Sunteți pe pagina 1din 33
MINISTÉRIO DA AGRICULTURA PECUÁRIA E ABASTECIMENTO LABORATÓRIO NACIONAL AGROPECUÁRIO SEMINÁRIO DE HABILITAÇÃO DE

MINISTÉRIO DA AGRICULTURA PECUÁRIA E

ABASTECIMENTO

LABORATÓRIO NACIONAL AGROPECUÁRIO

SEMINÁRIO DE HABILITAÇÃO DE TÉCNICOS EM DIAGNÓSTICO DA AIE
SEMINÁRIO DE HABILITAÇÃO
DE TÉCNICOS EM
DIAGNÓSTICO DA AIE

Anemia Infecciosa Equina AIE

INTRODUÇÃO

Anemia Infecciosa Equina AIE INTRODUÇÃO  AIE é a principal enfermidade da equideocultura mundial  Rebanho

AIE é a principal enfermidade da equideocultura mundial

Rebanho mundial: 120 milhões de eqüídeos

Brasil: terceira maior população mundial

de eqüideos

(FAO, 2002)

Rebanho eqüídeo nacional: 8.382.425

(IBGE, 2003)

Anemia Infecciosa Equina AIE

HISTÓRICO

Anemia Infecciosa Equina AIE HISTÓRICO  O vírus da AIE foi o 1º vírus animal a

O vírus da AIE foi o 1º vírus animal a ser descrito

FRANÇA: Lignée, 1843; Vallée e Carré, 1904

BRASIL:

Primeiro diagnóstico;

extinto estado da Guanabara animais da raça Puro Sangue Inglês (PSI) Jóquei Clube Brasileiro

Sideroleucócitos Inoculação de animais

Dupont et al., 1968

Anemia Infecciosa Equina

AIE

Envelopado

gp90 → adsorção

viral

p26 + abundante cerne viral

+ conservada

RNA

Transcriptase

reversa

ETIOLOGIA

+ conservada  RNA  Transcriptase reversa ETIOLOGIA Gp. superfície g p 90 e n v
Gp. superfície g p 90 e n v Gp. transmembrana AIE ( 1º Lentivírus a
Gp. superfície
g p 90
e n v
Gp. transmembrana
AIE
( 1º Lentivírus a ser descrito)
g p 45
e n v
Proteína
p 15
p 26
Duas moléculas
RNA
RT
Transcriptase
Reversa
pol

Anemia Infecciosa Equina AIE

Família Retroviridae Gêneros:

Lentivírus

Spumavírus

Gammaretrovírus

Deltaretrovírus

Alfaretrovirus

Epsilonretrovírus

ETIOLOGIA

Deltaretrovírus Alfaretrovirus Epsilonretrovírus ETIOLOGIA RETROVÍRUS DE IMPORTÂNCIA VETERINÁRIA  Vírus da

RETROVÍRUS DE IMPORTÂNCIA VETERINÁRIA

Vírus da anemia infecciosa equina (EIAV).

Vírus maedi-visna (MVV).

Vírus da artrite-encefalite caprina (CAEV).

Leucose Enzoótica Bovina.

Vírus da Leucemia Felina (FeLV).

Vírus da Imunodeficiência Felina (FIV).

RETROVÍRUS DE IMPORTÂNCIA HUMANA

HIV - Vírus da Imunodeficiência Humana.

HTLV - Vírus T- Linfotrópico.

AIE

( 1º Lentivírus a ser descrito)

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE REPLICAÇÃO RETROVÍRUS - AIE Persistência viral !!!

REPLICAÇÃO RETROVÍRUS - AIE

Persistência viral !!!
Persistência viral !!!

Anemia Infecciosa Equina AIE

TRANSMISSÃO

Forma natural:

Anemia Infecciosa Equina AIE TRANSMISSÃO  Forma natural: picada interrompida de insetos hematófagos. Família

picada interrompida de insetos hematófagos.

Família Tabanidae

Raio ação durante alimentação: ~ 200m

hematófagos. Família Tabanidae Raio ação durante alimentação: ~ 200m Hawkins et al., 1976; Issel e Foil,

Hawkins et al., 1976; Issel e Foil, 1984

hematófagos. Família Tabanidae Raio ação durante alimentação: ~ 200m Hawkins et al., 1976; Issel e Foil,

Anemia Infecciosa Equina AIE

TRANSMISSÃO

Iatrogênica:

Anemia Infecciosa Equina AIE TRANSMISSÃO  Iatrogênica: fômites contaminados com sangue infectado. Instrumentos

fômites contaminados com sangue infectado.

Iatrogênica: fômites contaminados com sangue infectado. Instrumentos cirúrgicos Williams et al., 1981 Arreios

Instrumentos cirúrgicos

Williams et al., 1981

Arreios

com sangue infectado. Instrumentos cirúrgicos Williams et al., 1981 Arreios Esporas Seringas 9 6 h o

Esporas

com sangue infectado. Instrumentos cirúrgicos Williams et al., 1981 Arreios Esporas Seringas 9 6 h o
com sangue infectado. Instrumentos cirúrgicos Williams et al., 1981 Arreios Esporas Seringas 9 6 h o

Seringas

96 horas

Anemia Infecciosa Equina AIE

TRANSMISSÃO

Anemia Infecciosa Equina AIE TRANSMISSÃO  Transplacentária, colostro e sêmen: pode ocorrer, mas com menor

Transplacentária, colostro e sêmen:

pode ocorrer, mas com menor importância epidemiológica

disseminação menos eficiente dependente da fase da doença viremia

Kemen Jr. e Coggins, 1972; Tashjian, 1984; Clabough, 1990

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE Contato vírus AIE IMUNOPATOGÊNESE Alta freqüência de mutações genéticas - TR

Contato vírus

AIE

IMUNOPATOGÊNESE

Alta freqüência de mutações genéticas - TR

Alteração epitopos virais Escape da resposta imune neutralizante
Alteração epitopos virais Escape da resposta imune neutralizante
Alteração epitopos virais

Alteração epitopos virais

Alteração epitopos virais Escape da resposta imune neutralizante
Alteração epitopos virais Escape da resposta imune neutralizante
Escape da resposta imune neutralizante

Escape da resposta imune neutralizante

Replicação viral em macrófagos

tissulares do fígado, baço, linfonodos, pulmão

VIREMIA

ALTERAÇÕES NO GENOMA

NOVAS VARIANTES ANTIGÊNICAS

RESPOSTA IMUNE ALTA E DURADORA

Controle dependente de células B e T

Controle dependente de células B e T

Controle dependente de células B e T
Controle dependente de células B e T

Replicação viral abaixo do limiar de indução da doença

Habilidade de sofrer rápida variação antigênica:

persistência viral e obstáculo ao desenvolvimento de vacinas

Anemia Infecciosa Equina AIE

EPIDEMIOLOGIA

Anemia Infecciosa Equina AIE EPIDEMIOLOGIA  Distribuição mundial – NOTIFICAÇÃO OBRIGATÓRIA 
Anemia Infecciosa Equina AIE EPIDEMIOLOGIA  Distribuição mundial – NOTIFICAÇÃO OBRIGATÓRIA 

Distribuição mundial NOTIFICAÇÃO OBRIGATÓRIA

Susceptibilidade: somente espécies da família Equidae

equinos - muares - asininos

Mais prevalente em áreas de clima quente e úmido

Anemia Infecciosa Equina AIE

EPIDEMIOLOGIA

Anemia Infecciosa Equina AIE EPIDEMIOLOGIA  Animais assintomáticos são importantes fonte de infecção 95% dos

Animais assintomáticos são importantes fonte de infecção

Animais assintomáticos são importantes fonte de infecção 95% dos infectados são assintomáticos Razão para grande
95% dos infectados são assintomáticos
95% dos infectados são
assintomáticos

Razão para grande importância do diagnóstico laboratorial !!!!

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE EPIDEMIOLOGIA – Situação da AIE no Brasil  TABELA 1 Demonstrativo epidemiológico

EPIDEMIOLOGIA Situação da AIE no Brasil

TABELA 1

Demonstrativo epidemiológico da AIE no Brasil, 1993 a 2004.

Fonte: Ministério da Agricultura Pecuária e Abastecimento, 2004.

 
ANIMAIS
ANIMAIS

ANIMAIS

  ANIMAIS POSITIVOS

POSITIVOS

ANOS

FOCOS

POSITIVOS

 

EXAMINADOS

EXAMINADOS
EXAMINADOS
  EXAMINADOS (%)

(%)

1993

1.669

238.198

4.055

1,70

1994

1.633

145.880

3.799

2,60

1995

1.562

178.813

4.145

2,32

1996

1.471

186.583

4.322

2,32

1997

1.592

137.226

8.382.425

131.991

 

4.476

3,26

1998

1.621

3.689

2,79

1999

1.841

156.152

4.037

2,59

2000

1.964

235.739

4.446

1,89

2001

2.334

200.854

2.243

2,11

2002

2.299

220.652

3.892

1,76

2003

3.616

340.928

7.513

2,20

2004

3.135

310.346

7.865

2,53

TOTAL

24.737

2.483.362

56.482

 

2,27

340.928 7.513 2,20 2004 3.135 310.346 7.865 2,53 TOTAL 24.737 2.483.362 56.482   2,27
340.928 7.513 2,20 2004 3.135 310.346 7.865 2,53 TOTAL 24.737 2.483.362 56.482   2,27
340.928 7.513 2,20 2004 3.135 310.346 7.865 2,53 TOTAL 24.737 2.483.362 56.482   2,27
340.928 7.513 2,20 2004 3.135 310.346 7.865 2,53 TOTAL 24.737 2.483.362 56.482   2,27

~ 2%

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE EPIDEMIOLOGIA – Situação da AIE no Brasil  Distribuição regionalizada  Mais

EPIDEMIOLOGIA Situação da AIE no Brasil

Distribuição regionalizada

Mais prevalente em áreas de clima quente e úmido como Mato Grosso e Roraima.

áreas de clima quente e úmido como Mato Grosso e Roraima.  Pantanal: estima-se que mais
áreas de clima quente e úmido como Mato Grosso e Roraima.  Pantanal: estima-se que mais

Pantanal: estima-se que mais de 50% dos animais

estejam contaminados

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE Almeida, 2005  FIGURA 1 Prevalência da AIE em eqüídeos de serviço,
Anemia Infecciosa Equina AIE Almeida, 2005  FIGURA 1 Prevalência da AIE em eqüídeos de serviço,

Almeida, 2005

FIGURA 1

Prevalência

da AIE em

eqüídeos de serviço, por

estrato, em

Minas Gerais.

PREVALÊNCIA X ESTRATÉGIAS DE CONTROLE PREVALÊNCIA X CONDIÇÕES SOCIOECONÔMICA

Anemia Infecciosa Equina AIE

DIAGNÓSTICO

Anemia Infecciosa Equina AIE DIAGNÓSTICO  Clínico - Deve ser considerado sempre em associação com o

Clínico - Deve ser considerado sempre em associação com o

diagnóstico laboratorial

Laboratorial:

IDGA Imunodifusão em gel de ágar

OFICIAL

ELISA Ensaio Imunoenzimático

PCR Reação em cadeia pela polimerase

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE DIAGNÓSTICO – Sinais Clínicos  TABELA 2: Formas clínicas da AIE (

DIAGNÓSTICO Sinais Clínicos

TABELA 2: Formas clínicas da AIE ( Montelaro et al., 1996 )

AGUDA CRÔNICA ASSINTOMÁTICA
AGUDA
CRÔNICA
ASSINTOMÁTICA

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE DIAGNÓSTICO – Sinais Clínicos  Em eqüídeos assintomáticos pode ocorrer o

DIAGNÓSTICO Sinais Clínicos

Infecciosa Equina AIE DIAGNÓSTICO – Sinais Clínicos  Em eqüídeos assintomáticos pode ocorrer o

Em eqüídeos assintomáticos

pode ocorrer o reaparecimento da forma crônica em casos de estresse ou administração de corticóides.

Anemia Infecciosa Equina AIE

PRINCÍPIO DO IDGA

Baseia-se na migração

radial dupla de Ag e Ac

através do gel de ágar

SCP 3 1 Ag SCP SCP 2
SCP
3
1
Ag
SCP
SCP
2
Ag e Ac através do gel de ágar SCP 3 1 Ag SCP SCP 2 

O encontro dos reagentes, em proporções ótimas, leva à formação

de complexos Ag-Ac insolúveis que precipitam, tornando-se visíveis sob a forma de uma linha ou banda de precipitação.

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE POSSÍVEIS INTERPRETAÇÕES DO IDGA  Negativo  Positivo  Fraco Positivo 

POSSÍVEIS INTERPRETAÇÕES DO IDGA

Negativo

Positivo

Fraco Positivo

Forte Positivo

Inespecífico

Anemia Infecciosa Equina AIE

PRINCÍPIO DO ELISA

Anemia Infecciosa Equina AIE PRINCÍPIO DO ELISA  As técnicas imunoenzimáticas são baseadas na utilização de

As técnicas imunoenzimáticas são baseadas na utilização de Ag ou Ac marcados com enzimas e permitem a detecção e titulação de substâncias de interesse biológico.

Anemia Infecciosa Equina

AIE

PRINCÍPIO DO ELISA

ANTÍGENOAnemia Infecciosa Equina AIE PRINCÍPIO DO ELISA SORO TESTE CONJUGADO anti-espécie c\ enzima SUBSTRATO 1 2

Anemia Infecciosa Equina AIE PRINCÍPIO DO ELISA ANTÍGENO SORO TESTE CONJUGADO anti-espécie c\ enzima SUBSTRATO 1

SORO

TESTE

CONJUGADO anti-espécie c\ enzimaAnemia Infecciosa Equina AIE PRINCÍPIO DO ELISA ANTÍGENO SORO TESTE SUBSTRATO 1 2 3 4 5

Infecciosa Equina AIE PRINCÍPIO DO ELISA ANTÍGENO SORO TESTE CONJUGADO anti-espécie c\ enzima SUBSTRATO 1 2

SUBSTRATO

1
1
2
2
3
3
Infecciosa Equina AIE PRINCÍPIO DO ELISA ANTÍGENO SORO TESTE CONJUGADO anti-espécie c\ enzima SUBSTRATO 1 2
4
4
5
5
Infecciosa Equina AIE PRINCÍPIO DO ELISA ANTÍGENO SORO TESTE CONJUGADO anti-espécie c\ enzima SUBSTRATO 1 2

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE CINÉTICA DA RESPOSTA HUMORAL ÀS PROTEÍNAS E GLICOPROTEÍNAS DO VÍRUS DA AIE

CINÉTICA DA RESPOSTA HUMORAL ÀS PROTEÍNAS E

GLICOPROTEÍNAS DO VÍRUS DA AIE

V1 V3 V2 gp90 gp45 p26 Concentração Ac
V1
V3
V2
gp90
gp45
p26
Concentração Ac

Tempo

IDGA ( p26 ) falsos negativos em animais infectados a 14 dias ou menos ELISA ( gp90 ) - detecção com 7 a 10 dias PCR fragmentos de DNA detectado de 3 a 4 dias pós infecção

Anemia Infecciosa Equina AIE

PRINCÍPIO DO PCR

Anemia Infecciosa Equina AIE PRINCÍPIO DO PCR  Técnica de amplificação de um fragmento específico de

Técnica de amplificação de um fragmento específico

de um genoma, ou parte dele, sob condições definidas de

temperatura e utilizando-se iniciadores específicos. (primers)

EXTRAÇÃO

DNA

Coleta Sangue
Coleta
Sangue

Molde para

PCR

EXTRAÇÃO DNA Coleta Sangue Molde para PCR PBMC Extração de DNA DNA total (vírus + célula)
EXTRAÇÃO DNA Coleta Sangue Molde para PCR PBMC Extração de DNA DNA total (vírus + célula)

PBMC

EXTRAÇÃO DNA Coleta Sangue Molde para PCR PBMC Extração de DNA DNA total (vírus + célula)
EXTRAÇÃO DNA Coleta Sangue Molde para PCR PBMC Extração de DNA DNA total (vírus + célula)
Extração de DNA
Extração de
DNA

DNA total (vírus + célula)

PCR PBMC Extração de DNA DNA total (vírus + célula) FENOLCLOROFÓRMIO PROTEINA K NaOH Etc Lise

FENOLCLOROFÓRMIO

PROTEINA K

NaOH

Etc

de DNA DNA total (vírus + célula) FENOLCLOROFÓRMIO PROTEINA K NaOH Etc Lise Celular Digestação de
de DNA DNA total (vírus + célula) FENOLCLOROFÓRMIO PROTEINA K NaOH Etc Lise Celular Digestação de

Lise Celular

Digestação de Proteínas

Etc

COMPONENTES DA PCR

Fita molde:

5’ ▬▬▬ ATGTACCATTGCGAGAAGCCTAA▬▬▬3’ 3’ ▬▬▬ TACATGGTAACGCTCTTCGGATT▬▬▬5’

3’ ▬▬▬ TACATGGTAACGCTCTTCGGATT ▬▬▬5’ Iniciadores (Primers): ▬▬▬ TACATGGCCTAA ▬▬▬

Iniciadores (Primers): ▬▬▬TACATGGCCTAA▬▬▬

dNTPs: deoxinucleotídeos

Adenina (A), timina (T), guanina (G), citosina (C)

Enzima: DNA polimerase, resistente a várias temperaturas

Enzima: DNA polimerase, resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g
Enzima: DNA polimerase, resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g

Iniciadores

Taq DNA polimerase

resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g c a t
resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g c a t

DNA

resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g c a t
resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g c a t

c a t g

c a t g Nucleotídeos

resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g c a t

Tampão

resistente a várias temperaturas Iniciadores Taq DNA polimerase DNA c a t g c a t

REAÇÃO EM CADEIA DA POLIMERASE

PCR

R EAÇÃO EM C ADEIA DA P OLIMERASE PCR DESNATURAÇÃO ANELAMENTO EXTENSÃO
DESNATURAÇÃO ANELAMENTO EXTENSÃO
DESNATURAÇÃO
ANELAMENTO
EXTENSÃO
R EAÇÃO EM C ADEIA DA P OLIMERASE PCR DESNATURAÇÃO ANELAMENTO EXTENSÃO

REAÇÃO EM CADEIA DA POLIMERASE

R EAÇÃO EM C ADEIA DA P OLIMERASE
R EAÇÃO EM C ADEIA DA P OLIMERASE

Anemia Infecciosa Equina AIE

Anemia Infecciosa Equina AIE PRINCÍPIO DO PCR 2072 pb 1000 800 500 400 329 pb 300

PRINCÍPIO DO PCR

Anemia Infecciosa Equina AIE PRINCÍPIO DO PCR 2072 pb 1000 800 500 400 329 pb 300
2072 pb 1000 800 500 400 329 pb 300 200 100 ELETROFORESE Cuba de Eletroforese
2072 pb
1000
800
500
400
329 pb
300
200
100
ELETROFORESE
Cuba de
Eletroforese
corrente elétrica
X
peso molecular

Anemia Infecciosa Equina AIE

CONTROLE DA AIE

Anemia Infecciosa Equina AIE CONTROLE DA AIE  Uso de seringas e agulhas descartáveis  Limpeza

Uso de seringas e agulhas descartáveis

Limpeza dos utensílios utilizados nos animais

e agulhas descartáveis  Limpeza dos utensílios utilizados nos animais Hipoclorito de sódio (cloro livre a

Hipoclorito de sódio (cloro livre a 100 ppm)

Anemia Infecciosa Equina

AIE

CONTROLE DA AIE

Anemia Infecciosa Equina AIE CONTROLE DA AIE  Isolamento dos animais positivos até o sacrifício Uso

Isolamento dos animais positivos até o sacrifício

Uso de telas protetoras > 200 m

Não permitir a amamentação e realizar o isolamento de potros nascidos de éguas positivas

potro < 6 meses isolado mín. 60 dias 02 exames -

de potros nascidos de éguas positivas potro < 6 meses isolado mín. 60 dias 02 exames

Intervalo 30-60 dias

de potros nascidos de éguas positivas potro < 6 meses isolado mín. 60 dias 02 exames

Anemia Infecciosa Equina AIE

CONTROLE DA AIE

Anemia Infecciosa Equina AIE CONTROLE DA AIE  Exame de todos os eqüídeos que forem realizar

Exame de todos os eqüídeos que forem realizar trânsito

Exame de todos os eqüídeos que forem realizar trânsito  Realização de exame em todas aglomerações
Exame de todos os eqüídeos que forem realizar trânsito  Realização de exame em todas aglomerações
Exame de todos os eqüídeos que forem realizar trânsito  Realização de exame em todas aglomerações

Realização de exame em todas aglomerações de eqüídeos

que forem realizar trânsito  Realização de exame em todas aglomerações de eqüídeos (leilões e feiras)

(leilões e feiras)

FIM !!!

FIM !!!