ChBE 473/594B (Due Jan.

31, 2011 in class)

Homework #1

Spring 2013

1. Multiple choice (Only one correct answer) (3 for each problem) 1) The ability of DNA to denature is important for which process? A) DNA synthesis B) Nucleic acid hybridization experiments C) RNA synthesis D) All of the above 2) Compare a gene expression vector with a DNA cloning vector. Which of the following feature is unique to the gene expression vector? A) Multiple cloning site (MCS) B) Origin of replication (Ori) C) Drug resistance gene D) Ribosomal binding site (RBS) 3) The energy released in the formation of a noncovalent bond is about: A) 0.1-0.5 kcal/mol B) 1-5 kcal/mol C) 5-20 kcal/mol D) 50-100 kcal/mol 4) The translation of a mRNA molecule can begin before synthesis of the mRNA is complete only in prokaryotes. The reason is A) Prokaryotes lack the mRNA processing mechanism, which prevents the translation during mRNA synthesis B) Related protein coding genes are clustered in prokaryotes, so they can be transcribed from a single start site into one mRNA encoding multiple proteins C) There are no nuclei in prokaryotes D) There are few non-coding gaps between the protein coding genes in prokaryotes E) All of the above 5) Which one(s) of the following processes involve(s) nucleotide base-pairing? A) DNA replication B) RNA transcription C) Protein synthesis D) A and B E) A and B and C

6) Which of the following processes used in recombinant DNA technology requires ATP? A) Ligation B) PCR C) Restriction endonuclease digestion D) Transformation E) All of the above 7) All of the following statements about enzymes are true except A) Enzymes typically react with many different substrates B) Enzymes lower the activation energy of a reaction C) Enzymes increase the rate of a reaction D) Enzymes catalyze reactions in aqueous solutions 8) The percentage of GC base pairs in a DNA molecule is related to the Tm because: A) The stability of GC and AT base pairs is intrinsically different. B) AT base pairs require a higher temperature for denaturation. C) The triple bonds of GC base pairs are less stable than the double bonds of AT base pairs. D) The GC content equals the AT content E) None of the above 9) Starch, a polymer of glucose, is linked mainly by A) (14) bond B) (16) bond C) (14) bond D) (16) bond E) None of the above 10) ATGGACTACTTAGGA is the start of a DNA molecule that encodes a protein. ATG is the start codon. Which of the following mutation would lead to the biggest change of the protein sequence? A) Single mutation: ATGGAATACTTA B) Double mutations: ATGGAATATTTA C) Three nucleotides deletion: ATG_ _ _TACTTA D) One nucleotide insertion: ATGGACATACTTA E) Triple mutations: ATGGCATATTTA 11) Which of the following structure is present in both prokaryotes and eukaryotes? A) Nucleus B) Mitochondrion C) Ribosome D) Plasma membrane E) Both C and D
2

12) In order for a plasmid to be useful as a cloning vector, it should contain all of the following except A) an origin of replication B) an antibiotic resistance marker C) sensitivity to Ca2+ ions for transformation D) a polylinker 2. (10). Draw a scheme of an expression vector in eukaryotes. List all basic elements and their functions.

Promoter: a specific DNA sequence that binds RNA polymerase with high affinity Terminator: a specific polyadenylation signals DNA sequence that terminates transcription and

Orieuk: eukaryotic origin of replication OriE: origin of replication in E. coli ESM: eukaryotic selectable marker MCS: multiple cloning site Drug resistance gene: selective marker

3. (4) The restriction enzyme AluI recognizes the sequence AGCT. Based on probability considerations, how many AluI recognition sites would be expected in a 5-kb plasmid?

4. (10). Briefly describe the difference between DNA and RNA? (Hint: compare structure and function roles) Sugar: Deoxyibose vs ribose Nucleotide bases: ATCG vs AUCG Structure: Double strand vs single strand Major Function: carrying genetic information vs protein synthesis Major localization (Eukaryotes): nucleus vs Cytosol Stability: Generally, DNA is more stable than RNA * Full credits will be given to provide 4 differences (each 2.5 points).

5. (10). List the three main types of RNAs. Describe their roles in protein synthesis. Please discuss specifically the chemical bonds involved in the functions of tRNA. 1) mRNA: message RNA; tRNA: transfer RNA; rRNA: ribosomal RNA (3) 2) mRNA carries genetic information for protein synthesis. mRNA is translated into protein by the joint action of tRNA, which recognizes the codons on mRNA, and the ribosome, which is composed of numerous proteins and two major rRNAs. (3) 3) tRNA can base-pair with codons in mRNA by hydrogen bond.(2) tRNA can link to a particular amino acid by covalent bonds. (2) Other noncovalent bonds involved in tRNA-enzyme reactions (w/ amino-acyl-tRNA synthase, ribosome, etc) (not required to get the full credit)

6. (5). A criminal leaves a single hair, containing about 10 to 20 picograms (10-12g) of DNA, at the scene of a crime. To characterize a small portion of this DNA and determine whether or not it matches the same region of DNA from a tissue from your prime suspect, you need about 10 to 100 nanogram (10-9g) of DNA from the crime scene. How would you go about obtaining sufficient DNA to compare the two samples? What information would you need before you could proceed? To obtain enough DNA for comparison, PCR amplification is needed. Information about DNA sequence at target regions should be known, in order to design PCR primers and then to amplify target DNA sequences for specific comparison. 7. (10). The coding sequence of a eukaryotic protein of interest is known. a) Determine the amino acid sequence encoded by the following mRNA: CGAUCGACGAUGUUUCUAAAAGUAUCUCAUCGAAAUGAGGGUUCGUAA UAGCGACCCGGGCGG (3) MetPheLeuLysValSerHisArgAsnGluGlySer b) What is the difference between a genomic and a cDNA library? (4) A genomic library contains all the DNA in a particular organisms genome (any introns, extrons, and any other non-coding DNA such as protein-binding sequences) A cDNA library contains double-stranded DNA copies of expressed mRNA. If the cDNA is derived from eukaryotic cells, they include only the exons or coding sequences the introns are not present. c) Which library, genomic or cDNA, would you use for the expression cloning of this protein in E. coli? Justify your answer. (3) cDNA library(1). This is a protein from eukaryote whose gene will contain introns. E. coli is a prokaryote without the machinery to process introns from eukaryotic DNA. So the cDNA library which has the introns already processed should be used for the expression cloning (2)

8. (15). Given the following dsDNA sequence. 5-GTAGAATTCC-3 3-CATCTTAAGG-5 a) Please identify the restriction site within this segment of DNA. Describe how you find it. (4)
5

5-GAATTC-3. (2) Because this is an inverted repeat (palindromic) sequence. (2) b) However, this sequence cannot be digested by the restriction enzyme that recognizes this site. If the enzyme and the reaction conditions are both OK, what could be the reason? (3) The nucleotides within this sequence are methylated. (3) *Full credit will be given mentioning the restriction-modification system. c) The Tm for this dsDNA is 60C. At 60C, for the reaction dsDNAssDNA1+ssDNA2, what is the dissociation constant (The initial concentration of the dsDNA is 1M, neglect the influence of ion concentration). (6) At Tm, half of the dsDNA is denatured (2), thus [dsDNA]=0.5M, [ssDNA1]= [ssDNA2]=0.5M (2) Kd=[ssDNA1]*[ssDNA2]/ [dsDNA]=0.5M (2) d) Given the same condition as in c). If the concentration of the single strand 5-GTAGTTAACC-3 is doubled, how the Kd will be affected?(2) Kd will remain unchanged because Kd is a thermodynamics parameter which is not affected by concentrations of reactants or products.