Sunteți pe pagina 1din 25

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp.

prezent n stupinele din zona Transilvaniei

UNIVERSITATEA DE TIINE AGRICOLE I MEDICIN VETERINAR CLUJ-NAPOCA COALA DOCTORAL FACULTATEA DE ZOOTEHNIE I BIOTEHNOLOGII

Ing. chimist ANTONIA CRISTINA MARIA M. ODAGIU

TEZ DE DOCTORAT
CERCETRI PRIVIND DEZVOLTAREA I VALIDAREA UNEI METODE DE GENOTIPIZARE A PARAZITULUI VARROA SP. PREZENT N STUPINELE DIN ZONA TRANSILVANIEI
(REZUMAT AL TEZEI DE DOCTORAT)

CONDUCTOR TIINIFIC Prof. univ. dr. AUGUSTIN VLAIC

CLUJ NAPOCA 2010


229

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Teza de doctorat intitulat CERCETRI PRIVIND DEZVOLTAREA I VALIDAREA UNEI METODE DE GENOTIPIZARE A PARAZITULUI VARROA SP. PREZENT N STUPINELE DIN ZONA TRANSILVANIEI i propune dezvoltarea unei metode de identificare a genotipului cruia i aparine parazitul Varroa sp. prezent n stupinele din Transilvania, precum i caracterizarea parametrilor de performan a metodei n condiiile Laboratorului Zonal de Genotipizare a Animalelor al Universitii de tiine Agricole i Medicin Veterinar Cluj Napoca, n vederea validrii procedurii.

INTODUCERE
Datorit importanei mierii ct i a produselor apicole secundare (polen, lptior de matc, propolis, cear) tributar factorilor nutritivi pe care i conin precum i aciunii terapeutice a acestora, prevenirea i combaterea bolilor albinelor constituie una dintre preocuprile majore ale apicultorilor pe plan mondial (Bura M., 1996; Dezmirean D. i colab., 2008; Mrghita L. Al., 2002). Un alt factor ce contribuie la importana pstrrii strii de sntate a albinelor, l constituie calitatea lor de vector n procesul de polenizare al plantelor, dar i de perspectivele deschise de progresul biotehnologiilor care le transform n virtuali ageni de vehiculare al transgenelor provenite de la plantele modificate genetic (Dezmirean D. i colab., 2007; Rakosy-Tican Elena, 2005). n acest context, o tot mai mare importan se acord factorilor genetici care sunt implicai n rezistena natural a unor specii sau populaii de albine la ageni patogeni specifici, sau parazii, dar i a paraziilor la aciunea produselor destinate combaterii lor.

230

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

CAPITOLUL I ASPECTE PRIVITOARE LA COMPORTAMENTUL IGIENIC AL APIS MELLIFERA L.


Bolile albinelor pot fi de natur necontagioas sau contagioas. Cele de natur necontagioas au cauze fiziologice, pe cnd cele contagioase sunt provocate de ageni bacterieni, virali, micotici, sau parazii (Mrghita L. Al., 2002). Datorit efectelor sale extrem de nocive i rspndirii largi Varroa destructor (jacobsoni) constituie o problem major pentru apicultorii din ntreaga lume. Varroa sp. este un parazit ce face parte din regnul Animalia, ncrengtura Arthropoda, Clasa Arachnida, Ordinul Acari, Familia Parasitidae, Genul Varroa, Specia destructor (Drees B.M. i colab., 1999). Combaterea eficient a parazitului constituie una dintre cele mai mari provocri ale apicultorilor din ntreaga lume (Tew J. E., 2000; Moosbeckhofer R. i colab., 2003; Donz G., 1998; Al-Abbadi A. i colab., 2003). Una dintre cele mai mari probleme ale apicultorilor de azi const n rezistena parazitului la tratamentul cu Apistan (pesticid piretroid avnd component activ tau fluvalinatul), una dintre substanele cu cea mai mare utilizare n combaterea Varroa destructor, dar i la cele cu Amitraz i Cumafos (Pettis J. S., 2003). Rezistena parazitului Varroa sp. la principalii produi de combatere, bazai pe piretroizi s-ar putea explica prin mecanisme identificate la momentul de fa. Aceasta, ns, n contextul mai larg al dezvoltrii rezistenei la pesticide att a plantelor ct i al altor organisme (echinoderme, insecte, arahnide etc.), care se pare c sunt guvernate de procese similare (Doyle K. i colab., 1991; Sibbesen O. i colab., 1995; Besten P.J., 1998; Valles S.M. i colab., 2003; Tan J. i colab., 2005; Eleftherianos I. i colab., 2008, .a.). Unul dintre ele este reprezentat de prezena anumitor esteraze (monooxigenazele), care stau la baza unui mecanism metabolic de rezisten specific, mediat de acestea detoxifierea. n prezena monooxigenazelor piretroizii sintetici sunt oxidai, ceea ce conduce la anihilarea activitii lor toxice asupra paraziilor (Sammataro Diana i colab., 2005). Aceste monooxigenaze fac parte dintr-un grup mai extins (Lewis D. F.V., 2001) localizat n reticulul endoplansmatic i este desemnat ca Citocrom P 450 (CYP sau P450). Acestea
231

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

aparin superfamiliei de proteine care conin cofactorul Hem (hemoproteine). Denumirea atribuit acestui grup enzimatic se datoreaz localizrii celulare a acestora (cito), dar i caracteristicilor spectrofotometrice (crom) cnd fierul din Hem este redus, P450 absoarbe radiaiile luminoase cu lungimea de und carcteristic de 450 nm. Reacia de baz prin care Citocromul P450 i manifest rolul catalitic, este tipic monooxigenazelor (oxidare prin introducerea unui atom de oxigen ntr-un substrat organic RH i reducere prin formarea apei cu participarea celuilalt atom de oxigen): RH + O2 + 2H+ + 2e ROH + H2O La echinoderme a fost evideniat dependena de P450 a metabolismului compuilor piretroidici (Besten P. J. i colab., 1990; Besten P. J., 1998). n cazul insectelor, a fost confirmat prezena oxidazelor din complexul enzimatic microzomal P450, care utilizeaz sistemul NADPH/NADH pentru a cliva reductor oxigenul atmosferic, conducnd la o funciune organic i o molecul de ap (Schuler Mary A., 1996; Dong K., 2007; Soderlund D. M., 2008). Descrierea acestor mecanisme a facilitat explicarea fenomenului de rezisten a parazitului Varroa sp. la piretroizi. Pe baza lor tulpinile rezistente la produii de combatere i-au dezvoltat capacitatea de a detoxifica insecticidele prin oxidare. Cellalt mecanism al rezistenei poate fi explicat prin mutaiile punctiforme produse la nivelul genei, care controleaz canalele sodiului. Canalele sodiului caracterizate de un potenial electric sunt constituite integral din proteine transmembranare i sunt responsabile de faza de cretere rapid a potenialului de aciune al celulei care face parte din categoria celor cu excitabilitate ridicat. Insecticidele piretroide au efect de reducere a cineticii activrii i dezactivrii canalului sodiului. Consecina direct este deschiderea prelungit a canalelor individuale, ceea ce conduce la paralizia i n final moartea insectelor ce vin n contact cu aceti compui (Wang R. i colab., 2002; Wang R. i colab., 2003; Wang, R. i colab., 2003). Multe dintre insectele ce prezint rezisten la piretroizi au suferit mutaii punctiforme la nivelul genei canalului sodiului. Teste efectuate asupra oocitelor de Xenopus ce au exprimate canalele sodiului, au demonstrat c aceste mutaii reduc sensibilitatea acestor canale la piretroizi, ceea ce confirm faptul c acesta reprezint mecanismul major de rezisten la piretroizi la diverse specii de insecte (Soderlund D.M. i colab., 2003).
232

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Wang R i colab. (2003) au reuit s evidenieze gena pentru canalul sodiului de la arahnide gena VmNa i la Varroa destructor O. Izolarea integral a genei VmNa a reprezentat un moment important pentru caracterizarea complet a modului de funcionare a acestui mecanism de rezisten la produse pe baz de piretroizi. Cel mai cunoscut mecanism de rezisten a albinelor la boli i duntori, pe baza cruia se poate realiza selecia, este datorat comportamentului igienic al acestora, descris iniial de Park O.W. (1937), citat de Morse, R.A. & Flottum, K. Eds., 1997. Acest comportament complex const n dou activiti distincte desfurate n dou etape successive (Lapidge K.L. i colab., 2002). Primul implic descpcirea celulelor n care se afl larvele infestate, iar cel de al doilea const n eliminarea efectiv a corpului larvei din celulele descpcite. Pornind de la constatrile lui Park (1937), Rothenbuhler (1964a,b) presupune existena a dou mecanisme diferite care stau la baza controlului acestor activiti. Conform acestei aseriuni, fiecare dintre aceste dou activiti este controlat de o gen cu dou alele, iar comportamentul este transmis la descendeni conform mecanismului mendeleean. Spre exemplu, dac mperecherea se produce ntre un trntor a crui comportament igienic este controlat de ambele alele recesive i o matc ce posed doar cte o alel recesiv pentru fiecare tip de comportament, vor rezulta doar doi descendeni (un trntor i o albin) ce posed ambele alele recesive (fig. 3).

Fig. 3. Transmiterea comportamentului igienic la Apis mellifera L. (http://members.aol.com/queenb95/genetics.html)


233

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

CAPITOLUL II BAZELE TEORETICE ALE METODOLOGIEI DE GENOTIPIOZARE A PARAZITULUI VARROA SP.


Dup prelevarea i conservarea probelor n condiiile impuse de protocol, procedeul implic: extracia ADN, amplificarea, restricia, migrarea n gel de agaroz i secvenierea. Izolarea ADN trebuie s fie caracterizat de o eficien ct mai mare, precum i de obinerea unei cantiti suficiente, de puritate corespunztoare, care mai apoi s poat fi utilizat n scopul amplificrii, migrrii i eventual secvenierii atunci cd scopul final al analizei o impune (Vlaic A., 1997; Vlaic A. i colab., 2005). Cea mai utilizat metod de cuantificare a probelor de ADN se bazeaz pe spectrofotometria de absorbie molecular n UV. Acizii dezoxiribonucleici dublu catenari prezint un maximum de absorbie la = 260 nm. Majoritatea probelor, ns, conin contaminani, respectiv proteine i ADN i/sau ARN unicatenar, cu un maximum de absorbie la = 280 nm. O alt categorie de contaminani specifici acestui tip de probe este reprezentat de fenoli i tiocianai, cu un maximum de absorbie la = 230 nm. Reacia n Lan a Polimerazei - PCR se bazeaz pe caracteristicile replicrii ADN-ului. Este o tehnic rapid, care permite obinerea n cantiti suficiente, pentru scopuri analitice, a unor fragmente specifice de ADN aflate iniial n cantiti foarte reduse. n studiul de fa s-a recurs la adoptarea tehnicii perfecionate de amplificare, respectiv Real Time PCR (RT PCR). Principiul metodei se bazeaz pe faptul c fiecare prob sufer o amplificare PCR n prezena unui fluorocrom prezent n amestecul de reacie, care produce fluorescen doar atunci cnd produsul specific este recunoscut sau sintetizat. Pragul de fluorescen rezult din analiza curbei de reacie i este determinat n partea liniar a acesteia. El corespunde fazei n care se nregistreaz cea mai mare eficien a amplificrii. Tehnica RFLP se bazeaza pe existena, n genomul organismului studiat (Varroa sp. n cazul de fa), a unor situs-uri de restricie, asupra crora acioneaz specific anumite enzime, numite enzime de restricie. n urma aciunii acestora, se produce tierea macromoleculei de ADN i obinerea unor fragmente de diferite lungimi. Distribuia situsurilor de restricie corespunztoare unei anumite enzime este specific pentru fiecare specie (Vlaic A. i colab., 2008).
234

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

CAPITOLUL III CONCEPTUL DE VALIDARE DE METODE


Procedura de validare a unei metode analitice nou elaborate sau existente urmrete demonstrarea faptului c acea metod corespunde scopului utilizrii pentru care a fost elaborat sau selectat i c performanele sale caracteristice, stabilite prin studii de laborator, satisfac cerinele pentru ca metoda s poat fi aplicat. Principalii parametri care fac obiectul validrii sunt: selectivitate/specificitate, precizie, exactitate, domeniul de lucru, liniaritate, limit de detecie, limit de cuantificare, robustee, sensibilitate, incertitudine. Aceste criterii sunt prevzute i n normele ISO i ale IUPAC i, prin urmare, i n nota explicativ a Comisiei de specialitate a Uniunii Europene.

CAPITOLUL IV SCOPUL OBIECTIVELE I IMPORTANA CERCETRII


Scopul tezei de doctorat a vizat dou problematici n strns conexiune, respectiv identificarea genotipului speciei care paraziteaz Apis mellifera carpatica L. n Transilvania, precum i propunerea spre validare a metodei de genotipizare pe baz de ADN provenit de la parazitul Varroa sp. n condiiile Laboratorului Zonal de Genotipizare a Animalelor Domestice a USAMV Cluj Napoca, lund n considerare prezena i importana comportamentului igienic al albinei melifere n rezistena la aciunea parazitului Varroa. Planul experimental al cercetrii a prevzut luarea n studiu a comportamentului igienic al albinelor localizate randomizat n stupine din cele 10 judee din Transilvania (Alba, Bistria - Nsud, Braov, Cluj, Covasna, Harghita, Hunedoara, Mure, Slaj i Sibiu), precum i dezvoltarea unei metode de genotipizare a parazitului Varroa sp. i validarea acesteia n condiiile Laboratorului Zonal de Genotipizare a Animalelor Domestice a USAMV Cluj - Napoca.
235

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Importana cercetrii La noi n ar, nu au fost efectuate studii moleculare asupra caracteristicilor parazitului Varroa sp. i de asemenea, nu a fost ntreprins un studiu integrat ce vizeaz implicarea comportamentul igienic al varietii autohtone de albine n rezistena la boli n greneral i la Varroa sp. n particular. Procedeul de validare a unei metode analitice nou elaborate sau existente urmrete demonstrarea faptului c acea metod corespunde scopului utilizrii pentru care a fost elaborat sau selectat i c performanele sale caracteristice, stabilite prin studii de laborator, satisfac cerinele pentru ca metoda s poat fi aplicat (Kennedy S., 1997). n validarea metodelor analitice principalii parametri care fac obiectul validrii sunt: selectivitate/specificitate, precizie, exactitate, domeniul de lucru, liniaritate, limit de detecie, limit de cuantificare, robustee, sensibilitate i incertitudine. Aceste criterii sunt prevzute i n normele ISO i IUPAC . Enunate fiind principiile generale care stau la baza procedeelor de validare, trebuie subliniat faptul c acestea prezint caracteristici specifice pentru fiecare tip de analiz i, de asemenea, sunt specifice i pentru laboratoarele n care sunt aplicate. n consecin, implementarea acestora n laboratoarele de genetic molecular prezint o serie de particulariti, trebuind s rspund unor exigene specifice (OECD, 2007; Jennings L. i colab., 2009). n acest context, prezentul studiu i aduce aportul la caracterizarea metodei analitice de de izolare, cuantificare i amplificare a ADN din parazitul Varroa destructor O. Din punct de vedere al performanelor analitice i totodat rezultatele obinute permnit ncadrarea aacestora n categoria celor care pot parcurge cu succes exigenele procedeelor de validare n condiiile asigurrii calitii n laboratoarele de biologie molecular (IUPAC, ISO: 2005, 17025). Genotipizarea are un potenial ridicat n depistarea tulpinilor aparinnd Varroa sp. care au dezvoltat rezisten la tratamentul chimic i a cror existen a fost demonstrat nc din anii 90 (ben Hamida T., 1997). n urma aplicrii genotipizrii i confruntrii cu datele din literatur se pot evita cheltuieli inutile cu achiziionarea i

236

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

aplicarea tratamentelor cu Amitraz, Apistan, Cumafos .a. care se dovedesc ineficiente i aplicarea direct a unor soluii diferite de combatere.

CAPITOLUL V EVIDENIEREA COMPORTAMENTULUI IGIENIC LA APIS MELLIFERA CARPATICA L. DIN ZONA TRANSILVANIEI

Rezultatele obinute demonstreaz c n nici una dintre stupinele studiate, familiile de albine analizate nu au manifestat comportament igienic, procentul mediu de descpcire a nregistrat valoarea maxim n judeul Cluj, maximumul nregistrat fiind de 78,72%, situat mult sub limita de 91% de la care familiile de albine se consider c manifest rezisten natural la boli i parazii ca urmare a comportamentului igienic. Cea mai mic medie pentru procentul de descpcire a fost nregistrat n judeul Harghita, 67,54%.

CAPITOLUL VI REZULTATE PRIVIND DEZVOLTAREA METODEI DE GENOTIPIZARE A PARAZITULUI VARROA SP. PREZENT N STUPINELE DIN ZONA TRANSILVANIEI

Acest demers constituie un proces laborios care implic o succesiune de etape (fig. 30).

237

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Prelevarea probelor Izolarea ADN

Purificarea ADN

Amplificarea ADN Restricia produsului de amplificare cu enzimele SacI i XhoI Migrarea n gel de agaroz 2% i vizualizarea gelului Secvenierea

Identificarea genotipului Fig. 30. Etapele procesului de genotipizare a parazitului Varroa sp. n urma migrrii produsului de amplificare supus restriciei cu enzimele Xho I i Sac I a rezultat profilul electroforetic al celor 10 migrri, fiecare corespunztoare unei zone de colectare a paraziilor (fig. 36).

238

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

10

S S

700 pb

n
X X

n
X

n
X

n
X

n
X

n
X

n
X

n
X

n
X

n
400 pb 200 pb 150 pb

1- Alba, 2 Bistria Nsud, 3 Braov, 4 - Cluj, 5 - Covasna, 6 - Harghita, 7 - Hunedoara, 8 - Mure, 9 - Slaj, 10 Sibiu, X Xho I, S Sac I, n fragment nedigerat

Fig. 36. Profilul electroforetic al probelor de ADN provenit de la parazitul Varroa sp. obinut n urma restriciei cu enzimele Sac I i Xho I (original) Secvenierea a fost realizat de ctre compania Mycrosinth n Elveia. Rezultatele secvenierii au evideniat structura de interes prezent n subunitatea I a genei mitocondriale citocromoxidazei (CO I) a paraziilor aparinnd genotipului Varroa sp. recoltai din stupine localizate n Transilvania. A rezultat urmtoarea secven (n format FASTA):
ATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTTTGCCTGGTTTTGGTATTATTTCTCAGTA ATTTGTATACAGAGAGGGAAGAAGCAGCCTTTTGGAAATTTAGGGATAATTTACGCTATAATAACTATTG GTATTTTAGGTTTTATTGTATGAGCTCATCATATATTTACAGTAGGAATAGATATTGATACTCGAGCATAT TTTACTGCAGCTACAATAATTATTGCGGTTCCTACTGGTATTAAAATTTTTTCTTGATTAGCAACAATTCAT GGTTCTATAGTTAAATTAGATGTCCCAATAATTTGATCTTTAGGTTTTATTTTTTTATTTACTTTAGGGGGT ATTACTGGTGTAATTTTAGCTAATTCTTCTATTGATATTGTTTTACATGATACTTATTATGTAGTAGCACAT TTTCACTATGTATTAAGAATAGGGGCT

Compararea structurii secvenei izolate de noi din ADN provenit de la indivizi Varroa sp. prezeni n stupinele din Transilvania, cu genotipurile existente n baza de date NCBI, a crei rezultat a constat n suprapunerea de 100% cu secvenele cu numerele de acces AF106900.1, AJ84872.1.i AY372063.1 (fig. 40), a condus la constatatrea c genotipul Varroa existent n Transilvania coincide cu genotipul China 2, ce paraziteaz Apis cerana n Asia.
239

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct Query Sbjct

1 1 61 61 121 121 181 181 241 241 301 301 361 361 421 421

atttattttgattttttggacacccagaagtttatattttaattttgcctggttttggta |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTTTGCCTGGTTTTGGTA ttatttCTCATGTAATTTGTATACAGAGAGGGAAGAAGCAGCCTTTTGGAAATTTAGGGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTATTTCTCATGTAATTTGTATACAGAGAGGGAAGAAGCAGCCTTTTGGAAATTTAGGGA TAATTTACGCTATAATAACTATTGGTATTTTAGGTTTTATTGTATGAGCTCATCATATAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TAATTTACGCTATAATAACTATTGGTATTTTAGGTTTTATTGTATGAGCTCATCATATAT TTACAGTAGGAATAGATATTGATACTCGAGCATATTTTACTGCAGCTACAATAATTATTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTACAGTAGGAATAGATATTGATACTCGAGCATATTTTACTGCAGCTACAATAATTATTG CGGTTCCTACTGGTATTAAAATTTTTTCTTGATTAGCAACAATTCATGGTTCTATAGTTA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGGTTCCTACTGGTATTAAAATTTTTTCTTGATTAGCAACAATTCATGGTTCTATAGTTA AATTAGATGTCCCAATAATTTGATCTTTAGGTTTTAtttttttATTTACTTTAGGGGGTA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AATTAGATGTCCCAATAATTTGATCTTTAGGTTTTATTTTTTTATTTACTTTAGGGGGTA TTACTGGTGTAATTTTAGCTAATTCTTCTATTGATATTGTTTTACATGATACTTATTATG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTACTGGTGTAATTTTAGCTAATTCTTCTATTGATATTGTTTTACATGATACTTATTATG TAGTAGCACATTTTCACTATGTATTAAGAATAGGGGCT |||||||||||||||||||||||||||||||||||||| TAGTAGCACATTTTCACTATGTATTAAGAATAGGGGCT 458 458

60 60 120 120 180 180 240 240 300 300 360 360 420 420

Fig. 40. Secvenele genotipurilor originale China 2 (Anderson i Trueman, 2000; Ting Y. i colab., 2004; Solignac M. i colab., 2005) obinute pentru Varroa destructor i a celor obinute n stupinele din Transilvania

CAPITOLUL VII VALIDAREA METODEI DE GENOTIPIZARE A PARAZITULUI VARROA DESTRUCTOR O.


Pe baza testrii parametrilor de reacie implicai n procedeul de izolare a ADN din parazitul Varroa destructor O., a fost elaborat un flux de operaii care au avut drept rezultat dezvoltarea unei metode de izolare i cuantificare a ADN. n urma caracterizrii parametrilor de performan ai metodei (selectivitate/ specificitate, precizie, exactitate, parametrii analizei de regresie liniar, liniaritate, domeniul
240

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

de lucru, test de liniaritate, limit de detecie, limit de cuantificare robustee, i incertitudinea de msurare) a rezultat c procedeul are o capabilitate (proficiency) corespunztoare i este n conformitate cu scopul pentru care a fost selectat (tabelul 25). Tabelul 25 Gradul de ndeplinire a criteriilor de validare selectate pentru metoda spectrofotometric de absorbie molecular UV-VIS dezvoltat n vederea cuantificrii ADN izolat din parazitul Varroa destructor O.
Parametrul 1 Selectivitatea Obinerea Rezultat impus 2 spectrului de Rezultat realizat

absorbie molecular UV-VIS la = 230 nm, = 260 nm i respectiv = 280 nm, pentru diferite cantiti de ADN (ng/l) izolate de la parazitul Varroa destructor O. Tehnic specific Precizia Exactitatea Parametrii analizei de Curba regresie liniar RSD% < 3,50 85% R 105% de etalonare y = a + bx are o
y = 0,0675 + 0,0009x
Absorbana (Absorbance)

Repetabilitate RSD% = 1,98% Precizia intermediar RSD% = 1,64% R = 99,60%

reprezentare liniar de forma

Cantitatea de ADN extras din parazitul Varroa destructor O., ng/l Quantity of DNA extracted from Varroa destructor O. mite, ng/l

241

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Tabelul 25 continuare
1 Liniaritate 2
Cantitatea de ADN extras din parazitul Varroa destructor O., ng/l Quantity of DNA extracted from Varroa destructor O. mite, ng/l

3
800

Dispersie redus a valorilor individuale n jurul dreptei de regresie

750

700

650

600

550

500

450

400 -0,58 -0,08 0,42 0,92 1,42

Absorbana (Absorbance)

Domeniu de lucru

Testul

de

omogenitate

a PG = 1,484 Valoarea abaterii standard reziduale

dispersiilor Valoarea de ncercare PG < 5,35 Testul de liniaritate

(0,8139) indic o dispersie redus a valorilor individuale n jurul liniei de regresie calculate. Limita de detecie i Limita de cuantificare trebuie s limita de cuantificare fie superioar cu cel puin un ordin de mrime Limitei de detecie Robusteea Influena minim a variaiilor Metoda are un caracter robust, din parametrilor metodei ADN izolat din parazitul Varroa
Absorbana (Absorbance)

xLC = 0,002500 ng/l xLD = 0,000859 ng/l

punct de vedere a stabilitii n timp a

-Stabilitatea n timp a soluiei de soluiei de ADN (rproaapt, r48h i r96h). destructor O.

r = 0,9833

Cantitatea de ADN extras din parazitul Varroa destructor O., ng/l Quantity of DNA extracted from Varroa destructor O. mite, ng/l

- izolat ADN proaspt -

242

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Tabelul 25 continuare
1 2

Absorbana (Absorbance)

r = 0,9827

Cantitatea de ADN extras din parazitul Varroa destructor O., ng/l Quantity of DNA extracted from Varroa destructor O. mite, ng/l

- izolat ADN la 48 ore dup preparare


Absorbana (Absorbance)

r = 0,9759

Cantitatea de ADN extras din parazitul Varroa destructor O., ng/l Quantity of DNA extracted from Varroa destructor O. mite, ng/l

- izolat ADN la 96 ore dup preparare

-Influena temperaturii

Metoda are un caracter robust dac se lucreaz la temperatura ambiental normal 15 - 200C i se evit variaiile de temperatur (tabelul 21).

Incertitudinea msurare

de Stabilirea incertitudini.

bugetului

de Cea mai mare contribuie le bugetul de incertitudini este adus de volumul total de soluie supus cuantificri (soluie tampon + ADN izolat).
u_absorban (ADN) u_volum (Tips) Tipul incertitudinii (Type of incertitude) 0,025 0,1318 u_volum (Total) u_volum (Ap pur) u_volum (Nonidet) u_volum (tampon) u_volum (Eppendorf) 0,74767 0,407738 3,2363877 3,21066 4,391795 u_puritate (Tris)

0,0086592

5
Valoarea (Value)

243

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Tabelul 32 Gradul de ndeplinire a criteriilor de validare selectate pentru metoda de amplificare a fragmentului de ADN mitocondrial localizat la nivelul genei CO-I a parazitului Varroa destructor O.
Parametrul 1 Limita de detecie Amplificarea Rezultat impus 2 devine vizibil Ct =16,83 dup un numr redus de cicluri de amplificare (< 21) Reproductibilitatea Nu exist diferene care n ntre
500 pb 400 pb

Rezultat realizat 3

rezultatele obinute de analiti diferii amplificarea Termocycler realizeaz acelai


150 pb

700 pb

400 pb 150 pb

Precizia

Valoare deviaiei

ct

mai

redus

a s = 0,638

standard

pentru

amplificarea aceleiai probe n 20 de repetiii Sensibilitatea Cantitate ct mai redus de ADN ce poate fi amplificat (< 1 g)

500 ng

244

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Liniaritatea

Dispersie redus a valorilor individuale n jurul dreptei de regresie


Media valorilor CT The average of CT values Log din cantitatea de ADN Log of DNA quantity

Robusteea

Influena minim a variaiilor -n parametrilor metodei ADN izolat din parazitul Varroa destructor O. (amplificare ADN: izolat proaspt - a, dup 48h - b i dup 96h - c)

condiile

prezervrii

probelor

condiii corespunztoare, au fost obinute

-Stabilitatea n timp a soluiei de geluri identice.


700 pb

500 pb 150 pb

700 pb

500 pb

700 pb

500 pb

c -Influena temperaturii de Metoda are un caracter robust dac se lucreaz la temperatura de ataare a primerilor de 500C. ataare a primerilor

245

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Tabelul 32 continuare
1 Incertitudinea msurare de Stabilirea incertitudini. 2 bugetului 3 de Cea mai mare contribuie le bugetul de incertitudini este adus de volumul total de soluie supus amplificrii (soluie tampon + ADN izolat).
T ip u l in ce rtitu d in ii (T yp eo f in ce rtitu d e )

0,2000003

2,1606608

0,2700263 0,3184415

0,1001278 0,015 0,0375 0,025

1,1859058 0,0086592

0,5

1,5

2,5 Valoa

Aceste constatri permit ncadrarea metodei de izolare i cuantificare i amplificare a ADN din parazitul Varroa destructor O. n categoria celor care pot parcurge cu succes exigenele procedeelor de validare n condiiile asigurrii calitii n laboratoarele de biologie molecular (IUPAC, ISO: 2005, 17025).

CONCLUZII
Datorit faptului c finalitatea tezei de doctorat a vizat o abordare complex a problematicii dezvoltrii i validrii unei metode de genotipizare a parazitului Varroa sp. n stupinele din zona Transilvaniei, n conexiune cu particularitile albinei melifere (Apis mellifera L.) din punctul de vederea al aspectelor etologice i al mecanismelor de rezisten la boli i parazii, concluziile formulate debuteaz cu aceste aspecte. Privitor la studiul comportamentului igienic al Apis mellifera L., n stupinele din Transilvania, rezultatele studiului concretizate n nregistrarea valorilor medii ale procentului de descpcire cuprinse n intervalul 67 78% (cu valoarea medie minim de 67,54% nregistrat n judeul Harghita i maxim de 78,72% n judeul
246

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

Cluj) au demonstrat c n nici una dintre stupinele studiate, familiile de albine analizate nu au manifestat comportament igienic, limita de la care familiile de albine se consider c manifest rezisten natural la boli i parazii ca urmare a comportamentului igienic fiind de 91%. Genotipul identificat n urma studiului nostru n stupinele din Transilvania, corespunde numrului de acces n Banca de Gene AF 106900 este genotipul China 2 (Anderson i colab., 2000), unul dintre cele dou genotipuri Varroa din cadrul varietii extreme de largi prezente n Asia capabile s paraziteze i Apis mellifera L. Acesta se suprapune 100% cu genotipurile evideniate de Ting Z. si col. (2004) n China, avnd numarul de acces n baza de date NCBI - AY372063.1 i n Europa, de Solignac M. i colab. (2005) avnd cu numrul de acces n baza de date NCBI AJ84872.1 Cuantificarea parametrilor de performan ai metodei de amplificare a ADN din parazitul Varroa destructor O. enumerai mai sus i analiza rezultatelor obinute, confirm faptul c aceasta corespunde scopului pentru care a fost selectat i n consecin poate fi validat.

RECOMANDRI
Pentru combaterea eficient a parazitului Varroa destructor O. este necesar aplicarea unui management specific rezistenei la duntori, inndu-se cont de faptul c orice organism, n condiii de constrngere, caut s gseasc soluii de supravieuire. Acest tip de management trebuie s includ tehnici legate de: bune practici n managementul stupului, meninerea unui grad redus de infestare, dar i aplicarea produselor de combatere n cantitile omologate i de calitate ecologic. Identificarea rezistenei parazitului Varroa destructor O. la Apistan i cuantificarea acesteia, constituie premisa pentru elaborarea unor strategii eficiente pentru combaterea parazitului. Cunoscndu-se genotipul Varroa sp., precum i faptul c rezistena se datoreaz apariiei unei mutaii punctiforme la nivelul genei canalului sodiului, prin
247

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

aplicarea secvenierii se poate dezvolta un sistem de diagnoz eficient, bazat pe diferenele genetice ntre formele rezistene i cele sensibile. Este necesar implementarea, la nivel naional, a unui sistem de monitorizare a formrii i dezvoltrii rezistenei parazitului Varroa destructor O. la tratamentul cu ageni de combatere piretroidici, dar i a celor pe baz de compui organofosforici sau antibiotice, dei, alturi de o metodologie competent pentru diagnoza acesteia, utilizarea lor este din ce n ce mai rar datorit efectelor de remanen. Cuantificarea parametrilor de performan ai metodei de genotipizare a parazitului Varroa destructor O. (prin aplicarea direct la etapele de de izolare, cuantificare i amplificare a ADN) i analiza rezultatelor obinute, n condiiile Laboratorului Zonal de enotipizare a Animalelor Domestice, confirm faptul c aceasta poate fi propus spre validare, contribuind de aceast manier la sporirea competenei laboratorului.

248

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

BIBLIOGRAFIE SELECTIV

1.

Andersen C.L., J.L. Jensen and T. F. rntoft, 2004, Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets, Cancer research, No. 64, 5245 5250

2.

den Besten P.J. 1998, Cytochrome P450 monooxygenase system in echinoderms, Comparative Biochemistry and Physiology Part C: Pharmacology, Toxicology and Endocrinology, Vol. 121, No. 1 - 3, 139 146 Brown, T.A., 2002, Genomes, 2nd Edition, BIOS Scientific Publishers Ltd., 101, 121, 122 Bruneau E., Jacobs F., and Trouiller J., 1997, Rsultats de la campagne dedtection de la rsistance de Varroa aux pyrthrinodes en Belgique - 1997. Abeilles et Compagnie, No. 60, 5 6 Bura M., Creterea intensiv a albinelor, 1996, Editura Helicon, Timioara Bura M., Silvia Ptruic, V.A. Bura, 2005, Tehnologie Apicol, Ed. Solnes, Timioara Burkardt H. J., Standardization and quality control of PCR analyses, Clin. Chem. Lab. Med, 2000, Vol. 38, No. 2, 87 91 Cuia Eliza, 2006 - 2008, Determinarea rezistenei naturale la boli a populaiilor de albine (A. M. Carpatica) din Romania pe baza unor teste specifice i realizarea unei metodologii optime de ameliorare pentru acest character, Proiect CEEX, Modulul II, EP Colton T., 1974, Statistics in Medicine, Little Brown Publishers, 372 pag. Coier Viorica, A. Vlaic, 2007, Abordarea practic a problemelor de genetic animal, Editura Todesco, Cluj - Napoca
249

3.

4.

5. 6.

7.

8.

9. 10.

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

11.

Defilando Baker M. D., 1988, Variability and biotypes of Varroa jacobsoni Oudemans, American Bee Journal, Vol. 128, No. 8, 567 568 Dezmirean S. Daniel, L. Al. Mrghita, Graia I. Dezmirean, G. Dini, O.Bobi, L. Laslo, A. Moise, Antonia Odagiu, A. Fiiu, I. Paca, C. Bojan, Simona Brsan, O. Maghear, C. Coroian, M. Man; 2007, Reccomandations regarding prophylaxis of honey contamination during primary processing, Apicultura de la tiin la agribusiness i apiterapie, 82-84 Dezmirean D., L. Al. Mrghita, Oltica Giorgiana Stanciu, Otilia Bobi, Laura Laslo, Adela Moise, O.Maghear, Cristina Bojan, 2008, Mineral composition of honeydew honey produced in Transylvania determined by Atomic Absorbtion Spectrometry, Bulletin USAMV-CN, Vol. 65, No.1 - 2, 233-237

12.

13.

14.

Gonccalves M.C., M. M. Klerks, M. Verbeek, J. Vega, J. F. van den Heuvel, 2002, The use of molecular beacons combined with NASBA for the sensitive detection of Sugarcane Yellow Leaf Virus, European Journal of Plant Pathology No. 108, 401407 de Graaf D.C., W. Ritter, F. J. Jacobs, Marleen Brunian, H. Inberechts, K. Mintiens, Y. Van der Stede, B. Verheyden, A.K. Fauske, P. Boujon, Gabriela Chioveanu, D. Dezmirean, G. Formato, F. Mutinelli, H.-J. Roest, D. Titera, S.F. Pernal, Katia Knapen, 2009, Lessons from the first international proficiency test for the detection of spores from the honey bee pathogen Paenibacillus larvae, Accreditation Quality Assurance, No. 14, 273-276 Martin S. J., 2004, Acaricide (pyrethroid) resistance in Varroa destructor, Bee World, No. 85, 67 - 69 Mrghita L. Al., 2003, Albinele i produsele lor, Editura Ceres, Bucureti Mrghita L. Al., D. Dezmirean - Coordonatori, 2007, Apicultura de la tiin la agribusiness i apiterapie, Editura AcademicPres, Cluj - Napoca Milani N., G. Della Vedova, 2002, Decline in the proportion of mites resistant to fluvalinate in a population of Varroa destructor not treated with pyrethroids, Apidologie, No. 33, 417 - 422

15.

16.

17. 18.

19.

250

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

20.

Odagiu Antonia, A. Vlaic, L. Al. Mrghita, D. Dezmirean, I. Cornoiu, Laura Laslo, 2007, Research into the hygienic behaviour of honeybees in Transylvania, Proceedings of the 42nd Croatian&2nd International Symposium on Agriculture, 13-16 February, 302 306 Odagiu Antonia, A. Vlaic, L. Al. Mrghita, D. Dezmirean, 2007, The hygienic behavior testing honeybee colonies from Transylvanian area, n Apicultura de la tiin la agribusiness i apiterapie, Mrghita L. Al., D. Dezmirean Coordonatori, Editura AcademicPres, Cluj Napoca, 17 - 19 Odagiu Antonia., A.Vlaic, L. Al. Mrghita, I. Oroian, D. Dezmirean, Dana Pusta, 2008, The Validation of the DNA Extraction Method from Apis mellifera L., Bulletin of University of Agricultural Sciences and Veterinary Medicine, Animal Science and Biotechnologies, Vol. 65, No.1 - 2, 387 390 Odagiu Antonia, I. Oroian, A. Vlaic, Al. Mrghita, P. Mazzone, E. Caprio, D. Dezmirean, 2009, Assessing Linearity of the Parasite Varroa destructor DNA Amplification, ProEnvironment/ProMediu, Vol. 2, No. 4, 226 229 (319 322) Patti Elzen and D. Westervelt, 2004, A scientific note on reversion of fluvalinate resistance to a degree of susceptibility in Varroa destructor, Apidologie, No. 35, 519 520 Peirson S. N., J. N. Butler, and R. G. Foster, 2003, Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis, NucleicAcid Res., Vol. 31, No. 14, 118 125 Peters I. R., C. R. Helps, E. J. Hall, and M. J. Day, 2004, Real-time RT-PCR: considerations for efficient and sensitive assay design, J. Immunol. Methods, Vol. 286, Nos. 1- 2, 203217 Ponchel F., C. Toomes, K. Bransfield, F. T. Leong, Susan Douglas, Sarah Field, Sandra Bell, Valerie Combaret, A. Puisieux, A.J. Mighell, P. A. Robinson, C. F. Inglehearn, J. D. Isaacs and A. F. Markham, 2003, Real-time PCR based on SYBRGreen I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions, BMC Biotechnology, Vol. 3, No. 18, 1 13
251

21.

22.

23.

24.

25.

26.

27.

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

28.

Rakosy - Tican Elena, 2005, Inginerie genetica vegetala: note de curs, Casa Crii de tiin, Cluj-Napoca Rakosy Tican Elena, L. Al. Mrghita, 2007, The bees as vehicles for transgene transfer from genetically moddified plants to other organisms theoretical issues, n Apicultura de la tiin la agribusiness i apiterapie, Mrghita L. Al., D. Dezmirean - Coordonatori, Editura AcademicPres, Cluj Napoca, 184 188 Rieu I. and S. J. Powers, 2009, Real - Time Quantitative RT-PCR: Design, Calculations, and Statistics, Plant Cell, No. 21, 1031 1033 Soderlund D. M., 2008, Pyrethroids, knockdown resistance and sodium channels, Pest Management Science, Vol. 64, No. 6, 610 - 616 Solignac M., D. Vautrin, E. Baudry, F. Mouguel, A. Loiseau and J-M Cornuet, 2004, A Microsatelitte-Based Linkage Map of the Honeybee, Apis mellifera L., Genetics, No. 167, 253 - 262 Spivak M., and G. S. Reuter, 2001, Varroa destructor infestation in untreated honey bee (Hymenoptera: Apidae) colonies selected for hygienic behavior, Journal of Economic Entomology, Vol. 94, No. 2, 326 331 Tnase I. Gh., G. L. Radu, Al. Pan, Mihaela Buleandr, 2007, Validarea metodelor analitice. Principii teoretice i studii de caz, Editura PRINTECH, Bucureti Vlaic A., 1997, Inginerie genetic, realizri, sperane, neliniti, Editura Promedia Plus Vlaic A., T. Oroian, Simona Pacalu, 2001, Genotypization of bulls used for artificial insemination at k-casein and -lactoglobulin locus, Bulletin USAMVCN, Vol. 55 56, 112 117 Vlaic A., T. Oroian, 2004, Elemente de genetic pentru zootehniti, Editura AcademicPres, Cluj Napoca Vlaic A., Viorica Coier, Antonia Odagiu, T. Oroian, V. Blteanu, 2005, Analysis of genetic diversity in five cattle breeds from Romania, Bulletin USAMV-CN, Seria ZB, Vol. 61, 332

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

252

Cercetri privind dezvoltarea i validarea unei metode de genotipizare a parazitului Varroa sp. prezent n stupinele din zona Transilvaniei

39.

Vlaic A., V. A. Blteanu, F. D. Pop, Anda Raluca Rusu, 2008, Molecular methods used for detection of cattle milk in buffalo, ewe and dairy products, Lucrri tiinifice, seria Zootehnie, Iai, Vol. 51, 1016 - 1021 Ting Z., L. Anderson, Z. Y. Huang, S. Huang, J. Yao, T. Ken, Q. Zhang, 2004, Identification of Varroa mites (Acari: Varroidae) infesting Apis cerana and Apis mellifera in China, Apidologie, No. 35, 645 - 654 ***, 1993, ISO 3534 - 1/VIM, International Vocabulary of Basic and General Terms in Metrology, International Standards Organization, Geneva, Switzerland, IInd Edition ***, 1995, SR 13 434, ISO/GUM, Guide to the expression of uncertainty in measurement, International Standards Organization, Geneva, Switzerland ***, 2001, IUPAC Recommendations, Selectivity in analytical chemistry, Pure Applied Chemistry, Vol. 73, No. 8, 1381 - 1386 ***, 2003, Validation of analytical procedures: Methodology, International Conference on Harmonization Federal Register, Vol. 60, 27463 ***, 2003, Ghidul ILAC-G17 privind incertitudinea de msurare, SR ENV 13005, International Standards Organization, Geneva, Switzerland ***, 2005, Standardul SR EN ISO/CEI 17025 : 2005, International Standards Organization, Geneva, Switzerland

40.

41.

42.

43.

44.

45.

46.

253