Medical Journal of Indonesia

Medical Journal of Indonesia
Vol 20, No 1 (2011): Vol. 20, Number 1, February 2011, pp 1 - 82
ISSN: 0853-1773
Table of Contents
Editorial
Editors note Isnani A.S. Suryono, H.J. Fedi Freisleben 3
Basic Medical Research

Polyclonal VDAC3 antibody decreases human sperm motility: a novel approach to male contraception Asmarinah ., Muhammad . I Saleh, Septelia I. Wanandi, Vanny Narita, Rita Damayanti, Nukman H. Moeloek, H. Joachim Freisleben, Elvira Hinsch Genetic polymorphism of merozoite surface protein-1 (MSP-1) block 2 allelic types in Plasmodium falciparum fi eld isolates from mountain and coastal area in West Sumatera, Indonesia Nuzulia Irawati Effect of adipose tissue processing procedures in culture result: a study preliminary Jeanne A. Pawitan, Arleni Bustami, Lia Damayanti, Radiana D. Antarianto, Ni M. Swantari The metabolic effects of di (2-ethyl hexyl) phthalate medium dose on lipid profi les in serum and liver tissue Buang Y Expression of manganese superoxide dismutase in rat blood, heart and brain during induced systemic hypoxia Septelia I Wanandi, Syarifah Dewi, Sri W. A. Jusman, Mohamad Sadikin Pomegranate (Punica granatum L) powder reduced malondialdehyde (MDA) level in cigarette smoke exposed rats Francisca A Tjakradidjaja, Anita S Tjakradidjaja 34-39 27 - 33 20 - 26 15 - 19 11 - 14 5 - 10
Clinical Research
Anthropometric profi les of children with congenital heart disease Damayanti R. Sjarif, Shirley L Anggriawan, Mulyadi M Djer Dietary iron intake, serum ferritin and haemoglobin levels, and cognitive development scores of 40 - 45
infants aged 68 months Dian Kusumadewi, Saptawati Bardosono, Rini Sekartini 46 - 49
Community Research
Highly active antiretroviral therapy adherence and its determinants in selected regions in Indonesia Felix F. Widjaja, Caroline G Puspita, Ferdi Daud, Ienag Yudhistrie, Marita R Tiara, Christopher S Suwita, 50 - 55 Ekachaeryanti Zain, Lailatul Husna, Samsuridjal Djauzi Access to health information may improve behavior in preventing Avian infl uenza among women Ajeng T Endarti, Shamsul A Shah Oral health related quality of life in Indonesian middle-aged and elderly women Lindawati S Kusdhany, Yuliana Sundjaja, Sitti Fardaniah, Raden I Ismail The level of Escherichia coli contamination in foods and drinks sold at canteens campus Dewi Susanna, Tris Eryando, Yvonne M Indrawani 66 - 70 62-65 56 - 61
Review Articles
Iron defi ciency anemia in the elderly Indra Kurniawan 71-77
ISSN: 0853-1773
Vol.20, No.1, Februari 2011
Editors note
Editors note
Dear Colleagues,
Greetings for a Happy New Year 2011! This year we are th in our 20 year of paper version and entering the second year for our electronic version of the Medical Journal of Indonesia. Thank you for your collaboration, either as readers, contributors, reviewers, or donators. We have so many things to be thankful for. For one, we are happy to inform you, that we have again gained for the next three years, the accreditation from the Indonesian Directorate General of Higher Education which is granted only to a few prominent journals in every field of science in Indonesia.
between Germany and Indonesia including the training and exchange of physicians, clinical specialists, and biomedical scientists.
Secondly, we should clarify what it means for MJI and for DIGM to cooperate. For MJI, it is advantageous for its accreditation to cooperate with a professional society, even better, if it is an International Society. For DIGM Medical Journal, it is advantageous because it is always difficult to receive sufficient numbers of scientific articles from the environment of its own society in order to appear regularly and periodically. Thirdly, what does it mean to merge the Journals? For MJI, it means that there will be additional articles from DIGM members, for the next edition, we have already two articles, one of them is a case report from Germany and Indonesia, the other one is from the hospital in Bad Oeynhausen, which has been wellknown in Indonesia, because several prominent Indonesians have been operated there by the former President of the German Chapter of DIGM, Prof.Dr.med. Rainer Krfer, and dozens of young Indonesian physicians have been trained there for their professional specialisation. For DIGM Medical Journal it is advantageous to merge with MJI mainly for the above mentioned reasons, and in addition, articles from DIGM members will be read in wider-spread distribution. Included into the Scientific Advisory Board of DIGM is also the Editorial Board of DIGM Medical Journal. The current Editor-in-Chief, Dr. med. Abraham Simatupang from Universitas Kristen Indonesia, becomes a member of the Editorial Board of MJI and Prof. Dr. H.-J. Fedi Freisleben has already been a member of the Editorial Advisory Boards of both Journals. Further members of DIGM e.V. are also in the International Advisory Board of MJI, Prof. Dr. med. Markus Meyer and Dr. Thomas Mller. The Vice-President of the German Chapter, Prof. Dr. med. Ulrike Blum will follow, soon.
To enhance the quality of our journal, internally we have made several adjustments, we have gained several young and therefore more energetic personnels in our board of editors, and also our secretariat. Thus, hopefully we will be able to better serve our readers and researchers/writers in general.
In this edition of MJI, we want to inform our readers to a novelty, which is implemented from 2011. The Editorial Board of MJI and the Faculty of Medicine Universitas Indonesia as its Publisher on one hand, and the Board of DIGM e.V. both the Societys German and Indonesian Chapters and the Editorial Board of the Societys Scientific Journal on the other hand, have decided to collaborate and merge DIGM Medical Journal with MJI. Some of our readers may immediately ask, what the heck is DIGM e.V.? And what does it mean to merge the Journals? Let us answer the first question first: DIGM stands for Deutsch-Indonesische Gesellschaft fr Medizin or German-Indonesian Medical Association, e.V. means registered society. The Society is registered in Germany as well as in Indonesia, here as Perhimpunan Kedokteran Jerman-Indonesia, and has thus two Chapters with a total of over 300 members, both in Indonesia and Germany. The presidents of the German and the Indonesian Chapters are ex officio automatically one of the two Vice-Presidents of the other Chapter. Currently, Dr. med. Henry Naland is the President of the Indonesian Chapter and Prof. Dr.rer.med.habil. H.-J. Fedi Freisleben is the President of the German Chapter. The Societys goals and tasks are the exchange and transfer of biomedical and clinical knowledge and technology
Last but not least, we do hope that this joint Medical Journal of Indonesia will be beneficial to the most important party in the whole scenario: OUR HONORABLE READERS! Jakarta, February, 2011. Isnani A.S. Suryono Editor-in-Chief H.J. Fedi Freisleben President of DIGM e.V
Correspondence email to: isnanis@yahoo.com hj.freisleben@tonline.de
Vol. 20, No. 1, February 2011
VDAC3 antibody decreases sperm motility
Polyclonal VDAC3 antibody decreases human sperm motility: a novel approach to male contraception
Asmarinah, Muhammad I. Saleh, Septelia I. Wanandi, Vanny Narita, Rita Damayanti, Nukman H. 1 2 5 Moeloek, H.-Joachim Freisleben, Elvira Hinsch
1 2
Department of Medical Biology, Faculty of Medicine, University of Indonesia Postgraduate Program Biomedical Sciences, Faculty of Medicine, University of Indonesia 3 Department of Biochemistry, Faculty of Medicine, University of Indonesia 4 Center of Pharmaceutical and Medical Technology, Agency for the Advancement and Application of Technology, Jakarta, Indonesia 5 Department of Urology, Pediatric Urology and Andrology, Faculty of Medicine, University of Giessen, Germany
Abstrak
Latar belakang: Voltage dependent anion channel (VDAC) merupakan protein spesifik yang memperantarai transport anion, kation dan ATP dan berperan penting pada motilitas sperma. Penelitian ini bertujuan mengevaluasi pengaruh antibody VDAC3 poliklonal terhadap motilitas sperma manusia.
Metode: Antibodi VDAC3 poliklonal diproduksi dengan mengimunisasi kelinci dengan peptid sintetik spesifik VDAC3. Serum kelinci sebelum diimunisasi dikoleksi menjadi preimunserum untuk kontrol percobaan. Pengenalan antiserum VDAC3 yang diproduksi terhadap antigen VDAC3 pada sperma dilakukan dengan menggunakan metode western blot. Sperma dengan motilitas baik dari 30 pria fertile dicuci dan diisolasi dengan menggunakan metode Percoll gradient. Evaluasi pengaruh antibody VDAC3 terhadap motilitas sperma dilakukan dengan mengukur kecepatan gerak sperma (detik/0,1 mm) dan menghitung jumlah sperma tidak bergerak (juta/ml) pada 0 menit, 30 menit, 60 menit setelah penambahan antiserum dan preimunserum. Data kecepatan sperma dan jumlah sperma tidak bergerak dianalisis dengan mengunakan program statistic SPSS 13.0.
Hasil: Antiserum VDAC3 dapat mengenali protein VDAC3 pada sperma dan dapat meningkatkan jumlah sperma tidak bergerak setelah 60 menit secara bermakna dibandingkan preimunserum. Kecepatan gerak sperma menurun secara bermakna setelah penambahan antiserum VDAC3 pada menit ke 0, 30 dan 60 dibandingkan dengan preimunserum.
Kesimpulan: Antiserum VDAC3 poliklonal dapat menurunkan motilitas sperma manusia, sehingga diharapkan dapat dikembangan untuk vaksin kontrasepsi pria di masa dating. (Med J Indones 2011; 20:5-10)
Abstract
Background: Voltage dependent anion channels (VDAC) mediate transport of anions, cations and ATP which play an important role in sperm motility. This study was aimed to examine the effect of polyclonal VDAC3 antiserum to human sperm motility.
Methods: Polyclonal VDAC3 antiserum used in this study was produced in rabbits by immunization of VDAC3specific synthetic peptides. Preimmunserum was collected before immunization and used for control experiment. Recognition of VDAC3 antiserum to antigen in human sperm was performed by western blot. Thirty sperm samples obtained from fertile men which had high quality of sperm motility were washed and collected by Percoll gradient. Sperm motility was assessed by means of evaluation of sperm velocity (seconds per 0.1 mm distance) and the number of unmoved sperm (million per ml) which were observed 0 minute, 30 minutes and 60 minutes after addition of VDAC3 antiserum and preimmunserum as a control. Both data were analyzed by SPSS 13.0 software.
Results: VDAC3 antiserum recognized VDAC3 protein in human sperm. Statistical analysis demonstrated that there were increasing numbers of unmoved spermatozoa after addition of anti-VDAC3 antiserum in vitro for 60 minutes observation compared with preimmunserum (control). We found also that sperm velocity decreased significantly after giving antiVDAC3 antiserum in vitro for 0 minute, 30 minutes, and 60 minutes compared with pre-immunee serum (control).
Conclusion: VDAC3 antiserum can decrease motility of human sperm. and may provide a novel principle of male contraception in the future. (Med J Indones 2011; 20:5-10) Key words: VDAC3 antiserum, sperm, motility, contraception
The rate of world population growth especially in developing countries is presently still high. Family planning through use of contraceptive methods for couples is proposed in many developing countries to suppress growth
of the population. Traditionally, most of contraceptive methods have been targeted to women. The numbers of contraceptive methods for men are limited to condom 1 and vasectomy, both of which have their limitations.
Correspondence email to: asmarinah@fk.ui.ac.id
Development of new satisfactory male contraceptive methods is needed to provide alternatives that might aim to encourage men to actively participate in successful family planning. There are several target approaches to develop male contraceptive methods, such as hormonal approach, control of epididymal function as well as nonhormonal and post-testicular approaches. One of post-testicular approaches for the
Asmarinah et al.
Med J Indones
development of male contraception methods is antispermatozoal immunocontraception: antibodies against sperm-specific protein may be potential 2 candidates for immunocontraception.
Voltage Dependent Anion Channels (VDACs) also known as porins are pore-forming 30-35 kDa proteins abundant in the outer mitochondrial membrane and also found in plasma membrane of eukaryotes. There are three different VDAC genes encoding distinct isoforms in mammals, i.e. VDAC1, VDAC2 and VDAC3. Each of these proteins is highly conserved in human, rat and 3 mouse. They mediate transportation of anions, cations 2+ (Ca ), ATP, and metabolites between mitochondria and 4-6 other intra- and extra-cellular compartments. A knock-out mouse study with deletion of the last four exons (i.e. exons 5, 6, 7 and 8) of mouse VDAC3 demonstrated that mutant male mice were healthy, but infertile. The mutant mice had normal sperm counts, but low sperm motility compared to that of wild type mice. In sperm flagella of the knock-out mice, structural 7 defects were observed. Our genetic studies on human VDAC3 gene of asthenozoospermic patients brought evidence to raise the hypotheses that about 50% of these patients exert various mutations in the last 4 exons of hVDAC3 gene and that these mutations can cause the 8,9 observed asthenozoospermia. It has been reported that VDACs are found in bovine testis and sperm flagellum as well as in the acrosomal region of bovine sperm head. VDAC2 was found in the 10,11 acrosomal region of the bovine sperm head. AntiVDAC antibodies against VDAC isoforms structurally and functionally lead to surface alterations of the sperm head with a loss of the acrosomal cap, to coiled sperm 12 tails and sperm cell volume disturbances.
days injection after the end of the wash out period (AS3R2). We also took the serum before the injection (preimmunserum) as control. Immunization with the synthetic peptide was carried out after conjugation with keyhole lemphet hemocyanin (KLH) and glutaraldehyde 13 using modified Single-Step coupling method. The specificity of anti-VDAC3 antiserum to recognize its antigen was analyzed by ELISA method using ABTS peroxide substrate system (KPL, Netherland).
Evaluation of the presence of VDAC3 protein in human sperm

Human normozoospermic sperm was isolated by Percoll gradient (90% and 45%) centrifugation method in Cramer medium. Sperm pellet residing in 90 % Percoll solution was collected and subsequently the extraction of total protein in the sperm was accomplished using 2% triton-100 solution containing protease inhibitor 10 cocktail. Protein extract from sperm was electrophorised in SDS polyacrylamide gel electrophoresis (SDS-PAGE) consisting of 6% stacking and 12% separation gel. Electrophoresis was carried out at 200 mV for 45 minutes. Subsequently, the separated proteins were transferred from the electrophoresis gel to nitrocellulose membrane at 70 mV in 90 min time. The presence of VDAC3 protein in human sperm was determined by immune blot method using the produced VDAC3 antiserum (AS3) and protein A HRP (Sigma, USA) as a second antibody. VDAC3 protein was then detected with ECL chemiluminescence (Amersham, USA) and exposed to X-ray film (Fuji, Japan).
Evaluation of the effect of VDAC3 antiserum on the motility of human sperm Sperm samples were obtained from 30 fertile men with high quality of sperm motility (normozoospermia). Sperm analysis profile is depicted in Table 1. Spermatozoa of high quality sperm motility were isolated by swim-up procedure in Cramer medium. The concentration of sperm samples was adjusted to 50 million spermatozoa per ml.
Sperm motility in this study was assessed blindly by means of evaluation of sperm velocity (seconds per 0.1 mm distance in improved Neubauer chamber) and the number of unmoved sperm (million per ml) which were observed under light microscope at 0, 30 and 60 minutes after addition of anti-VDAC3 antiserum (AS3R2) and preimmunserum (S0R2) as a control, respectively,
The aim of this study was to examine the effect of anti-VDAC3 polyclonal antibody produced in our own lab on human sperm motility.
METHODS Production of anti-VDAC3 polyclonal antibody

Polyclonal anti-VDAC3 antiserum used in this study was collected from rabbits after five times every ten days (AS1R2) sub-cutaneous injection of a VDAC3 synthetic peptide of ten amino acids (SVFNKGYGFM). This procedure was followed by 30 days wash out of the immunization (AS2R2) and four times every ten
VDAC3 antibody decreases sperm motility
with 1:1 of dilution volume between antibody and sperm solution. Data from sperm velocity and number of unmoved sperm evaluation both from VDAC3 antiserum-treated samples and preimmunserum-treated
Table 1. Assessment of motility parameters of spermatozoa
No. Samples 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Total amount of sperm (million per ejaculate) 168 161 210 177 60 75 227 120 70 276 76 134 224 207 381 232 429 224 390 306 130 126 156 66 432 63 119 60 204 108
samples was analyzed statistically with Saphiro-Wilk, Levene, Mann-Whitney, or T-Test using SPSS 13.0 software (P < 0.05).
Rapid progressive motility (%) 5 5 17 11 8 5 5 10 10 5 10 8 8 7 9 9 6 7 12 10 8 9 14 10 10 7 8 8 6 10
Motility of sperm Slow or sluggish progressive motility (%) 43 40 43 43 43 73 64 65 70 60 55 42 43 44 42 43 43 44 42 42 43 43 50 37 41 42 42 43 44 40
No progressive motility (%) 17 10 10 21 17 7 16 15 13 15 15 17 18 17 18 17 16 26 20 18 16 17 16 23 17 14 20 21 23 21
Immotility (%) 35 45 30 25 32 15 15 10 7 20 20 33 31 32 31 31 35 23 26 30 33 31 20 30 32 37 30 28 27 29
RESULTS Anti-VDAC3 antiserum produced against the synthetic 10 amino acid peptide- analogue of VDAC3 protein revealed its antigenic activity by ELISA method at different dilution levels. The profile of the antibody ELISA titer is displayed in Figure 1. The absorbance value of the preimmunserum in the ELISA reader system was 0.1495 at 1:100 dilution. By using western and immune blot methods, the presence of VDAC3 protein in human sperm could be detected as a band in the molecurar weight range of about 30 kDa. No positive reaction could be detected in the sperm protein extract with ELISA method using preimmunserum (Fig. 2). The measurement of the velocity of sperm motility immediately after addition (0 min) of the VDAC3
antiserum (AS3R2) or at incubation times of 30 and 60 minutes demonstrated that the required time (seconds) of sperm to reach 0.1 mm distance increased significantly as compared to preimmunserum treatment (Fig. 3). The differences in seconds required to reach 0.1 mm distance increased with duration of incubation: 0.28 sec at 0 min < 0.32 sec at 30 min < 0.44 sec at 60 min (values of antiserum-incubated samples minus values of preimmunserum-incubated samples from the table in Fig. 3). The number of unmoved sperm 60 min after addition of VDAC3 antiserum increased also significantly as compared to the incubation with preimmunserum, while the number of unmoved sperm at 0 and 30 minutes was not significantly different (Fig. 4).
Genetic polymorphism of merozoit surface protein 11
Genetic polymorphism of merozoite surface protein-1 (MSP-1) block 2 allelic types in Plasmodium falciparum field isolates from mountain and coastal area in West Sumatera, Indonesia
Nuzulia Irawati
Department of Parasitology, Medical Faculty of Andalas University, Padang, Indonesia
Abstrak
Latar belakang: Sampel P. falciparum dari lapangan dapat menampilkan bentuk dan jenis yang bervariasi. Penelitian ini bertujuan mengetahui keragaman alel MSP-1 blok 2 isolat P. falciparum yang berasal dari daerah pegunungan dan daerah pantai Sumatera Barat, Indonesia dan membandingkan keberadaan jenis-jenis alel dari kedua daerah pegunungan dan pantai. Metode: 56 sampel darah yang terinfeksi P. falciparum, diperoleh dari 27 penderita yang berobat pada Puskesmas di Kabupaten Solok Selatan yang merupakan daerah pegunungan dan 29 penderita yang datang berobat pada Puskesmas dari daerah pantai di kabupaten Pesisir Selatan, Sumatera Barat, Indonesia. Daerah-daerah yang mengapit sifat-sifat yang sangat polimorfik, blok 2 MSP-1, ditentukan genotipnya melalui allele-specific nested PCR guna menganalisa populasi kepadatan parasit. Analisis urutan daerah-daerah polimorfik dari MSP-1 juga dilakukan untuk mengidentifikasi keanekaragaman alel di dalam populasi parasit. Hasil: Polimorfisme alel yang beranekaragam dari MSP-1 diidentifikasi pada isolat P. falciparum dari suatu daerah pegunungan dan daerah pantai di Sumatera Barat, Indonesia, dan kebanyakan infeksi ditemukan berupa infeksi campuran. Analisa urutan MSP-1 blok 2 mengungkapkan bahwa teridentifikasi 16 alel berbeda untuk MSP-1 (3 untuk tipe K1, 2 untuk tipe MAD20 dan 2 untuk tipe RO33). Kesimpulan: Dari isolat lapangan P. falciparum yang dikumpulkan dari suatu daerah pegunungan dan daerah pantai di Sumatera Barat teridentifikasi polimorfifme genetik yang luas. Juga ditemukan tingkat infeksi campuran yang tinggi, sebagai derajat kemajemukan infeksi yang tinggi. (Med J Indones 2011; 20:11-4)
Abstract
Background: The field isolates of P. falciparum may display variant forms and different frequencies. This study was designed to know the diversity of allelic type of MSP-1 block 2 among P. falciparum isolates collected in a mountain and a coastal area in West Sumatera, Indonesia, and compare mountain and coastal area.
Methods: A total of 56 P. falciparum infected blood samples, collected from 27 patients attending local health facilities in South Solok district in a mountain region and 29 patients attending a local health facilities in South Coastal district region, West Sumatera, Indonesia were used in this study. The regions flanking the highly polymorphic characters, block 2 for MSP-1, were genotyped by allele-specific nested-PCR to analyse the population diversity of parasite. Sequence analysis of the polymorphic regions of MSP-1 was also conducted to identify allelic diversity in the parasite population.
Results: Diverse allelic polymorphism of MSP-1 was identified in P. falciparum isolates from a mountain area and a coastal area in West Sumatera, Indonesia, and most of the infections were determined to be mixed infections. Sequence analysis of MSP-1 block 2 revelaled that 16 different alleles for MSP-1 (3 for K1 type, 2 for MAD20 type and 2 for RO33 type) were identified. Conclusion: Extensive genetic polymorphism with diverse allele type was identified in MSP-1 in P. falciparum field isolates from a mountain and a coastal area. A high level of mixed infections was also obcserved, as was a high degree of multiplicity of infection. (Med J Indones 2011; 20:11-4) Key words: allelic types, coastal area, mountain area, MSP-1 block 2, Plasmodium falciparum
Genetic diversity displayed by P. falciparum field isolates, the occurence of variant forms of parasite at different frequencies in different geographic areas, and the complexity of infection represent major obstacles for the effective control of malaria. The propagation of multi-drug resistant parasites and insecticide-resistant mosquitoes has led to major difficulties in controlling the spread of malaria. To fight against malaria, an 1,2 effective vaccine is urgently needed. A number of
Correspondence email to: nuzulia.irawati@yahoo.com
antigens expressed at different stages of parasites life cycle have been characterized with respect to their use in vaccine development against P. falciparum. Merozoite surface protein-1 (MSP-1) is one of the most promising vaccine 3 candidates. People naturally exposed to P. falciparum develop antibodies against MSP-1. Further-more, an association between a naturally acquired immune response to MSP-1 and reduced malaria morbidity has been observed. In a number of independent studies,
12 Irawati
Med J Indones
immunization with purified native MSP-1 or a recombinant fragment of protein has induced at least partial protection against parasite challenge. Sequence comparisons showed that the entire MSP-1 gene could be divided into 17 blocks 4 that are vaiable, conserved, or semiconserved. In seven blocks 1,3,5,12, and 17, the sequences are conserved. In seven blocks (blocks 2,4,6,8,10, 14, and 16), the sequence show extensive diversity, while in the remaining (blocks 7,9,11,13, and 15), the sequence are semiconserved.Variation in sequences of variable regions are dimorphic (K1/Wellcome or MAD20) in nature with the exception of the trimorphic encoding region in block-2, 5,6 which has a third version (RO33) found in natural isolates. Naturally acquired antibodies react more frequently against variable rather than conservedMSP_1 blocks and are 7 specific for one of the major version of variable blocks.
In the current study, we have analyzed polymerase chain reaction (PCR)-amplified fragments containing variable blocks 2,4, and 12-16 of the MSP-1 gene in the P. falciparum natural population and allelic types were scored by sampling allele-specific radio-labeled olingonuclotide probes. The allelic types were compared among the isolates collected from regions of hyperendemic malaria transmission (RHEMT) and 8,9 mesoendemic malaria transmission (RMEMT). We have also analyzed the allelic diversity in the isolation showing more than strain of parasites.
The samples was collected by finger puncture in the form of thick smears on slides. The slides were stained with Giemsa, and the presence of P. falciparum was detected under microscopic observation. The slides were then sent to the Medical Faculty, Andalas University in Padang, and parasitemia was determined and normalixed for 100 leukocytes. This information was converted into the number of parasites per microliter, assuming a leucocyte count of 8,000/L. To prepare DNA of the clinical samples, the thick smear, moistened previously with 1% saponin, the o incubated for one hour at 4 C. The sample was centrifuged at 12,000 xg for five minutes, and the supernatant discarded. The precipitate was resuspended in 40 L of Chelex-100 5% and boiled for 10 minutes. Finally the sample was centrifuged at 12,000xg for five minutes, and o 10,11 We the supernatant was recovered and stored at 4 C. used 8 L of the extract to amplify the MSP-1 gene through polymerase cian reaction (PCR).
The first amplification were used as a template for respective nested PCR assays. We took 5 L to identify the allotypes in block 2 of MSP-1.
Allotype detection in block 2 of MSP-1
In the PCR-based amplification for MSP1 gene and the nested PCR to identify the allotypes in block 2 of this gene, we used an amplification profile with an initial o o denaturation at 94 C/2 min followed by 72 C/2 min, time during which the Taq DNA Polymerase enzyme was o o added. Then, 35 cycles at 94 C/30 sec, 55 C/30 sec, and o 72 C/2 min were performed, ending with a final o extension at 72 C/2 min. The following primers were used in amplifying the MSP1 gene: OK11 )5 TAG AAG ATG CAG TAT TGA CAG GTT A 3) and OK12 (5 ATT CTA ATT CAA GTG GAT CAG TAA ATA A 3). To define the allele present in block 2 of the MSP-1 gene, the primers OK1 (CTT AAA TGA AGA AGA AAT TAC TAC AAA AGG TGC 3) and OK2 (5 GAG GGC TTG CAC CAG ATG AAG T 3) were used for the K1 allelic type. The primers OK3 (5 GTA TTA AAT GAA GGA ACA AGT GGA ACA 3)and OK4 (5 TAT CTG AAG GAT TTG TAC GTC TTG AAT T 3) were used to typify the MAD20 allotype. The primers Primer-primer OK5(5 ATT AAA GGA TGG AGC AAA TAC TCA AFT TGT 3 and OK6 (5 TC GAA GGA TTT GCA GCA CCT GGA GA 3) were used to amplify the RO33 allelic type. Both the primary and the nmested PCR were conducted in a final volume of 50 L, using 200 M of each dNTP, 1 M of each primer, 2,5 U of TaqDNA polymerase (Promega) per reaction and 1,mM of MgCl2 in the enzyme buffer (50 mM KCl, 10 mM Tris-HCl, pH 9.0, 0,1% Triton x100).
METHODS Clinical samples
The study was conducted in South Solok district, a area located in Bukit Barisan Mountain and in Pesisir Selatan, a area located in west coastal in West Sumatera province, Indonesia. The area has a farming of cocoa and sawit coconut in South Solok and majority was the fishing community in Pesisir selatan. All area is infested a primary vector, Anopheles balabacensis in South Solok and Anopheles sundaicus in Pesisir Selatan and is characterized by high altitude, relative high humidity, constant rain, and an average o of temperature 23 C, in South Solok, and coastal area, relative high humidity, constant rain, and an average o of temperature 30 C in Pesisir Selatan. The analyzed samples were collected during an outbreak in which the prevalence of malaria was 60%, measured as the percentage of people with parasites among those who presented with malaria symptoms at a health service.
Genetic polymorphism of merozoit surface protein
13
Allelic distribution and complexity of infection

The prevalence of each allelic type analyzed was determined as the percentage of PCR fragments for the type in the total number of amplified bands for the corresponding locus. The complexity of infection, which is the average number of PCR bands per infected individual, was determined as described earlier. The percentage for type and complexity of infection were calculated independently for each genetic marker.
Table 3. Distribution of fragments length of MAD20 allele types

Located Mountain area Coastal area MAD20 136bp 7 6
110bp 6 5
total 13 11
Table 4 Distribution of fragments length of RO33 allele types

Located Mountain area Coastal area 99 bp 6 5 RO33 120 bp 5 total 11 5
RESULTS
Of 56 samples analyzed from mountain area and coastal area, the endemic area in West Sumatera result in MSP1 was 14 peoples respectively. Genetic diversity was analyzed through PCR amplification of polymorphic regions in MSP1 gene. The three previously reported allelic types were found in block 2 of MSP1 from 28 samples were K1, MAD20, and RO33 type with the result as following: (Table 1)
Table 1. The result of the allelic amplification K1, MAD20, and RO33 of MSP1 gene of P. falciparum in mountain area
DISCUSSION
The structure of natural P. falciparum population plays a highly important role in the natural acquisition of immunity in malarial infection. Knowledge of this structure is necessary to develop strategies to control the disease, beginning with the design of effective vaccines against P. falciparum and including policy on the use of antimalarial medicines. We analyzed the genetic diversity of P. falciparum isolates collected in mountain endemic area and in coastal endemic area in West Sumatera, Indonesia for malaria but one where there is no permanent transmission of the parasite, as in certain African zones.
and coastal area.

Combined allelic types K1 MAD20 RO33 K1,MAD20 K1,RO33 MAD20,RO33 K1, MAD20, RO33 Total Mountain area 0 0 0 3 0 1 10 14 Coastal area 2 0 1 7 0 0 4 14
These types were established on the basis of differences in size observed through electrophoresis and showed respective sizes of 99-147 bp, 110-136 bp, and 99-120 bp of K1, MAD20, and RO33 respectively. The allelic most often present in the parasite population of the samples in mountain area studied was MAD20, with the frequency of 36.84% ( 14 of 38), K1 34.21% (13 of 38), and RO33 28.94% (11 of 38). Similarly, the allelic most often present in the parasite population of the samples in coastal area studied was K1, with the frequency of 44.8% ( 13 of 29), MAD20 37.93% (11 of 29), and RO33 17.24% (5 of 29).
Table 2. Distribution of fragments length of K1 allele types
K1 Located Mountain area Coastal area 99 bp 3 3 120 bp 3 4 147 bp 5 6 total 11 13
From the result was known that there were three infection combinations in mountain area and four infection combinations in coastal area. This condition may be caused by both these study areas were the open areas for all the comers and result in chance to occur mutation to P. falciparum infection is very large that is genetic recombination and variable result. Although the mountain and the coastal area in West Sumatera is the low endemic area, in Sumatera allelic variation is highly. This is much the same to result obtained ih other region, such as Thailand12 and Senegal.13 The presence of novel variation is due to transmigration from other island in Indonesia to Sumatrera terrestrial is the important issue.
In this study is also found amount balance of K-type allele, MAD20-type allele, and RO33-type allele in their frequency. This condition is proven with other regions having geographical isolation. For example, the studies by Diana Gomez only find MAD20 and Ktyoe alleles, by fragment variance is restricted. 14 Because there are in isolation areas in Colombia. In some same research in different geographic area than msp1 block 2 as a marker, report important
Comparison of adipose tissue processing 15
Effect of adipose tissue processing procedures in culture result: a study preliminary

Jeanne A. Pawitan, Arleni Bustami, Lia Damayanti, Radiana D. Antarianto, Ni M. Swantari
1 2 3
Department of Histology, Faculty of Medicine, University of Indonesia Immunology and Endocrinology Integrated Laboratory, Faculty of Medicine, University of Indonesia Department of Surgery, Faculty of Medicine, University of Indonesia
Abstrak
Latar belakang: Ada berbagai cara pemrosesan jaringan lemak sebelum dikultur, tergantung jenis sampelnya yang dapat mempengaruhi hasil kultur. Penelitian ini bertujuan membandingkan berbagai modifikasi prosedur kultur dan subkultur jaringan lemak yang disesuaikan dengan kondisi lab yang ada. Metode: Penelitian ini adalah penelitian deskriptif yang dilakukan di Makmal Terpadu Imunologi dan Endokrinologi, Universitas Indonesia, mulai Oktober 2009 sampai April 2010. Kami membandingan tiga cara pemrosesan, berbagai jumlah sel yang ditanam yang tergatung jumlah perolehan sel, dan dua cara subkultur, lalu membandingkan hasilnya dalam hal jumlah sel yang dihasilkan dan waktu yang diperlukan. Pada cara pemrosesan pertama, pencernaan dengan collagenase-1 dilakukan selama 30 menit dan jumlah sel yang ditanam adalah 24.000 dan 36.000 sel per wadah kultur; pada cara kedua, pencernaan dengan collagenase-1 dilakukan selama 60 menit dan jumlah sel yang ditanam adalah 24.000, 48.000, dan 72.000 per wadah kultur; dan pada cara ketiga, sisa jaringan lemak dari pemrosesan pertama dicerna kembali selama 45 menit dan jumlah sel yang ditanam adalah 74.000 dan 148.000 per wadah kultur. Perbedaan cara subkultur adalah pada ada atau tidaknya tahap pencucian. Hasil: Prosedur -1 menghasilkan jumlah sel yang paling sedikit, dan sesudah dikultur, selnya tumbuh sangat lambat, dan terkontaminasi sebelum panenan kultur primer. Prosedur-2 dan -3 berhasil menumbuhkan kultur primer. Beberapa kultur terkontaminasi, sehingga tidak dapat dilanjutkan dengan subkultur, dan hanya satu cara pemrosesan (prosedur-2: pencernaan collagenase-1 selama 60 menit tanpa penggunaan dapar pelisis, dan jumlah sel yang ditanam 48.000 dan 72.000) yang berhasil menyelesaikan semua proses yang direncanakan sampai subkultur ketiga. Walaupun beberapa prosedur tidak mencapai subkultur ketiga, hasilnya tetap dapat disimpulkan. Kesimpulan: Penelitian pendahuluan ini menunjukkan bahwa pencernaan collagenase-1 selama 60 menit dipadu dengan goyangan berkala setiap 5 menit dan jumlah sel yang ditanam sekitar 50.000 atau lebih, diikuti dengan cara subkultur tanpa tahap pencucian memberi hasil yang terbaik. (Med J Indones 2011; 20:15-9)
Abstract
Background: There are various methods of processing adipose tissue before culture, depending on the adipose tissue samples. The aim of this study is to compare several modifications of culturing and sub-culturing procedures of adipose tissue to fit the condition in our laboratory. Method: This is a descriptive study that was done in the Immunology and Endocrinology Integrated Laboratory, University of Indonesia, from October 2009 to April 2010. Three adipose tissue processing procedures, various amount of seeding and two subculture methods were compared in term of cell yield and time needed. In the first procedure, collagenase-1 digestion was done in 30minutes, cell seeding were 24,000 and 36,000 per flask; in the second procedure, collagenase-1 digestion was done in 60minutes, cell seeding were 24,000, 48,000, and 72,000 per flask; and in the third procedure, the adipose tissue remnants from the first procedure were again digested for another 45 minutes, cell seeding were 74,000, and 148,000 per flask. Difference in subculture methods were the presence or absence of washing step.
Result: Procedure 1 yielded the lowest amount of cell, and after culture, the cells grew very slow, and was contaminated before harvest of primary culture. Procedure-2 and -3 succeeded to yield primary cultures. Some of the cultures were contaminated, so that further subculture was not applicable, and only one tissue processing procedure (procedure 2: 60 minute collagenase-1 digestion, without lysis buffer, cell seeding 48,000 and 72,000) could complete the three subcultures. Though some of the procedures could not be completed, final result could be concluded.
Conclusion: In this preliminary study, 60 minute colagenase-1 digestion with intermittent shaking every 5 minutes and cell seeding around 50,000 or more, followed by subculture method without washing step gave the best result. (Med J Indones 2011; 20:15-9) Key words: collagenase-1, primary culture, subculture, stromal-vascular fraction
Correspondence email to: jeanneadiwip@fk.ui.ac.id
16
Pawitan et al.
Med J Indones
Adipose tissue stem cells are adult stem cells that have similar properties to the previously identified bone marrow mesenchymal stem cells. They can be isolated from adipose tissue stromal vascular fraction 1, (SVF) that is called adipose stromal compartment. 2 The stromal vascular fraction derived cells are 2 also called processed lipo-aspirate (PLA) cells, or alternatively, adipose tissue derived mesenchymal stem cells (AT-MSCs). Adipose tissue stem cells have 2 3 various differentiation and angiogenic potentials. In 4, 5 addition, they have immuno-suppressive properties, 6 and might be used to treat autoimmune diseases. Moreover, the ease in collecting the samples compared to that of bone marrow make adipose tissue 7 stem cells very promising for regenerative medicine. There are various methods of processing adipose tissue before culture, depending on the adipose tissue samples. Processing adipose tissue samples from lipoaspirate is different from resection derived samples. Further, there are various procedures for resection derived samples. The aim of this study is to compare several modifications of culturing and subculturing procedures for resection sample to fit the condition in our laboratory.
METHODS
This is a descriptive study that is part of a research on adipose tissue derived stem cells, which has got an approval from the ethical committee of the Faculty of Medicine University of Indonesia. This research was done in the Immunology and Endocrinology Integrated Laboratory, Faculty of Medicine, University of Indonesia, from October 2009 to April 2010
Both adipose tissue pieces were subjected to collagenase-1 digestion. Digestion was done in a 50mL tube containing 25mL 0.075% collagenase-1 in PBS pH o 7.4 at 37 C, and was gently shaken every 5 minutes. In this preliminary study, we tested 3 kinds of modified procedures using the available equipments in our lab. In the first and second procedure, digestion was done in 30 and 60 minutes respectively. In the third procedure, the adipose tissue remnants from the first procedure were again digested for another 45 minutes. After digestion, the floating adipose tissue was removed and the infranatant was placed in 15mL tubes, centrifuged at 800g, and the supernatant was discarded.
Culture and subculture

In the first and second procedure, the pellets were dissolved in 2.5 and 3 ml tissue culture (TC) medium respectively, and the cells were counted in Neubauer chamber.
In the third procedure, the pellet was dissolved in 4mL o lysis buffer and incubated at 37 C for 5 minutes, then centrifuged at 800g, and the supernatant was discarded. The pellet was dissolved in 3mL TC medium, and the cells were counted in Neubauer chamber.
The TC medium contained 10% fetal bovine serum (FBS, Biowest), 1% penicillin streptomycin (Lonza) and 1% Amphotericin B (Biowest) in Dulbeco Minimal Eagle Medium (DMEM, Lonza).
According to cell yield of every procedure, the cells were then seeded at different cell numbers (Table 1) in a final volume of 8mL TC medium in 25mL TC flask, and incubated at 37C with 5% CO2.The cultures were checked for the presence of contamination every day. Contaminated flasks were discarded. Beginning at day two, the flasks were checked every day for cell attachment. After the cell attachment of all flasks, the TC medium was replaced twice a week, every Monday and Thursday, or more frequent when the color changed into orange.
Sample
The adipose tissue resection sample was taken by a plastic surgeon, after the patient who underwent a plastic surgery got information about the research and had signed the informed consent form.
Tissue processing
In this study, we compared several procedures of tissue processing. We also compared different amount of cells that were cultured. First of all, the adipose tissue sample was washed from contaminating blood in phosphate buffered saline (PBS) pH 7.4 until the washing solution was clear, cut into 2 pieces, weighted, and the weights were noted. All processing was done in aseptic condition using sterile instruments and solutions.
When the cells were 40 - 80% confluence, subculture was done. We tested two subculture procedures, i.e. with and without washing step (direct subculture). Subculture (until subculture-3) was done by replacing the TC medium by 1.5mL of 0.05% trypsin in PBS pH 7.4, until the cells were detached, and trypsin solution was added when the cells were not detached after 10 m minutes. Further the trypsin was neutralized by a same amount of TC medium. The number of cells in the cell
Comparison of adipose tissue processing
17
suspension was counted. In direct subculture, half of the cell suspension was directly sub-cultured, and in the procedure with washing step, the other half was washed by PBS pH 7.4 before sub-culturing. When the yield was abundant, part of the cell suspension was directly subcultured, and a same amount was washed before subcultured, and the rest was cryopreserved. For direct subculture, the TC medium was replaced the next day. Further, for both subculture procedures, the TC medium was replaced twice a week, or more frequent when the color changed into orange.
RESULTS
Adipose tissue weight in the first (followed by the third) and second procedure was 2.74 and 1.94 grams respectively. The total number of cell yield in procedure 1, 2, and 3 were 60,000, 144,000, and 296,000 cells respectively, and cell yield per gram of adipose tissue in procedure 1, 2 and 3 was 21,898, 74,227, and 108,029 cells, respectively.
Data collection and interpretation

The total numbers of cell yield per gram of adipose tissue for every procedure were noted. Further, the days needed until the cells attached and began to grow in primary culture, became confluence or contaminated for every procedure and seeding and cell yield of every subculture were noted and tabulated. The procedure that yielded 40-80% confluence in the shortest time was regarded as the best.
Table 1. The number of seeded cells and needed time for attachment
Procedure 1-1 1-2 2-1 2-2 2-3 3-1 3-2 3-3 Seeding (final) 24,000 36,000 24,000 48,000 72,000 74,000 74,000 148,000
The cells were attached at day-3 to day-8 (Table 1). Primary culture took a long time to grow, but subcultures grew faster and became confluence in shorter time. The time needed until confluence or contamination, and the total yield of cells for every culturing and sub-culturing procedure can be seen in Table 2.
Cell yield in procedure 1, 2 and 3 was 21,898, 74,227, and 108,029 cells/gram of adipose tissue. Some of the cultures were contaminated, so that further subculture was not applicable, and only one tissue processing procedure could complete the three subcultures (Table 1 and 2).
Cell attachment Day-8 Day-8 Day-7 Day-3 Day-3 Day-5 Day-6 Day-7
Cell growth NC-42 NC-18 NC-42 C-16 (70%) C-16 (40%) C-28 (80%) NC-13 NC-11
Cell yield 200,000 32,000 1,464,000 -
C-= confluence at day-, NC= not yet confluence and contaminated at day-
Table 2. The time needed until sub-culturing or contamination and the yield of cells for every sub-culturing in the various procedures
P 1-1 1-2 2-1 2-2 Subc-1 NA NA NA Dir-S: 100, C-7 (80%) W-S: 60, C-7 (50%) 2-3 3-1 3-2 3-3 Dir-S: 16, C-23 (85%) W-S: 8, Cont-22 Dir-S: 488x1.5, cont-1 NA NA Cell yield (x1000) 1,080 456 1,312 Subc-2 NA NA Dir-S: 540, C-8 (90%) W-S: 152, C-15 (50%) Dir-S: 228, C-8 (80%) W-S: 80, Cont-21 (40%) NA - cryo NA NA NA NA Cell yield (x1000) 4,496 460 1,152 144 Subc-3 NA NA Dir-S: 1,124, C-7 (80%) NA-cryo Dir-S: 384, C-7 (80%) NA NA NA NA NA NA Cell yield (x1000) 2,960 2,464 -
P= procedure, Subc= subculture, C-= confluence at day-, cont-= contaminated at day-, NA= not applicable, Dir-S= directly sub-cultured and number of cell seeded, W-S= washed before sub-cultured and number of cell seeded, cryo= cryopreserved
20 Buang et al.
Med J Indones
The metabolic effects of di (2-ethyl hexyl) phthalate medium dose on lipid profiles in serum and liver tissue
Buang Y
6 7
1,2
Department of Chemistry, Faculty of Science and Engineering, Nusa Cendana University, Kupang, Indonesia Laboratory of Applied Biochemistry, Department of Applied Biological Science, Saga University, Saga Shi, Honjo Machi1, Saga, Japan
Abstrak
Latar belakang: Di (2-ethyl hexyl) phthalate merupakan bahan plasticizer yang banyak digunakan pada kantong darah untuk transfusi. Bahan ini dapat mempengaruhi metabolisme lipid. Penelitian ini bertujuan menyelidiki efek metabolik di (2-ethyl hexyl) phthalate dosis tengah pada profil lipid dalam serum dan jaringan hati. Metode: Tikus percobaan galur Sprague Dawley diberi diet yang disuplementasi dengan 1,0% di (2-ethyl hexyl) phthalate (kelompok DEHP, n=5) dan diet yang tak disuplementasi (kelompok kontrol, n=5) selama 10 hari. Hewan percobaan dibiarkan mendapatkan makanan secara ad libitum. Kadar lipid dalam serum diukur menggunakan enzyme assay kits. Lipid jaringan hati diekstraksi dan konsentrasinya ditentukan. Sepotong jaringan hati diambil untuk menentukan aktivitas malic enzyme dan carnitine palmitoyl transferase-1 (CPT-1).
Hasil: Kadar lipid serum kelompok DEHP menurun dibandingkan dengan kelompok kontrol (P<0,05), di mana kadar lipid serum (mg/dL) pada kelompok kontrol dan DEHP masing-masing: trigliserida (TG) (100,516,5) dan (31,21,7); fosfolipid (PL) (143,37,8) dan (88,93,2); kolesterol total (88,74,6) dan (51,92,3); dan kolesterol HDL (high-density lipoprotein) (29,81,0) dan (16,10,7). Kandungan PL hati pada kelompok DEHP meningkat secra bermakna dibandingkan dengan kelompok kontrol (P<0,05); peningkatannya mencapai 15%. Kandungan lipid hati (mg/g jaringan) pada kedua kelompok masing-masing: TG (40,84,4) dan (23,71,3); kolesterol total (3,360,29) dan (2,330,23); PL (36,51,0) dan (41,70,6). Aktivitas malic enzyme dan CPT-1 masing-masing meningkat sebesar 4,35 dan 2,33 kali kelompok kontrol.
Kesimpulan: Di (2-ethyl hexyl) phthalate dosis tengah menurunkan sekresi lipid dari sel-sel hati ke dalam aliran darah. Kandungan TG dan kolesterol total sel-sel hati juga berkurang, sebaliknya kadar fosfolipid hati meningkat. Peningkatan fosfolipid hati disertai peningkatan aktivitas malic enzyme dan CPT-1 merupakan faktor utama penurun kadar lipid serum, TG dan kolesterol sel-sel hati yang diinduksi oleh di (2-ethyl hexyl) phthalate. (Med J Indones 2011; 20:20-6)
Abstract
Background: Di (2-ethyl hexyl) phthalate is the most widely used plasticizer in blood storage bag for transfusion. This substance can modify lipid metabolism. This study was aimed to elucidate the metabolic effects of di (2-ethyl hexyl) phthalate medium dose on lipid profiles in serum and liver tissue.
Methods: Sprague Dawley rats were fed 1.0 % di (2-ethyl hexyl) phthalate diet (DEHP group, n=5) or a non-supplemented diet (control group, n=5) for 10 days. The rats were allowed to freely access each food. Serum lipid concentrations were measured using enzyme assay kits. Lipids of liver tissues were extracted and the lipid contents were determined. A peach of liver was prepared to determine the activities of malic enzyme and carnitine palmitoyl transferase-1 (CPT-1).
Results: Serum lipid concentrations (mg/dL) of DEHP group decreased compared to control (P<0.05). The serum triglyceride (TG) concentrations of control and DEHP groups were respectively (100.516.5) and (31.21.7); phospholipid (PL), (143.37.8) and (88.93.2); total cholesterol, (88.74.6) and (51.92.3). The liver TG content of control and DEHP group (mg/g liver) were respectively, (40.84.4) and (23.71.3); liver cholesterol were (3.360.29) and (2.330.23); and the liver PL were (36.51.0) and (41.70.6). Malic enzyme and CPT-1 activities (nmol/min/ mg protein) of DEHP group increased compared to control (P<0.05), in which their increases were approximately by 4.35- and 2.33-folds, respectively.
Conclusion: The di (2-ethyl hexyl) phthalate medium dose attenuates lipids secretion from the liver cells into the bloodstream. The increase of liver PL level accompanied with the promotions of malic enzyme and the CPT-1 activities are the key factors of the dietary di (2-ethyl hexyl) phthalate effects in rats to attenuate the lipid secretions from the livers.
(Med J Indones 2011; 20:20-6) Key words: Di (2-ethyl hexyl) phthalate, hyperphospholipids, lipolysis, liver lipids, serum lipids
Di (2-ethyl hexyl) phthalate is the most widely used plasticizer in polyvinyl chloride plastic. It was reported that di (2-ethyl hexyl) phthalate used in blood storagebags leaches out in significant amounts into the blood stored and the blood products resulted from exposure of patients to this compound during transfusion.
1-3
It was also reported
that after 21 days storage of blood used to transfuse in human recipients, the blood storage bags averagely leaches out 10 mg di (2-ethyl hexyl) phthalate/100 mL blood. Furthermore, a number of reports are available on the toxicity of di (2-ethyl hexyl) phthalate, particularly 4,5 studied in the liver. Almost all of those studies carried
Correspondence email to: pajohn_buang@hotmail.com
Metabolic effects of di (2-ethyl hexyl) phthalate medium dose
21
out the treated doses reached 200mg/100g body weight 6 (BW). Gayathri et al. administered the rats with a dose of 0.75 mg/100g BW which is equivalence with transfusion of ten unit of blood in a human recipient. These authors did not find the serious toxic effects as evidenced by lack of any histopathological changes in the liver or significant alterations in many biochemical parameters. Overall, the doses of di (2-ethyl hexyl) phthalate that had been treated have ranges 750g200mg per 100g BW. Therefore, the dose of 75 mg di (2ethyl hexyl) phthalate/100g BW that was used in the present study might be considered medium dose. Currently, di (2-ethyl hexyl) phthalate, a phthalate plasticizer, belongs to a peroxisome proliferators class of 7,8 rodent nongenotoxic hepatocarcinogens. This phthalate modulates the peroxisome proliferators9 activated receptor (PPAR). PPAR is known as lipidactivated transcription factors expressed in the liver that belongs to the nuclear hormone superfamily. Numerous 7-9 authors reported that di (2-ethyl hexyl) phthalate is the essential transcription factors regulating key cellular functions that include lipid metabolism.
METHODS Animals and experimental design

All aspects of the experiment were conducted according to guidelines provided by the ethical committee of experimental animal care at Saga University (Saga, Japan). Male SD-rats aged 5 weeks were housed individually in an air-conditional room (24oC) with a 12h light/dark cycle. After one week acclimatization, rats were assigned to two groups (five rats each). Control diet (as control group) was prepared according to recommendations of the American Institute of Nutrition (AIN) and contained (in weight %) 20 of casein, 10 of safflower oil, 1 of vitamin mixture (AIN-93), 3.5 of mineral mixture (AIN-93), 10 of sucrose, 0.25 of choline bitartrate, 0.3 of L-Cystein, 0.0014 of t-BHQ, 5 of cellulose, 13.2 of -cornstarch, and -cornstarch to make 100. The di (2-ethyl hexyl) phthalate diet (as DEHP group) was prepared by replacement of 1.0% -cornstarch with di (2-ethyl hexyl) phthalate to the control diet. Considering evidences in food intake and final BW of the dietary di (2-ethyl hexyl) phthalate in male SD-rats, the 1% of food intake is equally to a range of 73-77 mg di (2-ethyl hexyl) phthalate/100g BW 16 dose. The animals received the diets for 10 days. At the end of the feeding period, rats were killed by decapitation after a 9-h starvation. Livers were excised immediately, and serum was separated from blood.
Some biochemical parameters in lipid metabolism such as serum lipid profiles are constantly altered during normal states or disorders of metabolisms. Very-low density lipoprotein is a lipoprotein handling the lipid transportation from the synthesized lipid in the liver into extra hepatic tissues. Hence, serum lipid profiles generally indicate how lipid metabolism occurred in the liver. Commonly, disorders of lipid metabolism in the liver such as fat infiltration induce 10-12 hepatic steatosis. The impacts of the hepatic steatosis is similar to those seen in patients with alcoholic liver disease and range from mild hepatic steatosis to steatohepatitis, liver fibrosis, and 13 14 cirrhosis, and, rarely, to hepatocellular carcinoma.
Considering di (2-ethyl hexyl) phthalate is widely used in consumer products in common society such as food 15 packaging materials and childrens toys and used for tubing and containers for blood transfusions and blood products, etc., di (2-ethyl hexyl) phthalate constantly and directly or indirectly interacts with human and animal health cells. Therefore, its effect on lipid profiles in serum and liver tissue is of interested to evaluate. The present study was conducted to elucidate the metabolic effects of di (2-ethyl hexyl) phthalate medium dose on lipid profiles in serum and liver tissue using spraguedawley (SD) rats as animal model.
Analyses of serum and liver lipids

Liver lipids were extracted according to the method of Folch 17 et al., and concentrations of TG, cholesterol, and phospholipids (PL) were measured by the methods used 10-12,18,19 elsewhere. Serum TG, PL, cholesterol, and glucose were measured using enzyme assay kits from Wako Pure Chemicals according to the manufactures instructions.
Preparation of liver sub cellular fractions The mitochondrial and cytosol of liver sub cellular fractions were prepared as previously reported by 19 Nagao et al. Protein content was determined by the 10-12,18,19 method used in our previous studies. Assays of hepatic enzyme activity The malic enzyme (ME, EC1.1.1.40), the carnitine palmitoyl transferase-1 (CPT-1; EC2.3.1.23), glucose 6-phosphate dehydrogenase (G6PDH; EC1.1.1.49), fatty acid synthase (FAS; EC2.3.1.85), phosphatidate phosphohydrolase (PAP, EC3.1.3.4) activities were
22 Buang et al.
10-
Med J Indones
determined by the methods used in our previous studies.

12,18,19
The glutathione peroxidase (GSH-Px; EC1.11.1.9)

20,21
Effects of di (2-ethyl hexyl) phthalate on glucose blood level, serum and liver lipid levels
As shown in Figure 1, the lipid levels in serum of DEHP group decreased significantly (P<0.05), in which serum TG, PL, total cholesterol, and HDL-cholesterol levels decreased approximately by 70%, 38%, 41%, and 46%, respectively. Although failed to reach significant level, the glucose blood level decreased by approximately 9%.
Table 1. The metabolic effects of di(2-ethyl hexyl) phthalate on growth parameters
Group Initial body weight (g) Final body weight (g) Food intake (g/day) Liver weight (g/100 g body weight) Control 132.8 3.4 a 206.1 3.5 a 18.7 0.8 4.0 0.1
a
was determined by the methods used elsewhere.
Statistical analyses
All values are expressed as mean standard error of the mean (SEM). Data were analyzed by one-way analysis of variance, and all differences were inspected by Duncans new multiple-range test using SPSS statistical software (SPSS inc., Chicago, IL, USA).
RESULTS Dietary di (2-ethyl hexyl) phthalate promoted liver weight The daily food intake is shown in Table 1. The food intake of DEHP group decreased in comparison to control. The low level of food intake in the group was equivalent with the reduction of body weight. However, the weights of liver were significantly higher than that of the control group (P<0.05).
DEHP* 134.6 2.5 b 188.4 6.3 b 14.1 0.8 6.7 0.2

b
Values are expressed as mean SEM of five rats. Clearly define a & b indicates significant difference at P < 0.05. *DEHP, di(2-ethyl hexyl) phthalate
Figure 1. Serum lipids and glucose levels

Values are expressed as mean SEM of five rats. Clearly define a & b regarding difference of significance at P < 0.05.
MnSOD mRNA expression and specific activity 27
Expression of manganese superoxide dismutase in rat blood, heart and brain during induced systemic hypoxia
Septelia I. Wanandi, Syarifah Dewi,
8
9
1,2
Sri W. A. Jusman Mohamad Sadikin
Department of Biochemistry and Molecular Biology, Faculty of Medicine Universitas Indonesia, Jakarta Master Program in Biomedical Sciences, Faculty of Medicine Universitas Indonesia, Jakarta
Abstrak
Latar belakang: Hipoksia mengakibatkan peningkatan ROS. Hingga saat ini, belum banyak diketahui mengenai peran MnSOD enzim antioksidan endogen utama pada respons adaptasi sel terhadap hipoksia. Penelitian ini bertujuan menganalisis ekspresi mRNA dan aktivitas spesifik MnSOD pada darah, jantung dan otak tikus yang diinduksi hipoksia sistemik.
Metode: 25 ekor tikus Sprague Dawley diinduksi hipoksia sistemik di dalam ruang hipoksia (8-10% O2) selama 0, 1, 7, 14 atau 21 hari. Ekspresi relatif mRNA MnSOD dianalisis menggunakan Real Time RT-PCR. Aktivitas spesifik MnSOD diukur dengan metode inhibisi xantin oksidase. Hasil: Ekspresi relatif mRNA MnSOD pada darah dan jantung tikus menurun selama fase awal induksi hipoksia sistemik (hari ke 1) dan meningkat setelah hari ke 7, sedangkan ekspresi mRNA pada otak meningkat sejak hari ke 1 dan mencapai kadar maksimum pada hari ke 7. Hasil pengukuran aktivitas spesifik MnSOD selama awal induksi hipoksia sistemik menyerupai hasil ekspresi mRNA. Pada kondisi hipoksia yang sangat lanjut (hari ke 21), aktivitas spesifik MnSOD pada darah, jantung dan otak menurun secara signifikan. Ekspresi mRNA MnSOD pada ketiga jaringan tersebut selama hari ke 0-14 induksi hipoksia sistemik berkorelasi positif dengan aktivitas spesifiknya. Selain itu, ekspresi mRNA dan aktivitas spesifik MnSOD pada jantung berkorelasi kuat dengan hasil pada darah.
Kesimpulan: Ekspresi MnSOD pada fase awal dan lanjut induksi hipoksia sistemik mengalami regulasi yang berbeda. Ekspresi MnSOD pada otak berbeda dengan pada darah dan jantung, menunjukkan bahwa jaringan otak dapat lebih bertahan pada induksi hipoksia sistemik dibandingkan jantung dan darah. Pengukuran ekspresi MnSOD di dalam darah dapat digunakan untuk menggambarkan ekspresinya di dalam jantung pada keadaan hipoksia sistemik. (Med J Indones 2011; 20:27-33)
Abstract
Background: Hypoxia results in an increased generation of ROS. Until now, little is known about the role of MnSOD - a major endogenous antioxidant enzyme - on the cell adaptation response against hypoxia. The aim of this study was to determine the MnSOD mRNA expression and levels of specific activity in blood, heart and brain of rats during induced systemic hypoxia.
Methods: Twenty-five male Sprague Dawley rats were subjected to systemic hypoxia in an hypoxic chamber (at 810% O2) for 0, 1, 7, 14 and 21 days, respectively. The mRNA relative expression of MnSOD was analyzed using Real Time RT-PCR. MnSOD specific activity was determined using xanthine oxidase inhibition assay. Results: The MnSOD mRNA relative expression in rat blood and heart was decreased during early induced systemic hypoxia (day 1) and increased as hypoxia continued, whereas the mRNA expression in brain was increased since day 1 and reached its maximum level at day 7. The result of MnSOD specifi c activity during early systemic hypoxia was similar to the mRNA expression. Under very late hypoxic condition (day 21), MnSOD specific activity in blood, heart and brain was significantly decreased. We demonstrate a positive correlation between MnSOD mRNA expression and specific activity in these 3 tissues during day 0-14 of induced systemic hypoxia. Furthermore, mRNA expression and specific activity levels in heart strongly correlate with those in blood. Conclusion: The MnSOD expression at early and late phases of induced systemic hypoxia is distinctly regulated. The MnSOD expression in brain differs from that in blood and heart revealing that brain tissue can possibly survive better from induced systemic hypoxia than heart and blood. The determination of MnSOD expression in blood can be used to describe its expression in heart under systemic hypoxic condition. (Med J Indones 2011; 20:27-33) Key words: MnSOD, mRNA expression, ROS, specific activity, systemic hypoxia
Nowadays, the pattern of morbidity and mortality in Indonesia has shifted from infectious to degenerative diseases, such as cardio- and cerebrovascular diseases and cancer. Almost all risk factors for those diseases could induce hypoxic condition, indicating the involvement of hypoxia in pathogenesis of the 1 degenerative diseases.
Correspondence email to: septelia@gmail.com
Hypoxia is a pathological condition in which the body as a whole or region of the body is deprived of adequate oxygen supply. This condition threatens life of cells or organisms. The ability to maintain oxygen homeostasis is essential for the survival of all aerobic species. Oxygen homeostasis mechanisms can occur at systemic level and cellular level, such as by oxygen sensing. At
28 Wanandi et al.
Med J Indones
systemic level, low oxygen could stimulate heart rate, peripheral vasodilatation and hyperventilation, whereas at cellular level, anaerobic metabolic 2,3 pathways would be activated. One of the cellular oxygen sensing reactions in hypoxia is the increased level of hypoxia-inducible factor-1 (HIF-1). HIF-1 is a ubiquitous intracellular protein that is degraded by prolyl hydroxylase right after its biosynthesis in normoxic condition. Stabilized HIF-1 joins HIF-1 to form HIF-1 transcription factor which interacts with HRE (HIF-1 response element) and regulates the transcription of essential 4-6 genes for the adaptation responses to hypoxia.
Hypoxia results in an increased generation of reactive oxygen species (ROS), such as superoxide anion radical (O2 ) and hydrogen peroxide (H2O2) in mitochondria. Free radicals are molecules that have at least one unpaired electron and thus are very reactive. The term ROS also includes reactive oxygen species which are chemically not radicals, e.g., hydrogen peroxide. Under hypoxic condition, the consumption of oxygen at cytochrome c oxidase level (complex IV of the mitochondrial electron transport chain) is lower than under normoxic conditions and electrons accumulate at the preceding complex III. Such an accumulation leads 7 to an increased generation of ROS at complex III or on the transport between the two complexes by cytochrome C. In hypoxia, ROS also participate in signal transduction pathways inducing the stabilization of HIF1. Moreover, pro-oxidant treatment in normoxic cells 3,8 can activate genes that induce hypoxia.
Superoxide dismutase (SOD) is one of the antioxidant enzymes that could protect cells from oxidative damage. This enzyme converts very reactive superoxide anion radicals (O2 ) to less reactive hydrogen peroxide (H2O2). Among the three isoforms of SOD, manganese superoxide dismutase (MnSOD) is the major antioxidant enzyme in mitochondria that scavenges superoxide radicals generated 7 by the electron transport chain in mitochondria. Decreasing the MnSOD level could elevate ROS levels in mitochondria and lead to oxidative stress including oxidative the damage 9 of biomacromolecules, such as proteins, lipids and DNA.
differential MnSOD expression in various tissues during induced systemic hypoxia would open the new concept of localized adaptation response as antioxidant protection.
METHODS This was an experimental study carried out at Biochemistry and Molecular Biology Laboratory, Faculty of Medicine University of Indonesia. All procedures were approved by the Ethical Committee of Research Center and Health Development, Ministry of Health Republic of Indonesia (BALITBANGKES RI; No. LB.03.02/ KE/1347/2008). Systemic hypoxia induction
Twenty-five male Sprague Dawley rats (6-8 weeks old; body weight 150-200 g at entry into protocol) were randomly divided into 5 groups (n = 5 per group). Rats were subjected to systemic hypoxia by placing them into a normobaric hypoxic chamber treated with 8-10% of O2 for 0 (control rats without hypoxia), 1, 7, 14 and 21 days, respectively. The hypoxic chamber (kindly provided by Dr. F. Ferdinal) was designed as previously described by 12 Corno et al. All rats had free access to water and standard rat chow. Water and food consumption was assessed every 2 days.
Isolation of total RNA and protein

After hypoxic treatment, rats were sacrificed with ether anaesthesia. Rat blood was immediately collected from the heart for blood gas analysis. Subsequently, brain and heart tissues were rapidly excised. Samples from blood, heart and brain were used for the analysis of mRNA expression and specific activity of MnSOD. All excision procedures were executed in the hypoxic chamber.
Whole blood (200 l) was added into 600 l of Red Blood Cell Lysis Solution (Promega). The mixture was incubated for 10 minutes at room temperature and centrifuged at 16000 rpm for 20 seconds. The white pellet containing 0 leucocytes was collected and kept at -80 C before use. Total RNA was extracted from leucocytes and tissue samples (100 mg) using Tripure RNA Isolation Kit (Roche) and was 0 kept at -80 C before use. The isolation of total protein from leucocytes and tissue samples was performed as previously 13 described by Hardiany et al.
Many studies have explained the important role of 10,11 MnSOD in the prevention of oxidative stress. However, little is known about the expression of MnSOD during systemic hypoxic conditions, particularly in the essential tissues, such as brain, heart and blood. In the present study, mRNA expression and specific activity of MnSOD were analyzed. The information about
Analysis of MnSOD mRNA relative expression using Real Time RT-PCR

Total RNA (~300 ng) was amplified using iScript One Step RT-PCR Kit with SYBR Green (BioRad). cDNA synthesis and PCR amplification were carried out in the same tube.
MnSOD mRNA expression and specific activity 29
Reaction protocol was as follows: cDNA synthesis for 10 o minutes at 50 C; inactivation of reverse transcriptase for 5 minutes at 95C; PCR cycles (40 cycles) for 10 seconds at 95C, 30 seconds at 59C (after optimalization), 30 seconds at 72C; melting curve analysis for 1 minute at 95C, 1 minute at 55C; 10 seconds at 55C (80 cycles increasing 0.5C each cycle). Primers were designed according to NCBI gene bank data: NM_017051 (for MnSOD) and NM_031144 (for -actin as a reference gene) using Primer3 program & Primer Analysis software.
Primer sequences used to generate cDNA for MnSOD (178 bp) are: 5- AACGTCACCGAGGAGAAGTA - 3 (forward); 5- TGATAGCCTCCAGCAACTCT - 3 (reverse) and those used to generate cDNA for -actin (174 bp) are: 5- CACTGGCATTGTGATGGACT - 3 (forward); 5- CTCTCAGCTGTGGTGGTGAA - 3 (reverse). Amplification procedures for the -actin gene were the same as for the MnSOD gene. Aqua bidest was used as a negative control (NTC) to reduce false positive results. The level of mRNA expression of treated groups was relatively determined using PfaffI formula and normalized to the control group (as a calibrator with expression level of 1).
Figure 1. Melting curve of MnSOD and -actin cDNA produced by Real Time RT-PCR.
Insert: Electrophoresis on 2% agarose gel for MnSOD cDNA (178 bp) and actin cDNA (174 bp). NTC (Non-template control) is a negative control: no cDNA prod-uct visible for NTC.
Analysis of MnSOD specific activity

SOD activity was biochemically determined using xanthine oxidase inhibition assay, as previously 13 described. To inhibit the Cu/ZnSOD, prior to addition of xanthine oxidase, natrium cyanide (5 mM) was first added into each sample and incubated for 5 minutes in room temperature. Kinetic of enzyme activity was measured using spectrophotometer at 505 nm after 30 seconds and 3 minutes and calculated as a percentage inhibition of the samples plotted to the standard curve. The specific activity of MnSOD enzyme was calculated as enzyme activity (in Unit) per mg protein. Protein concentration was measured using spectrophotometer at 280 nm and plotted to the BSA (Bovine Serum Albumin) standard curve. Specific activity of MnSOD in rat blood, heart and brain are expressed as Unit/gram protein, and compared by using t-test.
Figure 2 shows that MnSOD mRNA relative expression in rat blood and heart was decreased during early induced systemic hypoxia (day 1) and continuously increased after 7 days of systemic hypoxia. Compared to this result, the relative expression of MnSOD mRNA in rat brain was increased from day 1 of induced systemic hypoxia and reached its maximum level at day 7.
RESULTS
Analysis of MnSOD mRNA expression using Real Time RT-PCR was first optimized for the primers specificity. As shown in Figure 1, there was merely a single peak in the melting curve and a single band in the electrophoresis of cDNA product of MnSOD as well as -actin. This indicates that the primers designed in this study for both genes could generate the specific cDNA products and there were no primer dimers present.
Figure 2. Relative expression level of MnSOD mRNA in rat blood, heart and brain during induced systemic hypoxia. The level of mRNA relative expression of treated groups was determined using Real Time RT-PCR, calculated according to PfaffI formula and normalized to the data of particu-lar control group (as a calibrator with expression level of 1). actin was used as a reference gene.
The result of MnSOD specific activity during early systemic hypoxia was similar to the result of mRNA expression. Figure 3 demonstrates that MnSOD specific activity in rat blood and heart during early systemic hypoxia was significantly (t-test; p < .05) decreased on day 1 and subsequently increased afterwards, whereas this activity in rat brain
34 Tjakradidjaja and Tjakradidjaja
Med J Indones
Pomegranate (Punica granatum L) powder reduced malondialdehyde (MDA) level in cigarette smoke exposed rats
Francisca A. Tjakradidjaja, Anita S. Tjakradidjaja
10 11
Department of Medicine, Faculty of Medicine and Health Science, Syarif Hidayatullah State Islamic University, Jakarta Department of Animal Nutrition and Food Technology, Faculty of Animal Science, Bogor Agricultural University, Bogor
Abstrak
Latar belakang: Mengetahui efek pemberian bubuk pomegranate selama 14 hari terhadap peroksidasi lipid berdasarkan pengukuran kadar malondialdehida (MDA) pada tikus yang dipaparkan asap rokok. Metode: Rancangan acak lengkap diterapkan pada penelitian ini. Tigapuluh tikus Sprague-Dawley dibagi menjadi tiga kelompok, yaitu: kelompok tanpa penambahan bubuk pomegranate (kontrol), kelompok R1 dengan penambahan 5% (kandungan flavonoid 0,351%/100g) dan kelompok R2 dengan penambahan 10% (kandungan flavonoid 0,566%/100g) bubuk pomegranat ke dalam ransum. Ransum diberikan ad libitum selama 14 hari. Tikus dipaparkan pada asap rokok selama tiga kali sehari. Kadar MDA diukur sebelum pemaparan, hari ke-8 dan -15 pemaparan. Data dianalisis menggunakan uji ANOVA setelah pengujian normalitas data. Hasil: Kadar MDA sebelum pemaparan adalah 0.350.06 nmol/mL, 0.380.06 nmol/mL dan 0.380.06 nmol/mL berturut-turut untuk kelompok kontrol, R1 dan R2 (P= 0.65). Pada hari ke-8, kadar MDA adalah 0.700.06 nmol/mL, 0.570.06 nmol/mL dan 0.560.06 nmol/mL berturut-turut untuk kelompok control, R1 dan R2. Kadar MDA pada hari ke-15 berturut-turut untuk kelompok kontrol, R1 dan R2 adalah 1.02 0.06 nmol/mL, 0.890.06 nmol/mL dan 0.800.06 nmol/mL. Terdapat perbedaan bermakna (P= 0,001) rerata kadar MDA hari ke-8 dan hari ke-15 antar kelompok. Rerata kadar MDA pada kelompok kontrol paling tinggi dibandingkan kelompok R1 dan R2 baik pada hari ke-8 maupun hari ke-15. Rerata kadar MDA pada kelompok R2 paling rendah dibandingkan kelompok R0 dan R1 pada hari ke 8 maupun hari ke 15. Peningkatan kadar MDA pada hari ke delapan dibandingkan sebelum pemaparan pada kelompok R0, R1 dan R2 berturut-turut adalah 97%, 52% dan 48%, sedangkan peningkatan MDA pada hari ke 15 dibandingkan sebelum pemaparan pada kelompok R0, R1 dan R2 berturut-turut adalah 187%, 137% dan 113%. Peningkatan kadar MDA terbesar adalah pada kelompok R0. Kesimpulan: Pemberian bubuk pomegranat pada kadar 5% dan 10% dapat menekan terjadinya peroksidasi lipid yang ditunjukkan dengan kadar MDA dibandingkan dengan kelompok kontrol. (Med J Indones 2011; 20:34-9)
Abstract
Background: To analyze the effect of pomegranate (P. granatum) powder consumption for 14 days on lipid peroxidation as shown by malondialdehyde (MDA) level in cigarette smoke exposed rats. Methods: Thirty Sprague-Dawley male rats were randomly divided into three groups, i.e.: a control group and two treatment groups. The treatment groups either received 5% (R1: 0.351% flavonoids/100g) or 10% (R2: 0.566% flavonoids/100g) pomegranate extract powder, respectively. The diets in the form of pellets were freely consumed (ad libitum) and were given for 14 days. Rats were exposed to cigarette smoke three times per day. Blood samples were taken on day 0, day 8th and 15th for MDA analyses. Comparison of MDA levels was done by ANOVAs test on normal data. Results: On day 0, the MDA levels were 0.350.06 nmol/mL, 0.380.06 nmol/mL and 0.380.06 nmol/mL for control, 5% and 10% pomegranate powder group, respectively (P=0.65). On day 8th, the MDA levels were 0.700.06 nmol/mL, 0.570.06 nmol/mL and 0.560.06 nmol/mL, and on day 15th, the MDA levels were 1.02 0.06 nmol/mL, 0.890.06 nmol/mL and 0.800.06 nmol/mL in control, 5% and 10% pomegranate powder group, respectively. There was a significant difference (P< 0.001) in MDA levels on day 8th and 15th between groups. The average MDA level for rats consuming control diet was the highest on day 8th and 15th. On the other hand, the lowest average MDA level on day 8th and 15th was observed in rats given 10% pomegranate extract powder. In comparison to MDA level before cigarette smoke exposure, the increases in MDA levels for rats consuming control diet, 5% and 10% pomegranate extract powder were 97%, 52% and 48% on day 8th, and 187%, 137% and 113% on day 15th, respectively. The highest increase in MDA level was observed in control group. Conclusion: The use of pomegranate powder at 5% and 10% concentration was able to prevent the occurrence of lipid peroxidation as shown by the MDA levels and the effect was dose dependent. (Med J Indones 2011; 20:34-9) Key words: antioxidant, flavonoids, lipid peroxidation
Correspondence email to: chika.tjakra@yahoo.co.id
Pomegranate powder reduced malondialdehyde (MDA)
35
Cigarette smoke contains more than 4000 elements and at least 200 of them are harmful to health. The main toxins in cigarettes are tar, nicotine, and carbon monoxide. In addition, cigarette smoke also contains other chemicals that are not less toxic such as ammonia, 1, 2 formic acid, formaldehyde, hydrogen cyanide, etc.
The combustion of cigarettes can lead to the production of reactive oxygen species (ROS). Free radicals, components of ROS are found in cigarette mainstream and side stream smoke. Side stream cigarette smoke contains more toxic gases and free radicals than the mainstream cigarette smoke. The adverse effects of smoking may result from the accumulation of oxidative damage brought about by ROS, which is called oxidative stress. Oxidative stress is a condition that occurs due to imbalance betweenfreeradicalandantioxidantproductions.Thiswill cause serious damage to biological macromolecules and disregulation of normal metabolism and physiological functions. Free radicals can cause lipid peroxidation in cell membranes, which in turn produces compounds that are toxic to cells, such as malondialdehyde (MDA). Elevated levels of MDA show the increased activity of lipid peroxidation.
6 5 3, 4
METHODS
This study was conducted in a completely randomized design that compared three groups of rats. The treatments were R0 (control diet), R1 (95% of R0 + 5% of pomegranate powder), and R2 (90% of R0 + 10% of pomegranate powder). The experiment was carried out for two months in an animal house at the Laboratory of Animal Genetic and Breeding, Department of Animal Production and Product Technology, Faculty of Animal Science, Bogor Agricultural University, and at the Laboratory of Biochemistry, Faculty of Medicine and Health Sciences Syarif Hidayatullah State Islamic University, Jakarta.
Subjects Thirty male white rats (Rattus norvegicus) of SpragueDawley strain (3 weeks of age) with average body weight of 80 g were used in this experiment. These rats were divided into 3 groups (R0, R1 and R2) that consisted of 10 rats each. These rats were individually kept in a plastic cage. Pomegranate powder Pomegranate powder was commercial pomegranate powder (Taify). Nutrient composition of the pomegranate powder is shown in Table 1. Diet and drink
A standard diet of commercial feed for rats in powder form was used. For the control rats no pomegranate powder was added. For the treatment groups, pomegranate powders were added at the final levels of 5 and 10%. All diets were made into -pellets. The pellets were freely consumed (ad libitum) through oral (without gavage) and were given weekly, for two weeks (14 days). Food intake was measured by subtracting the amount of food that was given with the amount of food that was left. The result was divided by 7 days to obtain food intake per day. Food intake was then multiplied with dry matter (DM) content to obtain DM intake. Flavonoid intake was calculated by multiplying DM intake with flavonoid content of each treatment diet.
As a response to oxidative damage, antioxidants are produced. Antioxidants are molecules that slow or 7 prevent the oxidation of other chemicals. Antioxidants can be derived from the body or from outside the body. Antioxidants from outside the body are natural food ingredients from fruits. One of the antioxidant containing fruits is pomegranate (Punica granatum L.). Pomegranate contains high concentration of antioxidants (11.33 mmol/100 g). The main natural antioxidants in 8 pomegranate are polyphenols; and one of the polyphenols is the flavonoid.
Rat is one of the animals, which are widely used as laboratory animals due to their similar anatomy to mammals, and some other advantages such as easy handling, their short life cycle, and they are readily available. Moreover, rats resemble humans in most conditions, and their reproduction also resemble those 9 of large mammals.
Currently, there is no study that has determined the effect pomegranate powder consumption against cigarette smoke induced oxidative stress. Therefore, the objective of this study was to evaluate the possible effects of pomegranate in reducing the blood MDA content in cigarette smoke exposed rats (Rattus norvegicus).
Cigarette exposure
Rats were exposed to cigarette smoke 3 times per day (in the morning, at noon and in the evening) using 1 cigarette per rat. The cigarette used was a commercial filter cigarette. A burning cigarette was place in a glass
36 Tjakradidjaja and Tjakradidjaja
Med J Indones
cup and was put into each of the plastic cage. The top of each of plastic cage was then fully covered with a paper cartoon to expose the rats with cigarette smoke. This treatment was applied until the cigarette was burned, and the paper cartoon was then replaced. Blood sampling
Blood sampling was taken at day-0, -8, and -15 by cutting the tip of the tail (+0.5 cm from the tail tip); the tail was then massaged from its base up to the tip of the tail to collect the blood (2 ml). Blood was collected using a vaccutainer and stored in an ice box to be brought to the laboratory for MDA measurement.
Beta-N contents when pomegranate powder was added at 10%. The control diet already contained flavonoids. With the addition of pomegranate powder, the flavonoid content was increased nearly one-fold in R1, and the increase was doubled in R2.
Table 1. The content of nutrients in the diet
Nutrients Dry matter (DM - %) Ash (%DM) Crude Protein (%DM) Fiber crude (%DM) Fat crude (%DM) Beta N (%DM) Energy (kcal/gram) Flavonoids (%/100g) Pomegranate powder 81.50 5.06 4.86 16.82 1.31 71.95 3855 4.22 R0 89.35 8.66 18.18 10.44 3.67 48.40 3.88 0.253 Diet R1 91.50* 8.81* 17.4* 11.47* 4.14* 56.67* 4.04* 0.351* R2 91.46* 8.28* 18.47* 15.22* 4.20* 45.29* 4.07* 0.566*
Malondialdehyde measurement
Measurement of MDA level was done according to the 10 method of soewoto et al, in brief: the blood sample was added to 0.50 mL of 10% cold TCA solution, which was then centrifuged for 15 minutes. The supernatant formed was added to 0.75 mL of 0.67% TCA solution, and the mixture was then placed into a boiling-water containing water bath for 10 minutes. After it was cold, it was read using a spectrophotometer at a wavelength of 532 nm to determine the MDA concentration. The MDA concentration was obtained by dividing the absorption -1 -1 10 with (=153.000 M cm ).
R0= control diet, R1= 95%R0+5% pomegranate powder, R2= 90%R0+10% pome-granate powder, *= ANOVA test result: P < 0.01 compared to R0
Data analysis The data obtained were noted and tabulated to be entered and processed using Microsoft Excel 2007 software. All results were expressed as meanstandard deviation. Statistical test to compare the three groups was done using two ways repeated ANOVAs test on normal data. Differences were considered significant if P< 0.05. RESULTS All the rats were in healthy conditions throughout the study. The diet was controlled every day and added when necessary. Cages were cleaned once a week and the replacement of husk as bedding was also carried out at the same time. Every time after cigarette smoke exposure the rats looked weak.
The composition of nutrients in the diet is presented in Table 1. Addition of pomegranate powder into the diet changed the composition. Generally, the amount of almost all nutrients was increased; except for crude protein, it decreased on the addition of pomegranate powder at 5%, and a similar result was found in ash and
11
Food intake in all three groups can be seen in Table 2. There was no significant difference in food intake between the three groups (P = 0.65). Flavonoid intakes are presented in Figure 1. In R0 group, flavonoid intake was lower than in that of R1 (P= 0.000) and R2 group (P= 0.000). In R1 group, flavonoid intake was lower than in the R2 group (P = 0.000). The addition of pomegranate powder in the diet will increase the content of flavonoids. The higher the addition of pomegranate extract powder, the higher the flavonoid content will be.
Tabel 2. Average of food intake in each group (g/head/day)
Groups R0 R1 R2 First week2 10.40 (0.97) 10.45 (0.52) 10.30 (0.48)
2
Second week2 10.50 (0.53) 11.27 (1.62) 10.70 (0.48)

3
P-value3
0.65
R0= control diet, R1= 95%R0+5% pomegranate powder, R2= 90%R0+10% pome-granate powder, = Mean (standard deviation), = ANOVA test result
(mg)
Figure 1. Average flavonoid intake in the first and second week (mg).
intake Flavonoid
40 Sjarif et al.
Med J Indones
Anthropometric profiles of children with congenital heart disease

Damayanti R. Sjarif, Shirley L. Anggriawan, Sukman T. Putra, Mulyadi M. Djer,
12 13
Division of Pediatric Nutrition and Metabolic Disease, Department of Child Health, University of Indonesia, Jakarta, Indonesia Division of Pediatric Cardiology, Department of Child Health, University of Indonesia, Jakarta, Indonesia
Abstrak
Latar belakang: Kekurangan gizi merupakan penyebab umum morbiditas pada anak dengan penyakit jantung bawaan (PJB). Data dari negara berkembang memperlihatkan prevalensi malnutrisi penderita dengan PJB sebelum dioperasi mencapai 45%. Penelitian ini bertujuan untuk mengetahui profil anhropometrik dan prevalensi kekurangan gizi pada anak dengan PJB dengan melakukan pengukuran anthropometrik. Metode: Penelitian ini merupakan penelitian dengan rancang bangun cross sectional pada anak berusia 0-2 tahun dengan PJB di RSCM. Pengukuran antropometri (berat badan, panjang badan, lingkar kepala) dilakukan pada seluruh pasien. Kekurangan gizi, failure to thrive/FTT, perawakan pendek, mikrosefali dinilai dengan menggunakan rekomendasi WHO tahun 2006, berupa perhitungan z-skor BB/PB, BB/U di 2 titik, PB/U dan LK/U < -2 SD. Hasil: Total subyek dalam penelitian ini berjumlah 95 orang, 73 orang dengan asianotik dan 22 orang dengan PJB sianotik. Prevalensi kekurangan gizi sebesar 51,1% dengan 22,3% diantaranya adalah gizi buruk. FTT terdapat pada 64,9%, perawakan pendek pada 49,5% dan mikrosefali pada 37% pasien. FTT ditemukan lebih banyak pada pasien dengan lesi asianotik (72,2%) dibandingkan dengan lesi sianotik (42,9). Pada lesi asianotik, berat badan lebih dipengaruhi daripada panjang badan (72,2% dengan 49,3%). Pasien dengan lesi sianotik, berat dan panjang badan akan dipengaruhi secara seimbang (42,9% dengan 54.5%). Konsultasi diet diberikan kepada pasien dengan kekurangan gizi. Terapi obat-obatan, intervensi transkateter atau bedah diindikasikan pada pasien tertentu.
Kesimpulan: Prevalensi FTT lebih tinggi dibandingkan dengan kekurangan gizi pada anak dengan kelainan jantung kongenital. FTT ditemukan lebih banyak pada pasien dengan lesi asianotik. Pada lesi asianotik, berat badan lebih dipengaruhi daripada panjang badan. Pada lesi asianotik, berat badan lebih dipengaruhi daripada panjang badan.
(Med J Indones 2011; 20:40-5)
Abstract
Background: Undernutrition is a common cause of morbidity in children with CHD. Previous data from developing country showed prevalence of preoperative undernutrition in children with CHD was up to 45%. The aim of this study are to determine the anthropometric profiles and prevalence of undernutrition in children with CHD by using the anthropometric measurement.
Methods: A cross-sectional study was carried out in children aged 0-2 years old with CHD in Cipto Mangunkusumo hospital. All patients underwent an anthropometric evaluation (weight, length and head circumference) at presentation. Undernutrition, failure to thrive /FTT, short stature and microcephaly were determined according to WHO, weight-forlength, weight-for-age at 2 points, length-for-age, head circumference-for-age z-score < -2SD accordingly.
Results: We had total of 95 patients, 73 patients with acyanotic and 22 patients with cyanotic lesions. Prevalence of undernutrition in CHD was 51.1%, with 22.3% severe undernutrition. FTT was found in 64.9%, short stature in 49.5% and microcephaly in 37% patients. FTT was found higher in acyanotic (72.2%) compared to cyanotic lesions (42.9%). In acyanotic, weight was affected more than length (72.2% vs 49.3%). In cyanotic, weight and length affected equally (42.9% vs 54.5%). Diet counseling were done in patients with undernutrition. Medicines, transcatheter or surgery intervention were indicated in selected patients.
Conclusions: Prevalence of FTT was higher than undernutrition in children with CHD. FTT was found higher in acyanotic lesions. In acyanotic, weight was affected more than length. In cyanotic, weight and length affected equally.
(Med J Indones 2011; 20:40-5) Key words: congenital heart disease, failure to thrive, short stature, undernutrition
Undernutrition is one of the malnutrition problem in Indonesia. Data from National Socioeconomic Survey (Survei Social Ekonomi Nasional/SUSENAS) 2007 showed the prevalence of children under 5 years who had underweight is 18.4%. Indonesias MDG (Millenium Developmental Goal) in 2015 is to reduce the prevalence of severe underweight to 3.3% and 1 moderate underweight to 18%.
Correspondence email to: flowersla1979@yahoo.com
Undernutrition is a common cause of morbidity in children with congenital heart disease (CHD). Undernutrition can be caused by inadequate nutritional intake or absorption, excessive energy expenditure, frequent respiratory infections, limitation of growth potential and genetic syndromes. Previous data from developing country showed prevalence of pre operative 2,3 undernutrition in children with CHD was up to 45%.
Anthropometric profiles of children with congenital heart disease 41
At birth, the weight and length of children with CHD are typically normal or close to normal and APGAR 4 scores are generally high.
Cyanotic patients are affected in growth, depending on the severity of tissue hypoxemia and on the degree of physiological adaptation. Weight and height are affected equally in cyanotic patients. Acyanotic lesions, especially in combination with septal defect, left to right shunt, will affect weight more than height. Acyanotic lesions were related to acute malnutrition, whereas 4,5 cyanotic lesions were related to chronic malnutrition.
Table 1. Age and anthropometric measurement (birth weight, length, and weight) in children with CHD
Variable Age (month) Birth weight (gram) Birth length (cm) Weight (gram) Minimum-maximum 0.49 24 1300 4000 30 54 2415 13740 Median 7,1 3100 49 5750
Table 2. Anthropometric measurement (length, head circumference, weight/length, weight/age, length/age, HC/ age z-score) in children with CHD
Variable Length (cm) Head circumference/HC (cm) weight/length z-score weight/age z-score length/age z-score HC/age z-score Mean + Standar Deviation (SD) 64.93 + 8.92 41.16 3.94 -1.93 + 1.57 - 2.69 1.51 -2.09 + 1.47 -1.67 + 1.52
The aims of this study are to determine the anthropometric profiles and prevalence of undernutrition in children with CHD by using the anthropometric measurement. Those measurements are useful in early detection of CHD and assessing the prognosis of the basic defects and their complications. METHODS
A cross-sectional study was carried out in children aged 0-2 years old with CHD who had consultation in our outpatient clinic, cardiology division, department of child health in Cipto Mangunkusumo Hospital, Jakarta. This study was conducted from February to August 2009. Children should meet the inclusion criteria for age, no definitive or palliative treatment were given and filled up the informed consent. Consent was obtained in accordance with the Ethical Committee Cipto Mangunkusumo Hospital-University of Indonesia.
HC= head circumference; SD= standard deviation
Table 3. Prevalence of undernutrition, failure to thrive, short stature and microcephaly in children with CHD
Variable weight/length z-score weight/age z-score length/age z-score HC/age z-score < - 2 SD (%, 95%CI) 51.1% (40.4%-61.7%) 64.9% (54.7%-75.1%) 49.5% (38.9%-60.1%) 37% (26.5%-47.4%) < - 3 SD (%,95% CI) 22.3% (13.4%-31.3%) 46.8% (36.2%-57.4%) 30.5% (20.7%-40.3%) 21,7% (12.8%-30.7%)
HC= head circumference; SD= standard deviation; CI= confidence interval
All patients underwent an anthropometric evaluation (weight, length and head circumference/HC) at presentation. Echocardiography was done on the same day to determine the type of CHD. Anthropometric data were analyzed using WHO anthro 2006 (software for assessing growth and development of the worlds children). Undernutrition, failure to thrive, short stature and microcephaly were determined according to weight-for-length, weightfor-age at 2 points, length-for-age and head 6 circumference-for-age z-score < -2SD accordingly. RESULTS
We had total of 95 patients, consisted of 52 (54.7%) male and 43 (45.3%) female with age of gestation ranged from 31 to 40 weeks. Their ages ranged from 0.49 to 24 months old with 12.8% of them had low birth weight.
Acyanotic heart disease was present in 73 (76.8%) of all patients whereas cyanotic heart disease affected 22 (23.2%). The most common diagnoses were ventricular septal defect/ VSD (23.2%), patent ductus arteriosus/PDA (13.7%), tetralogy of fallot/ TOF (12.6%), atrial septal defect/ASD (7.4%) and valvular pulmonary stenosis (6.3%). Two or more CHD were found in 27.8% patients. Study done in our institution (1983-1992) showed the same results, with 76.7% acyanotic and 23.3% cyanotic CHD.
7
Birth weight/age z-score < -2SD was 12.8% (95% CI 5.5%-20%), < -3SD 9.6% (95% CI 3.1%-16.1%), mean -0.76 1.31. Weight/age z-score < -2SD was 64.9% (95% CI 54.7%-75.1%), < -3SD was 46.8% (95% CI 36.2%-57.4%), and mean -2.69 1.51. Birth length/age z-score <-2SD was 14.9% (95% CI 6.1%-23.6%), <-3 SD 5.4% (95% CI 0-11.2%), mean -0.76 1.38. Length/age age z-score < -2SD was 49.5% (95% CI 38.9%-60.1%), <-3SD was 30.5% (95% CI 20.7%-40.3%) and mean -2.09 1.47.
42 Sjarif et al.
Med J Indones
WHO standards CHD ( N = 95 )
WHO standards CHD( N = 95 )
Figure 1. Birth weight/age z-score
Figure 2. weight/age z-score children with CHD
WHO standards CHD ( N = 73)
Figure 3. Birth length/age z-score
Figure 4. Length/age z-score children with CHD
Figure 5. Weight/length z-score children with CHD
Weight/length z-score <-2SD was 51.1% (95% CI 40.4%-61.7%), < -3SD was 22.3% (95% CI 13.4%31.3%) and mean -1.93 1.57.
In acyanotic, weight/length z-score < -2SD was 54.2% (95% CI 42%-66.4%), <-3SD was 22.2% (95% CI 11.9%-32.5%), mean -1.99 1.47. In cyanotic, weight/ length z-score < -2SD was 40.9% (95% CI 18.1%-
63.7%), <-3SD was 22.7% (95% CI 2.9%-42.5%) and mean -1.74 1.88.
In acyanotic, weight/age z-score < -2SD was 72.2% (95% CI 61.2-83.3%), <-3SD was 50% (95% CI 37.8%-62.2%), mean -2.76 1.46. In cyanotic, weigth/age z-score <-2SD was 42.9% (95% CI 19.3-66.4%), <-3SD was 33.3% (95% CI 10.8%-55.9%) with mean -2.38 1.47.
46 Kusumadewi et al.
Med J Indones
Dietary iron intake, serum ferritin and haemoglobin levels, and cognitive development scores of infants aged 68 months
Dian Kusumadewi, Saptawati Bardosono, Rini Sekartini
14 15
Nutrition Department, Faculty of Medicine, University of Indonesia, Jakarta, Indonesia Child Health Department, Faculty of Medicine, University of Indonesia, Jakarta, Indonesia
Abstrak
Latar belakang: Defisiensi besi selama masa kanak-kanak dapat menimbulkan pengaruh buruk pada fungsi kognitif dan perkembangan psikomotor. Penelitian ini bertujuan mengetahui kadar feritin serum dan hemoglobin dan hubungannya dengan skor perkembangan kognisi pada usia 6-8 bulan. Metode: Rancangan penelitian potong lintang digunakan pada 76 bayi yang diperoleh dari beberapa Posyandu terpilih di kelurahan Kampung Melayu, kecamatan Jatinegara, Jakarta yang memenuhi kriteria penelitian. Data yang dikumpulkan meliputi usia, berat, panjang, lingkar kepala, asupan zat iron, feritin serum, haemoglobin dan skor perkembangan kognitif dengan menggunakan Capute Scales method (Cognitive Adaptive Test/ Clinical Linguistic Auditory Milestone Scales/ CAT-CLAMS). Hasil: Dari 74 bayi usia 6-8 bulan yang menjadi subyek penelitian ini, 73% mempunyai asupan zat besi kurang dari AKG (7 mg/hari), 18,9% mempunyai kadar feritin serum kurang dari normal (20 g/L), dan 56,7% mempunyai kadar hemoglobin kurang dari normal (11 mg/dL). Terkait dengan skor perkembangan kognitif, ditemukan skor CAT yang lebih rendah secara bermakna pada subyek dengan kadar hemoglobin <11 mg/dL (p = 0,026). Kesimpulan: Sebagai upaya pencegahan dini terhadap gangguan perkembangan kognitif, disarankan agar sejak usia 6 bulan mulai memperhatikan asupan zat besi dari makanan pendamping ASI agar tidak terjadi penurunan kadar hemoglobin. (Med J Indones 2011; 20:46-9)
Abstract
Background: Iron deficiency during infancy may lead to negative effect on cognitive function and psychomotor development. This study aimed to investigate serum ferritin, haemoglobin level and its relation to cognitive development score in infants aged 68 months. Methods: This cross-sectional study was done on 76 infants recruited from several selected community health center in Kampung Melayu Village, Jatinegara Jakarta who had fulfilled the study criteria. Data collected consist of age, weight, height, head circumference, energy, protein and iron intake, serum feritin levels, haemoglobin levels and cognitive development score using Capute Scales method (Cognitive Adaptive Test/ Clinical Linguistic Auditory Milestone Scales/ CAT-CLAMS). Results: Among 74 infants aged 6-8 months, 73% had less dietary iron intake as compared to its RDA (7 mg/d), 18.9% were with serum ferritin less than normal value (20 g/L), and 56.7% with haemoglobin levels less than normal value (11 mg/dL). In relation to cognitive development score, this study revealed that the CAT score was significantly lower among subjects with hemoglobin value less than 11 mg/dL (p = 0.026).
Conclusion: Early prevention of impaired cognitive development is urgently needed by providing iron-rich complementary foods to infants since 6 months (mo) old to maintain the normal level of hemoglobin. (Med J Indones 2011; 20:46-9)
Key words: cognitive score, ferritin, hemoglobin, infants
Iron deficiency anemia (IDA) is still remaining a global 1 nutritional problem all over the world especially in developing countries, including Indonesia. The Survei Kesehatan Rumah Tangga (SKRT) (Household health survey) 2001 stated that IDA in Indonesia is as high as 61.3% among less than 6-mo old infants and 64.8% in 6 11 mo infants. Survey done by Indonesian pediatricion association 2004 found that among 412-mo infants in Matraman district-Jakarta, 38% had anemia and 73% 2 had iron deficiency.
Correspondence email to: tati_bardo@yahoo.com
Infants iron status is affected by many factors including food intake, physiology (low birth weight), and environment factors (socio-demographic background). Depletion of iron storage can be identified using specific indicators, such as serum ferritin level. However, hemoglobin level is a parameter commonly measured to detect anemia, although it can not specifically find out 3 the cause of the anemia.
During infancy, IDA if not being treated properly will result in negative effects on cognitive function and
Dietary iron, serum ferritin and cognitive development score 47
in psychomotor development interference. Infants with IDA have impaired psychomotor development and would have even low psychomotor and mental development compared to infants with iron deficiency 4 but not (yet) being anemic. Black et al. also stated that micronutrient supplementation consisting of iron and zinc each 20 mg every week for six months had 5 6 an advantage in motoric development. Faber et al. found that infants at the age of 612 mo, who consumed 40 g porridge fortified with 11 mg of iron every day for six months would have an increase in their iron status and developmental scores. This study aims to investigate dietary iron intake, serum ferritin and hemoglobin levels and their relation to cognitive development score among infants aged 6 8 mo in Kampung Melayu Village, Jatinegara district Jakarta Timur. METHODS Subjects
The subjects were infants aged 68 months recruited from several selected community health center in Kampung Melayu during November 2009 to February 2010 who met the study criteria: 1) male and female infants aged 6-8 months, 2) having normal gestational age and birth weight, 3) apparently healthy, and permitted by the mothers as the respondents to participate in this study.
Subjects weight and height were measured twice to obtain the average measure. Nutritional status indicator was analyzed using WHO anthro 2005 program.
9
The laboratory examinations performed include the assessment of hemoglobin and serum ferritin levels. The sample of blood was drawn from the cubiti region which was disinfected using alcohol 70% before the 1.5 ml of venous blood was drawn. The hemoglobin level was assessed using HemoCue method by placing two drops of blood in the microcuvette. After the microcuvette was completely filled, it was placed to the HemoCue photometer. After several seconds, numbers indicating hemoglobin levels would appear to be recorded. The remaining venous blood was then placed to a vacutainer and sent to Prodia laboratory to assess the serum ferritin 10,11 level using a method of Elisa.
Statistical analysis All statistical analyses were performed using SPSS for windows version 11.5. Data were expressed as mean SD for normally distributed data and median (minimum-maximum) for the non-normally distributed data. Normality of the data distribution was checked using Kolmogorov-Smirnov test before further analysis. Based on the results of normality tests, relationships between dietary iron, serum ferritin and hemoglobin levels to cognitive development score were performed using independent-t test or MannWhitney U. Power of the study was 0.90 based on assumption to be able to have mean difference of 10% 12 and probability for type I error =0.05.
Study design The study used a cross-sectional design to determine the correlation between cognitive development score and dietary iron intake, serum ferritin and hemoglobin levels. Data collection Interview with the respondents was conducted to obtain data concerning the characteristics of subjects and respondents, to find out the infants intake from breast feeding and complementary feeding using the 24-hour food recall and a one month semiquantitative FFQ to assess the adequacy of iron intake among the 7 research subjects. In addition to interview, the respondents were also asked to fill out a questionnaire on cognitive development scores with Capute Scales methode (Cognitive Adaptive Test/ Clinical Linguistic 8 Auditory Milestone Scales/ CAT-CLAMS).
RESULTS Subjects of the study There were 74 subjects participating in this study. Data on the characteristics of the subjects include sex and age and were furthermore collected from anthropometric measurements and blood assessment. Cognitive deve-lopment score was determined as the outcome of the study. Subjects consisted of 46 (66.2%) boys and 28 (33.8%) girls with median age of 6.79 mo. The median weight was 7.4 kg, the average of length was 67.70 3.13 cm, and head circumference 43.21 1.56 cm, as shown in Table 1.
48 Kusumadewi et al.
Med J Indones
Tabel 1. Characteristics of infants under the study (n = 74)

Variables Sex, n (%): Male Female Age in months, median (min-max) Weight in kg, median (min max) Length in cm, mean SD Head circumference in cm, mean SD 49 (66.2) 25 (33.8) 6.79 (6.02 8.81) 7.4 (5.35 14.50) 67.70 3.13 43.21 1.56 value
values ranged from 85.7 to 185.7. To be able to see factors related to the cognitive development scores, this study analyzed whether the CAT-CLAMS scores differed in relation to the iron status of each subject, i.e. dietary iron, serum ferritin and hemoglobin status.
Table 3 shows that the CAT score did not significantly different in relation to the dietary iron and serum ferritin status, however, the score was significantly higher (p =0.026) among subjects having hemoglobin value >11 mg/dL. This study did not show any significant difference in the relation between CLAMS score and dietary iron, serum ferrtin and haemoglobin status.
Table 3. Relationships between cognitive development score (CAT) and dietary iron intake, serum ferritin and haemoglobin levels
Iron status
Table 2 shows that the median of dietary iron was 3.82 mg /d ranging from 0.42 mg/d to 14.4 mg/d. This study revealed that 54 of the subjects (73%) had dietary iron intake less than its RDA for Indonesian infants aged 7-12 mo (7 mg/d). The median serum ferritin level of the subjects was 42.3 mg/L ranging from 2.37 mg/L to 333 mg/L. Fourteen subjects (18.9%) had serum ferritin level less than 20 mg/L as the cut-off of its normal value. The median of hemoglobin values found in this study was 10.80 mg/dL ranging from 7.60 mg/ dL to 13.80 mg/dL. This study revealed that 42 subjects (56.8%) had hemoglobin value less than 11 mg/dL, the cut-off for anemic status for infants.
Table 2. Cognitive score, iron intake, serum ferritin and hemoglobin level of the subjects (n = 74)
Variables Cognitive score, median (min max) CAT score, median (min max) CLAMS score, median (min max) Dietary iron in mg, median (min max) % of iron requirement, median (min max) <RDA (7 mg/day), n (%) RDA, n (%) Serum ferritin in mg/L, median (min max) Iron deficiency Iron depletion Normal Hemoglobin concentration, median (min max) Moderate anemia Mild anemia Normal Value
Variables Dietary iron <7 mg/day >7 mg/day Serum ferritin levels <20 mg/dL >20 mg/dL Haemoglobin levels <11 mg/dL >11 mg/dL
Cognitive development score (CAT) (mean SD) 109.11 13.36 106.04 117.01 (median, min-max) 103.95 (86 131.4) 107.75 (75.7 - 148) (median, min-max) 101.85 (76.6 138) 113.15 (75.7 148)
p-value 0.419 (independent-t test) 0.590 (Mann-Whitney U) 0.026 (Mann-Whitney U)
DISCUSSION This study found that in general, iron status in terms of dietary iron intake, serum ferritin and haemoglobin levels were less than normal. This cross-sectional study also shows a significant dependence of cognitive development CAT-score on hemoglobin status.
This study shows that the average of dietary iron intake of the subjects from breastmilk and complementary foods was lower than its RDA (7 mg/d) and 73% of the subjects had low dietary iron intake. Theoretically, dietary iron intake is related to iron content in breastmilk and complementary foods, increased requirement in relation to the rapid growth during infancy, iron malabsorption, and other pathological 1 conditions. The low dietary iron intake found in this study was in accordance with the fact that breastmilk for the age of 6-8 months infants will only provide approximately 0.03 mg/dL or 4.32 mg/d if receiving 6 times 240 mL breastmilk/d. Thus, among infants aged 6 mo and over, there is a need to have supplemented dietary iron from ironrich
107.5 (75.7 148.0) 114.25 (85.7 185.7) 3.82 (0.42 14.4) 62 (4.2 193.33) 54 (73) 20 (27) 42.3 (2.37 333.0) 8 (10.8) 6 (8.1) 60 (81.1) 10.80 (7.60 13.80) 8 (10.8) 34 (45.9)
32 (43.2)
Cognitive development status

Cognitive development status was determined using CAT and CLAMS scores. Table 2 shows that the median of CAT-score was 107.5 with values ranging from 75.7 to 148.0. The median of CLAMS-score was 114.25 and
50 Widjaja et al.
Med J Indones
Highly active antiretroviral therapy adherence and its determinants in selected regions in Indonesia
Felix F. Widjaja, Caroline G. Puspita, Ferdi Daud, Ienag Yudhistrie, Marita R. Tiara, Christopher S. 1 4 5 6 Suwita, Ekachaeryanti Zain, Lailatul Husna, Samsuridjal Djauzi
16 17
Faculty of Medicine Universitas Indonesia/RSUPN Cipto Mangunkusumo, Jakarta, Indonesia Faculty of Medicine Universitas Brawijaya/RSU Saiful Anwar, Malang, Indonesia 18 Faculty of Medicine Universitas Padjajaran/RSU Hasan Sadikin, Bandung, Indonesia 19 Faculty of Medicine Universitas Hasanuddin/RSU Wahidin Sudirohusodo, Makassar, Indonesia 20 Faculty of Medicine Universitas Syiah Kuala/RSU Zainoel Abidin, Aceh, Indonesia 21 Department of Internal Medicine, Faculty of Medicine Universitas Indonesia/RSUPN Cipto Mangunkusumo, Jakarta, Indonesia
Abstrak
Latar belakang: Mengkonsumsi obat antiretrovirus dapat mengurangi morbiditas dan mortalitas orang dengan HIV/ AIDS (ODHA). Tetapi, hal tersebut bergantung pada adherens terhadap pengobatan. Penelitian ini bertujuan untuk menilai adherens obat antiretrovirus dan mengevaluasi karakteristik individu pasien (self-efficacy, tingkat depresi dan dukungan sosial) yang menentukan adherens terhadap obat antiretrovirus di beberapa daerah di Indonesia. Metode: Studi potong lintang ini dilakukan di Jakarta, Malang, Bandung, Makasar, dan Banda Aceh. Subjek penelitian kami adalah ODHA yang berumur lebih dari 13 tahun dan telah mengkonsumsi obat antiretroviral setidaknya satu bulan. Subjek diambil secara konsekutif kemudian ditanyakan jumlah pil yang mereka tidak minum sejak satu bulan yang lalu. Adherens dikatakan rendah apabila persentase rata-rata adherens di bawah 95%. Kami mengadaptasi HIV treatment adherence self-efficacy scale (HIV-ASES), Beck Depression Inventory (BDI-II) dan Interpersonal Support Evaluation List (ISEL) untuk menilai self-efficacy, tingkat depresi, dan dukungan sosial, secara berurutan. Hasil: Pada penelitian ini didapatkan 96% subjek penelitian (n=53) memiliki adherens yang baik terhadap pengobatan antiretrovirus. Selain itu, tidak ditemukan adanya hubungan antara adherens dengan self-efficacy, tingkat depresi dan dukungan sosial. Penyebab utama rendahnya adherens pada penelitian ini karena faktor lupa tanpa adanya alasan yang spesifik. Kesimpulan: ODHA di beberapa daerah di Indonesia memiliki adherens yang baik terhadap pengobatan antiretrovirus dan adherens tersebut tidak berhubungan dengan self-efficacy, tingkat depresi dan dukungan sosial. (Med J Indones
2011; 20:50-5)
Abstract
Background: Highly active antiretroviral therapy (HAART) can reduce morbidity and mortality of HIV-infected patients. However, it depends upon adherence to medication. The objective of this study was to examine the adherence to HAART and to evaluate individual patient characteristics i.e. self-efficacy, depression level, and social support and to finally determine HAART adherence in selected regions in Indonesia. Methods: This cross-sectional study was conducted in Jakarta, Malang, Bandung, Makasar and Banda Aceh. The subject of the study was HIV-infected patients who were older than 13 years old and had taken HAART for at least a month. They were recruited consecutively then asked how many pills they had missed during the previous month. Poor adherence can be stated if the percentage of adherence rate is below 95%. HIV treatment adherence selfefficacy scale (HIV-ASES), Beck Depression Inventory (BDI-II) and Interpersonal Support Evaluation List (ISEL) was adapted to assess self-efficacy, depression level and social support, respectively.
Results: We found that 96 % (n=53) of the subjects adhered to HAART. There were no associations between adherence with self-efficacy, depression level, and social support. The main cause of non-adherence in this study was simply forget.
Conclusion: Adherence to HAART was found to be high and not associated with self-efficacy, depression level and social support in some central regions in Indonesia. (Med J Indones 2011; 20:50-5) Key words: adherence, depression, HAART, HIV, self-efficacy, social support
Acquired immunodeficiency syndrome (AIDS) is caused by human immunodeficiency virus (HIV). The virus attacks human immunity response, hence HIVinfected patients would be easily infected by other pathogens. Since the discovery of HIV in 1983, it has become pandemic and a major cause of deaths by 1 opportunistic infections.
Correspondence email to: felixfw@gmail.com
According to Joined United Nations Programme for HIV/AIDS (UNSAID) data in 2007, there were 33.2 million HIV-infected patients in the world, 2.1 million of whom had died. The number of HIV-infected patients is increasing annually although less newly HIV-infected 2 patients are recorded. The HIV epidemic in Indonesia is among the fastest rising numbers in Asia.
Adherence to HAART and its determinants 51
This is considered to result from the development of intravenous drug users (IVDUs) since 1999.
2,3
infected patients who were treated in the hospital and those who refused to participate in this study were excluded.
Although a cure for HIV infection is yet to be found, the infection can be controlled. By taking highly active antiretroviral therapy (HAART) regularly, viral replication in HIV-infected patients can be suppressed. In addition, drug resistance can be prevented in order to avoid morbidity 4 and mortality of HIV-infected patients. However, these benefits depend upon adherence to medication due to the complexity of antiretroviral therapy by using triple regimens and due to the fact that this medication must be taken life-long. Some studies showed reduction of viral load and avoidance of chronic (opportunistic) diseases provided 4,5 the adherence rate was above 95%.
This study was approved by the Committee of Medical Research Ethics of the Faculty of Medicine Universitas Indonesia. Participants were given verbal and written information about the study. Written informed consent was obtained from all participants prior to inclusion into the study. No financial incentives were provided and all data were kept confidential. In order to validate our questionnaires and to measure minimum sample size a preliminary study was conducted with fifteen subjects at ambulatory care of Dharmais and Cipto Mangunkusumo Hospitals, Jakarta. From this study, we obtained that 93% of the subjects (n=15) adhered to HAART therapy the subsequent calculation of the minimum number for this study was 25 subjects.
There are many factors that may contribute to therapy adherence including self-efficacy, social support and 6 depression level. Involvement of self-efficacy can be seen by their persistence i.e. high motivation, thoughts, cognition and affection to take the regimens 7 to improve the quality of life of the recent condition. Depression level and social support affect adherence in psychological setting. Social stigma compels HIVinfected patients fall into depression. However, adequate social support may help them to overcome these psychological symptoms and to gain 6 subsequently optimal medication adherence rate. The purpose of this study is to examine the proportion of adherence to HAART and to evaluate factors (selfefficacy, depression level, and social support) related to adherence in selected regions in Indonesia. We hypothesized that self-efficacy, depression level, and social support influence the adherence of taking medication in selected regions in Indonesia.
Assessment Procedures The data was collected by asking the participants to fill the questionnaires, which was accompanied by surveyors to avoid misunderstandings and unnecessary mistakes. Every participant took about 15 minutes to answer all the questions. Measures
Demographics. Demographic data included participants
age, gender, marital status, education and employment.
METHODS Study Participants

This cross-sectional study was conducted in five regions by the Medical Faculties of five universities: Jakarta (Universitas Indonesia), Malang (Universitas Brawijaya), Bandung (Universitas Padjajaran), Makassar (Universitas Hasanuddin) and Banda Aceh (Universitas Syiah Kuala). Between April 2009 and October 2009, in the five cities, participants were recruited consecutively from ambulatory care of each hospital or non-governmental organizations. The participants were older than 13 years and had been in treatment of HAART at least a month. HIV-
Medication. We asked whether the participants had ever missed taking their antiretroviral medications. If they answered yes, there were 12 questions about the reasons with choices of very rare, rare, often or very often. The frequency range described was scored from 0-3, respectively. Medication adherence was assessed with indirect methods by self-reporting, asking the participants how many pills they had missed to take during the previous month. Patients were classified as adherent when not more than three doses were missed and non-adherent if the patients admitted having missed at least four doses during the last month. We used one month recall period since we assessed self-efficacy, depression level and social support represented for the condition at that month.
Self-efficacy. HIV treatment adherence self-efficacy scale 8 (HIV-ASES) developed by Johnson et al. was assessed with a 12-item scale of patient confidence to carry out important treatment-related behaviour plans for nutrition, exercise, etc. in front of barriers. Responses
52 Widjaja et al.
Med J Indones
range from 1 (cannot do it at all) to 10 (certainly can do 8 it). Questions were translated to Indonesian language and a preliminary study was conducted to assess the validity and reliability of the questionnaire. Eight questions were valid with excellent internal consistency (Cronbachs = 0.858). In its adapted form, the scale consists of eight items with a score range of 0-80 with higher scores indicating higher confidence in ability to carry out treatment-related behaviours.
Depression Level. Beck Depression Inventory (BDI-II) which consists of 21-items self-report instrument was 9 developed by Beck et al. to assess the existence and severity of symptoms of depression as listed in DSM IV. There is a four-point scale for each item ranging from 0 to 3. There are also cut score guidelines which can be 9 adjusted according to the purpose of use. Questionnaires were also translated, then validity and reliability were tested in the same way as in the self-efficacy section. Fourteen items were valid and the questionnaire was shown to have excellent internal consistency (Cronbachs = 0.88). The cut score was also modified according to the number of items. In the total score, 0-8 is considered minimal range, 9-12 is mild, 13-18 moderate, and 19-42 is considered severe.
Social Support. Interpersonal Support Evaluation List (ISEL), which originally consists of 40 questions was 10 developed by Cohen et al. to assess the perceived availability of the four separate functions of social support: appraisal items, tangible items, self-esteem items and belonging items as well as providing an overall functional 10 support measure. In this study, we did not assess each function separately. The translated questionnaire was checked for validity: 12 items were valid and had reliable psychometric properties (Cronbachs = 0.842). Each question was scored ranging from 0 to 3. The modified ISEL consists of 12 items with a score range of 0-36 with higher scores indicating more social support.
value of 0.05 was considered significant. All analyses were performed with SPSS Statistic 17.0. RESULTS Description of the participants Demographic characteristics are shown by adherence status in Table 1. The average age of patients (n=53) was 32 years, 77.4% were male, 83% of our participants had a senior high school degree or more, and approximately half of them were married. There were 6 unemployed participants (11.3%) in this study.
Most patients (n = 28 or 52.8%) had ever missed taking their medications. Among them, 64.29% forgot to take their medication in the night, followed by 28.57% who forgot it in the morning and the rest in the afternoon. The major reasons affecting their adherence were simply forget without any specific reasons (score = 34), followed by busy with other things (score = 25), run out of medications (score = 19) and ashamed if seen by others (score = 18). There were 2 participants (3.8%) who were classified as non-adherent indicating that they missed at least four doses of their antiretroviral medications over the previous month.
The mean of self-efficacy was 70.11 (SD = 13.4) with the highest score of 80. The distribution of these data was not normal (p < 0.001). The depression level was 47.2% scored minimal, 17% mild, 17% moderate, and 18.9% scored severe. The mean of social support score was 25.49 (SD = 5.95) with the highest score of 36. The data distribution was normal (p = 0.200). Bivariate Analysis of associations between selfefficacy, depression level and social support with antiretroviral adherence In this study, we found that adherence was neither associated with self-efficacy (p = 0.962), social support (p = 0.474) nor depression level (p = 0.709). Although we did not hypothesize any relationship between self-efficacy, social support and depression level, we found that they were significantly related to each other. The depression level was not categorized and distribution of the data was not normal (p = 0.007), hence Spearman test was used. The correlation between self-efficacy and depression level was weak (r = -0.304, p = 0.027); as was the correlation between self-efficacy and social support (r = 0.286, p = 0.038); while correlation between depression level and social support was moderate (r = -0.461, p = 0.001).
Participants were informed that their answers in selfefficacy, depression level and social support sections should represent their condition in the past month. Statistical Analysis Bivariate associations of numerical variables (social support score and self-efficacy scale) with medication adherence were analyzed using unpaired t-test or Mann-Whitney test as an alternative. KolmogorovSmirnov test was used to examine normality of data. For analyzing depression level with medication adherence, Mann-Whitney test was used. Probability
56
Endarti et al.
Med J Indones
Access to health information may improve behavior in preventing Avian influenza among women
Ajeng T. Endarti,
1 2
1,2
Shamsul A. Shah
Faculty of Health Sciences, Universitas Pembangunan Nasional Veteran Jakarta Department of Community Health, Faculty of Medicine, Universiti Kebangsaan Malaysia
Abstrak
Latar belakang: Peningkatan perilaku terhadap Flu burung dapat menurunkan risiko infeksi Flu burung. Tujuan penelitian ini ialah untuk mengetahui faktor-faktor dominan yang mempengaruhi perilaku pencegahan penyebaran penyakit Flu burung pada masyarakat. Metode: Desain studi potong lintang dilakukan dalam bulan Juli 2008 untuk mengetahui perilaku yang diukur dengan menghitung skor pengetahuan, sikap dan tindakan. Penelitian ini dilakukan di suatu kecamatan di Depok, Jawa Barat, yang merupakan wilayah berisiko terjadinya penyebaran kasus Flu burung. Dalam menentukan unit sampel, untuk memilih kepala rumah tangga digunakan metode multi stage sampling.
Hasil: Dari 387 responden 29,5% responden berperilaku baik terhadap penyakit Flu burung. Perilaku subjek yang baik dipengaruhi oleh jenis kelamin dan akses terhadap informasi kesehatan. Perempuan dibandingkan lelaki 67% lebih tinggi berperilaku baik terhadap penyakit Flu burung [risiko relatif (RRa) = 1,67; 95% interval kepercayaa (CI) = 0,92-3,04; P = 0,092]. Sedangkan, subjek yang mempunyai dibandingkan yang tidak yang mempunyai akses terhadap informasi kesehatan 3,4 lipat berperilaku baik terhadap penyakit flu burung (RRa = 3,40; 95% CI = 0,84-13,76; P = 0,087).
Kesimpulan: Akses terhadap informasi mengenai flu burung terutama efektif di antara perempuan untuk meningkatkan perilaku penyakit flu burung. (Med J Indones 2011; 20:56-61)
Abstract
Background: Improving human behavior toward Avian influenza may lessen the chance to be infected by Avian influenza. This study aimed to identify several factors influencing behavior in the community. Method: A cross-sectional study was conducted in July 2008. Behavior regarding Avian influenza was measured by scoring the variables of knowledge, attitude, and practice. Subjects were obtained from the sub district of Limo, in Depok, West Java, which was considered a high risk area for Avian influenza. The heads of household as the sample unit were chosen by multi-stage sampling.
Results: Among 387 subjects, 29.5% of them was had good behavior toward Avian influenza. The final model revealed that gender and access to health information were two dominant factors for good behavior in preventing Avian influenza. Compared with men, women had 67% higher risk to have good behavior [adjusted relative risk (RRa) = 1.67; 95% confidence interval (CI) = 0.92-3.04; P = 0.092]. Compared to those with no access to health information, subjects with access to health information had 3.4 fold increase to good behavior (RRa = 3.40; 95% CI = 0.84-13.76; P = 0.087).
Conclusion: Acces to health information concerning Avian influenza was more effective among women in promoting good behavior toward preventing Avian influenza. (Med J Indones 2011; 20:56-61) Key words: avian influenza, behavior, gender, health promotion
WHO have stated the risk of Avian influenza to humans was almost confined to those who had close contact with infected domestic poultry. The first Avian influenza outbreak in Hong Kong in 1997 caused 18 cases with 6 deaths.1 The study revealed that live poultry markets 2 were the primary source of infection. The pandemic then was started in Vietnam in 2003 and spread to other Asian and African countries.1 In Indonesia, the number of confirmed cases of human Avian influenza in 2006
Correspondence email to: ajengtias@gmail.com
was 28 cases with 71.4% deaths, and most of them had high interaction with chicken and ducks. Authorities Network showed a large number of confirmed human cases acquired the infection during the slaughtering and subsequent handling of diseased or dead birds prior to cooking.
4 3
To prevent Avian influenza in high risk population, farms or people with domestic poultry, behavioral changes should be attempted. It can be through public
Behavior in preventing Avian influenza 57
education and reinforced through behavioral counseling. 2 Based on research in Thailand, attitudes, which will 5 influence behavioral changes, such as how to protect oneself from poultry with Avian influenza. The behavior changed significantly after the respondents heard about Avian influenza. These changes in human behavior, included those related to food handling, can reduce the opportunity to be infected by Avian influenza. Therefore behavioral changes can become the most important way 4 to reduce the risk of further human infection.
Vietnam (USAID 2006) and A Guide for Monitoring and Evaluating Avian influenza Programs 15 in Southeast Asia (USAID 2007) questionnaires. To assure the reliability of the questionnaires, we conducted questionnaire tryouts to 20 persons. Behavior was defined as the respondents activities in preventing the spread of Avian influenza. At the end of the study, behavior was categorized into good behavior and poor behavior based on Knowledge, Attitude and Practice (KAP).
Knowledge was the respondents knowledge about Avian influenza (definition, symptoms, route of transmission and preventive activities). Knowledge was categorized into poor and good. If the respondents could answer at least 6 questions correctly (from 10 questions), the respondent knowledge was good (score 1).
14
The importance of identifying preventive behavior in Avian influenza have encouraged researchers to conduct studies of knowledge attitude and practice in Avian influenza on many different subjects. For 1 instance studying behavior among school children, 6 7 poultry workers, health workers, and people living 8,9 in high risk Avian influenza areas.
The mode of transmission of Avian influenza is known and many evidence showed that Avian influenza occurrences in humans were due to unhealthy behavior when in contact with poultry and also by unhygienic 2,10,11 behavior. Besides the behavioral factors, other nonpharmaceutical interventions that can be utilized to prevent Avian influenza were good surveillance and case reporting and increasing rapid viral diagnosis.12
Attitude was response of the respondents about Avian influenza. Attitude was categorized into poor and good. If the respondents could answer at least 7 questions correctly (from 11 questions), the respondent attitude was good (score 2).
Practice was the respondents action in preventing the spread of Avian influenza within their surroundings. Practice was categorized into poor and good. If the respondents could answer at least 9 questions correctly (from 14 questions), the respondent practice was good (score 3).
The aim of this study was to identify several dominant risk factors influencing the behavior of the community in preventing Avian influenza.
METHODS
This cross-sectional study was conducted in a sub district of District Depok, West Java, Indonesia in July 2008 which was considered to be a high risk area for Avian influenza. In this area many homes keep poultry in the backyard, and the 13 poultry were not certified free of Avian influenza virus. In addition, the location of sub district Limo borders with DKI Jakarta Province (the second largest Avian influenza cases 3 in Indonesia) and the rate of migration of people between these areas was high.
This categorization was used to decide whether the respondents behavior was good or poor. From these three variables (Knowledge, Attitudes and Practices) if the sum of those variables were 6 the behavior was good. But if the sum were less than 6 the behavior was poor.
Variable such as access to health care was categorized into good if respondents answered all three questions (regarding accessibility, affordability, and satisfaction to health services). Family/neighbor support was categorized as good if they answered at least 2 out 3 questions. Age was grouped as young (18-29 years), young adults (30-50 years), and old (50 years or older)
Cox Regression was used to analyze data. This study obtained ethical clearance from the ethical committee of the Faculty of Medicine, Universitas Kebangsaan Malaysia.
Multi-stage sampling was used in determining the sample. This method was suitable because there was a hierarchy within study area, such as village and neighborhood, to reach the sample unit (head of household).
The instrument for this study was modified from Avian Flu Baseline Survey Backyard Poultry Farmers of
RESULTS
The study revealed there was about 29.5% out of 387 subjects with good behavior in preventing Avian
58
Endarti et al.
Med J Indones
influenza. Subject with good behavior and poor behavior was similarly distributed by educational level, income, age group, ethnic, access to health care, and family and community support (table 1). In the final model, gender and access to health information were two dominant factors for good behavior in preventing Avian influenza (table 2).
Compared with men, women had 67% higher risk to good behavior [adjusted relative risk (RRa) = 1.67; 95% confidence interval (CI) = 0.92-3.04; P = 0.092]. Compared to those with no access to health information, those with access had 3.4 fold risk to good behavior (RRa = 3.40; 95% CI = 0.84-13.76; P = 0.087).
Table 1. Several characteristics of subjects and the risk of good behavior in preventing Avian influenza
Poor Behavior (n=273) Educational level Poor Average High Income Low Middle High Age Young group Young adult Old Ethnic Sundanese Javanese Betawi Other Access to health care Poor Good Family and community support Poor Good 187 74 12 53 174 46 37 191 44 36 89 132 16 43 230 166 107 Good Behavior (n=114) 71 37 6 15 75 24 24 74 15 16 33 59 6 12 102 68 46 1.00 1.21 1.21 1.00 1.36 1.55 1.00 0.71 0.64 1.00 0.87 1.00 0.65 1.00 1.40 1.00 1.03 Reference 0.814-1.802 0.526-2.787 Reference 0.784-2.377 0.815-2.963 Reference 0.448-1.125 0.339-1.232 Reference 0.48-1.60 0.58-1.74 0.38-2.27 Reference 0.77-2.56 Reference 0.71-1.50 Crude relative risk 95% confidence interval
0.345 0.652
0.271 0.180
0.144 0.185
0.672 0.989 0.801
0.262
0.859
Table 2. The relationship between gender, access to health information and good behavior in preventing Avian influenza Poor Behavior Good Behavior (n=273) Gender Men Women Access to health information No Yes 21 251 2 112 1.00 3.40 Reference 0.84-13.76 0.087 53 220 12 102 1.00 1.67 Reference 0.92-3.04 0.092 (n=114) Adjusted relative risk 95% confident interval P
66 Susanna et al.
Med J Indones
The level of Escherichia coli contamination in foods and drinks sold at canteens campus
Dewi Susanna, Tris Eryando, Yvonne M. Indrawani
1
22
Department of Environmental Health, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia Department of Biostatistics and Health Informatic, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia 23 Department of Nutrition, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia
Abstrak
Latar belakang: Kontaminasi bakterial pada makanan yang disediakan di kantin kampus merupakan hal yang sering terjadi dan dapat mengganggu aktivitas akademik. Penelitian ini bertujuan mengetahui tingkatan kontaminasi Escherichia coli pada makanan dan minuman yang dijajakan di kantin sebuah kampus universitas.
Metode: Sebanyak 49 makanan dan 24 jenis minuman diperiksa dengan menggunakan metode konvensional untuk pengukuran Most Probable Number (MPN), yaitu uji penduga, uji penguat, dan uji pelengkap. Analisis kontaminasi pada makanan dan minuman dilakukan di Laboratorium Kesehatan Lingkungan Fakultas Kesehatan Masyarakat Universitas Indonesia. Analisis data dengan membuat tingkatan kontaminasi berdasarkan kelompok makanan dan minuman serta lokasi kantin.
Hasil: Hampir semua kelompok makanan terkontaminasi. Makanan dengan sambal adalah makanan yang paling berisiko untuk terkontaminasi E. coli (90,15 %), diikuti oleh makanan kering, sedangkan makanan berkuah adalah yang paling kecil risikonya (38,89%). Minuman yang paling tinggi kontaminasinya adalah jus lacy, diikuti oleh jus jambu, lalu jus sirsak dan orange di peringkat ketiga, sementara jus mangga kontaminas nya terendah. Jus melon, cappucino dan coctail tidak menunjukkan adanya kontaminasi. Kesimpulan: Makanan dan minuman yang ditemukan pada tiga lokasi yang menduduki urutan tertinggi disebabkan oleh terkontaminasinya alat makan dan tangan penjamah makanan. (Med J Indones 2011; 20:66-70)
Abstract
Background: Bacterial contamination is a common phenomenon in foods served in campus canteens and my cause physical illness which will affect academic activity. The aim of this study was to rank the level of Escherichia coli contamination in food and drink in campus canteens. Methods: Forty nine (49) foods and 24 types of drink were examined using conventional agar broth method for calculation of most probable number (MPN). The steps of the mothod were presumptive test for coliforms, fecal coliforms and E. coli, confirmes test for coliforms, fecal coli and E. coli and then completed test for E. coli. An analysis for contamination by E. coli in meals, utensils, and on the hands of the server was also undertaken. The data analyzed in percentage and rank all type of foods and drinks, also rank based on the location.
Results: Almost all type of meals was contaminated. Meals with chili sauce were the most risky from the contamination of E. coli (90.15 %), then followed by dry meals (38.89%), while the wet meals were the the most unrisky meals. In drinks, the highest was lacy juice, followed by jambu (guava) juice, then Sirsak and Orange juices on the third rank, while the mango juice was the lowest contamination. Melon juice, cappucino and fruit-coctail did not have E. coli contamination.
Conclusion: The contamination in the top three rank of contamination could be from the utensils used and foodhandler. (Med J Indones 2011; 20:66-70) Key words: campus, canteen, drink, Escherichia coli, food
Meals that served for university members in campus, mainly served in canteen and some by group of mobile eatery in the area of the campus, which organized or not by the faculty management. Meals contamination may cause physical illness, which related to productivity of the costumers, and will affect the academic activity. The previous studies in the same area found that there were quite low in knowledge on food hygiene and sanitation 1,2 of the food handlers.
Correspondence email to: dsusanna2@yahoo.com
Canteen in the area of campus means a place where people get meals. Canteen sometimes is also used for discussion or for social events, and the peak time is mostly during the lunch time. Each canteen served different type of meals, from the very light meals to heavy meals. It is necessary to monitor each canteen about the bacterial contamination, for instance, Esherichia coli, condition of sanitation, personal hygiene, knowledge and practice of the food handler,
Escherischia coli contamination in foods 67
as well as the materials and utensils used, since they are all related to the so called food-borne diseases. Some physical illness that related to hygiene and sanitation of the meals are diarrhea, gastroenteritis and poisoning.
3
The Decree of Ministry of Health no.715/MENKES/ SK/V/2003 mentioned that it is necessary to control food, people, place and the utensil uses to avoid possible hazards or illness. The decree also mentioned that every eatery or canteen need to have the licence from local government, and for the hygiene and sanitation aspect has to be certified by the local health office. The workers in the canteen has their own health standard, since they related directly to the foods and the instruments that served to the costumers, so they have to possess health and chef certificate, but sometimes is neglected especially in small canteens.
There are limited number of information and literature on food hygiene and sanitation and so are researches in this related area in Indonesia. Survey in Three type of food establishment in Jakarta in 2003 study found that E. coli contamination in served cooked, fresh cooked food, and raw food were 12.2 %, 7.5 %, and 40 % respectively. Contamination also found in water, food handlers and kitchen utensil with various percentage, they were 12.9 4 %, 12.5 %, and 16.9 %. In an outbreak in Bogor (2005), E. coli found in raw meat and beefsteak seemed to be 5 causative organism. The source of E. coli contamination might be from meat, milk, water, and food handlers. It have been proven that all meat (100%) coming from abattoirs and traditional markets were contaminated with E. coli O157:H7, in addition to most of the fresh and pasteurized milk samples (73.3%) coming from cattle ranches and home industries. Contamination was also found in most of the 6 water samples (60%) and in food handlers (41.7%). Another study showed that there are more or les around 35 types of common bacteria exist in foods, some of them are Bacillus, Camphylobacter, Clostridium, 7 Escherichia, Salmonella, Shigella, and Staphylococcus. One of the strains of E. coli is E. coli
important aspect is whether these meals are healthy or save to be consumed. During first to fourth semester 2006, gastroenteritis was put at the second position of the ten diseases in University of Indonesia, although moved from 2 to 3 in first semester 2007. In order to know the contaminating bacteria and to guarantee that the foods and or drinks served by canteens are healthy, measuring the presence Escherichia coli in food and drinks is needed. The objective of this study was to measure the existence of E. coli in all type of foods sold in canteens around the campus of University of Indonesia.
METHODS
This was a cross-sectional study, conducted around campus of University X (this is a universitys initial), between 2007 and 2008. Thirteen canteens around the Depok Campus of University of Indonesia were observed for the presence of E. coli in meals served in each canteen. For ethical purposes, the real name of the canteens was given by the initial names. Those were A for canteen from Faculty of Mathematic and Sciences, B for Faculty of Engineering, C for Faculty of Law, D for Faculty of Economic, E for Faculty of Psychology, F for Faculty of Humanities, G for Faculty of Social and Politics Science, H for Faculty of Public Health, I Faculty of Nursing, J for Faculty of Computer Science, K canteen next to the Tower, and finally L for Rectorates canteen. There were 4 category of foods observed and analyzed: dry foods where no water added in the meals, wet foods, and food with sambal (chili) and sambals itself. Food mixture with sambal is kind of traditional meals; named as gado-gado, pecel, karedok, siomay, which contain vegetables added or mixed with sambal (mix of chili, peanut, onion, garlic, sugar, and salt). A total of 49 type of foods were sampled, consisted of 18 dry food, 14 wet food, 9 food with sambal mixture or poured, and 8 type of sambals that used in many different type of meals. Twenty four types of drink were also examined, which consisted of 16 juices, 4 iced teas, and others. An analysis for contamination by E. coli in meals, utensils, and on the hands of the server was also undertaken. Each sample measured in food and drink, in the utensil used for preparation and serving, and on the hand of the food handlers. Data were collected by 5 trained collectors. Sample of meals were analyzed in the Faculty of Public HealthUniversity of Indonesia Laboratory for the presence of E. coli in meals and drinks using most probable number (MPN) method. The data analyzed in percentage and in
O157:H7. The contamination of E. coli O157:H7 will risk people with diarrhea and could lead to hemorrhagic colitis, hemolytic uremic syndrome (HUS), and thrombotic thrombocytopenic purpura (TTP), which is quite dangerous to human body. Canteen costumers in a campus are mostly students, and they prefer to get cheap meals. The problem then is not about cheap or expensive meals, but the most
68 Susanna et al.
Med J Indones
rank of each category of meal for all type of foods, also made rank based on the location where the samples were come from with symbolic letters from A to M (13 locations).
Colonies of the bacteria were calculated using formula; N=

colony petridish s
1 p
of meals from eah canteen were contaminated by E. coli. Meals with sambal were the most risky from the contamination of E.coli (90,15 %), then followed by dry meals (38,89%), while the wet meals were the the most unrisky meals. For the dry meals, rice with chicken grilled has the highest contamination of E. coli, whereas Kweetiauw was the lowest. Lontong sayur was in the first rank of E.coli contamination in wet meals, while the lowest contamination was lamb soup. In food with sambal, karedok, gado-gado, pecel, and ketoprak were the type of foods with higher contamination compared with siomay. At last, the sambal in rib soup and in chicken grilled were riskier than others type of sambals from 13 canteens around Campus. (Table 1) Table 2 shows the rank of positive percent of E. coli in drinks per mL from 13 canteens around campus, 2008.
Where; N: number of colonies per mL or gram sample p: solution ratio s: volume (mL) or weight of the sample in grams
RESULTS
Totally there were 49 types of foods that divided into 4 categories. The examination found that almost all type
Tabel 1. The rank of positive percentage of E. coli in foods (per mL) from 13 canteens around campus, 2008
Food Category Dry meals Type of foods Fried rice Mix rice Rice + chicken grilled Padang rice Kweetiauw Fried noodle Total Lamb soup Tongseng Meet soup Chicken soto Noodle soup Meat soto Rib soto Lontong sayur Noodle + chicken Total Number of measured (n=49)
Frequency of measured 21 9 3 12 3 6 54 3 3 6 9 6 3 6 3 3 42 6 12 3 3 3 21 3 6 3 6 3 3 24
Number of positive
Percentage of positive 23,88 44,44 100,00 66,67 0,00 16,66 38,89 0,00 33,33 33,33 11,11 33,33 33,33 33,33 66,67 33,33 28,57 50,00 83,33 100,00 66,67 33,33 90,15 33,33 0,00 33,33 66,67 66,67 0,00 33,33
Rank of its category of foods
Wet meals
7 3 1 4 1 2 18 1 1 2 3 2 1 2 1 1 14 2 4 1 1 1 9 1 2 1 2 1 1 8
5 4 3 8 0 1 21 0 1 2 1 2 1 2 2 1 12 3 10 3 2 1 19 1 0 1 4 2 0 8
4 3 1 2 6 5 2 4 2 2 3 2 2 2 1 2 4 4 2 1 3 5 1 2 3 2 1 1 3 3
With Sambal
Sambal
Ketoprak Gado-gado Karedok Pecel Siomay Total in meat soup in chicken soto in noodle soto in rib soup for chicken grilled for Padang rice Total
Frequency of measured: in food, utensil, and food handler
66 Susanna et al.
Med J Indones
The level of Escherichia coli contamination in foods and drinks sold at canteens campus
Dewi Susanna, Tris Eryando, Yvonne M. Indrawani
1
24
Department of Environmental Health, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia Department of Biostatistics and Health Informatic, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia 25 Department of Nutrition, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia
Abstrak
Latar belakang: Kontaminasi bakterial pada makanan yang disediakan di kantin kampus merupakan hal yang sering terjadi dan dapat mengganggu aktivitas akademik. Penelitian ini bertujuan mengetahui tingkatan kontaminasi Escherichia coli pada makanan dan minuman yang dijajakan di kantin sebuah kampus universitas.
Metode: Sebanyak 49 makanan dan 24 jenis minuman diperiksa dengan menggunakan metode konvensional untuk pengukuran Most Probable Number (MPN), yaitu uji penduga, uji penguat, dan uji pelengkap. Analisis kontaminasi pada makanan dan minuman dilakukan di Laboratorium Kesehatan Lingkungan Fakultas Kesehatan Masyarakat Universitas Indonesia. Analisis data dengan membuat tingkatan kontaminasi berdasarkan kelompok makanan dan minuman serta lokasi kantin.
Hasil: Hampir semua kelompok makanan terkontaminasi. Makanan dengan sambal adalah makanan yang paling berisiko untuk terkontaminasi E. coli (90,15 %), diikuti oleh makanan kering, sedangkan makanan berkuah adalah yang paling kecil risikonya (38,89%). Minuman yang paling tinggi kontaminasinya adalah jus lacy, diikuti oleh jus jambu, lalu jus sirsak dan orange di peringkat ketiga, sementara jus mangga kontaminas nya terendah. Jus melon, cappucino dan coctail tidak menunjukkan adanya kontaminasi. Kesimpulan: Makanan dan minuman yang ditemukan pada tiga lokasi yang menduduki urutan tertinggi disebabkan oleh terkontaminasinya alat makan dan tangan penjamah makanan. (Med J Indones 2011; 20:66-70)
Abstract
Background: Bacterial contamination is a common phenomenon in foods served in campus canteens and my cause physical illness which will affect academic activity. The aim of this study was to rank the level of Escherichia coli contamination in food and drink in campus canteens. Methods: Forty nine (49) foods and 24 types of drink were examined using conventional agar broth method for calculation of most probable number (MPN). The steps of the mothod were presumptive test for coliforms, fecal coliforms and E. coli, confirmes test for coliforms, fecal coli and E. coli and then completed test for E. coli. An analysis for contamination by E. coli in meals, utensils, and on the hands of the server was also undertaken. The data analyzed in percentage and rank all type of foods and drinks, also rank based on the location.
Results: Almost all type of meals was contaminated. Meals with chili sauce were the most risky from the contamination of E. coli (90.15 %), then followed by dry meals (38.89%), while the wet meals were the the most unrisky meals. In drinks, the highest was lacy juice, followed by jambu (guava) juice, then Sirsak and Orange juices on the third rank, while the mango juice was the lowest contamination. Melon juice, cappucino and fruit-coctail did not have E. coli contamination.
Conclusion: The contamination in the top three rank of contamination could be from the utensils used and foodhandler. (Med J Indones 2011; 20:66-70) Key words: campus, canteen, drink, Escherichia coli, food
Meals that served for university members in campus, mainly served in canteen and some by group of mobile eatery in the area of the campus, which organized or not by the faculty management. Meals contamination may cause physical illness, which related to productivity of the costumers, and will affect the academic activity. The previous studies in the same area found that there were quite low in knowledge on food hygiene and sanitation 1,2 of the food handlers.
Correspondence email to: dsusanna2@yahoo.com
Canteen in the area of campus means a place where people get meals. Canteen sometimes is also used for discussion or for social events, and the peak time is mostly during the lunch time. Each canteen served different type of meals, from the very light meals to heavy meals. It is necessary to monitor each canteen about the bacterial contamination, for instance, Esherichia coli, condition of sanitation, personal hygiene, knowledge and practice of the food handler,
Escherischia coli contamination in foods 67
as well as the materials and utensils used, since they are all related to the so called food-borne diseases. Some physical illness that related to hygiene and sanitation of the meals are diarrhea, gastroenteritis and poisoning.
3
The Decree of Ministry of Health no.715/MENKES/ SK/V/2003 mentioned that it is necessary to control food, people, place and the utensil uses to avoid possible hazards or illness. The decree also mentioned that every eatery or canteen need to have the licence from local government, and for the hygiene and sanitation aspect has to be certified by the local health office. The workers in the canteen has their own health standard, since they related directly to the foods and the instruments that served to the costumers, so they have to possess health and chef certificate, but sometimes is neglected especially in small canteens.
There are limited number of information and literature on food hygiene and sanitation and so are researches in this related area in Indonesia. Survey in Three type of food establishment in Jakarta in 2003 study found that E. coli contamination in served cooked, fresh cooked food, and raw food were 12.2 %, 7.5 %, and 40 % respectively. Contamination also found in water, food handlers and kitchen utensil with various percentage, they were 12.9 4 %, 12.5 %, and 16.9 %. In an outbreak in Bogor (2005), E. coli found in raw meat and beefsteak seemed to be 5 causative organism. The source of E. coli contamination might be from meat, milk, water, and food handlers. It have been proven that all meat (100%) coming from abattoirs and traditional markets were contaminated with E. coli O157:H7, in addition to most of the fresh and pasteurized milk samples (73.3%) coming from cattle ranches and home industries. Contamination was also found in most of the 6 water samples (60%) and in food handlers (41.7%). Another study showed that there are more or les around 35 types of common bacteria exist in foods, some of them are Bacillus, Camphylobacter, Clostridium, 7 Escherichia, Salmonella, Shigella, and Staphylococcus. One of the strains of E. coli is E. coli
important aspect is whether these meals are healthy or save to be consumed. During first to fourth semester 2006, gastroenteritis was put at the second position of the ten diseases in University of Indonesia, although moved from 2 to 3 in first semester 2007. In order to know the contaminating bacteria and to guarantee that the foods and or drinks served by canteens are healthy, measuring the presence Escherichia coli in food and drinks is needed. The objective of this study was to measure the existence of E. coli in all type of foods sold in canteens around the campus of University of Indonesia.
METHODS
This was a cross-sectional study, conducted around campus of University X (this is a universitys initial), between 2007 and 2008. Thirteen canteens around the Depok Campus of University of Indonesia were observed for the presence of E. coli in meals served in each canteen. For ethical purposes, the real name of the canteens was given by the initial names. Those were A for canteen from Faculty of Mathematic and Sciences, B for Faculty of Engineering, C for Faculty of Law, D for Faculty of Economic, E for Faculty of Psychology, F for Faculty of Humanities, G for Faculty of Social and Politics Science, H for Faculty of Public Health, I Faculty of Nursing, J for Faculty of Computer Science, K canteen next to the Tower, and finally L for Rectorates canteen. There were 4 category of foods observed and analyzed: dry foods where no water added in the meals, wet foods, and food with sambal (chili) and sambals itself. Food mixture with sambal is kind of traditional meals; named as gado-gado, pecel, karedok, siomay, which contain vegetables added or mixed with sambal (mix of chili, peanut, onion, garlic, sugar, and salt). A total of 49 type of foods were sampled, consisted of 18 dry food, 14 wet food, 9 food with sambal mixture or poured, and 8 type of sambals that used in many different type of meals. Twenty four types of drink were also examined, which consisted of 16 juices, 4 iced teas, and others. An analysis for contamination by E. coli in meals, utensils, and on the hands of the server was also undertaken. Each sample measured in food and drink, in the utensil used for preparation and serving, and on the hand of the food handlers. Data were collected by 5 trained collectors. Sample of meals were analyzed in the Faculty of Public HealthUniversity of Indonesia Laboratory for the presence of E. coli in meals and drinks using most probable number (MPN) method. The data analyzed in percentage and in
O157:H7. The contamination of E. coli O157:H7 will risk people with diarrhea and could lead to hemorrhagic colitis, hemolytic uremic syndrome (HUS), and thrombotic thrombocytopenic purpura (TTP), which is quite dangerous to human body. Canteen costumers in a campus are mostly students, and they prefer to get cheap meals. The problem then is not about cheap or expensive meals, but the most
68 Susanna et al.
Med J Indones
rank of each category of meal for all type of foods, also made rank based on the location where the samples were come from with symbolic letters from A to M (13 locations).
Colonies of the bacteria were calculated using formula; N=

colony petridish s
1 p
of meals from eah canteen were contaminated by E. coli. Meals with sambal were the most risky from the contamination of E.coli (90,15 %), then followed by dry meals (38,89%), while the wet meals were the the most unrisky meals. For the dry meals, rice with chicken grilled has the highest contamination of E. coli, whereas Kweetiauw was the lowest. Lontong sayur was in the first rank of E.coli contamination in wet meals, while the lowest contamination was lamb soup. In food with sambal, karedok, gado-gado, pecel, and ketoprak were the type of foods with higher contamination compared with siomay. At last, the sambal in rib soup and in chicken grilled were riskier than others type of sambals from 13 canteens around Campus. (Table 1) Table 2 shows the rank of positive percent of E. coli in drinks per mL from 13 canteens around campus, 2008.
Where; N: number of colonies per mL or gram sample p: solution ratio s: volume (mL) or weight of the sample in grams
RESULTS
Totally there were 49 types of foods that divided into 4 categories. The examination found that almost all type
Tabel 1. The rank of positive percentage of E. coli in foods (per mL) from 13 canteens around campus, 2008
Food Category Dry meals Type of foods Fried rice Mix rice Rice + chicken grilled Padang rice Kweetiauw Fried noodle Total Lamb soup Tongseng Meet soup Chicken soto Noodle soup Meat soto Rib soto Lontong sayur Noodle + chicken Total Number of measured (n=49)
Frequency of measured 21 9 3 12 3 6 54 3 3 6 9 6 3 6 3 3 42 6 12 3 3 3 21 3 6 3 6 3 3 24
Number of positive
Percentage of positive 23,88 44,44 100,00 66,67 0,00 16,66 38,89 0,00 33,33 33,33 11,11 33,33 33,33 33,33 66,67 33,33 28,57 50,00 83,33 100,00 66,67 33,33 90,15 33,33 0,00 33,33 66,67 66,67 0,00 33,33
Rank of its category of foods
Wet meals
7 3 1 4 1 2 18 1 1 2 3 2 1 2 1 1 14 2 4 1 1 1 9 1 2 1 2 1 1 8
5 4 3 8 0 1 21 0 1 2 1 2 1 2 2 1 12 3 10 3 2 1 19 1 0 1 4 2 0 8
4 3 1 2 6 5 2 4 2 2 3 2 2 2 1 2 4 4 2 1 3 5 1 2 3 2 1 1 3 3
With Sambal
Sambal
Ketoprak Gado-gado Karedok Pecel Siomay Total in meat soup in chicken soto in noodle soto in rib soup for chicken grilled for Padang rice Total
Frequency of measured: in food, utensil, and food handler
Vol. 20, No. 1, Februari 2011
Iron deficiency anemia 71
Iron deficiency anemia in the elderly

Indra Kurniawan
Pangkalbalam Public Health Centre & Bhakti Wara Hospital, Pangkalpinang, Bangka Belitung Archipelago, Indonesia
Abstrak
Jumlah kaum lanjut usia (lansia) di seluruh dunia mengalami pertumbuhan dengan pesat. Anemia merupakan masalah hematologi yang paling utama pada lansia. Namun, anemia sebaiknya tidak dianggap sebagai konsekuensi penuaan yang tidak dapat dihindari. Anemia pada lansia menandakan adanya suatu penyakit yang mendasari. Anemia Defisiensi Besi (ADB) merupakan salah satu penyebab utama anemia pada lansia. ADB pada lansia menyebabkan terjadinya gejalagejala yang tidak spesifik. Diagnosis ADB biasanya didasarkan pada hasil laboratorium. Oleh karena itu, penggunaan berbagai pemeriksaan laboratorium memegang peranan penting di dalam penegakkan diagnosis ADB. Adanya ADB pada lansia biasanya berhubungan dengan terjadinya suatu kelainan gastrointestinal. Maka pada semua pasien dengan ADB perlu dilakukan evaluasi gastrointestinal kecuali pada mereka yang mempunyai riwayat perdarahan non gastrointestinal yang bermakna secara klinis. Lansia yang mengalami ADB perlu mendapat supplementasi besi, baik untuk mengkoreksi anemia maupun untuk memperbaiki cadangan besi tubuh. Selain itu, juga harus dilakukan tatalaksana terhadap penyakit yang mendasari untuk mencegah kehilangan besi lebih lanjut. (Med
J Indones 2011; 20:71-7)
Abstract
The numbers of older people in the world have been growing rapidly. Anemia is the most common hematologic problem encountered in older adults. However, anemia should not be accepted as an inevitable consequence of aging. Anemia in the elderly signifies an underlying disease. Iron Deficiency Anemia (IDA) is being one of the most common causes of anemia in older people. IDA in the elderly is often associated with such non specific symptoms. The diagnosis of IDA is typically based on laboratory results. Hence, the utilization of the various laboratory tests plays an important role for the diagnosis of IDA. The presence of IDA in the elderly is usually related with gastrointestinal disorders. Thus, gastrointestinal evaluation should be contemplated in all patients with IDA unless there is a history of clinically important non gastrointestinal blood loss. Older people with IDA should have iron supplementation both to correct anemia and to replenish body iron stores. However, the underlying cause should always be treated to prevent further iron loss. (Med J Indones 2011; 20:71-7) Key words: anemia, elderly, gastrointestinal, iron deficiency
Anemia is defined as a reduction in the number of circulating red blood cells, or the hemoglobin concentration in the blood. The World Health Organization (WHO) defined it as a hemoglobin (Hb) level <13 g/dL in men and <12 g/dL in women. Anemia is extremely frequent in elderly persons, defined in this article as those aged 65 years and older. A recent review of studies of anemia in elderly patients (2008) confirms that anemia affects 1 in every 7 or 8 older people living in the community.
1,2
Iron Deficiency Anemia (IDA) outranks the anemia of chronic disorders in prevalence, but the reverse is encountered in hospital practice. The diagnosis of IDA is important because proper iron therapy can improve the symptoms, and investigations may help in detecting an occult gastrointestinal pathology such as malignancy.
1,3,4
AGE-ASSOCIATED CHANGES IN THE HEMATOPOIETIC SYSTEM

The bone marrow is the site of production for blood cells, such as circulating RBCs, granulocytes, and platelets. As aging proceeds, the marrow becomes increasingly localized to the axial skeleton. However, in the non-diseased elderly, the total number of marrow cells in the body is not decreased; it is similar to that of healthy young adults. Consequently, clinical examination of the marrow of older persons does not differ from that of normal young adults. The prevalence of anemia is
Nowadays, anemia is considered to be an important health problem among the elderly. With advancing age, there is a progressive and apparently physiological decrement of marrow hematopoesis. However, anemia in the elderly is due to disease and should never be considered as a normal physiological response to ageing.
1,2
The causes of anemia in the elderly are diverse, with anemia of chronic disease and iron deficiency anemia being the most common causes. In community studies,
Correspondence email to:indra_kurniawan@windowslive.com
72
Kurniawan
Med J Indones
increased in populations of community-dwelling, clinic visiting, and hospitalized elderly. However, anemia is not a consequence of aging. This supports the concept that older persons develop anemia due to underlying disease.
5
ETIOLOGY
In the absence of any history of hemorrhage, iron deficiency anemia in older people is sometimes related to diet, but is usually a result of digestive disorder. Focusing on digestive disorders, the etiology of IDA of gastrointestinal origin can be divided into two groups: situations with increased loss of iron and those with decreased iron absorption. In the former, there could be a hidden bleeding, which might be more difficult to diagnose. Common causes include NSAID use, colonic cancer or polyp, gastric cancer, angiodysplasia, and inflammatory bowel disease. Rare causes include previous gastrectomy, intestinal teleangiectasia, lymphoma, leiomyoma and other small bowel tumour. The possible existence of a malignancy as the source of anemia, which leads to early completion of endoscopic examinations is a great concern.3,6-8
causes no symptoms (asymptomatic) and could be found only by laboratory survey. Although the impact of IDA on the quality of life of the subject is high, they often get used to their symptoms and these are assumed as normal. The patient becomes aware of an improvement only 4,10,11 when the symptoms disappear.
Older people with IDA might have alopecia, atrophy of lingual papillae, or dry mouth due to loss of salivation. These changes were caused by reduction of iron-containing enzymes in the epithelia and the gastrointestinal tract. Some older people could have other signs, such as cheilosis (fissures at the corners of the mouth) and koilonychia (spooning of the fingernails). The presence of these signs suggests that there might be an advanced tissue iron deficiency. Physical examination might be normal or show pallor of varying intensity. Besides that, there might be a 4,10-12 systolic murmur in cardiac auscultation.
LABORATORY FINDINGS
In the second category of etiology, reduced iron absorption can be caused by celiac disease, atrophic gastritis, and postsurgical status (gastrectomy, intestinal resection). In a study on patients referred to gastroenterologists because of IDA, celiac disease was the diagnosis in at least 2-3% of cases. Microscopic alterations in the duodenal mucosa in non-treated celiac disease will lead to a refractory condition in oral iron treatment. Gastroscopy with biopsy allowed detection of gastritis with or without H.pylori. The positivity of autoantibodies (anti-intrinsic factor or anti-parietal cell) supports the diagnosis of autoimmune atrophic gastritis. A recent meta-analysis concluded that the infection of H.pylori is associated with depleted iron deposits. The mechanism is not clear, but it appears to involve gastrointestinal blood loss, diminished iron absorption from the diet, and 6,9 increased consumption of iron by the bacteria.
CLINICAL MANIFESTATION
The clinical presentation of IDA depends on the degree of anemia, the speed of onset, the underlying cause, and the presence of comorbid conditions. IDA in the elderly is often associated with such nonspecific symptoms as general weakness, fatigue, functional decline, irritability, poor concentration and headache. Sometimes, IDA
The diagnosis of IDA is typically based on laboratory results. There are various measurements of iron status. No single measurement is ideal for all clinical circumstances, as all are affected by confounding factors. Hence, the utilization of the various laboratory tests for the diagnosis of IDA is required.
26 Complete blood count The World Health Organization (WHO) defines anemia as the decline in blood hemoglobin to a concentration below 13 g/dl in men and 12 g/dl in women. The diagnosis of anemia needs complete blood count examination, including a measure of the mean corpuscular volume (MCV). In this way, the anemias can be characterized morphologically as normocytic, microcytic, or macrocytic. Faced with microcytic anemia, there are four main diagnostic possibilities include iron deficiency anemia (IDA), thalassemia, anemia of chronic disorders, and sideroblastic anemia. The next step in diagnosis should be directed toward 5,10,12 confirmation or exclusion of IDA. 27 Serum iron (SI) and total iron binding capacity (TIBC) The SI level represents the amount of circulating iron bound to transferrin. The TIBC is an indirect measure of the circulating transferrin. The SI and TIBC give a measure of the iron supply to the tissues. In normal subjects, SI shows a diurnal rhythm, with values being lower in the morning
Vol. 20, No. 1, Februari 2011
Iron deficiency anemia
73
than in the evening. In iron deficiency, however, values stabilize at low levels respectively. A low SI (<10 mol/l) with increase in TIBC (>70 mol/l) is characteristic of iron deficiency. A serum transferrin saturation (SI/TIBC 100) that is persistently less than 15% is insufficient to support normal 7,13,14 erythropoiesis, indicates iron deficiency states.
3. Serum ferritin
Free iron is toxic to the cells, and the body has established a set of protective mechanisms to bind iron in various tissue compartments. Within cells, iron is stored complexed to protein as ferritin. Apoferritin binds to free ferrous iron and stores it in the ferric state. Iron in ferritin can be extracted for release by the RE cells. In normal conditions, the serum ferritin level reflects total body iron stores. Thus, the serum ferritin level is the most convenient 13 laboratory test to estimate iron stores. The normal value for ferritin varies according to age of the individual. Serum ferritin level tends to rise with aging. In adults, a serum ferritin concentration <15 g/L is diagnostic of iron deficiency. However, in the elderly, the diagnosis of IDA is highly likely in those with ferritin levels of up to 45 g/L. A low serum ferritin level always indicates iron deficiency, but normal value does not exclude this because ferritin synthesis is influenced by factors other than iron. It also acts as an acute-phase reactant in many inflammatory diseases. Iron deficiency is highly unlikely if the serum ferritin concentration is >100
g/L. 7,13,14
hemoglobin synthesis. Normal values are <30 g/dL of red cells. Concentrations greater than the normal upper limit of 80 g/dL hemoglobin therefore indicate iron deficiency. Protoporphyrin levels may also increase in patients with sideroblastic anaemias and lead poisoning. Convenient analysers measure zinc protoporphyrin the form in which most of the protoporphyrin exists in iron deficiency. 13,14 Evaluation of iron status using the Zinc Protoporphyrin /Heme (ZPP/H) ratio is another diagnostic indicator of IDA diagnostic of early iron depletion. The ZPP/H ratio reflects iron status in the bone marrow during the formation of Hb. When iron supply is diminished, Zn utilization increases resulting in a high ZPP/H ratio. Das and Philip compared the utility of ZPP/H ratio as a diagnostic measure of IDA with bone marrow iron store aspirates. They concluded that ZPP/H was reliable in reflecting the bone marrow iron status except in the 15 pre-latent phase of iron deficiency.
6. Serum levels of transferrin receptor protein

Serum transferrin receptor (sTfR) reflects erythropoesis and inversely the amount of iron available for erythropoiesis. sTfR levels increase in the absence of storage iron (absolute iron deficiency). sTfRs can contribute significantly to the detection of IDA. Chang et al. compared the utility of serum sTfR levels and serum ferritin to bone marrow iron stores in identifying IDA. They concluded that elevated sTfR levels were found to be the most sensitive marker for the detection of absent bone marrow iron (100%). This laboratory test is becoming increasingly available and, along with the serum ferritin, has been proposed to identifying 13-15 IDA.
4. Evaluation of bone marrow iron stores Bone marrow aspiration and staining for iron (Prussian blue stain) provides a definite diagnosis of IDA. It is considered to be the standard for assessing iron status. However, in addition to storage iron, the marrow iron stain provides information about the effective delivery of iron to developing erythroblasts. Normally, when the marrow smear is stained for iron, 2040% of developing erythroblast will have visible ferritin granules in their eythoplasm. This represents iron in excess of that needed for hemoglobin synthesis. In iron deficiency anemia, RE iron and 7,13,14 erythroblast iron are absent. 5. Red cell protoporphyrin
Protoporphyrin is an intermediate in the pathway to heme synthesis. Under conditions in which heme synthesis is impaired, protoporphyrin accumulates within the red cell. This reflects an inadequate iron supply to erythroid precursors to support
INVESTIGATION
The underlying cause of IDA should always be investigated before treatment is begun, because in many cases it is correctable. A study reported that in most patients, the treatment of IDA will not be effective if a cause for IDA is not found.
History
Poor iron deficient diets are sometimes found and a dietary history should be taken to identify poor iron intake. The use of aspirin and NSAID should be noted and these drugs should be stopped when the clinical indication is weak or other choices are available. Family history of IDA (which may indicate inherited disorders
ISSN: 0853-1773

Medical Journal of Indonesia

Încărcat de

Informații document

Descriere originală:

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

Medical Journal of Indonesia

Încărcat de

Drepturi de autor:

Formate disponibile

Medical Journal of Indonesia

Vol 20, No 1 (2011): Vol. 20, Number 1, February 2011, pp 1 - 82

Basic Medical Research

infants aged 68 months Dian Kusumadewi, Saptawati Bardosono, Rini Sekartini 46 - 49

Vol.20, No.1, Februari 2011

Correspondence email to: isnanis@yahoo.com hj.freisleben@tonline.de

Vol. 20, No. 1, February 2011

VDAC3 antibody decreases sperm motility

Evaluation of the presence of VDAC3 protein in human sperm

METHODS Production of anti-VDAC3 polyclonal antibody

Vol. 20, No. 1, February 2011

VDAC3 antibody decreases sperm motility

Rapid progressive motility (%) 5 5 17 11 8 5 5 10 10 5 10 8 8 7 9 9 6 7 12 10 8 9 14 10 10 7 8 8 6 10

Motility of sperm Slow or sluggish progressive motility (%) 43 40 43 43 43 73 64 65 70 60 55 42 43 44 42 43 43 44 42 42 43 43 50 37 41 42 42 43 44 40

No progressive motility (%) 17 10 10 21 17 7 16 15 13 15 15 17 18 17 18 17 16 26 20 18 16 17 16 23 17 14 20 21 23 21

Vol. 20, No. 1, February 2011

Genetic polymorphism of merozoit surface protein 11

METHODS Clinical samples

Vol. 20, No. 1, February 2011

Genetic polymorphism of merozoit surface protein

Allelic distribution and complexity of infection

Table 3. Distribution of fragments length of MAD20 allele types

Table 4 Distribution of fragments length of RO33 allele types

and coastal area.

Vol. 20, No. 1, February 2011

Comparison of adipose tissue processing 15

Effect of adipose tissue processing procedures in culture result: a study preliminary

Correspondence email to: jeanneadiwip@fk.ui.ac.id

Culture and subculture

Vol. 20, No. 1, February 2011

Comparison of adipose tissue processing

Data collection and interpretation

Cell yield 200,000 32,000 1,464,000 -

It was also reported

Correspondence email to: pajohn_buang@hotmail.com

Vol. 20, No. 1, February 2011

Metabolic effects of di (2-ethyl hexyl) phthalate medium dose

METHODS Animals and experimental design

Analyses of serum and liver lipids

determined by the methods used in our previous studies.

The glutathione peroxidase (GSH-Px; EC1.11.1.9)

was determined by the methods used elsewhere.

DEHP* 134.6 2.5 b 188.4 6.3 b 14.1 0.8 6.7 0.2

Figure 1. Serum lipids and glucose levels

Vol. 20, No. 1, February 2011

MnSOD mRNA expression and specific activity 27

Sri W. A. Jusman Mohamad Sadikin

Isolation of total RNA and protein

Analysis of MnSOD mRNA relative expression using Real Time RT-PCR

Vol. 20, No. 1, February 2011

MnSOD mRNA expression and specific activity 29

Analysis of MnSOD specific activity

34 Tjakradidjaja and Tjakradidjaja

Correspondence email to: chika.tjakra@yahoo.co.id

Vol. 20, No. 1, February 2011

Pomegranate powder reduced malondialdehyde (MDA)

36 Tjakradidjaja and Tjakradidjaja

Second week2 10.50 (0.53) 11.27 (1.62) 10.70 (0.48)

Anthropometric profiles of children with congenital heart disease

(Med J Indones 2011; 20:40-5)

Vol. 20, No. 1, February 2011

Anthropometric profiles of children with congenital heart disease 41

HC= head circumference; SD= standard deviation