Hepatita B - Interpretarea analizelor

Tabelul de mai jos arata cum sint interpretate rezultatele analizelor de laborator ale diferitelor componente ale virusului hepatic B. Test HBsAg HBsAb HBcAb Total (IgG + IgM) HBcAb (IgM) HBeAg HBeAb HBsAg HBsAb HBcAb Total (IgG + IgM) HBcAb (IgM) HBeAg HBeAb HBsAg HBsAb HBcAb Total (IgG + IgM) HBcAb (IgM) HBeAg HBeAb HBsAg HBsAb HBcAb Total (IgG + IgM) HBcAb (IgM) Rezultat Negativ Negativ Negativ Negativ Negativ Negativ Negativ Pozitiv Negativ Negativ Negativ Negativ Negativ Pozitiv Pozitiv Negativ Negativ Negativ Pozitiv Pozitiv Pozitiv sau Negativ Pozitiv sau Negativ Infectat acut - Pot exista simptome caracteristice - Persoana este contagioasa - In perioada de inceput a infectiei acute rezultatul anticorpi HBc Se recomanda contactarea unui doctor care sa urmareasca evolutia bolii Imunizat / Neinfectat - Imunizare ca urmare a unei infectii acute anterioare Anticorpii au fost dobinditi ca urmare a unei infectii acute care sa vindecat. Se recomanda verificarea periodica a cantitatii de anticorpi HBs pentru asigurarea unei imunitati continue Imunizat / Neinfectat Se recomanda verificarea periodica a cantitatii de anticorpi HBs pentru - Imunizare ca urmare a vaccinarii asigurarea unei imunitati continue Interpretare Neimunizat / Neinfectat - Nu exista si nu a existat o infectie anterioara - E posibil sa fie perioada de incubatie a virusului - Exista riscul de infectie in viitor Observatii Se recomanda vaccinarea.

HBeAg HBeAb HBsAg HBsAb HBcAb Total (IgG + IgM) HBcAb (IgM) HBeAg HBeAb HBsAg HBsAb HBcAb Total (IgG + IgM) HBcAb (IgM) HBeAg HBeAb HBsAg HBsAb HBcAb Total (IgG + IgM) HBcAb (IgM) HBeAg

Pozitiv Negativ Pozitiv Negativ Pozitiv Negativ Pozitiv Negativ Pozitiv Negativ Pozitiv Negativ Negativ * Pozitiv Negativ Negativ Pozitiv Negativ Negativ Neclar Posibile explicatii: - O infectie acuta in trecut care a fost eliminata de organism, dar cantitatea de anticorpi este inca prea mica pentru a fi detectata - Analiza HBcAb fals pozitiva - Infectie cronica cu cantitatea de antigen AgHBs prea mica pentru a fi detectata - Recuperare dupa o infectie acuta Se recomanda contactarea unui medic in vederea efectuarii unor investigatii suplimentare (viremie, transaminaze) Infectat cronic inactiv - Infectie cronica inactiva (purtator de virus) - Persoana poate fi contagioasa, dar riscul de contaminare este foarte scazut Se recomanda contactarea unui medic pentru analize periodice poate fi negativ Infectat cronic activ Se recomanda contactarea unui medic in vederea initierii unui - Infectie cronica activa care ataca tratament fixatul - Persoana este contagioasa

HBeAb

Negativ

*Nota: Exista unele tulpini ale virusului care nu produc HBeAg. In aceste cazuri, HBeAg negativ nu inseamna neaparat ca antigenul nu este prezent sau ca persoana nu este infectioasa.

Regim hepatita cronica

Bolnavii de hepatita cronica si de alte afectiuni ale ficatului necesita diete speciale, create pentru fiecare pacient in parte pentru a preveni complicatiile hepatitei si malnutritia. Odata ce sunt diagnosticati cu hepatita, pentru majoritatea pacientilor supravegherea atenta a dietei devine o parte esentiala a tratamentului. Intelegerea impactului dietei asupra ficatului este

necesara atat din partea pacientului, cat si a familiei. Riscul de aparitie a complicatiilor hepatitepoate fi redus cu ajutorul unei diete adecvate. La pacientii cu hepatita cronica, dieta si nutritia joaca un rol esential in prevenirea complicatiilor ce pot afecta in mod suplimentar ficatul. Prin urmare, in urma stabilirii diagnosticului de hepatita, consultarea unui nutritionist este un element important al regimului de viata dedicat imbunatatirii starii de sanatate. Un aspect fundamental al regimului pentru hepatita este evitarea bauturilor alcoolice de orice tip. In conditiile in care aceasta regula nu este respectata, aparitia cirozei hepatice este frecventa si poate duce la decesul persoanei. Prin urmare, consumul de alcool nu este recomandat, iar evitarea sa completa este cea mai buna optiune pentru bolnavii de hepatita.In plus, bolnavii trebuie sa respecte unele recomandari nutritionale pentru a controla luarea excesiva in greutate sau slabirea organismului. Regimul pentru hepatita este cel putin normocaloric, bogat in proteine, dar sarac in grasimi, pentru a cruta ficatul.In formele severe ale hepatitei se recomanda un regim de spitalizare periodica, iar in celelalte forme 12 -14 ore de repaus la pat zilnic, permitand in perioadele de remisiune in formele usoare o activitate profesionala cu program redus si fara expunere la surmenaj si eforturi fizice mari.

Tratamentul igieno-dietetic consta in:

-evitarea eforturilor fizice excessive -alimentatie completa si echilibrata, suficienta caloric, administrata in prize mici, la ore regulate si individualizata in functie de preferinte sau restrictii dietetice determinate de alte afectiuni - excluderea bauturilor alcoolice Dieta bolnavilor de hepatita trebuie sa fie bogata in proteine, pentru a sustine repararea celulelor hepatice. In prezent, nutritionistii recomanda un aport zilnic de 120 grame de proteine. Aporturile adecvate de proteine sunt importante pentru a construi si mentine masa musculara si pentru a contribui la vindecare. Aporturile trebuie adaptate la greutatea corporala. Aproximativ 0,8 grame de proteine/kgc sunt recomandate pentru pacientii cu hepatita, cu exceptia cazului in care o complicatie a cirozei (encefalopatie) apare. Cauza acestei atingeri a encefalului nu este cunoscuta cu exactitate, dar se pare ca o restrictie a proteinelor animale din dieta si adoptarea unei diete vegetariene joaca un rol in redobandirea capacitatilor mentale. Ficatul joaca un rol important in metabolismul fierului, deoarece este principalul organ care stocheaza acest metal. O dieta normala contine 10 -20 mg de fier. Doar 10% din aceasta cantitate este eliminata din organism. Pacientii cu hepatita cronica au uneori dificultati in excretia fierului, ceea ce poate duce la acumularea excesiva in ficat, sange si alte organe. Dar, excesul de fier poate fi daunator ficatului. Din acest motiv, pacientii cu un nivel ridicat de fier seric, sau care sufera de ciroza ar trebui sa evite luarea suplimentelor.

Alimente permise in hepatita cronica

LACTATE: -lapte(de preferinta degresat), iaurt, branza de vaci, cas, telemea (desarata) CEREALE SI FAINOASE: -macaroane, taitei, orez, gris -fierte bine -biscuiti, cornuri, chifle -paine alba (de preferinta prajita), mamaliguta

FRUCTE: mere, struguri, capsuni, pepene, lamai, portocale, grepfruit LEGUME: -dovlecei, laptuci, conopida, rosii, sfecla fiarta, morcovi, cartofi (fierti sau copti) ardei gras, spanac, mazare verde sub forma de salate, supe, piureuri, soteuri (fara prajeli) CARNE SI PREPARATE DIN CARNE: -carne slaba: de pasare (dupa indepartarea pielitei), de vaca - fiarta sau preparata pe gratar, fara condimente -peste alb: pastrav, calcan, mreana, salau, stiuca fiert sau fript pe gratar OUA: -maxim 2 oua pe saptamana fierte Ouale sunt interzise cu desavarsire numai la bolnavii de colecistita sau litiaza biliara. GRASIMI max. 50 g/ zi -unt proaspat, smantana (alegeti sortimentele cu putine grasimi) -grasimi vegetale: ulei de masline, floarea-soarelui, porumb, dovleac; margarina sosuri fara grasimi, fara prajeli si fara condimente DULCIURI SI PRODUSE ZAHAROASE -miere de albine, marmelada, magiun, jeleu, bomboane, serbet, bezele -prajituri preparate din aluat uscat, cu branza de vaci, cu fructe sau marmelada tarte cu fructe BAUTURI -sucuri de fructe (in special de citrice si struguri), compoturi -ceai de menta, tei, cozi de cirese -cafea naturala CONDIMENTE -patrunjel, marar, leustean, dafin, cimbru, chimen, telina suc de lamaie, sare de lamaie diluata, otet slab (de preferinta de fructe)

Alimente de evitat in hepatita cronica

-alimente vechi sau conservate -afumaturi si mezeluri afumate -prajeli -branzeturi fermentate -vanat -carnea grasa (porc, rata, gasca), peste gras, icre -sosuri picante, alimente condimentate -fructe de mare -cafea, cafeina

LACTATE -branzeturi fermentate sau grase FRUCTE -nuci, alune, avocado, migdale, smochine, curmale, unt de arahide LEGUME -castraveti, gulii, varza, vinetele, ceapa, usturoi, cartofii prajiti muraturi CARNE SI PREPARATE DIN CARNE carne grasa: de porc, oaie, miel, gasca, rata, cocos, vanat mezelurile, carnatii, salamurile, pastrama, conservele carnea conservata sau afumata carnea tocata si condimentata (ardei umpluti, sarmale) prajelile maruntaie: creier, rinichi, drobul de miel peste gras: somn, crap, biban, scrumbie; afumat, conservat, prajit sau marinat icre OUA ouale prajite in untura sau ulei ouale de rata GRASIMI max. 50 g/ zi untura de porc, slanina, grasimea de vaca sau de gasca grasimi prajite maioneza sosurile preparate cu ceapa prajita, sau cu condimente DULCIURI SI PRODUSE ZAHAROASE prajiturile cu unt sau multe galbenusuri de ou: placinte, cozonac, clatite, gogosi prajiturile cu cacaco, ciocolata inghetata BAUTURI toate tipurile de bauturi alcoolice (cel putin 1 an) bauturile prea reci CONDIMENTE piper, ardei iute, hrean, mustar

Alimentatie/Diete Hepatita

Dieta in afectiunile hepatice este un subiect destul de controversat. Ceea ce unii nutritionisti recomanda, altii contesta, iar acest lucru nu face decat sa creeze si mai multe confuzii in randul persoanelor ce sufera de bolile hepatice. De aceea, ce a mai sigura abordare a acestui subiect este prezentarea unor linii generale dupa care sa se ghideze cei care traiesc cu virusii hepatici. O dieta corespunzatoare este cu atat mai importanta cu cat majoritatea alimentelor pe care le ingeram sunt procesate de catre ficat. Prin urmare, ideal ar fi sa nu-l suprasolicitam dandu-i si mai mult de munca cu alimente necorespunzatoare. Pentru asta, e nevoie sa intelegem cateva elemente de baza in ceea ce priveste nutritia. Este vital sa ne alocam cateva secunde sa citim etichetele produselor, intrucat exista cateva restrictii ce se impun bolnavilor de hepatita.Alimentatia zilnica se va supune urmatorului profil nutritional (procentele sunt raportate la numarul total de calorii): 60-70% carbohidrati (in principal carbohidrati complecsi, precum cei din paste si cereale integrale) 20-30% proteine (provenite de vegetale si carne slaba, fara grasime) 10-20% grasimi polinesaturate (cele provenite din peste, din uleiul de floarea soarelui, de porumb, de sofranel sau de seminte de bumbac etc.) Pe langa aceasta distributie a aportului caloric, trebuie sa includem zilnic si: 8-12 cani cu apa 1000-1500 mg sodiu Sunt recomandate: Evitarea excesului de vitamine si minerale, in special a fierului si a vitaminelor A si B3. Evitarea alcoolului Evitarea mancarurilor procesate Evitarea excesului de cofeina (nu sunt permise mai mult de 3 cesti de cafea sau produse ce contin cofeina pe zi) Suplimente de vitamina D si calciu Suplimente de vitamina C Proteinele Proteinele sunt elementare in mentinerea sanatatii organismului: ajuta la formarea unor componente anatomice precum: mushii, unghiile, pielea, parul etc., fac parte din structura anticorpilor ajutand la protejarea corpului atunci cand e cazul si uneori pot functiona ca sursa de energie, desi nu la fel de eficienta precum carbohidratii si grasimile. Asta explica de ce foarte multi oameni se ghideaza prost dupa principiul cu cat mai multe proteine consum, cu atat mai bine. Un ficat afectat nu poate procesa la fel de multe proteine precum unul sanatos, de aceea este bine sa nu-l suprasolicitam cu o cantitate de proteine zilnica prea mare. Cand un ficat bolnav este fortat sa metabolizeze prea multe proteine, exista riscul de a favoriza aparitia encefalopatiei. Desi multi asociaza proteinele cu produsele animale, ele se gasesc si in vegetale, dupa cum se vede si in tabelul de calorii si proteine. Pentru persoanele cu o afectiune hepatica stabila, se recomanda o doza zilnica de 0,8 grame de proteine per kilogram corp. Astfel, o persoana de 60 de kilograme va avea nevoie de 48 de grame de proteine zilnic. Cand alegem proteinele animale trebuie sa alegem carne slaba de peste, pui sau curcan. Carnea rosie, chiar si atunci cand este slaba, are un continut ridicat de grasimi.

Carbohidratii Din punct de vedere chimic, carbohidratii sunt compusi formati din carbon, hidrogen si oxigen. Cei mai simpli carbohidrati sunt zaharurile si includ: mierea, gemurile, jeleurile, bomboane etc. Atunci cand cateva zaharuri simple sunt legate intre ele formeaza carbohidratii complecsi. Acestia se regasesc in alimentele de calitate precum: grane, legume, seminte, paste, orez etc. Spre deosebire de carbohidratii simpli care au valoare nutritionala zero, furnizand organismului doar energie si calorii, sursele de carbohidrati complecsi furnizeaza organismului si vitamine, minerale si alti compusi nutritivi necesari unei bune sanatati. De asemenea, glucoza provenita din carbohidratii complecsi este eliberata in sange treptat, mentinand un nivel constant al glicemiei. Persoanele cu afectiuni hepatice ar trebui sa consume zilnic aproximativ 400 grame de carbohidrati, din care cea mai mare parte fiind carbohidrati complecsi. Daca sunt prea putini carbohidrati consumati , asta de obicei inseamna ca sunt prea multe proteine si grasimi consumate, ceea ce pune presiune pe ficat, intrucat acesta trebuie sa le converteasca in energie, ceea ce e un proces dificil si pentru un ficat sanatos. Acesta e unul din motivele pentru care unele persoane cu hepatita cronica se simt mereu obositi: din cauza dietei necorespunzatoare. O dieta echilibrata poate combate oboseala asociata cu afectiunile hepatice. Excesul de carbohidrati poate duce la absorbtia deficitara a unor vitamine si minerale. De asemenea, ficatul converteste carbohidratii in grasimi care se pot depune chiar si pe ficat, ingreunandu-i si mai mult functiile.

Grasimile In cazul in care sunt consumate in exces, grasimile sunt nocive chiar si pentru persoanele cu un ficat sanatos. In ciuda faptului ca acest fapt este mediatizat de ani buni, suntem totusi o populatie supraponderala. Grasimile au si efecte pozitive, de asta trebuie incluse in alimentatia zilnica: Sunt o sursa de energie la indemana Sunt o parte importanta in procesul de crestere al copiilor Ajuta organismul sa absoarba si sa depoziteze vitaminele uleioase precum vitamina A, D, E si K. Fara grasimi, am manifesta deficiente ale acestora. Furnizeaza acizi grasi esentiali responsabili pentru o serie de procese elementare in interiorul organismului. Totusi, grasimile saturate sunt mai nocive decat cele nesaturate . Cum se explica asta? Majoritatea grasimilor saturate tind sa fie solide la temperatura camerei, prin urmare, au capacitatea de a infunda arterele si de a creste nivelul colesterolului din sange. Grasimile polinesaturate, care sunt lichide si la temperatura camerei, nu fac asta. De aceea se recomanda diete sarace in grasimi saturate si bogate in grasimi nesaturate. (de exemplu, grasimea de peste e mai lichida decat cea de pui, care e mai lichida decat cea de vita) Tot din alimentatie fac parte si suplimentele alimentare.

Vitamina A Vitamina A este esentiala pentru sistemul imunitar si are un rol important in mentinerea unei vederi bune, in sanatatea pielii, a oaselor si a dintilor. Ficatul este cel care decide unde anume in organism este nevoie de vitamina A, de aceea. Pentru persoanele cu afectiuni hepatice, doza zilnica recomandata de vitamina A e de 1000 micrograme pentru barbati (1 mg) si 0.800 micrograme pentru femei (0.8 mg). Alimente ce contin vitamina A: ficat, galbenusul de ou, lapte gras si alte produse lactate, margarina, uleiul de peste, morcovi, cartofi dulci, salate, spanac. O persoana cu afectiune hepatica nu ar trebui sa ia niciodata suplimente de vitamina A, intrucat isi ia cu usurinta necesarul din alimente. Vitamina C Vitamina C este utila in vindecarea taieturilor si intarirea oaselor, dar intensifica absoptia fierului. De aceea, persoanele care au nivelul fierului din sange peste normal trebuie sa evite suplimentele cu aceasta vitamina. Trebuie stiut totusi ca vitamina C ajuta productia de interferon, de aceea se considera ca in unele cazuri poate fi folosita in tratarea hepatitei B si C. Fierul Cand vorbim despre fier, trebuie facuta o distinctie: fierul din produsele de origine animala precum carnea rosie si fierul provenit din plante. Cel de origine animala e absorbit de catre organism in proportie de 15% din totalul ingerat, pe cand cel provenit din vegetale este absorbit doar in proportie de 3%. Fierul este o componenta importanta a hemoglobinei proteina responsabila cu transportul oxigenului catre celulele organismului si organe. Excesul de fier poate avea efecte foarte grave asupra persoanelor cu afectiuni hepatice. Studiile au aratat ca un usor exces de fier poate cauza o itensificare afectarii ficatului la persoanelor cu boli hepatice. Sfaturi generale: In loc de 3 mese copioase pe zi, incercati mai multe mese mai mici cantitativ, bazate pe carbohidrati complecsi. In acest mod, organismul va avea sursa de energie constanta si sanatoasa. Carnea se poate consuma fiarta, coapta la grill sau preparata intr-o tigaie teflonata. Ouale se pot servi fierte moi, ochiuri romanesti, ca omleta dietetica sau in diverse preparate. Se recomanda un ou la 2-3 zile.

Importanta exercitiilor (fizice) pentru persoanele cu afectiuni hepatice

Primavara si vara sunt chiar dupa colt, asadar pentru multi oameni, intrarea intr-o forma fizica mai buna devine o prioritate. Deoarece se apropie anotimpul cald nu ne mai putem ascunde corpurile cu pulovere groase sau sub paltoane. Toata lumea vrea sa arate cat mai bine, inclusiv persoanele cu boli ale ficatului. Insa, in cazul acestora din urma, exista anumite aspecte legate de fitness asupra carora ar trebui sa fie constienti. Acest articol va incerca sa demonstreze, de ce este bine ca exercitiile si mentinerea in forma sa faca parte din rutina zilnica a persoanelor cu boli de ficat. Exercitiile fizice regulate sunt o componenta importanta in combaterea afectiunilor hepatice. Persoanele care sunt intr-o forma buna si care fac exercitii in mod regulat, nu numai ca se simt mai bine, dar de cele mai multe ori raspund mai bine la tratamente. Care sunt beneficiile exercitiilor fizice? Beneficiile care le pot aduce exercitiile sunt numeroase. Primul, exercitiile ofera persoanelor o stare generala buna si o mai mare incredere in sine. Este stiut ca daca o persoana se simte bine, din punct de vedere psihic, sistemul imun al respectivei persoane va functiona mai bine. Al doilea, exercitiile dau persoanei un plus de energie. Oboseala este, probabil, cel mai comun si cel mai stanjenitor simptom in cazul persoanelor cu boli de ficat. Majoritatea simt adesea ca nu au destula energie pentru a face o plimbare in jurul camerei, sa nu mai vorbim de o plimbare in jurul blocului sau printr-un parc. Cu toate acestea, cel mai bun mod de a lupta impotriva acestei epuizari sunt exercitiile. Chiar daca acest lucru poate parea un cerc vicios, majoritatea persoanelor constata ca intr-adevar functioneaza. Oboseala poate aparea si fiindca inima si ficatul lucreaza mai mult pentru a asigura o cantitate adecvata de sange filtrat prin organism. Astfel, adaugarea unei rutini de exercitii fizice regulate permite ca ambele organe sa lucreze mai eficient. In timp, acest lucru va mari nivelul de energie. In timp ce majoritatea persoanelor considera ca este greu la inceput, in cele din urma isi dau seama ca beneficiile merita. Al treilea, exercitiile imbunatatesc functiile cardiovasculare. Cu cat organismul devine mai puternic, cu atat sistemul cardiovascular va fi capabil sa lucreze mai eficient. Astfel, va fi nevoie de un efort mai mic din partea inimii pentru a pompa sange catre ficat si catre celelalte organe. Este extrem de important ca pacientii care fac tratament cu interferon sa incerce sa faca exercitii, fiindca acest lucru va reduce oboseala, iritabilitatea si depresia, adesea asociate cu acest medicament. Cel de-al patrulea beneficiu care il pot aduce exercitiile fizice este reducerea grasimii corporale totale. Atunci cand grasimea totala din corp este redusa, scade implicit continutul de grasime din ficat. O alimentatie corecta combinata cu exercitiile fizice este probabil cel mai lent mod cunoscut omenirii de a pierde din greutate, dar este, de asemenea, cel mai sigur. Acest lucru este mai ales valabil pentru persoanele cu boli ale ficatului. Tipuri de exercitii Persoanele cu boli ale ficatului ar trebui sa faca atat exercitii aerobice, cat si ridicari de greutati, fiindca fiecare dintre ele joaca un rol diferit in lupta impotriva bolii. Din fericire, in momentul de fata, exista o multime de carti, casete video si programe de televiziune care ajuta la o utilizare cat

mai buna a fiecarui tip de exercitiu. Este important sa ne folosim de acest fel de materiale inainte de a ne apuca de treaba. Alegerea timpului potrivit. In cazul persoanelor cu boli de ficat cel mai bun moment pentru a face exercitii este dimineata, imediat dupa trezire. Chiar daca unora persoane le este greu doar sa se trezeasca dimineata, vor observa ca in cele din urma le va fi din ce in ce mai usor, odata ce organismul se va obisnui cu asta. In plus, aceste exercitii de dimineata dau un plus de energie organismului. Un sfat foarte important: nu incercati sa va bateti propriile recorduri. Este mai important sa mentinem o rutina simpla decat sa incercam sa ne depasim de fiecare data. Exercitiile aerobice Exercitiile aerobice ajuta inima, plamanii si intregul sistem cardiovascular printr-o livrare mai rapida, eficienta si mai insemnata de oxigen in tot corpul. Beneficiile pe care le are o persoana antrenata in exercitii aerobice includ un nivel mai ridicat de energie, ceea ce se traduce prin oboseala scazuta. Mersul pe jos vioi, plimbatul cu bicicleta, inotul sau utilizarea unei banzi de alergare - toate acestea ofera beneficii celui care le practica. Multi pacienti incep cu ceva usor, cum ar fi o plimbare in jurul blocului. O sugestie ar sa incepeti sa va plimbati in apropierea casei dumneavoastra, astfel ca in cazul in care oboseala apare brusc, va puteti intoarce repede acasa. Ridicarea greutatilor (sau exercitii cu greutati) Acest tip de exercitii tonifica atat oasele, cat si muschii. Este important din mai multe motive ca persoanele cu boli hepatice sa incorporeze in exercitiile lor si acest tip sport. In primul rand, pacientii cu afectiuni hepatice au nevoie de oase puternice, fiindca acestea sunt predispuse la osteoporoza. In al doilea rand, in stadiile avansate ale bolii hepatice organismul este obligat sa foloseasca musculatura ca sursa de energie. In al treilea rand, persoanele cu boli hepatice care au prea multa grasime sunt mai predispuse la o agravare a bolii prin dezvoltarea unui ficat gras si posibil steatohepatita care pot duce in cele din urma la ciroza. In cele din urma, deoarece muschii cantaresc mai mult decat grasimea, acest tip de exercitiu este mijlocul ideal de a obtine o greutate optima in cazul persoanelor subponderale.Este important sa nu uitam sa lucram toate grupele de muschi la fel de mult. (Stiati ca sunt in total 11 parti ale corpului care pot fi lucrate?). Alcatuirea unui program de exercitii Nimeni nu se asteapta ca o persoana sa poata alerga la un maraton din prima incercare. Cand ne stabilim standarde prea inalte, cel mai probabil vom suferi un esec. Dar daca o persoana incepe cu pasi mici si ii mareste pe parcurs cel mai probabil va ajunge ca exercitiile sa devina o rutina de zi cu zi. Un inceput corect ar putea include 10-20 min de aerobic, urmat de un timp scurt de ridicat greutati, de trei ori pe saptamana. Insa, daca cineva nu poate sa faca efort fizic mai mult de cateva minute nu e cazul sa disperati. Putin e mult mai bine decat deloc. Consumul adecvat de apa Corpul are nevoie de apa pentru a putea functiona normal. Exercitiile fizice duc la o deshidratare accentuata. Din aceasta cauza este foarte important ca persoanele cu boli hepatice sa consume cat mai multa apa (1,3l 1,7l apa). Si este si mai important ca pacientii cu Hepatita B si C care fac tratament cu interfon sa aiba grija sa fie bine hidratati. Acestia ar trebui sa bea cel putin 2,6l de apa pe zi. Pacientii cu boli hepatice constata uneori ca atunci cand beau cantitati mai abundente de

apa au o stare de bine mai accentuata. Iar in cazul celor care fac tratament cu interferon, consumul suficient de apa ajuta la micsorarea unora dintre efectele secundare ale medicamentului. O mica avertizare in legatura cu Dietele Crash si cu pastilele de slabit Modul recomandat prin care ar trebui sa slabim e prin adoptarea unei diete sanatoase si echilibrate si prin exercitii fizice regulate. In schimb, pastilele de slabit sau dietele Crash sunt mai mult decat nerecomandate. Aceste solutii ar putea produce efecte adverse serioase sau chiar consecinte fatale la un individ cu boli hepatice. Tineti minte ca absolut tot ceea ce mancati in cele din urma va fi procesat de ficat. Pastilele de slabit ar putea ingreuna un ficat si asa impovarat, astfel marind posibilitatea ca starea persoanei sa se inrautateasca, in loc sa se amelioreze.

HEPATITIS B VIRUS OCCULT INFECTION IN SUBJECTS WITH PERSISTENT ISOLATED ANTI-HBc REACTIVITY. The aim of this study was to investigate the presence of hepatitis B virus occult infection in asymptomatic subjects with persistent anti-HBc reactivity but no other hepatitis B virus serological markers, including HBsAg, anti-HBs, IgM anti-HBc and HBV-DNA. For this purpose we used both polymerase chain reaction assays in sera and immunohistochemistry for HBsAg and HBcAg in liver biopsy specimens. Twenty-four cases were studied: 15 were drug abusers or homosexuals (eight with normal alanine aminotransferase levels) and nine were heterosexuals with raised alanine aminotransferase levels (> 45 U/l) but with no history of blood transfusion or ethanol intake (< 80 g daily). In all but five cases, liver biopsy was performed in subjects with persistent elevated alanine aminotransferase levels. In 10 out of 24 cases (41.66%) hepatitis B virus infection was demonstrated by polymerase chain reaction or immunohistochemistry, and when results from both procedures were available (n = 11) hepatitis B virus infection was detected in 63.63% of the subjects. The only clinical feature associated with HBV infection was the presence of persistent elevated alanine aminotransferase levels (p < 0.05). In conclusion, persistent isolated anti-HBc reactivity may be a relatively common serologic pattern for hepatitis B virus occult infection, at least in patients with chronic liver disease.

What is an Enzyme?
An enzyme is a protein or RNA (yep... some RNA molecules behave in this way, they are called ribozymes) which is capable of initiating a chemical reaction which involves the formation and/or breakage of chemical bonds.Any chemical reaction which results in products of the reaction which exist at a lower energy level relative to the reactants which led to the product, will theoretically occur, with or without an enzyme, but it may take a thousand years, or, may never occur, unless there is a little "zip" added to the mixture.Enzymes are catalysts, a very special kind of "organically grown" catalyst with a very precise chemical definition. A "true" catalyst in chemical terms substantially reduces the energy barrier which exists between atoms and which prevents the atoms from "getting close" enough to react and form a bond with one another. An enzyme, like all strictly defined catalysts, is therefore said to lower the energy of activation of a reaction; but, the catalyst is not changed in any way in the process , kind of like a conduit, a path through which reactions occur. All catalyst like things, do this.Therefore, when the atoms of molecules are acted

upon by enzymes, an identical reaction occurs as would have occurred without the enzyme, but, the energy hill required to overcome the getting close barrier, is much, much smaller than would have been true without the enzyme's help. The structure of the enzyme is such that atoms of molecules can get close enough to interact, but the energy required to allow this closeness is reatively small, like going into an empty closet with someone relative to going into an empty auditorium with someone. The chances of interaction within the closet are greater than the chances within the auditorium, less energy required to move around to increase the chances of bumping into one another.Let's look at some analogies to explain all of this energy stuff... You already know that it takes energy to climb a hill. At the bottom of the hill, you possess less potential energy than when you are finally exhausted, but are standing at the top of the hill. This gain in potential energy is partly the result of the effect of gravity, and partly the result of the transfer of energy from your muscles (they lost some to the hill and to the environment) to get you to the top. If you jumped off of the hill, your rate of fall would increase by 32 feet/second, for every second you spent flying through the air (just as it would if you jumped off of a chair) - this means that you will accelerate and you know that getting hit on the head by a marble dropped from one inch, is not nearly as unpleasant as getting hit on the head by a marble dropped from 100 feet. You know as well as I do, that you could immediately tell are difference in energy released from the two marbles, although, in the latter case you would most likely be unconscious, and couldn't make your knowledge available to anyone.Now, once you hit the ground, all of the energy you had accumulated at the top of the hill, would be released as heat, friction, and not worth much, no useful work, especially to your prostrate form...However, what if you had tied one end of a rope to yourself, and the other end to a person on the opposite side and at the bottom of the hill? Once you reached the end of your rope during the fall, some of the energy accumulated by you from your arduous trek up the hill and released by your fall, would be transferred to the other person connected to you. This person would probably fly up and over the hill without much effort on their part unless the person was way bigger than you would require more energy than you had made available to drag them up and over. Such enzyme connected reactions are called coupled reactions. WHAT THE HECK IS AN ENZYME? Now we must talk about personal relationships... you are attracted to someone, and they to you. You and they would each like to move closer to one another and form a bond between you. However, each of you may first need to overcome some barriers (shyness, self-doubt, etc.) Each of you has your own energy level (pretty high, you're out and about, looking to bond), but, your own set of inhibitions as well. So, there must be some impetus required to overcome your individual inhibitions and to push you together (might be a friend who catalyzes the interaction).Chemicals are like this, too. For atoms to get close enough to each other to form bonds between one another, an energy barrier must first be overcome (a hill); however, once this barrier is breached, the resulting reaction then occurs spontaneously, and a product is formed which is at a lower energy level than the reactants which formed it, the reactants come together and roll down the hill to form a product. Would be similar to you climbing a hill, and when you looked over the other side you find you are standing on the edge of a cliff and there is a canyon beneath you.Would have taken energy to get you to the top, and start you over the edge, but after that, you could parachute to the bottom of the canyon without expending any energy, in fact you would release energy and your energy level at the bottom of the canyon would be less than the energy level you possessed prior to climbing the hill, and substantially less than the energy you possessed at the top of the hill. If this difference in energy could somehow be collected, then other useful things could be made to happen.You know that if you place a piece of wood in an empty fireplace, that you could stare at

that wood for a million years and it would never suddenly burst into flames.However, if you place some paper, and maybe a few little sticks in there, and then apply the flame of a match to the paper, there is a strong likelihood that the wood will begin to burn and will continue to burn until the wood is gone. What's happened here? First, the wood, paper and sticks are all made of cellulose, a bunch of sugar molecules (glucose) hooked together into a complex polymer.So, cellulose is nothing but lots of individual carbon, oxygen and hydrogen atoms arranged in a particular way. If more oxygen (O2, the kind that we breathe) reacts with this stuff, chemical bonds can be formed and others broken which results in the release of carbon dioxide and water from the cellulose, that's it, just CO2 and water (you have "tasted" CO2, it's the stuff in "carbonated" water, that's where the name carbonated, comes from).Back to the burning wood, there is plenty of oxygen available in the room, or else you would be unconscious again, just after reviving from themarble attack..... so, why doesn't the oxygen in the air just hop onto the cellulose and react with it? Because, there is that energy hill which must first be overcome in order to allow the oxygen atoms to get close enough to the atoms within the cellulose to form a chemical bond. This extra energy is supplied by the flame of the match, increases the rate of movement (is what temperature is) of the oxygen and the atoms in the paper near the flame, accelerates them, and the atoms now have enough energy to slam together. Now, nothing would continue to happen UNLESS the products of this reaction, carbon dioxide and water, were at a lower, final energy level than the energy stored in the bonds of the cellulose. It is because of this difference in energy levels that the reaction continues spontaneously (we call this particular reaction a fire...) There are enzymes in your body and within bacteria which ultimately do exactly the same thing to glucose, e.g., produce CO2 (you exhale it) and water, by allowing glucose (you eat it) and oxygen (you inhale it) to react with one another.In the fireplace, some of the energy released by the formation of CO2 and water, is taken up by the unburned cellulose and oxygen in the air, which causes more atoms to slam together. Some of the energy remains in the bonds of CO2 and water. Some is lost as heat up the chimney, and the rest goes out into the room. Therefore, we are warmed by the fire. This warmth is useful to us, but really doesn't perform any work. However, if we used some of this heat to boil water, to drive the liquid water molecules into a gas (steam), we could let the steam bang into a turbine blade, turn it, and produce movement... Or, better yet for us and bacteria, this energy is used to provide an ability to move, and to produce other things.Enzymes are very particular, they won't catalyze just any reaction, only those which are suited for the enzyme.This selectivity is because of the essentially fixed shape of the place where the molecules must get together within the enzyme's reaction site in order to get close enough to form a bond. This site may comprise only a tiny part (the closet) of the entire enzyme's structure, but all of the structure is necessary in order for the site to be shaped correctly, And, only a select few molecules for any single enzyme will fit into this site. Therefore, there are thousands of different enzymes required in order for the thousands of different molecules within a living cell to engage in reactions. It is for this reason that a change in a gene (mutation) which encodes the enzyme's structure can result in a dysfunctional enzyme and lead to an inability of a cell to properly function.Some people cannot eat any milk products, milk contains the sugar, lactose (is where the word lactation comes from) which is made of glucose and galactose hooked together. An enzyme is required to digest the lactose and to convert it into glucose and galactose (we use both). However, if there is no enzyme (or a dysfunctional enzyme) which subsequently converts galactose into usable substances, then galactose will build up and result in severe damage, even mental retardation. The treatment is a diet which is very low in galactose. Another example is the inability of a person to tolerate fructose (in fruits and part of the structure of sucrose, table

sugar). The child has only one enzyme missing, the one which works on fructose phosphate.This child will become severely ill, have very low blood sugar (glucose), and will be malnourished. These children, remarkably, have a natural aversion to sweets and fruits, and also very few dental cares. The treatment is to place the child on a low fructose diet.Bacteria too, must have functioning enzymes available.Being only a single cell with only a single chromosome, bacteria are quite astonishing in their ability to make structural and functional components of all of the things necessary for the cell to stay alive. However, not all bacteria have all of the same enzymes, therefore different habitats and nutritional substances are required for the different species of bacteria, because they can't make all of the component parts necessary to build all of the structures, they need to be near a source of already made substances for which they have enzymes which can utilize them. Of course, we are like this too. We depend on bacteria, plants and animals for the sources of many of the component parts which we cannot make, and our enzymes which can utilize these substances to initiate chemical reactions and build the structures necessary for life. Believe it! Enzymes are important!

Aspartate Aminotransferase (AST)

1. AST is a cytoplasmic enzyme in liver, muscle, RBC's and other locations 2. Released from damaged cells; serum levels peak 24-36 hr after injury and normalize at 3-6 days if injury isn't ongoing 3. Highest elevations occur in viral hepatitis and hepatotoxicity (10-20 times the upper reference limit) 4. Mild-to-moderate (3-10 fold) elevations occur in chronic hepatitis, active cirrhosis, chronic passive congestion, drug-induced injury, metastatic tumor, biliary disease and a number of other conditions. 5. Cardiac and skeletal muscle injury will also produce substantial AST elevations.

Alanine Aminotransferase (ALT)

1. More specific for the liver than AST, but also present in kidney and muscle 2. Used to confirm that AST elevations are of liver origin (e.g., elevation of both AST and ALT strongly suggest hepatocellular injury) 3. The time course of ALT elevations in liver disease is shown below; AST would show a similar overall time course (though the ratio of the AST and ALT varies with disease and from patient to patient, as described in the next section)

AST/ALT Ratio
1. Viral hepatitis, mononucleosis, and acute hepatotoxicity typically show elevations in ALT that are equal to or greater than AST elevations (AST/ALT less than or equal to 1.0) 2. ALT is elevated to a lesser degree than AST in alcoholic liver disease and cirrhosis, passive congestion, bile duct obstruction, or metastatic tumor to the liver (AST/ALT greater than 1.0) 3. These are rules of thumb--substantial minorities of patients deviate from them, making the AST/ALT ratio of limited usefulness in the diagnosis of individual patients (though it may be helpful in suggesting the next appropriate step in the workup) What do these letters mean? These letters are acronyms for enzymes - proteins inside of cells. AST for example stands for aspartate amino transferase. This enzyme used to be called serum glutamic oxalacetic transaminase (SGOT), hence the two names. ALT = amino alanine transferase, GGTP= gamma glutamyl

transpeptidase, and AP= alkaline phosphatase. Different cells have different enzymes inside them, depending on the function of the cell. Liver cells happen to have lots of AST, ALT, and GGTP inside them. When cells die or are sick the enzymes leak out causing the blood level of these enzymes to rise, which is a way of determining if the cells in question are sick. ALT is more specific for liver disease than AST because AST is made in more places (e.g. heart, intestine, muscle). So the AST will rise after a heart attack or bruised kidney. GGTP and AP are said to be more specific for biliary disease since they are made in bile duct cells. In liver disease caused by excess alcohol ingestion, the AST tends to exceed the ALT, while the reverse is true to for viral hepatitis. However, this particular generalization is often wrong. Some points: These tests have meaning, but they generally cannot be interpreted without clinical information. They are probably most useful to track, or follow a particular problem, but even then they often "bounce around" greatly. These numbers are not linear. An AST that is 300 is not twice as bad as 150 (normal is less than 50). We are used to numbers like temperature and dollars. If it is 94 degrees F outside, it is warmer than if it is 80 every time. And if one has 94 dollars, one has more money than if one has 80. Liver enzyme values don't behave this way. An AST of 94 and 80 are essentially the same to a liver specialist. These numbers do not always detect all liver disease. Some very patients with severe advanced liver disease will have normal or nearly normal enzyme levels. Are these numbers indicative of liver funtion? Not really. Unfortunately, they are often called "liver function tests" or "LFT's", but in actuality, they do not measure function per se. Then how is liver function measured? Other tests including:albumin and bilirubin, and prothrombin time are more truely measures of function, but clinical factors must be considered as well.

Bilirubin
Serum total bilirubin is increased in hepatocellular damage (infectious hepatitis, alcoholic and other toxic hepatopathy, neoplasms), intra- and extrahepatic biliary tract obstruction, intravascular and extravascular hemolysis, physiologic neonatal jaundice, Crigler-Najjar syndrome, Gilbert's disease, Dubin-Johnson syndrome, and fructose intolerance. Drugs known to cause cholestasis include the following: aminosalicylic acid androgens azathioprine,benzodiazepines,carbamazepine ,carbarsone,chlorpropamide, propoxyphene,estrogens penicillin,gold Na thiomalate imipramine,meprobamate,methimazole,nicotinic acid progestins,penicillin,phenothiazines oral contraceptives,sulfonamides,sulfones,erythromycin estolate Drugs known to cause hepatocellular damage include the following:acetaminophen,allopurinol aminosalicylic acid, amitriptyline,androgens,asparaginase,aspirin, azathioprine,carbamazepine chlorambucil,chloramphenicol,chlorpropamide,dantrolene,disulfiram,estrogens,ethanol,ethionamid e,halothane, ibuprofen,indomethacin,iron salts,isoniazid, MAO inhibitors,mercaptopurine,methotrexate methoxyflurane methyldopa,mithramycin,nicotinic acid,nitrofurantoin, oral contraceptives,papaverine,paramethadione penicillin phenobarbital phenazopyridine,phenylbutazone,phenytoin,probenecid,procainamide,propylthiouracil pyrazinamide,quinidine,sulfonamides,tetracyclines, trimethadione,valproic acid.

Disproportionate elevation of direct (conjugated) bilirubin is seen in cholestasis and late in the course of chronic liver disease. Indirect (unconjugated) bilirubin tends to predominate in hemolysis and Gilbert's disease. Decreased serum total bilirubin is probably not of clinical significance but has been observed in iron deficiency anemia.

Bilirubin Analysis
Bilirubin is both a precursor and a product of liver metabolism. Three forms circulate: 1. Unconjugated bilirubin ("indirect") 2. Bilirubin covalently conjugated with glucuronide ("direct," normally about 1/3 of the total) 3. Bili-Alb (delta bilirubin) Elevated bilirubin occurs when: 1. Production of bilirubin is increased by increased breakdown of heme (increases unconjugated bilirubin) Hemolysis of any cause Resorption of hematomas or pulmonary hemorrhage Ineffective erythropoiesis (rapid heme turnover in the bone marrow) 2. Bilirubin excretion is limited (variable increases in unconjugated/conjugated ratio) Hepatocellular disease Cirrhosis Biliary tract obstruction Congenital disorders of bilirubin excretion Drug-induced inhibition of bilirubin excretion (e.g., phenytoin) Congestive heart failure (decreased hepatic blood flow)

Standard Reporting The International Normalized Ratio (INR)

Standard Reporting The International Normalized Ratio (INR), adopted by the World Health Organization (WHO) in 1983, attempts to address the many variables associated with the measure of warfarin effectiveness. The INR is a standardized system of reporting PT, based on a referenced calibration model and calculated by comparing the patient's PT with a control value. Factored into this calculation is the International Sensitivity Index (ISI), also developed by WHO, which is a determination of each reagent's degree of sensitivity, compared with that of a specific reference thromboplastin (which was assigned an ISI of 1.0).4 The ISI allows the associated PT ratio to be normalized to an International Reference Preparation.6 Acceptance of the INR in the United States has been slow.3This is surprising, considering the INR's potential value as a marker--one that allows for comparisons of values, regardless of the source or sensitivity of the thromboplastin reagent used. This allows for consistency in evaluation and treatment.Currently, the desired INR for most moderate-intensity warfarin regimens is between 2.0 and 3.0.5 However, more intensive therapy may require higher INR values5--although an INR higher than 4 is considered dangerous because of the increased risk of bleeding. Patients for whom oral anticoagulation therapy is planned should have baseline studies, including a PT. Because individual patient response to anticoagulant therapy varies, INR values are most useful after 1 to 2 weeks, when adequate time has been allowed for individual response. The INR then provides a very consistent and reliable tool for the clinician and patient, eliminating the variability that can occur in the PT:control ratio system due to differences in reagent sensitivity.

Results from any lab that uses the INR process can be considered consistent. Typically, the laboratory report will indicate the patient's PT and the INR. If the INR is in the desired range, a PT value that is high or low (most likely due to varying reagent sensitivity) should not present a problem. The INR represents a standardized value and the one for guiding treatment. As therapeutic outcomes come to be measured more consistently in relation to INR values, clinical data will become better established and more specific therapeutic values will be identified. Short of requiring all laboratories to use a standard thromboplastin, 4 it is important that patients be monitored at the same laboratory using the same or similar reagents during the initial treatment phase,7 a period of time which may last as long as 2 weeks. The American College of Chest Physicians has recommended using thromboplastin reagents with an ISI of 1.2 or less to increase reliability in INR reporting.7 This becomes less important once the initial treatment period has passed. Conclusion Introduced 14 years ago to the United States and gaining acceptance slowly, the INR nearly eliminates variability in PT by taking into account the possible variations in reagent sensitivity. The INR provides a consistent monitor for oral anticoagulation therapy that makes it a very useful tool for clinicians.

Prothrombin Time (PT) and Serum Albumin

PT depends on the hepatic synthesis of the Vitamin-K-dependent factors: II, VII, IX and X. Elevation in PT may be a sign of hepatic insufficiency (usually advanced and chronic) or a deficiency of vitamin K (in the absence of anticoagulant therapy or disseminated intravascular coagulopathy--DIC). Challenge with IV or IM vitamin K: correction of PT within 24-48 hr indicates vitamin deficiency. Albumin is also synthesized in the liver: hepatic insufficiency causes decreased serum albumin.

What is Albumin?
Albumin is a protein manufactured by the liver. WHAT DOES ALBUMIN DO? Albumin performs many functions including maintaining the "osmotic pressure" that causes fluid to remain within the blood stream instead of leaking out into the tissues. WHAT CAUSES ALBUMIN TO BE TOO LOW? Liver disease, kidney disease, and malnutrition are the major causes of low albumin. A diseased liver produces insufficient albumin. Diseased kidneys sometimes lose large amounts of albumin into the urine faster than the liver can produce it (this is termed nephrotic syndrome). In malnutrition there is not enough protein in the patient's diet for the liver to make new albumin from. WHAT IS THE NORMAL LEVEL OF ALBUMIN? The normal value depends on the laboratory running the test. Most labs consider roughly 3.5 to 5 grams per deciliter to be normal. WHAT HAPPENS IF MY ALBUMIN GETS TOO LOW? In a healthy person with normal nutrition, the liver will simply manufacture more and the level will normalize. If albumin gets very low swelling can occur in the ankles (edema) and fluid can begin to accumulte in the abdomen (ascites) and in the lungs (pulmonary edema). HOW DO YOU MAKE YOUR ALBUMIN HIGHER? The person must return to health. Therefore the underlying disorder must be corrected. If the disorder is cirrhosis of the liver, the only way to correct low albumin is generally to have a liver transplant.

Albumin levels are also dependant on the state of hydration of the body. A person that is deficient of water ("dry") because of dehydration will have an artificially low albumin level. This returns to normal when the dehydration is corrected. Albumin fluctuates so widely because it is very sensitive to changes in hydration of the body.

Alpha fetoprotein
Alternative names: fetal alpha globulin; AFP Definition: A test that measures the amount of alpha fetoprotein (AFP) in serum (blood). Why the test is performed: AFP is measured to diagnose or monitor fetal distress or fetal abnormalities, some liver disorders, and some cancers. This test has been used to determine the progress of therapy for hepatitis or liver disease. During pregnancy, this test, along with the examination of amniotic fluid (amniocentesis), can help detect fetal spinal bifida or other defects of the fetus' neural tube. AFP is a protein normally produced by the liver and yolk sac of a fetus, where it has an analogous function to albumin levels increase soon after birth; AFP probably has no normal function in adults. Normal values: Males or nonpregnant females: less than 300 ng/ml Note: ng/ml = nanograms per milliliter What abnormal results mean: Greater-than-normal levels of AFP may indicate:cancer in testes, ovaries, biliary (liver secretion) tract, stomach, or pancreas,cirrhosis of the liver,liver cancer,malignant teratoma,recovery from hepatitis During pregnancy, increased levels of AFP may indicate: fetal defects,spina bifida,anencephaly,omphalocele,tetralogy of Fallot,duodenal atresia,Turner's syndrome,intrauterine death (usually results in a miscarriage) Additional conditions under which the test may be performed: testicular cancer Alpha-Fetoprotein (AFP) 1. AFP is a protein normally made by the fetal liver that is also produced by hepatocellular carcinoma and several other GI tumors. 2. Current antibody-based assay methods detect AFP in about 85% of hepatomas. 3. AFP also appears occasionally in settings associated with hepatocyte necrosis (e.g., active alcoholic cirrhosis). 4. At present, AFP isn't normally used for screening or primary diagnosis. In cases where it is present, it is useful for following the response to treatment

GGT and 5'-NT

Gammaglutamyltransferase (GGT) Located primarily in hepatocytes and to a lesser extent in a number of other organs Highly sensitive to hepatocyte damage and cholestasis Elevated in chronic alcohol consumption and binge drinking Also elevated by extensive reparative processes, drugs (phenytoin and phenobarbital), obesity Not elevated by bone disease, pregnancy, or childhood and adolescence

Used as a confirmatory test to indicate a hepatic origin for ALP elevation (GGT can be elevated in co-existing conditions, so interpret its results carefully and with consideration of the whole clinical picture) 5' -Nucleotidase Provides confirmation for a hepatic origin for elevated ALP similar to GGT More specific for the liver and for cholestasis than GGT (which is generally elevated with any type of hepatocellular injury) Controversial as to whether GGT or 5'-NT provides the best confirmatory test; in the past, 5'-NT has been more difficult to perform and thus less generally available

Blood Ammonia
The liver normally removes ammonia during urea synthesis. Substantial liver failure must be present for blood ammonia to rise. The test is primarily used to evaluate patients with mental status changes; elevated blood ammonia supports a diagnosis of hepatic encephalopathy. Disrupted hepatic blood flow patterns in cirrhotic patients cause blood ammonia to elevate after milder degrees of liver failure in that group. Arterial plasma is the best specimen; smoking should be avoided prior to the test (it raises blood ammonia).

Alkaline Phosphatase (ALP)

ALP comprises a group of related enzymes found in high concentration in liver & biliary tract, bone, intestinal mucosa and placenta Cholestasis stimulates increased synthesis of hepatic ALP and leakage of the enzyme into blood Circulating ALP levels are very sensitive to cholestasis of any cause, including localized intrahepatic cholestasis that may not be otherwise apparent Hepatic causes of elevated ALP include:Extra- and intrahepatic biliary obstruction Hepatocyte injury of various causes (produces local cholestasis), including viral hepatitis Space-occupying lesions (tumors, abcesses, granulomas) ,Sepsis ,Drugs (phenytoin) ,Primary biliary cirrhosis Circulating ALP may also come from non-hepatic sources, and in those cases it does not indicate hepatic disease: Bone ALP is elevated when bone turnover is increased: Paget's disease of bone, hyperparathyroidism, osteoporosis, tumor metastatic to bone, and fracture healing. Bone ALP is also substantially elevated in childhood and adolescence due to bone growth. Enlarged reference ranges must be used at those times, and ALP is correspondingly less sensitive for hepatic disease in those age groups. Placental ALP and bone ALP are elevated during pregnancy ALP may also be elevated during active healing (granulation tissue formation) because it is present in relatively high levels in growing endothelial cells and fibroblasts Benign transient elevations can occur in a variety of diseases; may be strikingly high (most common in young), but are self-limited, resolving over a month or two Elevated ALP is typically confirmed as hepatic using a second test that is also sensitive to cholestasis Gammaglutamyltransferase (GGT))

If additional information is needed, tissue-specific ALP isoenzymes can be determined by electrophoresis (reference laboratories) and will specifically identify the tissue source of an elevation in ALP.

Caffeine Metabolism
1. Caffeine is eliminated by liver metabolism. 2. The rate of caffeine metabolism is dramatically slowed in cirrhosis. Release of 14-C from labelled caffeine into the breath (as CO2) can be used as a measure for the rate and capacity of liver metabolism. Rate of decline of caffeine concentration in the blood (a first order elimination curve) is also a measure of hepatic function. Measures hepatic function directly. 3. Fasting caffeine levels are elevated in cirrhosis and correlate with residual hepatic function (most people have measureable caffeine in the blood because its presence is ubiquitous in various drinks).

Polymerase chain reaction (PCR) is a technique which is used to amplify the number of
copies of a specific region of DNA, in order to produce enough DNA to be adequately tested. This technique can be used to identify with a very high-probability, disease-causing viruses and/or bacteria, a deceased person, or a criminal suspect. In order to use PCR, one must already know the exact sequences which flank (lie on either side of) both ends of a given region of interest in DNA (may be a gene or any sequence). One need not know the DNA sequence in-between. The building-block sequences (nucleotide sequences) of many of the genes and flanking regions of genes of many different organisms are known. We also know that the DNA of different organisms is different (while some genes may be the same, or very similar among organisms, there will always be genes whose DNA sequences differ among different organisms - otherwise, would be the same organism (e.g., same virus, same bacterium, an identical twin; therefore, by identifying the genes which are different, and therefore unique, one can use this information to identify an organism). A gene's building-block sequence is the precise order of appearance, one after the other, of 4 different components (deoxyribonucleotides) within a stretch of DNA (deoxyribonucleic acid). The 4 components are: Adenine, Thymidine, Cytosine and Guanine, abbreviated as: A, T, C and G, respectively (a 4-letter alphabet). The arrangement of the letters (one after the other) of this 4-letter alphabet generates a "sentence" (a gene sequence). The number of letters in the sentence may be relatively few, or relatively many, depending on the gene. If the sentence is 1000 letters-long, the sequence would be said to be 1 kilobase (1000 bases). As an example: ATATCGGGTTAACCCCGGTATGTACGCTA would represent part of one gene. DNA is double-stranded (except in some viruses), and the two strands pair with one another in a very precise way. EACH letter in a strand will pair with only one kind of letter across from it in the opposing strand: A ALWAYS pairs with T; and, C ALWAYS pairs with G across the two strands. So: TTAACGGGGCCCTTTAAA.... ....TTTAAACCCGGGTTT Would pair with: AATTGCCCCGGGAAATTT.... ....AAATTTGGGCCCAAA

Now, let's say that the above sequences "flank" (are on either end of..) the gene, which includes a long stretch of letters designated as: .............. These are known, absolutely identified to be, the sequence of letters which ONLY flank a particular region of a particular organism's DNA, and NO OTHER ORGANISM'S DNA. This region would be a target sequence for PCR. The first step for PCR would be to synthesize "primers" of about 20 letters-long, using each of the 4 letters, and a machine which can link the letters together in the order desired - this step is easily done, by adding one letter-at-a-time to the machine (DNA synthesizer). In this example, the primers we wish to make will be exactly the same as the flanking sequences shown above. We make ONE primer exactly like the lower left-hand sequence, and ONE primer exactly like the upper right-hand sequence, to generate: TTAACGGGGCCCTTTAAA..... ...TTTAAACCCGGGTTTAATTGCCCCGGGAAATTT...... and: ...........TTTAAACCCGGGTTTAATTGCCCCGGGAAATTT... .....AAATTTGGGCCCAAA Now. the ........ may be a very long set of letters in-between; doesn't matter. If you look at this arrangement, you can see that if the lower left-hand primer sequence (italics) paired to the upper strand could be extended to the right in the direction of the arrow, and the upper right-hand sequence paired to the lower strand could be extended to the left in the direction of the arrow (remembering that the ......... also represent letters, and opposite pairing will ALWAYS be A to T and C to G), one could successfully exactly duplicate the original gene's entire sequence. Now there would be four strands, where originally there were only two. If one leaves everything in there, and repeats the procedure, now there will be eight strands, do again - now 16, etc.. therefore, about 20 cycles will theoretically produce approximately one-million copies of the original sequences (2 raised to the 20th power). Thus, with this amplification potential, there is enough DNA in one-tenth of one-millionth of a liter (0.1 microliter) of human saliva (contains a small number of shed epithelial cells), to use the PCR system to identify a genetic sequence as having come from a human being! Consequently, only a very tiny amount of an organism's DNA need be available originally. Enough DNA is present in an insect trapped within 80 million year-old amber (fossilized pine resin) to amplify by this technique! Scientists have used primers which represent present-day insect's DNA, to do these amplifications. Here is how PCR is performed: First step: unknown DNA is heated, which causes the paired strands to separate (single strands now accessible to primers). Second step: add large excess of primers relative to the amount of DNA being amplified, and cool the reaction mixture to allow double-strands to form again (because of the large excess of primers, the two strands will always bind to the primers, instead of with each other). Third step: to a mixture of all 4 individual letters (deoxyribonucleotides), add an enzyme which can "read" the opposing strand's "sentence" and extend the primer's "sentence" by "hooking" letters together in the order in which they pair across from one another - A:T and C:G. This particular enzyme is called a DNA polymerase (because makes DNA polymers). One such enzyme used in PCR is called Taq polymerase (originally isolated from a bacterium that can live in hot springs therefore, can withstand the high temperature necessary for DNA-strand separation, and can be left in the reaction). Now, we have the enzyme synthesizing new DNA in opposite directions - BUT ONLY THIS PARTICULAR REGION OF DNA.

After one cycle, add more primers, add 4-letter mixture, and repeat the cycle. The primers will bind to the "old" sequences as well as to the newly-synthesized sequences. The enzyme will again extend primer sentences ... Finally, there will be PLENTY of DNA - and ALL OF IT will be copies of just this particular region. Therefore, by using different primers which represent flanking regions of different genes of various organisms in SEPARATE experiments, one can determine if in fact, any DNA has been amplified. If it has not, then the primers did not bind to the DNA of the sample, and it is therefore highly unlikely that the DNA of an organism which a given set of primers represents, is present. On the other hand, appearance of DNA by PCR will allow precise identification of the source of the amplified material. Cholic acid and chenodeoxycholic acid Bile acids are water-soluble cholesterol breakdown products which are secreted into the bile They recirculate in bile, aiding fat absorption in the intestine Diseases affecting hepatic function and GI absorption affect serum bile acid levels Since absorption problems can generally be separated from hepatocellular disease on clinical grounds, bile acids are relatively specific for hepatobiliary disease--but are nonspecific within that category Bile acid levels are considered to be the most sensitive indicator of hepatic or biliary disease: they may be abnormal in inactive cirrhosis and late convalescent hepatitis when other tests are normal Normal bile acids in a 2-hour postprandial specimen are a strong indication that the liver and biliary tree are normal.

Liver Enzymes
Four separate liver enzymes are included on most routine laboratory tests. They are- aspartate aminotransferase (AST or SGOT) and alanine aminotransferase (ALT or SGPT), which are known together as transaminases; and alkaline phosphatase (AP) and gamma-glutamyl transferase (GGT), which are known together as cholestatic liver enzymes. Elevations of these enzymes can indicate the presence of liver disease.

AST and ALT (Transaminases)

AST and ALT are jointly known as transaminases. They are associated with inflammation and/or injury to liver cells, a condition known as hepatocellular liver injury. Damage to the liver typically results in a leak of AST and ALT into the bloodstream. Because AST is found in many other organs besides the liver, including the kidneys, the muscles, and the heart, having a high level of AST does not always (but often does) indicate that there is a liver problem. For example, even vigorous exercise may elevate AST levels in the body. On the other hand, because ALT is found primarily in the liver, high levels of ALT almost always indicate that theres a problem with the liver. (Conversely, a normal ALT level does not necessarily mean that the liver is definitely normal- but, more about this later.)

Despite what one might expect, high levels of transaminases in the blood dont always reveal just how badly the liver is inflamed or damaged. This is an extremely important point to keep in mind. The normal ranges for AST and ALT are around 0 to 40 IU/L and 0 to 45 IU/L respectively. (IU/L stands for international units per liter and is the most commonly accepted way to measure these particular enzymes.) But someone who has an ALT level of 50 IU/L is not necessarily in better condition than someone with an ALT level of 250 IU/L! This is because these blood tests measure inflammation and damage to the liver at an isolated point in time. For instance, if the liver is inflamed on the day that blood was drawnlets say if a patient consumes an alcoholic drink a few hours prior to blood being drawnthe levels of the transaminases may be much higher than if the alcohol had not been consumed. Following the same reasoning, if the liver was damaged years beforeby excessive alcohol usethe results of a blood test done today may be normal, but a damaged liver may still be present. To confuse issues even further, there are many other factors besides liver injury that could affect the levels of AST and ALT. For example, males have higher transaminase levels than females. And, African-American men have higher AST levels compared with Caucasian men. Even the time of day that a blood sample is drawn may influence the level of transaminase elevation. People appear to have higher transaminase levels in the morning and afternoon than in the evening. Food intake does not appear to have a significant effect on transaminase levels. Thus, levels do not significantly differ in the fasting and non-fasting state. Finally, transaminase levels may vary from day-to-day. The ratio of the ALT and AST may also provide useful information regarding the extent and cause of liver disease. Most liver diseases are characterized by greater ALT elevations than AST elevations. Two exceptions to this rule exist. Both cirrhosis and/or alcohol abuse are associated with higher AST levels than ALT levels, often in a ratio of approximately 2:1. Elevations of the transaminases occur due to so many causes that they give the doctor only a vague clue of the diagnosis. Additional testing is required in order to determine more precisely what is wrong with the liver. Some possible causes of elevated transaminase levels include the following: Viral hepatitis A fatty liver Alcoholic liver disease Drug/medication-induced liver disease Autoimmune hepatitis Herbal toxicity Genetic liver diseases Liver tumors

 Heart failure - Strenuous exercise

GGT and AP (Cholestatic Liver Enzymes)

High levels of GGT and AP hint at a possible blockage of the bile ducts, or of possible injury to, or inflammation of, the bile ducts. This type of problem is characterized by an impairment, or failure, of bile flow, which is known as cholestasis. This type of liver injury is known as cholestatic liver injury, and this type of liver disease is known as cholestatic liver disease. (Primary biliary cirrhosis, discussed in Chapter 15, is an example of a cholestatic liver disease.) Intrahepatic cholestasis refers to bile duct blockage or injury within the liver. Intrahepatic cholestasis may occur in people with primary biliary cirrhosis or liver cancer (see Chapter 19), for example. Extrahepatic cholestasis refers to bile duct blockage or injury occurring outside the liver. Extrahepatic cholestasis may occur in people with gallstones. When a blockage or inflammation of the bile ducts occurs, the GGT and AP can overflow like a backed up sewer and seep out of the liver and into the bloodstream. These enzymes typically become markedly elevatedapproximately ten times the upper limit of normal. GGT is found predominantly in the liver. AP is mainly found in the bones and the liver but can also be found in many other organs, such as the intestines, kidneys, and placenta. Therefore, elevated levels of AP will indicate that something is wrong with the liver only if the amount of GGT is raised as well. Keep in mind that, GGT can be elevated without AP being elevated, as GGT is a sensitive marker of alcohol ingestion and certain hepatotoxic (liver toxic) drugs. It should be noted that for unclear reasons, people who smoke cigarettes appear to have higher AP and GGT than nonsmokers. Also, levels of AP and GGT are most accurate after a twelve-hour fast. You are beginning to get an inkling of the complexities that arise when evaluating abnormal LFTs!

Normal levels of AP range from 35 to 115 IU/L and normal levels of GGT range from 3 to 60 IU/L. Some causes of elevated AP and/or GGT include the following: Primary biliary cirrhosis Primary sclerosing cholangitis Nonalcoholic fatty liver disease (NAFLD) Alcoholic liver disease Liver tumors

 Drug-induced liver disease Gallstones

Bilirubin and Liver Disease/Hepatitis

Bilirubin is the yellow-colored pigment that the liver produces when it recycles worn-out red blood cells. Normal bilirubin levels are less than 1 mg/dl (milligram per deciliter). When levels become elevated, eyes and skin may turn yellow (jaundice), urine may appear a dark-tea color, and stools may look like light colored clay. Elevated bilirubin, while not the most common abnormality in blood tests pertaining to the liver, is quite obvious on a physical exam, and it is the liver-related abnormality most familiar to the general public. A phrase doctors often hear from their patients is, I cant have liver disease, Im not yellow. People are often surprised to discover that most people with liver disease will never become yellow. In fact, many bilirubin elevations are not even related to liver disease at all. Bilirubin metabolism is very complex and consists of many steps. A problem with any one of these steps results in an abnormally high level of bilirubin. As it pertains to the liver, an elevated bilirubin level is usually associated with worsening liver disease or with bile duct blockage (cholestasis). Some possible causes of a high bilirubin level include the following: Primary biliary cirrhosis Primary sclerosing cholangitis Alcoholic hepatitis Hemolysisred blood cell (RBC) destruction Drug-induced liver disease Choledocholithiasis (gallstones in the bile duct) Liver failure or general worsening of liver disease Tumors affecting the liver, bile ducts, or gallbladder Viral hepatitis Benign familial disorders of bilirubin metabolism, such as Gilberts syndrome (see below)

Bilirubin elevations are often associated with GGT and AP level elevations (discussed in my book). When elevated levels of bilirubin and GGT and AP occur concurrently, a person is referred

to as being cholestatic. However, if the bilirubin level remains normal and the GGT and AP remain elevated, the person is known as having anicteric cholestasis. Diseases marked by elevations of bilirubin, GGT, and AP are known as cholestatic liver diseases.

A Word About Gilberts Syndrome

Gilberts syndrome is a very common, albeit benign, inherited disorder of bilirubin breakdown (metabolism). It occurs in approximately 4-9 percent of the population. It is characterized by intermittently elevated bilirubin levels. The presence of Gilberts syndrome is usually discovered when blood tests are routinely performed, or when they are performed for the evaluation of an unrelated problem, or for preemployment or preinsurance screening. Bilirubin levels usually rise to about 3 mg/dl, but rarely do they go any higher than 5 mg/dl. Levels typically increase during periods of fasting, stress, menstruation, or during the course of an unrelated illness or infection. Jaundice is the only abnormality found on physical exam. Some people complain of nonspecific symptoms such as abdominal discomfort, nausea or fatigue. However, some experts feel that these symptoms are due to anxiety. All other LFTs are normal. Imaging studies, such as a liver sonogram and liver biopsy are not indicated. However, they should be normal if performed. No long-term complications arise from this harmless syndrome, and no therapy is required.

CLOTTING FACTORS and HEPATITIS/LIVERDISEASE Prothrombin Time

The liver manufactures most of the clotting factors that the body uses to stop bleeding. The time it takes to produce a clot, called the prothrombin time (PT), generally runs from nine to eleven seconds. Vitamin K is an important factor in the blood clotting process. If the liver is very seriously damaged or if a vitamin K deficiency is present (as sometimes occurs in cholestatic liver diseases such as primary biliary cirrhosis), the PT will run much longer than normal, thereby increasing the risk of excessive bleeding. In some cases, injections of vitamin K can help the PT return to normal. Improvement of the PT with a vitamin K injection indicates that the liver is still functioning. When the PT does not normalize after a vitamin K injection, a condition known as a coagulopathy (a tendency to bleed excessively), severe liver damage, and/or liver failure may exist. To adjust for variation among laboratories in calibrating the PT, the international ratio (INR) is often used. However, additional research is needed before the INR can be applied to people with liver disease.

Platelets

Platelets are blood cells that help the blood form clots. The spleen plays a role in the storage of platelets. In people with cirrhosis, the spleen works overtime to compensate for the decreased functional abilities of the damaged liver. This is associated with and enlarged spleen (splenomegaly), and a low platelet count known as thrombocytopenia. A normal platelet count is 150 to 450x103/microliter. If a patient has a value lower than 150x103/microliter, thrombocytopenia is said to be present and cirrhosis should be contemplated as a diagnosis.

Ammonia (NH3) and Liverdisease/Hepatitis

Ammonia is a product of amino acid breakdown. Increased levels of ammonia may be a sign of encephalopathy - an altered mental status associated with liver failure. (see chapter 6). Some doctors use ammonia levels to monitor the course of people with encephalopathy. However, since some studies have demonstrated a poor correlation between ammonia levels and degree of encephalopathy, its use for this purpose is controversial. Measurement of the ammonia level in people with liver disease is not recommended, as mild increases may occur with any liver disease and are not diagnostic of encephalopathy. Finally, there are multiple factors which can artificially elevate ammonia levels, thereby skewing interpretability. Such factors include- cigarette smoking, certain medications such as valproic acid (a medication used to treat seizures), accidentally mixing the patients perspiration with their blood sample during the blood draw, and laboratory delay in analyzing the blood sample.