UNIVERSITATEA DE TIINE AGRICOLE I MEDICIN VETERINAR CLUJ-NAPOCA COALA DOCTORAL FACULTATEA DE ZOOTEHNIE I BIOTEHNOLOGII

Med.Vet. Oroian Rare Gelu

Genotipizarea speciilor de Saprolegnia i determinarea patogenitii acestora asupra diferitelor specii de ciprinide n cresctorii din centrul i nord-vestul Romniei
-REZUMAT AL TEZEI DE DOCTORAT-

CONDUCTOR TIINIFIC Prof.univ.dr.ing. AUGUSTIN VLAIC

Cluj-Napoca 2010
1

CUPRINS
INTRODUCERE.................................................................................................................................. 4 CAPITOLUL I ..................................................................................................................................... 4 IPOTEZA EXPERIMENTAL, OBIECTIVELE CERCETRII, DISPOZITIVUL EXPERIMENTAL, MATERIAL I METOD DE LUCRU ............................................................. 4 I.1. IPOTEZA EXPERIMENTAL I OBIECTIVELE CERCETRII ........................................ 4 I.2. DISPOZITIVUL EXPERIMENTAL......................................................................................... 6 I.3. MATERIAL I METOD DE LUCRU ................................................................................... 7 I.3.1. Prelevarea probelor ............................................................................................................. 7 I.3.2. Iniierea culturii de Saprolegnia n condiii de laborator.................................................... 8 I.3.3. Mediile de cultur utilizate ................................................................................................. 9 I.3.3.1. Mediile de cultur solide utilizate n experiment ....................................................... 10 I.3.3.2. Mediile de cultur lichide utilizate n experiment ..................................................... 10 I.3.3.3. Antibioticele utilizate n experiment .......................................................................... 11 I.3.4. Caracterizarea morfologic a tulpinilor de Saprolegnia ................................................... 11 I.3.5. Extracia i detectarea ADN-ului din fungi ...................................................................... 12 I.3.5.1. Extracia ADN-ului din fungi utiliznd kituri de extracie (QIAGEN) ...................... 12 I.3.5.2. Extracia ADN-ului din fungi utiliznd soluii ........................................................... 13 I.3.6. Cuantificarea ADN prin metoda direct de determinare a puritii i concentraiei ADN cu spectofotometrul Nanodrop ND-1000 ......................................................................... 13 I.3.7. Regiunea ITS de la fungi i primerii utilizai.................................................................... 13 I.3.8. Tehnici moleculare utilizate n experiment....................................................................... 15 I.3.8.1. Amplificarea PCR a probelor de Saprolegnia ........................................................... 15 I.3.8.2. Tehnica PCR-RFLP - Restriction Fragment Length Polymorphism ......................... 16 I.3.9. Metode utilizate n stabilirea diversitii i....................................................................... 16 nrudirii filogenetice a speciilor de fungi din familia Saprolegniaceae ..................................... 16 I.3.9.1. Secvenierea automat ............................................................................................... 16 CAPITOLUL II .................................................................................................................................. 17 REZULTATELE CERCETRILOR PROPRII ................................................................................ 17 II.1. REZULTATELE CULTURII DE SAPROLEGNIA N CONDIII DE LABORATOR ...................................................................................................... 17 II.2. REZULTATE PRIVIND CRETERA I DEVZOLTAREA SAPROLEGNIEI PE MEDIILE DE CULTUR .......................................................................... 18 II.2.1. Rezultate comparative privind creterea coloniilor de Saprolegnia pe mediile de cultur solide .............................................................................. 18 II.2.2. Rezultate comparative privind dezvoltarea coloniilor de Saprolegnia pe mediile de cultur lichide ............................................................................. 20 II.3. CARACTERIZAREA MORFOLOGIC A TULPINILOR DE SAPROLEGNIA ................ 20 II.4. REZULTATE PRIVIND EXTRACIA I CUANTIFICAREA ADN-ULUI LA SAPROLEGNIA ................................................................................................... 21 II.4.1. Extracia ADN ................................................................................................................. 21 II.5. REZULTATELE AMPLIFICRII ADN-ULUI LA SPECII DE FUNGI DIN FAMILIA SAPROLEGNIACEAE ...................................................................... 22 II.5.1. Amplificarea ADN prin PCR .......................................................................................... 22

II.6. REZULTATELE RESTRICIEI ENZIMATICE A ADN-ULUI DE LA SPECII DE FUNGI DIN FAMILIA SAPROLEGNIACEAE PRIN METODA PCR-RFLP ............................. 23 II.7. REZULTATE PRIVIND STUDIUL NRUDIRII GENETICE A FUNGILOR DIN FAMILIA SAPROLEGNIACEAE ..................................................................... 27 II.8. REZULTATELE SECVENIERII SPECIILOR DE FUNGI DIN FAMILIA SAPROLEGNIACEAE N LOCAIILE STUDIATE .................................................................... 29 II.9. INCIDENA SAPROLEGNIOZEI N AREALUL STUDIAT DIN CENTRUL I NORD-VESTUL ROMNIEI....................................................................... 29 CAPITOLUL III................................................................................................................................. 33 CONCLUZII I RECOMANDRI ................................................................................................... 33 BIBLIOGRAFIE SELECTIV ......................................................................................................... 37

INTRODUCERE
Saprolegnioza constituie una din cele mai importante cauze ale pierderilor economice din acvacultur, infeciile cu fungi secondnd doar bolile bacteriene ca importan economic. Infeciile fungice sunt n general cronice, provocnd pierderi constante. Saprolegnia afecteaz un numr mare de peti teleostei, cum sunt: somnul, tiuca, bibanul, babuca, crapul, salmonidele, sturionii, barramundi, tilapia; fiind implicat n infestaii i la specii de peti tropicali: gurami, guppy, platy. n Japonia rata anual de mortalitate la somonul Coho (Oncorhynchus kisuth) cauzat de Saprolegnia parasitica Coker este de 50%. Acelai procent se nregistreaz i la anghil (Anguilla anguilla), tot n Japonia. n Scoia, saprolegnioza provoac pierderi economice importante ndeosebi n cresctoriile de somoni. n sudul Statelor Unite ale Americii pierderile nregistrate la somn au fost de 50%, iar pierderea economic de 40 milioane de dolari. n Romnia nu exist pn la ora actual o evaluare tiinific a pierderilor din cresctoriile piscicole generate de saprolegnioz.

CAPITOLUL I IPOTEZA EXPERIMENTAL, OBIECTIVELE CERCETRII, DISPOZITIVUL EXPERIMENTAL, MATERIAL I METOD DE LUCRU
I.1. IPOTEZA EXPERIMENTAL I OBIECTIVELE CERCETRII Studiul bibliografic asupra saproleniozei la peti n general, i ciprinidelor n special, indic faptul c n lume datorit diferenelor generate de diversele tipuri de ap, ca i de solul pe care l strbat sau n care sunt localizate, de temperaturile medii anuale, de gradul de populare i speciile piscicole existente, boala este generat de numeroase specii de Saprolegnia, care au specificitate i patogenitate diferite, n funcie de factorii mai sus enumerai. Literatura de specialitate prezint preocupri actuale privind identificarea i clasificarea diverselor specii i subspecii de Saprolegnia, saprofite i condiionat patogene la
4

diverse specii piscicole. De aici se desprinde faptul c nu este suficient identificarea strict morfologic a tulpinilor izolate, ci este necesar i o caracterizare complementar molecular privind structura ADN-ului, care s permit identificarea corect i stabilirea distanelor genetice dintre populaiile i subpopulaiile de Saprolegnia. Acest lucru este necesar ntruct pierderile tehnologice n piscicultur raportate att la nivel mondial, ct i naional, datorit saprolegniozei, care afecteaz dezvoltarea petilor de la faza de icr, larv, alevin, tineret, adult ating pn la 50% din producie, ceea ce se repercuteaz negativ asupra situaiei economico-financiare a cresctoriilor. Pornind de la aceste considerente, prin ipoteza cercetrii ne-am propus identificarea i caracterizarea morfologic i molecular, prin analize de ADN, a speciilor i subspeciilor de Saprolegnia, care afecteaz populaiile de ciprinide din cresctoriile din centrul i nordvestul Romniei. n Romnia nu s-au mai efectuat studii genetice asupra speciilor i subspeciilor de Saprolegnia, care afecteaz speciile de ciprinide, i care ntr-un viitor mai mult sau mai puin ndeprtat ar putea constitui baza de plecare pentru crearea de vaccinuri de ADN, care s fie utilizate la efectivele de reproducie. Studiul izolatelor locale de Saprolegnia vor contribui n mod evident la dezvoltarea strategiilor de control a bolii. Obiective urmrite n cercetare: 1. Stabilirea planului i protocolului experimental; 2. Optimizarea metodelor de cultur a Saprolegniei; 3. Optimizarea metodelor de extracie i amplificare a ADN-ului la Saprolegnia; 4. Testarea diferitelor enzime de restricie prin tehnica PCR-RFLP; 5. Stabilirea distanelor genetice dintre speciile familiei Saprolegniaceae identificate; 6. Monitorizarea incidenei saprolegniozei la ciprinide din centrul si nord-vestul Romniei.

I.2. DISPOZITIVUL EXPERIMENTAL Dispozitivul experimental a fost localizat n zona de centru i nord-vest a Romniei, fiind cuprinse n control bazine piscicole localizate dup cum urmeaz: Complexul Piscicol Arini, judeul Maramure, cu 9 bazine; C.P.Moti, judeul Slaj, cu 7 bazine; C.P.Adrian, judeul Satu Mare, cu 10 bazine; Ferma Piscicol aga, judeul Cluj, cu 5 bazine; Ferma Piscicol Ciurila, judeul Cluj, cu 6 bazine; Ferma Piscicol Chiochi, judeul Bistria-Nsud, cu 5 bazine; Ferma Piscicol Daia, judeul Alba, cu 5 bazine; Ferma Piscicol Iernut, judeul Mure, cu 5 bazine; Complexul Piscicol Cefa, judeul Bihor, cu 10 bazine; Ferma Piscicol Ineu, judeul Arad, cu 7 bazine; n acest dispozitiv experimental, reprezentativ ca distribuie zonal, cuprinznd toat diversitatea de tipuri de ap i sol existente, s-au organizat mai multe experimente. Prezentm n continuare spre vizualizare repartizarea locaiilor marcate prin puncte albe pe harta Romaniei (fig.1).

Fig.1. Locaiile n care s-au efectuat cercetrile

I.3. MATERIAL I METOD DE LUCRU I.3.1. Prelevarea probelor Prelevarea probelor de ap s-a fcut prin organizarea unui plan experimental complet randomizat, pentru ca probele s fie reprezentative pentru cresctoriile piscicole din zona analizat. Au fost nominalizate bazinele din fiecare ferm, fiind monitorizate: suprafaa de luciu de ap, cu adncimea i caracteristicile biologice ale apei, precum i structura fito- i zooplanctonului i speciile de peti care le populeaz. Pentru acurateea rezultatelor, n identificarea speciilor din familia Saprolegniaceae, pe lng observaiile curente efectuate pe

perioada experimental, s-a procedat la prelevarea de probe de ap din fiecare bazin luat n studiu, n trei luni diferite ale anului (decembrie, martie, iunie), indiferent de suprafaa bazinului, care a fost cuprins ntre 0,5 i 30 Ha. Modelul experimental utilizat a prevzut prelevarea a 5 probe de ap din fiecare bazin, din cele patru laturi i centru, de la adncimi medii de 50 cm. Din cele 5 probe s-a fcut o singur prob de ap, care a fost ulterior analizat n condiii de laborator. Pentru identificarea diferitelor specii din familia Saprolegniaceae s-au prelevat i analizat probe de ap, specii de ciprinide i icre afectate de boal din bazinele piscicole din Transilvania, luate n studiu. Probele de ap s-au prelevat n peturi de 2 litri, din cele 5 puncte ale fiecrui bazin, dup care cele 5 probe s-au amestecat ntr-un vas de 15 litri, prelevndu-se pentru analiz o singur prob de amestec din fiecare bazin, ntr-o sticl de 2 litri. Transportul s-a efectuat n primele 12 pn la 24 ore de la recoltare, procesele de analiz i experimentele fiind derulate n ziua urmtoare. I.3.2. Iniierea culturii de Saprolegnia n condiii de laborator Pentru ca eventualele diferene, care se pot constata ntre speciile de fungi din familia Saprolegniaceae existente n ape, s poat fi atribuite strict diferenelor date de natura apei i de speciile care o populeaz, s-a procedat n felul urmtor: din fiecare prob de ap, n cantitate de 2 litri, s-au constituit cte 3 probe a 100 ml de ap n recipiente de plastic sterile. n fiecare recipient au fost introduse 10-15 icre provenite de la aceeai femel de crap. Pentru c literatura de specialitate ofer date contradictorii privind temperatura de dezvoltare a Saprolegniei n diferite zone ale lumii, noi ne-am propus testarea modului de cretere i dezvoltare a fungului la 3 nivele de temperatur: 10C, 15C i 22C. Probele de ap n care au fost introduse spre infestare artificial cele 10-15 buci de icre au fost introduse n incubator la temperaturile mai sus menionate, ntre 3-7 zile. n aceast perioad s-au fcut observaii zilnice asupra fiecrei probe pentru a se constata momentul de debut al atacului fungului asupra icrelor i a intensitii dezvoltrii la temperatura respectiv.

A fost constituit un numr de 207 probe pentru fiecare lun de recoltare, cte 3 probe pe fiecare bazin, care au fost urmrite la cele 3 temperaturi vizate, facndu-se o apreciere a gradului de infestare a icrelor cu puncte de la 0 la 4, la 48, 96 i 144 ore. Interpretarea datelor s-a fcut prin estimarea punctajului mediu a tuturor probelor de la acelai gradient termic, diferenele s-au exprimat procentual. Punctajele utilizate au urmtoarele semnificaii: 0 - neevideniat 1 - foarte slab infestat 2 - slab infestat 3 - mediu infestat 4 - bine infestat I.3.3. Mediile de cultur utilizate Literatura de specialitate evideniaz faptul c n general n dezvoltarea culturilor de fungi pot fi utilizate att medii solide, ct i lichide. Mediile lichide permit dezvoltarea miceliului fungic n cantitate mare, nct s poat fi utilizat prin tehnici ulterioare la extracia de ADN (Dieguez-Uribeondo i col., 2007; Fernandez-Benitez i col., 2008). n aceast cercetare am utilizat comparativ dou medii solide: Potato Dextrose Agar (PDA-agar cu cartof-dextroz) i Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu glucoz) i dou medii lichide: Potato Dextrose Broth (PDB-bulion cu cartof-dextroz) i Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroz). Icrele infestate au fost prelevate steril n plci Petri i splate cu ap distilat coninnd 100 mg L-1 Penicilin G cu sare de potasiu. Apoi au fost nsmnate pe dou medii solide: Potato Dextrose Agar (PDA-agar cu cartof-dextroz) i Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu glucoz), iar pentru a prentmpina creterea bacterian s-a adugat acelai antibiotic, n concentraia recomandat. Coloniile au fost meninute apoi pe mediile PDA i SGA timp de 3 zile la incubator, la temperaturile menionate (10, 15 i 22C). n aceast perioad s-a urmrit viteza de cretere i diametrul coloniilor de Saprolegnia (adaptat dup Fernandez-Benitez i col., 2008). Contribuia original a constat

n faptul c s-au utilizat dou medii de cultur solide comparative i trei gradiente de temperatur pentru fiecare mediu. I.3.3.1. Mediile de cultur solide utilizate n experiment Cele dou medii de cultur solide utilizate n experiment au fost urmtoarele (conform http://www.sigmaaldrich.com): Potato Dextrose Agar (PDA-agar cu cartof-dextroz) (Fluka) Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu glucoz) (Fluka) Din fiecare bazin s-a fcut nsmnare n cele dou medii de cultur solide utilizate (PDA, SGA), din cea mai bine dezvoltat prob, pentru a putea fi fcute observaii comparative privind modul de dezvoltare al speciilor de fungi din familia Saprolegniaceae. Pentru testarea ratei de cretere pe mediul solid cu agar, n plcile Petri coninnd cele dou medii de cultur solide (PDA, SGA) i incubate la 22C 2C timp de 72 ore s-a urmrit rata de cretere a hifelor de Saprolegnia. Creterea radial n diametru a fost msurat tot la 24 ore. S-a considerat c hifele i-au epuizat creterea radial atunci cnd acestea au atins marginea plcilor Petri (>40 mm) (prelucrare dup Stueland i col., 2005). La 72 ore de dezvoltare pe mediile solide, coloniile fungice au fost pasate pe cele lichide, n urmtorul mod: coloniile de pe mediul solid Potato Dextrose Agar (PDA-agar cu cartof-dextroz) au fost transferate pe mediul lichid Potato Dextrose Broth (PDB-bulion cu cartof-dextroz), iar coloniile de pe mediul solid Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu glucoz) pe mediul lichid Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroz). Acest experiment s-a efectuat pentru a putea observa i recomanda cea mai bun combinaie de transfer de la mediul solid la mediul lichid. I.3.3.2. Mediile de cultur lichide utilizate n experiment Mediile lichide utilizate n experiment au fost urmtoarele (conform

http://www.sigmaaldrich.com): Potato Dextrose Broth (PDB-bulion cu cartof-dextroz) (Fluka):

10

Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroz) (Fluka) Toate coloniile de fungi saprolegnieni de pe mediile solide au fost pasate n pahare Erlenmeyer cu 100 ml mediu lichid cu adaos de antibiotic i meninute ntr-un incubator cu agitator, la temperatura de 22C 2C, timp de 5-7 zile, n funcie de gradul de dezvoltare. Peletele miceliale au fost apoi filtrate, splate cu ap distilat i meninute la temperatura de -20C pn la extracia ADN (metod adaptat dup Leclerc i col., 2000). Menionez faptul c la aceast procedur au fost supuse probele de fungi obinui din apa recoltat n cursul lunii iunie 2009, un numr total de 138 probe, din care 69 probe pe combinaia de mediu solid-lichid Potato Dextrose Agar (PDA-agar cu cartof-dextroz)Potato Dextrose Broth (PDB-bulion cu cartof-dextroz) i 69 probe combinaia de mediu solid-lichid Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu glucoz) - Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroz). I.3.3.3. Antibioticele utilizate n experiment Pentru a prentmpina dezvoltarea i contaminarea bacterian, n mediile de cultur pentru fungi se utilizeaz mai multe tipuri de antibiotice (Lategan i col., 2003, 2004). n experiena noastr, am optat pentru: Penicillin G potassium salt (sare de potasiu cu penicilin G) (Sigma). Concentraia de lucru utilizat de noi pe mediile solide, ct i lichide a fost de 100 mg L-1 Penicilin G cu sare de potasiu. I.3.4. Caracterizarea morfologic a tulpinilor de Saprolegnia Pentru caracterizarea mofologic a tulpinilor de Saprolegnia dezvoltate pe mediile de cultur, s-a urmrit pe cele 69 probe urmtoarele aspecte: tipurile de hife caracteristice genului Saprolegnia, reproducerea asexuat (prezena flagelilor pe zoosporii primari) i formarea structurilor sexuale (anteridiile i oogoanele). Tulpinile fungice din fiecare bazin, la 72 ore de cretere pe mediul solid PDA, au fost rensmnate n plci Petri de plastic cu diamentrul de 9 cm, pe acelai mediu PDA, la temperatura de 22C, pH 5,5. Creterea Saprolegniei a fost examinat periodic la microscop

11

timp de 2-3 sptmni, pentru a verifica dezvoltarea structurilor sexuale. Toate tulpinile au fost caracterizate i identificate conform cheilor de identificare comunicate de Johnson Jr. i col., 2002 (Dieguez-Uribeondo i col., 2007). Observaiile microscopice s-au efectuat pentru fiecare prob din fiecare bazin, procedndu-se n felul urmtor: s-a prelevat cu o ans microbiologic o poriune din colonia dezvoltat pe mediul PDA, s-a pus pe o lam histologic, s-a mrunit cu o lam de bisturiu, s-a adugat o pictur de soluie Lugol pentru colorare, s-a omogenizat, iar la final preparatul a fost acoperit cu o lamel histologic. Observaiile s-au efectuat cu microscopul cu contrast de faz, imaginile prelundu-se cu o camera digital adaptat la microscop. I.3.5. Extracia i detectarea ADN-ului din fungi Extracia ADN s-a fcut dup protocolul liu Colao Maria Chiara (1999). Extracia ADN a fost efectuat din miceliumul fungic dezvoltat n cultur pur pe mediul lichid PDB (Potato dextrose broth). S-au utilizat kitul de extracie de la Qiagen, Dneasy Plant Minikit (conform http://www.qiagen.com) i extracia rapid a ADN prin soluie PBS (tampon fosfat salin). Extracia de ADN s-a efectuat pe 69 de probe, obinute pe combinaia de mediu solidlichid Potato Dextrose Agar (PDA-agar cu cartof-dextroz)- Potato Dextrose Broth (PDBbulion cu cartof-dextroz). Fiecare prob realizat pe fiecare bazin a fost divizat n dou pri egale, fiind realizate n total 138 probe, pentru a se putea efectua extracia comparativ prin cele dou metode utilizate.

I.3.5.1. Extracia ADN-ului din fungi utiliznd kituri de extracie (QIAGEN) DNeasy Plant minikit este o procedur bazat pe coloane spin, care ncorporeaz: liza probelor, ndeprtarea ARN-ului, ndeprtarea proteinelor i a polizaharidelor, precipitarea ADN-ului, i legarea acestuia de membranele coloanelor spin. Sunt efectuate multiple splri pentru a ndeprta contaminanii, apoi ADN-ul este ndeprtat de pe membran.

12

Echipament, materiale i reactivi utilizate n experiment: - Colonii fungice n faz staionar (aproximativ 1 x 109), n numr de 69 pe probe, pe bazine de provenien; Kitul de la Qiagen. I.3.5.2. Extracia ADN-ului din fungi utiliznd soluii La extracia rapid a ADN utiliznd soluie de PBS (fosfat tampon salin), efectuat pe un numr de 69 probe, s-a procedat n felul urmtor: ntr-un tub Eppendorf se cntresc 120 mg esut fungic, peste care se adaug 200 l soluie PBS. Probele se centrifugheaz la 3000 rpm timp de 20 minute, apoi se elimin supernatantul. Operaiunea a fost repetat de 5 ori, pn la curarea peletei de ADN fungic. Apoi probele s-au pus n baie de ap, la 95C pentru spargerea peretelui celular, timp de 15 minute. Se usc probele la etuv 30 minute, dup care se adaug soluie TE (Tris-EDTA) de rehidratare a ADN-ului. Pentru metoda rapid de extracie a ADN cu soluie NE se folosesc anumite materiale chimice, soluiile trebuind preparate n laborator. Materialele i consumabilele au fost urmtoarele: pipete Eppendorf, cu volume reglabile; tuburi (Eppendorf); vrfuri de pipete de dimensiuni diferite (dimensiuni mari, medii i mici); ap steril. I.3.6. Cuantificarea ADN prin metoda direct de determinare a puritii i concentraiei ADN cu spectofotometrul Nanodrop ND-1000 Pentru determinarea puritii i concentraiei ADN s-a utilizat spectofotometrul Nanodrop ND 1000. Pentru a se putea afla concentraia ADN extras din probele de fungi sa utilizat metoda direct de determinare, care presupune msurarea densitii optice a probei de ADN, la lungimea de und 260/280 nm, pe un spectrofotometru, n domeniul UV/VIS. I.3.7. Regiunea ITS de la fungi i primerii utilizai La fungi i alte eucariote, exist dou locaii pentru ADNr: genomul nuclear i genomul mitocondrial. Cel din urm conine dou gene care codific genele mitocondriale mici i mari ale ARNr. ADNr nuclear la fungi este organizat, n general, ntr-o unitate

13

nuclear care se repet n tandem. O unitate ADNr, ilustrat n fig.2, include 3 gene ARNr: gena nuclear mic-small nuclear (18S) ARNr, 5,8S ARNr i gena nuclear mare-large nuclear (28S) ARNr. ntr-o unitate, genele sunt separate de dou spaii transcrise interninternal transcribed spacers (ITS1 i ITS2), i dou uniti ADNr separate de spaiul intergenic-intergenic spacer (IGS). Ultima gen ARNr (5S) poate fi sau nu n interiorul unitii repetate (Kamoun, 2003).

Fig.2. Diagrama unitilor repetitive ale ADN ribozomal nuclear (Frisvad i col., 1998) Cu excepia unor domenii variabile ale genelor ARNr, regiunile codificatoare sunt nalt conservate n cazul organismelor, acest lucru permind comparaii ntre fungi nrudii ndeprtat. n contrast, deoarece acetia evolueaz repede, regiunile necodificatoare au o variabilitate mai mare fa de regiunile codificatoare. Spaierile transcrise intern (ITS1 i ITS2) necodificatoare pot fi utilizate n diferenierea speciilor nrudite strns din interiorul unui gen fungic. Regiunea ITS, incluznd aici ITS1, gena 5,8S ARNr i ITS2, este de aproximativ 600 pn la 1000 perechi de baze i poate fi amplificat att total, ct i parial folosind primerii universali descrii de White i col., n 1990. Regiunea ITS este acum poate cea mai secveniat regiune a ADN la fungi. Aceasta este folosit n elaborarea studiilor de sistematic molecular ntre specii i chiar n interiorul speciilor (de exemplu, pentru a identifica geografic rasele). Din cauza gradului mare de variaie fa de alte regiuni genice ale ADNr (SSU i LSU), variaia n interiorul unitilor repetitive individuale ale ADNr uneori poate fi observat att n interiorul regiunii ITS, ct i IGS. Pe lng primerii standard utilizai de majoritatea laboratoarelor (ITS1 i ITS4), mai pot fi folosii ali civa primeri n amplificarea selectiv a secvenelor ITS a fungilor.
14

Primerii folosii de ctre noi n reacia PCR au fost urmtorii (standardizai de White i col., 1990):
- ITS1, cu secvena 5-3: TCCGTAGGTGAACCTGCGG;

- ITS4, cu secvena 5-3: TCCTCCGCTTATTGATATGC; - ITS5, cu secvena 5-3: GGAAGTAAAAGTCGTAACAAGG; Am folosit comparativ un amestec de perechi de primeri, n urmtoarea combinaie: ITS1 cu ITS4 i ITS4 cu ITS5. Primerul ITS1 se ataeaz la captul 3al genei 18S ADNr i primerul ITS4 la captul 5 al genei 28S ADNr (dup Paul B. i col., 2004). Ultima combinaie de primeri se utilizeaz n amplificarea regiunii unitii repetitive a ADNr, care include dou regiuni necodificatoare, denumite ITS1 i ITS2, i gena 5,8S ARNr (Llanos Frutos i col., 2004). I.3.8. Tehnici moleculare utilizate n experiment I.3.8.1. Amplificarea PCR a probelor de Saprolegnia n experiena efectuat de noi am utilizat combinaiile de perechi de primeri ITS1 i ITS4, ITS4 i ITS5 (White i col., 1990), care amplific regiunea ITS1, gena 5,8S rRNA i ITS2. Reaciile de amplificare au fost efectuate individual, ntr-un volum final de 25 l, cu un termocycler Eppendorf. Parametrii ciclului de amplificare utilizat au fost urmtorii: denaturarea iniial la 95C timp de 3 minute, urmat de 35 cicluri de denaturare la 94C timp de 1 minut, annealing la 55C timp de 1 minut i extensia la 72C timp de 1 minut, i extensia final la 72C timp 7 minute. Produii de amplificare au fost separai prin electoforez pe gel de agaroz 1,5%, cu buffer TBE 1x, timp de 60 minute la 70V. ADN a fost apoi colorat cu Sybr Safe (Invitrogen) i vizualizat la lumin UV. Se fotografiaz gelul i se salveaz imaginea pe aparat (Biorad). Lungimile produilor de amplificare au fost estimate n comparaie cu un Ladder ADN Low Range (700 pb) sau de 50 pb (Fermentas) (adaptat dup Ristaino i col., 1998).

15

Am mai testat o alt metod de amplificare, care s-a efectuat ntr-un termocycler Eppendorf, dup urmtorul protocol de lucru, cu etapele: - predenaturare: 5 minute la 95C - 35 cicluri: - denaturare 30 secunde la 95C - annealing 30 secunde la 48C - extensie 90 secunde la 68C - extensie final: 7 minute la 68C (dup Coalo Maria Chiara, 1999). Amplificarea s-a efectuat pe un numr de 69 probe, dezvoltate pe mediul Potato Dextrose Broth (PDB-bulion cu cartof-dextroz), utiliznd tehnica adaptat a lui Ristaino i col., 1998. I.3.8.2. Tehnica PCR-RFLP - Restriction Fragment Length Polymorphism Fragmentele amlificate au fost digerate de noi cu 3 enzime de restricie de la Fermentas: RsaI, HindIII i AluI. Protocolul de digestie a fost conform cu a manufacturierului (http://www.fermentas.com). Produii PCR au fost incubai peste noapte, la 37C, iar la final la 65C timp de 10 minute. Produii de digestie au fost apoi supui electroforezei, ntr-un gel de agaroz de 3% cu buffer TBE, la 60V, timp de 2 ore. ADN-ul a fost colorat cu Sybr Safe (Invitrogen), pentru a vizualiza polimorfismele fragmentelor amplificate, la lumin ultraviolet (Biorad). S-a utilizat un ladder ADN de 700 pb pentru compararea fragmentelor (Fermentas). I.3.9. Metode utilizate n stabilirea diversitii i nrudirii filogenetice a speciilor de fungi din familia Saprolegniaceae I.3.9.1. Secvenierea automat Catena de ADN a fost secveniat cu primerii universali ITS1 (sens) i ITS4 (antisens) la Mycrosinth (Elveia). Rezultatele secvenierilor au fost interpretate utiliznduse un software specific denumit Chromas Lite. Pentru stabilirea diversitii genetice au mai fost utilizate softuri genetice specifice.
16

CAPITOLUL II REZULTATELE CERCETRILOR PROPRII

II.1. REZULTATELE CULTURII DE SAPROLEGNIA N CONDIII DE LABORATOR S-a procedat la exprimarea procentual din total probe analizate, a fiecrui scor cu care s-a apreciat gradul de infestare, pe fiecare nivel de temperatur, neinndu-se cont de bazine i ferme (tabelul 1). Tabelul 1 Gradul de infestare a icrelor cu Saprolegnia n funcie de temperatur exprimat procentual din numrul total de probe (207) Temperatura Scor de infestare 0 1 10C 4,34 38,64 15C 0,96 11,11 22C 0,96 0,96 Legend: 0 infestaie neevideniat; 1 - foarte infestat; 4 bine infestat. 2 54,58 32,36 12,56 slab infestat; 3 4 2,41 0 51,20 4,34 45,41 40,09 2 - slab infestat; 3 mediu

Din datele tabelare se evideniaz faptul c dezvoltarea saprolegniozei este diferit de la o temperatur de incubaie la alta. La 10C, 38,64% dintre probe au fost punctate cu scorul de 1, ceea ce denot o infestare foarte slab la 144 ore de la incubaie. 54,58%, deci mai mult din jumtatea probelor analizate dezvolt slab fungul, doar 2,41% fiind mediu infestate. La temperatura de 15C doar 0,96% din probe nu manifest semne de infestare, comparativ cu 4,34% procent de neinfestare la 10C. Un prag de infestare slab de 32,36% din probe este atins la temperatura de 15C, iar nivelul mediu de infestare la 51,20% din ele. Spre deosebire de gradientul de temperatur de 10C, la cel de 15C apare un procent de 4,34% din probe bine infestate.

17

La temperatura de incubaie de 22C, 40,09% din probe prezint un nivel bun de infestare, 45,41% nivel mediu, i doar 0,96% sunt neinfestate sau cu nivel foarte slab de infestare. Aceste date evideniaz faptul c indiferent de bazinul de recoltare, de zon i de momentul anului, saprolegnioza ca boal se manifest cu intensitate ridicat i cu o durat mai scurt de manifestare n timp la temperaturi de 20C. Acest lucru vine s confirme datele de pierderi la icrele i larvele de ciprinide comunicate de cresctori, ca i de cercettorii din domeniu, care au loc n lunile mai-iunie, perioad de reproducie, cnd se constat un puseu de saprolegnioz. La temperaturi mai sczute, fungul este prezent chiar dac pentru a afecta populaiile de peti este necesar o perioad mai lung de incubaie a acestuia. La populaii de ciprinide, care ierneaz sub ghea i care realizeaz micri mai reduse, incidena este mai redus dect la alte specii, afectai fiind doar indivizi care au intrat slbii la iernare sau prezint rniri generate de manipulare.

II.2. REZULTATE PRIVIND CRETERA I DEVZOLTAREA SAPROLEGNIEI PE MEDIILE DE CULTUR II.2.1. Rezultate comparative privind creterea coloniilor de Saprolegnia pe mediile de cultur solide S-au utilizat cele dou medii solide pentru a putea fi urmrit comparativ modul de cretere al coloniilor la 24, 48 i 72 ore. Din fiecare bazin al fiecrei locaii s-au constituit 2 probe, cte una pentru fiecare mediu. ntruct cele dou probe de pe cele dou medii, din fiecare bazin provin din aceeai cultur, nsmnat la 6 zile pe aceste medii, considerm c diferenele de dezvoltare la acelai gradient de temperatur de 22C, se pot atribui diferenelor de specii i cerinelor de mediu. Pentru a se putea interpreta corect statistic diferenele de cretere a coloniilor pe cele 2 medii i la cele 3 gradiente de temperatur, n tabelul 2, prezentm valorile medii de dezvoltare a coloniilor n mm.

18

Tabelul 2 Mediile diametrului coloniilor de Saprolegnia la 24, 48 i 72 ore de dezvoltare pe cele dou medii de cultur solide (n mm) Timp citire 24 48 72 Medii de cultur Locaia Arini 14,33 9,44 29,00 19,44 56,22 Moti 12,57 7,57 26,57 16,00 51,85 Adrian 13,50 10,10 28,10 20,70 53,90 aga 12,00 7,60 24,20 16,20 48,80 Ciurila 14,66 9,16 30,33 19,16 57,00 Chiochi 13,60 9,60 28,20 19,20 53,80 Daia 11,80 8,00 24,80 16,60 49,40 Iernut 11,80 8,20 25,00 17,40 50,80 Cefa 12,20 8,00 22,50 16,60 51,30 Ineu 13,14 8,28 26,85 17,14 54,00 *PDA - Potato Dextrose Agar (agar cu cartof-dextroz) **SGA - Sabouraud 2% Glucose Agar (agar Sabouraud cu glucoz) 38,11 31,57 39,50 32,20 36,50 36,60 33,60 34,80 33,20 35,71 9+9 7+7 10+10 5+5 6+6 5+5 5+5 5+5 10+10 7+7 PDA* SGA** PDA SGA PDA SGA

Se constat analiznd mediile diametrelor, c la 24 ore (tabelul 2), pe mediul PDA, coloniile prezint valori ntre 11,80 mm (n locaiile Daia i Iernut) i 14,66 mm (n locaia Ciurila). Dup aceleai 24 ore, coloniile cultivate pe SGA au o medie cuprins ntre 7,57 mm (Moti) i 10,10 mm (Adrian). La 48 ore, cititrea acelorai plci de cultur indic aproape o dublare de la cititrea anterioar, pe mediul PDA. Diametrul minim, n medie de 22,50 mm, se obine pe coloniile provenite de la Cefa, i maximul de 30,33 mm pe probele provenite de la Ciurila (tabelul 2). La acelai interval de timp, comparativ cu probele de pe mediul PDA, cele de pe mediul SGA prezint valori mult mai reduse, cu un minim de 16,00 mm n diametru (Moti) i un maxim de 20,70 mm (Adrian). Dup Stueland i col., 2005, valori a diametrului coloniilor mai mari de 40 mm indic ajungerea la limita de cretere. La 72 ore, diametrele medii indic valori mai mari de 40 mm pentru mediul de cultur cu PDA i sub aceast valoare pentru cele cu SGA. Diametrul maxim al coloniilor, de 57,00 mm se realizeaz pe cele 6 probe nsmnate de la Ciurila i valori medii de 48,80 mm pe
19

cele recoltate de la aga (tabelul 2). Pe mediul SGA, diametrul minim de cretere, de 31,57 mm realizeaz coloniile nsmnate din apele de la Moti, iar diametrul maxim, de 38,11 mm, probele provenite de la Arini. II.2.2. Rezultate comparative privind dezvoltarea coloniilor de Saprolegnia pe mediile de cultur lichide Utilizarea mediilor de cultur lichide este necesar pentru a se obine cantiti mai mari de mas fungic utilizat pentru extracia de ADN. Acest experiment s-a efectuat pentru a putea observa i recomanda cea mai bun combinaie de transfer de la mediul solid la mediul lichid, prin aprecierea cantitii de mas fungic exprimat n cm3. Au fost urmrite i analizate 138 de probe, cte 69 probe pe fiecare combinaie de mediu. Observaiile zilnice efectuate de la ziua de transfer la ziua a aptea au evideniat un ritm de dezvoltare aproape dublu n cazul mediului lichid Potato Dextrose Broth (PDBbulion cu cartof-dextroz), comparativ cu probele din mediul lichid Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroz). n ziua a aptea, n toate paharele Erlenmeyer cu 100 ml, peletele de fungi din mediul lichid Potato Dextrose Broth (PDB-bulion cu cartofdextroz), aveau ntre 2,5 i 4 cm3, iar n cele cu mediul lichid Potato Dextrose Broth (PDBbulion cu cartof-dextroz) valori de 1-2 cm3 .

II.3. CARACTERIZAREA MORFOLOGIC A TULPINILOR DE SAPROLEGNIA Analiza microscopic evideniaz faptul c hifele au un aspect neseptat caracteristic fungilor inferiori. Nu au fost analizate lungimea i grosimea acestor hife, doar aspectul general de morfologie, care a confirmat prezena fungilor saprolegnieni n cultur, fr a fi efectuate diferenieri morfologice ntre genuri i specii. Observaiile microscopice pe o perioad de 21 de zile au evideniat la nivelul fiecrei probe prezena sau absena organelor de reproducie sexuat, i a celei asexuate. Putem afirma cu certitudine c n condiii de

20

laborator specifice metodologiei descrise de noi, la toate izolatele fungice a fost identificat prezena flagelilor pe zoosporii primari. n ceea ce privete dezvoltarea organelor de reproducie sexuat (anteridiile i oogoanele), se constat c exist diferene de la un bazin la altul i de la o locaie la alta. Aceast prezen sau absen a reproduciei sexuate o putem atribui n acest moment al cercetrii faptului c speciile existente n bazine sunt diferite, iar unele dintre ele nu realizeaz reproducia sexuat in vitro, fapt confirmat i de ali autori (Fregeneda Grandes, 2000; Dieguez Uribeondo, 2007). O analiz sintetic privind dezvoltarea organelor de reproducie sexuat la speciile de fungi din familia Saprolegniaceae analizate (69 probe), ne permite s afirmm c la un numr de 41 de izolate ceea ce reprezint procentual 59,42%, ele sunt prezente, putnd fi vizualizate microscopic. La 28 de probe, deci la 40,58%, prezena lor nu a putut fi vizualizat (tabelul 3). Tabelul 3 Sintez privind dezvoltarea organelor de reproducie la speciile de fungi din familia Saprolegniaceae analizate (69 probe) Reproducia sexuat Aspectul Reproducia hifelor asexuat (prezena flagelilor) Prezent Absent Nr. probe Procent (%) 59,42 Nr. probe Procent (%) 40,58% Nr. probe Procent (%) 100%

Neseptat

41

28

69

II.4. REZULTATE PRIVIND EXTRACIA I CUANTIFICAREA ADN-ULUI LA SAPROLEGNIA II.4.1. Extracia ADN Fiecare prob de material biologic a fost divizat, cele dou probe fiind supuse la cte o metod de extracie, pentru a se putea aprecia pertinent care din cele dou este mai eficient pentru acest tip de fungi sub aspectul cantitii de ADN i a puritii lui.

21

Rezultatele prelucrrii celor 69 probe extrase prin fiecare metod arat c puritile i cantitile de ADN redate de spectrofotomentrul Nanodrop ND 1000, variaz de la un bazin la altul ca i de la o metod la alta n cadrul aceluiai bazin. Astfel, puritile ADN redate de spectrofotomentru, n urma extraciei cu kit pe microcoloane (Qiagen), oscileaz ntre 1,02 - 1,51, cu o medie a puritii probelor de 1,250, la lungimea de und 260/280, iar cantitile de ADN obinute prin aceeai metod ntre 2,54 14,00 ng/l, cu o medie de 5,543 ng/l. Analiznd puritile ADN redate de spectrofotomentru, n urma extraciei cu soluie ce conine PBS, constatm c probele au valori cuprinse ntre 1,10 1,51, cu o medie de 1,394, la lungimea de und 260/280, iar cantitile de ADN obinute prin aceeai metod, ntre 5,23 ng/l i 86,56 ng/l, cu o medie de 30,653 ng/l.

II.5. REZULTATELE AMPLIFICRII ADN-ULUI LA SPECII DE FUNGI DIN FAMILIA SAPROLEGNIACEAE II.5.1. Amplificarea ADN prin PCR Reaciile de amplificare au fost efectuate individual, ntr-un volum final de 25 l, cu un termocycler Eppendorf. Menionm faptul c procesul de amplificare n faz preliminar a fost efectuat pe cte 20 probe, din care 10 provenite din extracia ADN-ului din fungi utiliznd kituri de extracie (QIAGEN) i 10 probe provenite din extracia ADN-ului din fungi utiliznd soluia PBS (tampon fosfat salin). Acest test a fost efectuat pentru a se urmri prin care din cele dou metode utilizate se realizeaz cea mai precis amplificare a ADNului, fr obinerea de produi nespecifici. Menionez faptul c al doilea protocol utilizat, descris n material i metod, nu a dat rezultatele scontate la fungi, motiv pentru care s-a renunat la el. Prezentm n continuare, n fig.3, rezultate comparative privind profilele electroforetice ale fragmentelor amplificate cu cele dou seturi de primeri.

22

Deoarece am utilizat n experimente extraciile ADN cu soluie PBS i kit QIAGEN i combinaia de primeri universali ITS1 i ITS4, ITS4 i ITS5, rezultatele electroforezei mau determinat s optez pentru extracia ADN cu kit (QIAGEN) i perecherea de primeri ITS1 i ITS4.

700pb-

Fig.3. Profilul electroforetic ale unei probe de ADN extras din Saprolegnia i amplificat cu perechile de primeri ITS1 i ITS4, ITS4 i ITS5 (original) 1-Ladder Low Range de 700 pb (Fermentas); 2-prob ADN extras cu kit (primeri ITS1-ITS 4); 3-prob ADN extras cu soluie PBS (primeri ITS1-ITS4); 4-prob ADN extras cu soluie NE (primeri ITS1-ITS4); 5-prob ADN purificat cu kit PCR (primeri ITS1-ITS4); 6-prob ADN purificat cu kit PCR (primeri ITS4-ITS5); 7-prob ADN extras cu soluie NE (primeri ITS4-ITS5); 8-prob ADN extras cu soluie PBS (primeri ITS4-ITS5); 9-prob ADN extras cu kit (primeri ITS4-ITS5) II.6. REZULTATELE RESTRICIEI ENZIMATICE A ADN-ULUI DE LA SPECII DE FUNGI DIN FAMILIA SAPROLEGNIACEAE PRIN METODA PCR-RFLP n cazul restriciei cu enzimele AluI i HindIII, aceasta nu s-a produs, enzimele nedigernd fragmentul de aproximativ 700 pb amplificat, nerecunoscnd situsul de restricie. Pentru acest considerent cea de-a treia enzim testat (RsaI), care a restricionat toate

23

probele testate a fost utilizat n continuare n analiza profilului electroforetic al celor 69 de probe, aparinnd bazinelor din cele 10 locaii. n continuare s-au efectuat profilele electroforetice ale analizelor de restricie cu enzima RsaI (Fermentas) a ADN amplificat cu perechile de primeri ITS1 i ITS4 la specii de fungi din familia Saprolegniaceae, pe fiecare bazin al fiecrei locaii. n cazul probelor de fungi din familia Saprolegniaceae, provenite din Complexului Piscicol Arini, judeul Maramure, cu 9 bazine, n probele provenite din bazinele 1,2,3,4,5,8 i 9, se remarc prezena a 3 fragmente de ADN bine evideniate, primul fragment fiind cuprins ntre 350 i 400 pb, al doilea fragment n jur de 200 pb, iar cel de-al treilea n jur de 150 pb. n probele din bazinele 6 i 7 se evideniaz 4 fragmente: primul este cuprins ntre 450 i 500 pb, aldoilea n jur de 300 pb, al treilea n jur de 200 pb, iar al patrulea la 150 pb. Aceste probe de ADN amplificate prezint un polimorfism de lungime al fragmentelor, fapt confirmat de analiza secvenierii. Astfel, n urma rezultatelor secvenierii s-au identificat dou specii de fungi acvatici, fiecare aparinnd la cte un alt gen din familia Saprolegniaceae. Profilele de ADN ilustrate n godeurile 2,3,4,5,6,9 i 10, aparin speciei Saprolegnia ferax, iar profilele polimorfice de ADN, prezente n godeurile 7 i 8, aparin speciei Achlya bisexualis. La probele de fungi din familia Saprolegniaceae, provenite din Complexul Piscicol Moti, judeul Slaj, n toate cele 7 bazine analizate se constat acelai profil electroforetic al produilor PCR, constituit din cte 3 fragmente vizibile. Primul fragment este de aproximativ 400 pb, al doilea fragment de 200 pb i al treilea de 150 pb. n probele analizate din aceast locaie nu se semnaleaz existena unor polimorfisme, toate fragmentele indicnd prezena unei singure specii de fungi, confirmat n urma secvenierii ca Saprolegnia ferax. La probele de fungi din familia Saprolegniaceae, din Complexul Piscicol Adrian, judeul Satu Mare, cu 10 bazine, n bazinele 1,2,3,4,6,7,8 i 10, semnalm prezena a 3 benzi de migrare, prima la aproximativ 380-400 pb, a doua band la 200 pb i a treia ntre 100 i 150 pb. n urma analizelor de secveniere, n bazinele respective s-a identificat specia Saprolegnia ferax. n bazinul 5 semnalm prezena a 2 benzi, din care banda 1 la aproximativ 450 pb, iar a doua band la 200 pb. n bazinul 9 pot fi observate clar 4
24

fragmente: primul la aproximativ 450 pb, al doilea la 250 pb, al treilea la 200 pb i al patrulea ntre 100 i 150 pb. n probele din godeurile 6 i 10 pot fi observate polimorfisme de lungime diferite fa de restul probelor de ADN fungic, confirmate prin secveniere ca aparinnd speciei Achlya bisexualis. La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicol aga, din judeul Cluj, sunt evideniate la fiecare din cele 5 bazine analizate cte 4 fragmente de restricie. Primul fragment este ntre 380-400 pb, al doilea fragment la 200 pb, al treilea fragment la 150 pb, iar al patrulea la aproximativ 100 pb. Profilele electroforetice ale probelor de ADN sunt asemntoare ca i lungime de perechi de baze. Datele secvenierii au relevat faptul c toate profilele electroforetice aparin speciei Saprolegnia ferax. La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicol Ciurila, judeul Cluj, cu 6 bazine, n bazinele 1,2,3,5 i 6 se constat 3 fragmente de ADN restrictate, din care primul fragment este de aproximativ 400 pb, al doilea la 200 pb, iar al treilea la 130-150 pb. n bazinul numrul 4, respectiv n godeul 5, sunt evideniate 4 fragmente de ADN, din care primul la 500 pb, al doilea la 250 pb, al treilea la 200 pb i al patrulea ntre 130-150 pb, ceea ce semnaleaz existena unui polimorfism, confirmat prin secveniere ca aparinnd speciei Achlya bisexualis. La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicol Chiochi, judeul Bistria-Nsud, cu 5 bazine, n bazinele 1,2,3 i 5, apar 3 fragmente cu urmtoarele mrimi: primul fragment ntre 400 i 500 pb, al doilea fragment ntre 200 i 250 pb, iar al treilea fragment ntre 150-200 pb. Aceste profile electroforetice, corelate cu datele secvenierii i confruntarea lor n GeneBank, au indicat prezena speciei Saprolegnia ferax. n bazinul 4, cele 3 fragmente au lungimi diferite, astfel: primul fragment de 500 pb, al doilea de aproximativ 250 pb, iar al treilea de 150-200 pb. n urma analizei lungimii fragmentelor de amplificare prin electroforez, n bazinul 4, se evideniaz un polimorfism diferit fa de al celorlalte probe de ADN de la fungi, care pune n eviden prezena unei alte specii, confirmat ca Achlya bisexualis. La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicol Daia, judeul Alba, cu 5 bazine, n bazinele 1,2,3,4 se remarc prezena a 3 benzi de restricie, din
25

care prima band este la 400 pb, a doua band la 200 pb, iar a treia la 130-150 pb, n urma secvenierii identificndu-se specia de fungi acvatici Saprolegnia ferax. Se observ un polimorfism al lungimii fragmentelor la probele de fungi provenite din bazinul 5, confirmat ca aparinnd speciei Achlya bisexualis. Primul fragment este de 500 pb, al doilea de aproximativ 200 pb. Al treilea fragment este slab vizibil. La probele de fungi din familia Saprolegniaceae, din Ferma Piscicol Iernut, judeul Mure, cu 5 bazine, se observ aceleai lungimi ale fragmentelor n bazinele 1,2,3 i 5. Primul fragment este de 400 pb, al doilea fragment de 200 pb, iar al treilea de 130-150 pb. Profilele electroforetice aparin speciei Saprolegnia ferax, secveniat ulterior. n bazinul 4, lungimea fragmentelor difer astfel: primul fragment este de 500 pb, al doilea de aproximativ 210-220 pb, iar al treilea de 150 pb, fiind vorba de un polimorfism, respectiv de o alt specie de fungi (Achlya bisexualis). n cazul probelor de fungi din familia Saprolegniaceae, provenite din Complexul Piscicol Cefa, judeul Bihor, cu 10 bazine, n bazinele 1,2,4,5,6,7 i 9, cele 3 fragmente au urmtoarele lungimi: primul fragment este de 400 pb, al doilea de 200 pb, iar al treilea ntre 130 i 150 pb. Aceste polimorfisme aparin speciei Saprolegnia ferax. n bazinele 3, 8 i 10, fragmentele sunt de mrimi diferite, confirmnd n urma secvenierii specia Achlya bisexualis. Primul fragment se vizualizeaz mai clar, fiind la aproximativ 450 pb. La probele provenite din bazinele 8 i 10, se observ prezena unui fragment n plus, al doilea, de 250 pb, al treilea de 200 pb i al patrulea de aproximativ 130 pb sunt la aceeai lungime cu al doilea i al treilea fragment de la probele provenite din celelalte bazine. La Ferma Piscicol Ineu, judeul Arad, fragmentele tuturor probelor de fungi din familia Saprolegniaceae, din cele 7 bazine analizate au prezentat aceleai mrimi: primul de 400 pb, al doilea de 200 pb i al treilea ntre 130 i 150 pb. Analizele ulterioare de secveniere au confirmat prezena speciei Saprolegnia ferax, n bazinele din locaia studiat.

26

II.7. REZULTATE PRIVIND STUDIUL NRUDIRII GENETICE A FUNGILOR DIN FAMILIA SAPROLEGNIACEAE
Tree Diagram for 12 Variables Single Linkage Euclidean distances Var1 Var7 Var3 Var6 Var2 Var8 Var10 Var11 Var4 Var9 Var5 Var12 0 10 20 30 Linkage Distance 40 50 60

Fig.4. Analiza de filogenie a celor 69 de probe de ADN de la fungi din familia Saprolegniaceae, provenite din 10 locaii Varianta 1: Arini, cu probele din bazinele 1-5, 8,9; Moti, cu probele din cele 7 bazine; Varianta 2: Arini, cu probele din bazinele 6 i 7; Varianta 3: Adrian, cu probele din bazinele 14, 6-8, 10; Varianta 4: Adrian, cu probele din bazinul 5; Varianta 5:Adrian, cu probele din bazinul 9; Varianta 6: aga, cu probele din toate cele 5 bazine; Varianta 7: Ciurila, cu probele din bazinele 1-3, 5-6; Daia, cu probele din bazinele 1-4; Iernut, cu probele din bazinele 1-3, 5; Cefa, cu probele din bazinele 1-2, 4-7, 9; Ineu, cu probele din toate cele 7 bazine; Varianta 8: Ciurila, cu probele din bazinul 4; Varianta 9: Chiochi, cu probele din bazinele 1-3 i 5; Varianta 10: Chiochi, cu probele din bazinul 4; Varianta 11: Iernut, cu probele din bazinul 4; Daia, cu probele din bazinul 5; Varianta 12: Cefa, cu probele din bazinele 8 i 10.

27

Interpretarea dendrogramei efectuate n urma citirii lungimilor fragmentelor de ADN din toate cele 69 de bazine analizate ne permite s afirmm urmtoartele aspecte privind filiaia fungilor din familia Saprolegniaceae identificai (fig.4). Toate tipurile de fungi identificate au origine ancestral comun, prima ruptur de speciaie realizndu-se la varietatea ancestral, la o distan de linkage de 58 cM (centiMorgani). Una din speciaii a evoluat o lung perioad de timp, ntr-o parte a bazinelor analizate, cnd din cauza unei mutaii punctiforme, localizat la o distan de 20 cM au aprut alte dou speciaii. Una din acestea evolueaz si n prezent, fiind localizat n bazinele 1-5, 8,9 din locaia Arini, cele 7 bazine de la locaia Moti (var.1), bazinele 1-3, 5-6 din Ciurila, bazinele 1-4 din Daia, bazinele 1-3 i 5 din Iernut, bazinele 1-2, 4-7 i 9 de la Cefa i toate cele 7 bazine din locaie Ineu (var.7). Cealalt speciaie care a evoluat n urma mutaiei punctiforme, de la nivelul de 20 cM a evoluat o perioad de timp, dup care n urma altei mutaii punctiforme, la distana de linkage de 10 cM a generat alte dou speciaii. Una dintre ele (var.3) evolueaz i a fost identificat n prezent n bazinele 1-4, 6-8 i 10 n locaia Adrian i n toate cele 5 bazine din locaia aga (var.6). Cea de-a doua ramur care s-a desprins din forma ancestral, la distana de 58 cM a evoluat n timp pn cnd o mutaie punctiform a determinat crearea a dou noi speciaii, la distana de linkage de 42 cM. Una din ramuri a evoluat o perioad scurt de timp, cnd la o distan de linkage de 35 cM, a realizat o mutaie punctiform care a determinat crearea a dou noi speciaii. Una a fost identificat n bazinele 6 i 7 din locaia Arini (var.2). Cealalt speciaie, n urma unei alte mutaii punctiforme, la o distan de 30 cM a determinat evoluia a dou uniti taxonomice identificate azi. Una din ele evolueaz i este foarte activ n bazinul 4 din localitatea Ciurila (var.8) i bazinul 4 din localitatea Chiochi (var.10). Cealalt ramur desprins este identificat i activeaz n bazinul 4 din localitatea Iernut i bazinul 5 din Daia (var.11). Cea de-a doua ramur desprins la distana de linkage de 42 cM a evoluat o lung perioad de timp ntr-o parte a bazinelor analizate, dup care, la distana de 10 cM, n urma unei alte mutaii, au rezultat 3 speciaii, din care dou apropiate genetic (var.4 i 9), identificate n bazinul 4 din locaia Adrian i bazinele 1-3 i 5 din Chiochi. La o distan
28

mai mare genetic, indivizii desprini din aceeai ramur evolueaz n bazinul 9 din ferma Adrian (var.5) i cei din bazinele 8 i 10, localitatea Cefa (var.12).

II.8. REZULTATELE SECVENIERII SPECIILOR DE FUNGI DIN FAMILIA SAPROLEGNIACEAE N LOCAIILE STUDIATE n urma secvenierii automate cu secveniatorul ABI Prism, efectuate la Mycrosinth (Elveia), au fost identificate dou specii de fungi acvatici n bazinele studiate, reprezentate de Saprolegnia ferax i Achlya bisexualis. n cazul secvenierii speciei Saprolegnia ferax, fragmentul secveniat cu primerii ITS1 (forward) i ITS4 (reverse) are o lungime de 743 de perechi de baze, o identitate de 99% i prezint dou mutaii punctiforme fa de specia matri din GeneBank. La poziia 31, se observ o deleie a unei nucleotide C, ntre nucleotidele AC i la poziia 368, se remarc o substituie A cu C. n cazul secvenierii speciei Achlya bisexualis, fragmentul secveniat cu primerii ITS1 (forward) i ITS4 (reverse) are o lungime de 761 de perechi de baze, o identitate de 99% i prezint 7 mutaii punctiforme fa de specia matri din GeneBank. La poziia 112, se observ o substituie ntre nucleotidele C cu T; la poziia 119, se remarc o substituie G cu A; la poziia 194, o substituie T cu G; la poziiile 370 i 371, dou substituii C cu A; la poziia 416, o substituie A cu T i la poziia 633 o substituie A cu G. II.9. INCIDENA SAPROLEGNIOZEI N AREALUL STUDIAT DIN CENTRUL I NORD-VESTUL ROMNIEI Aa cum s-a artat la nceputul acestei teze, saprolegnioza este considerat ucigaul tcut al speciilor piscicole, boala producnd pierderi extrem de importante n toate cresctoriile piscicole, ndeosebi la cele ciprinicole. Saprolegnioza constituie una din cele mai importante cauze ale pierderilor economice din acvacultur, infeciile cu fungi secondnd doar bolile bacteriene ca importan economic. Infeciile bacteriene sunt n general cronice, provocnd pierderi constante. n Japonia rata anual de mortalitate la somonul Coho (Oncorhynchus kisuth) cauzat de

29

Saprolegnia parasitica Coker este de 50%. Acelai procent se nregistreaz i la anghil (Anguilla anguilla), tot n Japonia. n Scoia, saprolegnioza provoac pierderi economice importante ndeosebi n cresctoriile de somoni. n sudul Statelor Unite ale Americii pierderile nregistrate la somn au fost de 50%, iar pierderea economic de 40 milioane de dolari. n fiecare an cresctorii de somn din S.U.A. nregistrez pierderi mai mari de 25 milioane de dolari din cauza bolilor acvatice, conform statisticilor. n Europa procentul de pierderi la populaiile de ciprinide, n zonele n care pe lng factorii predispozani reprezentai de suprapopulare, manipularea defectuas a petilor, stresul de reproducie determinat de excesul hormonilor corticosteroizi, infeciile asociate (Jeney i col., 1995), se suprapun i factorii de poluare a apei i aerului, procentul de mortalitate mediu la aduli depete 25%. Pierderi ntre 50 i 100% la icre i de 14 pn la 30% la larve i alevini, ntre 10 i 15% la tineret semnaleaz mai muli autori (Horvath i col., 2005). Raportndu-ne la situaia pe plan mondial i european, constatm c n arealul cuprins n cercetare evideniaz i n cazul nostru pierderi nsemnate determinate de saprolegnioz (tabelul 4).

Tabelul 4 Procentul de pierderi determinate de saprolegnioz n locaiile studiate la ciprinide (%)

Locaia Icre n perioada de incubaie Larve Alevini Tineret Aduli

Iarna Arini Moti Adrian aga Ciurila Chiochi Daia Iernut Cefa Ineu Media pe total locaii 70 40 58 60 30 30 25 50 20 28 41,1 30 20 25 28 10 12 15 25 5 7 16,7 5 7 10 10 5 10 5 13 5 6 7,6 3 5 5 8 5 5 3 10 2 3 4,9 4 3 8 9 7 10 5 10 3 4 6,3

Primvara 5 2 6 5 5 6 3 7 4 3 4,6

Vara 5 3 6 4 4 5 3 5 4 4 4,3

Toamna 3 3 5 4 3 4 3 5 4 3 4,1

30

Menionm faptul c n toate bazinele piscicole analizate se procedeaz la dezinfecia anual a bazinelor n care se practic reproducia natural dirijat, prin golirea i meninerea lor uscat pe perioada de iarn. nainte de umplere bazinele sunt dezinfectate cu var nestins pe toat suprafaa lor. Cu toate acestea, prin modul de manipulare al reproductorilor i prin explozia de tipuri de vegetaie, n perioada de reproducie se semnaleaz atacuri masive de fungi patogeni asupra icrelor, cu pierderi procentuale de pn la 70% n locaia Arini, iar acolo unde msurile de igien sunt extrem de severe, pierderile se ridic la 20% din icre (locaia Cefa). n medie, pe cele 69 bazine din cele 10 locaii luate n studiu, pierderile de icre de ciprinide se ridic la 41,10%. Perioada larvar, mai ales cea cuprins n primele 3 zile de via, cnd deplasarea lor este limitat de prezena sacului vitelin, pierderile medii semnalate pe arealul studiat se ridic la 16,70%, cu un maxim de pierderi de 30% n Complexul Piscicol Arini, i un minim de 5% n locaia Cefa. Perioada de alevini, extrem de pretenioas ca nivel a oxigenului din ap i a calitii hranei, este puternic afectat de saprolegnioz. Pierderile medii sunt ceva mai reduse fa de perioada larvar, fiind de 7,60%. Cel mai mare procent de pierderi la aceast categorie, de 13% se semnaleaz n locaia Iernut, i un minim de 5% n locaiile Arini, Ciurila, Daia, Cefa. Pe perioada de tineret, creia i se acord o deosebit atenie, n ceea ce privete calitatea apei i a furajului, cnd se asigur o densitate optim de indivizi i cnd manipulrile sunt interzise, pierderile determinate de saprolegnioz sunt mult mai reduse, n medie n arealul studiat fiind de 4,90%. Perioada de adult nu este ferit de atacul cu Saprolegnia. n majoritatea pescriilor luate n studiu se practic pescuitul de toamn i mutarea petilor reinui pentru anul urmtor n bazinele de iernare. Operaiunea de prindere, transport i repopulare n alt bazin produc inerente rniri la nivelul cutanat i al nottoarelor. Pe perioada de iernare petii nu consum furaj, organismul fiind uor slbit i pe acest fond, sub influena schimbrilor brute de temperatur i a stratului de ghea, pierderile sunt n medie de 6,30%. n perioada de primvar, att reproductorii, ct i petii reinui pentru cretere sunt verificai privind starea lor de ntreinere i sntate, prin pescuit de control cu plase. Manipularea produce rniri, care duc la creterea incidenei saprolegniozei, n medie pierderile semnalate n areal
31

fiind de 4,60%. Sfritul primverii i nceputul verii coincide la ciprinide cu perioada de reproducie, cnd manipularea reproductorilor, ca i stresul dat de hormonii corticosteroizi determin la exemplarele slbite i n asociere cu alte boli apariia saprolegniozei. Procentul mediu de pierderi pe toate cele 69 de bazine studiate este de 4,30%. Un procent mai redus, de 4,10% se nregistreaz pe perioada de toamn, cnd toate efectivele de peti prezint n general o foarte bun stare de ntreinere, fiind pregtii de iernare.

32

CAPITOLUL III CONCLUZII I RECOMANDRI

1. Prezena Saprolegniei n ap, dovedit prin infestarea icrelor, este semnalat indiferent de luna de recoltare a apei. 2. Cel mai mare grad de infestare al icrelor de ciprinide cu Saprolegnia s-a semnalat la temperatura apei de 22C, cnd procentul de infestare mediu i puternic atinge 85,41%, indiferent de lunile calendaristice n care se preleveaz probele. 3. Indiferent de mediul de cultur solid utilizat (PDA i SGA) i timpul de citire (24, 48 i 72 ore) se semnaleaz diferene de la un bazin la altul i de la o locaie la alta a coloniilor de Saprolegnia analizate. 4. Dezvoltarea coloniilor de Saprolegnia n mediul lichid Potato Dextrose Broth (PDBbulion cu cartof-dextroz) este superioar celei realizate n mediul lichid Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroz). 5. Caracterizarea morfologic a tulpinilor de Saprolegnia din coloniile obinute, evideniaz hife cu aspect neseptat specifice fungilor inferiori, fiind semnalate diferene privind prezena reproduciei sexuate (la 59,42%) i absena acesteia (la 40,58%). 6. La toate izolatele de Saprolegnia a fost identificat prezena flagelilor la zoosporii primari. 7. Puritile ADN redate de spectrofotomentrul Nanodrop ND 1000 n urma extraciei cu kit pe microcoloane (Qiagen), oscileaz ntre 1,02 - 1,51, cu o medie a puritii probelor de 1,250, la lungimea de und 260/280 nm, iar cantitile de ADN obinute prin aceeai metod ntre 2,54 14,00 ng/l, cu o medie de 5,543 ng/l, iar puritile ADN redate de spectrofotomentru, n urma extraciei cu soluie ce conine PBS, au valori cuprinse ntre 1,10 1,51, cu o medie de 1,394 la lungimea de und 260/280 nm, iar cantitile de ADN obinute prin aceeai metod ntre 5,23 86,56 ng/l, cu o medie de 30,653 ng/l.

33

8. n cazul probelor ADN extrase cu kit QIAGEN, n toate cazurile s-a produs amplificarea cu ambele perechi de primeri utilizate, cu evidenierea fragmentelor de 743 pb la Saprolegnia ferax, respectiv 761 pb la Achlya bisexualis. 9. n cazul probelor ADN extrase cu soluii PBS, cu toate c puritile i cantitile de ADN au fost n limite normale, amplificarea probelor de ADN provenite de la Saprolegnia cu cele dou perechi de primeri s-a produs diferit, din cauza prezenei n probe a unor posibili inhibitori fungici, care nu permit ataarea perechii de primeri ITS1 i ITS4, iar n cazul utilizrii unui kit de purificare PCR, amplificarea s-a produs. 10. n cazul probelor extrase cu soluii NE, cu toate c puritile i cantitile de ADN au fost n limite normale, amplificarea probelor de ADN provenite de la Saprolegnia cu cele dou perechi de primeri nu s-a produs. 11. Enzima RsaI are specificitate foarte bun pentru situsurile de restricie de la Saprolegnia i Achlya, motiv pentru care s-a optat pentru utilizarea acesteia n toate restriciile de fragmente efectuate. 12. Enzimele AluI i HindIII testate de noi n experiment nu au specificitate pentru situsul de restricie de la probele provenite de la Saprolegnia i Achlya, acestea nerealiznd restricia fragmentelor de ADN. 13. n cazul celor 10 locaii piscicole analizate i n cele 69 de probe recoltate, se semnaleaz prezena a dou polimorfisme de lungime a ADN-ului, n gelurile analizate. 14. Studiul arborelui filogenetic, pe baza distanelor de linkage i a celor Euclidiene ne permite s afirmm faptul c n locaiile i bazinele studiate exist diferite genuri din familia Saprolegniaceae, care manifest patogenitate diferit fa de speciile de ciprinide. 15. n urma secvenierii ADN au fost identificate dou specii de fungi acvatici n bazinele studiate, reprezentate de Saprolegnia ferax (743 pb, o identitate de 99% i prezint dou mutaii punctiforme fa de specia matri din GeneBank) i Achlya

34

bisexualis (761 pb, o identitate de 99% i prezint 7 mutaii punctiforme fa de specia matri din GeneBank). 16. Cele mai mari pierderi determinate de speciile identificate de noi (Saprolegnia ferax i Achlya bisexualis), la speciile de ciprinide din Romnia, sunt semnalate n perioada de reproducie, cnd procentul de pierderi mediu al icrelor este de 41,10%, iar n perioada larvar, cu pierderi medii de 16,70%. 17. Speciile identificate produc pierderi n bazinele de cretere ale ciprinidelor din Romnia, i la categoriile de tineret (4,90%) i adult (cu o medie de 6,30% pe perioada de iernare, 4,60% primvara, 4,30% vara i 4,10% toamna). 18. Pierderile semnalate din cauza saprolegniozei variaz de la un sezon la altul, de la o cresctorie la alta n funcie de condiiile fizico-chimice i biologice ale apei, de acurateea tehnologiei de cretere aplicate i de condiiile meteorologice generale.

Pe baza rezultatelor obinute recomandm:

1. Recomandm ca pentru analiza prezenei Saprolegniei n bazinele piscicole, probele de ap s fie prelevate din 4 laturi i centrul bazinului, la adncimea de aproximativ 50 cm. 2. Pentru creterea diferitelor tulpini de Saprolegnia se preteaz mediile solide (PDA i SGA), dar prin timpul de cretere mai rapid al coloniilor recomandm mediul PDA. 3. ntruct n analiza de ADN sunt necesare cantiti mai mari de fungi i innd cont de modul de dezvoltare a Saprolegniei n cele dou medii lichide, recomandm utilizarea mediului lichid Potato Dextrose Broth (PDB-bulion cu cartof-dextroz) n experimentele pe speciile genului. 4. Recomandm extracia ADN-ului fungic cu kituri (QIAGEN) i neutilizarea extraciei cu soluii (PBS i NE), care cu toate c realizeaz puriti i cantiti de ADN n limite normale, realizeaz parial sau nu realizeaz amplificarea probelor de ADN provenite de la Saprolegnia.

35

5. n cercetrile pe fungi acvatici recomandm utilizarea enzimei RsaI, care are o specificitate foarte bun pentru situsurile de restricie de la Saprolegnia i Achlya, i neutilizarea enzimelor AluI i HindIII, care nu au specificitate pentru situsul de restricie. 6. Pentru caracterizarea genetic a fungilor acvatici din familia Saprolegniaceae, recomandm utilizarea metodei PCR-RFLP descris de Ristaino i col., 1998, adaptat de noi. 7. Pentru identificarea precis a genurilor i speciilor din familia Saprolegniaceae, recomandm utilizarea secvenierii ADN i compararea rezultatelor cu cele din GeneBank. 8. Pentru evitarea pierderilor datorate saprolegniozei, n bazinele de ciprinide din centrul i nord-vestul Romniei, recomandm o deosebit vigilen a cresctorilor concretizat n: controlul permanent al calitii apei, controlul tipurilor de vegetaie existent n bazine, evitarea traumatizrii petilor prin manipulri, evitarea stresului prin oscilaiile nivelului apei, ca i a tipului de furaj utilizat.

36

BIBLIOGRAFIE SELECTIV
1. Colao Maria Chiara, 1999, Proprieta cinetiche e molecolari di laccasi fungine, Universita degli Studi della Tuscia, Viterbo, 99 pg.; 2. Coier Viorica, 2007, Inginerie genetic, Ed. Risoprint, Cluj-Napoca; 3. Dick, M.W., 1969, Morphology and taxonomy of the Oomycetes, with special reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. I. Sexual reproduction, New Phytol., 68, 751775; 4. Dick, M.W., 1972, Morphology and taxonomy of the Oomycetes, with special reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. II. Cytogenetic systems, New Phytol., 71, 11511159; 5. Dieguez-Uribeondo, J., Fregeneda-Grandes, J.M., Cerenius, L., Elena PerezIniesta, Aller-Gancedo, J.M., Teresa M. Telleri, Soderhall, K., Maria P. Martin, 2007, Re-evaluation of the enigmatic species complex Saprolegnia diclina Saprolegnia parasitica based on morphological, physiological and molecular data, Fungal Genetics and Biology, 44, 585601; 6. Fernandez-Benitez Maria Jose, Ortiz-Santaliestra, M.E., Lizana, M., DieguezUribeondo, J., 2008, Saprolegnia diclina: another species responsible for the emergent diseaseSaprolegnia infections in amphibians, FEMS Microbiol. Lett., 279, 2329; 7. Francesconi, A., Kasai, M., Susan M. Harrington, Mara G. Beveridge, Ruta Petraitiene, Petraitis, V., Schaufele, R. L., Walsh, T J., 2008, Automated and manual methods of DNA extraction for Aspergillus fumigatus and Rhizopus oryzae analyzed by Quantitative Real-Time PCR, Journal of Clinical Microbiology, 46:6, 19781984; 8. Fregeneda Grandes, J.M., Fernandez Diez, M., Aller Gancedo, J.M., 2000, Ultrastructural analysis of Saprolegnia secondary zoospore cyst ornamentation from infected wild brown trout, Salmo trutta L., and river water indicates two distinct morphotypes amongst long-spined isolates, Journal of Fish Diseases, 23, 147160;

37

9. Frisvad, J.C., Bridge, P.D., Arora, D.K., 1998, Chemical fungal taxonomy, Marcel Dekker Inc., New York, 398 pg.; 10. Heath, I.B., Karen Rethoret, 1981, Nuclear cycle of Saprolegnia ferax, J. Cell Set., 49, 353-367; 11. Johnson Jr., T.W., Seymour, R.L., Padgett, D.E., 2002, Biology and systematics of the Saprolegniaceae, on-line publication: http://www.ilumina-dlib.org., 1028 pg.; 12. Kamoun Sophien, 2003, Molecular genetics of pathogenic oomycetes, Eukaryotic Cell, 2:2, 191199; 13. Lategan, M.J., Gibson, L.F., 2003, Antagonistic activity of Aeromonas media strain A199 against Saprolegnia sp., an opportunistic pathogen of the eel, Anguilla australis Richardson, Journal of Fish Diseases, 26, 147-153; 14. Lategan, M.J., Torpy, F.R., Gibson, L.F., 2004, Biocontrol of saprolegniosis in silver perch Bidyanus bidyanus (Mitchell) by Aeromonas media strain A199, Aquaculture, 235, 77-88; 15. Leclerc, M.C., Guillot, J., Devilla, M., 2000, Taxonomic and phylogenetic analysis of Saprolegniaceae (Oomycetes) inferred from LSU rDNA and ITS sequence comparisons, Antonie van Leeuwenhoek, 77, 369377; 16. Llanos Frutos, R., M. Teresa Fernndez-Espinar, Querol, A., 2004, Identification of species of the genus Candida by analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers, Antonie van Leeuwenhoek, 85, 175185; 17. Oroian, R.G., Oroian, T.E., Crina Teodora Carai, Viorica Coier, L. Sasca, 2009, RAPD technique used in analyzing the genetic structure of Cyprinus carpio species Galitian and Lausitz varieties, International symposium Modern animal husbandry-science, creativity and innovation, Lucrri tiinifice seria Zootehnie, USAMV Iai, cotaie CNCSIS B+, 52:14, 444-449; 18. Oroian, R.G., Vlaic, A., Oroian, T.E., 2008, PCR technique used in Saprolegnia sp. genetical characterization, Lucrri tiinifice - Universitatea de tiinte Agricole i Medicin Veterinar Iai, Seria Zootehnie, vol. 51, 631-634;

38

19. Oroian, T.E., 2006, Selecia asistat de markeri la crap, Ed. Risoprint, Cluj-Napoca, 180 pg.; 20. Oroian, T.E., Oroian, R.G., Cristina Hegedu, Cighi, V., Dronca, D., 2009, The monitoring of phytoplankton evolution by biological year within Arinis-Maramures fishery complex, International symposium Modern animal husbandry-science, creativity and innovation, Lucrri tiinifice seria Zootehnie, USAMV Iai, cotaie CNCSIS B+, 52:14, 456-461; 21. Paul, B., Monica M. Steciow, 2004, Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France, FEMS Microbiology Letters, 237, 393398; 22. Ristaino, J.B., Madritch, M., Trout, C.L., Parra, G., 1998, PCR amplification of ribosomal DNA for species identification in the plant pathogen genus Phytophthora, Applied and Environmental Microbiology, 64:3, 948-954; 23. Stueland, S., Hatai, K., Skaar, I., 2005, Morphological and physiological characteristics of Saprolegnia spp. strains pathogenic to Atlantic salmon, Salmo salar L., Journal of Fish Diseases, 28, 445-453; 24. Vlaic, A., 2007, Genetica petilor, Ed. Risoprint, Cluj-Napoca, 150 pg.; 25. White, P.L., Barton, R., Guiver, M., Linton, C.J., Wilson, S., Smith, M., Beatriz L. Gomez, Carr, M.J., Kimmitt, P.T., Shila Seaton, Rajakumar, K., Tessa Holyoake, Chris C. Kibbler, Elizabeth Johnson, Hobson, R.P., Jones, B., Rosemary A. Barnes, 2006, A consensus on fungal Polymerase Chain Reaction diagnosis, Journal of Molecular Diagnostics, 8:3, 376-384; 26. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990, Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand, D.H., Sninsky, J., White, T.J. (Eds) PCR protocols (pg 315322), Academic Press, San Diego; 27. *** http://www.fermentas.com 28. *** http://www.ncbi.nlm.nih.gov 29. *** http://www.qiagen.com
39

30. *** http://www.sigmaaldrich.com 31. *** http://www.tnfish.org/FishDiseasesParasites_TWRA/files/Saprolegnia.pdf

40

UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE CLUJ-NAPOCA DOCTORAL SCHOOL FACULTY OF ANIMAL PRODUCTION AND BIOTECHNOLOGIES

Vet. Oroian Rare Gelu

The genotypization of Saprolegnia species and the establishing of their pathogenicity upon different carp species from centern and north-western Romanian fisheries
-SUMMARY OF THE PhD. THESIS-

SCIENTIFIC COORDINATOR Prof.univ.dr.eng. AUGUSTIN VLAIC

Cluj-Napoca
41

2010
CONTENTS
CHAPTER I ........................................................................................................................................... 4 EXPERIMENTAL HYPOTHESIS, RESEARCH OBJECTIVES, EXPERIMENTAL DISPOSAL, MATERIAL AND METHOD........................................................... 4 I.1. EXPERIMENTAL HYPOTHESIS AND RESEARCH OBJECTIVES ..................................... 4 I.2. EXPERIMENTAL DISPOSAL................................................................................................... 5 I.3. MATERIAL AND METHOD ..................................................................................................... 7 I.3.1. Sample collecting.................................................................................................................. 7 I.3.2. The initiation of Saprolegnia culture in laboratory conditions............................................. 7 I.3.3. Culture media used ............................................................................................................... 8 I.3.3.1. Solid culture media used in the experiment ................................................................... 9 I.3.3.2. Liquid culture media used in the experiment ............................................................... 50 I.3.3.3. Antibiotics used in the experiment ............................................................................... 51 I.3.4. Morphological characterization of Saprolegnia strains ...................................................... 51 I.3.5. Fungal DNA extraction and detection ................................................................................ 52 I.3.5.1. Fungal DNA extraction using extraction kits (QIAGEN) ............................................ 52 I.3.5.2. Fungal DNA extraction using solutions....................................................................... 52 I.3.6. DNA quantification using direct method of DNA purity and concentration with Nanodrop ND-1000 spectrophotometer ....................................................................................... 53 I.3.7. ITS region from fungi and primers used............................................................................. 53 I.3.8. Molecular techniques used in the experiment..................................................................... 55 I.3.8.1. PCR amplification of Saprolegnia samples ................................................................. 55 I.3.8.2. PCR-RFLP techique - Restriction Fragment Length Polymorphism .......................... 56 I.3.9. Methods used in establishing the phylogenetic diversity and relationship of Saprolegniaceae family fungi species........................................................... 56 I.3.9.1. Automatic sequencing .................................................................................................. 56 CHAPTER II ........................................................................................................................................ 56 PERSONAL RESEARCH RESULTS ................................................................................................. 56 II.1. THE RESULTS OF SAPROLEGNIA CULTURE IN LABORATORY CONDITIONS ..................................................................................................... 57 II.2. RESULTS REGARDING SAPROLEGNIAS GROWTH AND DEVELOPMENT ON THE CULTURE MEDIA ........................................................................... 58 II.2.1. Comparative results regarding the growth of Saprolegnia colonies on solid culture media ........................................................................... 58 II.2.2. Comparative results regarding the development of Saprolegnia colonies on the liquid culture media.................................................................... 19 II.3. THE MORPHOLOGICAL DESCRIPTION OF SAPROLEGNIA STRAINS......................... 19 II.4. RESULTS REGARDING SAPROLEGNIAS DNA EXTRACTION AND QUANTIFICATION.................................................................................... 61 II.4.1. DNA extraction.................................................................................................................. 61 II.5. THE DNA AMPLIFICATION RESULTS OF FUNGAL SPECIES FROM SAPROLEGNIACEAE FAMILY ......................................................................................... 62 II.5.1. DNA amplification using PCR .......................................................................................... 62 II.6. THE DNA ENZYMATIC RESTRICTION RESULTS OF FUNGAL 42

SPECIES FROM SAPROLEGNIACEAE FAMILY USING PCR-RFLP METHOD...................... 63 II.7. RESULTS REGARDING THE GENETIC PHYLOGENY STUDY OF SAPROLEGNIACEAE FAMILY FUNGI.................................................................... 67 II.8. SEQUENCING RESULTS OF THE SAPROLEGNIACEAE FAMILY FUNGAL SPECIES FROM THE STUDIED LOCATIONS .......................................................... 28 II.9. THE INCIDENCE OF SAPROLEGNIASIS IN THE CENTRAL AND NORTH-WESTERN ROMANIAN AREAL......................................................................... 28 CHAPTER III....................................................................................................................................... 72 CONCLUSIONS AND RECOMMENDATIONS............................................................................... 72 SELECTIVE BIBLIOGRAPHY.......................................................................................................... 76

43

INTRODUCTION
Saprolegniasis is one of the most important causes of economic losses in aquaculture, fungal infections are second only to bacterial diseases in economic importance. Fungal infections are generally restricted to chronic, steady losses. Saprolegnia infests a large number of teleosts, as: channel catfish, pike, bass, roach, carp, salmonids, sturgeon, barramundi, tilapia; being associated with tropical fish: gourami, guppy, platyfish. In Japan, there is an annual mortality rate of 50% in coho salmon (Oncorhynchus kisutch) due to Saprolegnia parasitica Coker. Fifty percent per year losses have also been reported in elver (Anguilla anguilla) culture in Japan. In Scotland, saprolegniasis causes important economic losses especially in salmon fisheries. In the southeastern of United States, major losses of 50% occur in channel catfish farming, and the economic loss of 40 million dollars. In Romania, until now, there is not a scientific estimation of the fisheries losses due to saprolegniasis.

CHAPTER I EXPERIMENTAL HYPOTHESIS, RESEARCH OBJECTIVES, EXPERIMENTAL DISPOSAL, MATERIAL AND METHOD
I.1. EXPERIMENTAL HYPOTHESIS AND RESEARCH OBJECTIVES The bibliographic study on fish saprolegniasis in general, and particularly on carp species, indicates the fact that in the world, because of the differences generated by the diversity of water and soil types, by the medium annual temperatures, by the habitation degree and by the existent fish species, the disease is generated by many species of Saprolegnia, which have different specificity and pathogenicity, depending on the factors listed above.

44

The specific literature presents updated preoccupations regarding the identificationd and classification of different Saprolegnia species and subspecies, saprophytic and conditioned pathogenic at different fish species. This fact indicates that there is not sufficient the strain morphologic strict identification, but there is needed a molecular additional characterization regarding DNA structure, which could permit a correct identification and the establishing of genetic distances between Saprolegnia populations and subpopulations. This fact is necessary because the technological losses in fish industry, raported at international and national level, caused by saprolegniasis, which are affecting the fish development from spawn, larva, alevin, young fish and adults, are reaching up to 50% from production, which has a negative impact on the fisheries economical and financial situation. Starting from those considerations, by the research hypothesis we proposed the morphologic and molecular identification and description, using DNA samples, of Saprolegnia species and subspecies, which are affecting carp species populations from centern and north-western romanian fisheries. In Romania there havent been made any genetic studies on Saprolegnia species and subspecies, which affect carp species, and which could be the starting point in the future for DNA vaccination technology, at reproduction individuals. The study of Saprolegnia local isolates will have an obvious contribution at the development of the disease control strategies. The research objectives were the following: 1. The establishing of experimental plan and protocole; 2. The optimization of Saprolegnia culture methods; 3. The optimization of Saprolegnia DNA extraction and amplification methods; 4. The testing of different restriction enzymes using PCR-RFLP technique; 5. The establishing of genetic distances between identified species from Saprolegniaceae family; 6. The monitor of saprolegniasis incidence at carp species from centern and northwestern part of Romania.

45

I.2. EXPERIMENTAL DISPOSAL The experimental disposal was placed in the centern and north-western part of Romania, including in the control, fishponds localized as it follows: Arini Fishery Complex, Maramure county, with 9 fishponds; Moti Fishery Complex, Slaj county, with 7 fishponds; Adrian Fishery Complex, Satu Mare county, with 10 fishponds; aga Fishery, Cluj county, with 5 fishponds; Ciurila Fishery, Cluj county, with 6 fishponds; Chiochi Fishery, Bistria-Nsud county, with 5 fishpons; Daia Fishery, Alba county, with 5 fishponds; Iernut Fishery, Mure county, with 5 fishponds; Cefa Fishery Complex, Bihor county, with 10 fishponds; Ineu Fishery, Arad county, with 7 fishponds; In this experimental disposal, representative as areal distribution, including all types of water and soil existing, we have organized more experiments. We are presenting the repartition of the locations, marked with white points on the map of Romania (fig.1).

46

Fig.1. The locations where the researches took place I.3. MATERIAL AND METHOD I.3.1. Sample collecting For the sample representativeness of the analyzed fisheries, the collecting of water samples included a completely randomized experimental plan. There were established the fishponds from each fishery, being monitored: the water surface area, with the depth and biological characteristics, as well as the structure of phytoplankton and zooplankton, and the fish species which populate them. For the results accuracy in Saprolegniaceae family species identification, beside the current observations made in the experimental period, we took water samples from each fishpond studied, in 3 different months of the year (December, March, June), irrespective of the fishpond surface area, comprised between 0,5 and 30 Ha.

47

The experimental model used, included the collecting of 5 water samples from each fishpond, from the 4 lake sides and from centre, and 50 cm medium depth. From the 5 samples we made a single water sample, which was subsequent analyzed in laboratory conditions. For the identification of different species from Saprolegniaceae family, we collected and analyzed water samples, carp species and spawns affected by disease, from Transylvania monitored fishponds. The water samples were collected in 2 litres recipients, from the 5 areas of each fishpond, then the 5 samples were mixed in a 15 litres tank, collecting for the analyze a single blended sample from each fishpond, in a 2 litres recipient. The transport was made in the first 12-24 hours from the collection and the analysis were performed in the next day.

I.3.2. The initiation of Saprolegnia culture in laboratory conditions To ensure that the possible differences, which could appear between the fungal species from Saprolegniaceae family present in the water, could be strict attributed to the differences given by water nature and the species which populates it, we performed as it follows: from each water sample, in a quantity of 2 litres, we made up 3 samples of 100 ml, in plastic sterile recipients. In each recipient there were introduced 10-15 spawns from the same carp female. Because the literature offers contradictory data respecting Saprolegnias development temperature in different world areals, we suggested the testing of the fungus growing and development mode, at 3 levels of temperature: 10C, 15C and 22C. Water samples, containing 10-15 spawns for artificial infestation, were introduced in a incubator, following the temperatures mentioned, between 3-7 days. In this period we made daily observations on each sample, to find out the starting moment of fungus infestation upon spawns and the intensity of its development at that temperature. There was constituted a number of 207 samples for each collecting month, 3 samples for each fishpond, which were monitored at the 3 temperature levels, and making an

48

estimation of the spawns infestation degree, with marks from 0 to 4, at 48, 96 and 144 hours. The data interpretation was made by estimating the medium score of all the samples from the same thermal gradient, the differences being percentual expressed. The marks used have the following significations: 0 uninfested 1 very weak infested 2 weak infested 3 medium infested 4 strong infested

I.3.3. Culture media used The scientific literature underlines the fact that, generally, in the fungi cultures development could be used either solid media, or liquid ones. Liquid media allow the development of fungal mycelium in a large quantity, that could be used in techniques for DNA extraction (Dieguez-Uribeondo and al., 2007; Fernandez-Benitez and al., 2008). In this research we utilized comparatively 2 solid media: Potato Dextrose Agar (PDA) and Sabouraud 2% Glucose Agar (SGA), and 2 liquid media: Potato Dextrose Broth (PDB) and Sabouraud Dextrose Broth (SDB). The spawns were sterile collected in Petri dishes and washed with distilled water containing 100 mg L-1 Penicillin G potassium salt. Then, were inoculated in two solid media: Potato Dextrose Agar (PDA) and Sabouraud 2% Glucose Agar (SGA), and for preventing the bacterial growing, we added the same antibiotic, in the recommended concentration. The colonies were preserved then on PDA and SGA media, in the incubator for 3 days, at the mentioned temperatures (10, 15 and 22C). In this period we observed Saprolegnia colonies growing speed and their diameter (adapted after Fernandez-Benitez and al., 2008). The original contribution consisted in the fact that we used two comparative solid culture media and three temperature gradients for each medium.

49

I.3.3.1. Solid culture media used in the experiment The two solid culture media used in the experiment were the following (according to http://www.sigmaaldrich.com): Potato Dextrose Agar (PDA) (Fluka) Sabouraud 2% Glucose Agar (SGA) (Fluka) From each fishpond, we made an inoculation in the two solid culture media used (PDA, SGA), from the most developed sample, for making comparative observations respecting the developing mode of fungal species from Saprolegniaceae family. For testing the growing rate on agar solid medium, in Petri dishes containing the two solid culture media (PDA, SGA) and incubated at 22C 2C for 72 hours, we observed Saprolegnias hyphae growing rate. The radial diameter growth was measured at every 24 hours. The hyphae reached the maximum capacity of radial growth, when those have get until the edge of Petri dises (>40 mm) (adapted after Stueland and al., 2005). At 72 hours of development on the solid media, fungal colonies were moved on the liquid ones, in the following procedure: the colonies from Potato Dextrose Agar (PDA) solid medium were transfered on Potato Dextrose Broth (PDB) liquid medium, and the colonies from Sabouraud 2% Glucose Agar (SGA) solid medium, on Sabouraud Dextrose Broth (SDB) liquid medium. This experiment was performed to be able to observe and recommend the best transfer procedure from a solid medium to a liquid one. I.3.3.2. Liquid culture media used in the experiment The liquid media used in the experiment were the following (according to http://www.sigmaaldrich.com): Potato Dextrose Broth (PDB) (Fluka) Sabouraud Dextrose Broth (SDB) (Fluka) All the saprolegnian colonies from the solid media were moved in Erlenmeyer glasses, with 100 ml antibiotic liquid medium and kept in an rotary shaker incubator, at the temperature of 22C 2C, for 5-7 days, depending on the developing degree. The mycelial
50

pellets were filtred, washed with distilled water and maintained at -20C until DNA was extracted (adapted method after Leclerc and al., 2000). We mention the fact that this procedure was applied to fungi samples obtained from the water collected in June 2009, including 138 samples, whereby 69 samples on solid-liquid medium combination, Potato Dextrose Agar (PDA)- Potato Dextrose Broth (PDB), and the other 69 samples on solid-liquid Sabouraud 2% Glucose Agar (SGA) - Sabouraud Dextrose Broth (SDB). I.3.3.3. Antibiotics used in the experiment For preventing the bacterial development and contamination, in the fungi culture media there are used more types of antibiotics (Lategan and al., 2003, 2004). In our experience, we opted for Penicillin G potassium salt (Sigma). We used the working concentration of de 100 mg L- Penicillin G potassium salt, on both solid and liquid media.

I.3.4. Morphological characterization of Saprolegnia strains For the morphological characterization of Saprolegnia strains, developed on culture media, we analyzed the 69 samples with the following aspects: the hyphal type specific to Saprolegnia genus, the asexual reproduction (flagella presence on primary zoospores) and the formation of sexual structures (antheridia and oogonia). Fungal strains collected from each fishpond, at 72 hours of growing on PDA solid medium, were inoculated in 9 cm diameter plastic Petri dishes, on the same PDA medium, at 22C, 5,5 pH. Saprolegnias growing was periodically examined at the microscope, for 2-3 weeks, to check the developing of sexual structures. All the strains were characterized and identified pursuant to the control keys communicated by Johnson Jr. and al., 2002 (DieguezUribeondo and al., 2007). The microscope observations were performed for each sample from each fishpond, after the following procedure: we isolated with a microbiological dowser a part of the colony

51

developed on PDA medium, then was placed on a histological slide, minced with a scalpel, was added a droplet of Lugol solution for coloring, homogenized, and in the end the sample was covered with a histological slide. The observations were performed with the phase contrast microsope and the images were analyzed with a adapted digital camera.

I.3.5. Fungal DNA extraction and detection DNA extraction was made pursuant to the protocol of Colao Maria Chiara (1999). DNA was extracted from fungal mycellium developed in pure culture on PDB (Potato dextrose broth) liquid medium. We used Qiagen extraction kit Dneasy Plant Minikit (pursuant to http://www.qiagen.com) and DNA rapid extraction using PBS (phosphate saline buffer) solution. The DNA extraction was applied to 69 samples, obtained on Potato Dextrose Agar (PDA) solid medium-Potato Dextrose Broth (PDB) liquid medium combination. Each sample from each fishpond was divided in two equal parts, being realized a total number of 138 samples, performing a comparative extraction for the two methods used.

I.3.5.1. Fungal DNA extraction using extraction kits (QIAGEN) The DNeasy Plant minikit is a spin column procedure that incorporates sample lysis, removal of RNA, removal of proteins and polysaccharides, DNA precipitation, and binding to the spin column membrane. Multiple washes are performed to remove contaminants, and DNA is then eluted from the membrane. Equipment, materials and reactives used: - Stationary phase fungal colonies (approximate 1 x 109), 69 samples, on fishponds provenance; Qiagen kit. I.3.5.2. Fungal DNA extraction using solutions

52

The DNA rapid extraction using PBS solution, applied on 69 samples, performed in the following way: there was weighted 120 mg of fungal tissue in an Eppendorf tube and added 200 l PBS solution. The samples were centrifuged at 3000 rpm, for 20 minutes, then the supernatant was removed. This operation repeated five times, until the fungal DNA pellet was clean. Then, the samples were introduced in a marine bath, at 95C for 15 minutes, to disrupt the cell wall. The samples were dried for 30 minutes, and then was addes TE (Tris-EDTA) solution for DNA rehydrating. For the DNA rapid extraction method with NE solution are used some chemical substances, the solutions being made in a laboratory. The materials and expendables were the following: Eppendorf pipettes, with adjustable volumes; Eppendorf tubes; pipette tips of different dimensions (large, medium and small); sterile water.

I.3.6. DNA quantification using direct method of DNA purity and concentration with Nanodrop ND-1000 spectrophotometer For the establishing of DNA purity and concentration, there was used Nanodrop ND1000 spectrophotometer. To be able to find the DNA concentration extracted from fungal samples, we used the direct method, which involves the optical density measurement of DNA sample, at 260/280 nm ripple length on a spectrophotometer, in UV/VIS domain.

I.3.7. ITS region from fungi and primers used At the fungi and other eukaryotes, there are two locations for rDNA: the nuclear and the mitochondrial genome. The last one contains two genes which are coding the small and large mitochondrial genes of rDNA. Fungal nuclear rDNA is generally structured in a tandem repeated nuclear unit. A rDNA unit, illustrated in fig.2, includes 3 rRNA genes: small nuclear (18S) rRNA, 5,8S rRNA and large nuclear (28S) rRNA gene. In a unit, the

53

genes are separated by two internal transcribed spacers (ITS1 and ITS2), and two rDNA units separated by intergenic spacer (IGS). The last rRNA gene (5S) can or cant be in the interior of repeated unit (Kamoun, 2003).

Fig.2. Diagram of nuclear ribosomal DNA repeat unit (Frisvad and al., 1998) With the exception of some variable domains of the rRNA genes, the coding regions are highly conserved among organisms, thus allowing comparisons between distantly related fungi. In contrast, because they evolve rapidly, noncoding regions have more variability than coding regions. The noncoding internal transcribed spacers (ITS1 and ITS2) can be used to discriminate between closely related species within a fungal genus. The ITS region, including the ITS1, the 5,8S rRNA gene, and the ITS2, is about 600 to 1000 base pairs and can be amplified either fully or partly, using universal primers described by White and al., in 1990. The ITS region is now perhaps the most widely sequenced DNA region in fungi. It has typically been most useful for molecular systematics at the species level, and even within species (e.g., to identify geographic races). Because of its higher degree of variation than other genic regions of rDNA (SSU and LSU), variation among individual rDNA repeats can sometimes be observed within both the ITS and IGS regions. In addition to the standard primers used by most labs (ITS1 and ITS4), everal taxon-specific primers have been described that allow selective amplification of fungal ITS sequences. The primers used in PCR reaction were the following (standardized by White and al., 1990):
- ITS1, with 5-3 sequence: TCCGTAGGTGAACCTGCGG;

- ITS4, with 5-3 sequence: TCCTCCGCTTATTGATATGC; - ITS5, with 5-3 sequence: GGAAGTAAAAGTCGTAACAAGG;

54

We used a comparatively mixture of two primer pairs, in the following combination: ITS1 with ITS4 and ITS4 with ITS5. ITS1 primer is attaching at the 3 end of the 18S rDNA gene and ITS4 primer is at the 5end of the 28S rDNA gene (after Paul B. And al., 2004). The last combination of primers is used to amplify the region of the rDNA repeat unit that includes the two non-coding regions designated as the internal transcribed spacers ITS1 and ITS2, and the 5,8S rDNA gene (Llanos Frutos and al., 2004).

I.3.8. Molecular techniques used in the experiment I.3.8.1. PCR amplification of Saprolegnia samples In our experience we used ITS1 and ITS4, ITS4 and ITS5 primer pair combinations (White and al., 1990), which amplify ITS1 region, 5,8S rRNA gene and ITS2. The amplification reactions were individually performed, in a final volume of 25 l, with an Eppendorf thermocycler. The amplification cycling parameters were: initial denaturation at 95C for 3 minutes, followed by 35 cycles of denaturation at 94C for 1 minute, annealing at 55C for 1 minute, and extension at 72C for 1 minute, with a final extension at 72C for 7 minutes. The amplification products were separated by electrophoresis in 1,5% agarose gels, in 1x TBE buffer, for 60 minutes at 70V. The DNA was stained with Sybr Safe (Invitrogen) and visualized under UV light. The gel was photographed and the image recorded on the machine (Biorad). The lengths of amplification products were estimated by comparison to a DNA Ladder Low Range (700 bp) or 50 bp (Fermentas) (adapted after Ristaino and al., 1998). We tested another amplification method, which was performed in an Eppendorf thermocycler, after the following protocol: - initial denaturation: 5 minutes at 95C - 35 cycles: - denaturation 30 seconds at 95C - annealing 30 seconds at 48C

55

- extension 90 seconds at 68C - final extension: 7 minutes at 68C (after Coalo Maria Chiara, 1999). The amplification performed on 69 samples, developed on Potato Dextrose Broth (PDB) medium, using an adapted method after Ristaino and al., 1998.

I.3.8.2. PCR-RFLP techique - Restriction Fragment Length Polymorphism The amplified fragments were digested with 3 restriction enzymes from Fermentas: RsaI, HindIII and AluI. The digestion protocol was pursuant to the manufacturer (http://www.fermentas.com). The PCR products were overnight incubated, at 37C, and at the end at 65C for 10 minutes. The digestion products were then separated by electrophoresis, in a 3% agarose gel, in 1x TBE buffer, for 2 hours at 60V. The DNA was stained with Sybr Safe (Invitrogen), for the observation of amplified fragments polymorphism, under UV light (Biorad). There was used a DNA Ladder Low Range (700 bp), for the fragment comparison (Fermentas).

I.3.9. Methods used in establishing the phylogenetic diversity and relationship of Saprolegniaceae family fungi species I.3.9.1. Automatic sequencing The DNA strand was sequenced with universal primers ITS1 (forward) and ITS4 (reverse), by Mycrosinth (Switzerland). The sequencing results were interpreted using a specific software called Chromas Lite. For the establishing of genetic diversity there were used specific genetical software.

CHAPTER II PERSONAL RESEARCH RESULTS

56

II.1. THE RESULTS OF SAPROLEGNIA CULTURE IN LABORATORY CONDITIONS We expressed in percentage from the total number of analyzed samples, every infestational score from each temperature level, regardless the fishponds and fisheries (table 1). Table 1 Spawns infestation degree with Saprolegnia based on temperature percentage estimated from the total number of samples (207) Infestational degree Temperature 0 1 2 10C 4,34 38,64 54,58 15C 0,96 11,11 32,36 22C 0,96 0,96 12,56 Legend: 0 uninfested; 1 - very weak infested; 2 - weak infested; 3 strong infested. 3 4 2,41 0 51,20 4,34 45,41 40,09 medium infested; 4

From the table data results the fact that saprolegniasis development is different from one incubation temperature to another. At 10C, 38,64% from the samples had the score of 1, which indicates a very weak infestation at 144 hours of incubation. A percentage of 54,58%, more than half of the analyzed samples, are weak infested, and only 2,41% are medium infested. At 15C, only 0,96% from the samples do not manifest any infestation sign, comparative to 4,34% uninfested samples at 10C. A weak infestation degree, of 32,36% from samples is reached at 15C, and the infestation medium level at 51,20%. Compared to the temperature gradient of 10C, at 15C there is a percentage of 4,34% with strong infestation. At 22C, 40,09% from the samples have a strong infestation degree, 45,41% have a medium infestation, and only 0,96% are uninfested. Those data indicate the fact that regardless the fishpond, the area and the time of the year, saprolegniasis as disease spreads with a high intensity and a shorter period at 20C. This result confirms the literature data regarding the carp spawns and larvae losses, communicated by fishery owners and
57

researchers, which take place in May-June months, the reproduction period, when there is observed a high incidence of saprolegniasis. At lower temperatures, the fungus is present even if to infest the fish populations it needs a longer incubation period. At carp populations, which are wintering under the ice and have reduced movements, the incidence is lower compared to the other species, being infested only the individuals which were weak in winter period or had wounds generated by manipulation procedures. II.2. RESULTS REGARDING SAPROLEGNIAS GROWTH AND DEVELOPMENT ON THE CULTURE MEDIA II.2.1. Comparative results regarding the growth of Saprolegnia colonies on solid culture media We used two solid media to be able to test comparatively the growth type of the colonies, at 24, 48 and 72 hours. From each fishpond of each fishery, there were constituted 2 samples, one for each medium. Because the two samples from the two media, are originating from the same culture, inoculated at 6 days, we consider that the growing differences at the same temperature gradient, of 22C, are assigned to the differences between species and to the culture requests. To interpret statistical correctly the colonies growth differences on the two culture media and at the three temperature gradients, we present in table 2 the average values of colonies development in mm.

Table 2 The diameter averages of Saprolegnia colonies at 24, 48 and 72 hours of development on the two solid culture media (in mm)

58

Reading time Culture media Location PDA*

24 SGA** PDA

48 SGA PDA

72 SGA

Arini 14,33 9,44 Moti 12,57 7,57 Adrian 13,50 10,10 aga 12,00 7,60 Ciurila 14,66 9,16 Chiochi 13,60 9,60 Daia 11,80 8,00 Iernut 11,80 8,20 Cefa 12,20 8,00 Ineu 13,14 8,28 *PDA - Potato Dextrose Agar **SGA - Sabouraud 2% Glucose Agar

29,00 26,57 28,10 24,20 30,33 28,20 24,80 25,00 22,50 26,85

19,44 16,00 20,70 16,20 19,16 19,20 16,60 17,40 16,60 17,14

56,22 51,85 53,90 48,80 57,00 53,80 49,40 50,80 51,30 54,00

38,11 31,57 39,50 32,20 36,50 36,60 33,60 34,80 33,20 35,71

9+9 7+7 10+10 5+5 6+6 5+5 5+5 5+5 10+10 7+7

Analyzing the diameter averages at 24 hours (table 2), on PDA culture medium, the colonies had values between 11,80 mm (Daia and Iernut) and 14,66 mm (Ciurila). The colonies inoculated on SGA culture medium had an average between 7,57 mm (Moti) and 10,10 mm (Adrian). At 48 hours, the reading of the same culture Petri dishes indicated almost a doubling from the first reading, on PDA culture medium. The minimum diameter, in average of 22,50 mm, was observed in the colonies from Cefa, and the maximum of 30,33 mm in the colonies from Ciurila (table 2). At the same time interval, compared to the samples from PDA culture medium, the samples from SGA medium had lower values, with a minimum of 16,00 mm in diameter (Moti) and a maximum of 20,70 mm (Adrian). After Stueland and al., 2005, values of the colonies diameter bigger than 40 mm are indicating the reaching at the growing edge. At 72 hours, the diameter averages indicated values bigger than 40 mm on PDA culture medium, and under this value for SGA medium. The maximum diameter of the colonies, 57,00 mm, was observed on the 6 samples inoculated from Ciurila, and medium values of 48,80 mm on the samples collected from aga (table 2). On SGA culture medium,
59

the minimum growing diameter, of 31,57 mm, was realized by the colonies inoculated from Moti water samples, and the maximum diameter, of 38,11 mm, the water samples from Arini. II.2.2. Comparative results regarding the development of Saprolegnia colonies on the liquid culture media The usage of liquid culture media is necessary to obtain bigger quantities of fungal mass, for DNA extraction. This experiment was performed to observe and recommend the best transfer combination from solid culture medium to the liquid one, estimating the fungal mass quantity, in cm3. There were observed and analyzed 138 samples, 69 samples on each culture medium combination. Daily observations made from the transfer day up to the seventh day indicated almost a double rhythm of development in Potato Dextrose Broth (PDB) liquid medium compared to the samples in Sabouraud Dextrose Broth (SDB) liquid medium. In day seven, in all 100 ml Erlenmeyer glasses, the fungal pellets from Potato Dextrose Broth (PDB) liquid medium had between 2,5 and 4 cm3, compared to the colonies developed in Potato Dextrose Broth (PDB) liquid medium, with values of 1-2 cm3 . Further to the results, only the fungal samples obtained in bigger quantities on Potato Dextrose Broth (PDB) liquid medium were analyzed.

II.3. THE MORPHOLOGICAL DESCRIPTION OF SAPROLEGNIA STRAINS The microscope observations indicated the fact that the hyphae have a characteristic unsegmented aspect of lower fungi. There were not analyzed the hyphal length and thickness, only the morphological general aspect, which confirmed the presence of saprolegnian fungi in the culture, without any morphological differentiation between genera and species. The microscope observations performed on a period of 21 days evaluated at every sample the presence or the absence of sexual reproduction organs, as well as the

60

asexual one. We can precisely conclude that in specific laboratory conditions, all fungal isolates had flagella on primary zoospores. Regarding the development of sexual reproduction organs (antheridia and oogonia), there are differences from on fishpond and location to another. This presence or absence of the sexual reproduction can be attributed to the fact that the existent species are different, and some of them do not realyze the sexual reproduction in vitro (Fregeneda Grandes, 2000; Dieguez Uribeondo, 2007). A statistical analysis regarding the development of sexual reproduction organs at the analyzed fungal species from Saprolegniaceae family (69 samples), allows us to conclude that 41 isolates (59,42%) have sexual reproduction organs, observed at the microscope. At 28 samples (40,58%), their presence was not visualized (table 3). Table 3 Synthesis regarding the development of reproduction organs at analyzed fungal species from Saprolegniaceae family Hyphal Sexual reproduction Asexual aspect reproduction (Flagella presence) Present Absent No.of samples Unsegmented 41 Percent (%) 59,42 No.of samples 28 Percent (%) 40,58% No.of samples 69 Percent (%) 100%

II.4. RESULTS REGARDING SAPROLEGNIAS DNA EXTRACTION AND QUANTIFICATION II.4.1. DNA extraction Each sample of biologic material was divided, the two samples being tested by an extraction method, to conclude which one of the two methods is more efficient for this type of fungi, respecting the DNA quantity and purity. The results of the 69 samples extracted by each method, are indicating that DNA purities and quantities performed by Nanodrop ND 1000 spectrophotometer differ from one fishpond and method to another.
61

So, DNA purities obtained after kit extraction (Qiagen) varied between 1,02 and 1,51, with an average of 1,250, at 260/280 nm, and the DNA quantity obtained was between 2,54 and 14,00 ng/l, with an average of 5,543 ng/l. Analyzing the DNA purities after the extraction with PBS solution, we observate that the samples have values between 1,10 and 1,51, with an average of 1,394, at 260/280 nm, and DNA quantities varied between 5,23 ng/l and 86,56 ng/l, with an average of 30,653 ng/l.

II.5. THE DNA AMPLIFICATION RESULTS OF FUNGAL SPECIES FROM SAPROLEGNIACEAE FAMILY II.5.1. DNA amplification using PCR The amplification reactions were individually performed, in a final volume of 25 l, with a thermocycler Eppendorf. In a preliminary phase, the amplification process was applied on 20 samples, 10 of the fungal DNA being extracted with kits (QIAGEN) and 10 extracted with PBS solution. This test was done to observe which of the two methods used, realizes a more precisely DNA amplification, without any unspecific product. The second protocol used, described in material and method, didnt give the expected results at fungi, so we abandoned it. In the figure 3, we present the comparative results regarding the electrophoretic profiles of the fragments amplified with the two primer pairs. Because we used in the DNA extractions, PBS solution and QIAGEN kit, and the universal primers, the electrophoresis results convinced me to continue with the DNA kit extraction (QIAGEN), and ITS1 - ITS4 primer pair.

62

700pb-

Fig.3. Electrophoretic profile of a DNA sample extracted from Saprolegnia and amplified with ITS1 and ITS4, ITS4 and ITS5 primer pairs 1-Ladder Low Range of 700 bp (Fermentas); 2-DNA sample extracted with kit (ITS1-ITS4 primers); 3-DNA sample extracted with PBS solution (ITS1-ITS4 primers); 4-DNA sample extracted with NE solution (ITS1-ITS4 primers); 5-DNA sample purified with PCR kit (ITS1-ITS4 primers); 6-DNA sample purified with PCR kit (ITS4-ITS5 primers); 7-DNA sample extracted with NE solution (ITS4-ITS5 primers); 8-DNA sample extracted with PBS solution (ITS4-ITS5 primers); 9-DNA sample extracted with kit (ITS4-ITS5 primers) II.6. THE DNA ENZYMATIC RESTRICTION RESULTS OF FUNGAL SPECIES FROM SAPROLEGNIACEAE FAMILY USING PCR-RFLP METHOD When we used AluI and HindIII restriction enzymes, the restriction didnt perform. The enzymes couldnt digest the amplified fragment of 700 bp, because of the restriction site. Only the third enzyme tested (RsaI), which restricted all the samples, was used in the experiment to analyze the electrophoretic profile of the 69 samples, from the 10 locations. Then were performed the electrophoretic profiles of the restriction analyses, with RsaI (Fermentas) enzyme, of the DNA amplified with ITS1 and ITS4 primer pairs, at Saprolegniaceae family fungal species. The samples of fungal species from Saprolegniaceae family, from Arini fishery, Maramure county, with 9 fishponds, collected from the fishponds 1,2,3,4,5,8 and 9, had 3

63

DNA fragments, the first one between 350 and 400 bp, the second one around 200 bp, and the third one around 150 bp. In the samples collected from 6 and 7 fishponds, there are visualized 4 fragments: the first one between 450 bp and 500 bp, the second one around 300 bp, the third one around 200 bp, and the fourth one at 150 pb. Those samples of amplified DNA are presenting a fragment length polymorphism, confirmed by the sequencing analyses. The results indicated the presence of two aquatic fungal species, each one belonging to another genera of Saprolegniaceae family. The DNA profiles, observed in 2,3,4,5,6,9 and 10 lanes, are belonging to Saprolegnia ferax species, and the DNA polymorphic profiles, from 7 an 8 lanes, to Achlya bisexualis species. At the fungal samples from Saprolegniaceae family, collected from Moti fishery, Slaj county, in all the 7 analyzed fishponds, there is observed the same electrophoretic profile of the PCR products, with 3 visible fragments. The first fragment has about 400 bp, the second one 200 bp and the third one 150 bp. In all the analyzed samples, the polymorphisms were the same, all the fragments indicating the presence of a single fungal species, confirmed by sequencing as Saprolegnia ferax. At the fungal species from Saprolegniaceae family, collected from Adrian fishery, Satu Mare county, with 10 fishponds, in the 1,2,3,4,6,7,8 and 10 fishponds, there can be visualized 3 migration lanes, the first one at about 380-400 bp, the second one at 200 bp and the third one between 100 and 150 bp. After the sequence analyses performing, in the respective fishponds was identified Saprolegnia ferax species. In the fishpond 5, there are present 2 lanes, the first one at about 450 bp, and the second one at 200 bp. In the fishpond 9 can be observed precisely 4 fragments: the first one at about 450 bp, the second one at 250 bp, the third one at 200 bp and the fourth one between 100 and 150 bp. At the samples from 6 and 10 lanes, can be observed length polymorphisns, different from the rest of fungal DNA samples, confirmed by sequencing as belonging to Achlya bisexualis species. At the fungal species from Saprolegniaceae family, collected from aga fishery, Cluj county, there are present 4 restriction fragments, in all 5 analyzed fishponds. The first fragment has 380-400 bp, the second one has 200 bp, the third one has 150 bp, and the fouth one has around 100 bp. The electrophoretic profiles of DNA samples are similar as base
64

pairs length. The sequencing results indicated the fact that all the electrophoretic profiles belonged to Saprolegnia ferax species. At the fungal species from Saprolegniaceae family, collected from Ciurila fishery, Cluj county, with 6 fishponds, in the fishponds 1,2,3,5 and 6 there can be observed 3 fragments of restricted DNA, the first one is about 400 bp, the second one has 200 bp, and the third one has 130-150 bp. In the fishpond 4 there can be seen 4 DNA fragments, the first one at 500 bp, the second one at 250 bp, the third one at 200 bp and the fouth one between 130-150 bp, which indicate the presence of a polymorphism, confirmed by sequencing as belonging to Achlya bisexualis species. At the fungal species from Saprolegniaceae family, collected from Chiochi fishery, Bistria-Nsud county, with 5 fishponds, in the 1,2,3 and 5 fishponds, can be observed 3 fragments, with the following lengths: the first one between 400 bp and 500 bp, the second fragment between 200 bp and 250 bp, and the third one between 150-200 bp. Those electrophoretic profiles, correlated with the sequencing data and the GeneBank comparison, indicated the presence of Saprolegnia ferax species. In the fishpond 4, the 3 fragments have different lengths: the first fragment has 500 bp, the second one has about 250 bp and the third one has 150-200 bp. After the fragment length analyses by electrophoresis, in the fishpond 4 there is observed a different polymorphism compared to the other fungal DNA samples, which indicates the presence of another species, confirmed as Achlya bisexualis. At the fungal species from Saprolegniaceae family, collected from Daia fishery, Alba county, with 5 fishponds, in the 1,2,3,4 fishponds there is remarked the presence of 3 restriction lanes, the first one having 400 bp, the second one 200 bp, and the third one 130150 bp, after the sequencing analyses being identified the aquatic fungal species named Saprolegnia ferax. It can be seen a fragment length polymorphism at the fungal species collected from fishpond 5, confirmed as belonging to Achlya bisexualis species. The first fragment has 500 bp, the second one has about 200 bp. The third fragment is low visible. At the fungal species from Saprolegniaceae family, collected from Iernut fishery, Mure county, with 5 fishponds, can be observed the same fragment lengths, in 1,2,3 and 5 fishponds. The first fragment has 400 bp, the second one had 200 bp, and the third one 13065

150 bp. The electrophoretic profiles are belonging to Saprolegnia ferax species, ulterior sequenced. In the fishpond 4, the fragment length differs as it follows: the first fragment has 500 bp, the second one has about 210-220 bp, and the third one has 150 bp, involving a polymorphism of another fungal species (Achlya bisexualis). In the case of the fungal species from Saprolegniaceae family, collected from Cefa fishery, Bihor county, with 10 fishponds, in the fishponds 1,2,4,5,6,7 and 9 , the 3 fragments have the following lengths: the first fragment 400 bp, the second fragment 200 bp and the third fragment between 130 and 150 bp. Those polymorphisms are belonging to Saprolegnia ferax species. In the fishponds 3,8 and 10, the fragments have different lengths, the sequencing confirming the presence of Achlya bisexualis species. The first fragment is visualized more clearly, having about 450 bp. At the samples originating from the fishponds 8 and 10, it is observed an extra fragment the second one, of 250 bp, the third one having 200 bp and the fourth one about 130 bp, have the same length with the second and third fragments from the other fishpond samples. At Ineu fishery, Arad county, the fragments of all the fungal samples from Saprolegniaceae family, collected from 7 fishponds analyzed, had the same lengths: the first one had 400 bp, the second one 200 bp, and the third one between 130 and 150 bp. The ulterior sequencing analyses confirmed the presence of Saprolegnia ferax species, in this location fishponds.

66

II.7. RESULTS REGARDING THE GENETIC PHYLOGENY STUDY OF SAPROLEGNIACEAE FAMILY FUNGI
Tree Diagram for 12 Variables Single Linkage Euclidean distances Var1 Var7 Var3 Var6 Var2 Var8 Var10 Var11 Var4 Var9 Var5 Var12 0 10 20 30 Linkage Distance 40 50 60

Fig.4. Phylogenetic analysis of 69 DNA samples from Saprolegniaceae family fungi, isolated from 10 locations
Variant 1: Arini, with the samples from 1-5, 8,9 fishponds; Moti, with the samples from the 7 fishponds; Variant 2: Arini, with the samples from 6 i 7 fishponds; Variant 3: Adrian, with the samples from 14, 6-8, 10 fishponds; Variant 4: Adrian, with the samples from fishpond 5; Variant 5:Adrian, with the samples from fishpond 9; Variant 6: aga, with the samples from all the 5 fishponds; Variant 7: Ciurila, with the samples from 1-3, 5-6 fishponds; Daia, with the samples from 1-4 fishponds; Iernut, with the samples from 1-3, 5 fishponds; Cefa, with the samples from 1-2, 4-7, 9 fishponds; Ineu, with the samples from all the 7 fishponds; Variant 8: Ciurila, with the samples from fishpond 4; Variant 9: Chiochi, with the samples from 1-3 and 5 fishponds; Variant 10: Chiochi, with the samples from fishpond 4; Variant 11: Iernut, with the samples from fishpond 4; Daia, with the samples from fishpond 5; Variant 12: Cefa, with the samples from 8 and 10 fishponds.

67

The dendrogram interpretation, performed after the reading of DNA fragment lengths, from the 69 analyzed fishponds, allows us to conclude the following aspects regarding the Saprolegniaceae family fungi phylogeny (fig.4). All the identified fungal types have an common ancestral origin, the first speciation being realized at the ancestral variety, at a linkage distance of 58 cM (centiMorgans). One of the speciations evolved for a longer period of time, in a part of the analyzed fishponds, when caused by a point mutation, placed on a distance of 20 cM, appeared another 2 speciations. One of them evolves until today, being localized in the fishponds 1-5, 8,9 from Arini fishery, in the 7 fishponds from Moti fishery (var.1), in the fishponds 1-3, 5-6 from Ciurila, Daia fishponds 1-4, Iernut fishponds 1-3 and 5, Cefa fishponds 1-2, 4-7 and 9, and all the 7 fishponds from Ineu fishery (var.7). The other speciation, which evolved from a point mutation, at the level of 20 cM, for a period of time, suffered another point mutation, at the linkage distance of 10 cM, generating another two speciations. One of them (var.3) still evolves and was identified in the fishponds 1-4, 6-8 and 10 from Adrian fishery and in all the 5 fishponds from aga fishery (var.6). The second branch which broked from the ancestral form, at the distance of 58 cM evolved until a point mutation caused the creation of two new speciations, at the linkage distance of 42cM. One of the branches evolved for a shorter period of time, when at the linkage distance of 35 cM realized a point mutation, which caused the appearance of another two new speciations. One of them was identified in the fishponds 6 and 7 from Arini fishery (var.2). The other speciation, after a point mutation, at a linkage distance of 30 cM, caused the evolution of two taxonomical units, identified today. One of them evolves and it is very active in the fishpond 4 from Ciurila fishery (var.8), and in the fishpond 4 from Chiochi fishery (var.10). The other broked branch is identified and present today in the fishpond 4 from Iernut fishery and fishpond 5 from Daia (var.11). The second branch, broked at a linkage distance of 42 cM, evolved for a longer period of time, in a part of the analyzed fishponds, then, at a distance of 10 cM, after another mutation, resulted 3 speciations, two of them genetic related (var.4 and 9), identified in the fishpond 4 from Adrian fishery and in fishponds 1-3 and 5 from Chiochi fishery. At a
68

higher genetic distance, the individuals broked from the same branch, are evolving today in the fishpond 9 from Adrian fishery (var.5) and in the fishponds 8 and 10, from Cefa fishery (var.12).

II.8. SEQUENCING RESULTS OF THE SAPROLEGNIACEAE FAMILY FUNGAL SPECIES FROM THE STUDIED LOCATIONS After the automatic sequencing, performed with ABI Prism sequencer, by Mycrosinth (Switzerland), there were identified two aquatic fungal species, in the studied fishponds, represented by Saprolegnia ferax and Achlya bisexualis. In the case of Saprolegnia ferax species sequencing, the fragment sequenced with the primers ITS1(forward) and ITS4 (reverse), has a length of 743 bp, a identity of 99% and has two point mutations compared to the matrix species from GeneBank. At 31 position, there is observed a deletion between A-C nucleotides, of a C nucleotide, and at 368 position, there is a substitution of A with C. After sequencing Achlya bisexualis species, the fragment sequenced with the primers ITS1(forward) and ITS4 (reverse), has a length of 761 bp, a identity of 99% and has 7 point mutations compared to the matrix species from GeneBank. At 112 position, there is rematked a substitution of C with T; at 119 position, a substitution of G with A; at 194 position, a substitution of T with G; at 370 and 371 positions, two substitutions of C with A; at 416 position, a substitution of A with T, and at 633 position, a substitution of A with G. II.9. THE INCIDENCE OF SAPROLEGNIASIS IN THE CENTRAL AND NORTH-WESTERN ROMANIAN AREAL Saprolegniasis is the silent killer of the aquatic species, the disease producing extremely important losses in the fisheries, particularly in the cyprinid ones. Saprolegniasis is one of the most important causes of economic losses in aquaculture, fungal infections are second only to bacterial diseases in economic importance. Fungal infections are generally restricted to chronic, steady losses. In Japan, there is an annual mortality rate of 50% in coho salmon (Oncorhynchus kisutch) due to Saprolegnia parasitica

69

Coker. Fifty percent per year losses have also been reported in elver (Anguilla anguilla) culture in Japan. In Scotland, saprolegniasis causes important economic losses especially in salmon fisheries. In the southeastern of United States, major losses of 50% occur in channel catfish farming, and the economic loss of 40 million dollars. Every year, the channel catfish farmers, from United States, have losses of more than 25 million dollars caused by aquatic diseases. In Europe, the cyprinid species losses percentage is more than 25%, in the areals where over the predisposing factors, represented by overpopulation, bad manipulation of the fish, reproduction stress caused by corticosteroid hormone excess, associated infection (Jeney and al., 1995), there are cumulating the water and air pollution factors. Losses between 50 and 100% at spawns, and between 14% up to 30% at larvae and alevins, between 10 and 15% at young fish are signaled by different authors (Horvath and al., 2005). Taking in consideration the International and European situation, we observed in our research areal important losses caused by saprolegniasis (table 4).

Table 4 The percentage of losses caused by saprolegniasis at carp species in the studied locations (%)
Location Spawns in hatching period Larvae Alevins Young fish Winter Arini Moti Adrian aga Ciurila Chiochi Daia Iernut Cefa Ineu Average on total locations 70 40 58 60 30 30 25 50 20 28 41,1 30 20 25 28 10 12 15 25 5 7 16,7 5 7 10 10 5 10 5 13 5 6 7,6 3 5 5 8 5 5 3 10 2 3 4,9 4 3 8 9 7 10 5 10 3 4 6,3 Spring 5 2 6 5 5 6 3 7 4 3 4,6 Adults

Summer 5 3 6 4 4 5 3 5 4 4 4,3

Autumn 3 3 5 4 3 4 3 5 4 3 4,1

70

We mention the fact that in al the analyzed fisheries there is applied the annual disinfection, in the fishponds where the natural supervised reproduction takes place, emptying and keeping them dry on the winter period. Before the filling, the fishponds are disinfected with lime at all of their surface. With all this, because of the reproduction individuals manipulation and of the vegetation massive development, in the reproduction period there are described strong attacks of pathogenic fungi upon spawns, with losses up to 70% in Arini fishery, and in the fisheries where the hygienic measures are very severe, the losses are up to 20% from affected spawns (Cefa location). In average, in the 69 fishponds from the 10 locations studied, the cyprinid spawn losses raise up to 41,10%. The larval period, specially the first 3 days of life one, when their movements are limited by the presence of vitelline membrane, the average losses raise up to 16,70%, with a 30% maximum of losses, in Arini fishery, and a 5% minimum of losses in Cefa fishery. The alevin period, extremely difficult as needs of water oxygen level and food quality, is strong affected by saprolegniasis. The average losses of 7,60%, are more reduced compared to the larval period. The biggest losses percentage at this category of age, is encountered in Iernut fishery (13%), and a minimum of 5% in Arini, Ciurila, Daia, Cefa fishries. In the young fish period, with its particular attention gived by the fishery owners regarding the water and food quality, when there is assured an optimal density of the individuals and the manipulations restricted, the losses caused by saprolegniasis are more reduced, being in average of 4,90%. The adult period is not safe from Saprolegnia attack. In the majority of the studied fisheries, there is practiced the autumn fishing and the transfer of the kept fish for the next year, in the wintering fishponds. The manual labor of catching, transportation and repopulation in another fishpond causes body and fishfins inherent wounds. On the winter period, the fish do not eat any food, their organism being weakened, and under the influences of sudden temperature changes and ice layer, the losses are in average of 6,30%. In springtime, the reproducers, as well as the fish kept for breeding, are verified regarding their state maintenance and health, using fishing nets. The manipulation produces wounds, which are causing the increase of saprolegniasis incidence, the average of the losses being of
71

4,60%. The springtime end and the begining of the summer are overlapping with the cyprinid reproduction period, when the manipulations, as well as the stress caused by corticosteroid hormones are the factors of saprolegniasis incidence, at the weakened individuals. The average losses on the 69 samples studied is 4,30%. A lower percentage, of 4,10%, is remarked in the autumn period, when generally all the fish populations have a very good immune status, being prepared for wintering.

CHAPTER III CONCLUSIONS AND RECOMMENDATIONS

1. The water presence of Saprolegnia, prooved by the spawns infestation, is observed irrespective of the water collecting month. 2. The higher infestation degree of the cyprinid spawns with Saprolegnia was remarked at the water temperature of 22C, when the medium and strong infestation percentage reaches 85,41%, irrespective of sample collecting months. 3. Irrespective of the solid culture media used (PDA and SGA), and of the reading interval (24, 48 and 72 hours), there are differences between the analyzed Saprolegnia colonies, from one fishpond and location to another. 4. The growing of Saprolegnia colonies on Potato Dextrose Broth (PDB) liquid culture medium is superior to the one realized on Sabouraud Dextrose Broth (SDB) liquid medium. 5. The morphologic characterization of Saprolegnia strains, from the obtained colonies, reveals unsegmented hyphae specific to the inferior fungi, and differences regarding the presence of sexual reproduction (at 59,42%) and its absence (at 40,58%). 6. At all Saprolegnia isolates it was identified the presence of flagella on the primary zoospores. 7. DNA purities illustrated by Nanodrop ND 1000 spectrophotometer, after the kit extraction (Qiagen), varies between 1,02 - 1,51, with a sample purity average of 1,250, at 260/280 nm ripple length, and the DNA quantities between 2,54 14,00 ng/l, with an average of 5,543 ng/l, and the DNA purities after PBS solution
72

extraction have values between 1,10 1,51, with an average of 1,394, at 260/280 nm ripple length, and the DNA quantities obtained by the same method, varied between 5,23 86,56 ng/l, with an average of 30,653 ng/l. 8. In the case of DNA samples extracted with kit QIAGEN, in all the situations the amplification produced with both primer pairs used, with the visualization of 743 bp fragments at Saprolegnia ferax, and of 761 bp at Achlya bisexualis. 9. In the case of the DNA samples extracted with PBS solutions, in spite of the normal DNA purities and quantities, the amplification of Saprolegnia DNA samples, with the two primer pairs, produced differently, because of the presence of possible fungal inhibitors, which do not allow the attachment of ITS1 and ITS4 primer pair, and in the case of using a PCR purification kit, the amplification performed. 10. In the case of the samples extracted with NE solutions, in spite of the normal purities and quantities, the amplification of Saprolegnia DNA samples, with the two primer pairs didnt produced. 11. RsaI enzyme has a very good specificity for Saprolegnia and Achlya restriction sites, so we opted for its usage in all the fragment restriction tests. 12. AluI and HindIII enzymes, tested by us in the experiment, do not have any specificity for Saprolegnia and Achlya restriction sites, failing to produce any restricion of the DNA fragments. 13. In the case of the 10 fisheries and 69 samples analyzed, there are visualized two DNA length polymorphisms, in the gels. 14. The study of phylogenetic tree, using linkage and Euclidean distances, allows us to conclude the fact that in the studied fisheries and fishponds, there are different genera of fungi from Saprolegniaceae family, which have different pathogenicity upon cyprinid species. 15. After the DNA sequencing, there were identified two species of aquatic fungi, in the studied fishponds, represented by Saprolegnia ferax (743 bp, a identity of 99% and has two point mutations compared to the matrix species from GeneBank) and Achlya

73

bisexualis (761 bp, a identity of 99% and has 7 point mutations compared to the matrix species from GeneBank). 16. The bigger losses caused by identified species (Saprolegnia ferax and Achlya bisexualis), at the cyprinid species from Romania, are observed in the reproduction period, when the percentage of average losses at spawns reaches 41,10%, and 16,70% at larval period. 17. The identified species are causing losses in the cyprinid breeding fishponds from Romania, and at the young fish (4,90%) and adults (with an average of 6,30% in wintertime, 4,60% in springtime, 4,30% in summertime and 4,10% in autumn). 18. The losses caused by saprolegniasis differ from one season and fishery to another, depending on the water physical, chemical and biological conditions, on the breeding technology severity and on the general meteorological conditions.

Based on the obtained results, we recommend:

9. We recommend for the analyses of Saprolegnia presence in fishponds, that the water samples should be collected from the 4 lake sides and centre, and from the depth of about 50 cm. 10. For the growth of different Saprolegnia strains, can be used solid culture media (PDA and SGA), but we recommend PDA culture medium for the colonies more rapid growing time. 11. Because, in the DNA analyses there are needed big quantities of fungi, and making allowance for Saprolegnia development mode in the two culture liquid media, we recommend the use of Potato Dextrose Broth (PDB) liquid medium, in the experiments on the genus species. 12. We recommend the fungal DNA extraction with kits (QIAGEN) and avoiding the solutions extraction (PBS and NE), which in spite of the fact that realizes normal DNA purities and quantities, the amplification of Saprolegnia DNA samples produces partialy or was absent.

74

13. In researches on the aquatic fungi we recommend the use of RsaI enzyme, which has a very good specificity for Saprolegnia and Achlya restriction sites, and to avoid AluI and HindIII enzymes, which do not have any specificity for the restriction sites. 14. For the genetic characterization of Saprolegniaceae family aquatic fungi, we recommend the use of PCR-RFLP method, described by Ristaino and al., 1998, adapted by us. 15. To be able to identify precisely the genera and species from Saprolegniaceae family, we recommend the use of DNA sequencing and the results comparison with the ones from GeneBank. 16. To avoid the losses caused by saprolegniasis, in the cyprinid fisheries from centern and north-western part of Romania, we recommend a special attention of the fishery owners in: the permanent water quality control, the vegetation type control, avoiding the fish traumatisms during manipulations, avoiding the stress caused by water level oscillations, and by the forage type used.

75

SELECTIVE BIBLIOGRAPHY
32. Colao Maria Chiara, 1999, Proprieta cinetiche e molecolari di laccasi fungine, Universita degli Studi della Tuscia, Viterbo, 99 pg.; 33. Coier Viorica, 2007, Inginerie genetic, Ed. Risoprint, Cluj-Napoca; 34. Dick, M.W., 1969, Morphology and taxonomy of the Oomycetes, with special reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. I. Sexual reproduction, New Phytol., 68, 751775; 35. Dick, M.W., 1972, Morphology and taxonomy of the Oomycetes, with special reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. II. Cytogenetic systems, New Phytol., 71, 11511159; 36. Dieguez-Uribeondo, J., Fregeneda-Grandes, J.M., Cerenius, L., Elena PerezIniesta, Aller-Gancedo, J.M., Teresa M. Telleri, Soderhall, K., Maria P. Martin, 2007, Re-evaluation of the enigmatic species complex Saprolegnia diclina Saprolegnia parasitica based on morphological, physiological and molecular data, Fungal Genetics and Biology, 44, 585601; 37. Fernandez-Benitez Maria Jose, Ortiz-Santaliestra, M.E., Lizana, M., DieguezUribeondo, J., 2008, Saprolegnia diclina: another species responsible for the emergent diseaseSaprolegnia infections in amphibians, FEMS Microbiol. Lett., 279, 2329; 38. Francesconi, A., Kasai, M., Susan M. Harrington, Mara G. Beveridge, Ruta Petraitiene, Petraitis, V., Schaufele, R. L., Walsh, T J., 2008, Automated and manual methods of DNA extraction for Aspergillus fumigatus and Rhizopus oryzae analyzed by Quantitative Real-Time PCR, Journal of Clinical Microbiology, 46:6, 19781984; 39. Fregeneda Grandes, J.M., Fernandez Diez, M., Aller Gancedo, J.M., 2000, Ultrastructural analysis of Saprolegnia secondary zoospore cyst ornamentation from infected wild brown trout, Salmo trutta L., and river water indicates two distinct morphotypes amongst long-spined isolates, Journal of Fish Diseases, 23, 147160;
76

40. Frisvad, J.C., Bridge, P.D., Arora, D.K., 1998, Chemical fungal taxonomy, Marcel Dekker Inc., New York, 398 pg.; 41. Heath, I.B., Karen Rethoret, 1981, Nuclear cycle of Saprolegnia ferax, J. Cell Set., 49, 353-367; 42. Johnson Jr., T.W., Seymour, R.L., Padgett, D.E., 2002, Biology and systematics of the Saprolegniaceae, on-line publication: http://www.ilumina-dlib.org., 1028 pg.; 43. Kamoun Sophien, 2003, Molecular genetics of pathogenic oomycetes, Eukaryotic Cell, 2:2, 191199; 44. Lategan, M.J., Gibson, L.F., 2003, Antagonistic activity of Aeromonas media strain A199 against Saprolegnia sp., an opportunistic pathogen of the eel, Anguilla australis Richardson, Journal of Fish Diseases, 26, 147-153; 45. Lategan, M.J., Torpy, F.R., Gibson, L.F., 2004, Biocontrol of saprolegniosis in silver perch Bidyanus bidyanus (Mitchell) by Aeromonas media strain A199, Aquaculture, 235, 77-88; 46. Leclerc, M.C., Guillot, J., Devilla, M., 2000, Taxonomic and phylogenetic analysis of Saprolegniaceae (Oomycetes) inferred from LSU rDNA and ITS sequence comparisons, Antonie van Leeuwenhoek, 77, 369377; 47. Llanos Frutos, R., M. Teresa Fernndez-Espinar, Querol, A., 2004, Identification of species of the genus Candida by analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers, Antonie van Leeuwenhoek, 85, 175185; 48. Oroian, R.G., Oroian, T.E., Crina Teodora Carai, Viorica Coier, L. Sasca, 2009, RAPD technique used in analyzing the genetic structure of Cyprinus carpio species Galitian and Lausitz varieties, International symposium Modern animal husbandry-science, creativity and innovation, Lucrri tiinifice seria Zootehnie, USAMV Iai, cotaie CNCSIS B+, 52:14, 444-449; 49. Oroian, R.G., Vlaic, A., Oroian, T.E., 2008, PCR technique used in Saprolegnia sp. genetical characterization, Lucrri tiinifice - Universitatea de tiinte Agricole i Medicin Veterinar Iai, Seria Zootehnie, vol. 51, 631-634;

77

50. Oroian, T.E., 2006, Selecia asistat de markeri la crap, Ed. Risoprint, Cluj-Napoca, 180 pg.; 51. Oroian, T.E., Oroian, R.G., Cristina Hegedu, Cighi, V., Dronca, D., 2009, The monitoring of phytoplankton evolution by biological year within Arinis-Maramures fishery complex, International symposium Modern animal husbandry-science, creativity and innovation, Lucrri tiinifice seria Zootehnie, USAMV Iai, cotaie CNCSIS B+, 52:14, 456-461; 52. Paul, B., Monica M. Steciow, 2004, Saprolegnia multispora, a new oomycete isolated from water samples taken in a river in the Burgundian region of France, FEMS Microbiology Letters, 237, 393398; 53. Ristaino, J.B., Madritch, M., Trout, C.L., Parra, G., 1998, PCR amplification of ribosomal DNA for species identification in the plant pathogen genus Phytophthora, Applied and Environmental Microbiology, 64:3, 948-954; 54. Stueland, S., Hatai, K., Skaar, I., 2005, Morphological and physiological characteristics of Saprolegnia spp. strains pathogenic to Atlantic salmon, Salmo salar L., Journal of Fish Diseases, 28, 445-453; 55. Vlaic, A., 2007, Genetica petilor, Ed. Risoprint, Cluj-Napoca, 150 pg.; 56. White, P.L., Barton, R., Guiver, M., Linton, C.J., Wilson, S., Smith, M., Beatriz L. Gomez, Carr, M.J., Kimmitt, P.T., Shila Seaton, Rajakumar, K., Tessa Holyoake, Chris C. Kibbler, Elizabeth Johnson, Hobson, R.P., Jones, B., Rosemary A. Barnes, 2006, A consensus on fungal Polymerase Chain Reaction diagnosis, Journal of Molecular Diagnostics, 8:3, 376-384; 57. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990, Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand, D.H., Sninsky, J., White, T.J. (Eds) PCR protocols (pg 315322), Academic Press, San Diego; 58. *** http://www.fermentas.com 59. *** http://www.ncbi.nlm.nih.gov 60. *** http://www.qiagen.com
78

61. *** http://www.sigmaaldrich.com 62. ***http://www.tnfish.org/FishDiseasesParasites_TWRA/files/Saprolegnia.pdf

79