Biochemistry best of five collection for medical students

New and full review

CELL & WATER

1. The following is not found in prokaryotic cells: a) Cytoplasmic membrane b) DNA c) Cytoplasm d) Nucleus e) RNA 2. Buffers in the human body include: a) Carbohydrates b) Phospholipids c) Sulphuric Acid and Sulphate d) Phosphoric Acid and Phosphate e) None of the Above 3. Water is the ideal solvent in biological systems because of its: a) Low melting point b) Low dielectric constant c) Dipolarity d) High concentration in cells e) High ionization potential 4. The following are organelles of prokaryotic cells: a) Plasma membrane b) Mitochondria c) Cytoplasm d) Endoplasmic reticulum e) Both A and C are correct 5. The endoplasmic reticulum is: a) Continuation of the plasma membrane b) Site for protein synthesis c) The major site for energy production d) A double membrane organelle e) Not found in hepatocytes 6. Mechanisms of transport across the plasma membrane: a) Are identical in prokaryotes and eukaryotes b) Include pinocytosis c) Include phagocytosis d) Require glycolipids e) Both B and C are correct

7. Water participates in the following reactions: a) Hydration b) Dehydration c) Hydrolysis d) Thiolysis e) All A, B and C are correct

8. The bonds that are mostly involved in interactions of biomolecules include: a) The peptide bonds b) The ionic bonds c) The covalent bonds d) Thioester bonds e) Phosphodiester bonds 9. The dipolarity of water: a) Results in covalent interaction b) Facilitates the solubility of most biomolecules c) Disappears in the solid state d) Is the basis for ionic interactions e) Is none of the above 10. Buffers in the human body do not include: a) Proteins b) Amino acids c) Sulphuric acid & sulphate d) Phospheric acid & phosphate e) Carbonic acid & bicarbonate 11. Metabolic acidosis can result from: a) Excessive vomiting b) Uncontrolled diabetes mellitus c) Increased pH d) Increased carbohydrate intake e) None of the above 12. The plasma pH is maintained by the buffering effect of: a) Proteins b) Carbonic acid & Bicarbonate c) The kidney d) Gastric HCl e) A, B and C are correct 13. Buffers in the human body do not include: a) Carbonic acid bicarbonate b) Plasma proteins c) Sulphuric acid & sulphate d) Phospheric acid & phosphate e) Hemoglobin 14. The mitochondrion: a) Has a higher density than the nucleus b) Sediment before the nucleus in gradient centrifugation c) Is a site for protein synthesis d) Has the same size as the nucleus e) Is absent in eukaryotes

15. The equation pH=pK + Log (Conjugate acid/ Conjgate base): a) Is known as the Handerson Hasselbalch equation b) Assumes that water ionizes c) Assumes that water does not ionize d) Applies to strong acids e) is incorrect 16. At neutral pH, a mixture of amino acids in solution would be predominantly: a) Dipolar ions b) Nonpolar molecules c) Positive and monovalent d) Hydrophobic e) Negative and monovalent 17. The cytosol: a) Is composed of all subcellular organelles except the nucleus b) Sediments before the nucleus in gradient centrifugation c) Is the site for glycogen synthesis d) Contains enzymes of the TCA cycle e) Is absent in prokaryotes 18. Interactions between biomolecules usually involve: a) Covalent bonds and hydrogen bonds b) Ionic bonds and hydrogen bonds c) Disulphide bridges and hydrophobic interactions d) Hydrogen bonds and disulphide bridges e) All of the above 19. Bonds involved in the interactions between biomolecules usually include: a) Covalent bonds b) Hydrogen bonds c) Ionic bonds d) Hydrophobic interactions e) B, C and D are all correct 20. Which of the following bonds is covalent? a) Hydrophobic b) Hydrogen c) Disulphide d) Electrostatic e) Ionic 21. Metabolic acidosis: a) Results from high bicarbonate in the blood b) Is associated with increase in pH c) Occurs in uncontrolled diabetes mellitus d) Results from excessive vomiting e) None of above is correct

22. Reactions which involve water include: a) Thiolysis b) Phosphorylysis c) Hydrolysis d) Hydrogenation e) Dehydrogenation 23. Water: a) Has high melting point b) Has low dielectric constant c) Does not contribute in interaction of biomolecules d) Has high concentration in cells e) Ionizes completely at 25 oC 24. The intestinal bicarbonate is produced by: a) Stomach b) Duodenum c) Jejunum d) Pancreas e) Colon 25. pH of a buffer solution can be determined by: a) -log [base]/[acid] b) -log [acid]/[base] c) -log [acid-base] d) pK + log [base]/[acid] e) pK + log [acid]/[base] 26. Peroxisome site for synthesis of: a) Ether glycerophospholipids b) Dolicols c) Cholesterol d) Triacylglycerol e) A, B and C are correct 27. The physiological buffers that maintain intracellular pH include: a) Proteins b) Bicarbonate c) Phosphate d) A, B and C are correct e) Albumin

28. The plasma pH that is most suitable with human life is: a) 6.8 - 8.7 b) 7.0 - 8.5 c) 6.0 - 8.5 d) 7.35 7.45 e) 7.45 7.95 29. The plasma membrane of the cell: a) Contains proteins b) Is a lipid bilayer 5

c) Is selectively permeable d) Is different from the mitochondrial membrane e) Is all of the above 30. The pH is: a) The hydrogen ion concentration in solution b) Measured by colorimeter c) The same in all body fluid compartments d) Maintained by buffers e) Dependent on ionization of strong acids 31. The following are found in prokaryotic and eukaryotic cells: a) Plasma membrane and cytosol b) Nucleus and plasma membrane c) Cytosol and endoplasmic reticulum d) Mitochondria and cytoskeleton e) Ribosomes and mitochondria 32. In cell fractionation: a) Mechanical shearing and detergent solubilization can be used b) Gradient centrifugation separates organelles in one step c) Nuclei sediment in the first pellet in differential centrifugation d) Subcellular organelles can be identified by molecular markers e) All of the above are correct 33. A patient has aciduria with a urine sample at pH 4.9. What is the approximate ratio of lactic acid molecules to lactate ions? a) 1 : 100 b) 100 : 1 c) 10 : 1 d) 1 : 10 e) 1 : 1 34. What is the pH of a buffer solution (HA and A) where HA is 100x the concentration of A? (pK of HA is 6.8): a) 4.8 b) 6.8 c) 5.8 d) 7.8 e) 8.8 35. Buffer capacity is: a) Greatest at a pH equal to the pKa of the acid form of a buffer pair in a closed system b) The change in pH that results from adding a given amount of acid or base to a solution c) Both A and B d) Neither A nor B e) Dependent on the concentration of the buffer 36. Plasma (HCO3-) is regulated by: a) The rate of respiration b) Acidification of urine by the kidney 6

c) The rate of urea synthesis in the liver d) Pancreatic production of HCO3e) Loss of bicarbonate in vomiting and diarrhea 37. The cellulose is: a) An important constituent of the human muscles b) Important in human diet c) The main constituent of the plant cell wall d) Made up of glucose units attached by alpha- 1,4 glycosidic linkage e) Degraded to free glucose in humans

BIOCHEMICAL TECHNIQUES
1. In gel filteration, biomolecules are separated according to: a) The net charge b) The difference in molecular weight c) Ability of diffusion through porous membranes d) Polarity e) Solubility 2. Radio Immune Assay (RIA): a) Is used for purification of hormones b) Involves the use of radioactive elements c) Is used for quantitative measurements of hormones d) Requires a pure antigen of known concentration e) "A" is the only wrong statement 3. Electrophoresis: a) Involves the use of polyacrylamide gel b) Can be used for purification of proteins and nucleic acids c) Is usually followed by Western blotting for proteins d) A, B and C are all correct e) Only B is correct 4. The following technique is the most suitable for the separation of a mixture of the 20 amino acids: a) Two dimensional electrophoresis b) Gel filteration c) Affinity chromatography d) Dialysis e) RIA 5. Chromatography: a) Is a technique for protein sequencing b) Is a separation technique c) Involves a mobile phase and stationary phase d) Is exemplified by gel filteration e) Only B,C and D are correct 6. Dialysis: a) Involves separation of molecules according to density 7

b) Is based on diffusion across a porous membrane c) Is a type of chromatography d) Can be used to separate 2 molecules with the same molecular weight e) The molecular weight is not important in the technique

7. Ion exchange chromatography: a) Used for sequencing of proteins b) Useful in separation of proteins c) Affinity chromatography d) Dialysis e) RIA 8. Electrophoresis: a) Is based on centrifugal force b) Cannot be used for separation of proteins and DNA c) Requires electrical power source d) Is based on passive diffusion of biomolecules e) Is a technique for mammalian cell culture 9. A mixture of amino acids can be separated by: a) ELISA b) RIA c) Electrophoresis d) Dialysis e) None of the above 10. In electrophoresis, the rate of migration depends on: a) Net electrical charge of the molecule b) Size and shape of the molecule c) Temperature of operation d) Both A and B are correct e) A, B and C are correct 11. Chromatography technique can be used to seperate: a) Proteins b) Amino acids c) Lipids d) Both A and B are correct e) A, B and C are correct 12. The following method is used only to detect RNA and can be used to measure the difference in levels of specific mRNA in different tissues: a) Northern blot analysis b) Polymerase chain reaction c) Restriction fragment length polymorphism linkage analysis d) DNA fingerprint analysis e) Southern blot analysis

13. Radio Immune Assay: a) Is based on centrifugal force b) Is used for quantitative measurement of abundant biomolecules c) Requires antibodies and radioisotopes d) Is used for measurement of plasma albumin e) Has low sensitivity and high specifity 14. Dialysis: a) Is an ideal separation technique b) Involves movement of molecules through a porous membrane c) Depends on the difference in size and concentration d) Is useful after affinity chromatography e) B, C and D are correct 15. ELISA: a) Is a separation technique b) Involves use of radioisotopes c) Is ideal for quantitative measurements of hormones d) Involves change of color in enzymatic reactions e) Is not specific 16. The following is correct: a) Western blotting is for proteins b) Northern blotting is for RNA c) Southern blotting is for DNA d) Transfer follows separation by electrophoresis e) All of the above is correct 17. The following statements are true regarding Southern blotting except: a) It is the transfer of DNA from a gel onto a nylon membrane b) It involves transfer of double stranded DNA from a gel to nylon membrane c) It is helpful in detection of certain stains of infectious agents d) Is useful for detection of a mutation in a given gene e) It uses capillary diffusion for fragment transfer 18. RFLP stands for: a) Restriction fragment length position b) Restriction fragment length polyploidy c) Restriction fragment length phenotype d) Restriction fragment length polymorphism e) Restitution fragment loose polymorphism 19. The following statements are true regarding agarose electrophoresis except: a) DNA migrates towards the negative electrodes b) Large molecules migrate more slowly than small molecules c) Ethidium bromide is used to visualize the DNA d) Bromophenol blue is indicative of the distance migrated by DNA e) Ultra-violet light is needed 20. The following techniques are used to immobilize the corresponding biomolecules: a) Southern blotting for proteins b) Northern blotting for RNA c) Southern blotting for DNA 9

d) Northern blotting for DNA e) Both B and C are correct

ENZYMES
1. Oxidoreductases include: a) Catalases and Mutases b) Oxygenases and Dehydrogenases c) Dehydrogenases and Ligases d) Aminotransferases and Racemases e) Epimerases and Oxidases 2. Michaelis constant of enzyme (Km) is: a) The substrate concentration which gives maximal velocity b) The substrate concentration which gives 1/2 the maximal velocity c) 1/2 the substrate concentration which gives maximal velocity d) The enzyme concentration which gives maximal velocity e) The enzyme concentration which gives 1/2 the maximal velocity 3. A competitive inhibitor: a) Increases the Km of the enzyme b) Decreases the Vmax of the enzyme c) Increases the Vmax of the enzyme d) Decreases the Km of the enzyme e) Increases both Km and Vmax of the enzyme 4. The non-protein part of an enzyme is called: a) Apoenzyme b) Holoenzyme c) Allosteric Enzyme d) Isoenzyme e) Coenzyme 5. The major 6 classes of enzymes include: a) Transferases and Oxygenases b) Isomerases and Lyases c) Hydrolases and Epimerases d) Oxidoreductases and Catalases e) Transaminases and Transferases 6. Enzymes: a) Increase the energy barrier for a reaction b) Are recovered chemically altered after a complete reaction c) Increase the equilibrium constant of the reaction d) Activity is subject to regulation e) Are exclusively proteins

10

7. Coenzymes a) The non-protein part of enzymes b) Needed for enzyme activity c) Usually vitamin derivatives d) Termed prosthetic group if bonded tight to their enzymes e) All of the above are correct

8. At Vmax of an enzyme catalyzed reaction: a) Further increase in substrate concentration increases the rate of the reaction b) All the enzyme molecules are combined with substrate c) The substrate concentration that produces maximal velocity is termed Km d) Half the enzymes are combined with substrate e) Km is maximum 9. In case of non-competitive inhibition of enzymes a) Vmax can not be reached b) There is no significant alteration of the active site c) Inhibitor is structurally similar to the substrate d) Inhibitor can be removed by increasing substrate concentration e) Vmax is increased 10. Isoenzymes: a) Are factors required for enzyme activity b) Are functional plasma enzymes c) Show similar responses to inhibitor molecules d) Are important tools in the diagnosis & prognosis of disease e) Catalyze oxidation-reduction reactions 11. Hydrolases enzymes include: a) Racemases and oxygenases b) Isomerases and lyases c) Peptidases and lipases d) Oxidoreductases and catalases e) Transaminases and hydralases 12. Which of the following statements is true of enzyme catalysts? a) To be effective they must be present at the same concentration as their substrate b) They can increase the equilibrium constant for a given reaction by a thousand-fold or more c) They lower the activation energy for conversion of substrate to product d) Their catalytic activity is independent of pH e) They are generally equally active on D and L isomers of a given substrate 13. Allosteric effector influences the enzyme activity by: a) Covalently modifying the enzyme b) Binding to the substrate and altering its conformation c) Competing for catalytic site with substrate d) Changing the specificity of the enzyme for its substrate e) Binding to a site on the enzyme distinct from catalytic site 11

14. The following enzyme complex requires both thiamine and lipoic acid: a) Malate dehydrogenase b) Alpha-ketoglutarate dehydrogenase c) Fumarase d) Isocitrate dehydrogenase e) Succinate dehydrogenase 15. Sterioisomers: a) Diversify physical and chemical properties of molecules b) Have the same spatial configuration c) Exhibit enzyme specifity d) Include epimers, anomers and enantiomers e) All A, C and D are correct 16. In an enzyme catalyzed reaction: a) Enzymes increase the energy barrier for the reaction b) Enzymes form a perminant complex with the substrate c) After the reaction, enzymes are recovered unchanged d) V-max is reached in the presence of a non-competitive inhibitor e) The equilibrium constant is decreased 17. Isomerases: a) Racemases and mutases b) Phosphatases and hydratases c) Lyases and oxidases d) Transaminases and kinases e) Hydratases and glucosidases 18. Subclasses of oxidoreductases include: a) Kinases and oxygenases b) Reductases and dehydrogenases c) Racemases and oxidases d) Catalases and aminotransferases e) Peroxidases and anomerase 19. The active site of an enzyme: a) Is rich with hydrophobic amino acid side chains b) Binds allosteric effectors c) Is similar in shape to the substrate d) Occupies most of the enzyme molecule e) None of the above 20. Coenzymes: a) Are small organic molecules needed for enzyme activity b) Are associated with apoproteins c) Are vitamin derivatives d) Are called prosthetic groups if they are tightly bound to the enzyme e) All of the above is correct 21. In competitive inhibition of an enzyme: a) Km and Vmax are decreased b) Inhibitor is structurally similar to the substrate c) Inhibition cannot be reversed by increasing substrate concentration d) Vmax is decreased 12

e) The inhibitor binds to the regulatory site on the enzyme

22. In non-competitive inhibition of enzyme activity: a) Both Vmax and Km are increased b) Inhibitor has no structural resemblance to the substrate c) There is a significant alteration of the active site d) Vmax is decreased e) A is the only wrong answer 23. The following statements describe Allosteric enzymes: a) Effectors may enhance or inhibit substrate binding b) Binding of the substrate to the Allosteric site displaces the effectors c) They are always multimeric proteins d) The regulatory site is identical to the active site e) Binding of substrate to the active site releases allosteric effector 24. The following statements about regulation of enzyme activity are correct: a) Phosphorylation/ dephosphorylation is the common covalent modification b) Regulatory enzymes usually catalyze reversible reactions c) Allosteric inhibitors are usually the end products d) Increase in the enzyme level has no effect e) Irreversible inhibition is physiological type of regulation 25. Phosphorylation/ dephosphorylation of enzymes: a) Occurs on specific serine and threonine residues b) Is a covalent type of modification c) Is a reversible type of regulation d) Is achieved by the activities of protein kinases and phosphatases e) All of the above is correct 26. The enzyme for starch digestion is: a) Salivary amylase b) Pancreatic amylase c) Lysosomal glucosidase d) Both A and B e) All of the above is correct 27. Hydrolases include: a) Catalases and mutases b) Oxygenases and dehydrogenases c) Esterases and glucosidases d) Aminotransferases and racemases e) Epimerases and oxidases 28. The following enzymes are absent in muscles but are present in the liver: a) Pyruvate carboxylase and citrate synthase b) Glucose-6-phosphatase and glycerol kinase c) Lactate dehydrogenase and isocitrate dehydrogenase d) Pyruvate dehydrogenase and beta-ketothiolase e) Glycogen synthase and 3-HMG CoA synthase

29. Which of the following statements is true of enzyme catalysts? 13

a) To be effective, they must be present at the same concentration as their substrate b) They can increase the equilibrium constant for a given reaction by a thousand-fold or more c) They lower the activation energy for conversion of substrate to product d) Their catalytic activity is independent of pH e) They are generally equally active on D and L isomers of a given substrate 30. Isoenzymes: a) Are differentiated by dialysis b) Show the same electrophoretic mobility c) Include lactate dehydrogenase d) Are used as diagnostic tools e) Both C and D are correct 31. The pancreatic enzyme not involved in protein digestion is: a) Carboxypeptidase b) Trypsin c) Lipase d) Elastase e) Chymotrypsin 32. Restriction enzymes: a) Recognize specific nucleotide sequences in DNA b) Cut both strands of DNA c) Often produce single stranded tails d) Do all of the above e) Do none of the above 33. Enzymes involved in hydrolysis: a) Are called decarboxylases b) Use folic acid as a coenzyme c) Include dehydrogenases d) Include peptidases e) Always require coenzyme 34. Enzymes and pH: a) All enzymes have one optimum pH b) Enzymes in the stomach require alkaline pH c) All enzymes in eukaryotic cells require the same pH d) The optimum pH is the one at which the enzyme has maximum activity e) The pH is the same in the lysosome and plasma 35. Isomerases: a) Catalyze oxidation-reduction reactions b) Do not change the structural formula of the substrate c) Include transaminases d) Use water to break covalent bonds e) Require ATP to form covalent bonds 36. The following vitamin work as coenzymes with the corresponding enzyme: a) Biotin and carboxylases b) Cobalamin with isomerases c) Retinol with lyases d) Riboflavin with hydrolases 14

e) Thiamin and isomerases

VITAMINS
1. Vitamin A: a) Deficiency can give rise to xerophthalmia b) Is normally excreted in urine c) Carnitine, Retinine and Retinone are known forms d) Is required for collagen synthesis e) Can be synthesized by intestinal flora 2. Vitamin D: a) Requires parathyroid hormones for activation b) Is water-soluble c) Lowers calcium level in the blood d) Deficiency from overexposure to the sun e) Is not required in the diet 3. Vitamin K: a) Is derived from cholesterol b) Is synthesized by intestinal flora c) Deficiency causes night blindness d) Cannot be stored in the body e) Is involved in transamination reactions 4. Beriberi: a) Is due to deficiency of pyruvate dehydrogenase complex b) Affects the nervous system and the heart c) Is due to deficiency in Vitamin C d) Is associated with bone deformity e) Can be treated by iron supplements 5. Vitamin B12: a) Is a potent anti-oxidant b) Deficiency causes pellagra c) Vegetable seeds are a major source d) Is not stored in the body e) Requires the intrinsic factor for absorption 6. Pyridoxal Phosphate: a) Is vitamin B5 b) Deficiency causes rickets c) Is coenzyme with pyruvate carboxylase d) Can be synthesized in the human body e) Is needed by the enzyme alanine transaminase 7. The following is formed in the liver: a) Cholicalciferol b) 7- dehydrocholesterol c) 1, 25- dihydroxycholecalciferol d) 25- hydroxycholecalciferol 15

e) 24, 25- dihydroxycalciferol 8. Pernicous anemia is caused by: a) A deficiency of dietery vitamin B12 b) A deficiency of dietery folic acid c) Excessive production of HCl by parietal cells of the stomach d) A deficiency of the intrinsic factor e) A deficiency of vitamin C 9. Vitamin A: a) Is important for growth and reproduction b) Is obtained from beta-carotene c) Retinol and retinoic acid are known forms d) Is required for keratin synthesis e) All of the above is correct 10. Pellagra: a) Due to deficiency of pyruvate dehydrogenase complex b) Due to deficiency of riboflavin c) Associated diarrhea, dermatitis and dementia d) Treated by supplementation of tyrosine e) Inherited as autosomal recessive character 11. Thiamin pyrophosphate is essential coenzyme for: a) Pyruvate dehydrogenase and transketolase b) Transketolase and lactate dehydrogenase c) Glycogen phosphorylase and glucose-6-phosphatase d) Lactate dehydrogenase and alpha-ketoglutarate dehydrogenase e) None of the above 12. Ascorbic acid: a) Deficiency causes hypochromic microcytic anemia b) Is required for synthesis of epinephrine and collagen c) Is required for synthesis of bile acids d) Promotes iron absorption in GIT e) All of the above are correct 13. The following is not true about cobalamin: a) Active form is methylcobalamin b) Absorption requires a glycoprotein factor c) Is required for metabolism of propionate d) Deficiency results in hemolytic anemia e) Is involved in folate metabolism 14. The effects of vitamin A include all of the following except: a) Prevention of infection b) Serving as an antioxidant c) Cell differentiation d) The visual cycle e) Induction of certain cancers

15. The vitamin component of coenzyme A is: a) Riboflavin b) Biotin 16

c) Panthothenic acid d) Nicotinic acid e) Pyridoxine 16. Vitamin A: a) Deficiency can give rise to rickets b) Is normally excreted in urine c) Carnitine, Retinine and Retinone are known forms d) Is required for collagen synthesis e) Is important for epithelial growth 17. Vitamin D: a) Requires thyroid hormones for activation b) Active form is called calcitrol c) Lowers calcium level in the blood d) Deficiency from overexposure to the sun e) Is not required in the diet 18. Vitamin K: a) Is derived from cholesterol b) Is needed for activation of prothrombin c) Deficiency causes night blindness d) Cannot be stored in the body e) Is involved in transamination reactions 19. Beriberi: a) Is due to deficiency of pyruvate dehydrogenase complex b) Is due to deficiency in Vitamin C c) Is associated with bone deformity d) Can be treated by iron supplements e) Is associated with high lactate in the blood 20. Vitamin B12: a) Is a potent anti-oxidant b) Deficiency causes pellagra c) Vegetable seeds are a major source d) Binds transcobalamin I in the liver e) Is absorbed in the stomach 21. Pyridoxal phosphate: a) Is vitamin B2 b) Deficiency is very common c) Is coenzyme with pyruvate carboxylase d) Can be synthesized in the human body e) Is coenzyme with aminotransferases

22. Synthesis of vitamin B12 occurs in the: a) Stomach b) Duodenum c) Jejunum d) Ileum e) Colon 17

23. The vitamins involved in energy producing reactions include: a) Folic acid, thiamin and niacin b) Biotin, niacin and cobalamin c) Thiamin, niacin and pantothenic acid d) Cobalamin, ascorbic acid and riboflavin e) Pyridoxine, folic acid and cobalamin 24. The following vitamins act as coenzymes with dehydrogenases: a) Thiamin and panthothenic acid b) Biotin and pyridoxine c) Cobalamin and folic acid d) Ascorbic acid and biotin e) Niacin and riboflavin 25. The following vitamins are involved in hemopoiesis: a) Ascorbic acid and thiamin b) Folic acid and cobalamin c) Riboflavin and biotin d) Pyridoxine and thiamin e) Niacin and panthothenic acid 26. The vitamins synthesized by intestinal bacteria include: a) Thiamin and riboflavin b) Biotin and vitamin K c) Folic acid and cobalamin d) Niacin and vitamin C e) Vitamin D and panthothenic acid

CARBOHYDRATES
1. The following is the main aldohexose in the blood: a) Fructose b) Mannose c) Glucose d) Galactose e) Alcose 2. Glycogen is: a) A storage form of carbohydrate in plants b) A polymer of glucose and fructose c) A structural polysaccharide d) Abundant in adipose tissue e) A branched sugar 3. The following properties are common for both glucose and ribose: a) Both are aldoses b) Both are found in DNA and RNA c) Both are found in disaccharides d) Both are obtained on hydrolysis of amylopectin e) Both are ketoses 18

4. The following is a disaccharide and non-reducing sugar: a) Lactose b) Fructose c) Maltose d) Sucrose e) Cellubiose 5. Proteoglycans: a) Are composed of cellulose and pectin b) Are the major source of energy for ruminants c) Act as lubricants in the joints d) Give a blue color with iodine e) Are degraded to free glucose in the lumen of the intestine 6. Carbohydrates: a) Are polyhydroxyaldehydes or ketones b) Are polyhydroxyphenols c) Include glucagon d) Are components of phosphingolipids e) Circulate in the blood as polymers

7. Glycogen is: a) A storage form of carbohydrate in plants b) A branched sugar c) A polymer of glucose d) A structural polysaccharide e) Both B and C are correct 8. Benedict's test: a) Does not differentiate between reducing substances b) Is not specific for glucose c) Is positive for ascorbic acid d) Involves an oxidation-reduction reaction e) All of the above are correct 9. The following is a structural polymer of glucose: a) Amylopectin b) Inulin c) Amylose d) Cellulose e) Mannitol 10. The following properties are common for both D- glucose and D- ribose: a) Both are reducing sugars b) Form intramolecular hemiacetal bonds c) Both are aldoses d) A, B and C are correct e) A is the only correct answer 19

11. The following are non-reducing sugars: a) Glucose and sucrose b) Fructose and Trehalose c) Maltose and Lactose d) Sucrose and Trehalose e) Lactose and Ribose 12. Cellulose: a) Is a major constituent of the plant framework b) Is the major source of energy in humans c) Is a polymer of N-acetyl glucosamine d) Is made up of glucose units attached by alpha 1,4 glycosidic link e) Can be degraded to free glucose in humans 13. Glycosaminoglycans: a) Are bacterial and structural polysaccharides b) Include chondriotin sulphate c) Are membrane glycolipids d) Are polymers of glucose e) Are the major dietary carbohydrates

14. Carbohydrates: a) Are polyhydroxyaldehydes and acetone b) Are polyhydroxyketones c) Include glycoproteins d) Are components of glycerophospholipids e) Are components of lecithin 15. Isomers of glucose: a) All have six carbon atoms b) Include mannose c) Can be epimers or anomers d) Differ only in configuration e) All of the above are correct 16. Which of the following statements is true of glucose? a) It is ketoaldose b) It is found in DNA and RNA c) It is part of the disaccharide sucrose d) It is obtained on hydrolysis of galacesylceramide e) It is constituent of globular proteins 17. Which of the following can be considered as a non-carbohydrate? a) Starch b) Proteoglycan c) Glycoprotein d) Cellulose e) Peptidoglycan 18. Which of the following can be synthesized from glucose in the human body: a) Ribose b) Lactose 20

c) Sucrose d) Cellulose e) Both A and B are correct 19. Inulin: a) Is a glycoprotein b) Is the chief constituent of the framework of plants c) Is a fructosan d) Solution gives the blue colour with iodine e) Is used only for determination of the glomerular filtration rate 20. The following are aldohexoses: a) Fructose and galactose b) Mannose and fructose c) Glucose and galactose d) Galactose and ribose e) Maltose and glucose

21. Glycogen is: a) A storage form of carbohydrates in plants b) Main branched polymer of glucose c) A structural homopolysaccharide d) Abundant in adipose tissue e) Stored in the liver 22. Benedict's test: a) Is positive for ascorbic acid b) Involves an oxidation-reduction reaction c) Does not differentiate between reducing substances d) Is specific for glucose e) All of the above are correct 23. The following are polymers of glucose: a) Pectin and collagen b) Inulin and glycogen c) Amylose and cellulose d) Cellulose and chitin e) Mannitol and starch 24. The following properties are common for both D-glucose and D-ribose: a) Are reducing sugars b) Form intramolecular hemiacetal bonds c) Have functional groups that can form glycosidic linkages d) Are aldoses e) All of the above are correct 25. The following is a non-reducing sugar from plants a) Glucose b) Fructose c) Maltose d) Sucrose e) Trehalose 21

26. Glycosaminoglycans: a) Are highly hydrophobic b) Have a cushioning function c) Contain abundant negative charges d) Act as enzymes e) Are the same as glycoproteins 27. The following is a structural polymer of glucose: a) Inulin b) Chitin c) Amilopectin d) Cellulose e) Peptidoglycan

28. Glycoproteins: a) Contain more protein than carbohydrates b) Act as receptors c) Contain N-linked and/or O-linked oligiosaccharides d) Act as enzymes e) Are space occupying

`CARBOHYDRATE METABOLISM
1. Gluconeogenesis: a) Is favoured when isulin concentration is high b) Occurs in the liver during prolonged fasting c) Allows skeletal muscle to produce glucose for export to blood for use by the CNS d) Is stimulated by high levels of glucose-6-phosphate e) Uses Acetyl CoA as substrate 2. Glucose-6-phosphate dehydrogenase: a) Is the key enzyme in glycogenesis b) Is activated by high levels of NADP+ c) Catalyzes conversion G6P to fructose-6-phosphate d) Is important in muscle during exercise e) Not found in RBC's 3. In the TCA cycle: a) 3 ATP's are produced by substrate-level phosphorylation b) Oxygen is directly involved c) All reactions are reversible d) Succinyl CoA is the precursor for Heme synthesis e) Oxaloacetate is converted to pyruvate 4. The following can be synthesized from glucose in the human body: a) Ribose and lactose b) Lactose and cellulose c) Sucrose and ribulose 22

d) Cellulose and fructose e) Fatty acid sucrose 5. Glucose-6-phosphate deficiency: a) Is known as Von Gierke's disease b) Is associated with hypoglycemia in the fed state c) Inhibits the last step of glycogenolysis and gluconeogenesis in the liver d) Is associated with hyperuricemia e) B is the only wrong statement 6. In glycogenesis: a) ATP is required b) Phosphoglucomutase catalyses irreversible step c) Glucose residues are added to the reducing end of glycogen d) Glycogen synthase is the key enzyme e) 2 ATP molecules are consumed 7. In galactosemia: a) Treatment involves restriction of glucose in diet b) The liver function can be seriously affected c) Galactose is deposited in tissues d) Galactose is readily converted to glucose e) Galactosuria is the most serious manifestation 8. Uncoupling of oxidative phosphorylation: a) Decreases the oxygen consumption b) Releases heat only c) Occurs during hypoxia d) Causes a buildup of NADH e) Produces more ATP 9. The enzyme not involved in glycolyisis is: a) Aldolase b) Endolase c) Pyruvate kinase d) Phosphoglycerate mutase e) Alpha phosphoglycerate dehydrogenase 10. Which of the following is not a glycolytic intermediate? a) Glucose-6-phosphate b) Fructose-6-phosphate c) Dihydroxyacetone phosphate d) Pyruvate e) Glycerol-3-phosphate 11. Which site utilizes glucose as an energy source exclusively in all conditions: a) Brain b) Muscle c) Liver d) Fat cell e) Erythrocyte 12. The following agent interferes with oxidative phosphorylation: a) Cyanide inhibits NADH-dehydrogenase 23

b) Carbon monoxide inhibits Coenzyme Q c) Rotenone enhances electron transfer d) Oligomyein inhibits electron transfer e) Dintrophenol uncouples phosphorylation from electron transfer 13. The following compounds are part of the pyruvate dehydrogenase complex: a) Thiamin diphosphate b) Lipoamide c) CoA d) NAD+ e) All of the above 14. UDP-G: a) Is derived from vitamin B1 b) Is a substrate for the enzyme glycogen phosphorylase c) Is intermediate in glycerophospholipid synthesis d) Is not required for normal galactose metabolism e) Can be formed from UDP-Galactose

15. Glycogen phosphorylase: a) Is a mitochondrial enzyme b) Is activated by dephosphorylation c) Acts by the same mechanism as intestinal amylase d) Produces uridine diphosphate from glycogen e) Produces glucose-1-phosphate 16. Fructose 2,6 bisphosphate: a) Is a glycolytic intermediate b) Activates phosphofructokinase 1 c) Is synthesized by phopshofuctokinase 1 d) Enhances fructose 1,6 bisphosphate e) Level in the liver is increased by glucagon 17. Pyruvate carboxylase: a) Converts acetyl CoA to pyruvate b) Requires carnitine c) Converts pyruvate to oxaloacetate d) Is activated by high fructose 1,6 bisphosphate e) Requires pyridoxal phosphate 18. In glycogen storage diseases: a) Von Gierke's disease is type III b) Hypoglycemia is the main feature of type V c) Type II is associated with glucose 6 phosphatase deficiency d) Type IV is called Andersen's disease e) Hepatomegally is the main feature of all types 19. Which of the following statements about galactosemia is correct: a) Treatment involves restriction of glucose in the diet 24

b) A deficiency of glucokinase is the major case c) Is treated by elimination of galactose from the diet d) Can be treated by restricting sucrose in the diet e) Is inherited as autosomal dominant character 20. Glucose-6-phosphate dehydrogenase: a) Is the key enzyme in glycogenesis b) Deficiency can cause hemolytic anemia c) Catalyses conversion of G6P to fructose-6-phosphate d) Is important in muscles during exercise e) Is not found in RBC's 21. Synthesis of glucose from pyruvate by gluconeogenesis in the liver: a) Occurs exclusively in the cytosol b) Is inhibited during prolonged fasting c) Requires participation of biotin d) Requires lactate as intermediate e) Occurs exclusively in the mitochondrion

22. In the TCA cycle: a) Four NADH molecules are produced b) Substrate-level phosphorylation occur by the action of sccinyl CoA thiokinase c) The reactions can proceed in the absence of molecular oxygen d) Fumarase reactions occur immediately after isocitrate dehydrogenases reactions e) Glutamate dehydrogenase is a key enzyme 23. In fructose metabolism: a) Deficiency of hexokinase results in fructosuria b) Glucokinase is the major enzyme c) Fructokinase phosphorylates fructose d) Fructose 6 phosphate is produced by fructokinase e) Aldolase A is the key enzyme 24. Oxidation of glucose by red blood cells gives: a) Lactate + NADH+H b) 36 ATP molecules per molecule of glucose c) Lactate and NAD+ d) Carbon dioxide and water e) 2 NADPH 25. The pentose phosphate pathway: a) Produces ATP b) Is a mitochondrial pathway c) Is important for reductive biosynthesis d) Is least active in the liver e) Is inhibited by high glucose levels 26. The following agent interferes with oxidative phosphorylation: a) Carbon monoxide inhibits cytochrome reductase 25

b) Cyanide inhibits NADH-dehydrogenase c) Rotenone enhances electron transfer d) Oligomyein inhibits electron transfer and phosphorylation e) Dintrophenol enhances ATP synthesis 27. UDP-Glucose: a) Is indirectly involved in bilirubin conjugation b) Is a substrate for the enzyme 4-epimerase in lactating mammary gland c) Is intermediate in sphingolipid synthase d) Is required for galactose metabolism e) All of the above 28. Glycogen synthesis: a) Is a mitochondrial pathway b) Is activated during the fasting state c) Occurs in the liver and muscle d) Produces uridine diphosphate from glycogen e) All of the above

29. Pyruvate is: a) Converted to acetyl CoA by pyruvate carboxylase b) Four-carbon compound c) Converted to oxaloacetate by pyruvate dehydrogenase complex d) Converted to alanine by transamination e) Intermediate in the TCA cycle 30. In glycogen storage diseases: a) Fatigability and muscle cramps are main features of Von Geirke's disease b) Hypoglycemia is the main feature of type V c) Type II is associated with glucose 6 phosphatase deficiency d) Type IV is called Andersen's disease e) Hepatomegally is the main feature of all types 31. The following enzyme would be impaired in biotin deficiency: a) Fructose 1,6-bisphosphate b) Pyruvate kinase c) PEP carboxykinase d) Pyruvate carboxylase e) Malate dehydrogenase 32. The following statement about the pentose phosphate pathway is correct: a) Pentoses can be formed both oxidatively and non-oxidant b) This pathway is important to fatty acid synthesis because it produces equivalents c) Fructose 6 phosphate can be used to make ribose-5-phosphate d) Glyceraldehyde-3-phosphate can be used to make dinitrophenol e) All of the above are correct 33. The following is caused by deficiency in aldolase B: a) Hereditory fructose intolerence b) Jaundice c) Hypoglycemia 26

d) Catarct e) Ataxia 34. The rate of glycolysis in the liver is increased by: a) Insulin b) ATP c) Citrate d) NADH e) Glucose 6-phosphate 35. The preparative step of glycolysis involves the following: a) ATP synthesis at the substrate level b) The incorporation of Pi into a triose phosphate c) The reduction of NAD+ to NADH d) The formation of 1,3-bisphosphoglycerate e) Formation of triose phosphates from a hexose diphosphorase

36. The following is present in the liver, but is absent in muscles: a) Pyruvate carboxylase b) Glycogen synthase c) Lactate dehydrogenase d) Pyruvate dehydrogenase e) Glucose-6-phosphatase 37. The following enzyme utilizes FAD as a coenzyme: a) Malate dehydrogenase b) Aconitase c) Succinate dehydrogenase d) Isocitrate dehydrogenase e) Lactate dehydrogenase 38. A patient complaining of painful cramps in the legs during exercise and has easy fatigability, the most likely cause is: a) Diabetes mellitus b) Deficiency of glucose-5-phosphatase c) Deficiency of the debranching enzyme or muscle phosphorylase d) Defective glycogen synthesis e) Over-storage of glycogen 39. Malonate inhibits succinate dehydrogenase because: a) Binds irreversibly to the active site b) Covalently modifies the enzyme c) Resembles succinate but cannot react d) Displaces he FAD coenzyme e) Chelates a metal ion required by the enzyme 40. In oxidative phosphorylation: a) An electrochemical potential is created across the inner mitochondrial membrane b) ATP is synthesized from ADP and Pi c) Protons are pumped into the interspace between the inner and outer 27

mitochondrial membranes d) The energy released from the electron flow is directly used for synthesis of ATP e) D is incorrect 41. Phosphofructokinase-1: a) Is activated by high level of ATP b) Catalyzes the only irreversible reaction in glycolysis c) Is activated by the high level of AMP d) Converts fructose 1-phosphate to fructose 1,6-bisphosphate e) Is costimulated with fructose 1,6 bisphosphatase 42. In gluconeogenesis: a) Pyruvate is converted to acetyl CoA b) Valine and Leucine are substrates c) Energy consumption is high d) Insulin is needed to enhance the synthesis of glucose e) Acetyl CoA is a substrate 43. Glycogen synthesis: a) Is typically the reverse of glycogenolysis b) Is mitochondrial pathway c) Is very active in adipose tissue d) Requires uridine diphosphate-glucose as intermediate e) Is activated by adrenaline 44. Galactosemia: a) Causes mental retardation b) Can cause liver failure c) Is caused by deficiency of galactose-1-phosphate uridyl transferase d) Can be treated by restricting galactose from the diet e) All of the above is correct 45. The following can be obtained from the TCA cycle intermediates: a) Fatty acids and glucose b) Cholesterol and ketone bodies c) Heme and glutamine d) A, B and C are correct e) Only B is correct 46. The tissue which can metabolize normally glucose, fatty acids and ketone bodies for ATP production is: a) Liver b) Skeletal muscle c) Brain d) Red blood cell e) All of the above 47. All of the following compounds are part of the pyruvate dehydrogenase complex except: a) Thiamine diphosphate b) Lipoamide c) Biotin d) FAD 28

e) NAD+ 48. Which of the following glycolytic intermediates is a close precursor to TAG: a) Glucose 6 phosphate b) Fructose 6 phosphate c) Dihydroxyacetone phosphate d) Pyruvate e) 3-phosphoglycerate 49. The carbon skeleton of glucose can participate in the synthesis of : a) Purine ring b) Fatty acid c) Glutamine d) Pyrimidine ring e) All of the above is correct

50. The following agent interferes with oxidative phosphorylation: a) Cyanide inhibits NADH-dehydrogenase b) Carbon monoxide inhibits coenzyme Q c) Rotenone enhances electron transfer d) Oligomyein inhibits electron transfer e) Dintrophenol uncouples phosphorylation from electron transfer 51. In oxidative phosphorylation: a) Ubiquinone transfers electrons from complex I to complex II b) Dinitrophenol inhibits the flow of electrons c) The electrons transported from one FADH2 to oxygen will produce 3 ATP's d) Complex IV contains copper e) Complex III is called cytochrome oxidase 52. In galactosemia: a) Cataract results from accumulation of galactose in the lens b) The liver function can be seriously affected as a result of phosphate depletion c) Galactose is deposited in tissues d) Galactose is readily converted to glucose e) Galactosuria is the most serious manifestation 53. The pyruvate dehydrogenase complex defect is mainly manifestd in the following condition: a) Beriberi b) Pellagra c) Pernicious Anemia d) Scurvy e) Rickets 54. The committed step in glycolysis is catalyzed by: a) Hexokinase b) Phosphofructokinase-1 c) Pyruvate kinase d) Phosphoglycerate mutase e) Glyceraldehyde 3 phosphate dehydrogenase 29

55. The following agent interferes with oxidative phosphorylation: a) Cyanide inhibits NADH-dehydrogenase b) Carbon monoxide inhibits Coenzyme Q c) Rotenone enhances electron transfer d) Cyanide inhibits cytochrome oxidase e) Oligomycin inhibits electron transfer 56. The pyruvate dehydrogenase complex: a) Requires pyridoxal phosphate b) Is inactive when thiamin is deficient c) Deficiency results in pernicious anemia d) Catalyses a carboxylation reaction e) Is a key enzyme in the red blood cell

57. Activation of phophofructokinase-1 in the liver: a) Inhibits hexokinase b) Enhances gluconeogenesis c) Enhances the activity of pyruvate kinase d) Occurs as a result of high glucagons/insulin ratio e) Results in accumulation of fructose-6-phosphate 58. Which of the following cells utilize glucose, fatty acid and ketone bodies as fuels: a) Neuron b) Myocyte c) Hepatocyte d) Adipocyte e) Erythrocyte 59. Glycogen phosphorylase: a) Is activated by insulin b) Is activated by dephosphorylation c) Requires inorganic phosphate d) Produces uridine diphosphate glucose from glycogen e) Is a key enzyme in gluconeogenesis 60. In oxidative phosphorylation: a) Ubiquinone transfers electrons from complex I to complex II b) Dinitrophenol inhibits the flow of electrons c) The electrons transported from one FADH2 to oxygen will produce 3 ATP d) A decrease in oxygen supply increases the flow of the electrons through the complexes e) An increase in the rate of ATP synthesis will decrease electron transport 61. Glycogen: a) Is found in liver and muscle b) Is a branched polysaccharide formed from glucose c) Is responsible for maintenance of blood glucose level between meals d) Excessively deposits in liver of von Geirk's disease patient e) All of the above is correct 62. Fructose: 30

a) Enters directly into glycolysis as Fructose-6-phosphate in the liver b) Is isomerized to glucose before catabolism c) Is a potent lipogenic factor d) Is produced from lactose e) Is a non-reducing sugar 63. Hypoglycemia can result from: a) Deficiency of debranching enzyme (Cori's disease) b) Deficiency in glucose-6-phosphatase c) Defects in beta oxidation in the liver d) Insulin overdose e) All of the above is correct

64. The common features of glycolysis and the PPP include: a) Both pathways produce carbon dioxide b) Both pathways use NAD as coenzyme c) Both pathways are mitochondrial d) Both pathways produce ATP e) Both pathways occur in RBC's 65. Gluconeogenesis: a) Is the reversal of glycolysis b) Is active during prolonged fasting c) Requires participation of carnitine d) Uses acetate as substrate e) Is very active in the fed state 66. Galactosemia: a) Is caused by increased galactose intake b) Can be avoided by using sucrose-free diet c) Is associated with hypoglycemia d) Results from galactose-1-phosphate uridyl transferase deficiency e) Is a genetic disorder caused by lactase deficiency 67. Hereditary fructose intolerance: a) Is always associated with hypoglycemia b) Results from fructokinase deficiency c) Results from aldose b deficiency d) Results in accumulation of fructose-6-phosphate e) Can be treated by restriction of lactose in the diet 68. Muscle glycogen: a) Accumulates in lysosomes in Pomp's disease b) Is largely depleted by marathon running c) Provides phosphohexoses for muscular glycolysis d) Provides most of glucose in the blood e) A, B and C are correct 69. An enzyme that produces non-mitochondrial NADH is: a) Alpha-ketoglutarate dehydrogenase b) Glyceraldehyde 3 phosphate dehydrogenase c) Succinate dehydrogenase 31

d) 6-phophogluconate dehydrogenase e) 3-HMG CoA synthase 70. Glycerol-3-Phosphate: a) Is produced by reduction of dihydroxyacetone phosphate b) Is precursor of phosphatidic acid c) Can be produced by glycerol kinase d) Is intermediate in TAG synthesis e) All of the above is correct

71. The following agent interferes with oxidative phosphorylation: a) Cyanide inhibits NADH dehydrogenase b) Carbon monoxide inhibits coenzyme Q c) Rotenone enhances electron transfer d) Oligomycin inhibits complex I e) Dinitrophenol uncouples phosphorylation from electron transfer 72. In the fed state: a) Glucose is converted to glycogen and stored in skeletal muscle b) Adipose tissue converts triglycerides to glucose c) Amino acids are transaminated to form ketone bodies d) Glycogen stores in liver are depleted e) Glycogen phosphorylase is in the active form 73. Twenty four hours after a meal, the primary source of glucose carbons for the brain is: a) Skeletal muscle protein b) Glycerol from adipose tissue c) Dietary glucose d) Muscle glycogen e) Both A and B are correct 74. Activity of the following enzyme is expected to increase in the fed-state: a) Lactate dehydrogenase b) Glucose 6-Phosphate dehydrogenase c) Glucose 6-Phosphatase d) Glycogen phosphorylase e) PEP carboxykinase 75. The following enzymes are absent in muscles but are present in the liver: a) Pyruvate carboxylase and citrate synthase b) Glucose-6-phosphatase and glycerol kinase c) Lactate dehydrogenase and isocitrate dehydrogenase d) Pyruvate dehydrogenase and beta-ketothiolase e) Glycogen synthase and 3HMG CoA synthase 76. Concerning inhibition of the electron transport chain: a) Cyanide inhibits NADH dehydrogenase b) Carbon monoxide inhibits coenzyme Q c) Rotenone enhances electron transfer 32

d) Oligomycin inhibits complex I e) Dinitrophenol uncouples phosphorylation from electron transfer 77. Liver glycogen synthase and PFK-1: a) Are activated simultaneously in the fed state b) PFK-1 is activated before glycogen synthase c) Both are allosteric enzymes d) Both are activated by insulin e) All of the above is correct

78. Insulin activates PFK-1 in the liver by: a) Increasing the level of AMP b) Phosphorylation c) Increasing the level of fructose 2,6 bisphosphate d) Inhibiting fructose 1,6 bisphosphatase e) None of the above 79. Metabolism of the major fuels mostly culminate in: a) Glucose 6 phosphate b) Pyruvate c) Oxaloacetate d) Acetyl CoA e) Fumerate 80. In the liver during the fed state: a) Glucokinase indirectly enhances uptake of glucose b) Hexokinase is inhibited c) Glucose 6 phosphate dehydrogenase is very active d) Glycogen phosphorylase is dephosphorylated e) All of the above is correct 81. Glycerol 3 phosphate dehydrogenase: a) Converts glycerol 3 phosphate to DHAP in the fed state b) Converts DHAP to glycerol 3 phosphate in the fasting state c) Catalyses a reversible reaction d) Is an allosteric enzyme e) Is a glycolytic enzyme 82. Liver enzymes which are active in the fed state include: a) Glycerol kinase b) PEP carboxykinase c) Pyruvate kinase d) Glucose 6 phosphatase e) Glycogen phosphorylase 83. Insulin: a) Activates acetyl CoA carboxylase b) Causes the phosphorylation of acetyl CoA carboxylase c) Stimulates lipolysis d) Inhibits the formation of malonyl CoA e) Inhibits fatty acid synthesis in adipose cells 33

84. Insulin exerts its effect on target tissue through: a) Enhancing tyrosine synthesis b) Binding tyrosine kinase receptor c) Increasing phosphorylation of all cellular proteins d) Increasing intracellular cAMP e) Inhibition of protein kinase C

85. Glucagon: a) Is a steroid hormone b) Binds intracellular receptors c) Mimic all actions of epinephrine d) Enhances glycogenolysis in the liver e) Is transcriptional enhancer 86. Hypoglycemia: a) Is caused by hyperinsulinemia b) Is prominent feature of DKA c) Enhances release of glucagon d) Affects the brain seriously e) B is the only wrong statement 88. In Diabetes Mellitus: a) Type II is more common than type one b) Type I is more serious than type II c) Type I is called insulin dependent d) DKA is usually associated with type I e) All of the above is correct 89. Glucose alanine cycle: a) Serves to carry amino groups from the skeletal muscle to the liver b) Requires participation of gluconeogenesis in the liver c) Provides the working muscle with glucose made by the liver d) Requires participation of transamination reactions in both the skeletal muscle and the liver e) All of the above is correct 90. Lactate is increased in the blood: a) During sleep b) During exercise c) In Von Gierke's disease d) Thiamin deficiency e) B, C and D are correct 91. Glucose, fatty acids and ketone bodies are normally oxidized for ATP production by: a) Liver b) Skeletal muscle c) Brain d) Red blood cell 34

e) All of the above is correct 92. During prolonged starvation, all of the following tissues can use fuels other than glucose except: a) Red blood cells b) Muscle c) Brain d) Kidney e) Adipose tissues

93. The enzyme which is not involved in glycolysis is: a) Aldolase b) Enolase c) Pyruvate kinase d) Phosphoglycerate mutase e) Alpha phosphoglycerate dehydrogenase 94. Activation of phosphofructokinase-1 in the liver: a) Inhibits hexokinase b) Enhances gluconeogenesis c) Enhances the activity of pyruvate kinase d) Occurs as a result of high glucagons/insulin ratio e) Results in accumulation of fructose 6 phosphate 95. Which of the following glycolytic intermediates is converted to a precursor of TAG synthesis: a) Glucose 6 phosphate b) Fructose 6 phosphate c) Dihydroxyacetone phosphate d) Pyruvate e) PEP 96. Human liver usually produces glucose during prolonged fasting from: a) Palmitic acid and alanine b) Glycerol and lactate c) Leucine and Serine d) Galactose and fructose e) Lactate and acetyl CoA 97. The Electron Transport Chain: a) Produces ATP at substrate level b) Produces 3 ATP's per FADH2 c) Gets NADH and FADH2 from beta oxidation and TCA cycle d) Occurs in the mitochondrial matrix e) Is inhibited by carnitine 98. The Hexose Monophosphate Shunt: a) Is the same as PPP b) Releases CO2 c) Produces NADPH d) Is active in the adrenal cortex e) All of the above is correct 35

99. Phosphofructokinase-1: a) Allosteric enzyme b) Activated by ATP c) Catalyses a reversible step d) Produces fructose 2,6 bisphosphate e) All of the above is correct

100. Type 1 glycogen storage disease: a) Is known as Cori's disease b) Is associated with cardiomegally c) Causes hyperglycemia d) Is known as McArdle's disease e) None of the above 101. In the TCA cycle: a) Malate dehydrogenase catalyzes a reversible reaction b) Malonate is an intermediate c) Two ATP molecules are produced d) All reactions are reversible e) All intermediates are phosphorylated 102. In gluconeogenesis: a) Lactate comes from the RBC's and the brain b) Glycerol is produced from TAG in the adipose tissue c) Linolenic acid is a substrate d) The rate of glucose production increases during the fed state e) B is the only correct answer 103. Glycogenolysis: a) Is synthesis of glucose from non carbohydrates b) Produces fructose 1 phosphate c) Is a cytosolic pathway d) Is active in the fed state e) Require glycogen synthase 104. In galactosemia: a) Galactosuria is the most serious maifestation b) Cataract results from accumulation of galactose in the lens c) Galactose is converted to galactitol d) The liver function can be seriously affected as a result of phosphate depletion e) Both C and D are correct 105. Oxidative PPP: a) Needs F6P as Substrate b) Is activated by high levels of NAP+ c) Catalyzes conversion of G6P to F6P d) Is important in muscle during exercise e) Is active in the fasting state 106. The TCA Cycle: 36

a) Provides Acetyl CoA for Ketone Body Synthesis b) Is inactive in the absence of Oxygen c) Converts all amino acids to Glucose by Gluconeogenesis d) Is blocked by excessive Beta-Oxidation e) Can convert Oxaloacetate to Pyruvate

107. Glucose-6-Phosphatase Deficiency: a) Is known as Von Gierke's Disease b) Is associated with Hypoglycemia c) Inhibits Glycogenolysis & Gluconeogenesis in the liver d) Is associated with Hyperuricemia e) All of the above is correct 108. The following is required in both Glycogenesis and Glycogenolysis: a) CTP b) Phosphoglucomutase c) Glucose residues are added to the reducing end of Glycogen d) Glycogen Synthase e) Insulin 109. The Liver: a) Has a high capacity for Fatty Acid Oxidation b) Can produce Glucose from Glycerol c) Is the only site for Ketogenesis d) Activates acetoacetate to acetoacetyl CoA e) D is the only wrong answer 110. In the fed state, glucose reaching the liver has the following fates: a) Is converted into Glycogen b) May be converted into Triacylglycerols c) Is oxidized to produce ATP d) Is oxidized via PPP to generate ribose and NADPH e) All of the above is correct 111. In the well-fed state: a) There is high glucose level in the portal blood b) There is high chylomicrons in the portal blood c) Hexokinase is very active in the liver d) Lipogenesis is active only in adipose tissue e) The liver converts Lactate to Fatty Acids 112. The following liver enzymes have decreased concentration in the fasting state: a) G-6-Phosphatase b) Phosphoenolpyruvate Carboxykinase c) F1,6-Bisphosphate d) G-6-P Dehydrogenase e) Pyruvate Carboxylase 113. Metabolism of major fuels (glucose, fatty acids, amino acids) mostly culminate in: a) Glucose-6-Phosphate b) Pyruvate 37

c) Oxaloacetate d) Acetyl CoA e) Fumerate

114. In the fed state, glucose reaching the liver has the following fates: a) Is converted into Glycogen b) May be converted into Triacylglycerols c) Is oxidized to produce ATP d) Is oxidized via PPP to generate ribose and NADPH e) All of the above is correct 115. Glycogen synthesis: a) Is a reversible pathway b) Is a mitochondrial pathway c) Is activated during the fasting state d) Occurs in the liver and muscle e) Produces Uridine Diphosphate from Glycogen 116. Fructose 2,6 bisphosphate: a) Is not a glycolytic intermediate b) Activates phosphofructokinase 1 c) Is synthesized by phopshofuctokinase 2 d) Inhibits fructose 1,6 bisphosphate e) All of the above is correct 117. In glycogen storage diseases: a) Fatigability and muscle cramps are main features of Von Geirke's disease b) Hypoglycemia is the main feature of type V c) Type II is associated with glucose 6 phosphatase deficiency d) Type IV is due to deficiency of the branching enzyme e) Hepatomegally is the main feature of all types 118. The following enzyme requires biotin as a coenzyme: a) Fructose 1,6-bisphoshate b) Pyruvate kinase c) PEP carboxykinase d) Pyruvate carboxylase e) Malate dehydrogenase 119. All the following enzymes are present in the liver and muscle except: a) Pyruvate Carboxylase b) Glycogen Synthase c) Lactate Dehydrogenase d) Pyruvate Dehydrogenase e) Glucose-6-Phosphatase 120. The Pyruvate Dehydrogenase Complex: a) Requires pyridoxal phosphate b) Deficiency results in pernicious anemia c) Is inactive when Vitamin B1 is deficient d) Catalyzes a carboxylation reaction e) Is a key enzyme in the Red Blood Cell 38

LIPIDS
1. The following are essential amino acids: a) Linoleic acid and Palmitic acid b) Palmitic acid and Archidonic acid c) Linolenic acid and Linoleic acid d) Stearic acid and Linolenic acid e) Linoleic acid and Arachidonic acid 2. Arachidonic Acid: a) Is a branched fatty acid b) Contains 3 double bonds c) Is a precursor for eicosanoids d) Contains 5 double bonds e) Is a 20-carbon saturated fatty acid 3. A membrane phospholipids that contains glycerol is: a) Phosphatidyl Choline b) Sphingomyelin c) Cerebroside d) Ganglioside e) Ceramide 4. Lipids are important in the human body because they act as: a) Enzymes b) Immune molecules c) Lubricants d) Stored genetic information e) Energy source 5. The following compound is a simple lipid a) Methionine b) Lecithin c) Cholesterol d) Triacylglycerol e) Amylopectin 6. Fatty acids: a) Are always dicarboxylic 39

b) Are only composed of an even number of C atoms c) Are obtained from the hydrolysis of triacylglycerol d) Contains glycerol e) Are the only components of cell membrane lipids

7. The following are saturated fatty acids: a) Linoleic acid and archidic acid b) Palmitic acid and stearic acid c) Linolenic acid and myristic acid d) Stearic acid and linolenic acid e) Oleic acid and lauric acid 8. Arachidonic acid is: a) The same as arachidic acid b) Essential fatty acid c) The precursor of prostaglandins d) Not found in membrane lipids e) Is a 22-carbon compound 9. Membrane phospholipids which contain glycerol include: a) Lecithin and cardiolipin b) Sphingomyelin and lecithin c) Cerebroside and Phosphatidyl serine d) Cardiolipin and gangliosides e) Ceramide and phosphatidyl inosital 10. Lipids are important in the human body because they act as: a) Enzymes and hormones b) Hormones and energy source c) Coenzyme and enzymes d) Stored genetic information e) Energy source and lubricants 11. The following are derived lipids: a) Vitamin D and methionine b) Lecithin and cholesterol c) Cholesterol and palmitic acid d) Dolicol and coenzyme Q e) Amylopectin and prostaglandins 12. Structural lipids include: a) Gangliosides and aminoglycosides b) Cerebrosides and cholesterol c) Phenylaline and phosphatidylserine d) Phosphatidylserine and glucosamine e) Glycosaminoglycans and proteoglycans 13. Lipids are stored in mammalian tissues: a) Starch 40

b) Triacylglycerol c) Cholesterol d) Estrogen e) Fatty acids

14. In mammals, cholesterol is: a) A normal membrane constituent b) Converted to cholic acid by intestinal bacteria c) Important source of energy d) Parent molecule for sphingolipids e) Synthesized in the liver mitochondria 15. In digestion and absorption of lipids: a) Bile pigments are important biological detergents b) Hormone-sensitive lipase is secreted by the pancreas c) Non-specific lipid esterase is the main digestive enzyme d) Bile salts are important enhancers e) TAG enters enterocytes directly 16. Unlike prostaglandins, thromboxanes: a) Are derived from arachidonic acid b) Are synthesized cyclooxygenase pathway c) Are released by platelets d) Act as local hormones e) Have 20 carbons 17. Complex lipids include: a) Gangliosides and peptidoglucans b) Cerebrosides and cellulose c) Phenylalanine and phosphatidylcholine d) Phosphatidylserine and cholesterol e) Glycosaminoglycans and chitin 18. Triacylglycerol and Glycogen: a) Are storage form of energy in plants b) Are polymers of glucose c) Are storage form of energy in animals d) Have the same energy yield on complete oxidation e) Are mainly stored in the liver 19. A membrane phospholipids that does not contain glycerol is: a) Lecithin b) Sphingomyelin c) Cerebroside d) Cardiolipin e) Ceramide 20. Unsaturated fatty acids: a) Are obtained in the diet from animals b) Are always in the cis configuration c) Include linolenic acid and arachidonic acid d) Give important derivatives e) Are water soluble 41

21. Phosphatidylcholine: a) Is also known as lecithin b) Is a major constituent of lung surfactant c) Occurs in cell membranes d) Can be obtained from phosphatidyl ethanolamine e) All of the above is correct 22. Cholesterol is: a) Found in plants b) Membrane lipid c) Non-amphipathic lipid d) Precursor of bilirubin e) A source of energy 23. Cerebrosides: a) Include glucosylceramide b) Are derived lipids c) Contain sialic acid d) Are glycerophospholipids e) Are membrane glycoproteins 24. The following is an important function of cholesterol: a) Synthesis of acetylcholine b) Synthesis of prostaglandins c) Formation of bile salts d) Formation of phosphatidylcholine e) Increasing membrane rigidity 25. Sphingomyelins: a) Consist of phosphoric acid, choline and ceramide b) Consist of ceramide, sphingosine and choline c) Are glycosphingolipids d) Are part of the skin pigment melanin e) Are equally distributed in all tissues 26. The following is true about eicosanoids: a) Prostacyclines inhibit platelet aggregation b) Thromboxanes cause platelet aggregation c) Prostaglandins enhance smooth muscle contraction d) Leukotrienes are allergic mediators e) All of the above is correct 27. The following are amphipathic membrane lipids: a) Triacylglycerol and cholesterylester b) Cholesteryl esters and cerebrosides c) Cholesterol and fatty acid d) Glycerophospholipds and sphingomyelins e) Galactosyl ceramide and glycerol

28. The following statement about simple lipids is true: a) TAG's always contain similar fatty acids 42

b) Waxes are esters of fatty acids with high molecular weight polyhydric alcohols c) Glucosyl ceramide is the main simple lipid in extra-neural tissues d) Some contain fatty acids with odd carbon number e) Include only esters of fatty acids with glycerol 29. Complex lipids do not include: a) Phosphatidyl inositol 4,5 biphosphate b) Octadecanoic acid c) Lecithin d) Glycosphingolipids e) Ganglioside 30. The following is a storage lipid: a) Triacylglycerol b) Cholesteryl esters c) Cholesterol d) Phospholipid e) Galactosyl ceramide 31. In digestion and absorption of lipids: a) Bile pigments are important biological detergents b) Hormone-sensitive lipase is secreted by the pancreas c) Non-specific lipid esterase is the main digestive enzyme d) Bile salts are important enhancers e) Phospholipase A2 releases a fatty acid from C2 of TAG

LIPIDS METABOLISM
1. The main enzyme for lipid digestion is: a) Lipoprotein lipase b) Pancreatic lipase c) Phospholipase C d) Enteropeptidase e) LCAT 2. The site of bicarbonate excretion: a) Stomach b) Duodenum c) Jejunum d) Ileum e) Colon 3. Fatty acid oxidation is a significant source of energy in all of the following except: a) Liver b) Kidney c) Red blood cell d) Heart e) Skeletal muscle 43

4. Malonyl CoA: a) Is the commited step in fatty acid synthesis b) Level is decreased in the fasting state c) Is a precursor of melanin d) Is synthesized by pyruvate carboxylase e) Is a precursor of cholesterol 5. During prolonged fasting: a) B-oxidation of fatty acids is initiated b) Glycogenesis is very active c) Blood glucose level is maximum d) Ketogenesis is maximal e) Bicarbonate is high in the blood 6. The following are intermediates in cholesterol biosynthesis: a) Prostacyclin and squaline b) Lanosterol and squaline c) Squalene and Malonyl CoA d) Farnesyl pyrophosphate and thiamine pyrophosphate e) Carbamoyl phosphate and mevalonate

7. Lipoprotein lipase: a) Hydrolyses cholesteryl ester b) Is present in the cytosol of adipocytes c) Is active during starvation d) Hydrolyses TAG in chylomicrons and VLDL e) Is activated by glucagon 8. 3-HMG CoA is: a) Intermediate in cholesterol synthesis b) Intermediate in ketone body degradation c) Precursor of fatty acids d) Final product in ketogenesis e) Three carbon compound 9. The contents of chylomicron include: a) Apoprotein A b) Apoprotein B-100 c) Apoprotein B-48 d) No cholesterol e) Hormone sensitive lipase 10. In mammals, cholesterol serves as precursor of all of the following except: a) Aldosterone b) Corticosterone c) Cholic acid d) Lanosterol e) Testosterone 44

11. Formation of ketone bodies: a) Occurs in the cytosol of the liver b) Increases during fasting c) Starts from pyruvate d) Requires lactate dehydrogenase e) Is inhibited during fasting 12. Prostaglandins: a) Are neurotransmitters b) Are derivatives of cholesterol c) Are synthesized by cyclooxygenase from unsaturated fatty acids d) Include propanol e) Are found in adipose tissue 13. Concerning cholesterol biosynthesis: a) Two squalene units are required b) The rate of synthesis is controlled by the rate of production HMG-CoA c) The liver is the only site for synthesis d) NADH is required e) Mevalonate is an intermediate 14. For transport across the inner mitochondrial membrane, long chain fatty acids are attached to: a) Coenzyme A b) Acyl tansacylase c) Phosphatidylethanolamine d) Acyl transferase e) Carnitine 15. The activity of lipoprotein lipase is stimulated by: a) Apo A b) Apo B-48 c) Apo CII d) Apo E e) Apo B-100 16. The rate-limiting step in the conversion of cholesterol to bile acids: a) Is side-chain oxidation b) 12-alpha-hydroxylation c) 7-alpha-hydroxylation d) 7-beta-hydroxylation e) Conversion to coprostanol 17. Cholesterol is: a) A source of energy b) A precursor of vitamin K c) Not found in lipoproteins d) Precursor of steroid hormones e) The same as the steroid nucleus 18. Fatty acid oxidation is a significant source of energy in all of the following except: a) Liver b) Skeletal muscle c) Kidney 45

d) Red blood cell e) Heart 19. The rate-limiting enzyme in cholesterol biosynthesis is: a) Isopentyl pyrophosphate isomerase b) Mevalonate kinase c) 3-hydroxy 3-methyl glutamyl-CoA reductase d) Dimethylallyl transferase e) Squalene synthase 20. Triacylglycerol in chylomicron is mainly hydrolysed by: a) Hormone-sensitive lipase b) Lipoprotein lipase c) Fatty acyl CoA transferase d) Pancreatic lipase e) LCAT 21. The oxidation of the following is coupled to the production of NAD+H in the cytosol: a) Acetoacetic acid b) Succinyl CoA c) Malic acid d) Phosphatidic acid e) Malonyl CoA 22. The following compound is a COMMON intermediate in ketogenesis and cholesterol synthesis: a) Mevalonic acid b) Acetoacetic acid c) Succinyl CoA d) 3HMG-CoA e) Malonyl CoA 23. Concerning lipoproteins: a) VLDL is synthesized in the intestine b) LDL contains endogenous cholesterol c) Chylomicrons are synthesized in the liver d) Lipoprotein lipase is a component of VLDL and chylomicron e) The protein component decreases hydrophilicity 24. The following is correct on apolipoproteins: a) Apo CII is coenzyme with HSL b) Apo AI is coenzyme with choline acetyltransferase c) Apo B100 interacts with LDL receptor d) Apo CI is integral component of chylomicrons e) Apo B48 is integral protein of HDL 25. Malonyl CoA: a) Activates carnitine acyl transferase 1 b) Is increased due to glucagon stimulation c) Is a precursor of melanin d) Is synthesized by acetylCoA carboxylase e) Is the immediate precursor of palmitate 26. Prostaglandins: a) Are endocrine hormones 46

b) Are synthesized from arachidic acid c) Enhances smooth muscle contraction d) Are involved in control of inflammation and blood pressure e) Both C and D are correct

27. Ketone bodies: a) Are synthesized in the mitochondria of the liver b) Increase in the blood during starvation c) Are good fuels for cardiac muscle d) Increase in the blood in uncontrolled diabetes mellitus e) All of the above are correct 28. During diabetic ketoacidosis there is a rise in: a) Plasma free fatty acids b) Plasma insulin level c) Blood pH d) Plasma alkali reserve e) Bicarbonate 29. Denovo synthesis of cholesterol occurs mainly in: a) Adipose tissue and muscles b) Liver and intestine c) Endothelial cells and hepatocytes d) Pancreas and bone marrow e) All of the above 30. Lipoprotein lipase is: a) Activated by insulin b) Active during the fed state c) Hydrolyses TAG d) Activated in presence of Apo CII e) All of the above are correct 31. Examples of sphinglipodoses include: a) Gaucher's disease and Tay-Sacch's disease b) Niemann-pick disease and von Gierke's disease c) Andersen's disease and Krabbe's disease d) Fabry's disease and rickets e) Farber's disease and Refsum's disease 32. Acetyl CoA carboxylase: a) Is activated by citrate b) Converts acetyl CoA to pyruvate c) Converts acetyl CoA to malonyl CoA d) Is a cytosolic enzyme e) B is the only wrong statement 33. The following is correct: 47

a) The liver uses ketone bodies and fatty acids as major fuels b) Skeletal muscles use glucose, fatty acids and ketone bodies as fuels c) Red blood cells oxidize acetylCoA to carbon dioxide d) Heart muscles are totally dependent on glucose as fuel e) The brain uses glucose and ketone bodies as normal fuels

34. Fatty acid synthesis: a) The committed step is catalyzed by fatty acid synthase b) Steps shared between cytosol and mitochondria c) Carnitine is needed for fatty acid transport to the mitochondria d) Pyruvate carboxylase is a key enzyme e) The liver and muscles are major sites 35. Ketone bodies: a) Include acetoacetate and acetoacetyl CoA b) Are produced in excess in the fed state c) Are synthesized from pyruvate d) Are produced by liver and kidney e) Are preferred fuels by cardiac muscles 36. The contents of HDL do not include: a) Apo A b) Cholesterol c) Apoprotein B-48 d) Apo E e) Apo C 37. Prostaglandins: a) Are local hormones b) Are derivatives of cholesterol c) Are synthesized by lipooxygenase from unsaturated fatty acids d) Include propanol e) Are found in adipose tissue only 38. In cholesterol biosynthesis: a) Prostacyclin and squalene are intermediates b) 3-HMG CoA is a precursor c) Rate is enhanced by epinephrine d) Thiamin pyrophosphate is coenzyme with 3-HMG CoA reductase e) All steps are reversible 39. Lipoprotein lipase: a) Is cystolic enzyme b) Is the same as HSL c) Is active during starvation d) Requires biotin as coenzyme e) Is activated by insulin 40. 3-HMG CoA is: a) Intermediate in cholesterol degradation b) Intermediate in ketone body synthesis c) Precursor of fatty acids d) Final product in ketogenesis 48

e) Three carbon compound

41. Triacylglycerol and glycogen: a) Are storage form of energy in animals and plants b) Are synthesized from glucose c) Are transported between tissues as lipoprotein particles d) Have the same energy yield on complete oxidation e) Are mainly stored in the liver 42. The chylomicron: a) Carries cholesterol from the intestine b) Contains mainly TAG c) Has apoprotein B-48 d) Has lower density than HDL e) All of the above are correct 43. Citric acid: a) Is produced in the mitochondria as a member of the TCA cycle b) Is an allosteric activator of acetyl CoA carboxylase c) Is a source of cytoplasmic acetyl CoA d) Is cleaved in the cytosol by an ATP-dependent lyase e) All of the above 44. Inherited disorders of B-oxidation: a) Include Refsum's disease which is due to absence of peroxisomes b) Acyl CoA dehydrogenase deficiency causes hyperglycemia c) Include dicarboxylic aciduria d) Causes hemolytic anemia e) Includes McArdle disease 45. Acetyl CoA Carboxylase: a) Catalyzes committed step in glycogen synthesis b) Converts acetyl CoA to pyruvate c) Converts acetyl CoA to malonyl CoA d) Is a mitochondrial enzyme e) Needs folate as co-enzyme 46. Malonyl CoA: a) Is activated form of acetyl CoA b) Is increased during glucagons stimulation c) Inhibits carnitine palmitoyl transferase-1 d) Synthesis does not require biotin as cofactor e) Can be converted to glucose in the liver 47. Lipolysis in adipose tissue: a) Is catalyzed by lipoprotein lipase b) Is enhanced in the fed state c) Produces fatty acid and glycerol d) Is enhanced by insulin secretion e) Produces ketone bodies

48. Ketone bodies: 49

a) Formation occurs in the mitochondria of hepatocytes b) Levels in blood increase with prolonged starvation c) Are increased in blood patients with uncontrolled diabetes mellitus type-1 d) Are prefentially used by heart muscle e) All of the above is correct 49. Prostaglandins: a) Primarily synthesized from eicosanoic acids b) Closely related to thromboxanes c) Potent smooth muscle contractor d) Local hormone e) All of the above is correct 50. In lipoproteins: a) VLDL is the major carrier of dietary triglycerides b) LDL contains endogeneous cholesterol c) Chylomicrons are synthesized in the liver d) Hormone-sensitive lipase is a component of HDL e) The protein component increases the hydrophobicity 51. Gallstone blocking the common bile duct will result in the impaired intestinal absorption of all the following except: a) Retinol b) Cholecalciferol c) Cholesterol d) Diacylglycerol e) Folic Acid 52. Beta-oxidation of a fatty acid: a) Produces ATP at substrate level b) Involves two steps of reduction of fatty acid c) Has a preference for fatty acids shorter than 12 carbons d) Requires NAD+ e) Is a cystosolic pathway 53. Glycerol-3-phosphate in adipose tissue arises primarily from: a) Reduction of dihydroxyacetone phosphate b) Hydrolysis of phosphatidic acid c) Phosphorylation of glycerol by glycerol kinase d) Selective uptake from blood e) Reduction of glyceraldehydes-3-phosphate 54. Cholesterol is: a) A normal membrane constituent of plant cells b) Converted to cholic acid by intestinal bacteria c) Important source of energy d) Parent molecule for cholecalciferol e) Synthesized in the liver mitochondria 55. Derivatives of cholesterol include all of the following except: a) Cholecalciferol b) Cortisol c) Retinol d) Chenodeoxycholate 50

e) Aldosterone 56. The activity of acetylCoA carboxylase is enhanced: a) Dephosphorylation b) Insulin c) Citrate d) Esterification of fatty acylCoA e) All of the above is correct 57. In lipogenesis and beta oxidation: a) Carnitine palmitoyl transferase I is enhanced by malonyl CoA b) The two pathways are mitochondrial c) High level of cytosolic fatty AcylCoA enhances lipogenesis d) Insulin enhances malonyl CoA synthesis which indirectly inhibits beta oxidation e) NADPH is needed 58. Conversion of glucose to TAG in the liver requires all of the following except: a) Acetyl CoA carboxylase b) Fatty acid synthase c) Pyruvate dehydrogenase d) Glucose 6 phosphatase e) Glycerol 3 phosphate dehydrogenase 59. All of the following are synthesized in the liver in the fed state except: a) VLDL b) Glucose c) LDL d) PRPP e) Cholesterol 60. During fasting the following pathways are active in the liver except: a) Glycogenolysis b) Glycolysis c) Ketogenesis d) Beta oxidation e) Gluconeogenesis 61. Concerning cooperation between the liver and adipose tissue: a) TAG is synthesized in the adipose tissue and transported to the liver b) Ketone bodies are synthesized by the liver and consumed in adipose tissue c) LDL is released from adipose tissue and oxidized in the liver d) VLDL is synthesized in the liver and converted to HDL in adipose tissue e) HDL is synthesized in the liver and degraded in adipose tissue 62. The main sources of energy in skeletal muscle during vigorous exercise are: a) Fatty acids and creatine phosphate b) Anaerobic oxidation of glucose and creatine phosphate c) Blood glucose and ketone bodies d) Fatty acids and glycerol e) All of the above are correct 63. In the cardiac muscle: a) Glycogen is the main energy reserve 51

b) Ketone bodies are preferred over glucose for energy production c) Anaerobic glycolysis is vital d) Fatty acids are not used in the fed state e) None of the above is correct 64. In the brain: a) Most of the energy is used for generation of nerve impulses b) Glucose is a sole fuel under normal conditions c) There is a high turnover of biomolecules d) Ketone bodies can be utilized e) All of the above is correct 65. Insulin promotes fat storage in adipose tissue cells by: a) Inhibition of HSL b) Stimulation of lipoprotein lipase c) Stimulation of glycolysis d) Enhancing glucose uptake e) All of the above is correct 66. Ketone bodies are present in high levels in the blood when: a) Hepatic glycogen levels are high b) Fat is being actively synthesized c) Protein synthesis in muscle is elevated d) Blood glucose is high e) Fatty acid oxidation is high in the liver 67. Malonyl-CoA: a) Is produced from citrate b) Is increased during glucagons stimulation c) Inhibits carnitine palmitoyl transferase-1 d) Synthesis require folate as a coenzyme e) Is converted to glucose in the liver 68. The following is correct about chylomicron: a) It is formed in the intestinal mucosal cells b) It contains the apoprotein B48 c) It is carried from the intestinal mucosa to the circulation through lymphatic vessels d) The major load is dietary triacylglycerol e) All of the above is correct 69. The major carrier of cholesterol from the liver to the tissues is: a) HDL b) IDL c) LDL d) VLDL e) HDL2 70. The HDL play a major role in: a) Transport of phospholipids to the tissues b) Synthesis of triacylglycerol c) Delivary of apoprotein B100 to VLDL d) Transport of cholesterol from the tissues to the liver e) Storage of apoproteins 52

71. Triacylglycerol is mainly transported between tissues in: a) VLDL and chylomicron b) LDL and HDL c) Chylomicron and IDL d) The free form e) HDL and VLDL 72. The following is correct about lipoproteins: a) VLDL is the precursor of IDL b) IDL is the precursor of LDL c) LDL receptor binds apoB100 d) LDL receptors are defective in familial hypercholesterolemia e) All of the above is correct 73. Cholesterol is: a) Supplied to tissues through LDL receptors b) Taken from tissues by LCAT of HDL c) Increased in the blood of patient with a defective LDL Receptor d) Stored in tissues by the action of ACAT e) All of the above is correct 74. Eicosanoids: a) Are neurotransmitters b) Are derivatives of cholesterol c) Are synthesized by cyclooxygenase from unsaturated fatty acids d) Include Prostaglandins e) Are found in adipose tissue only

PROTEINS & AMINO ACIDS

1. The peptide bond: a) Links two amino acids b) Links two nucleotides c) Is weaker than the hydrogen bond d) Is broken by mild heating e) Is a non-covalent bond 2. The most important function of proteins in our body is: a) Emulsification b) Thermal insulation c) Storage d) Catalysis e) Energy production 3. Aliphatic non polar amino acids are exemplified by: 53

a) Isoleucine and Serine b) Histidine and Alanine c) Cysteine and Valine d) Aspartate and Glycine e) Valine and Isoleucine 4. The following amino acids contain two carboxylic groups: a) D and E b) Q and Y c) A and K d) C and M e) H and R 5. Positively charged amino acids are: a) P and R b) L and T c) K and R d) H and M e) N and F 6. The primary structure of proteins: a) Refers to the sequence of amino acids in the polypeptide chain b) Refers to the helical structure of the protein c) Describes the beta-pleated sheets d) Is maintained by hydrogen bonds e) Is maintained by hydrophobic interactions

7. Denaturation of a protein involves loss of its: a) Primary structure b) Secondary & Tertiary structure c) Primary & Tertiary structure d) Primary & Quaternary structure e) Amino acids 8. The alpha helix in a protein: a) Refers to its tertiary structure b) Is not affected by amino acid sequence c) Is stabilized by covalent bonds d) Refers to its secondary structure e) Is the quaternary structure 9. Glycoproteins contain sugar residues covalently bonded to: a) Lysine b) Methionine c) Leucine d) Asparagine e) Cysteine 10. The following amino acids contain two carboxylic groups: 54

a) Aspartate and Glutamate b) Asparagines and Glutamine c) Glutamine and Aspartate d) Proline and Glutamate e) Glycine and Methionine 11. Positively charged amino acids are: a) Valine and Arginine b) Leucine and Lysine c) Lysine and Arginine d) Histidine and Cystine e) Arginine and Glutamine 12. Sulphur containing amino acids: a) Are non-polar b) Include cysteine and methionine c) Are involved in disulphide bridges d) Are involved in methyl group donation e) Are non essential amino acids 13. The alpha helix in a protein: a) Describes the secondary structure b) Is stabilized by peptide bonds c) Stabalized by hydrogen bonds between NH and CO main chain groups d) Is the basis for quaternary structure formation e) Dictates its tertiary structure

14. The following are classified as acidic amino acids: a) H and R b) D and E c) E and Y d) A and K e) C and D 15. Albumin is an important carrier of: a) Fatty acids and glucose b) Hyroxine and glycerol c) Bilirubin and calcium d) Ammonia and urea e) Lactate and bilirubin 16. Hemoglobin and myoglobin have the same: a) Oxygen affinity b) Primary structure c) Quaternary structure d) Prosthetic group e) Molecular weight 17. The branched chain amino acids: a) Are isoleucine and serine b) Include histidine and valine c) Undergo transamination and oxidative decarboxylation by similar reactions d) Are valine, aspartate and glycine 55

e) Are serine, leucine and isoleucine 18. Hemoglobin and myoglobin: a) Have the same oxygen affinity b) Are found in red blood cells c) Are multimeric protein structures d) Contain heme e) Have the same molecular weight 19. Albumin is an important carrier of: a) Fatty acids and bilirubin b) Thyroxine and insulin c) Bilirubin and retinol d) Calcium and zinc e) Iron and copper 20. Hemoglobin and cytochromes: a) Contain Fe3+ as part of the active site b) Contain heme as prosthetic group c) Transports oxygen d) Have similar affinity for oxygen e) Are found in the mitochondria

21. The alpha helix in a protein: a) Refers to its tertiary structure b) Is not affected by the amino acid sequence c) Is stabilized by covalent bonds d) Refers to its secondary structure e) Is the quaternary structure 22. Properties of the peptide bond include: a) It is a covalent double bond b) It links to alpha amino acids covalently c) It is weaker than the hydrogen bond d) It can be broken by mild heating e) None of the above 23. Among the important functions of proteins in our body are: a) Emulsification and buffering b) Thermal insulation and energy production c) Storage of energy and transport d) Catalysis and hormonal function e) Buffering and hydrophobocity 24. Negatively charged amino acids: a) Are serine and glutamate b) Include glutamine and asparagene c) Are necessary for protein-protein interactions d) Are not found in membrane bound proteins e) Form disulphide bridges 25. Sulphur containing amino acids: a) Are cysteine and methionine 56

b) Are non-essential amino acids c) Can be synthesized from serine d) Are always found at the carboxy terminal of the polypeptide chain e) All of the above are correct 26. Albumin is: a) Synthesized in the liver b) Water-soluble protein c) A carrier of bilirubin and calcium d) Decreased in blood and in protein calorie malnutrition e) All of the above 27. Hemoglobin S: a) Results from insertion of a nucleotide b) Results from substitution mutation c) Is incompatible with life d) The deficiency manifest in all children of carrier parents e) Has the same affinity for oxygen as hemoglobin F

28. All of the following are considered "weak interactions" in proteins except: a) Van der Waals force b) Hydrogen bonds c) Ionic bonds d) Peptide bonds e) Hydrophobic interactions 29. Hemoglobin: a) Has a quaternary structure b) Contains porphyrin ring c) Contribute to pH maintenance in blood d) Affinity towards oxygen increases with cooperativity e) All of the above is correct 30. Globular proteins: a) Are structural proteins b) Include peptide hormones c) Are always found in the plasma membrane d) Are relatively water insoluble e) Are always glycosylated 31. The following are peptides: a) Glutathione and vasopressin b) Gramicidin and tyrosine c) Vasopressin and epinephrine d) Ceramide and endorfens e) Guanosine and insulin 32. Glycoproteins contain sugar residues covalently boded to: a) Threonine and serine b) Leucine and arginine c) Asparagine and glycine d) Cysteine and histidine e) Lysine and methionine 57

33. The following is true about amino acids: a) Cysteine and serine are polar uncharged b) Methionine can form a cross link between peptides c) Histidine and glutamic acid are negatively charged d) Glycine has D and L isomers e) Tyrosine is a basic amino acid 34. Enzymes involved in protein digestion are mainly produced by: a) Stomach b) Duodenum c) Jejunum d) Ileum e) Pancreas

35. Glycoproteins contain sugar residues covalently boded to: a) Lysine b) Threonine c) Leucine d) Asparagine e) Cysteine 36. The following amino acids have nonpolar side chains: a) Valine and serine b) Methionine and leucine c) Arginine and alanine d) Glycine and asparagine e) Isoleucine and valine 37. The following is true about amino acids: a) Ornithine is alpha amino acid b) Glycine has two carbon atoms c) Proline is an imino acid d) All of the above are true e) Valine is an aromatic amino acid 38. Which of the following amino acids is most likely to be found in the transmembrane region of a protein? a) Lysine b) Arginine c) Leucine d) Aspartate e) Glutamate 39. Which of the following amino acids are found in the cell but not in protein? a) Citrulline and ornithine b) Alanine and phosphotyrosine c) Citrulline and cysteine d) Gamma carboxyglutamate and hydroxylysine e) Phosphoserine and phosphothreonine 40. The sequence of amino acids are found in the cell but not in protein? a) Glycine-cysteine-glutamate 58

b) Cysteine-glycine-glutamate c) Glycine-glutamate-cysteine d) Glutamate-cysteine-glycine e) Glutamate-glycine-cysteine 41. The following are peptides: a) Glutathione and methionine b) Gramicidin S and vaspressin c) Vassopressin and sphingosine d) Ceramide and insulin e) Arginine and adrenaline 42. Properties of the peptide bond include: a) It is a covalent double bond b) It links three alpha-amino acids covalently c) It is stronger than the hydrogen bond d) It can be broken by mild heating e) None of the above 43. Alpha helix: a) Is stabilized by covalent bonds b) Has 3.6 amino acid residues per turn c) Proline favors its formation d) Denotes secondary structure of a protein e) Can be found in a tripeptide 44. Denaturation of a protein: a) Disrupts the primary structure of the protein b) Alters the secondary and tertiary structures of the protein c) Breaks all covalent bonds in the protein d) Has no effect on the biological activity e) Removes disulphide bridges 45. The amino acids with positively charged side chains include: a) Arginine and serine b) Glutamine and alanine c) Glutamate and proline d) Glutamine and tyrosine e) Arginine and lysine 46. In the polypeptide chain, the peptide bond: a) Is formed by the alpha carboxylic group of one amino acid and the alpha amino group of the next amino acid b) Is rigid c) Components are planner d) Is stronger than a single covalent bond e) All of the above is correct 47. The tertiary structure of a protein is: a) Its three dimensional structure b) The relationship between different subunits c) Not lost by denaturation d) Stabalized by peptide bonds only e) Not relevant to its function 59

48. The major functions of proteins in the human body include: a) Storage of genetic information b) Immunity and locomotion c) Buffering and transport d) Catalysis and signalling e) B, C and D are correct 49. Non standard amino acids in protein structure include: a) Ornithine b) Citrulline c) Hydroxyproline d) Serine e) Glycine 50. The pancreatic enzyme not involved in protein digestion is: a) Carboxypeptidase b) Trypsin c) Lipase d) Clastase e) Chymotrypsin

PROTEIN METABOLISM
1. Amino acids which can be synthesized from glutamate in human body include: a) Histidine b) Glutamine c) Phenylalanine d) Both A and B e) Both B and C 2. Gyrate atrophy of the retina: a) Is inherited as autosomal recessive trait b) Involves chorioretinal degeneration c) Results in loss of peripheral vision and tunnel vision d) Can cause blindness e) All of the above 3. An amino acid which is strictly ketogenic will be able to produce all of the following except: a) Fatty acids b) Glucose c) Ketone bodies d) Energy e) Both A and B 4. Which of the following compounds can not participate in transamination reactions: a) Oxaloacetate 60

b) Pyruvate c) Succinate d) Aspartate e) Alanine 5. Ammonia is mainly transported from extrahepatic tissues to the liver in the form of: a) Alanine and serine b) Glycine and threonine c) Glutamine and alanine d) Free ammonia e) Urea 6. The immediate precursor of heme in its biosynthesis is: a) Protoporphyrin b) Coproporphyrinogen III c) Protoporphyrinogen IX d) Porphobilinogen e) Urobilin 7. In-born errors of aromatic amino acid metabolism include: a) Albinism and cystinuria b) Pheuketonuria and alkaptonuria c) Citrullinuria and tyrosinemia d) Cystinnuria and fructosuria e) Tyrosinosis and ornithinemia 8. Carbamoyl phosphate synthatase I: a) Is cystolic enzyme b) Requires one ATP c) Deficiency causes hyperammonemia type I d) Is activated by glutamine e) Catalyses a reversible reaction 9. The carbon skeleton of the following amino acids is catabolized to fumerate: a) Methionine and leucine b) Phenylalanine and tyrosine c) Tyrosine and leucine d) Tryptophan and valine e) Threonine and histidine 10. The committed step in heme biosynthesis: a) Heme synthase b) Porphobilinogen deaminase c) Protoporphyrinogen oxidase d) ALA synthase e) Succinyl CoA thiokinase 11. Glycine participates in the synthesis of: a) Heme and purine b) Histamine and creatine c) Carnosine and anserine d) Pyrimidine and spermine e) GABA and bile salts 61

12. An immediate precursor of serine is: a) Phosphoserine b) Phosphatidyl ethanolamine c) Pyruvate d) Homocysteine e) Malate 13. Urobilinogen is formed in: a) The gall bladder b) The reticuloendothelial system c) Erythrocytes d) The liver parenchymal cells e) The gut 14. Arginine participates in the synthesis of: a) Glycholic acid and hippurate b) Creatine and urea c) Heme and spermine d) Purines and ceramide e) Sphingosine and ornithine 15. Arginine is converted directly to: a) Arginosuccinate by argininosuccinate synthase b) Citrulline by NO synthase c) Lysine by arginase d) Ornithine by lysine oxidase e) Urea by urease 16. The following are converted to direct transamination to the corresponding product: a) Oxaloacetate to aspartate b) Pyruvate to glycine c) Succinate to serine d) Aspartate to alpha-ketoglutarate e) Alanine to oxaloacetate 17. Most urinary ammonium ions are derived by the enzymatic reaction of: a) Glutamine b) Glutamic acid c) Histamine d) 6-amino purine derivatives e) Urea 18. In-born errors of tyrosine catabolism include: a) Albinism and cystinosis b) Phenylketonuria and tyrosinosis c) Citrullinuria and tyrosinemia d) Tyrosinemia and alkaptonuria e) Tyrosinosis and ornithinemia 19. Carbamoyl phosphate: a) Is formed from ATP and carbon dioxide b) Is hydrolysed to ammonia and carbon dioxide c) Is increased due to deficiency of ornithine transamomylase d) Is produced from degradation of arginine 62

e) Diffuses out of the mitochondria during urea synthesis 20. The conversion of alanine to glucose would be decreased during starvation to a person with a dietary deficiency of: a) Ascorbic acid b) Folate c) Pyridoxine d) Vitamin D e) Vitamin K 21. Maple syrup urine disease is due to defective branched-chain: a) Acyl-CoA dehydrogenase b) Amino acid transamination c) Amino acid transport by the kidney d) Keto acid decarboxylase e) Keto acid transamination 22. The one-carbon unit in methylene-tetrahydrofolate is mainly obtained from: a) S-adenosylmethionine b) Serine and glycine c) Arginine d) Homocysteine e) Choline

23. Amino acids which are both ketogenic and glucogenic are: a) Tyrosine and phenylalanine b) Alanine and valine c) Leucine and serine d) Glutamate and aspartate e) Histidine and serine 24. Lead poisoning characteristically leads to inhibition of the following: a) Uroporphyrinogen decarboxylase b) ALA dehydratase c) ALA synthase and ferrohectase d) Porphobilinogen deaminase e) Bilirubin reductase and eoproporphyrin 25. In acute intermittent porphyria the appearance of high levels of delta-aminolevulinic acid and porphobilinogen in the urine is due to deficiency of the following enzyme: a) Delta aminolevulinate synthase b) Delta aminolevulinate dehydratase c) Uroporphyrinogen I synthase d) Ferrochelastase e) Microsomoal heme oxygenase 26. Increased excretion of urobilinogen is most likely caused by: a) Erythropoetic porphyria b) Liver disease such as viral hepatitis c) Hemolysis d) Iron deficiency 63

e) Common bile duct obstruction 27. An increase in plasma conjugated bilirubin concentration is most often associated with: a) Increased heme synthesis b) Erythropoetic porphyria c) Viral hepatitis d) High level of bilverdin e) Common bile duct obstruction 28. The formation of bilirubin from heme: a) Requires oxygenase b) Requires bilverdin reductase c) Occurs in the reticuloendothelial system d) Releases carbon monoxide and iron e) All of the above 29. The commited step in heme biosynthesis produces: a) ALA b) Porphobilinogen c) Protoporphyrinogen d) Uroporphyrinogen e) Hydroxymethylbilane

30. The immediate precursor of heme in its biosynthesis is: a) Protoporphyrin III b) Coproporphyrinogen III c) Protoporphyrinogen d) Prophobilinogen e) Urobilin 31. Urobilinogen in the intestine is: a) Synthesized from conjugated bilirubin b) Converted to urobilin in stools c) Reabsorbed in the terminal ileum and large intestine d) Colourless e) All of the above 32. Positive nitrogen balance is a characteristic of: a) Normal adults and surgical patients b) Growing children and pregnant women c) Advanced cancer patients d) Prolonged starvation e) None of the above 33. In-born errors of aromatic amino acid metabolism include: a) Tyrosinosis and albinism b) Phenyketonuria and albuminuria c) Citrullinuria and ochronosis d) Cystinnuria and alkaptonuria e) Tyrosinosis and histidinuria 64

34. Glycine participates in the synthesis of the following specialized products: a) Glycocholic acid and serine b) Creatine and spermine c) Heme and anserine d) Purines and heme e) Sphingosine and ornithine 35. In the urea cycle: a) The whole process is cystosolic b) One ATP molecule is required c) Carbamoyl phosphate synthetase I catalyses a reversible reaction d) Fumerate and urea are released e) Glutamine is an intermediate 36. Amino acids which can be synthesized from glutamate in the human body include: a) Histidine b) Glutamine c) Phenylalanine d) Ornithine e) Tyrosine

37. Which of the following compounds cannot participate in transamination reactions: a) Oxaloacetate b) Pyruvate c) Succinate d) Aspartate e) Alanine 38. Myocardial infarction increases the serum level of: a) Lactate dehydrogenase b) Creatine phosphokinase c) Aspartate transaminase (AST) d) Alanine transaminase (ALT) e) All of the above is correct 39. The function of many enzymes can be quickly modified by phosphorylation of specific amino acid residues catalyzed by: a) Cyclases b) Kinases c) Phoshatases d) Phosphorylases e) Zymogens 40. In hemoglobin S the mutation in the beta chain results from: a) Insertion of a nucleotide b) Replacement of alanine by serine in position 6 c) Deletion of a nucleotide d) Replacement of glutamate by valine in position 6 e) A and C are correct 65

41. Glucose-alanine cycle: a) Serves to carry amino groups from the skeletal muscle to the liver b) Requires participation of gluconeogenesis in the liver c) Provides the working muscle with glucose made by the liver d) Requires participation of transamination reaction in both the skeletal muscle and the liver e) All of the above is correct 42. The following is correct: a) Glycine is involved in the synthesis of heme and purine b) Histidine is involved in the synthesis if histamine and creatine c) Serine is involved in the synthesis of carnosine and serine d) Asparagene is involved in the synthesis of pyrimidine and spermine e) Glutamine is involved in the synthesis of GABA and bile salts 43. Urobilinogen is detected in the urine of a patient with: a) Obstructive jaundice b) Hemolytic jaundice c) Hepatocellular jaundice d) Acute pancreatitis e) None of the above is correct

44. The pancreatic enzyme not involved in protein digestion is: a) Carboxypeptidase b) Trypsin c) Lipase d) Elastase e) Chymotrypsin 45. The immediate precursor of heme in its biosynthesis is: a) Protoporphyrin IX b) Coproporphhyrinogen III c) Protoporphyrinogen IX d) Porphobilinogen e) Urobilin 46. The cells which are very active in heme biosynthesis include: a) Erythroid precursors b) The liver cells c) Adipose tissue cells d) Cardiac muscles e) Intestinal mucosal cells 47. Glucose-alanine cycle: a) Serves to carry amino groups from the skeletal muscle to the liver b) Requires participation of gluconeogenesis in the liver c) Provides the working muscle with glucose made by the liver d) Requires participation of transamination reaction in both the skeletal muscle and the liver e) All of the above is correct 66

48. The following diseases are associated with tyrosine metabolism: a) Phenylketonuria and glycinuria b) Gyrate atrophy and ochronosis c) Albinism and alkaptonuria d) Tyrosinemia and maple syrup urine disease e) Tyrosinosis and Citrulinemia 49. The following are inborn errors of amino acid metabolism except: a) Albinism b) Phenylketonuria c) Cystinosis d) Gaucher disease e) Alkaptonuria 50. Specialized non protein products of the amino acid arginine include all of the following except: a) Nitric Oxide b) Creatine c) Spermidine d) Carnosine e) Spermine

51. In the hepatocytes, the main acceptors of amino nitrogen are: a) Asparagene and glycine b) Serine and methionine c) Pyruvate and aspartate d) Alpha-ketoglutarate and oxaloacetate e) Glutamine and ornithine 52. The amino nitrogen is transported from the extrahepatic tissues to the liver in the form of: a) Arginine and serine b) Glutamate and proline c) Glutamine and tyrosine d) Glutamine and alanine e) Free ammonia 53. Oxidative deamination in the hepatocytes: a) Is catalysed by glutamate amino transferase b) Is non-reversible c) Is catalysed by glutamate dehydrogenase d) Uses glutamine as substrate e) Requires ornithine transaminase 54. The following is correct about urea synthesis (cycle) except: a) Aspartate is a donor of an amino group b) Occurs in the cytosol and mitochondria c) Arginine is the precursor of urea d) Carbamoyl phosphate condenses with ornithine 67

e) Citrulline is formed in the cytosol 55. The carbon skeletons of the following amino acids are converted to the corresponding amphibolic intermediates except: a) Valine to succinyl CoA b) Histidine to alpha-ketoglutarate c) Phenylalanine to fumerate d) Tyrosine to acetyl CoA e) Leucine to malate 56. In the hepatocytes, the main acceptors of amino nitrogen are: a) Asparagene and Glycine b) Serine and Methionine c) Pyruvate and Aspartate d) Alpha-Ketoglutarate and Oxaloacetate e) Glutamine and Ornithine 57. The Amino Nitrogen is transported from the extrahepatic tissue in the form of: a) Arginine and Serine b) Glutamate and Proline c) Glutamine and Tyrosine d) Glutamine and Alanine e) Free Ammonia

58. Oxidative Deamination in the Hepatocytes: a) Is catalyzed by Glutamate Amino Transferase b) Is Non Reversible c) Is Catalyzed by Glutamate Deydrogenase d) Uses Glutamine as Substrate e) Requires Ornithine Transaminase 59. The Urea Synthesis (cycle) in the liver involves all of the following except: a) Aspartate is a donor of an amino group b) The Cytosol and Mitochondria c) Arginine is the precursor of Urea d) Carbamoyl Phosphate condenses with Ornithine e) Citrulline and Methionine are Intermediates 60. The Carbon Skeletons of the amino acids mentioned below are converted to the corresponding amphibolic intermediates except: a) Alanine to Pyruvate b) Arginine to Alpha-Ketoglutarate c) Phenylalanine to Fumerate d) Tyrosine to Acetyl CoA e) Leucine to Oxaloacetate 61. The Branched Chain Amino Acids: a) Degradation is impaired in Maple Syrup Urine Disease b) Are glucogenic except for leucine c) Undergo transamination and oxidative decarboxylation by similar reactions d) May require Vitamin B12 for degradation 68

e) All of the above is correct 62. Ornithine Delta Transaminase Deficiency: a) Is inherited as autosomal recessive trait b) Causes chorioretinal degeneration c) Results in loss of peripheral vision and tunnel vision d) Is called Gyrate Atrophy of the Retina e) All of the above is correct 63. The amino acids which are both Glucogenic and Ketogenic include: a) Alanine and Isoleucine b) Phenylalanine and Tryptophan c) Tyrosine and Serine d) Cysteine and Hydroxyproline e) All of the above is correct 64. The following are converted by direct transamination to the corresponding product: a) Oxaloacetate to aspartate b) Pyruvate to alanine c) Succinate to serine d) Alpha Ketoglutarate to Glutamate e) C is the only wrong statement

65. Arginine participates in the synthesis of: a) Glycholic acid and hippurate b) Heme and spermine c) Creatine and nitric oxide d) Purines and ceramide e) Sphingosine and ornithine 66. Amino acids which are only glucogenic include: a) Tyrosine and Phenylalanine b) Alanine and Valine c) Leucine and Serine d) Glutamate and Valine e) Histidine and Serine

NUCLEIC ACIDS
1. The following are purine nucleotides: a) ATP and CMP b) CTP and GDP c) NAD and TDP 69

d) GMP and ADP e) UDP and GTP 2. Watson and Crick model of DNA structure implies that: a) Thymine base pairs with adenine b) Thymine base pairs with cytosine c) DNA is a single strand d) The purine content is not equal to the pyrimidine content e) The nitrogenous bases from the backbone of the molecule 3. RNA: a) Contains deoxyribose b) Contains adenine, guanine, thymine & cytosine c) Is usually single stranded d) Guanine content is equal to cytosine content e) Is not found in the nucleus 4. The bonds that stabilize the structure of DNA are: a) Hydrogen bonds and peptide bonds b) Phosphodiester bonds and hydrogen bonds c) Glycosidic bonds and thioester bonds d) Disulphide bonds and hydrogen bonds e) Van der Waals forces 5. All the following compose a nucleoside except: a) Phosphate group b) Deoxyribose c) Ribose sugar d) Pentose sugar e) Purine base 6. The following are purine nucleotides: a) AMP and ADP b) ATP and CMP c) CTP and GDP d) NAD and TDP e) UDP and GTP 7. Select the incorrect statement. Messanger RNA: a) Is translated in the direction 5'to 3' b) Is oftend derived from a large precursor by processing in eukaryotes c) Has a poly A tail in eukaryotes d) Is a heterogeneous molecule e) Is extensively processed posttranscriptionally in prokaryotes

8. Nucleotides in nucleic acids are linked together by: a) Peptide bonds b) 3' to 5' phosphodiester bond c) 5' to 3' phosphodiester bond d) Disulphide bonds and hydrogen bonds e) Van der Waals forces 9. The following is a purine nucleotide: 70

a) Cytidylate b) Guanosine c) Cytidine monophosphate d) Uridine e) Adenylate 10. Regarding Watson-Crick model of DNA structure: a) The bases are found to the outside b) The two strands are parallel c) (G+C / A+T) = 1 d) The opposing strands of DNA are said to be complementary e) Adenine pairs with thymine by 3 hydrogen bonds 11. The following statement is correct: a) DNA is a polymer of nucleosides b) The two DNA strands are covalently linked c) The genetic information is stored in the linear sequence of bases along the molecule d) DNA is found only in the nucleus e) Successive nucleotides are linked by 3'-5- thioester bond 12. rRNA: a) Is the least RNA in the cell b) Is the smallest among RNA's c) Is the same in pro- and eukaryotic cells d) Codes for protein synthesis e) Has catalytic function in protein synthesis 13. tRNA: a) Is the most abundant RNA in the cell b) Acts as adaptor during protein synthesis c) Is the most heterogeneous of all RNA's d) Usually binds more than one amino acid e) Has a catalytic role during protein synthesis 14. The following is correct about the genetic code: a) 62 codons can code for amino acids b) It is universal c) Four codons can terminate protein sythesis d) Many amino acids have multiple codons e) All of the above is correct

15. The genetic code is said to be umambiguous, that means: a) Several triplets code for one amino acid b) Each triplet codes for one amino acid c) One gene one protein d) Each triplet specifies more than one amino acid e) Each amino acid has one codon 16. If GUA specifies valine, UUA specifies leucine, AUU specifies isoleucine and ACA specifies threonine, it is most likely that AUA specifies: 71

a) Valine b) Leucine c) Isoleucine d) Threonine e) Proline 17. With regard to mitochondrial DNA: a) It has a circular duplex of ribonucleic acid b) It accounts for 25% of total human DNA c) It codes for all mitochondrial enzymes d) It is inherited exclusively from the mother e) All of the above is true 18. The following is a purine nucleotide: a) Cytidylate b) Guanosine c) Cytidine monophosphate d) Adenine monophosphate e) Guanosine monophosphate 19. Concerning the different types of RNA: a) mRNA is the most abundant b) rRNA is involved in formation of ribosomes c) tRNA carries codons for amino acids d) tRNA acceptor arm is found in the 5' end e) mRNA is the most homogeneous type 18. Which of the following statement is correct: a) DNA is a polymer of nucleosides b) The two DNA strands are covalently linked c) The genetic information is stored in the linear sequence of bases in DNA d) DNA is found only in the nucleus e) Successive nucleotides are linked by 3'-5- thioester bond 19. cAMP is: a) Purine base b) Involved in signal transduction c) A synthetic nucleotide analogue d) Is a nucleoside derivative of cytosine e) Is the same as AMP

20. Synthetic nucleotide analogs: a) Include cGMP b) Include theophylline c) Can be used as anti-tumor agents d) 5-fluoro uracil is used for treatment of gout e) Have only antiviral effect 21. Nucleotides: a) Include NAD and FAD b) Are involved in formation of coenzymes 72

c) Are involved in base plus sugar plus phosphate d) Important in CHO biosynthesis e) All of the above is correct 22. The following are the properties of the genetic code: a) It is degenerate b) It is commaless c) It is non overlapping d) It is a triplet e) All of the above is correct 23. Concerning the 20 standard amino acids: a) Each amino acid has two codons b) Some amino acids have no codons c) One codon can code for more than one amino acid d) An amino acid can have more than one codon e) None of the above 24. The codon is: a) Three nucleotides (bases) in mRNA representing an amino acid b) The sequence of bases in tRNA c) The same as the gene d) The base sequence in rRNA e) None of the above 25. The gene is: a) Polymer of amino acid linked by peptide bond b) DNA segment carrying information about a protein c) Only made of introns d) The same as chromosomes e) Only made of exons in eukaryotes 26. The flow of genetic information is the following order: a) Translation replication transcription b) Replication transcription translation c) Transcription replication translation d) Replication translation transcription e) Transcription translation replication

27. All of the following are involved in purine nucleotide synthesis: a) Glycine, Serine, Glutamine b) Aspartate, Formyl Tetrahydrofolate, Glutamine c) Asparagine, Glycine, Glutamine d) Carbon Dioxide, Pyridoxine, PRPP e) Ribose 5 Phosphate, Glutamate, Formimino Tetrahydrofolate 28. The commited step in purine nucleotide biosynthesis is catalysed by: a) PRPP Synthase b) PRPP Glutamylamidotransferase c) Glucose 6 Phosphate dehydrogenase 73

d) IMP Dehydrogenase e) All of the above is correct 29. Denovo purine biosynthesis is inhibited by: a) Antifolate drugs b) Glutamine analogs c) Azaserine and diazanorleucine d) 6-mercaptopurine and mycophenolic acid e) All of the above 30. The salvage pathway of purin nucleotide synthesis involves: a) Conversion of adenine to AMP by adenosine kinase b) Conversion of adenosine to AMP by phosphoribosyl transferase c) Formation of GMP from guanine by HGPRTase d) Formation of dATP by ribonucleotide reductase e) C is the only correct answer 31. The following is correct about inherited disorders of purine metabolism: a) Adenosine deaminase deficiency results in severe immunodeficiency b) Gout results from decreased Km of PRPP synthase for Ribose-5-Phosphate c) Complete deficiency of HGPRTase results in Lesch Nyhan Syndrome d) Xanthinuria results from complete deficiency of xanthine oxidase e) All of the above is correct 32. Allopurinol: a) Lowers uric acid in the blood by increasing renal excretion b) Is xanthine oxidase inhibitor c) Increases formation of urate by increasing plasma pH d) Is the natural substrate for orotate phosphoribosyl transferase e) Inhibits purine and pyrimidine degradation 33. Methotrexate: a) Inhibits reduction of dihydrofolate to tetrahydrofolate b) Inhibits TMP synthesis c) Is an anticancer drug d) A,B and C are correct e) C is the only correct answer

34. The end products of pyrimidine catabolism: a) Include ammonia, beta alanine and CO2 b) Increase in leukemic patients c) Increases as a result of mitochondrial damage to the liver d) Are highly water soluble e) All of the above is correct 35. Orotic Aciduria: a) Type I reflects a deficiency in both Orotate Phosphoribosyl Transferase and Oritidylate Decarboxylase b) Type II reflects deficiency of oritidylate decarboxylase only c) Is transiently detected in allopurinol treated patients 74

d) Is detected in ornithine transcarbamoylase deficiency e) All of the above is correct 36. Possible roles of covalent modification of histones include: a) Acetylation of histones H3 and H4 is associated with the activation or inactivation of gene transcription b) Methylation enhances transcription c) Phosphorylation of H1 participate in octamer formation d) ADP-ribosylation is associated with nucleosomal assembly e) None of the above is correct

NUCLEOTIDE METABOLISM
1. The DNA library differs from a genomic DNA library in: a) Excluding DNA that encodes mitochondrial proteins b) Excluding DNA that encodes ribosomal proteins c) Only by having introns excluded from genes d) Having longer polynucleotide fragments e) Reflecting the whole activities of all tissues in multicellular organisms 2. The genetic code is: a) Ambigeous b) Overlapping c) Degenerate d) None specific e) None of the above 3. In contrast to DNA polymerase, RNA polymerase: a) Fills the gap between Okazaki fragments b) Works only in the 5'to 3'direction c) Edits as it synthesizes d) Synthesize RNA primer to initiate DNA synthesis e) Adds nucleoside monophosphates to the growing polynucleotides 4. A promoter site on DNA: a) Transcribes repressor b) Initiates transcription c) Codes for RNA polymerase d) Regulates termination e) Translates specific proteins 5. The portion of DNA which is transcribed but not translated is called: a) Insert b) Intron c) Vector d) Exon e) Ribozyme 6. Which of the following sequences is complementary to TGGCAGCCT: a) TCCGACGGT 75

b) ACCGTCGGA c) ACCGUCGGA d) AGGCTGCCA e) TGGCTCGGA 7. tRNA reacts specifically with: a) Specific aminoacyl-adenylates b) ATP c) Free amino acids d) The golgi apparatus e) Nuclear DNA 8. The polymerase chain reaction (PCR) requires: a) A double stranded DNA at least partially of known sequence b) A synthetic non-complementary RNA c) Dideoxynucleotide triphosphates d) Reverse transcriptase e) A pair of specific mismatched DNA primer 9. A cDNA library differs from a genomic DNA library: a) In excluding DNA that encodes mitochondrial proteins b) In excluding DNA that encodes ribosomal proteins c) Only by having introns excised from gene d) In having longer polynucleotide fragments e) In reflecting only the activities of the tissue from which it is derived 10. PRPP is: a) An intermediate in de novo purine biosynthesis b) Involved in biosynthesis of NAD+ and NADP+ c) An intermediate in pyrimidine biosynthesis d) Intermediate in the salvage pathway e) All of the above is correct 11. Restriction endonucleases: a) Digest DNA duplex molecules from the 5'ends b) Attack only single stranded DNA c) Have base sequence specifity d) Randomly digest double stranded DNA molecules e) Are not produced in prokaryotes 12. All of the following statements concerning replication of DNA in prokaryotes are true except: a) Synthesis of new strands occurs in a 5'to 3' direction b) Temple strand is read in a 3' to 5' direction c) Lagging strand synthesis is discontinuous d) Synthesis occurs in both strands e) It is a conservative process 13. 5-phosphoribosyl-1-pyrophosphate (PRPP) is an intermediate in: a) The de novo synthesis of purine nucleotides b) The de novo synthesis of pyrimidine nucleotides c) The salvage pathway for the synthesis of purine nucleotides d) Both A and C e) All of the above are correct 76

14. The end product of purine catabolism in man is: a) Urea b) Xanthine c) Uric acid d) Produced by the enzyme guanase e) Inosine monophosphate 15. Restriction endonucleases type II: a) Are DNA dependent polymerases b) Are obtained from viruses c) Cut double-stranded DNA from any source d) Catalyze labeling of the source e) All of the above is correct 16. To constract cDNA library: a) Reverse transcriptase is needed b) mRNA is the starting material c) Synthetic linkers with restriction sites are needed d) Restriction enzymes are used to cut the vector based on the linker choice e) All of the above is correct 17. Hyperuricemia: a) Gouty artheritis is a common feature b) There is a high level of urate in the blood c) Allopurinol is used for treatment d) The defect in purine nucleotide metabolism e) All of the above is correct 18. Inhibition of purine biosynthesis de novo may potentially be due to all of the following except: a) Decreased phosphorylation of IMP b) Inhibition of PRPP aminotransferase c) Inhibition of PRPP synthetase d) Depletion of PRPP e) C and D are correct 19. The sigma subunit of prokaryotic RNA polymerase: a) Is required to hold the subunits of the core enzyme together b) Remains with the RNA polymerase until the termination of transcription c) Is required for proper recognition of prometer d) Contains the active site for RNA synthesis e) Is required for termination of transcription 20. An anticodon is: a) The part of DNA molecule that codes termination b) A 3-nucleotide sequence of messenger RNA molecule c) A specific nucleotide sequence of a tRNA molecule d) A nucleotide triplet of a ribosomal RNA molecule e) Covalently bound to colon 21. The polymerase chain reaction (PCR) requires: a) A double stranded DNA of totally unknown sequence b) A pair of synthetic RNA primers 77

c) Dideoxynucleotide triphosphates d) Reverse transcriptase e) Both B and D are correct 22. Gout is: a) Characterized by high level of xanthine in the blood b) Characterized by high level of urate in the blood c) Treatable with chloramphenicol d) A defect in pyrimidine nucleotide metabolism e) Defect of praline catabolism 23. In biosynthesis of purines: a) The amino acids Gly, Glu and Asp are involved b) ATP is not required c) Glutamine provides the first nitrogen atom in the purine ring d) Puromycin inhibits purine synthesis e) All of the above is correct 24. In the Salvage pathway: a) The nucleotides are converted to bases b) More energy is required than in the De Novo pathway c) Purine bases are involved but not the pyrimidine bases d) Phosphoribosylation of nucleosides occur e) HGPRTase enzyme is involved 25. All of the following statements are correct except: a) Pyrimidines are not essential in the human diet b) CPS1 is involved in pyrimidine biosynthesis c) Type 1 Orotic aciduria leads to Megaloblastic anemia d) Allopurinol may precipitate Orotic aciduria e) Aspartate is important for pyrimidine nucleotides biosynthesis 26. The formation of dATP for DNA synthesis occurs primarily by: a) De Novo synthesis beginning with dPRPP b) Salvaging adenine using Adenine phosphoribosyl transferase c) Conversion of ATP to dATP using thioredoxin d) Conversion of ADP to dADP using ribonucleotide reductase e) Conversion of dIMP to dAMP 27. Which of the following would not be expected to contribute to hyperuricemia: a) Unusually high level of PRPP b) Inhibition of xanthine oxidase c) Usually high turnover of nucleic acids d) Deficiency of HGPRTase e) Leukemia 28. In lagging DNA strand: a) There are several RNA primers b) DNA synthesis is discontinuous c) Polymerization proceeds in 5'3' direction d) DNA polymerase III is needed e) All of the above is correct 29. Which of the following statements about DNA ligase is correct? 78

a) DNA ligase seals the gaps between RNA primers and Okazaki fragments b) DNA ligase makes single stranded nicks which relieve the supercoiling c) The energy source for DNA ligase can be either NADPH or GTP depending on the species d) DNA ligase joins the free 3' hydroxyl on the Okazaki fragment to the 5' carbon on the growing strand e) It is classified as endonuclease enzyme 30. DNA synthesis and RNA synthesis differ in: a) Production of a complementary polynucleotide from a template b) Release of pyrophosphate as a reaction product c) Synthesis proceeds in the 5' to 3' direction d) Proofreading to eliminate errors e) First nucleotides incorporated are RNA 31. Restriction sites of restriction endonucleases: a) Are on double stranded DNA b) Can be 4-7 bp long c) Provide blunt and sticky ends d) Are less when the enzyme recognizes longer DNA sequences e) All of the above is correct 32. The Polymerase Chain Reaction a) Requires specific primers to amplify a DNA sequence b) Involves cyclic thermal denaturation and reannealing of DNA c) Helps diagnosing sub-clinical infections d) Exploits Taq polymerase for DNA replication e) All of the above is correct 33. Which of the following is TRUE for cDNA? a) DNA, a primer, ATP, dideoxynucleotides, DNA polymerase b) DNA, end labeled primer, dNTP's, dideoxynucleotides, DNA polymersae c) RNA, two primers, NTP's, dideoxynucleotides, RNA polymerase II d) RNA, two primers, NTP's, AZT, Taq polymerase e) DNA, a primer, dNDP's, dideoxyribonucleotides, RNA polymerase II 34. The following is employed in DNA sequencing: a) Plasmids b) Bacteriophage lambda c) Dideoxynucleotide triphosphate d) Reverse transcriptase e) Ligases

35. Initiation of protein biosynthesis: a) Involves elongation factor 2 b) Starts by association of the two ribosomal units c) Requires binding of the ternary complex to 40S subunit d) Does not involve association of the two ribosomal subunits e) Requires CTP 79

36. Amino-acyl-tRNA synthetase: a) Recognizes codons on mRNA b) Recognizes the anti-codon on the tRNA c) Catalyses the binding of amino acid to its respective tRNA d) Recognizes the Darm of the specific tRNA e) Both C and D are correct 37. All of the following statements concerning replication of DNA in prokaryotes are true except: a) Synthesis of new strands occurs in a 5' to 3' direction b) Template strand is read in a 3' to 5' direction c) Lagging strand synthesis is discontinuous d) Synthesis occurs in both strands e) It is a conservative process 38. Which of the following is needed for a polymerase chain reaction? a) A thermostable DNA polymerase b) Helicase c) Primase d) One of the target DNA strands e) Reverse transcriptase 39. The main metabolic source of one-carbon units that are transferred by tetrahydrofolate is: a) Alpha carbon of glycine b) Beta carbon of serine c) CO2 d) Methionine e) Beta carbon of alanine 40. The following is true about DNA-dependent RNA polymerase: a) Pol I is responsible for synthesis of rRNA and it is less sensitive to alphaamanitin b) Pol II is responsible for synthesis of mRNA c) Pol III is responsible for synthesis of tRNA d) RNA Polymerases have unwindase activity e) All of the above is correct

41. In eukaryotes, hnRNA's undergo elaborate post-transcriptional processing as follows: a) tRNA is charges with its respective amino acids b) mRNA is capped at the 5' end c) rRNA is polyadenylated at the 3' end d) Intron sequences are spliced by snRNA's e) Exons are removed and intros are ligated 42. Reverse transcriptase exhibits the following functions: A ) RNA directed DNA synthesis b) DNA dependent RNA synthesis 80

c) DNA dependent DNA synthesis d) Proofreading of cDNA e) None of the above is correct 43. With regard to the lac operon, an inducer substance binds to: a) The operator, causing an allosteric shift which initiates transcription b) A repressor protein, which then dissociates from the operator c) Lactose which binds the DNA and completes transcription of the structural genes d) A repressor protein, causing it to bind tightly to the operator e) The promoter, which initiates transcription 44. Transcriptional Activator Proteins: a) Transcribe a messenger off a DNA template b) Bind to ribosomes to activate the production of specific proteins c) Are produced during an infection of bacteria by a phage d) Are essential to function of transfer RNA's during translation e) Bind regions near a eukaryotic gene and allows an RNA polymerase to transcribe a gene 45. The Wobble Hypothesis says: a) There is loose pairing between the 5' end of a single codon and the 3' end of more than one anticodon b) There is loose pairing between the 5' end of a single anticodon and the 3' end of more than one codon c) There is a loose pairing between the 3' end of a single anticodin and the 5' end of more than one codon d) There is loose pairing between the 3' end of a single codon and the 5' end of more than one anticodon e) Codons of a single amino acid differ mainly in the 3rd position, rarely in the 2nd position but never in the 1st position 46. Which of the following sets of components are required for enzymatic DNA sequencing? a) DNA, a primer, ATP dideoxynucleotides, DNA polymerase b) DNA, end-labelled primer, dNTP's, dideoxynucleotides, DNA polymerase c) RNA, two primers, NTP's, dideoxynucleotides, RNA polymerase II d) RNA, two primers, NTP's, AZT, Taq Polymerase e) DNA, a primer, dNDP's, dideoxyribonucleotides, RNA polymerase II

47. A mutation in structural gene that changes the UGA termination codon to UGG codon (trp). What effect would this mutation most likely cause? a) The RNA will not be translated b) The RNA transcribed from the gene will be much longer than normal c) The polypeptide produced will be shorter than expected d) The polypeptide produced will have extra amino acids e) No effect at all 48. What is the maximum number of amino acids in a peptide coded by the polyribonucleotide 5' CCAUGUUUGGGUGAGGGCC3' in an in-vivo system starting from the first base? a) Six b) Two 81

c) Three d) Four e) Five 49. All of the following statements about ribosomes are correct except: a) All ribosomes have two subunits b) Eukaryotic cells have 80S ribosomes and protein synthesis on these ribosomes can be inhibited by cycloheximide c) Prokaryotic cells have 70S ribosomes and protein synthesis on these ribosomes can be inhibited by chloramphenicol d) Mitochondria have 80S ribosomes and protein synthesis on these ribosomes can be inhibited by cycloheximide e) The larger subunits of all ribosomes have the enzyme peptidyl transferase which forms peptide bonds 50. Which of the following is mimicked by the antibiotic puromycin? a) Peptidyl-tRNA b) Aminoacyl-tRNA c) Peptidyl transferase d) Translation release factors e) Formylmethionyl-tRNA 51. Deamination of cytosine in mRNA produces: a) An insertion mutation b) A deletion mutation c) A point mutation d) A purine e) Thymine

52. In a gene (without introns) of a protein containing 300 amino acids (number 12 is serine), which of the following mutations would be the LEAST likely to result in a faulty protein? a) A single base change in codon 12 complementary to nucleotide 36 in mRNA b) A nonsense mutation in the codon for amino acid 37 c) Deletion of three bases of the codon for amino acid 19 d) A single base change such that amino acid 12 is now leucine rather than isoleucine e) A single base change such that amino acid 12 is now aspartic acid rather than leucine 53. In comparing a plasmid vector with a lambda phage vector: a) Both endow the host with antibiotic resistance b) Both carry DNA fragments from 3 to 5 kilobases in length c) Both can reproduce themselves within the host d) Both contain a selectable marker e) Both ultimately kill the host 82

54. The following is employed in DNA sequencing: a) Plasmids b) Bacteriophage lambda c) Dideoxynucleotide triphosphate d) Reverse transcriptase e) Ligases 55. The following method is used only to detect RNA and can be used to measure the difference in levels of specific mRNA in different tissues: a) Northern blot analysis b) Polymerase chain reaction c) Restriction fragment length polymorphism linkage analysis d) DNA fingerprint analysis e) Southern blot analysis 56. Transcription of genes that code for proteins is accomplished by: a) RNA polymerase III in eukaryotes b) Reverse transcriptase c) RNA polymerase I in eukaryotes d) RNA polymerase II in eukaryotes e) Both A and B are correct 57. The requirements of RNA polymerase for synthesis of RNA include: a) RNA primer b) DNA template c) All four deoxyribonucleoside triphosphates d) Both A and B e) Both B and C

58. In PCR: a) The technique is used for DNA cloning b) RNA polymerase is needed c) Primers should be in excess d) All steps are performed at room temperature e) Radiolabeled probe is needed 59. Hyperuricemia is a biochemical finding in: a) Von Gierke's disease b) Xanthine oxidase deficiency c) Leukemia d) Both A and C e) Both A and B 60. The major control of de novo purine nucleotides biosynthesis is: a) Feedback inhibition of PRPP synthase b) Feedback inhibition of aspartate transcarbomylase c) Availability of ribose-5-phosphate d) Feedback inhibition of glutamyl-PRPP amidotransferase e) A, C and D are correct 61. Which of the following molecules is NOT a component of the 43S pre-initiation complex? 83

a) GTP b) Eukaryotic initiation factor 2 (IF-2) c) mRNA d) Methionyl-tRNA e) 40S sub-unit 62. The formation of dATP for DNA synthesis occurs primarily by: a) De Novo synthesis beginning with dPRPP b) Salvaging adenine using Adenine phosphoribosyl transferase c) Converting ATP to dATP using thioredoxin d) Converting of ADP to dADP using ribonucleotide reductase e) Converting of dIMP to dAMP using N5, N10-methylene THF 63. Which of the following uses ATP directly? a) Formation of the 40S initiation complex b) Binding of the amino acyl transfer RNA to the ribosome c) Synthesis of amino acyl-tRNA d) Activation of the amino group for peptide bond synthesis e) Movement of mRNA on the ribosome

64. A mRNA coding for eukaryotic polypeptide chain is attached to seven ribosomes, which of the following is TRUE for this polyribosome complex? a) The ribosome nearest to the 5' end of the mRNA is carrying a longer polypeptide chain than is the ribosome nearest to the 3' end b) The ribosome nearest to the 3' end of the mRNA is carrying a longer polypeptide chain than is the ribosome nearest to the 5' end c) The 60S subunit of one ribosome and the 40S subunit of another ribosome may be exchanged during the synthesis process d) All seven ribosomes are cooperating in the synthesis of one copy of the same polypeptide chain e) The mRNA contains a series of separate binding sites for each ribosome to initiate a polypeptide chain 65. In general, eukaryotic RNA processing can be best described by the following: a) All RNA transcripts are finally processed in the nucleus b) It results in the addition of nucleotides to the primary transcript of ribosomal RNA c) It results in the addition of formyl groups to methionine d) It includes the addition of a tail of polyadenylic acid at the 5' end e) It includes the modification of nucleotides in transfer RNA 66. Topoisomerase enzymes are important in the replication of DNA because they: a) Covalently join Okazaki fragments b) Relax supercoiled DNA created by helicase action c) Degrade nucleosomal histones d) Proofread newly synthesized DNA e) Synthesize the RNA primer 84

67. Which of the following is not true for both DNA polymerase and RNA polymerase? a) Both require a template b) Both reactions produce pyrophosphates as a product c) Both add 5' nucleotides to 3' hydroxyl groups d) Both utilize 5' nucleoside triphosphates as substrates e) Both require a primer 68. Codons on mRNA may be accurately described by all of the following except: a) They are read in a non-overlapping fashion b) They can form hydrogen bonds with tRNA c) An amino acid can have more than one codon d) 6 successive bases along the mRNA can code for 4 amino acids e) The same codon specifies the same amino acid in almost all species

69. The RNA primer in replication differs from other RNA molecules in that it: a) Contains T instead of U b) Is formed by DNA polymerase I c) Found in a form of DNA-RNA double-stranded hybrid d) Contains a triphosphate group at the 5' end immediately after synthesis e) Is synthesized in the 3' 5' direction 70. The role of peptidyl transferase in protein biosynthesis is to: a) Promote the movement of peptidyl-tRNA from the A site to the P site on the ribosome b) Promote the movement of aminoacyl-tRNA from the P site to the A site on the ribosome c) Catalyze the ejection of free tRNA from the P site on the ribosome d) Catalyze the formation of peptide bonds e) Cause recognition of termination codons by release factors 71. How does chloramphenicol work to inhibit protein synthesis? a) It binds to 23S rRNA b) It causes mutations in mRNA making it unusable c) It intercalates into the DNA blocking RNA polymerase d) It binds to the sigma factor preventing initiation e) It inhibits the peptidyl-transferase activity of 28S (a component of 60S subunit) 72. Restriction endonucleases: a) Digest DNA molecules from the 5'-OH ends b) Mainly attack double-stranded DNA but can attack single stranded DNA c) Have base sequence specificity d) Randomly digest double stranded DNA molecules at a rich sequence (palindrome) e) Are found only in hepatic cells and placental tissue in human 73. The following is not true about polymerase chain reaction: a) Requires specific primers to amplify a DNA sequence b) Involves cyclic thermal denaturation and reannealing of DNA 85

c) Helps diagnosing sub-clinical infections d) Exploits Taq polymerase for in vivo replication e) All of the above is correct 74. The polymerase chain reaction (PCR) a) Uses flanking primers b) Uses restriction enzymes c) Uses varying temperatures d) All of the above e) Both A and C

75. For a genetic disease, point mutations are usually first found by: a) ASO hybridization b) DNA sequence analysis c) Microarray d) Southern Blot e) PCR 76. Which of the following could be a probable recognition site for a restriction enzyme: a) 5' CTGCAG 3' b) 5' CTAGAC 3' c) 5' GCCTGC 3' d) 5' CCACGG 3' e) 5' CAGCAG 3' 77. If the PCR reaction is 100% efficient, one copy of template DNA should be amplified to ... copies after n cycles: a) 2n b) n2 c) 2n d) 10n e) I can't tell having this information 78. The following is correct about DNA sequencing: a) Sanger's method involves base specific cleavage b) The chemical method uses ddNTP's c) Sanger's method is performed only on single stranded DNA d) DNA sequence is read on an agarose gel e) The Maxam-Gilbert method is currently the method of choice 79. All of the following statements concerning replication of DNA in prokaryotes are true except: a) Synthesis of new strands occurs in a 5' to 3' direction b) Template strand is read in a 3' to 5' direction c) Lagging strand synthesis is discontinuous d) A primer is not required e) Synthesis occurs in both strands 80. Select the incorrect statement. Messanger RNA: a) Is translated in the direction 5'to 3' 86

b) Is often derived from a large precursor by processing in eukaryotes c) Is synthesized in the direction 3' to 5' d) Has a Poly A Tail e) Is a Heterogeneous Molecule

81. In DNA Replication: a) The newly synthesized DNA strand is growing in direction 5'3' b) DNA synthesis by the leading strand is continuous c) DNA Helicase facilitates processive unwinding of double strands d) Origin of replication is identified by double strand DNA binding protein e) All of the above is correct

IMMUNITY
1. Severe combined immunodeficiency involves: a) An absence of hypoxanthine phosphoribosyl transferase b) A deficiency of adenosine deaminase c) A deficiency of OMP decarboxylase d) Overproduction of urate e) A deficiency of adenylate deaminase 2. The Cro gene in bacteriophage lambda: a) Is overexpressed in prophage b) Gives a protein product which bind the OR3 to enhance its expression c) Is expressed in the lytic phase d) Controls the expression of cl gene e) Both C and D are correct 3. With regard to Histones: a) They are basic proteins found only in animal cells b) They have a high content of lysine and arginine c) They are found in the mitochondria d) They form pentameric assembly in nucleosome e) The amino acid composition show great variability amongst different races 4. In the antibody: a) Disulphide bridges are formed between the two heavy chains b) The two light chains are different c) The two binding sites on each molecule are different d) The Fc fragment interacts with the antigen e) The heavy chain is always the gamma type 5. Secondary antibody responses are better because: 87

a) They have broader specifities b) They make mainly IgM antibody c) Complement fixing antibodies are made d) They do not require T Cells help e) They are stronger and faster 6. Which of the following statements does not apply to IgG? a) Appears in primary immune responses b) Neutralizes bacterial toxins c) Can fix complements d) Cannot cross the human placenta e) Osponizes bacteria 7. HAT medium is used to: a) Immortalize B lymphocytes b) Culture B lymphocytes c) Select for cancerous and non cancerous cell hybrids in the Hybridoma technology d) Kill B cell hybridomas e) Convert B lymphocytes to myeloma cells

8. Clonal selection occurs when a B lymphocyte encounters: a) Cytokine b) Antigen c) T lymphocyte d) Complement e) Chemotactic factor 9. When E. coli bacteria are grown in a medium containing lactose as the sole carbon source: a) The lac repressor is able to bind tightly to the lac operator region b) RNA polymerase is unable to transcribe the lac operon c) The lac operator binds lactose d) An inducer-repressor complex detaches from the lac operator region e) Beta-galactosidase activity will be at a minimal level 10. Energy transformation in the human body involves: a) Conversion of electrical energy to chemical energy b) Conversion of chemical energy to electrical energy c) Conversion of chemical energy to kinetic energy d) Conversion of electrical energy to heat e) All of the above is correct 11. Interconversion of biomolecules in living cells is facilitated by: a) The presence of amphibolic intermediates b) Reversible reactions c) Increasing the level of fructose 2,6 bisphosphate d) Inhibiting fructose 1,6 bisphosphatase e) None of the above 12. Recurring motifs of metabolic control include: a) Modulation of transcription rate b) Phosphorylation and dephosphorylation 88

c) Allosteric regulation d) Acetylation of key enzymes e) D is the only wrong answer 13. Hormones that bind membrane bound receptors include: a) Epinephrine b) T3 c) Cortisol d) Calcitrol e) Aldosterone 14. Characteristic features of receptors for peptide hormones include: a) They are all protein in nature b) They have specificity for the ligand c) The binding of the ligand is saturable and reversible d) Intracellular signal is initiated as a result of hormone-receptor interaction at the cell membrane e) All of the above is correct

15. Leptin: a) Is a peptide hormone produced by adipocytes b) Binds receptors in the hypothalamus c) Supresses appetite d) Stimulates the sympathetic nervous system e) All of the above is correct 16. The following is correct: a) Cholera toxin acts through cGMP production b) Nitroglycerides activate production of cAMP c) Phorbol esters inhibit protein kinase C d) Cortisol binds with intracellular receptors e) All of the above is correct 17. Epinephrine: a) Inhibits glycogenolysis and gluconeogenesis b) Enhances glycogen phosphorylase in the liver c) Binds an intracellular receptor d) Activates PFK-1 in the liver e) Activates cAMP phosphodiesterase 18. All the following hormones promote hyperglycemia except: a) Epinephrine b) Norepinephrine c) Insulin d) Glucagon e) Glucocorticoids 19. The level of cAMP is increased in adipocytes by: a) Epinephrine b) Insulin c) Growth hormone d) ANF 89

e) An increase in the activity of phosphodiesterase 20. The structure of the antibody: a) Disulphide bridges are formed between the two heavy chains b) The two light chains are identical c) The two binding sites on each molecule are identical d) The Fc fragment mediates effector function of the antibody e) All of the above is correct 21. Characteristics of the adaptive immune response include: a) High specifity b) Differentiation between self and non-self c) Versatility d) Brisk secondary response e) All of the above is correct

22. Concerning Immunoglobulins: a) IgM is found mainly in the blood b) IgA is found only in the blood c) IgE is found in association with mast cells in the skin d) Only IgG can cross the placental barrier e) B is the only wrong answer 23. T Helper 1 produces: a) IL-2 b) Antibodies c) IL-2 receptor d) Interferon gamma e) A, C and D are correct 24. Antibodies against an individual own body components are called: a) Autoantibodies b) Isotypes c) Autoantigens d) Anti-idiotypic e) Idiotypes 25. The complement components: a) Enhance phagocytosis b) Are produced by the spleen c) Induce cytotokine production by T cell d) Activate cytotoxic T cell e) Include interferon gamma 26. Cytokines: a) Include interleukins and interferons b) Act by autocrine and paracrine mechanisms c) Promote B cell growth and differentiation d) Interact with membrane-bound receptors e) All of the above is correct 90

27. The following is phase II reaction of a xenobiotic: a) Hydroxylation b) Deamination c) Reduction d) Glucuronidation e) Desulfuration 28. Properties of human cytochrome P450s: a) Some are hemoproteins b) Extremly versatile catalysts c) Found only in the liver d) Include cytochrome C e) The hydroxylated product are less water-soluble

29. The following statements are true: a) Transferrin transports calcium in the circulation b) Hemochromatosis is characterized by excessive storage of ions in tissues c) Haptoglobin binds extra corpuscular hemoglobin d) All of the above is correct e) B and C are correct 30. Oncogene: a) Are genes responsible of delaying cancer b) Are not detected in viruses c) Products may affect signal transduction in a cell d) Are not involved in causation of any cancer e) Are the same as protooncogenes 31. Characteristics of cancer cells include: a) Loss of contact inhibition b) Altered membrane permeability c) Diminished requirement for growth factors d) Altered cellular enzymes profile e) All of the above is correct 32. Biochemical changes that occur in transformed (cancer) cells include all of the following except: a) Increased pyrimidine catabolism b) Increased rate of glycolysis and lactate formation c) Increased activity of ribonucleotides reductase d) Increased rate of nucleic acid synthesis e) Inappropriate synthesis and secretion of proteases 33. Which of the following is a possible cause of cancer? a) Introduction of a novel gene into the cell genome by an oncogenic virus b) Damage of the cellular DNA by exposure to a radiant energy c) Alteration of DNA base sequence as a result of exposure to chemical mutagens d) Inheritance of defective tumor suppressor gene 91

e) All of the above is correct 34. The following are considered as phase 1 reactions in xenobiotics metabolism: a) Hydroxylation and dealogenation b) Dehalogenation and ulfation c) Sulfation and Hydroxylation d) Deamination and aceylation e) Acetylation and dehalogenation 35. The following are considered as phase 2 reactions in xenobiotics metabolism: a) Conjugation with bilirubin b) Conjugation with glutathione c) Methylation with S-adenosyl methionine d) Reduction e) B, C and D are correct

36. The following are known actions of cytochrome P450: a) Hydroxylation of foreign hydrophobic compounds in the liver b) Synthesis of steroid hormones in the adrenal cortex c) Conversion of procarcinogens into active carcinogens d) Inactivation of some drugs e) All of the above is correct 37. Characteristics of cytochrome P450 enzymes include: a) They are polymorphic hemoproteins b) They are mainly found in liver and intestine c) They have overlapping substrate specifities d) They are rich in phosphatidylcholine (lecithin) e) All of the above is correct 38. All of the following is correct about xenobiotics metabolism, except: a) It requires NADPH as a proton donor in hydroxylation reactions b) It renders non-polar chemicals more water soluble c) It may occur in the cytochromes of the electron transport chain d) It may affect drug action in the human body e) It is affected by genetic constitution of an individual 39. The following is correct about phase 2 reactions in xenobiotics metabolism? a) They intend to promote excretion of the xenobiotics b) They involve conjugation with glucuronic acid c) They involve methylation of xenobiotics with S-adenosylmethionine d) The acetyl transferase is the main enzyme in phase 2 reactions e) D is the only wrong statement 40. The following is correct about the regulation of cell division: a) It is triggered by phosphorylation of various cellular proteins b) It is mainly regulated by a complex protein called maturation promotion factor (MPF) c) The regulatory protein, cyclin is degraded at the end of the mitotic phase d) DNA is synthesized during the S phase of the cell cycle e) All of the above is correct 92

41. The following is incorrect about Ames test: a) It is used for evaluating the potential carcinogenicity of a chemical substance b) It is useful in diagnosis of cancer in human tissues c) It employs a mutated strain of Salmonella typhimurium d) It uses the ability of histidine synthesis as an indicator for mutagenicity e) It is used for screening the carcinogenicity of a chemical compound before introducing for human use 42. The following is incorrect about cytochrome P450 enzymes a) There are at least 30 different isoforms of these enzymes b) They may convert inert procarcinogens into active carcinogens c) They are essential for the activation of various drugs d) Their activity is affected by age and sex e) They are characterized by genetic differences

43. In comparing a plasmid vector with a lambda phage vector: a) Both endow the host with antibiotic resistance b) Both carry DNA fragments from 3 to 5 kilobases in length c) Both can reproduce themselves within the host d) Both contain a selectable marker e) Both ultimately kill the host

genetics
1. The cDNA library differs from a genomic DNA library in: a) Excluding DNA that encodes mitochondrial proteins b) Excluding DNA that encodes ribosomal proteins c) Only by having introns excluded from genes d) Having longer polynucleotide fragments e) Reflecting the whole activities of all tissues in multicellular organisms 2. The genetic code is: a) Ambigeous b) Overlapping c) Degenerate d) None specific e) None of the above 3. In contrast to DNA polymerase, RNA polymerase: a) Fills the gap between Okazaki fragments b) Works only in the 5'to 3'direction c) Edits as it synthesizes d) Synthesize RNA primer to initiate DNA synthesis e) Adds nucleoside monophosphates to the growing polynucleotides 4. A promoter site on DNA: a) Transcribes repressor b) Initiates transcription 93

c) Codes for RNA polymerase d) Regulates termination e) Translates specific proteins 5. The portion of DNA which is transcribed but not translated is called: a) Insert b) Intron c) Vector d) Exon e) Ribozyme 6. Which of the following sequences is complementary to TGGCAGCCT: a) TCCGACGGT b) ACCGTCGGA c) ACCGUCGGA d) AGGCTGCCA e) TGGCTCGGA 7. tRNA reacts specifically with: a) Specific aminoacyl-adenylates b) ATP c) Free amino acids d) The golgi apparatus e) Nuclear DNA 8. The polymerase chain reaction (PCR) requires: a) A double stranded DNA at least partially of known sequence b) A synthetic non-complementary RNA c) Dideoxynucleotide triphosphates d) Reverse transcriptase e) A pair of specific mismatched DNA primer 9. A cDNA library differs from a genomic DNA library: a) In excluding DNA that encodes mitochondrial proteins b) In excluding DNA that encodes ribosomal proteins c) Only by having introns excised from gene d) In having longer polynucleotide fragments e) In reflecting only the activities of the tissue from which it is derived 11. Restriction endonucleases: a) Digest DNA duplex molecules from the 5'ends b) Attack only single stranded DNA c) Have base sequence specifity d) Randomly digest double stranded DNA molecules e) Are not produced in prokaryotes 12. All of the following statements concerning replication of DNA in prokaryotes are true except: a) Synthesis of new strands occurs in a 5'to 3' direction b) Temple strand is read in a 3' to 5' direction c) Lagging strand synthesis is discontinuous d) Synthesis occurs in both strands e) It is a conservative process 94

13. Restriction endonucleases type II: a) Are DNA dependent polymerases b) Are obtained from viruses c) Cut double-stranded DNA from any source d) Catalyze labeling of the source e) All of the above is correct 14. To constract cDNA library: a) Reverse transcriptase is needed b) mRNA is the starting material c) Synthetic linkers with restriction sites are needed d) Restriction enzymes are used to cut the vector based on the linker choice e) All of the above is correct 15. The sigma subunit of prokaryotic RNA polymerase: a) Is required to hold the subunits of the core enzyme together b) Remains with the RNA polymerase until the termination of transcription c) Is required for proper recognition of prometer d) Contains the active site for RNA synthesis e) Is required for termination of transcription 16. An anticodon is: a) The part of DNA molecule that codes termination b) A 3-nucleotide sequence of messenger RNA molecule c) A specific nucleotide sequence of a tRNA molecule d) A nucleotide triplet of a ribosomal RNA molecule e) Covalently bound to colon 17. The polymerase chain reaction (PCR) requires: a) A double stranded DNA of totally unknown sequence b) A pair of synthetic RNA primers c) Dideoxynucleotide triphosphates d) Reverse transcriptase e) Both B and D are correct 18. In lagging DNA strand: a) There are several RNA primers b) DNA synthesis is discontinuous c) Polymerization proceeds in 5'3' direction d) DNA polymerase III is needed e) All of the above is correct 19. Which of the following statements about DNA ligase is correct? a) DNA ligase seals the gaps between RNA primers and Okazaki fragments b) DNA ligase makes single stranded nicks which relieve the supercoiling c) The energy source for DNA ligase can be either NADPH or GTP depending on the species d) DNA ligase joins the free 3' hydroxyl on the Okazaki fragment to the 5' carbon on the growing strand e) It is classified as endonuclease enzyme 20. DNA synthesis and RNA synthesis differ in: a) Production of a complementary polynucleotide from a template b) Release of pyrophosphate as a reaction product 95

c) Synthesis proceeds in the 5' to 3' direction d) Proofreading to eliminate errors e) First nucleotides incorporated are RNA 21. Restriction sites of restriction endonucleases: a) Are on double stranded DNA b) Can be 4-7 bp long c) Provide blunt and sticky ends d) Are less when the enzyme recognizes longer DNA sequences e) All of the above is correct 22. The Polymerase Chain Reaction a) Requires specific primers to amplify a DNA sequence b) Involves cyclic thermal denaturation and reannealing of DNA c) Helps diagnosing sub-clinical infections d) Exploits Taq polymerase for DNA replication e) All of the above is correct 23. Which of the following is TRUE for cDNA? a) DNA, a primer, ATP, dideoxynucleotides, DNA polymerase b) DNA, end labeled primer, dNTP's, dideoxynucleotides, DNA polymersae c) RNA, two primers, NTP's, dideoxynucleotides, RNA polymerase II d) RNA, two primers, NTP's, AZT, Taq polymerase e) DNA, a primer, dNDP's, dideoxyribonucleotides, RNA polymerase II 24. The following is employed in DNA sequencing: a) Plasmids b) Bacteriophage lambda c) Dideoxynucleotide triphosphate d) Reverse transcriptase e) Ligases 25. Initiation of protein biosynthesis: a) Involves elongation factor 2 b) Starts by association of the two ribosomal units c) Requires binding of the ternary complex to 40S subunit d) Does not involve association of the two ribosomal subunits e) Requires CTP 26. Amino-acyl-tRNA synthetase: a) Recognizes codons on mRNA b) Recognizes the anti-codon on the tRNA c) Catalyses the binding of amino acid to its respective tRNA d) Recognizes the D arm of the specific tRNA e) Both C and D are correct 27. All of the following statements concerning replication of DNA in prokaryotes are true except: a) Synthesis of new strands occurs in a 5' to 3' direction b) Template strand is read in a 3' to 5' direction c) Lagging strand synthesis is discontinuous d) Synthesis occurs in both strands e) It is a conservative process 96

28. Which of the following is needed for a polymerase chain reaction? a) A thermostable DNA polymerase b) Helicase c) Primase d) One of the target DNA strands e) Reverse transcriptase

29. The following is true about DNA-dependent RNA polymerase: a) Pol I is responsible for synthesis of rRNA and it is less sensitive to alphaamanitin b) Pol II is responsible for synthesis of mRNA c) Pol III is responsible for synthesis of tRNA d) RNA Polymerases have unwindase activity e) All of the above is correct 30. In eukaryotes, hnRNA's undergo elaborate post-transcriptional processing as follows: a) tRNA is charges with its respective amino acids b) mRNA is capped at the 5' end c) rRNA is polyadenylated at the 3' end d) Intron sequences are spliced by snRNA's e) Exons are removed and intros are ligated 31. Reverse transcriptase exhibits the following functions: a ) RNA directed DNA synthesis b) DNA dependent RNA synthesis c) DNA dependent DNA synthesis d) Proofreading of cDNA e) None of the above is correct 32. With regard to the lac operon, an inducer substance binds to: a) The operator, causing an allosteric shift which initiates transcription b) A repressor protein, which then dissociates from the operator c) Lactose which binds the DNA and completes transcription of the structural genes d) A repressor protein, causing it to bind tightly to the operator e) The promoter, which initiates transcription 33. Transcriptional Activator Proteins: a) Transcribe a messenger off a DNA template b) Bind to ribosomes to activate the production of specific proteins c) Are produced during an infection of bacteria by a phage d) Are essential to function of transfer RNA's during translation e) Bind regions near a eukaryotic gene and allows an RNA polymerase to transcribe a gene

97

34. The Wobble Hypothesis says: a) There is loose pairing between the 5' end of a single codon and the 3' end of more than one anticodon b) There is loose pairing between the 5' end of a single anticodon and the 3' end of more than one codon c) There is a loose pairing between the 3' end of a single anticodin and the 5' end of more than one codon d) There is loose pairing between the 3' end of a single codon and the 5' end of more than one anticodon e) Codons of a single amino acid differ mainly in the 3rd position, rarely in the 2nd position but never in the 1st position 35. Which of the following sets of components are required for enzymatic DNA sequencing? a) DNA, a primer, ATP dideoxynucleotides, DNA polymerase b) DNA, end-labelled primer, dNTP's, dideoxynucleotides, DNA polymerase c) RNA, two primers, NTP's, dideoxynucleotides, RNA polymerase II d) RNA, two primers, NTP's, AZT, Taq Polymerase e) DNA, a primer, dNDP's, dideoxyribonucleotides, RNA polymerase II

36. A mutation in structural gene that changes the UGA termination codon to UGG codon (trp). What effect would this mutation most likely cause? a) The RNA will not be translated b) The RNA transcribed from the gene will be much longer than normal c) The polypeptide produced will be shorter than expected d) The polypeptide produced will have extra amino acids e) No effect at all 37. What is the maximum number of amino acids in a peptide coded by the polyribonucleotide 5' CCAUGUUUGGGUGAGGGCC3' in an in-vivo system starting from the first base? a) Six b) Two c) Three d) Four e) Five 38. All of the following statements about ribosomes are correct except: a) All ribosomes have two subunits b) Eukaryotic cells have 80S ribosomes and protein synthesis on these ribosomes can be inhibited by cycloheximide c) Prokaryotic cells have 70S ribosomes and protein synthesis on these ribosomes can be inhibited by chloramphenicol d) Mitochondria have 80S ribosomes and protein synthesis on these ribosomes 98

can be inhibited by cycloheximide e) The larger subunits of all ribosomes have the enzyme peptidyl transferase which forms peptide bonds

39. Which of the following is mimicked by the antibiotic puromycin? a) Peptidyl-tRNA b) Aminoacyl-tRNA c) Peptidyl transferase d) Translation release factors e) Formylmethionyl-tRNA 40. Deamination of cytosine in mRNA produces: a) An insertion mutation b) A deletion mutation c) A point mutation d) A purine e) Thymine 41. In a gene (without introns) of a protein containing 300 amino acids (number 12 is serine), which of the following mutations would be the LEAST likely to result in a faulty protein? a) A single base change in codon 12 complementary to nucleotide 36 in mRNA b) A nonsense mutation in the codon for amino acid 37 c) Deletion of three bases of the codon for amino acid 19 d) A single base change such that amino acid 12 is now leucine rather than isoleucine e) A single base change such that amino acid 12 is now aspartic acid rather than leucine 42. In comparing a plasmid vector with a lambda phage vector: a) Both endow the host with antibiotic resistance b) Both carry DNA fragments from 3 to 5 kilobases in length c) Both can reproduce themselves within the host d) Both contain a selectable marker e) Both ultimately kill the host 43. The following is employed in DNA sequencing: a) Plasmids b) Bacteriophage lambda c) Dideoxynucleotide triphosphate d) Reverse transcriptase e) Ligases 44. The following method is used only to detect RNA and can be used to measure the difference in levels of specific mRNA in different tissues: a) Northern blot analysis b) Polymerase chain reaction c) Restriction fragment length polymorphism linkage analysis d) DNA fingerprint analysis e) Southern blot analysis

99

45. Transcription of genes that code for proteins is accomplished by: a) RNA polymerase III in eukaryotes b) Reverse transcriptase c) RNA polymerase I in eukaryotes d) RNA polymerase II in eukaryotes e) Both A and B are correct 46. The requirements of RNA polymerase for synthesis of RNA include: a) RNA primer b) DNA template c) All four deoxyribonucleoside triphosphates d) Both A and B e) Both B and C 47. In PCR: a) The technique is used for DNA cloning b) RNA polymerase is needed c) Primers should be in excess d) All steps are performed at room temperature e) Radiolabeled probe is needed 48. Which of the following molecules is NOT a component of the 43S pre-initiation complex? a) GTP b) Eukaryotic initiation factor 2 (IF-2) c) mRNA d) Methionyl-tRNA e) 40S sub-unit 49. Which of the following uses ATP directly? a) Formation of the 40S initiation complex b) Binding of the amino acyl transfer RNA to the ribosome c) Synthesis of amino acyl-tRNA d) Activation of the amino group for peptide bond synthesis e) Movement of mRNA on the ribosome 50. A mRNA coding for eukaryotic polypeptide chain is attached to seven ribosomes, which of the following is TRUE for this polyribosome complex? a) The ribosome nearest to the 5' end of the mRNA is carrying a longer polypeptide chain than is the ribosome nearest to the 3' end b) The ribosome nearest to the 3' end of the mRNA is carrying a longer polypeptide chain than is the ribosome nearest to the 5' end c) The 60S subunit of one ribosome and the 40S subunit of another ribosome may be exchanged during the synthesis process d) All seven ribosomes are cooperating in the synthesis of one copy of the same polypeptide chain e) The mRNA contains a series of separate binding sites for each ribosome to initiate a polypeptide chain 51. In general, eukaryotic RNA processing can be best described by the following: a) All RNA transcripts are finally processed in the nucleus b) It results in the addition of nucleotides to the primary transcript of ribosomal RNA 100

c) It results in the addition of formyl groups to methionine d) It includes the addition of a tail of polyadenylic acid at the 5' end e) It includes the modification of nucleotides in transfer RNA 52. Topoisomerase enzymes are important in the replication of DNA because they: a) Covalently join Okazaki fragments b) Relax supercoiled DNA created by helicase action c) Degrade nucleosomal histones d) Proofread newly synthesized DNA e) Synthesize the RNA primer 53. Which of the following is not true for both DNA polymerase and RNA polymerase? a) Both require a template b) Both reactions produce pyrophosphates as a product c) Both add 5' nucleotides to 3' hydroxyl groups d) Both utilize 5' nucleoside triphosphates as substrates e) Both require a primer 54. Codons on mRNA may be accurately described by all of the following except: a) They are read in a non-overlapping fashion b) They can form hydrogen bonds with tRNA c) An amino acid can have more than one codon d) 6 successive bases along the mRNA can code for 4 amino acids e) The same codon specifies the same amino acid in almost all species 69. The RNA primer in replication differs from other RNA molecules in that it: a) Contains T instead of U b) Is formed by DNA polymerase I c) Found in a form of DNA-RNA double-stranded hybrid d) Contains a triphosphate group at the 5' end immediately after synthesis e) Is synthesized in the 3' 5' direction 55. The role of peptidyl transferase in protein biosynthesis is to: a) Promote the movement of peptidyl-tRNA from the A site to the P site on the ribosome b) Promote the movement of aminoacyl-tRNA from the P site to the A site on the ribosome c) Catalyze the ejection of free tRNA from the P site on the ribosome d) Catalyze the formation of peptide bonds e) Cause recognition of termination codons by release factors

56. How does chloramphenicol work to inhibit protein synthesis? a) It binds to 23S rRNA b) It causes mutations in mRNA making it unusable c) It intercalates into the DNA blocking RNA polymerase d) It binds to the sigma factor preventing initiation e) It inhibits the peptidyl-transferase activity of 28S (a component of 60S subunit) 57. Restriction endonucleases: a) Digest DNA molecules from the 5'-OH ends b) Mainly attack double-stranded DNA but can attack single stranded DNA 101

c) Have base sequence specificity d) Randomly digest double stranded DNA molecules at a rich sequence (palindrome) e) Are found only in hepatic cells and placental tissue in human 58. The following is not true about polymerase chain reaction: a) Requires specific primers to amplify a DNA sequence b) Involves cyclic thermal denaturation and reannealing of DNA c) Helps diagnosing sub-clinical infections d) Exploits Taq polymerase for in vivo replication e) All of the above is correct 59. The polymerase chain reaction (PCR) a) Uses flanking primers b) Uses restriction enzymes c) Uses varying temperatures d) All of the above e) Both A and C 60. For a genetic disease, point mutations are usually first found by: a) ASO hybridization b) DNA sequence analysis c) Microarray d) Southern Blot e) PCR 61. Which of the following could be a probable recognition site for a restriction enzyme: a) 5' CTGCAG 3' b) 5' CTAGAC 3' c) 5' GCCTGC 3' d) 5' CCACGG 3' e) 5' CAGCAG

62. If the PCR reaction is 100% efficient, one copy of template DNA should be amplified to ... copies after n cycles: a) 2n b) n2 c) 2n d) 10n e) I can't tell having this information 63. The following is correct about DNA sequencing: a) Sanger's method involves base specific cleavage b) The chemical method uses ddNTP's c) Sanger's method is performed only on single stranded DNA d) DNA sequence is read on an agarose gel e) The Maxam-Gilbert method is currently the method of choice

102

64. All of the following statements concerning replication of DNA in prokaryotes are true except: a) Synthesis of new strands occurs in a 5' to 3' direction b) Template strand is read in a 3' to 5' direction c) Lagging strand synthesis is discontinuous d) A primer is not required e) Synthesis occurs in both strands 65. Select the incorrect statement. Messanger RNA: a) Is translated in the direction 5'to 3' b) Is often derived from a large precursor by processing in eukaryotes c) Is synthesized in the direction 3' to 5' d) Has a Poly A Tail e) Is a Heterogeneous Molecule 66. In DNA Replication: a) The newly synthesized DNA strand is growing in direction 5'3' b) DNA synthesis by the leading strand is continuous c) DNA Helicase facilitates processive unwinding of double strands d) Origin of replication is identified by double strand DNA binding protein e) All of the above is correct 67. The following are purine nucleotides: a) ATP and CMP b) CTP and GDP c) NAD and TDP d) GMP and ADP e) UDP and GTP 68. Watson and Crick model of DNA structure implies that: a) Thymine base pairs with adenine b) Thymine base pairs with cytosine c) DNA is a single strand d) The purine content is not equal to the pyrimidine content e) The nitrogenous bases from the backbone of the molecule 69. RNA: a) Contains deoxyribose b) Contains adenine, guanine, thymine & cytosine c) Is usually single stranded d) Guanine content is equal to cytosine content e) Is not found in the nucleus 70. The bonds that stabilize the structure of DNA are: a) Hydrogen bonds and peptide bonds b) Phosphodiester bonds and hydrogen bonds c) Glycosidic bonds and thioester bonds d) Disulphide bonds and hydrogen bonds e) Van der Waals forces 71. All the following compose a nucleoside except: a) Phosphate group b) Deoxyribose c) Ribose sugar 103

d) Pentose sugar e) Purine base 72. The following are purine nucleotides: a) AMP and ADP b) ATP and CMP c) CTP and GDP d) NAD and TDP e) UDP and GTP 73. Select the incorrect statement. Messanger RNA: a) Is translated in the direction 5'to 3' b) Is oftend derived from a large precursor by processing in eukaryotes c) Has a poly A tail in eukaryotes d) Is a heterogeneous molecule e) Is extensively processed posttranscriptionally in prokaryotes 74. Nucleotides in nucleic acids are linked together by: a) Peptide bonds b) 3' to 5' phosphodiester bond c) 5' to 3' phosphodiester bond d) Disulphide bonds and hydrogen bonds e) Van der Waals forces 75. The following is a purine nucleotide: a) Cytidylate b) Guanosine c) Cytidine monophosphate d) Uridine e) Adenylate 76. Regarding Watson-Crick model of DNA structure: a) The bases are found to the outside b) The two strands are parallel c) (G+C / A+T) = 1 d) The opposing strands of DNA are said to be complementary e) Adenine pairs with thymine by 3 hydrogen bonds 77. The following statement is correct: a) DNA is a polymer of nucleosides b) The two DNA strands are covalently linked c) The genetic information is stored in the linear sequence of bases along the molecule d) DNA is found only in the nucleus e) Successive nucleotides are linked by 3'-5- thioester bond 78. rRNA: a) Is the least RNA in the cell b) Is the smallest among RNA's c) Is the same in pro- and eukaryotic cells d) Codes for protein synthesis e) Has catalytic function in protein synthesis 79. tRNA: 104

a) Is the most abundant RNA in the cell b) Acts as adaptor during protein synthesis c) Is the most heterogeneous of all RNA's d) Usually binds more than one amino acid e) Has a catalytic role during protein synthesis 80. The following is correct about the genetic code: a) 62 codons can code for amino acids b) It is universal c) Four codons can terminate protein sythesis d) Many amino acids have multiple codons e) All of the above is correct 81. The genetic code is said to be umambiguous, that means: a) Several triplets code for one amino acid b) Each triplet codes for one amino acid c) One gene one protein d) Each triplet specifies more than one amino acid e) Each amino acid has one codon 82. If GUA specifies valine, UUA specifies leucine, AUU specifies isoleucine and ACA specifies threonine, it is most likely that AUA specifies: a) Valine b) Leucine c) Isoleucine d) Threonine e) Proline 83. With regard to mitochondrial DNA: a) It has a circular duplex of ribonucleic acid b) It accounts for 25% of total human DNA c) It codes for all mitochondrial enzymes d) It is inherited exclusively from the mother e) All of the above is true 84. The following is a purine nucleotide: a) Cytidylate b) Guanosine c) Cytidine monophosphate d) Adenine monophosphate e) Guanosine monophosphate 85. Concerning the different types of RNA: a) mRNA is the most abundant b) rRNA is involved in formation of ribosomes c) tRNA carries codons for amino acids d) tRNA acceptor arm is found in the 5' end e) mRNA is the most homogeneous type 86. Which of the following statement is correct: a) DNA is a polymer of nucleosides b) The two DNA strands are covalently linked c) The genetic information is stored in the linear sequence of bases in DNA d) DNA is found only in the nucleus 105

e) Successive nucleotides are linked by 3'-5- thioester bond 87. cAMP is: a) Purine base b) Involved in signal transduction c) A synthetic nucleotide analogue d) Is a nucleoside derivative of cytosine e) Is the same as AMP 88. Synthetic nucleotide analogs: a) Include cGMP b) Include theophylline c) Can be used as anti-tumor agents d) 5-fluoro uracil is used for treatment of gout e) Have only antiviral effect 89. Nucleotides: a) Include NAD and FAD b) Are involved in formation of coenzymes c) Are involved in base plus sugar plus phosphate d) Important in CHO biosynthesis e) All of the above is correct 90. The following are the properties of the genetic code: a) It is degenerate b) It is commaless c) It is non overlapping d) It is a triplet e) All of the above is correct 91. Concerning the 20 standard amino acids: a) Each amino acid has two codons b) Some amino acids have no codons c) One codon can code for more than one amino acid d) An amino acid can have more than one codon e) None of the above 92. The codon is: a) Three nucleotides (bases) in mRNA representing an amino acid b) The sequence of bases in tRNA c) The same as the gene d) The base sequence in rRNA e) None of the above 93. The gene is: a) Polymer of amino acid linked by peptide bond b) DNA segment carrying information about a protein c) Only made of introns d) The same as chromosomes e) Only made of exons in eukaryotes 94. The flow of genetic information is the following order: a) Translation replication transcription b) Replication transcription translation 106

c) Transcription replication translation d) Replication translation transcription e) Transcription translation replication 95. Possible roles of covalent modification of histones include: a) Acetylation of histones H3 and H4 is associated with the activation or inactivation of gene transcription b) Methylation enhances transcription c) Phosphorylation of H1 participate in octamer formation d) ADP-ribosylation is associated with nucleosomal assembly e) None of the above is correct 96. The Cro gene in bacteriophage lambda: a) Is overexpressed in prophage b) Gives a protein product which bind the OR3 to enhance its expression c) Is expressed in the lytic phase d) Controls the expression of cl gene e) Both C and D are correct 97. With regard to Histones: a) They are basic proteins found only in animal cells b) They have a high content of lysine and arginine c) They are found in the mitochondria d) They form pentameric assembly in nucleosome e) The amino acid composition show great variability amongst different races 98. When E. coli bacteria are grown in a medium containing lactose as the sole carbon source: a) The lac repressor is able to bind tightly to the lac operator region b) RNA polymerase is unable to transcribe the lac operon c) The lac operator binds lactose d) An inducer-repressor complex detaches from the lac operator region e) Beta-galactosidase activity will be at a minimal level

99. In comparing a plasmid vector with a lambda phage vector: a) Both endow the host with antibiotic resistance b) Both carry DNA fragments from 3 to 5 kilobases in length c) Both can reproduce themselves within the host d) Both contain a selectable marker e) Both ultimately kill the host 100. Restriction enzymes a) Recognize specific nucleotide sequences in DNA b) Cut both strands of DNA c) Often produce single stranded tails d) Do all of the above e) Do none of the above 101. In gel filteration, biomolecules are separated according to: a) The net charge b) The difference in molecular weight c) Ability of diffusion through porous membranes d) Polarity 107

e) Solubility 102. The following method is used only to detect RNA and can be used to measure the difference in levels of specific mRNA in different tissues: a) Northern blot analysis b) Polymerase chain reaction c) Restriction fragment length polymorphism linkage analysis d) DNA fingerprint analysis e) Southern blot analysis

103. The following is correct: a) Western blotting is for proteins b) Northern blotting is for RNA c) Southern blotting is for DNA d) Transfer follows separation by electrophoresis e) All of the above is correct 104. The following statements are true regarding Southern blotting except: a) It is the transfer of DNA from a gel onto a nylon membrane b) It involves transfer of double stranded DNA from a gel to nylon membrane c) It is helpful in detection of certain stains of infectious agents d) Is useful for detection of a mutation in a given gene e) It uses capillary diffusion for fragment transfer 105. The following techniques are used to immobilize the corresponding biomolecules: a) Southern blotting for proteins b) Northern blotting for RNA c) Southern blotting for DNA d) Northern blotting for DNA e) Both B and C are correct 106. If a double-stranded DNA molecule undergoes two rounds of replication in an in vitro system that contains all of the necessary enzymes and nucleoside triphosphates that have been labeled with 32P, which of the following best describes the distribution of radioactivity in the four resulting DNA molecules? A. Exactly one of the molecules contains no radioactivity. B. Exactly one of the molecules contains radioactivity in only one strand. C. Two of the molecules contain radioactivity in both strands. D. Three of the molecules contain radioactivity in both strands. E. All four molecules contain radioactivity in only one strand. 107. A 48-year-old man has had a lengthy history of skin cancer. In the past 6 years he has had over 30 neoplasms removed from sun-exposed areas and has been diagnosed with xeroderma pigmentosum. Which of the following best describes the enzymatic defect in patients with xeroderma pigmentosum? A. DNA polymerase 108

B. DNA polymerase C. DNA ligase D. Excision repair enzymes E. RNA polymerase II 108. Given the mRNA nucleotide sequence, choose the best protein sequence that will likely result. (Use the amino acid table in Questions [13.2] and [13.3] in Case 13, keeping in mind that [T] and [U] are analogous). mRNA 5 AUCGGAUGUCUCGGGUUCUGUAAAGGUAAUC 3 A. Met-Ser-Arg-Val-Leu B. Ser-Arg-Val-Leu C. Met-Leu-Ser-Val D. Ser-Arg-Val-Phe-Phe E. Pro-Ser-Val-Gly 109. One of the steps in the PCR amplification of DNA fragments is the denaturation step in which the temperature is raised to break the hydrogen bonds that make up the base pairing. Which of the following DNA fragments would most likely require the greatest increase in temperature to cause complete denaturation? A. 5-C-A-A-T-G-T-A-A-T-T-G-C-A-T-3 3-G-T-T- A-C-A-T-T-A-A-C-G-T-A-5 B. 5-A-T-A-T-A-T-A-T-A-T-A-T-A-T-3 3-T- A-T- A-T-A-T-A-T-A-T-A-T-A-5 C. 5-A-A-C-C-G-G-A-C-C-G-C-G-A-T-3 3-T- T-G-G-C-C-T-G-G-C-G-C-T-A-5 D. 5 -A-G-A-G-A-G-A-G-A-G-A-G-A-G-3 3-T-C-T-C-T-C-T-C-T-C-T-C-T-C-5 E. 5-G-A-C-T-G-T-A-A-T-A-C-G-A-T-3 3-C-T-G-A-C-A-T-T-A-T-G-C-T-A-5 110. Restriction enzymes are used to cleave genomic DNA into smaller fragments. Which of the following single-strand DNA sequences has the best potential to be a site of action for a restriction endonuclease? A. TAGCTT B. CTGCAG C. AACCAA D. GTGTGT E. AAACCC For each of the following steps in prokaryotic protein synthesis (Questions 111 to 113), indicate the most appropriate antibiotic (AJ) to inhibit the process. A. Aminoglycosides B. Chloramphenicol C. Erythromycin D. Ciprofloxacin, E. Cyclohexamide F. Rifampicin G. Puromycin H. Streptomycin I. Tetracycline 109

111. Transfer of the peptide from the peptidyl tRNA to the aminoacyl-tRNA and formation of a peptide bond. 112. Binding of aminoacyl-tRNA in the A-site of the ribosomal complex. 113. Translocation of the peptidyl tRNA from the A-site to the P-site. . 114. The 6-year-old son of a migrant worker is brought to a clinic with chills, headache, nausea, vomiting, and sore throat. The examining physician notes a persistent grayish colored membrane near the tonsils. History reveals that the patient has not been immunized against diphtheria. Diphtheria toxin is potentially lethal in this unimmunized patient because it causes which of the following? A. Inactivates an elongation factor required for translocation in protein synthesis B. Binds to the ribosome and prevents peptide bond formation C. Prevents binding of mRNA to the 60S ribosomal subunit D. Inactivates an initiation factor E. Inhibits the synthesis of aminoacyl-charged tRNA 115. Replication of a particular DNA sequence is noted to be under inhibitory control usually. However, when substance A is added, it binds to a repressor, rendering the repressor inactive and allowing transcription to occur. Which of the following terms describes agent A? A. Histone B. Operon C. Polymerase D. Transcriber E. Inducer 116. A 38-year-old woman, presented with UTI , the woman was treated with ciprofloxacin,an effective antibiotic. Ciprofloxacins mechanism of action is best described as an inhibition of which of the following? A. Bacterial dihydrofolate reductase B. Bacterial peptidyl transferase activity C. Bacterial RNA polymerase D. DNA gyrase E. DNA polymerase III 117. Acetylation and deacetylation of lysine residues on histone proteins provide one mechanism by which transcription can be activated or repressed. Which one of the histone proteins is least likely to participate in this process? A. H1 B. H2A C. H2B D. H3 E. H4

110

118. CBP a protein has a histone acetyltransferase activity, which does which of the following ? A. Inhibits RNA polymerase II B. Helps expose the promoters of genes C. Inhibits the splicing of heterogeneous nuclear RNA (hnRNA) to messenger RNA (mRNA) D. Prevents the addition of a poly-A tail to mRNA E. Activates the formation of nucleosomes

1. Hormones that bind membrane bound receptors include: a) Epinephrine b) T3 c) Cortisol d) Calcitrol e) Aldosterone 2. Characteristic features of receptors for peptide hormones include: a) They are all protein in nature b) They have specificity for the ligand c) The binding of the ligand is saturable and reversible d) Intracellular signal is initiated as a result of hormone-receptor interaction at the cell membrane e) All of the above is correct 3. Leptin: a) Is a peptide hormone produced by adipocytes b) Binds receptors in the hypothalamus c) Supresses appetite d) Stimulates the sympathetic nervous system e) All of the above is correct 4. The following is correct: a) Cholera toxin acts through cGMP production b) Nitroglycerides activate production of cAMP c) Phorbol esters inhibit protein kinase C d) Cortisol binds with intracellular receptors e) All of the above is correct 5. Epinephrine: a) Inhibits glycogenolysis and gluconeogenesis b) Enhances glycogen phosphorylase in the liver c) Binds an intracellular receptor d) Activates PFK-1 in the liver e) Activates cAMP phosphodiesterase 6. All the following hormones promote hyperglycemia except: a) Epinephrine 111

b) Norepinephrine c) Insulin d) Glucagon e) Glucocorticoids 7. The level of cAMP is increased in adipocytes by: a) Epinephrine b) Insulin c) Growth hormone d) ANF e) An increase in the activity of phosphodiesterase

1. Oncogene: a) Are genes responsible of delaying cancer b) Are not detected in viruses c) Products may affect signal transduction in a cell d) Are not involved in causation of any cancer e) Are the same as protooncogenes 2. Characteristics of cancer cells include: a) Loss of contact inhibition b) Altered membrane permeability c) Diminished requirement for growth factors d) Altered cellular enzymes profile e) All of the above is correct 3. Biochemical changes that occur in transformed (cancer) cells include all of the following except: a) Increased pyrimidine catabolism b) Increased rate of glycolysis and lactate formation c) Increased activity of ribonucleotides reductase d) Increased rate of nucleic acid synthesis e) Inappropriate synthesis and secretion of proteases 4. Which of the following is a possible cause of cancer? a) Introduction of a novel gene into the cell genome by an oncogenic virus b) Damage of the cellular DNA by exposure to a radiant energy c) Alteration of DNA base sequence as a result of exposure to chemical mutagens d) Inheritance of defective tumor suppressor gene e) All of the above is correct 5. The following is correct about the regulation of cell division: a) It is triggered by phosphorylation of various cellular proteins b) It is mainly regulated by a complex protein called maturation promotion factor (MPF) c) The regulatory protein, cyclin is degraded at the end of the mitotic phase d) DNA is synthesized during the S phase of the cell cycle e) All of the above is correct

112

6. The following is incorrect about Ames test: a) It is used for evaluating the potential carcinogenicity of a chemical substance b) It is useful in diagnosis of cancer in human tissues c) It employs a mutated strain of Salmonella typhimurium d) It uses the ability of histidine synthesis as an indicator for mutagenicity e) It is used for screening the carcinogenicity of a chemical compound before introducing for human use 13. Urobilinogen is formed in: a) The gall bladder b) The reticuloendothelial system c) Erythrocytes d) The liver parenchymal cells e) The gut 24. Lead poisoning characteristically leads to inhibition of the following: a) Uroporphyrinogen decarboxylase b) ALA dehydratase c) ALA synthase and ferrohectase d) Porphobilinogen deaminase e) Bilirubin reductase and eoproporphyrin 25. In acute intermittent porphyria the appearance of high levels of delta-aminolevulinic acid and porphobilinogen in the urine is due to deficiency of the following enzyme: a) Delta aminolevulinate synthase b) Delta aminolevulinate dehydratase c) Uroporphyrinogen I synthase d) Ferrochelastase e) Microsomoal heme oxygenase 26. Increased excretion of urobilinogen is most likely caused by: a) Erythropoetic porphyria b) Liver disease such as viral hepatitis c) Hemolysis d) Iron deficiency e) Common bile duct obstruction 27. An increase in plasma conjugated bilirubin concentration is most often associated with: a) Increased heme synthesis b) Erythropoetic porphyria c) Viral hepatitis d) High level of bilverdin e) Common bile duct obstruction 28. The formation of bilirubin from heme: a) Requires oxygenase b) Requires bilverdin reductase c) Occurs in the reticuloendothelial system d) Releases carbon monoxide and iron e) All of the above

113

29. The commited step in heme biosynthesis produces: a) ALA b) Porphobilinogen c) Protoporphyrinogen d) Uroporphyrinogen e) Hydroxymethylbilane

30. The immediate precursor of heme in its biosynthesis is: a) Protoporphyrin III b) Coproporphyrinogen III c) Protoporphyrinogen d) Prophobilinogen e) Urobilin 31. Urobilinogen in the intestine is: a) Synthesized from conjugated bilirubin b) Converted to urobilin in stools c) Reabsorbed in the terminal ileum and large intestine d) Colourless e) All of the above 40. In hemoglobin S the mutation in the beta chain results from: a) Insertion of a nucleotide b) Replacement of alanine by serine in position 6 c) Deletion of a nucleotide d) Replacement of glutamate by valine in position 6 e) A and C are correct 43. Urobilinogen is detected in the urine of a patient with: a) Obstructive jaundice b) Hemolytic jaundice c) Hepatocellular jaundice d) Acute pancreatitis e) None of the above is correct

45. The immediate precursor of heme in its biosynthesis is: a) Protoporphyrin IX b) Coproporphhyrinogen III c) Protoporphyrinogen IX d) Porphobilinogen e) Urobilin 46. The cells which are very active in heme biosynthesis include: a) Erythroid precursors b) The liver cells c) Adipose tissue cells d) Cardiac muscles e) Intestinal mucosal cells

] 114

29. The following statements are true: a) Transferrin transports calcium in the circulation b) Hemochromatosis is characterized by excessive storage of ions in tissues c) Haptoglobin binds extra corpuscular hemoglobin d) All of the above is correct e) B and C are correct

1. The following are considered as phase 1 reactions in xenobiotics metabolism: a) Hydroxylation and dealogenation b) Dehalogenation and ulfation c) Sulfation and Hydroxylation d) Deamination and aceylation e) Acetylation and dehalogenation 2. The following are considered as phase 2 reactions in xenobiotics metabolism: a) Conjugation with bilirubin b) Conjugation with glutathione c) Methylation with S-adenosyl methionine d) Reduction e) B, C and D are correct

3. The following are known actions of cytochrome P450: a) Hydroxylation of foreign hydrophobic compounds in the liver b) Synthesis of steroid hormones in the adrenal cortex c) Conversion of procarcinogens into active carcinogens d) Inactivation of some drugs e) All of the above is correct 4. Characteristics of cytochrome P450 enzymes include: a) They are polymorphic hemoproteins b) They are mainly found in liver and intestine c) They have overlapping substrate specifities d) They are rich in phosphatidylcholine (lecithin) e) All of the above is correct 5. All of the following is correct about xenobiotics metabolism, except: a) It requires NADPH as a proton donor in hydroxylation reactions b) It renders non-polar chemicals more water soluble c) It may occur in the cytochromes of the electron transport chain d) It may affect drug action in the human body e) It is affected by genetic constitution of an individual 6. The following is correct about phase 2 reactions in xenobiotics metabolism? a) They intend to promote excretion of the xenobiotics b) They involve conjugation with glucuronic acid c) They involve methylation of xenobiotics with S-adenosylmethionine d) The acetyl transferase is the main enzyme in phase 2 reactions e) D is the only wrong statement 7. The following is incorrect about cytochrome P450 enzymes 115

a) There are at least 30 different isoforms of these enzymes b) They may convert inert procarcinogens into active carcinogens c) They are essential for the activation of various drugs d) Their activity is affected by age and sex e) They are characterized by genetic differences

1. Severe combined immunodeficiency involves: a) An absence of hypoxanthine phosphoribosyl transferase b) A deficiency of adenosine deaminase c) A deficiency of OMP decarboxylase d) Overproduction of urate e) A deficiency of adenylate deaminase 2. In the antibody: a) Disulphide bridges are formed between the two heavy chains b) The two light chains are different c) The two binding sites on each molecule are different d) The Fc fragment interacts with the antigen e) The heavy chain is always the gamma type 3. Secondary antibody responses are better because: a) They have broader specifities b) They make mainly IgM antibody c) Complement fixing antibodies are made d) They do not require T Cells help e) They are stronger and faster 4. Which of the following statements does not apply to IgG? a) Appears in primary immune responses b) Neutralizes bacterial toxins c) Can fix complements d) Cannot cross the human placenta e) Osponizes bacteria 5. HAT medium is used to: a) Immortalize B lymphocytes b) Culture B lymphocytes c) Select for cancerous and non cancerous cell hybrids in the Hybridoma technology d) Kill B cell hybridomas e) Convert B lymphocytes to myeloma cells

6. Clonal selection occurs when a B lymphocyte encounters: a) Cytokine b) Antigen c) T lymphocyte d) Complement e) Chemotactic factor 7. The structure of the antibody: 116

a) Disulphide bridges are formed between the two heavy chains b) The two light chains are identical c) The two binding sites on each molecule are identical d) The Fc fragment mediates effector function of the antibody e) All of the above is correct 8. Characteristics of the adaptive immune response include: a) High specifity b) Differentiation between self and non-self c) Versatility d) Brisk secondary response e) All of the above is correct

9. Concerning Immunoglobulins: a) IgM is found mainly in the blood b) IgA is found only in the blood c) IgE is found in association with mast cells in the skin d) Only IgG can cross the placental barrier e) B is the only wrong answer 10. T Helper 1 produces: a) IL-2 b) Antibodies c) IL-2 receptor d) Interferon gamma e) A, C and D are correct 11. Antibodies against an individual own body components are called: a) Autoantibodies b) Isotypes c) Autoantigens d) Anti-idiotypic e) Idiotypes 12. The complement components: a) Enhance phagocytosis b) Are produced by the spleen c) Induce cytotokine production by T cell d) Activate cytotoxic T cell e) Include interferon gamma 13. Cytokines: a) Include interleukins and interferons b) Act by autocrine and paracrine mechanisms c) Promote B cell growth and differentiation d) Interact with membrane-bound receptors e) All of the above is correct

117

10. PRPP is: a) An intermediate in de novo purine biosynthesis b) Involved in biosynthesis of NAD+ and NADP+ c) An intermediate in pyrimidine biosynthesis d) Intermediate in the salvage pathway e) All of the above is correct 13. 5-phosphoribosyl-1-pyrophosphate (PRPP) is an intermediate in: a) The de novo synthesis of purine nucleotides b) The de novo synthesis of pyrimidine nucleotides c) The salvage pathway for the synthesis of purine nucleotides d) Both A and C e) All of the above are correct 14. The end product of purine catabolism in man is: a) Urea b) Xanthine c) Uric acid d) Produced by the enzyme guanase e) Inosine monophosphate 17. Hyperuricemia: a) Gouty artheritis is a common feature b) There is a high level of urate in the blood c) Allopurinol is used for treatment d) The defect in purine nucleotide metabolism e) All of the above is correct 18. Inhibition of purine biosynthesis de novo may potentially be due to all of the following except: a) Decreased phosphorylation of IMP b) Inhibition of PRPP aminotransferase c) Inhibition of PRPP synthetase d) Depletion of PRPP e) C and D are correct 22. Gout is: a) Characterized by high level of xanthine in the blood b) Characterized by high level of urate in the blood c) Treatable with chloramphenicol d) A defect in pyrimidine nucleotide metabolism e) Defect of praline catabolism 23. In biosynthesis of purines: a) The amino acids Gly, Glu and Asp are involved b) ATP is not required c) Glutamine provides the first nitrogen atom in the purine ring d) Puromycin inhibits purine synthesis e) All of the above is correct

24. In the Salvage pathway: a) The nucleotides are converted to bases 118

b) More energy is required than in the De Novo pathway c) Purine bases are involved but not the pyrimidine bases d) Phosphoribosylation of nucleosides occur e) HGPRTase enzyme is involved 25. All of the following statements are correct except: a) Pyrimidines are not essential in the human diet b) CPS1 is involved in pyrimidine biosynthesis c) Type 1 Orotic aciduria leads to Megaloblastic anemia d) Allopurinol may precipitate Orotic aciduria e) Aspartate is important for pyrimidine nucleotides biosynthesis 26. The formation of dATP for DNA synthesis occurs primarily by: a) De Novo synthesis beginning with dPRPP b) Salvaging adenine using Adenine phosphoribosyl transferase c) Conversion of ATP to dATP using thioredoxin d) Conversion of ADP to dADP using ribonucleotide reductase e) Conversion of dIMP to dAMP 27. Which of the following would not be expected to contribute to hyperuricemia: a) Unusually high level of PRPP b) Inhibition of xanthine oxidase c) Usually high turnover of nucleic acids d) Deficiency of HGPRTase e) Leukemia 39. The main metabolic source of one-carbon units that are transferred by tetrahydrofolate is: a) Alpha carbon of glycine b) Beta carbon of serine c) CO2 d) Methionine e) Beta carbon of alanine 59. Hyperuricemia is a biochemical finding in: a) Von Gierke's disease b) Xanthine oxidase deficiency c) Leukemia d) Both A and C e) Both A and B 60. The major control of de novo purine nucleotides biosynthesis is: a) Feedback inhibition of PRPP synthase b) Feedback inhibition of aspartate transcarbomylase c) Availability of ribose-5-phosphate d) Feedback inhibition of glutamyl-PRPP amidotransferase e) A, C and D are correct 62. The formation of dATP for DNA synthesis occurs primarily by: a) De Novo synthesis beginning with dPRPP b) Salvaging adenine using Adenine phosphoribosyl transferase c) Converting ATP to dATP using thioredoxin d) Converting of ADP to dADP using ribonucleotide reductase e) Converting of dIMP to dAMP using N5, N10-methylene THF 119

1. The following are purine nucleotides: a) ATP and CMP b) CTP and GDP c) NAD and TDP d) GMP and ADP e) UDP and GTP 9. The following is a purine nucleotide: a) Cytidylate b) Guanosine c) Cytidine monophosphate d) Uridine e) Adenylate 20. Synthetic nucleotide analogs: a) Include cGMP b) Include theophylline c) Can be used as anti-tumor agents d) 5-fluoro uracil is used for treatment of gout e) Have only antiviral effect 21. Nucleotides: a) Include NAD and FAD b) Are involved in formation of coenzymes c) Are involved in base plus sugar plus phosphate d) Important in CHO biosynthesis e) All of the above is correct 27. All of the following are involved in purine nucleotide synthesis: a) Glycine, Serine, Glutamine b) Aspartate, Formyl Tetrahydrofolate, Glutamine c) Asparagine, Glycine, Glutamine d) Carbon Dioxide, Pyridoxine, PRPP e) Ribose 5 Phosphate, Glutamate, Formimino Tetrahydrofolate 28. The commited step in purine nucleotide biosynthesis is catalysed by: a) PRPP Synthase b) PRPP Glutamylamidotransferase c) Glucose 6 Phosphate dehydrogenase d) IMP Dehydrogenase e) All of the above is correct 29. Denovo purine biosynthesis is inhibited by: a) Antifolate drugs b) Glutamine analogs c) Azaserine and diazanorleucine d) 6-mercaptopurine and mycophenolic acid e) All of the above 30. The salvage pathway of purin nucleotide synthesis involves: a) Conversion of adenine to AMP by adenosine kinase b) Conversion of adenosine to AMP by phosphoribosyl transferase c) Formation of GMP from guanine by HGPRTase 120

d) Formation of dATP by ribonucleotide reductase e) C is the only correct answer 31. The following is correct about inherited disorders of purine metabolism: a) Adenosine deaminase deficiency results in severe immunodeficiency b) Gout results from decreased Km of PRPP synthase for Ribose-5-Phosphate c) Complete deficiency of HGPRTase results in Lesch Nyhan Syndrome d) Xanthinuria results from complete deficiency of xanthine oxidase e) All of the above is correct 32. Allopurinol: a) Lowers uric acid in the blood by increasing renal excretion b) Is xanthine oxidase inhibitor c) Increases formation of urate by increasing plasma pH d) Is the natural substrate for orotate phosphoribosyl transferase e) Inhibits purine and pyrimidine degradation 33. Methotrexate: a) Inhibits reduction of dihydrofolate to tetrahydrofolate b) Inhibits TMP synthesis c) Is an anticancer drug d) A,B and C are correct e) C is the only correct answer 34. The end products of pyrimidine catabolism: a) Include ammonia, beta alanine and CO2 b) Increase in leukemic patients c) Increases as a result of mitochondrial damage to the liver d) Are highly water soluble e) All of the above is correct 35. Orotic Aciduria: a) Type I reflects a deficiency in both Orotate Phosphoribosyl Transferase and Oritidylate Decarboxylase b) Type II reflects deficiency of oritidylate decarboxylase only c) Is transiently detected in allopurinol treated patients d) Is detected in ornithine transcarbamoylase deficiency e) All of the above is correct

121