GENOMICS

THE STUDY OF GENES

Paper Presented By

Y.RAGHAVA, 3/4 B.Tech , E.C.E,

G.L.NARAYANA 3/4 B.Tech, E.C.E,

P.NO:9866036991 Email: mightyrk@gmail.com

P.NO:9441041039 Email: mighty_rk@yahoo.com

ST.ANNS TECHNOLOGY

COLLEGE
CHIRALA

OF

ENGG.

&

ABSTRACT Signal processing, computation, information theory all are more emerging technologies now a days. The application of these technologies to specific biological problems provides a model for how to approach many other questions in biology. Genomics is the field of genomes. All genes in an organism have a specific function or functions. In this paper we have given the basic idea of this field of genomics and also we described how signal processing can be done in genes. For understanding of biological system functional identification of genes is necessary. So we present the problem of functional identification in the contest of each biological scale. Then we conclude with specific challenges in functional genomics by using computational terms and providing appropriate tools and methods to solve them.

Introduction:
Signal processing is a science always at the vanguard of the most exciting and innovative developments in technology. No one can dispute that todays world ,including mobile phones, television and multimedia on the laptop in front of us, world not be the same with out the help involvement of signal processing technology. Genome exploration is now the emerging field in the universe of signal processing. Molecular biology is confronted now with an explosion in the amount of experimental data and consequently there is a need for new techniques to process this vast data. Gene expression is an important new addition to the already established collection of standard signals such as audio, speech, image, video, EEG, ECG. It is therefore not surprising that genomic signal processing becomes a new science, attracting the interest of researchers. The methods of traditional signal processing with molecular biology provides solutions for problems in functional genomics. High through put experimental methodologies have transformed biology into an information-rich science. These experiments may provide an integral understanding of biological systems .The depth understanding biological systems reflects the accuracy with which it can be simulated and engineered. It is critical to understanding of biological systems to the deepest level possible. For this reason some sophisticated computational methods are necessary. This paper focus on contemporary problems, in system biology and functional genomics in computational terms and providing appropriate tools and methods to solve them. This includes genome structure and function, transcriptional regulations and includes the necessary background of molecular biology.It can be seen as a faithful image of problems and current solutions in a rapidly changing area.

Genomics:Genomics entails the study of large sets of genes with the goal of understanding collective gene function. Apoptosis def:Apoptosis is process relative to cells replicate themselves by cell division and irreparably damaged cells remove themselves. Transcription:-The process by which DNA is copied into RNA by a protein. Translation:-The process of producing proteins from messenger RNA (mRNA). Genomic signal processing:Genomic signal processing is the engineering discipline that studies the processing of genomic signals. The aim of GSP is integrate the theory and methods of signal processing with the global understanding of genomics. GSP encompasses various methodologies related to signal profiles: detection, prediction, classification control and statistical and dynamical modeling of gene networks. These methods lie with in the domain of signal processing, including estimation, classification, pattern recognition, automatic control, information theory, networks, computation, imaging and coding. High-throughput experimental methodology has transformed biology into an information-rich science. It is now possible to rapidly obtain data on thousands of genes in a single experiment. In next decades, data from these experiments may provide an integral understanding of biological systems. The first step towards a system wide understanding of a biological system is functional identification of its components.

Functional identification:Biological systems are comprised of a multitude of proteins. These proteins generally facilitate (or catalyze) specific chemical reactions that allow the system to operate. Genes encode protein sequences. Genes are comprised of DNA. The DNA contains complete genetic code or Genome. DNA regulates all cell functions including response to disease, aging and development.

Instructions coded in the DNA direct the cell to divide under go apoptosis or perform a variety of other functions. Although all these instructions are present in almost every cell of an organism, they are not acting at all times. The overall behavior of the cell arises from the manner in which the instructions are called. The central dogma of molecular biology: When a particular instruction becomes active the corresponding Genes set to turn on or to be expressed. Here we introduce how main flow of information in the cell can be done, which is described by the central dogma of molecular biology.

Gene: protein-coding DNA

DNA
transcription CCTGAGCCAACTATTGATGAA

mRNA
translation

CCUGAGCCAACUAUUGAUGAA

Protein

PEPTIDE

What really happens is that the DNA strand (which serves as a master copy) is copied using a less stable molecule called ribonucleic acid or RNA, and one or more copies are made. The RNA strands are called messenger RNAs (mRNAs). The process by which they are produced is called transcription. The process of producing proteins from mRNAs is referred to as translation. This conduit of information flow from DNA to RNA to protein was one of the early central insights of molecular biology and is known as the Central Dogma of Molecular Biology.

One important step that contributes to these processes is termed splicing in which certain parts of the mRNA are excised before the mRNA is translated. mRNAs transcribed from two different regions of the DNA can be spliced together through a process called trans-splicing resulting in a single RNA that came from two genes. And a single gene can produce many mRNAs through a process called alternative splicing. Here we have to note that proteins can not be copied back into RNA or DNA. So the genetic code is irreversible. Cells have developed extremely efficient and accurate molecular mechanisms for replicating DNA. .Current high-throughput experimental techniques exploit these mechanisms to rapidly and efficiently measure specific features of genes. Thus genes are experimentally much easier to characterize than proteins. Genes are also fundamental elements of living systems so mostly high-throughput biological data is genetic. Eg: genetic sequences, gene expression levels

Functional identification is context specific, such that the function associated with a gene is dependent on the scale. 1. a gene in the molecular context encodes a protein that has the potential to catalyze a chemical reaction in the cell. 2. In cellular context, the phosphorylation reaction can activate a signal transduction cascaded. 3. In the Physiological context, the activation of this cascade ultimately leads to cell division. These are all shown in figure.

Molecular function: Molecular function is the biochemical or biophysical activity of a gene. These activities include catalysis of chemical reaction. Understanding what molecular function a gene can perform as well as where the activity occurs can provide powerful insights on how the gene works, how the gene may be modified to change its function, and even how to inhibit or activate the function for medical treatment. Two types of data are used for computational studies of molecular function. 1. Sequence of the gene. 2. Three dimensional (3D) structure of the protein encoded by the gene.

A key challenge in analyzing molecular function is identifying important functional sites in the protein.

Cellular function: Cellular function is the regulation of genes and interaction of proteins to perform cellular processes, such as cellular growth, communication, and metabolism. The central dogma of biology states that genes (DNA) are transcribed into ribonucleic acid (RNA), and that RNA is in turn translated into proteins. The regulation of a gene at the transcriptional or translational level thus results in varying activity of the protein product. The level of transcriptional expression of a gene can be measured experimentally using a variety of gene chips or micro arrays in a high-throughput manner. It is now possible to measure over 60,000 genes in a single experiment. Proteins interact together in pathways to perform cellular function. There are many types of path ways in a cell. 1. Signaling path ways 2. Metabolic pathways. In signaling path ways, a signal from external stimuli or from a change in the state of a cell is propagated from one part of the cell to another. In metabolic pathways, the cell breaks downs or creates substances to generate energy and to maintain its function. If two genes have the same cellular function, then they participate in the same pathway. Cellular function of a gene can be identified using gene sequence data, micro arrays, biological literature and other data sources. The key challenge is predicting how genes are regulated, which proteins participate in a pathway, and how proteins interact in a pathway. Physiological function: The physiological function of a gene is the effect that a gene has on the entire organism. Here we include two terms. 1. Phenotype. 2. Genotype.

Phenotype of an organism is its physical appearance or behavior, such as eye color and side effects to drug therapy. Genotype is the genetic make up of an organism. The phenotype of an organism is affected by its genotype and its environment. A key challenge is to correlate variations in the organisms : Genotype to variations in its phenotype.

Challenges:
Understanding gene function at the molecular, cellular, and physiological levels each poses numerous challenges.

Molecular function challenges:

1. Annotating genomes: Genomes of many organisms has been sequenced. But identification of the exact sequence and structure of every gene in the genome and their regulation remains a challenge. Identification of gene locations, their regulation, their products, and their function is an open area of research that can benefit from machine learning methods and other engineering principles. 2. Identifying functional regions in proteins: Identifying the exact area of a protein that is responsible for biological function is critical. That can be linked to a specific function is an area where machine learning and signal processing methods can be of great benefit. 3. Identifying protein interactions and their mechanisms: Even when a functional site of a protein is known, understanding what molecules the protein interacts with and the mechanism of the interaction, remains an open question. For example: In pharmaceutical development it is important to know the strength and transiency of interaction between a drug and protein.

Cellular function challenges:

1. Identifying biological pathways: To understand how cells operate, it is critical to understand function and regulation of specific pathways in the cell. A key challenge here is to identify which proteins participate in specific pathways how members of a pathway interact with one another. 2. Quantifying the dynamics of biological networks: Biological pathways interact and interconnect in the cell to form networks. Modeling the structure and dynamics of biological networks is critical for understanding how a cell functions. A key out come of this challenge is creating an accurate functional model of the cell. 3. Engineering biological networks: An emerging research area is design of artificial genetics circuit inside living cells. These circuits can be used to study cellular function and regulation is simplified and controlled systems, as well as to create cells with specific properties such as bacteria engineered for detecting chemicals and for bioremediation. Circuit diagrams can be designed using computational and modeling tools, and then constructed inside cells using experimental techniques.

Physiological function challenges:

Research on gene function at the organism level has only begun recently and the area poses many open questions. At a broad level challenges at the organism level include. 1. Correlating genotype to organism level effects: The variety of phenotypes observed among one species is formed through the interaction of each individuals genotype with its environment.

Computational and experimental researchers lead to modern effects of changes in the genomic composition of an organism on the organisms fitness and survival. Such models will improve our understanding of fundamental biology and may lead to development of novel treatments for disease that are targeted to each individuals genotype. In the post-genomic era, large quantities of biological data are being produced, and these data need to be stored, processed, and mined for relevant biological information. These large-scaled data are heterogeneous, and thus novel methods are necessary that can deal with integration as well as provide fast and accurate analysis of these diverse data sources. Biological data are often noisy and many problems posed in bioinformatics do not have true gold standard solutions, therefore machine learning methods for biological data should be robust to noise, number, and quality of the examples. Expertise from researchers in the signal processing, computer science, and other engineering disciplines can provide critical insight and innovation on applying new methodology to the biological field.

Conclusion:
The exponential growth of publicity available data has transformed biology into an information rich science .This provides many new and interesting applications for the machine learning community. Biological data is especially challenging to analyze because it is inherently noisy and biased .Expertise from researches in the signal processing, computer science, and other engineering disciplines can provide critical insight and innovation on applying new methodology to the biological field. This paper highlights various challenges in functional genomics and current methodologies are employed. To meet the challenges in this field we motivate this field of genomics. We hope that this paper provides an introduction to the field of functional genomics for further researches. References: 1. IEEE Signal processing magazine, vol: 21, no: 6 2. A literature based method for assessing the functional coherence of a gene group

Bioinformatics by: s. Raychaudhuri and R.B.Alitman 3.Discovering Genomics,Proteomics&Bioinformatics by:A.Malcolm Campbell,Laurie J.Heyer.