Sunteți pe pagina 1din 6

1

01- A melanina s produzida, nas clulas, se houver a enzima adequada. A responsabilidade direta da produo dessa enzima no citoplasma, : a) da sequencia de aminoacidos; b) do RNA; c) do DNA; d) da estrutura terciaria da proteina. e ) do cromossomo. 02- (UFMS) Os processos biolgicos indicados como 1, 2 e 3, no esquema que se segue, correspondem respectivamente, a: a) replicao, transcrio e traduo. b) transcrio, replicao e traduo. c) replicao, traduo e transcrio. d) transcrio, traduo e replicao. e) traduo, replicao e transcrio. 03- ((Fuvest-SP) Bactrias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de geraes. Dessa cultura, foram isoladas 100 bactrias e transferidas para um meio sem substncias radioativas. Essas bactrias sofreram trs divises no novo meio, produzindo 800 bactrias. A anlise dos cidos nuclicos mostrou que dessas 800 bactrias. a)100 apresentavam o DNA marcado, mas no o RNA. b)200 apresentavam o DNA marcado, mas no o RNA. c)400 apresentavam o DNA marcado, mas no o RNA. d)200 apresentavam o DNA e o RNA marcados. e)todas apresentavam o DNA e o RNA marcados. 04- (PUC-RS/99) Os cromossomos so constitudos principalmente por: a) fosfolipdeos. b) protenas. c) cido ribonuclico. d) enzimas. e) cido desoxirribonuclico. 05- Considere um segmento de molcula de DNA com a seguinte seqncia de bases: AAT CAA AGA TTT CCG. Quantos aminocidos poder ter no mximo, uma molcula de protena formada pelo segmento considerado? a) 15 b) 10 c) 5 d) 3 e) 1 06- Analise as alternativas abaixo, relacionadas com o cdigo gentico: I. Um mesmo cdon pode codificar mais de um aminocido. II. Um aminocido pode ser codificado por diferentes cdons. III. O cdigo usado na espcie humana o mesmo dos vrus. Esto corretas:

a) I e II b) I e III c) II e III d) Apenas II e) I, II e III 07. Uma protena constituda por 350 aminocidos. Quantos nucleotdeos apresenta a cadeia do ADN que codificou tal protena? a) 150 b) 350 c) 450 d) 700 e) 1 050 08. Em relao sntese protica errado afirmar que: a) Uma das fitas do DNA transcrita, formando-se uma molcula de RNA mensageiro. b) A traduo da fita do RNA mensageiro feita nos ribossomos. c) Os ribossomos originam-se do nuclolo. d) Cada RNA mensageiro codifica uma cadeia polipeptdica. e) Cada RNA de transferncia possui um anticdon especfico, que se prende o aminocido que ir transportar at o ribossomo. 09. (UF - Sergipe) A seleo de cada aminocido que entra na composio de cadeia polipeptdica determinada por uma seqncia de: a) 2 nucleotdeos do DNA; b) 2 nucleotdeos do RNA; c) 3 nucleotdeos do RNA; d) 3 desoxirriboses do DNA; e) 3 riboses do RNA mensageiro. 10. Considerando o seguinte esquema: As etapas 1, 2 e 3 representam, respectivamente, os processos de: a) replicao, transcrio e traduo; b) replicao, traduo e transcrio; c) transcrio, replicao e traduo; d) transcrio, traduo e replicao; e) traduo, replicao e transcrio. 11- (PUC-SP) Duas cadeias polinucleotdicas, ligadas entre si por pontes de hidrognio, so constitudas por fosfato, desoxirribose, citosina, guanina, adenina e timina. O enunciado anterior refere -se a molcula de: a) ATP b) FAD c) RNA d) DNA e) NAD

12- No ano de 2003, foram comemorados os 50 anos da descoberta da estrutura tridimensional do DNA. Com relao s caractersticas dessa molcula, ao papel que ela desempenha nos seres vivos e aos processos em que se encontra envolvida, correto afirmar que: I- formada por duas fileiras de nucleotdeos torcidas juntas em forma de hlice. II- Em sua composio possvel encontrar quatro bases nitrogenadas diferentes: a adenina, a citosina, o aminocido e a protena. III- Ela tem a capacidade de se autoduplicar. IV- Nela est contida a informao gentica necessria para a formao de um organismo. V- A mensagem nela contida pode ser transcrita para uma outra molcula denominada RNA. a) Somente I e II so verdadeiras. b) I, IV e V so verdadeiras. c) II, III e IV so verdadeiras. d) I e IV so verdadeiras. e) Todas so verdadeiras 13- O DNA tem duas propriedades fundamentais. Que propriedades so essas e qual sua importncia biolgica? Autoduplicao e sntese de RNA. A autoduplicao permite transmitir a programao da clula a clulas-filhas e a organismos-filhos. Pela sntese de RNA, o DNA controla a produo de protenas celulares, muitas delas enzimas; dessa forma, o DNA controla a atividade metablica da clula. 14- Numa das propriedades que voc ir citar ao responder a questo 1, podem ocorrer enganos. Como so chamados esses acidentes? A que resultados eles levam? Esse tipo de acidente chama-se mutao e pode levar produo de uma protena diferente, que perdeu a funo ou teve sua funo alterada. 15- (Unicamp-SP) A anlise da composio de nucleotdeos do cido nuclico, que constitui o material gentico de quatro diferentes organismos, mostrou o seguinte resultado: % de nucleotdeos Organismo A B C D Adenina 23,3 17,3 27,5 18,5 Guanina 26,7 40,7 14,3 31,5 Timina 23,5 28,2 0 18,3 Citosina 26,5 14,0 35,5 31,7 Uracila 0 0 22,7 0

Com base nesses resultados responda o que se pede abaixo e justifique as respostas:

a) Qual o cido nuclico de cada um desses organismos? A: DNA / B: DNA / C: RNA / D: DNA. As molculas A, B e D possuem base nitrogenada timina, exclusiva do DNA; enquanto a molcula C, possui uracila, base nitrogenada presente apenas no RNA. b) Quantas cadeias polinucleotdicas possuem o cido nuclico de cada um desses organismos? A molcula A possui duas cadeias, o que pode ser deduzido pelo fato de que a porcentagem da base adenina e timina a mesma. Na molcula de DNA, essas duas bases, quando pertencentes a cadeias complementares, esto unidas por pontes de hidrognio; o mesmo ocorre com a base citosina e guanina. J as molculas B, C e D possuem cadeias simples porque a porcentagem de bases que poderiam ser complementares no a mesma. 16- (FGV-SP) Considerando-se o total de bases nitrogenadas do DNA de uma espcie qualquer igual a 100, se nela existirem 15% de timina, qual ser a porcentagem das demais bases nitrogenadas? T = 15%; A = 15%; C = 35%; G = 35% 17- (UFV-MG) Considere a tabela abaixo, contendo cdigos de trincas de bases do DNA com os aminocidos correspondentes, para resolver os itens seguintes: Trinca de bases Aminocidos AGG CAA TTA CCG TTC a) Determine a sequncia de bases do RNAm que foi utilizado para sintetizar o seguinte polipeptdeo: RNAm: UCC GUU AAU UCC GGC AAG b) Se ocorresse uma substituio, por uma adenina, na 3. Base do cdico correspondente ao 6. Aminocido do polipepitdeo, qual seria o aminocido da tabela a ser incorporado? Seria incorporado o seguinte aminocido: c) Qual o anticdon correspondente ao novo aminocido incorporado? O anticdon seria UUA 18- (Unifesp-SP) O jornal Folha de So Paulo (23/09/2020) noticiou que um cientista espanhol afirmou ter encontrado protenas no ovo fssil de um dinossauro que poderiam ajud-lo a reconstituir o DNA desses animais. Faa um esquema simples, formado por palavras e setas, demonstrando como, a partir de uma sequncia de DNA, obtm-se uma protena. Sequncia de nucleotdeo do DNA sequncia de nucleotdeos do RNA mensageiro sequncia de aminocidos na protena 19- (FUVEST) Qual o papel do RNA mensageiro e do RNA transportador na sntese de protenas?

RNA-m leva a mensagem gentica ao ribossomo. / RNA-t transporta aminocidos para os ribossomos. 20- Uma clula terminou de sintetizar uma enzima constituda por uma cadeia de 56 aminocidos. Quantas molculas de RNA-m e de RNA-t foram usadas na biossntese? Uma molcula de RNA-m e 56 molculas de RNA-t. 21- De que maneira os genes determinam o fentipo de um organismo? Atravs de sntese de protenas que, produzindo estruturas celulares ou funcionando como enzimas, determinam as caractersticas de um organismo. 22- Defina os seguintes termos, usados em gentica molecular: a) cistron - Cistron ou gene o segmento de DNA que, atravs das bases nitrogenadas, codifica a seqncia de aminocidos de uma protena. b) cdon - a seqncia de trs bases que codificam um cdigo. 23- Escreva a sequncia de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequncia: a) ATGCCGTATGCATTGCATTC b) TTTCGAGTTACTACCAACCGT AAAGCTCAATGATGGTTGGCA c) TGCATTGCATTCTTTCGAGA ACGTAACGTAAGAAAGCTCT d) TTCGAGAATGCATTCGTGCA AAGCTCTTACGTAAGCACGT e) GCAATTCTTGAGTTCATCATT CGTTAAGAACTCAAGTAGTAA