicillin (10 g), Amoxycillin-clavulanic acid (20/10 g), Piperacillin (100 g), Cephotaxime (30 g), Ceftriaxone (30 g), Ceftazidime (30 g), Gentamicin (10 g), Amikacin (30 g), Netilmicin (30 g), Tetracycline (30 g), Ciprofloxacin (5 g), Chloramphenicol (30g), Imipenem (10 g) and Azythromycin (30 gm). Antimicrobial disks used for Pseudomonas spp.were Amoxycillin-

clavulanic acid (20/10 g), Piperacillin (100 g), Cephotaxime (30 g), Ceftriaxone (30 g), Ceftazidime (30 g), Gentamicin (10 g), Amikacin (30 g), Netilmicin (30 g), Tetracycline (30 g), Ciprofloxacin (5 g), Chloramphenicol (30g), Imipenem (10 g) and Azythromycin (30 gm) (CLSI 2010). Screening test for ESBLs Isolates were screened for ESBL production by using disc Diffusion of cefotaxime (CTX), ceftazidime (CAZ), ceftriaxone (CRX) and Aztreonam(AZM) placed on inoculated plates containing Muller Hinton agar according to the CLSI recommendations. Isolates showing inhibition zone size of 22 mm with ceftazidime (30g), 25 mm with ceftriaxone (30g), 27 mm with cefotaxime (30g) , 27 mm with Aztreonam (30 g) were suspected for ESBL production. But both the strains

were resistant as well as sensitive to 3GCs were included. E. coli ATCC 25922 was used as a negative control (Appendix-XII) Confirmatory test for ESBLs Phenotypic confirmatory test for ESBL producers were done by double disc diffusion test (DDDT) and MIC reduction methods, for all the ESBL producing isolates as per CLSI 2010 guidelines as well as initially sensitive to 3GCs (Tenover et al. 1999; Paterson and Yu 1999). Double disk diffusion method (DDDT) In this test a disc of ceftazidime (30g), cefotaxime (30g) alone and a disc of ceftazidime and cefotaxime in combination with clavulanic acid (30/10g) were used for each isolates. Both the discs were placed 25 mm apart, centre to center, on a lawn culture of the test isolate on Muller Hinton agar plate and incubated overnight at 370 C. A 5 mm increase in zone diameter for either antimicrobial agent tested in combination with clavulinic acid versus its zone when tested alone was designated as ESBL positive. (Figure-)

Fig. 15. Showing double disc diffusion test

Interpretation: When there is an increase of 5 mm in inhibition zone diameter around combination disk of Ceftazidime + Clavulanic acid versus the inhibition zone diameter around Ceftazidime disk alone, it confirms ESBL production.

MIC reduction test All the isolates were further confirmed for ESBL production by this test. For ceftazidime a break point of MIC, 16 g/ml was taken ESBL positive. (AppendixXII).

Determination of MIC by Agar plate dilution method Agar plate dilution test was used to determine the minimal inhibitory concentration (MIC) of an antimicrobial agent required for inhibiting or killing a microorganism. Preparation of antimicrobial agents Ceftazidime was dissolved in distilled water and then added to melted agar. The different antibiotic concentration (l/ml) was used in the MIC. The concentration of stock solution of antibiotics was 50 mg/ml and stored at -200C. MIC range was followed according to the CLSI guidelines (CLSI, 2010). Preparation of plates 100 ml Muller-Hinton medium of each flask was autoclaved and allowed to cool at 500C in water bath. Then different concentration of antibiotic solution was added to each flask, mixed thoroughly and antibiotic-containing media was poured immediately on the plate. Two fold (Log2) serial dilutions of the antimicrobials were added with agar medium. The concentration of the ceftazidime in different plates was 32 g/ml, 16 g/ml, 8 g/ml used in different plates. Plates were stored at 40C in plastic bag and use within one week of preparation. Before inoculation, plates were

dried. Control plates of Muller-Hinton agar containing no antimicrobial agent was also prepared to ensure the effectiveness of the medium in sustaining the growth of organism. Turbidity Standard for MIC inoculum preparation To standardize the inoculum density for a susceptibility test, a 0.5 McFarland standard was prepared as described in CLSI 2010. Inoculation and Incubation of the medium Agar surface of the plates containing different concentration of ceftazidime and the control plate contained no antimicrobial agents were spot inoculated with a digital micropipette. A volume of 2 l suspension of the 104 CFU/ml organisms was spot inoculated. Inoculation was done from the plate containing lowest concentration of antimicrobial and the control plate was inoculated lastly. At least 30 different strains were tested at a time in each plate. Inoculated agar plates was allowed to stand until the inoculums spot was completely absorbed and afterwards it was incubated at 350C for overnight. Control strains E. coli ATCC 25922 was used in each plate. Interpretation of results The MIC represents the concentration of antimicrobial at which there is complete inhibition of growth. In reading the end points, a barely visible haze of growth or a single colony is disregarded. The results were interpreted according to the recommendation chart CLSI 2010 (Appendix -XII) as resistant (R) and Susceptibility (S) .

Genotypic detection Multiplex PCR for detecting TEM, SHV and CTX-M genes: Steps: A) DNA extraction from colony. B) DNA amplification in thermal cycler. C) Gel electrophoresis and Visualization under UV lights by transilluminator. A) DNA extraction from colony was done by alkaline lysis method A single colony of each organism was inoculated from MacConkey agar into 5ml of Luria-Bertanii broth (LB) and incubated for 20 h at 37 C. Cells from 1.5ml of the overnight culture was harvested by centrifugation at 12,000 rpm for 5 min. 1.5 ml from LB media containing cells was taken appendrof tube, than 100 l TNE buffer was mixed. The mixture was centrifuged for 1 min at 10000 rpm and supernatant was discarded. Again 100 l NaOH (50 mM) was added to pellet. After heating at 400C in water bath for 1 min, 60 l of IM Tris HCl (PH 6.7) was added. Vortex, centrifuge at 10000 rpm for1 min was done. Then supernatant was used as template (1l) (Medici et al. 2003 with some modification). B) DNA amplification in thermal cycler PCR analysis for beta lactamase genes of the family TEM, SHV, CTX-M and CTXM-3, CTX-M-14, were carried out. Primers obtained from Japan used for TEM, SHV and CTX-M was kindly supplied by Prof. Nobumichi Kobayashi.

Primer used for TEM, SHV, CTX-M-U, CTX-M-3, CTX-M-14 were Target gene TEM Primers TEM F TEM R SHV SHV F SHV R CTX-M-U CTX-MU1 CTX-MU2 CTX-M-3 CTX-M-3 F CTX-M-3 R CTX-M-14 CTX-M 14 F CTX-M 14 R AATCACTGCGCCAGTTCACGCT GAACGTTTCGTCTCCCAGCTGT TACCGCAGATAATACGCAGGTG CAGCGTAGGTTCAGTGCGATCC 355 bp 479 bp (5_-ATGTGCAGYACCAGTAARGT) (5_TGGGTRAARTARGTSACCAGA) 593 bp TCAGCGAAAAACACCTTG TCCCGCAGATAAATCACC 471 bp Sequences CTTCCTGTTTTTGCTCACCCA TACGATACGGGAGGGCTTAC Amplicon size 717 bp

Preparation of reaction mixture For PCR amplification, 1 l of template DNA was added to 50 l of master mixture containing 4 l of Dntp mixture (2.5mM of each) , 10X PCR buffer 5 l (Ex Taq),0.5 l of Taq polymerase (250 U) , 1 l of each primer stock solution (50pmol/ l), and remaining 38.5 l volume was fulfilled by neuclease free water (Takara Japan).

Amplification
The prepared PCR tubes with master mixture were placed in the eppendrof thermal cycler. Amplification was carried out according to the following thermal and cycling condition: For TEM, SHV gene Initial denaturation at 940C for 3 minute

Denaturation at 940C for Annealing at 500C for Extension at 720C for

30 sec 30sec 2 min 10 minutes 35 cycles

Final extension at 720C for For CTX-M gene Initial denaturation at 940C for

7 minute

Denaturation at 940C for Annealing at 500C for Extension at 720C for

50 sec 40sec 1 min 5 minutes 30 cycles

Final extension at 720C for

C) Gel electrophoresis and Visualization under UV lights by transilluminator Agarose gel electrophoresis The PCR products were analyzed after electrophoresis in 1.0% agarose gel to detect specific amplified product by comparing with standard molecular weight marker.

Preparation of agarose gel One percent agarose gel was prepared by melting 2.0 gm agarose in 200 ml of diluted TBE Buffer using a microwave woven. The melted agarose was allowed to cool to about 50C and 20 l ethidium bromide was mixed and shacked and was poured into gel tray and combs were placed. After solidification of the gel, the comb was removed. During electrophoresis, the gel was placed in a Horizontal electrophoresis apparatus containing TBE buffer and ethidium bromide. Loading and electrophoresis of the sample Five l of amplified PCR product was mixed with 2.0 l of loading buffer. The mixture was slowly loaded into the well using disposable micropipette tips. Hundred bp molecular weight marker was loaded in one well to determine the size of the amplified PCR products. Electrophoresis was carried out at 100 volts for 35 minutes . Visualization of the gel The amplified products of the study samples were visualized by trans-illuminator. And the gel was photographed by a digital camera and transferred data to computer for further documentation ((Sharma et al. 2010; Lal et al. 2007; Pagani et al. 2003).

RESULTS
During the one year period, a total of 300 Gram negative isolates from various clinical specimens were included in the study. The isolated organisms were characterized for their antibiogram, MIC, production of ESBLs and presence of TEM, SHV, and CTXM genes and different clusters of CTX-M -lactamases. The distribution of various specimens are given in Table -I. The specimens were urine 216 (72%), wound swab 45 (15 %), pus 39 (13%). Table -I Distribution of sample from various specimens

Type of specimen Urine Wound swab Pus Total

Total no 216 (72) 45 (15) 39 (13) 300 (100)

Note: Figures in parentheses represent percentage

Out of 300 Gram negative isolates in this study majority were Esch. coli 156 (52%), followed by Proteus spp. 55 (18.3%), Klebsiella spp. 45 (15%), Pseudomonas spp. 9 (3%) and others (Enterobacter spp., Citrobacter spp.) 35 (11.7%). (Table -II). Table II Detection rate of different isolates in the study population

Name of the organisms Esch. coli Proteus spp. Klebsiella spp. Pseudomonas spp. *Others Total

Total No 156 55 45 9 35 300

Percent 52.0 18.3 15.0 3.0 11.7 100.0

* Others - Enterobacter spp., Citrobacter spp

Table-III Showed pattern of organisms isolated from the community and hospital. Klebsiella spp. (62%), was found to be the most prevalent organisms isolated from the community followed by, Esch. coli 57% Proteus spp. 45%, Pseudomonas spp 44.4%. On the other hand Proteus spp. 54.5% was found to be the most prevalent organisms isolated from the community followed by Esch. coli 42.9%, Klebsiella spp. 37.7%, Pseudomonas spp (5/9, 55.5%).Pseudomonas spp were found to be the least prevalent isolates. Table- III Pattern of organisms isolated from the community and hospital No. of clinical Name of the No. of total isolates organisms community Esch. coli Klebsiella spp Proteus Pseudomonas 9 (3.0) spp *Others 35 (11.7) 300 (100) 22 (62.85) 168 (56) 13 (37.1) 132 (44) 4 (44.4) 5 (55.5) 156 (52) 45 (15) 55 (18.3) 89 (57) 28 (62) 25 (45.4) hospital 67 (42.9) 17 (37.7) 30 (54.5) isolated from isolated from No. of clinical

Note: Figures in parentheses represent percentage * Others - Enterobacter spp., Citrobacter spp

Table IV Showed distribution of Esch.coli, Klebsiella spp. Proteus spp. Pseudomonas spp. found from different clinical specimens both from community and hospital. Detection of Esch.coli, 63.6% is more from hospital acquired isolates from pus; Klebsiella spp. 18.1% from urine sample from community, Proteus spp. 29.4% was most prevalent in urine both from community and hospital.

Table-IV showed distribution of E.coli, Klebsiella spp, Proteus spp and Pseudomonas spp. in different specimens both from hospital and community

Type of specimen Community Hospital 10 (58.8) Pus n= 17/22 14 (63.6) 3 (13.6) Esch.coli Klebsiell spp. 1 (5.8)

Isolated organism Proteus spp. 5 (29.4) 5 (22.7) Pseudomon as spp 1 (5.8) 0 (0) 3 (2.01) 0 (0) 0 (0) 5 (11.6) 9 0 (0) 0 (0) 22 (14.7) 5 (7.5) 0 (0) 8 (18.6) 35 Others

79 (53.0) 27 (18.1) 18 (12.0) Urine n=149/67 39 (58.2) Wound swab, n=2/43 Total, n=300 0 (0) 14 (32.5) 156 9 (13.4) 0 (0) 5 (11.6) 45 14 (20.8) 2 (100) 11 (25.6) 55

Note: Figures in parentheses represent percentage * Others - Enterobacter spp., Citrobacter spp C Community, H Hospital.

Table V Showed antimicrobial resistance pattern of both hospital and community acquired isolates. Aztreonam, Ampicillin, Amoxyclave and Piperacillin were more resistant. Among them in Klebsiella spp. was more resistant than Esch. coli. All the isolated organism in this study were 100% sensitive to Imepenem and 98% sensitive to Nitrofurantoin.

Table V Antibiotic resistance pattern of Esch.coli and Klebsiella spp. isolated from community hospital and community by disc diffusion method Antimicrobials Hospital isolates n=67 Aztreonam Piperacillin Amoxiclave Ampicillin Ceftriaxone Ciprofloxacin Cefotaxime Ceftazidime Azethromicine Gentamicin Amikacin Nitrofurantoin Imipenem 67 (100) 62 (92.5) 63 (94.0) 64 (95.5) 57 (85.0) 56 (83.5) 53 (79.1) 41 (61.1) 54 (80.5) 39 (58.2) 12 (17.9) 2 (2.9) 0 (0) Esch. coli Community isolates n=89 89 (100) 85 (95.5) 83 (93.2) 80 (89.8) 70 (78.6) 64 (71.9) 63 (70.7) 63 (70.7) 52 (58.4) 42 (47.1) 11 (16.4) 3 (3.3) 0 (0) Klebsiella spp. Hospital isolates n=17 17 (100) 15 (88.3) 16 (94.1) 16 (94.1) 15 (88.2) 15 (88.2) 14 (82.3) 14 (82.3) 14 (82.3) 11 (64.7) 3 (17.6) 1 (5.8) 0 (0) Community isolates n=28 28 (100) 27 (96.4) 26 (92.8) 25 (89.2) 23 (82.1) 22 (78.5) 22 (78.5) 22 (78.5) 16 (57.1) 17 (60.7) 6 (21.4) 1 (3.6) 0 (0)

Note: Figures in parentheses represent percentage

Table V I Showed prevalence of ESBL producing isolates from different clinical specimen by double disc diffusion test (DDDT). Among them Klebsiella spp. were

the leading bacteria 36/45 (80 %), followed by Proteus spp. 40/55 (72.7%), Esch. coli 105/156 (67.3 %) and others 25/35 (71.4 %). Table VI Rate of detection of ESBL production by DDDT from different organisms

Name of organism

Total

ESBL positive (%)

Klebsiella spp

45

36 (80)

Proteus spp E.coli Pseudomonas spp others * Total

55 156 9 35 300

40 (72.7) 105 (67.3) 8 (88.8) 25 (71.4) 214 (71.3)

Note: Figures in parentheses represent percentage * Others - Enterobacter spp., Citrobacter spp

Table VII Showed ESBL producing isolates distributed in hospital and community. Rate of ESBL production among Klebsiella spp. and Esch. coli is more in community

than hospital, it was 63.8 % and 60.9 % respectively. But in case of Proteus spp.52.5 %, it was more in hospital isolates. Table -VII Pattern of distribution of ESBL producing isolates in hospital and community Isolated organism Klebsiella spp. n=36 Proteus spp. n= 40 Esch. coli n=105 Pseudomonas spp. n=8 *Others n=25 Total 9 (36) 89 (41.6) 16 (64) 125 (58.4) 5 (62.5) 3 (37.5) 41 (39.0) 64 (60.9) 21 (52.5) 19 (47.5) Rate of ESBL positive isolates in hospital 13 (36.1) Rate of ESBL positive isolates in community 23 (63.8)

Note: Figures in parentheses represent percentage Others - Enterobacter spp., Citrobacter spp n= Number.

Table VIII Showed the overall isolation rate of ESBL positive Klebsiella spp., Proteus spp., E.coli, from different clinical specimen was 80%, 72.7% and 67.3%

respectively. Of them detection rate of ESBL production among E.coli and Proteus spp. were highest in urine sample were 80%, 81.1% respectively. But in case of Klebsiella spp. ESBL production was higher in pus 80.5%. Table VIII Rate of isolation of ESBL positive Esch.coli, Klebsiella spp. Proteus spp.from different clinical specimen

Rate of ESBL Type of specimen positive Esch. coli

Rate of ESBL positive Klebsiella spp.

Rate of ESBL positive Proteus spp. 26 (81.2) 8 (25.0) 6 (46.1) 32 (72.7)

Urine, n=180 Pus, n=28 Wound swab, n=14 total,n=156

84 (80.0) 16 (66.6) 5 (35.7) 105 (67.3)

29 (80.5) 4 (100) 3 (60.0) 36 (80.0)

Note: Figures in parentheses represent percentage Others - Enterobacter spp., Citrobacter spp n= Number

Table IX Showed antimicrobial resistance pattern in hospital and community among ESBL producers. All the antibiotics used were more resistant in hospital acquired ESBL producers. Among them Ampicillin, Aztreonam, Amoxyclave were more

resistant, on the other hand Amikacin, are 16.7%, 20% resistant in hospital and community respectively more sensitive and Imepenem are 100% sensitive. Table IX Antimicrobial resistant pattern in hospital and community acquired ESBL positive strain Name of antimicrobials Aztreonam Ampicillin Amoxiclave Piperacillin Ceftazidime Ceftriaxone Cefotaxime Ciprofloxacin Azethromicine Gentamicin Amikacin Nitrofurantoin Imipenem Rate of resistance to ESBL positive in hospital n=89 89 (100) 88 (98.9) 88 (98.9) 86 (96.6) 84 (94.4) 82 (92.1) 75 (84.3) 67 (75.29) 60 (67.4) 43 (48.4) 15 (16.7) 1 (1.1) 0(00) Rate of resistance to ESBL positive in community n=125 125 (100) 125 (100) 124 (99.2) 120 (96 ) 108 (86.4) 93 (74.4) 107 (85.6) 87 (69.44) 102 (81.8) 48 (38.7) 25 (20) 1 (0.8) 0(00)

Note: Figures in parentheses represent percentage Table X Showed phenotypic confirmation of ESBL positive bacteria by DDDT using tow combinations, ceftazidime alone and with the combination of clavulinic acid (CAZ/CAZC) and cefotaxime alone and with the combination of clavulinic acid (CTX/CTXC). Most of the bacteria showed ESBL positive by both combination

(CAZ/CAZC, and CTX/CTXC). Esch.coli and Klebsiella spp showed maximum ESBLs production in CAZ/CAZC combination. Both the CAZ/CAZC and CTX/CTXC methods were statistically significant Table X Detection of ESBL by Double Disc Diffusion test as confirmatory test Name of organism Esch. coli n=105 Klebsiella spp. n=36 Proteus spp. n=40 Pseudomonas spp. n=8 *Others n=25 Total n = 214 CAZ/CAZC 23 (21.5) 5 (13.8) 5 (12.5) 1 (12.5) 4 (16.0) 38 (17.7) CTX/CTXC 13 (12.3) 3 (8.3) 2 (5.0) 1 (12.5) 2 (8.0) 21 (9.8) Both 69 (65.7) 28 (77.7) 33 (82.5) 6 (75.0) 19 (76.0) 155 (72.4)

Table X (a) Cross tabulation between CAZ/CAZC and CTX/CTXC of ESBL detection CAZ/CAZC ESBL positive ESBL negative Total n = 300 193 21 214 Combined 155 59 214

x2 value 22.1 at df 3, p <0.001, highly significant

CTX/CTXC ESBL positive ESBL negative Total n = 300 176 38 214

Combined 155 59 214

x2 value 5.8 at df 3, p <0.01, highly significant Note: Figures in parentheses represent percentage *Others - Enterobacter spp., Citrobacter spp n= Number Table XI Showed comparison of ESBL production among 3GCs sensitive and resistant isolates. Out of 64 sensitive to 3GCs, 35 (54.6 %) were ESBL positive, on the other hand 236 resistant to 3GCs, 179 (75.8%) were ESBL positive. Table XI Pattern of ESBL production among 3GCs sensitive and resisatant isolates

ESBL positive Sensitive to 3GCs Resistance to 3GCs Total 300 35 (54.6) 179 (75.8) 214 (71.3)

ESBL negative 29 (45.3) 57 (24.1) 86 (28.7)

x2 value 11.02 at df 3, p <0.001, highly significant

Note: Figures in parentheses represent percentage

Table XII Showed ESBLs positive by phenotypic and genotypic method by different isolates .ESBLs production rate by Klebsiella spp (80%) were more in phenotypic method and Esch.coli 84.3% were more in genotypic method. Table XII Rate of ESBL positive by phenotypic and genotypic method

Name of isolates

Rate of detection of ESBL by phenotypic method

Rate of production of ESBL by specific gene amplification 43/51 (84.3) 18/23 (78.2) 15/17 (88.2) 4/5 (80.0) 9/11 (81.8) 89/107 (83.1)

Esch. coli Klebsiella spp. Proteus spp Pseudomonas spp *Others Total

105/156 (67.0) 36/45 (80.0) 40/55 (72.7) 8/9 (88.0 ) 25/35 (71.4) 214/300 (71.3 )

Note: Figures in parentheses represent percentage *Others - Enterobacter spp., Citrobacter spp

Table XIII Showed distribution of ESBLs gene in different isolates, among them Esch.coli carry more TEM, CTX-M genes, E.coli, Klebsiella spp and Proteus spp contain more than one gene were 17, 8, and 6 respectively. Rate of TEM, SHV and CTX-M genes present in study population were 50.46%, 18.69% and 46.72% respectively. Table XIII Pattern of distribution of TEM, SHV and CTX-M genes among phenotypic confirmed ESBL producers

Name of gene, No. Percentage (%)

Single

*Combined

TEM n=54

50.46

19

SHV n=20

18.69

31

CTX-M n=50

46.72

20

** SHV, CTX-M gene =5 TEM, CTX-M gene =14 TEM, SHV, CTX-M =8

Table XIV Showed CTX-M-3 and CTX-M-14 were 78.0 % (39/50) and 80.0 % (40/50) respectively. Table XIV Pattern of CTX-M-3, CTX-M-14 distribution in different isolates

Isolates E.coli Klebsiella spp. Proteus spp. Pseudomonas spp. Others Total

Group -1 (CTX-M-3) 27 (54) 9 (18.0) 01 (2.0) 01 (2.0)

Group -9 (CTX-M-14) 28 (56.0) 9 (18.0) 01 (2.0) 01 (2.0)

1 (2.0) 39 (78.0)

1 (2.0) 40 (80.0)

Table XV Showed rate of presence of ESBLs genes among the hospital and community acquired isolates. TEM and SHV genes were more in community acquired isolates 70.3% and 70.0%. On the other hand CTX-M gene was more in hospital acquired isolates.

Table XV Pattern of TEM, SHV and CTX-M gene distribution among hospital and community Name of gene Rate of gene present in hospital TEM n=54 SHV n=20 CTX-M n=56 16 (29.6) 6 (30.0) 32 (57.1) Rate of gene present in community 38 (70.3) 14 (70.0) 24 (42.8)

Note: Figures in parentheses represent percentage n= Number

DISCUSSION
Now a days antibiotics have been used extensively and newer antibiotics are continuously being added for the treatment of various infections. An extensive use of -lactam antibiotics in hospital and community has created a major problem leading to increased morbidity, mortality and health care costs. Proper use of antibiotics is very important for various reasons. Development of bacterial resistance against newer antibiotics makes the main focus of research. In the present study, a total of 300 Gram negative strains were isolated from various clinical specimens of which majority of the organisms were isolated from urine 72% (216/300) followed by wound swab 15% (45/300), pus 13% (39/300) (Table -1). Among the isolated organisms Esch. coli was the most prevalent 52% (156/300), followed by Proteus spp. 18.3% (55/300), Klebsiella spp. 15% (45/300) and Pseudomonas spp. 3% (9/300) (Table -II). Irrespective of specimens among the identified bacteria Klebsiella spp. 62% (28/45) was the leading bacteria from the community acquired isolates, followed by Esch.coli 57% (89/156), Proteus spp. 45.5% (25/55) and Pseudomonas spp. 44.4% (4/9) (Table III). In (table III) Klebsiella spp. now also found in community acquired isolates more than hospital which indicate that hospital strains circulate in the community. In the present study isolation of Esch.coli was 55.6% and 61.2% from both urine and pus respectively, (Table - IV) which are in aggrement with findings done by Haque et al. (2009) and Parveen et al. (2009) in the same institute. In India (2005) Marcus and associates found the same figure. In Bangladesh, it has been reported that 65-92% of commensal Enterobacteriaceae and other organisms isolated from urine is resistant to commonly used antibiotics like

ampicillin, tetracycline, co-trimoxazole etc (Chowdhury et al. 1994). Now a days organism encoding multiple antibiotic resistance genes are becoming increasingly prevalent (Perez et al.2007). In this study aztreonam, ampicillin, amoxyclauve were found 95-100% resistant (Table -V), this is in agreement with other studies (Sasirekha et al. 2010; Ullah et al. 2009). Cephalosporins specially third generation have been used for Gram negative bacterial treatment (Samaha-Kfoury et al. 2003). In the present study ceftriaxone, ceftazidime and cefotaxime were found 85%, 61%, 79% from hospital acquired and 78.6%, 70.7%, 70.7% resistant among community acquired E.coli respectively (Table V). It correlates with the study done by Sasirekha et al. (2010) and Singh and Goyal (2003) in India where they found 84% resistance to cefotaxime and 75%, 85% resistant for ceftriaxone and ceftazidime respectively. Klebsiella spp. were found resistant to ceftriaxone, ceftazidime and cefotaxime in 88.2%, 82.3%, and 82.3% in hospital acquired isolates and 82.3%, 78.5%, 75.5% in community acquired isolates respectively (Table -V). Hospital acquired isolates were more resistant than the community acquired isolates, it may be due to lack of antibiotic policy, irrational use of 3GCs mainly ceftriaxone in the hospital (Shova 2007) and the emergence of antibiotic-resistant organisms in hospitals in concert with the use of high levels of antibiotics use caused the emergence of resistant organisms and they might be inherently more virulent than the organisms are sensitive (CDC 2002). It was also noted that Klebsiella spp were more resistant than Esch. coli which may be due to Klebsiella spp. have some virulence factor like hyperviscosity, polysaccharide capsule and production of endotoxine, carbapenemases, which make it more resistant (Highsmith and Jarvis1985; Lin et al. 2011). Thomson and associates found Klebsiella spp. was more resistance to cefotaxime and ceftazidime (Thomson

1991).This indicate over use and irrational use of 3GCs give the world brand new resistant bacteria that can produce many other drug resistance enzymes. In this study observed resistance to ciprofloxacin was 78% and 88% for Esch.coli and Klebsiella spp. (Table-V) respectively. These findings were in accordance with the study by Haque and Salam (2010) from Bangladesh and it was 90.9%. Another study by Sasirekha from India where they found 68% resistant to ciprofloxacin. Aminoglycosides have good activity against clinically important gram negative bacilli (Gonzalez and Spencer 1998). In the present study 82.1% isolates were susceptible to amikacin, followed by 41.8% to gentamicin, it was similar to Sasirekha et al. (2010). Several studies showed that amikacin was more sensitive than gentamicin but if it is over used than it may also become resistant. In 2010 gentamicin was 59% resistant in India and 55.5% in Bangladesh (Haque and Salam 2010; Sasirekha et al. 2010; Ullah et al. 2009). These variations may be due to increased use of gentamicin, caused by selection pressure of aminoglycosides in different region (Miller and Sabatelli 1997). Carbapenems are the drugs of choice for many infections caused by Gram positive and Gram negative bacteria (Ullah et al. 2009). In this study imipenem was 100% sensitive (Table V and Table VIII). These findings were similar to study done by Haque and Salam in (2010) but one study showed 3.1% resistant to imipenem in Bangladesh (Rashid et al. 2007). Amikacin was the second most common sensitive drug after imipenem. So, these drug resistance organisms have limited theraputic options and necessitated the increased use of carbapenems. But very recently new beta lactamases are developed e.g., K. pneumoniae carbapenemase (KPC) which is resistant to imipenem and has been spread world wide (Rhee et al. 2010). So there is

very limited options to treat imipenem resistant strains and colistin may be the drug of choice (Amaya et al. 2009), though it has many side effect. ESBLs are the product of the over use of third generation cephalosporins (Paterson and Yu 1999). It is difficult to make valid comparison of the prevalence of ESBLs, because of variations in study design (Friedman et al. 2005). In Bangladesh (2004) ESBL was found in 43.2% and 39.5% isolates of Esch.coli and Klebsiella spp. respectively (Rahman 2004). Another study from Bangladesh (2010) showed 57.89% ESBL production for Klebsiella spp. followed by Proteus spp. 50.0%, Esch. coli 47.83% and pseudomonas spp 31.35% (Haque and Salam 2010). In the present study ESBLs prevalence was 71.3%, which was very similar to the study done by Sharma et al. (2010) in India who find 70% ESBLs rate. Few studies from Pakistan in 2005, it was 40% and two other studies in 2009 were 43% and 58.7% ESBLs producers (Ali 2009; Jabeen 2005; Ullah 2009). Studies from India reported as ESBL producers were 60.98%, 51.4% and 53.4% in 2004, 2007 and 2010 respectively (Babypadmini 2004; Shivaprakasha 2007; Sasirekha 2010). In Nigeria ESBL production rate was 66.7% (Yushau 2010). The frequency of ESBL producer in our study was 71.3% in general which was higher than the previous studies in Bangladesh, India and other countries. It may be due to steadily increasing the incidence of ESBL producing strains among the clinical isolates, also it indicate the possibility of treatment failure caused by resistant organisms (Chaudhary 2004; Haque and Salam 2010) .Two study (2010) in Iran and India ESBLs production rate were 96% and 97% respectively (Lal 2007; Naehi 2010). The studies done in Iran and India (2010) was higher than the present study and it may be due to fact that they consider only 3GCs resistant organisms, while we take some samples were sensitive to 3GCs sensitive (Sharma 2010; Naehi

2010). In the present study overall Klebsiella spp 80% (36/45) was the leading ESBL producers followed by Proteus spp 72.7% (40/55), Esch.coli 67.3% (105/156) and Pseudomonas spp 88.8% (8/9) (Table -VI), which correlates with studies done by Livrelli et al. (1996) and Lal et al. (2007) where they found Klebsiella spp. was the leading bacteria. The high occurrence of ESBLs in Klebsiella spp is of great concern since infections caused by this bacterium were very common and resistance of the organism may be due to the presence of capsule that gives some level of protection to the cells, presence of multidrug resistance efflux pump, they also spread easily, pathogenic and efficient at acquiring and disseminating resistance plasmid (Chaudhary and Aggarwal 2004; Gruteke 2003; Yushau 2010). In the present study most of the samples were collected from the community, Pseudomonas spp. is more in hospital acquired isolates (Sheryll et al. 2004) and sample size for Pseudomonas spp. was very small so, the occurrence of ESBLs observed among the Pseudomonas spp. 88.8% (8/9), might not reflected the actual picture. Originally ESBLs were most commonly reported to be a hospital based problem but it is now common among community acquired isolates, especially Esch. coli (Helfand and Bonomo 2005;Heffernan and Woodhouse 2006). In the present study Esch.coli and Klebsiella spp. were found 60.9% and 63.8% respectively in the community (Table-VIII), on the other hand Proteus spp. and Pseudomonas spp.were 52.5% and 62.5% in hospital respectively (Table-VIII). Denholm and associates found Esch.coli the most common community acquired isolates among the ESBLs (Denholm 2009). In the present study ESBL producing hospital acquired isolates were more resistance to third generation cephalosporins than community acquired isolates and it was from 84%-94% (Table-VIII), it was similar with the study done by Babypadmini and

Appalaraju (2004), who found 84% resistant, Sasirekha and associates (2010) found 75%-85%, Haque and Salam (2010) found 72%-100% resistant. This was due to irrational and wide use of third generation cephalosporins in both the hospital and community and is beleived to be the major cause of mutations in these enzymes that has lead to the emergence of the ESBLs (Chaudhury and Agrawal 2004). Aztreonam was found 100% resistant in this study, which correlates with the study done by Sasirekha et al. (2010). Most of the ESBL producing organisms were found to be co resistance to flouroquinolones, aminoglycosides and co-trimoxazole, which correlates with the study done by Denholm (2009) and Jabeen (2005). This was due to the genes encoding these -lactamases were often located on large plasmids that also encode genes for resistance to others antibiotics, including aminoglycosides, tetracycline, sulfonamides, trimethoprime and chloramphenicol (Perez et al. 2007). We found such associated resistance with gentamicin 48.7% and fluroquinolones 84.4%. In this study we used two combinations with clavulanic acid (CAZ/CAZC and CTX/CTXC) and found that E.coli and Klebsiella spp showed maximum ESBLs production in CAZ/CAZC combination, which correlates with other studies (Rahman 2004; Thomson 1991). Ceftazidime plus clavulinic acid (CAZ/CAZC) was the best single disc diffusion test was recommended by George et al. (2006). In the present study some samples were taken in accounts which were sensitive to 3GCs and subsequently showed positive for ESBLs production by DDDT 54.6% (35/64,). Failure to detect ESBL production by routine disc-diffusion tests has been well documented (Tenover 1999; Paterson 1999). Screening with 3GCs, with clavulinic acid more than one combination increased the rate of ESBL detection, but the combination of ceftazidime and cefotaxime still missed two strains producing the

SHV-5 and SHV-7 ESBLs (George et al. 2006). Use of only one combination may fail to detect ESBL positive strains and thus might cause low prevalence (Rahman et al. 2004). So, laboratory practitioner should do the ESBLs confirmatory test both from 3GCs sensitive and resistant strains. The use of Cefotaxime, Ceftazidime and Ceftriaxone as the only indicator of ESBLs screening can no longer be recommended. If only one indicator antibiotic would be used for screening, Cefpodoxime has proven to be the best molecule for screening all types ESBLs producers in clinical sample (Black et al. 2005). Occurrence and distribution of ESBLs differs from country to country and from hospital to hospital (Ali 2009). These types of discrepancies between susceptibility data and disc diffusion results have increased the need for an improved method of ESBL detection and incorporate it into routine susceptibility procedure. Since no previous data is available about the prevalence of genes responsible for ESBLs production in Bangladesh, it is assumed that this high rate of ESBLs by phenotypic method, may be due to mutation of first two parent gene TEM-1, SHV-1 and newer most prevalent gene CTX-M in the world (Peirano et al. 2010). CTX-M gene now the most coomon in Esch.coli in community and it may be due to overuse of ceftriaxone or due to faecal carriage and transfer gene by horizontal transmission (Cavaco et al. 2008; Ensor et al. 2006; Pitout and laupland 2008; Perez et al. 2007). In the present study, TEM, SHV and CTX-M genes were found in 50.5%, 18.7% and 46.72% from phenotypically confirmed ESBLs producers respectively (Table -XII). ESBLs belonging to the TEM (TEM-24, TEM-4, TEM-52), SHV (SHV-5, SHV-12) and CTX-M (CTX-M-9, CTX-M-3, CTX-M-14 or CTX-M-15) families are predominant in Europe (Coque et al. 2008).In India in 2006 CTX-M-15 was found

75%, out of them 73% of total Esch.coli and 72% of Klebsiella spp.( Ensor et al. 2006). In this study Esch.coli is more in genotypic method it may be due to we used three primers, which were most common in Esch. coli. Epidemiological study demonstrates that some enzymes are more frequently reported then others, but predominant enzyme type varies with country and that diverse CTX-M types often exist within a single country (Livermore and Woodford 2006). In Macao in 2010 TEM and CTX-M -9 gene were 100% and 87% respectively, which was much more than the present study (Yan-fang et al. 2011). In Iran, 2009 CTX-M, TEM and SHV was 24.5%, 18% and 7.5% respectively (Nasehi et al. 2010). In India (2007) both TEM and SHV, TEM, SHV were 67.3%, 20%, 804% respectively and (2010) it was 56%, 60% for TEM and SHV genes respectively from phenotypic confirmed ESBLs positive isolates (Lal et al. 2007; Sharma et al. 2010). CTX-M may be increased due to wide use of third generation cephalosporins, especially ceftriaxone and it is more resistant to cefotaxime. In this study among the 56 CTX-M genes present among them 47 were cefotaxime resistant and rest are ceftriaxone resistant. In the present study Esch. coli was 84.3% (43/51), because TEM, CTX-M is more common in Esch.coli (Table-XII), in Pseudomonas spp. it was 80%, it may be due to AmpC beta lactamases are more common in Pseudomonas spp. that primer was not used in this study. CTX-M was more prevalent that may be due to they represent examples of plasmid acquisition of beta lactamase gene from normally found chromosome of Kluyvera spp. a group of rarely pathogenic commonsal organism (Coque et al. 2008). In the present study CTX-M was found 46.72%, among them 57.1% (32/56) and 42.8% (24/56) were from hospital and community respectively (Table - XIV). Among 54 TEM gene, 26 were present in Esch.coli, 13 were in Klebsiella spp., 7 were in

proteus spp., 1 was in Pseudomonas and rest 7 were from others as a single gene, on the other hand TEM and CTX-M combine were 14 and TEM, SHV and CTX-M were 8. SHV was detected as a single gene in Klebsiella spp. Proteus spp and Pseudomonas spp. one in each. In the present study among the CTX-M positive Esch.coli 16.1% (9/56) were leading bacteria followed by Klebsiella spp. 7.1% (4/56) Proteus spp8.9% (5/56) and for Pseudomonas spp. was 3.6% (2/56). In the present study among 54 TEM gene, 26 were present in Esch.coli, 13 were in Klebsiella spp., 7 were in proteus spp., 1 was in Pseudomonas and rest 7 were from others as a single gene, on the other hand TEM and CTX-M combine were 14 and TEM,SHV and CTXM were 8. Klebsiella spp. Proteus spp and Pseudomonas spp. contain 3 SHV genes, one for each. Among the five groups of CTX-M gene (CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, CTX-M-25) group 1 includes CTX-M-1, CTX-M-3, CTX-M-15, CTX-M-22, CTXM-25 and others, group 9 includes CTX-M-13, CTX-M-14, CTX-M-16, CTX-M-18 and others (Pitout and Laupland 2008; Chanawong et al. 2002). As there was no previous genetic study in Bangladesh, we take some study from India. In India (2006) CTX-M-15 was 73% (Ensor 2006). In Pakistan 75% CTX-M was found and CTX-M 14 (group III) in Canada in 2005 was predominant wide outbreak (Pitout 2005; Mirja 2006). Again in China predominant CTX-M genes are similar to that seen in South America that is CTX-M-9, CTX-M-13, CTX-M-14 (Chanawang et al. 2002), it is also similar to Tawiwan in 2005 where SHV-12 and CTX-M -3, CTX-M-14 were 40.2%, 32.6% and 18.0% respectively (Chia 2005). CTX-M-15 producing Esch.coli are emerging world wide (Hawkey 2008). In Europe CTX-M become predominant among them group 9 (CTX-M-9 and CTX-M14) and group 1 (CTX-M-3 and CTX-M-

15) dominant (Liver et al. 2997). In India in 2011 TEM and CTX-M were predominantly found in E. coli (39.2%) while, among the Klebsiella spp., TEM, SHV and CTX-M occurred together in 42.6% of the isolates (Monoharan 2011). In the present study CTX-M-3 (like group 1) and CTX-M-14 (like group 9) were 78.0 % (39/50) and 80.0% (40/50) respectively, which correlates with other studies found in the world and India. The information found from this study would be helpful for formulation of an antibiotic policy for its rational use.

CONCLUSION AND RECOMMENDATIONS

Considering various findings of the present study, it can be concluded that Extended spectrum beta lactamases are gradually increasing in Bangladesh with co resistance to some other classes of antibiotics is very alarming. There was a limited number of drugs sensitivity for these bacteria only and drug of choice is imipenem, followed by amikacin in injectable form. But most probably in near future, if this irrational use is not stopped, infection with that Gram negative bacteria increase the rate of resistant to drugs that are now sensitive, resulting increase morbidity and mortality. This study shows that K. pneumoniae is essential for the prompt recognition of antimicrobialresistant organisms, as it is more resistant than Esch.coli. Infection-control practitioners and clinicians need the clinical laboratory to rapidly identify and characterise different types of resistant bacteria specially ESBLs efficiently to minimise the spread of these bacteria and help to select more appropriate antibiotics. It is very dangerous for laboratory practitionar that some amounts of ESBLs are present in 3GCs sensitive bacteria. So ESBLs must be detected by double disc diffusion test. The epidemiology of ESBL-producing bacteria is becoming more complex with increasingly blurred boundaries between hospitals and the community. Further studies are required to investigate MDR bacteria and ESBL from other parts of Bangladesh using more isolates. Studies of molecular epidemiology of these resistant genes can also be used for comparison with genes already isolated from other parts of the world.

Limitation Although utmost sincerity and dedication was investigated to carry out the study it could not go beyond limitations as the sample size was not large enough, moreover the genetic analysis of resistant bacteria could be done by other type of gene primer that could help finding the actual cause behind the emerging drug resistance, we could not do that due to lack of proper logistic support

REFERENCES
Adams-Haduch, JM, Potoski, BA, Sidjabat, HE, Paterson, DL, Doi, Y, 2009, Activity of Temocillin against KPC-Producing Klebsiella pneumoniae and Escherichia coli. Antimicrob Agents Chemother. Adeline, SY, TingCarol, HC, Tan and Aw, CS, 2009, Hydrocarbon-degradation by isolate Pseudomonas lundensis UTAR FPE2, Malaysian Journal of Microbiology; vol.5, no. 2, pp104-108. Agrawal, P, Ghosh, A, Kumar, S, Basu, B, Kapil, K, 2008, Prevalence of extended spectrum lactamases among E. coli and K. pneumoniae isolates in tertiary care hospital, Indian journal Pathology Microbiology, vol. 51, pp- 139-42. Aibinu, Ibukun, EA, Folake, RP, Kehinde, OA, Adesida, Solayide, AA, Mathew, OO,and Odugbemi, T, 2007, Multidrug Resistance in E .coli 0157 Strains and the Public Health Implication , Journal of American Science,vol. 3, no. 3. Akram, M, Shahid, M, 2007, Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in JNMC Hospital Aligarh, India. Ann. Clin. Microbiol. Antimicrob, vol.6, no. 4. Al- Charrakh, AH, Yousif, SY, and Al- Janabi, HS, 2011, Occurence and detection of Extended Spectrum -lactamases in Klebsiella isolates in Hilla, Iraq, African Journal of Biotechnology, vol. 10 no. 4, pp- 657-665. Al-Agamy, MH, Shible, AM, Tawfik, AF, 2009, Prevelance and molecular characterization of extended spectrum -lactamase- producing Klebsiella Pneumoniae in Riyadh, Saudi-Arabia, Annals of Saudi Medicine, vol. 29, no. 4, pp- 253-257.

Ali, AM, 2009, Frequency of Extended Spectrum Beta Lactamase (ESBL) Producing Nosocomial Isolates In A Tertiary Care Hospital In Rawalpindi, A journal of Army medical corps, 3 ISSN 0030-9648. Amaya, E, Caceres, M, Fang, H, Ramirez, AT, Palmgren, AC, Nord, CE, Weintraub,A, 2009, Extended spectrum beta lactamase-producing Klebsiella pneumoniae in a neonatal intensive care unit in Leon, Nicaragua, International Journal of Antimicrobial Agents, vol. 33, pp- 386-7. Ambler, RP, 1980, The structure of beta-lactamases, Philos Trans R Soc Lond B Biol Sci, vol. 16, no. 289, pp- 321-31. Anderson, MJ, Janoff, EN, 1998, Klebsiella endocarditis: report of two cases and review. Clinical Infectious Disease, vol. 26, no. 2, pp 468-74. Andrews, J, 2009, Dectection of extended spectrum lactamases (ESBLs) in E.coli and Klebsiella species, British society for antimicrobial chemotherapy BSAC, pp 674. Begum, S, Ahmed, I, Alam, F, Samsuzzaman, Hassan, P, Absar, N, Haq, JA, 2009, Isolation of a 29.5 kb plasmid confirring multiple drug resistance in Pseudomonas aerugnosa, J. bio-sci, vol. 17, pp- 95-100. Bell, JM, Chitsaz, M, Turnidge, JD, Barton, M, Walters, LJ, and Jones, RN, 2007, Prevalence and Significance of a Negative Extended-Spectrum -Lactamase (ESBL) Confirmation Test Result after a Positive ESBL Screening Test Result for Isolates of Escherichia coli and Klebsiella pneumoniae: Results from the SENTRY Asia-Pacific Surveillance Program, Journal of Clinical Microbiology, vol. 45, no. 5, pp-14781482 .

Black, JA, Thomson, KS, Buynak, JD, and Pitout, JD, 2005, Evaluation of lactamase inhibitors in disc tests for detection of plasmid-mediated AmpC lactamases in well characterized clinical strains of Klebsiella spp., Journal Clinical Microbiology, vol. 43 pp. 4161-4171. Bonnet, R, 2004, Growing Group of Extended-Spectrum -Lactamases: the CTX-M Enzymes, Antimicrobial Agents and Chemotherapy, vol. 48, no. 1, pp. 1-14. Bradford, PA, 2001, Extended-Spectrum -Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat, Clinical Microbiology Review, vol.14, no.4, pp. 933-951. Brun-Buisson, C, Legrand, P, Philippon, A, Montravers, F, Ansquer, M, Duval, J, 1987, Transferable enzymatic resistance to third-generation cephalosporins during nosocomial outbreak of multiresistant Klebsiella pneumoniae, Lancet, vol. 2, no. 8554, pp.302-6. Brssow, H, Canchaya, C, Hardt, WD, 2004, "Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion" Microbiology Moecular Biology Review, vol. 68, no. 3, pp- 560602. Bush, K, Jacoby, GA, and Medeiros, AA, 1995, Updated Functional Classification of -Lactamases , Antimicrob. Agents Chemother, vol.39, pp.1211-1233. Caccamo, M, Perilli, M, Celenza, G, Bonfiglio, G, Tempera, G, Amicosante, G, 2006, Occurrence of extended spectrum beta-lactamases among isolates of

Enterobacteriaceae from urinary tract infections in southern Italy, Microb Drug Resist, vol.12, no. 4, pp-257-64.

Cavaco, LM, Abatih, E, Aarestrup, FM, and Guardabassi, L, 2008, Selection and Persistance of CTX-M producing Esch. coli in the intestinal Flora of Pigs Treated with Amoxicillin, Ceftiofur or Cefquinome, Antimicrob Agents Chemothr, vol. 52, no.10, pp. 3612-3616. Champs, DC, Sauvant, MP, Chanal, C, Sirot, D, Gazuy, N, Malhuret, R, Baguet, JC, Sirot, J, 1989, Prospective survey of colonization and infection caused by expended spectrum beta lactamase- producing members of the family Enterobacteriaceae in an intensive care unit, Journal Clinical Microbiology , vol. 27, pp. 2887-2890. Chanawong, A, Lulitanond, A, Kaewkes, W, Lulitanond, V, Srigulbutr, S, Homchampa, P, 2007, CTX-M Extended spectrum lactamases among clinical isolates of Enterobacteriaceae in a thai university hospital, Faculty of associated medical sciences, Vol. 38, No. 3. Chaudhary, U, Aggarwal, R, 2004, Extended spectrum beta lactamases(ESBL)- An emerging threat to clinical theraputics, Indian Journal of Medical Microbiology, vol. 22, no. 2, pp. 75-80. Chia, J, Chu, C, Su, L, Chiu, C, Kuo, A, Sun, C, and Wu,T, 2005 Detection System for Detection of Some SHV and CTX-M -Lactamases of Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae in Taiwan, Journal of Clinical Microbiology, vol.43, no. 9, pp. 4486-4491. Chessbrough, M 2006, District laboratory practice in tropical countries, Part-2, Newyork, USA: Cambridge university. pp. 184- 186. Chiang, CS, Liaw, GJ, 2005, Presence of lactamase Gene TEM-1 DNA Sequence in Commercial Taq DNA Polymerase, Journal of clinical Microbiology, vol. 43, no. 1, pp.530-531.

Chowdhury, MA, Yamanaka, H, Miyoshi, S, Aziz, KM, and Shinoda,S, 1989, Ecology of Vibrio mimicus in aquatic environments, Appl Environ Microbiol, vol. 55, no. 8, pp. 2073-2078 CLSI. Performance Standards for Antimicrobial Susceptibility Testing, Twentieth Informational Supplement, CLSI Document M100-S20, Wayne, PA: Clinical and Laboratory Standards Institute, 2010 . Coque, TM, Baquero, F, Canton, R, 2008, Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe, Eurosurveillance, vol.13, no.47.

Datta, N, Kontomichalou, P, 1965, Penicillinase Synthesis Controlled By Infectious R Factors In Enterobacteriaceae, Nature, vol. 208, pp. 239-241.

Davis, CP, 1996, Normal flora, In: Baron S, Medical Microbiology, 4th edition. University of Texas Medical Branch at Galveston. den Engelsen, C, vander, Werf, C, Matute, AJ, Delgado, E, Schurink, CA, Hoepelman,,AI, 2009, Infectious diseases and the use of antibiotics in outpatients at the emergency department of the University Hospital of Len, Nicaragua, Intional Journal Infectious Dis. vol. 13, no. 3, pp. 349-54.

Denholm, JT, Huysmans, M, and Spelman, D, 2009, Community acquisition of ESBL-producing Escherichia coli: a growing concern, Medical Journal Australia, vol. 190, no.1, pp. 45-46.

Driscoll, JA, Brody, SL, Kollef ,MH, 2007, The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections, Drugs, vol. 67, no. 3, pp 351-68. Dutour, C, Bonnet, R, Marchandin, H, Boyer, M, Chanal,C, Sirot, D, and Sirot, J, 2002, CTXM-1,CTX-M-3 and CTX-M-14 - lactamases from Enterobacteriaceae Isolated in France, Antimicrobial Agents and Chemotherapy, vol. 46, no. 2, pp. 534537. Edelstein, M, Pimkin, M, Palagin, I, Edelstein, I, and Stratchounski, L, 2003,

Prevalence and Molecular Epidemiology of CTX-M Extended-Spectrum Lactamase-Producing Escherichia coli and Klebsiella pneumoniae in Russian Hospitals, Antimicrob Agents Chemother, vol. 47, no. 12, pp.3724-3732. Ensor, VM, Shahid, M, Evans, JT, and Hawkey, PM, 2006, Occurrence, prevalence and genetic environment of CTX-M b-lactamases in Enterobacteriaceae from Indian hospitals, Jourmal Antimicrobial Chemotherapy, vol. 58, pp. 1260-1263. Evans, J, Doyle, J, Dolores, Evans,G, "Escherichia Coli" Medical Microbiology, 4th edition. The University of Texas Medical Branch at Galveston. Archived from the originalon2007-11-02.http://web.archive.org/web/20071102062813/ http://www.gsbs.utmb.edu/microbook/ch025.htm. Retrieved 2007-12-02. Farkosh, MS, 2007, Extended-Spectrum betalactamase Producing Gram Negative Bacilli. http://nosoweb.org/infectious diseases/esbl.htm. Feng, P, Weagant, S, Grant, M, 2007, "Enumeration of Escherichia coli and the Coliform Bacteria" Bacteriological Analytical Manual (8th ed.). FDA/Center for Food Safety & Applied Nutrition. http://www.cfsan.fda.gov/~ebam/bam-4.html.

Finegold, SM, 1996, Anaerobic Gram-Negative Bacilli, In: Baron S, Medical Microbiology, 4th edition. University of Texas Medical Branch at Galveston. Florijn, A, Nijssen, S, Smitz, F, Verhoef, J, Fluit, A, 2002, Comperison of E-tests and double disk diffusion tests for the detection of Extended Spectrum Beta lactamases (ESBLs), Europian Journal of Clinical Microbiology and Infectious Disease, vol. 21, pp. 241-243. Fonze, E, Charlier, P, Toth, M, Vermeire, M, Raquet, X, Dubus, A, and Frere, J-M, 1995, Commonly used -lactam resistance markers in molecular biology, Acta Cryst, vol.51, pp. 682-694. Friedman, C, Callery, S, Jeanes, A, Piaskowski, P, Scott, L, 2005, Best Infection Control Practices for Patients with Extended Spectrum Beta Lactamase

Enterobacteriacae, International Infection Control Council. George, A, Jacoby, MD, and Silvia Munoz-Price, LS, 2005, "mechanisms of disease: The New beta-Lactamases." N Engl J Med, vol.35 pp.380-91. Girlich, D, Naas, T, and Nordmann, P, 2004, Biochemical Characterization of the Naturally Occurring Oxacillinase OXA-50 of Pseudomonas aeruginosa, American Society for Microbiology, vol. 48, no. 6, pp. 2043-2048. Girlich, D, Naas, T, and Nordmann, P, 2004, Biochemical Characterization of the Naturally Occuring Oxacillinase OXA-50 of Pseudomonas aeruginosa. Antiicrobial, Agents and Chemotherapy, vol. 48, no. 6, pp. 2043-2048. Gonzalez, LS, Spencer, JP, 1998, Aminoglycosides: a practical review, Am. Fam. Physician, vol. 58, no.8, pp. 1811-20.

Grover, SS, Sharma, M, Chattopadhya, D, Kapoor, H, Pasha, ST, Singh, G, 2006, Phenotypic and genotypic detection of ESBL mediated cephalosporin resistance in Klebsiella pneumoniae: emergence of high resistance against cefepime, the fourth generation cephalosporin, Journal Infectious disease, vol. 53, no.4, pp. 279-88. Grover, SS, Sharma, M, Chattopadhya, D, Kapoor, H, Pasha, ST, Singh, G, 2006, Phenotypic and genotypic detection of ESBL mediated cephalosporin resistance in Klebsiella pneumoniae: emergence of high resistance against cefepime, the fourth generation cephalosporin, Journal Infectious disease, vol. 53, no. 4, pp. 279-88. Gruteke, P, Goessens, W , Gils, JV, Peerbooms, P, Toom, NL, Santen-Verheuvel, M, V, Belkum, AV, and Verbrugh, H, 2003, Pattern of Resistance Associated with Integrons,the Extended-Spectrum lactamase SHV-5 Gene and a Multidrug Efflux Pump of Klebsiella pneumoniae Causing a Nosocomial Outbreak.Journal of Clinical Microbiology, vol. 41, no. 3, pp.1161-1166. Gutkind, GO, Ctedra de, 2001,Third-Generation Cephalosporin Resistance in Shigella sonnei, Argentina, Emerging Infectious Diseases, vol. 7, no. 3. Hanson, ND, Thomson, KS, Moland, ES, Sanders, CC, Berthold, G, Penn, PG, 1999, Molecular chacterization of a multiply resistant Klebsiella pneumoniae encoding ESBLs and a plasmid mediated AmpC, Oxford journals,Journal of Antimicrobial Chemotherapy; vol. 44, no. 3, pp. 377-380. Haque, R, Salam, MA, 2010, Detection of ESBL producing nosocomial gram

negative bacteria from a tertiary care hospital in Bangladesh, Pk J Med Sci , vol. 26, no. 4, pp.887-891.

Hawkey, PM, 2008, Prevalence and clonality of extended-spectrum -lactamases in Asia. Clinical Microbiology and Infection vol. 14, pp. 159165. Heffernan, H, Woodhouse, R, 2006, Prevalence of extended spectrum lactamases among Escherichia coli and Klebsiella in Newzealand in 2006, Antibiotic Referance Laboratory.Communicable Disease Group;ESR Porirua. Helfand, MS, Bonomo, RA, 2005, Extended spectrum -lactamases in Multidrug Resistant Eschechia coli: Changing the therapy for Hospital-Acquired and Community Acquired Infections, Oxford Journals, vol. 43, no. 11, pp. 1415-1416. Herrera-Luna, C, Klein, D, Lapan, G, Revilla-Fernandez, S, Haschek, B, SommerfeldStur, I, Moestl, K, Baumgartner, W, 2009, Characterization of virulence factors in Escherichia coli isolated from diarrheic and healthy calves in Austria shedding various enteropathogenic agents, Veterinarni Medicina, vol. 54, no. 1, pp 1-11. Highsmith, AK, Jarvis, WR, 1985, Klebsiella pneumoniae: selected virulence factors that contribute to pathogenicity, Infection controle, vol. 6, no. 2, pp. 75-77. Hirakata, Y, Matsuda, J, Miyazaki, Y, et al, 2005, Regional variation in the prevalence of extended-spectrum beta-lactamase-producing clinical isolates in the Asia-Pacific region SENTRY 19982002, Diagn Microbiology Infectious Disease, vol. 52, pp. 323329. Holten, KB, and Onusko, EM, 2000, Appropriate Prescribing of Oral Beta-Lactam Antibiotics, American Family Physician, vol. 62, pp. 611-20. Ishii, Y, Ohno, A, Taguchi, H,Imajo, S,Ishiguro, M, and Matsuzawa, H,1995, Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli, Antimicrobial Agents and Chemotherapy, vol. 39, no. 10, pp. 2269-2275.

Jabeen, K, Zafar, A, Hasan, R. 2005, Frequency and sensitivity pattern of extended spectrum beta lactamase producing isolates in a tertiary care hospital laboratory of Pakistan, Journal Pakistan Medical Association, vol. 55, pp 436439. Jacoby, GA, 2009, AmpC Lactamases, Clinical Microbiology Review, vol. 22, no.1, pp. 161-182. Jacoby, GA, Medeiros, AA, OBrien, TF, Pinto, ME, Jiang, H,1988, Broad-spectrum, transmissible beta-lactamases, New Engandl Journal Medcine, vol. 319, pp. 723724. Japoni, A, Farshad, S, Alborzi, A, 2009, Pseudomonas aeruginosa: Burn Infection, Treatment and Antibacterial Resistance, Iranian Red Crescent Medical Journal, vol. 11, no. 3, pp.244-253. Jarlier, V, Nicolas, MH, Fournier, G, Philippon, A, 1988, Extended spectrum beta lactamases conferring transferable resistance to newer beta lactam agents in Enterobacteriaceae : hospital al prevalence and susceptibility patterns, Rev Infect Dis , vol. 10, pp. 867-878. Jemima, SA, and Verghese, S, 2008, Multiplex PCR for blaCTX-M & blaSHV in the extended spectrum beta lactamase (ESBL) producing Gram-negative isolates, Indian Journal Medical Resarch, vol. 128, pp. 313-317. Johnson, JR, 1991, Virulence factors in Escherichia coli urinary tract infection, Clinical Microbiology Review, vol. 4, no. 1, pp. 80-128. Karim, A, Poirel, L, Nagarajan, S, Nordann, P, 2001, Plasmid-mediated extendedspectrum beta-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1, FEMS Microbiol Lett, vol. 201, pp. 237241.

Keller, R, Pedroso, MZ, Ritchmann, R, and Silva, RM, 1998, Occurrence of Virulence-Associated Properties in Enterobacter cloacae, Infection and Immunity, vol. 66, no. 2, pp.645-649. Khaled, Z, El-Baghdady, Mohammad, M, Abooulwafa, Madeha, O, Ghobashy and Hassan, M, Gebreel1, 2009, Plasmid mediated virulence factors of some Proteus isolates, Egypt. Acadamic Journal biological Science, vol. 1, no. 1, pp. 7-22. Kim, MH, Lee, HJ, Park, KS, and Suh, JT, 2010, Molecular Characteristics of Extended spectrum - Lactamases in Escherichia coli and Klebsiella pneumoniae and the prevalence of qnr in Extended spectrum Lctamase Isolates in a tertiatiary Care Hospital in Korea, Yonesei Medical Journal, vol. 51, no. 5, pp. 768-774. Kim, S, Hu, J, Gautom, R, Kim, J, Lee, B, and Boyle, D, 2007, CTX-M Extendedspectrum -Lactamases, Washington State, Emerging Infectious Disease, vol. 13, no. 3, pp. 513-516. Kliebe, C, Nies, BA, Meyer, JF, Tolxdorff-Neutzling, RM, and Wiedemann, B, 1985, Evolution of plasmid-coded resistance to broad-spectrum cephalosporins, Antimicrob Agents Chemotherapy, vol. 28, no. 2, pp. 302-307. Knothe, H, Shah, P, Krcmery, V, Antal, M, Mitsuhashi, S, 1983, Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens, Infection , vol. 11, no.6, pp.315-7. Kotra, LP, Samama, J, Mobashery, S, 2002, Beta-lactamases and resistance to betalactam antibiotics. In: Lewis K, Salyers AA, Taber HW,Wax RG, eds. Bacterial resistance to antimicrobials, pp.123-60.

Lal, P, Kapil, A, Das, BK, and Sood, S, 2007, Occurence of TEM and SHV gene in extended spectrum beta lactamases (ESBLs) producing Klebsiella spp.isolated from a tertiary care hospital, Indian Journal Medical, 125, pp. 173-178. Levinson, W, 2010, Review of medical microbiology and immunology. 11th ed. New York: Lange, pp. 85-93. Li, XZ, Nikaido, H, 2004, Efflux-mediated drug resistance in bacteria, Drugs, vol. 64, no. 2, pp. 159-204. Lin, Y, Lu, M, Hui-Ling Tang, H, Liu, H, Chen, C, Liu, K, Lin, C, Chiou, C, Chiang, M, Chen, C,Yi-Chyi Lai, Y, 2011, Assessment of hypermucoviscosity as a virulence factor for experimental Klebsiella pneumoniae infections: comparative virulence analysis with hypermucoviscosity-negative strain, Bio Med Central Microbiology, vol. 11, no. 50. Livermore, DM, 1995, -Lactamases in laboratory and clinical resistance, Clinical Microbial Review, vol.8, no. 4, pp. 557-84. Livermore, DM, 2003, Bacterial resistance: origins, epidemiology, and impact, Clin Infect Dis. vol. 15, no. 36, S- 111-23. Livermore, DM, Hawkey, PM, 2008, CTX-M: changing the face of ESBLs in the UK. 2005, Defining an extended-spectrum beta-lactamase, Clinical Infection, vol. 14, Suppl 5, pp.21-4. Livermore, DM, Woodford, N, 2006, The beta-lactamase threat in Enterobacteriaceae, Pseudomonas and Acinetobacter, Trends Microbial, vol. 14, no. 9, pp. 413-420. Microbiology

Livrelli, V, Champs, CD, Martino, PD, Michaud, AD, Forestier, C, Joly, B, 1996, Adhesive Properties and Antibiotic Resistance of Klebsiella, Enterobacter, and Serratia Clinical Isolates Involved in Nosocomial Infections, Journal of Clinical Microbiology, vol. 34, no. 8, pp.1963-1969. Lytsy, B, Sandegren, L, Tano, E, Torell, E, Andersson, DI, Melhus, A, 2008,The first major extended-spectrum beta-lactamase outbreak in Scandinavia was caused by clonal spread of a multiresistant Klebsiella pneumoniae producing CTX-M-15, APMIs. Vol. 116, no. 4, pp. 302-8. Manoharan, A, Premalatha, K, Chatterjee, S, Mathai, D, 2011, Correlation of TEM, SHV and CTX-M extended-spectrum beta lactamases among Enterobacteriaceae with their in vitro antimicrobial susceptibility, Indian Journal of Medical

Microbiology,vol. 29, no. 2, pp. 161-164. Marcus, N, Ashkenazi, S, Yaari, A, Samra, Z, Livni, G, 2005, Non-Escherichia coli versus Escherichia coli community-acquired urinary tract infections in children hospitalized in a tertiary center: relative frequency, risk factors, antimicrobial resistance and outcome, Pediatr Infect Dis J Vol. 24, no. 7, pp.581-585. Mathai, D, Rhomberg, PR, Biedenbach, DJ, Jones, RN, 2002, Evaluation of the in vitro activity of six broad-spectrum beta-lactam antimicrobial agents tested against recent clinical isolates from India: a survey of ten medical center laboratories, Diagn Microbiol Infect Dis, vol. 44, pp. 367377.

Matsumoto, Y, Ikeda,F, Kamimura,T, Yokota, Y, Mine,Y, 1988,Novel plasmidmediated beta-lactamase from Escherichia coli that inactivates oxyimino-

cephalosporins, Antimicrob. Agents Chemother , vol. 32, no.8, pp.1243-1246.

Medeiros, AA, 1997, Evolution and dissemination of beta-lactamases accelerated by generations of beta-lactam antibiotics, Clin Infect Dis, vol. 24, no. 1, S19-45. Medici, DD, Croci, L, Delibato, E, Pasquale, SD, Filetici, E and Toti, L, 2003, Evaluation of DNA Extraction Methods for Use in Combination with SYBR Green I Real-Time PCR To Detect Salmonella enterica Serotype Enteritidis in Poultry, Applied and Environmental Microbiology, vol. 69, no. 6, pp. 3456-3461. Miller, GH, Sabatelli, FJ, 1997, The most frequent aminoglycosideresistance mechanisms--changes with time and geographic area: areflection of aminoglycoside usage patterns? Aminoglycoside Resistance Study Groups, Clin. Infect. Dis. vol. 24, no.1, pp. 46-62. Mirza, SH, Salman, M, Khurshid,U, Wiqar, MA, 2006, CTX-M ESBL enzyme in Escherichia coli from urology patients in Rawalpindi, Pakistan, Dec, vol. 56, no.12, pp. 576-8 Munday, CJ, Xiong, J, Li, C, Shen, D, Hawkey, PM,2004, Dissemination of CTX-M type beta-lactamases in Enterobacteriaceae isolates in the Peoples Republic of China, Int J Antimicrob Agents, vol. 23, pp 175180. Muratani, T, Matsumoto, K, 2006, Urinary tract infection caused by fluoroquinoloneand cephem-resistant Enterobacteriaceae. Int J Antimicrob Agents; 28S: S10S13. National Committee for Clinical Laboratory standards. Methods for dilution Antimicrobial susceptibility tests for bacteria that grow aerobically .2003; M7-A6. Nieradko, J, Kurlenda, J, 2004, Characteristics of selected virulence factors of Enterobacter cloacae strains isolated from clinical specimens, Medycyna doswiadcz alna i mikrobiologia, vol. 56, no. 4, pp.351-8.

Oteo, J, Navarro1, C,Cercenado, E, Delgado-Iribarren, A, Wilhelmi, I, Orden, B, Garca, C, Miguelaez, S, Prez-Vzquez, M, Garca-Cobos, S, Aracil1, B, Bautista, V, and Campos, J, 2006, Spread of Escherichia coli Strains with High-Level Cefotaxime and Ceftazidime Resistance between the Community, Long-Term Care Facilities, and Hospital Institutions , Journal Clinical Microbiology, vol. 44, no. 7 , PP.2359-2366.

Pagani, L, Amico, ED, Migliavacca, R, DAndrea, MM, Giacobone, E, Amicosante, G, Romero, E, and Rossolini, GM, 2003, Multiple CTX-M-Type Extended-Spectrum -Lactamases in Nosocomial Isolates of Enterobacteriaceae from a Hospital in Northern Italy, Journal of Clinical Microbiology, vol. 41, no. 9, pp. 4264-4269. Pai H.1998. The characteristics of extended-spectrum beta-lactamases in Korean isolates of Enterobacteriaceae. Yonsei Med J; 39: 514519. Parveen, US, Hossain, MA, Musa, AK, Mahmud, C, Islam, MT, Haque, N, Muhammad, N, Khan, SI, Mahmud, NU, 2009, Pattern of Aerobic Bacteria with Antimicrobial Susceptibility Causing Community Acquired Urinary Tract Infection. Vol.18, no. 2, pp. 148-153. Paterson, DL,Yu VL, 1999, Extended spectrum beta lactamases: a call for improved detection and control, Clin Infect Dis , vol. 29, pp.1419-22. Peirano, G, Pitout, JDD, 2010, Molecular epidemiology of Escherichia coli producing CTX-M Lactamases : worldwide emergence of clone ST131 025:H4.International journal of Antimicrobial Agents, vol.35, pp. 316-321. Perez, F, Endimiani, A, Hujer, KM, Bonomo, RA, 2007, The continuing challenge of ESBLs. Current Opinion in Pharmacology, vol. 7, no. 5, pp. 459-469 .

Pfaller, MA, Segreti, J, 2006, Overview of the epidemiological profile and laboratory detection of extended-spectrum beta-lactamases, Clin Infect Dis, vol.15, no. 42, pp.153-63. Philippon, A, Labia, R, Jacoby, G, 1989, Extended-spectrum -Lactamases, Antimicrob Agents Chemother, vol.33, pp.1131-6. Pinheiro, MRS, Larcerda, HR, Melo, RGL, and Maciel, MA, 2008, Pseudomonas aureginosa Infections : Factors Relating to Mortality with Emphasis on Resistance Pattern and Antimicrobial treatment, The Brazilian Journal of Infectious Deseasese, vol. 12, no. 6, pp. 509-515. Pitout, JD, 2010, Infections with extended-spectrum beta-lactamase-producing enterobacteriaceae: changing epidemiology and drug treatment choices, Drugs, vol. 70, no. 3, pp. 313-33. Pitout, JDD, Gregson, DB, Church, DL, Elsayed, S, and Laupland, KB, 2005, Community wide outbreaks of Clonally Related CTX-M-14 -lactamase-producing Escherichia coli Strains in the Calgery health region, Journal Clinical Microbiology, vol. 43, no. 6, pp. 2844-2849. Pitout, JDD, Laupland, KB, 2008, Extended Spectrum Lactamase producing Enterobacteriaceae : an emerging public health concern. Lancet infect Dis, vol. 8, pp.159-66Poirel, L, Pitout, JD, Nordmann, P, 2007, Carbapenemases: molecular diversity and clinical consequences.Future Microbiol ; vol. 2, no. 5, pp- 501-512. Poole, K, 2004, Efflux-mediated multiresistance in Gram-negative bacteria,Clinical Microbiology and infection, vol.10, no.1, pp 12-26.

Postgate, J, 1998, Nitrogen fixation, 3rd ed.. Cambridge University Press. Radice, M, Gonzlez, C, Power, P, Vidal, MC, and Gutkind, G, 2001, Thirdgeneration cephalosporin resistance in Shigella sonnei, Argentina,Antimicrob Agents Chemother, vol.7, no. 3, pp. 442-443. Rahman, MM, Haque, JA, Hossain, MA, Sultana, R, Islam, F, AHM, Islam, S, 2004, Prevalence of extended spectrum beta lactamase-producing Escheria coli and Klebsiella pneumoniae in an urban hospital in Dhaka Bangladesh, International journal of antimicrobial agents, vol.24, no. 5, pp. 508-510. Rashid, A., Chowdhury, A., Rahman, SH, Begum, SA, and Muazzam, N, 2007,Infections by Pseudomonas aeruginosa and Antibiotic Resistance Pattern of the Isolates from Dhaka Medical College Hospital, Bangladesh Journal of Medical Microbiology, vol.01, no.02, pp. 48-51.Rayamajhi, N, Kang, SG, Lee, SI, Park,KY, Lee, HS, and Yoo, HS, 2008, Characterization of TEM, SHV and AmpC type lactamases from cephalosporin-resistant Enterobacteriaceae isolated from swine, International Journal of food Microbiology, vol. 124, no. 2, pp- 183-187. Rhee, YJ, Park, YK, Lee, MY, Peck, KR, Soo, KK, 2010, KPC-Producing Extreme Drug-Resistant Klebsiella pneumoniae Isolated from a patient with Diabetes Mallitus and Chronic Renal Failure on Haemodialysis in South Korea, Antimicrobial Agents and Chemotherapy, vol. 54, no. 5, pp. 2278-2279. Rozalski, A, Sidorczyk, Z, Kotelko, K, 1997, Potential Virulence Factors of Proteus Bacilli, Microbiology and Molecular Biology Review, vol. 61, no. 1, pp.65-89. Rupp, ME, and Paul, D, 2003, Extended Spectrum -Lactamase (ESBL) Producing Enterobacteriaceae, Drugs Vol. 63, no. 4, pp. 353-356.

Saha, SK, Hanif, M, Dutta, P, Chowdhury, MF, 1995, Emergence of high-level fluoroquinolone-resistant Escherichia coli in Bangladesh, International Journal Antimicrobial Agents, vol. 5, no. 2, pp.119-21. Sahm, DF, Thornsberry, C, Mayfield, DC, Jones, ME, Karlowsky, JA, 2001, Multidrug-resistant urinary tract isolates of Escherichia coli: prevalence and patient demographics in the United States in 2000, Antimicrob Agents Chemother, vol. 45, no. 5, pp. 1402-6. Samaha-Kfoury, JN, Araj, GF, 2003, Recent developments in lactamases and extended spectrum lactamases, Bairut Medical Journal, vol. 327, no. 22, pp.12091213. Sandel, DC, Wang, C, Kessler, S, 2002, Urinary Tract Infections and a MultidrugResistant Escherichia coli Clonal Group, N England Journal Medical, vol. 346, pp.535-536. Sasirekha, B, Manasa, R, Ramya, P, and Sneha, R, 2010, Frequency and Antimicrobial Sensitivity Pattern Of Extended Spectrum - Lactamases Producing E.coli And Klebsiella Pneumoniae Isolated In A Tertiary Care Hospital, Al Ameen journal Medical science, vol.3, no.4, pp. 265-271. Sharma, J, Sharma, M, and Roy, P, 2010, Detection of TEM and SHV genes in Escheria coli and Klebsiella pneumoniae isolates in a tertiary care hospital from India, Indian J Med, Res 132, pp.332-336. Sharma, S, Bhat, GK, Shenoy, S, 2007, Virulence factors and drug resistance in Escherichia coli isolated from extrintestinal infections, Indian Journal of Medical Microbiology, vol. 25, no. 4, pp.369-373.

Sheryll, L, Magalit, MD, Maria, Tarcela, S, Gler, MD, and Thelma, E, Tupasi, MD, 2004, Increasing Antimicrobial Resistance Patterns of Community and Nosocomial Uropathogens in Makati Medical Center antibiotics, Phil J Microbiol lnfect Dis, vol.33, no.4, pp. 143-148. Shivaprakasha, S, Radhakrishnan, K, Gireesh, AR, Shamsulkarim, PM, 2007, Routin screening for ESBL Production, A necessity of Today. The Internet Journal of Microbiology vol. 3, no. 1. Shobha, KL, Gowrish, RS, Sugandhi, R, Sreeja, CK, 2007, Prevalence of Extended Spectrum Lactamases in Urinary Isolates of Escherichia coli, Klebsiella and Citrobacter Species and their Antimicrobial Susceptibility Pattern in tertiary care hospital, Indian journal for the Practicing Doctor; vol. 3, no. 6, pp. 01 -02. Singh, NP, Goyal, R, 2003, Changing trends in bacteriology of burns in the burns unit, Delhi, India, Burns. vol. 29, no.2, pp. 129-32. Smet, A, Van Nieuwerburgh, F, Vandekerckhove, TTM, Martel,A, Deforce, D, et al, 2010, Complete Nucleotide Sequence of CTX-M-15 Plasmids from Clinical Escherichia coli Isolates Insertional Events of Transposons and Insertion Sequences, PLoS ONE , vol. 5, no. 6, e 11202.doi: 10.1371/ journal. Pone.0011202.

Subha, A, Ananthan, S, 2002, Extended spectrum beta lactamase (ESBL) mediated resistance to third generation cephalosporins among klebsiella pneumoniae in Chennai, Indian Journal Medical Microbiology, vol. 20, issue. 2, pp. 92-95.

Tenover, FC, Mohammed, MJ, Gorton, TS, Dembek, ZF, 1999 Detection and reporting of organisms producing extended spectrum beta-lactamases: survey of laboratories in Connecticut. Journal Clinical Microbiology, vol.37 , pp 4065-70.

Tenover, FC, Mohammed, MJ, Gorton, TS, Dembek, ZF, 1999, Detection and reporting of organisms producing extended spectrum beta-lactamases: survey of laboratories in Connecticut, Journal Clinical Microbiology , vol. 37, pp. 4065-70. Thomson, KS, Sanders, cc, and Washington, JA, 1991, High-level resistance to cefotaxime and ceftazidime in Klebsiella pneumoniae isolates from Cleveland, Ohio. Antimicrob Agents Chemother; vol. 35, no. 5, pp. 10011003.

Toder, DS, Gambello, MJ, and Iglewski, 2008, Bacterial resistance to Antibiotic in Toders Online Textbook of Bacteriology, Kinneth Toder Unerversity of WisconsinMedison.Department of Bacteriology.

Turner, PJ, 2005, Extended Spectrum -lactamases. Clinical Infectious Disease, vol. 41,no. 4, pp. 273-5. Turng, B, Votta, M, Turner, D, Pollitt, J, Callihan, D, Wulff, S, Wiles, T, 2002, Detection of Extended Spectrum Beta-Lactamase Among Enterobacteriaceae Using Phoenix Automated Microbiology System with BDXpert System, Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC). Ullah, F, Malik, SA, Ahmed, J, 2009, Antimicrobial susceptibility pattern and ESBL prevalence in Klebsiella pneumoniae from urinary tract infections in the North West of Pakistan, African Journal of Microbiology, vol.3, no. 11, pp.670-680. Varaiya, A, Dogra, J, Kulkarni, M, Bhalekar, P, 2008, Extende spectrum beta lactamase (ESBL) Producing Escherichia coli and Klebsiella pneumoniae in diabetic foot infection, Indian Journal of Medical Microbiology, vol. 26, no. 3. WHO Global Strategy for Containment of Antimicrobial Resistance, 2002.

Wiegand, I, Geiss, HK,Mack, D, Sturenburg, E, Seifert, H, 2007, Detection of ESBL among Enterobacteriaceae by use of semiaotomated microbiology systems and manual detection procedures, J Clin Microbiol, vol. 45, pp. 1167-74. Wiener, J, Quinn, JP, Bradford, PA, Goering, RV, Nathan, C, Bush, K, Weinstein, RA, 1999, Multiple antibiotic-resistant Klebsiella and Escherichia coli in nursing homes, Journal American Medical Association, vol. 281, no. 6, pp. 517-23. Wikipedia, 2010, Beta-lactamase. Accessed on December 10, 2010. Willems, EA, 2011, Evaluation and Development of a phenotypic Screening Strategy for emerging - lactamases in Gram negative bacilli, Critically Appraised Topic, pp.1-25.

Woodruff, HB, and Foster, JW, 1945, Microbiological Aspects of Penicillin, Journal of Bacteriology; vol. 49, no. 1, pp. 19-29.

Xu, L,Ensor,V, Gossain,S, Nye, K, Hawkey, P, 2005, Rapid and simple detection of CTX-M genes by multiplex PCR assay, Journal of Medical Microbiology, vol. 54, pp. 1183-1187. Yushau, MM, Kumurya, AS, and Suleiman, L, 2010, Prevalence of Extended spectrum lactamases among Enterobacteriaceae in Murtala Mohammed specialist hospital, Kano,N, Journal of Pure and Applied Sciences, vol.3, no.1, pp.169- 172. Zaborina, O, Kohler, JE, Wang, Y, Bethel, C, Shevchenko, O, Wu, L, Turner, JR and Alverdy, JC, 2006, Identification of multi-drug resistant Pseudomonas aeruginosa clinical isolates that are highly disruptive to the intestinal epithelial barrier, Annals oF Clinical Microbiology and AntimicrobialS, vol. 5, no.14.

Zwadyk, P, 1992, Enterobacteriaceae: Salmonella and Shigella, Intestinal pathogens. In: Joklik, WK, Willet, HP, Amos, B, and Wilfert, CM, eds. Zinsser Microbiology, 20th ed. USA: Appleton & Lange, pp. 556-565.

APPENDICES
APPENDIX-I Data sheet
Title:Phenotypic detection and molecular characterization of ESBL producers among Escherichia coli and Klebsiella pneumoniae.

Project Title: A. S.L No: number B. Particulars of the patients: 1. Name: 2. Age: Identification

3. Sex: Male/Female 4. Father/Mother/Husbands name: 5. Address: Village: Thana: 6. Admitted patients: 7. Date of admission: 8. Socio-economic condition: 9. History of relapse UTI: 10. Time of disease start and taking antibiotic: 11. Duration of hospital stay: month: catheter: week: canula: a) Yes b) No Ward no; P.O: Dist : Bed no; Reg. no: Union:

12. H/O long care facilities health care manipulation:

C. Clinical findings: 1. Fever: 2. Anemia: 3. Presenting rash: 4. Frequency of micturation : 5. Burning sensation during micturation : D.Laboratory findings: 1. Culture: Lactose farmenter / non lactose farmenter. 2. Microscopy: Gram negative bacilli. 3. Antibiogram : 4. Screening by third generation cephalosporins: Name of antibiotic Ceftriaxone Ceftazidime Aztreonam Cefotaxime 5. Double disc diffusion test: positive/negative. 6. PCR: TEM, SHV and CTX-M genes present /not. Resistance Sensitive a) Yes a) Yes a) Yes a) Yes a) Yes b) No b) No b) No b) No b) No

ANTIBIOGRAM OF ISOLATES Antimicrobial agents Aztreonam Ampicillin Amoxiclave Piperacillin Ceftazidime Cefotaxime Ceftriaxone Amikacin Gentamicin Nitrofurantoin Ciprofloxacin Imipenem 30 g 10 g 20/10 g 30 g 30 g 30 g 30g 30 g 10 g 50 g 5 g 10 g Disk content Zone diameter S (mm) 27 16 18 18 22 27 25 16 16 16 20 20 R (mm) 27 14 14 14 18 22 22 14 14 14 14 14

S-Sensitive, R-Resistant

APPENDIX-II
Nutrient agar medium Composition Ingredients Peptic digest of Animal Tissue Sodium Chloride Beef Extract Yeast Extract Agar gram/liter 5.00 5.00 1.50 1.50 15.00

Twenty-eight grams of dehydrated nutrient agar medium was added to 1000 ml of cold distilled water in a flask and boiled to dissolve the medium completely. The medium was then sterilized in an autoclave at 1210C and 15 lbs pressure for 15 minutes. The sterile media were stored in a refrigerator at 40C for future use.

APPENDIX-III
Blood agar medium Composition Ingredients Heart infusion Tryptose Sodium chloride Agar gram/liter 500.00 10.00 5.00 15.00

Forty grams of the dehydrated blood agar medium was suspended in 1000 ml cold distilled water in a flask and boiled to dissolve the medium completely. It was then sterilized by autoclaving at 1210C and 15 lbs pressure for 15 minutes. The autoclaved materials were allowed to cool to a temperature of 450C in a water bath. Defibrinated 5-10% sheep blood was then added to the medium aseptically and distributed to sterile petridishes. Sterile media was stored in refrigerator at 40C for future use.

APPENDIX-IV
Muller Hinton agar medium Composition Ingredients Beef dehytrated infusion Casein hydrolysate Starch agar Agar gram/liter 300 17.50 17.00 17.00

Thirty-eight grams of dehydrated Mueller Hinton agar medium was suspended in 1000 ml cold distilled water and boiled to dissolve the medium completely. The solution was then sterilized by autoclaving at 1210C and 15 lbs pressure for 15 minutes. The autoclaved media was stored at 40C

APPENDIX-V
MacConkey agar medium Composition Ingredients Peptone Lactose NaCl Na- Deoxycholate Neutral Red Crystal Violet Agar gram/liter 19.0 10.0 5.0 1.0 0.03 0.001 15.0

Fifty-two grams of dehydrated MacConkey agar medium was suspended in 1000 ml cold distilled water and boiled to dissolve the medium completely. The solution was then sterilized by autoclaving at 1210C and 15 lbs pressure for 15 minutes.

APPENDIX-VI
Brain Heart Infusion (BHI) broth Composition Ingredients Calf Brain infusion solid Beef Heart infusion solid Glucose NaCl Di-sodium phosphate gram/liter 12.5 5.0 2.0 5.0 2.5

Thirty-seven gm of dehydrated Brain Heart Infusion agar medium (Hi-media, India) was suspended in 1000 ml distilled water and dissolved the medium completely. The solution was then sterilized by autoclaving, for best result, the medium should be used on the day it is prepared, otherwise, it should be boiled or steamed for a few minutes and then cooled before use.

APPENDIX-VII
Triple suger irone agar media Composition Ingredients Beef extract Yeast extract Peptone Glucose Lactose Sucrose Ferric citrate Sodium chloride Sodium thiosulphate Agar Phenol red,0.2% solution Triple suger irone agar test to show Enterobacteriaceae: Species E. coli Klebsiella Proteus OX Cit + d + Ind + + slant Y Y Y R butt Y Y Y R H2S + gas + + d gram/liter 3 3 20 1 10 10 0.3 5 0.3 12 12

Pseudomonas + Enterobacter

OX: Oxidase; Cit: Citrate test; Ind:Indole test; d=different strains give different results R: Red(Pink),Alkaline; Yellow, Acid; + : Positive reaction; - : Negative reaction.

APPENDIX-VIII
Simmons Citrate medium This is modification of Kosers medium with agar and an indicator added. Ingredients Kosers medium Agar Bromothymol blue,0.2% amount 1 litre 20g 40ml

APPENDIX-IX
Indole test Composition Ingredients Peptone Sodium chloride Distilled water amount 20g 5g 1L

After adjustment of the pH to 7.4 , sterilize by autoclaving at 1210 C for 15 min. Kovacs reagent Amyl or isoamyle alcohol p Dimethyl-aminobenzaldehyde Hydrocloric acid 150ml 10g 50ml

Dissolve the aldehyde in the alcohol and slowly add the acid and store in the refrigerator.

APPENDIX-X
Oxidase reagent Composition Distilled water Tetramethyl-P- phenylenedimine 10ml 0.1 g

APPENDIX-XI
TNE buffer TE (Tris-EDTA) buffer (pH 7.4 to 8.0) - 1L 10 mM Tris, 1 mM EDTA - pH is determined by the pH of the Tris-Cl 100 ml 1 M Tris-Cl 20 ml 0.5 M EDTA pH 8.0 880 ml ddH2O

Equipments for PCR 1. Centrifuge 5415 R with refrigerator 2. Vortex mixture (Digi system VM-2000). 3. Micropipette (company -Eppendrof) 4. Laminar flow cabinet (company stremline). 5. Microwave oven for gel preperation. 6. Electric water bath 7. Thermal cycler (Model-master cycler personal). 8. Gel apparatus (Major science mini S-30).

APPENDIX-XII
CLSI 2010 Disk diffusion breakpoints (mm): Agent Cefazolin Cefotaxime 23 Ceftizoxime 20 Ceftriaxone 21 Ceftazidime 18 Aztreonam 22 MIC breakpoints (g/ml): Agent Cefazolin Cefotaxime 8 Ceftizoxime 8 Ceftriaxone 8 Ceftazidime 8 Aztreonam 8 16 32 4 8 16 16 32 4 8 16 16-32 64 1 2 4 16-32 64 1 2 4 Old (M100-S19) Susc Int Res 8 16 32 16-32 64 1 Revised (M100-S20) Susc Int Res 1 2 4 2 4 Old (M100-S19) Susc Int 1517 1522 1519 1420 1517 1621 Revised (M100-S20) Susc Int Res NA 14 23-25 14 22-24 14 20-22 13 18-20 14 18-20 15 21 17 21 17 23 19 25 21 26 22 NA NA

Res

18

APPENDIX-XIII

The composition and methods of preparation of different stains, diluents and chemicals used in this study are given below

Crystal violet Gram stain: Crystal violet Ammonium oxalate Ethanol or methanol, absolute Distilled water to 20g 9g 95ml 1 liter

Lugols iodine solution Potassium iodide Iodine Distilled water 20g 10g 1 liter

Alcohol fixative solution To make 200ml Ethanol (ethyl alcohol), absolute Acetic acid, glacial Distilled water 180ml 10ml 10ml

Immerse the fixative for 20 minutes. Rinse with 95% ethanol and allow the smear to dry. Carbol fuchsin Basic fuchsin Ethanol or methanol Phenol Distilled water 10g 100ml 50g 1 liter

APPENDIX-XIV
Physiological saline solution To make 1000 ml of Physiological saline solution, 0.9 gm of chemically pure sodium chloride was added in 1000 ml of distilled water in a sterile conical flask. The solution was then sterilized by autoclave at 1210C maintaing a pressure of 15 lbs per square inch for 15 minutes. After sterilization, the sterile physiological saline solution was cooled and stored in a refrigerator at 40C for future use. McFarland Standard 0.5 Composition and preparation 1 % (V/V) solution of chemically pure (0.36N) Sulphuric acid and 1.175 % (W/V) solution of chemically pure (0.048M) barium chloride was prepared in two separate sterile flasks. Then 9.9 ml of sulphuric acid and o.1 ml of barium chloride were added to the clean screw capped test tube and sealed. The barium sulphate suspension corresponds approximately to McFarland standard tube No.1 with corresponding cell density of 3 108 organisms/ml. To made the turbidity standard of cell density to one half of the McFarland standard tube No.1 which correspond to cell density of 1.5 108 organism/ml for determination of antibiotic sensitivity by Kirby-Bauer inoculated technique 0.5 ml of 1.7 %(W/V) barium chloride (Bacl2 2H2O) was added to 99.5 ml of 1 % (V/V) Sulphuric acid (0.36N), mixed well and 5- 10 ml was distributed in sterile capped test tubes and sealed.

Master mixture for PCR amplification DDW 38.5l

10 X buffer 5l dNTP 4l

Primer mixture 1l Taq polymerase 0.5l + Extracted DNA 1l.

APPENDIX-XV

STATISTICAL FORMULA
Sample size determination= Z2pq n = -------------d2 n= Desired sample size, p= Prevalence of the disease / problem in community, q= (1-p), d= Degree of accuracy (it is .05), z= Confidence interval (usually we take 95% CI, in which z= 1.96), Formula for mean

x
n

x
x n

= mean of observations = individual observations = number of observation

Formula for Chi-square test (2):

2
Here, O =

O E 2
E

Observed frequencies

E
df

= Expected frequencies
= Degrees of freedom = (c-1) (r-1)

Summation.

APPENDIX-XVI Groups and examples of lactam antimicrobial agents lactam groups Examples of antimicrobial agents Penicillins Penicillinase resistant penicillins: Aminopenicillins: Carboxypenicillins: Ureidopenicillins: First generation: Second generation: Penicillin G, penicillin methicillin, nafcillin, oxacillin, cloxacillin ampicillin, amoxicillin carbenicillin, ticarcillin mezlocillin, piperacillin, Cephalosporins cefazolin, cephalothin, cephalexin cefuroxime, cefaclor, cefamandole, cefamycins (cefotetan, cefoxitin) Third generation: cefotaxime, ceftriaxone, cefpodoxime, ceftizoxime, cefoperazone, ceftazidime Fourth generation: cefepime, cefpirome

Carbapenems

Imipenem, meropenem, ertapenem

Monobactams

Aztreonam

Adopt from Kotra et al. 2002.

APPENDIX-XVII
Functional Classification of Beta-lactamases Group 1 2a C A Cephalosporins Penicillins + AmpC, MIR-1 Gram positive penicillinases 2b A Penicillins, Cephalosporins 2be A Penicillins, extended spectrum Cephalosporins , monobactams 2br 2c A A Penicillins Penicillins, Carboxypenicilli ns 2d D Penicillins, Cloxacillin 2e 2f A A Cephalosporins Penicillins, Cephalosporins , carbapenems 3 4 B ? Beta-lactams Penicillins CcrA B. cepacia + + P. vulgaris NMC-A +/OXA-1 to 11 +/+ TEM-30 to 36 PSE-1, 3 and 4 + TEM-3 to 26, SHV-2 to 6 + TEM-1 and 2, SHV-1 Molecular Class Preferred Substrate Inhibited by CA* Examples

CONTENTS
Page No. List of Tables List of Figures List of Abbreviations vi vii viii

1. Summary 2. Introduction 3. Aims and objectives 4. Review of Literature 5. Materials and Methods 6. Results 7. Discussion 8. Bibliography 9. Appendices

1 3 9 10 60 69 90 99 117

LIST OF TABLES
Table No.
1. Age and sex distribution of cases 2. Age and sex of controls 3. Socioeconomic condition of subjects 4. Rate of isolation of Salmonella typhi among study cases 5. Result of Widal test in paired sera of blood culture negative typhoid cases showed rise of antibody titre 6. Comparison of Blood culture, Widal test and DOT EIA on first sample among clinically suspected typhoid cases 7. Category of cases. 8. Category wise result of DOT EIA. 9. Results of Widal test on 1st sample and DOT EIA in different study groups 10. Result of DOT EIA and Widal test in first and second sample among confirmed typhoid cases ( Group I & Group II ) 11. Sensitivity and specificity of DOT EIA ( IgM ) in confirmed typhoid cases 12. Sensitivity and specificity of Widal test on single sample 13. Comparative results among DOT EIA, single Widal test and paired Widal test 87 85 86 83 84 78 79 80 77

Title

Page No.
70 73 74 76

LIST OF FIGURES
Figure No.
1. Age distribution of cases 2. Age and sex distribution of cases 3. Comparative sensitivity of DOT EIA, single and paired Widal test 4. Specificity of DOT EIA and Widal test 5. Photograph of blood culture. Right: bottle containing trypticase soya broth. Left: Inoculated broth 6. Photograph of growth of Salmonella typhi on MacCokeys agar media 7. Photograph of reaction of Salmonella typhi on TSI medium 8. Photograph of DOT EIA reaction tray containing antigen dotted strips 9. Photograph of DOT EIA test strip showing positive and negative result 134 133 132 131 130 88 89

Title

Page No.
71 72

LIST OF ABBREVIATIONS
BMAC CMIR DSCC DTH EIA ELISA et al. H2S ICDDRB Bone-marrow-aspirate culture Cell-mediated immune responses Duodenal string-capsule culture Delayed-type hypersensitivity response Dot enzyme immunoassay Enzyme-linked immunosorbent assay et alia ( and others ) Hydrogen Sulphide International Center for Diarrrhoeal Diseses and Research, Bangladesh IROMPs Kda LDC LMI LPA LPS MDRTF Iron-regulated outer-membrane protein Kilo dalton Lysine decarboxylase Leucocyte migration inhibition test Lysophosphatidic acid Lipopolysaccharide Multi Drug Resistant typhoid fever

NPV n OMPs PPV PPs RSC RTI SPS SD TTSSs TSI TSB UTI Vs WHO

Negative Predictive value Number Outer membrane proteins Positive Predictive value Peyer's patch Rectal-swab culture Respiratory tract infection Sodium polyanethol sulfonate Standard Deviation Type III Secretion Systems Triple sugar iron Trypticase soya broth Urinary tract infection Versus World Health Organization

Appendix - II For Control Group : AeMwZg mwZc GB mwZci Dk AvcbvK cqvRbxq Z_ c`vb Kiv, h Z_jv AvcbvK wmv wbZ mvnvh Kie, Avcbvi ivMx/ivMxbx GB MelYvq AskMnb Kie wKbv bv? Dk I cwZ GwUevqvwUK iwR evsjv`k GKwU mvaviY mgmv| Avgvi MelYvi Dk njv GwUevqvwUK

iwR wbYq Kiv Ges ivM wbYqi mnRZg cwZ ei Kiv| GZ cieZxZ mwVK m mgq Ges mnRZg cwZZ B.Gm.we.Gj. wbYq Ki gvbzli GwUevqvwUK iwR RwVjZv Kge| Avcwb hw` Avcbvi ivMx/ivMxK GB MelYvq AskMnY KivZ mZ _vKb Zvnj Avcbvi/Avcbvi ivMxi AmyZv Ges wPwKrmv mwKZ wKQz ck Kiv ne Ges Zv bw_Z msiY Kiv ne| Melbvi Rb Avcbvi ckvve, cyuR bqv ne| MelYvi SzuwK GB MelYvq AskMnY Kvb kvixwiK SzuwKi mvebv bB|

LiP
MelYvq AskMnYi Rb Avcbvi ivMx/ivMxi ivM wbYqi Kvb LiP bvB ev AvcbvK Avw_K mnhvMxZv Kivi Rb eev bvB| MvcbxqZv MelYv PjvKvjxb I cieZxZ ck _K cv Z_ I jveiUix _K cv Z_ KVvifve Mvcb ivLv ne| MelYvq AskMnY GB MelYvq AskMnY m~Y ^Qvg~jK| Avcwb MelYvq AskMnY A^xKwZ RvbvZ cvib A_ev MelYv PjvKvjxb hKvb mgq MelYv _K Avcbvi ivMx/ivMxK cZvnvi Ki wbZ cvib| GB dig ^vi Kij Avcbvi AvBbMZ Kvb AwaKvi Le ne bv| Avcbvi ivMx/ivMxi wPwKrmv h_vh_fve Pje| hw` Avcbvi Kvb ck _vK, Avcwb wRvmv KiZ cvib, Avgiv Zvi Di c`vb Kivi h_vmva Pv Kie| mwZ ^xKvivw Avwg MelYvq wbqvwRZ wPwKrmKi mv_ GB MelYv wbq AvjvPbvq mw cKvk KiwQ| Avwg mwZci kZjv cowQ/Avi myL cwVZ nqQ Ges ^Qvq Avgvi ivMx/ivMxK MelYvq AskMnY KiZ mwZ vcb KiwQ| mvvrMnYKvixi ^vi ZvwiL t AwffveKi ^vi/evyjxi Qvc ZvwiL t