March2013 Vo1. 20 No.

l 43-48
Joumal ofNortheast Agricultural (English Edition)
m
tm
cd
e

Dm
e

r cu
-
M
H

'm aF
,
Lm
4waFMU
-
-

'

V
A
Expression of a Lysine-rich Gene in Bacillus subtilis 168
Li Xue-lin\ Liu Xiao-fd, Gao

Qiao Bin\ Pan Hong-bao\ and Ao Jin-xia

1
'College Northeast Agricultural University, Harbin 150000, China;
2 College ofFood Engineering, Harbin University ofCommerce, Harbin 150076,
Abstract: Lysine-rich protein gene (lys) was winged bean (Psophocarpus tetragonolobus (L.) DC), and cloned into
prokaryotic expression vector pHT43, the recombinant p1asmid pHT43/lys were constructed and then transferred into Bacillus
subtilis168, upon IPTG induction, the recombinant protein was expressed, and the content of 1ysine was detected by HPLC. The resu1t
showed that 1ysine content increased by 9.85%. It was suggested that introducing lys gene into Bacillus subtilis 168 was an effective
way to improve its nutrition quality.
Key words: 1ysine-rich protein gene, Bacillus subtilis 168, 1ysine content, HPLC
CLC number: S8 Oocument code: A Article 10: 1006-8104(2013)-01-0043-06
Introduction
L-lysine is one of the eight essential amino acids
for humans and other monogastric animals (Galili
et al. , 2000; He et al. , 2009). It is mainly used as a
feed additive in the animal feed industry, and mixed
with various common livestock feed, such as cereals
which do not contain sufficient levels of L-lysine for
the livestock's requirements, especially for
single-stomach (monogastric) animals like broilers,
bovine and swine (Leuchtenberger, 1996; Kircher
and Pfefferle, 2001). Biotechnology has provided
altemative methods to improve the lysine content
in feed. On the one hand, many genetic engineering
researches were devoted to: understanding the re-
gulation of lysine metabolism and its exploitation
for increasing free lysine level in seeds (Zhu and
Galili , 2003; Frizzi et a l., 2008; ILSI, 2008);
using proteins that are enriched in lysine content
(Beauregard and Hefford, 2006). On the other hand,
the synthetic L-lysine is produced exclusively using
bacterial fermentations. Bacterial fermentations were
devoted to: increase of the microorganism's
productivity characteristics by classical mutagenesis
and genetic engineering (Tosaka et al. , 1979; Jose,
1997); more recent developments of recombinant DNA
technology and molecular biology also have been used
in order to improve L-lysine producing strains (Becker
et al. , 2008; Ohnishi et al. , 2002; Anastassiadis, 2007).
But research on improvement of lysine content by
transferring alien lysine-rich genes into bacterial is
absent.
A cDNA encoding lysine-rich protein
winged bean is expressed in plants (Li et al. , 2006;
Gao et al. , 2001; Meng et al. , 2001). The lysine-rich
protein consists of 158 amino acids with a molecular
weight of 16.8 ku. There are 17 lysine residues in the
protein, and lysine is the most abundant amino acid in
this protein, amounting to 10.8% (Sun, 1998).
Received 11 May 2011
Supported by Funding of Heilongjiang Provincial Science Research Project (GB08B401-02); Innovation Team of Northeast Agricultural
(CXT005-1-2).
Li Xue-lin (1984-), female, Master, engaged research ofmolecular biology. E-mail: lixuelin27@yahoo.com.cn
* Corresponding Gao Xue-jun, professor, supervisor of Ph. D student, engaged in the research of molecular biology. E-mail: gaoxj5390@sina.
com
http://publish.neau.edu.cn
'44'
Agricultural University (English Edition) Vo1.20 NO.l 2013
Baci/lus subtilis 168 is an attractive host for the
expression of heterologous proteins, because the
absence of exterior membrane simplifies the pro-
tein secretion pathways, therefore, allows higher
secretion levels of extracellular
Baci/lus subtilis 168 is regarded as an ideal expre-
ssion system due to its nonpathogenic trait, well-
established fermentation technology and ripened
genetic manipulation as well as multiple regulators
which possibly influence expression and secretion
(Stragier and Losick, 1996). Previous reports paid
much attention to the expression of lysine-rich gene
in plants. However, studies about lysine-rich gene
citrate, 1 % w/v starch.
Enzymes and chemicals
Trizol from Invitrogen; PrimeScript RT-PCR Kit,
dNTP, Taq DNA polymerase, restriction enzymes
and T
4
-DNA ligase were purchased from TaKaRa
Biotechnology (Dalian, China) Company; DNA puri-
fication kit and plasmid extraction Axygen;
RNA easy mini Qiagen; IPTG, chloromycetin
and all chemicals used were of analytical grade and
were obtained from Shanghai Sangon Biological
Engineering Technology & Services Company.
expression in Bacillus subtilis are seldom. In this Total RNA isolation and reverse transcription
study, the lys gene from winged bean was cloned and reaction
expressed inBacillus subtilis 168. Total mRNA was isolated from developing seeds
Materials and Methods
Lysine-rich protein gene, strain, plasmid and
medium
The winged bean (Psophocarpus tetragonolobus
(L.) DC) was obtained from Shun Qiang Nong Ke
Company (China). E. coli topl0 and Bacillus subtilis
168 were provided by Laboratory of Dairy Science,
of Education. Plasmid pHT43 was purchased
Molecular Biotechnology Company (Germany).
LB medium: 1 % w/v peptone, 0.5% w/v yeast
extract, 1% w/v NaCl , and autoclave to sterilize ( pH
7.0).
Bacillus subtilis 168 transformation medium:
lOxSp 1 Salts (100 mL): 2% w/v (NH4)2S04, 14%
w/v K
2
HP0
4
, 6% w/v KH
2
P0
4
, 0.2% w/v MgS0
4
-7H
2
0 ,
1 % w/v sodium citrate.
CAYE (100 mL): 2% w/v 10% w/v yeast
extraction.
Sp 1 medium: 10% v/v lOxSp 1 Salts, 1 % v/v
CA YE, 1 % v/v 50% glucose.
Sp 11 medium: 10% v/v Sp 1 medium, 1% v/v 50
mmol- L-
1
CaC1
2
, 1 % v/v 250 mmol- L-
1
MgC1
2
.
Fermentation medium: 1.5% w/v peptone, 2% w/v
yeast extract, 0.3% w/v K
2
HP0
4
, 0.1 % w/v sodium
E-mail: xuebaoenglish@neau.edu.cn
of winged beans using trizol reagent according to
the instruction of the manufacturer (Invitrogen).
reaction consisted of the
following components: of total RNA, of
moloney murine leukemia virus reverse transcriptase,
of RNase inhibitor, of deoxynucleoside
triphosphate, of Oligo dT, of dithiothreitol,
and of 5
x
reverse transcriptase buffer. The
procedure of the reverse transcription was taken
according to the instructions of the manufacturer.
Primer design and PCR amplification
According to the published sequence of the winged
beans mRNA from United States Patent with an
accession number of US 6,184,437 BIB, and two
DNA oligonucleotide primers were designed and
synthesized by Biontechnology (Shanghai,
China). The primers were the
restriction enzyme sites Xba 1 and Sma 1 at their 5'
ends, allowing the directional cloning of PCR product
into the plasmid expression vector pHT43.
Primers were as the followings:
Forward one: 5'- GCTCTAGACATTATGGGTGTT
TTCACATATGAG-3' (Xba 1)
Backward one: 5'- TCCCCCGGGATTGTATTCAG
GATGGGCCAAAAGG-3' (Sma 1)
Li Xue-lin et al. Expression of a Lysine-rich Gene in Bacillus subtilis 168
The cDNA encoding lysine-rich protein was cloned
using the total cDNA as template and the primers
designed. The PCR condition was 94.C denaturation
for 5 min, 94.C for 50 s, 52.C for 60 s, 72.C for 80 s,
36 cycles, fmally 72.C for 30 min. The amplified PCR
products were analyzed by agarose gel electrophoresis.
Construction of expression plasmid
The PCR products were double-digested by Xba 1
and Sma 1 and ligated to plasmid pHT43 digested by
the same restriction and the recombination
plasmid pHT43/1ys was constructed. The ligation
reaction was transformed into E. coli Top 10 and
plated on LB with ampici1lin Plasmid
DNA was isolated and verified by sequencing. Plasmid
DNA was transfonnants by the alkaline
lysis method in accordance with the manufacturers'
instructions (Invitrogen). Clones were verified by
DNA sequencing (TaK.aRa Dalian, China).
Bacillus subtilis 168 transformation and
selection
Plasmids carrying the lys gene were isolated from
E. co/i Topl0 by miniprep. The preparation of
Bacillus subtilis 168 competent cells and plasmid
transformation were performed according to the
methods described by Spizizen (1 961).
Expression of Iys gene in Bacillus subtilis 168
Bacillus subtilis 168 cells containing the lys gene were
streak:ed on a nutrient agar plate supplemented with
chloramphenicol followed by incubation
at 3 TC overnight. A single colony was inoculated into
3 ml of LB at 3TC with shaking at 200 r 0 min-
1
for
12-13 inoculated medium was
to 20 rnL of LB at a dilution factor of 1 : 20, followed
by incubation at 3TC with shaking at 200 r
o
min-
1
.
When OD
600
reached 0.75-0.95, protein production
was induced by IPTG (1 mmol
o
L-
1
) at 3TC for 30 h.
After incubation, the bacterial cells were harvested by
centrifugation at 2 000 r-min-
1
and 4.C for 20 min, and
the supematant (containing the lysine-rich protein) was
-45'
collected by and stored at 4.C with the
concentration 50% (NH4)2S04 for 12 h and then,
the precipitate was col1ected by centrifugation. The
precipitation was analyzed by SDS-polyacrylamide gel
electrophoresis (SDS-P AGE).
Oetection of Iys gene expression by 505-
PAGE
of proteins was perfonned in 15% (wt/
vol) polyacrylamide gels as described by Molecular
Cloning (Joseph Sambrook, 2001).
RT-PCR
Total RNA extraction was performed at various
phases of LB culture of induced Bacillus subtilis 168
with trizol reagent according to the instruction of the
manufacturer (lnvitrogen). The RNA was quantified
and cDNA was synthesized by
RNA. The cDNA was used as a template for PCR.
Lysine content detected by HPLC in Bacillus
subtilis 168
Lysine content was detennined by measuring the ratio
of the chromatographic of the ions
the analytes (lysine) to those the extemal
standards.
Lysine determination was perfonned, the precipitate
and supematant liquid were hydrolyzed
according to the GB/T18246-2000 method.
Samples were injected in a Diamonsil
4.6 mm column, maintained at 25.C, and the flow rate
was
Results
Construction of expression vector in Bacillus
subtilis 168
The lys gene encoding the lysine-rich protein was
isolated from the seeds of winged beans (Fig. 1).
Restriction enzyme analysis of the plasmid pHT43/1ys
showed that it was successfully constructed (Fig. 2).
Plasmid of recombinant clones were submitted
//publish.neau.edu.cn
.46. Agricultural University (English Edition) Vol. 20 No.l 2013
t'O nucle'Otide sequencing and c'Onfirmed that they
had inserted the actual sequence 'Of the wh'Ole 478 bp

2 3
100 bp
Fig. 1 PCR products of lys gene of Psophocarpus tetra-
gonolobus
1, DL2000 Marker; 2, 3, PCR products ofthe lys.
10000 bp
7000 bp
4 000 bp
2000bp
1000 bp
250bp
2 3
Fig.2 of recombinant plasmid pHT 43/1ys
1, DLl OOOO Marker; 2, Recombinant plasmid pHT43/lys digested with
Xba 1 and Sma Recombinant pHT43/lys digested withXba 1.
Oetection of recombinant protein by 505-
PAGE
The expressi'On 'Of the rec'Ombinant protein was induced
by IPTG in supematant. A single17 ku pr'Otein band
was invisible in the induced culture.
RT-PCR
Transcripti'Onal analysis 'Of lys by RT-
PCR in Bacillus subtilis 168 cells at different stages
The amplificati'On signal 'Of lys gene was
increasing during the lag phase till the end 'Of the
exp'Onential gr'Owth phase and then decreased at the
stati'Onary phase till the recessi'On phase. These results
suggested that the expressi'On 'Of lys was enhanced
during exp'Onential gr'Owth phase 'Of Bacillus subtilis
168.
2 3 4 5
250bp
100bp
Fig.3 RT-PCR products of lys gene from B. subtilis 168
1, DL2000 Marker; 2, RT-PCR products ofthe lag phase; 3, RT-PCR
products of the recession phase; 4, RT -PCR products of the stationary
phase; 5, RT-PCR products ofthe exponential
Lysine content detected by HPLC
Linearity was assessed 'Over c'Oncentrati'Ons varying

t'O

f'Or the lysine standard.
The calibrati'On pl'Ots f'Or lysine were fit t'O linear
equati'Ons 'Of sl'Ope and intercept y =0.0003x+2.3725
(Fig. 4). The c'Orrelati'On c'Oefficient was in the excess
'OfO.99 in case.
The c'Ontent 'Of lysine in the induced pHT43/1ys/
Bacillus subtilis 168 increased by 9.85% c'Ompared
with Bacillus subtilis 168.
Table 1 Lysine content analysis in Bacillus subtilis 168
(geV
1
)
Item Not induced Induced
pHT43/lys/Bacillus
49.03:1:1. 22

pHT43/Bacillus
47.89:1:1.03
subtilis 168
Bacillus subtilis 168
'Of cellular gr'Owth (Fig. 3). A 500 bp amplificati'On Each value is shown as of five individuals. * Significant
product was detected c'Orresp'Onding t'O the expressi'On difference (P<0.05) compared control.
E-mail: xuebaoenglish@neau.edu.cn
Li Xue-lin et al. Expression of a Lysine-rich Gene in Bacil/us subtilis 168
140 I
.!:"" I
I
bo 100
:::L

D
E 60
540
320
10000 20000
.47'
30000 40000 50000
(uy.s)
Fig. 4 Standard curve of Iysine by HPLC
Discussion
The lys gene encoding the lysine-rich protein,
containing 10.8 % of lysine and other essential amino
acids, such as threonine, valine and isoleucine, etc. ,
was the seeds of winged bean. 1n the
present study, lysine-rich gene was c10ned and the
corresponding protein was expressed in Bacillus
subtilis 168. It was an effective method to enhance the
lysine content by transferring alien lysine-rich genes
in cereals. The results in this study were similar to the
previous reports of maize, rice, wheat and lettuce (Li
et al. , 2006; Gao et al. , 2001; Meng et al. , 2001).
L-lysine is L-aspartate as a part
of the aspartate pathway in Bacillus subtilis. The
first step in the common pathway, phosphorylation
of L-aspartate, is catalyzed by aspartate kinase (AK).
Bacillus subtilis has three independently regulated
isozymic aspartate kinases. AKI (encoded by dapG)
is allosterically inhibited by meso-diaminopimelate
AKI1 (encoded by lysC) is inhibited by
L-lysine, and AKII1 (encoded by yclM, also
designated thrD) is regulated by concerted feedback
inhibition by L-lysine and L-threonine (Graves
and Switzer, 1990). Although decreased feedback
inhibition of AK1 and AKII was demonstrated in
Bacillus subtilis, improved L-lysine production was
not demonstrated. Mutations in the 5' untranslated
part of lysC mRNA decreased repression and
increased L-lysine pro-duction in Bacillus subtilis
168, but significant L-lysine production by such
mutants (more than 1 g 0 not been reported.
Unti1 now, no mutation in any AK1II-encoding
genes that leads to increased levels of L-lysine
production in Bacillus species has been described.
Dihydrodipicolinate synthase (DHDPS), encoded
by dapA, has been proved to be another key
for microbial L-lysine production at the end product
of the pathway (Cremer et al. , 1991; Eggeling and
Sahm, 2003; Grundy et al. , 2003). It is suggested that
this enzyme is not feedback inhibited in Bacillus
subtilis. Comparatively, DHDPS from plants is
strongly inhibited by lysine. The last step in the
L-lysine biosynthetic pathway is catalyzed by meso-
DAP decar-boxylase which is encoded by lysA. 1n
Bacil/us subtilis, lysA is repressed by L-lysine (Beli-
tsky, 2002).
Bacillus are gram-positive soil bacteria that
produce and export a variety of hydrolytic
that enable them to utilize complex carbohydrates in
their natural habitats (Huang, 2005). Many genes have
been successful expressed in Bacil/us subtilis, as early
as 1984, Ohmura achieved gene signal
peptide sequence and promoter E. coli
expressed in Bacillus subtilis.
sample of induced culture was detected by SDS-
PAGE and the recombinant protein band had not been
found. It might have been degraded by extra cellular
enzymes secreted by Bacillus subtilis. 1n conc1usion,
lysine content was increased by transferring alien
lysine-rich gene in Bacillus subtilis 168 from 49.32
mgoL-
1
up to 54.18 mgoL-
1

//publish.neau.edu.cn
'48. Agricultural University (English Edition) Vo1. 20 NO.l 2013
sensing by leader RNAs of bacterial lysine biosynthesis genes. Proc
Conclusions
Natl Acad Sci USA, 100: 12057-12062.
He X Y, Tang M Z, Luo Y B, et al. 2009. A 90-day toxicology study of
In this study, lys gene was cloned from winged transgenic lysine-rich maize in rague-Dawley rats. Food
bean and the recombinant plasmid pHT43/1ys was Chem Toxicol, 47(2): 425-32.
constructed, then it was expressed significantly in Wang G, Xiao L. 2005. Cloning, and expression of
Bacillus subtilis 168. Through data analysis, the con- the xylanase gene from a Bacillus subtilis strain BIO in Escherichia
tent oflysine increased by 9.85% 168. coli. Bioresour Technol, 97: 802-808.
ILSI. 2008. Maize with increased lysine (lysine maize-L Y038). In
References nutritional and safety assessments of foods and feeds nutritionally
Anastassiadis S. 2007. L-Lysine fermentation. Recent Patent Bion- studies. Compr Rev Food Sci
technol, 1: 11-24. Food 99-106.
Beauregard M, Hefford M A. 2006. Enhancement of essential amino Jose M, Gasent-Ramirez, Benitez T. 1997. Lysine-overproducing
acid contents in crops by genetic engineering and protein design. mutants of saccharmyces cerevisiae baker's yeast isolated in
Plant Biotechnol J, 4: 561-574. continuous Appl Environ Microbiol, 12: 4800-4806.
Becker J, Klopprogge C, Wittmann C. 2008. Metabolic responses Kircher M, Pfefferle, W. 2001. The fermentative production ofL-lysine
to pyruvate kinase deletion in lysine producing animal feed additive. Chemosphere, 43: 27-31
glutamicum. Microb Cell Fact, 5(13): 7-8. Leuchtenberger W. 1996. Amino acids: technical production and use
R. 2002. of amino acids of the glutamate and Rehm H J, Reed G, Puhler A, et al. Biotechnology: a multi volume
aspartate families, alanine and polyamines. Sonenshein A L, Hoch J A, comprehensive treatise. Products 01 Primary Metabolism. Weinheim,
Losick R. Bacillus subtilis 168 and its closest relatives: from York. pp: 465-502.
cells. ASM Press, Washington, DC. Li X T, Li X, Zhang J W, et al. 2006. Expression and inheritance of
Cremer J, Eggellng L, Sahm H. 1991. Control lysine biosynthesis lysine-rich protein gene in lettuce. Chin J Appl Environ Biol, 12(4):
sequence in Corynebacterium glutamicum as analyzed by over- 472-475
expression of the individual corresponding genes. Appl Environ Meng C M, Chen X Q, Liang R Q, et al. 2004. Expression of lysine-
Microbiol, 57: 1746-1752. rich protein gene and analysis of lysine content in transgenic wheat.
Eggellng L, Sahm H. 2003. New ubiquitous translocators: amino acid Chinese Science Bulletin, 49(19): 2053-2058.
export by Corynebacterium glutamicum and Escherichia coli. Arch Ohnishi J, Mitsuhashi S, Hayashi M, et al. 2002. A novel methodology
Microbiol, 180: 155-160. employing Corynebacterium glutamicum genome information
Frizzi A, Huang S, Gilbertson L A, et al. 2008. Modifying lysine to generate a new L-lysine-producing mutant. Appl Microbiol
biosynthesis and catabolism in com with a single bifunctional Biotechnol, 58(2): 217-223.
expressionlsilencing transgene cassette. Plant Biotechnol J, 6: 13-21. LosickR. 1996. Molecular genetics ofsporulation inBacillus
Galili S, Guenoune D, Wininge S, et al. 2000. Enhanced levels of free subtilis 168. Annu Rev Genet, 30: 297-41.
in transgenic alfalfa (Medicago Sun S S M, Xiong L W, Jing Y X, et al. 1998. Lysine rich protein from
L.) expressing a bacterial feedback-insensitive kinase gene. winged bean: U.S. A. application no, 08/964,722.
Transgenic 9(4): 137-144. Tosaka 0 , shihaya M, Moninaga Y. 1979. Mode of concersion of aspara-
Gao Y F, Jing Y X, Shen S H, et al. 2001. Transfer of lysine-rich to B semialdehyde to L-threonine and L-lysine in B-revibacterium
protein gene and production of fertile transgenic Acta lactofermentum. Agri Biol Chem, 43(2): 265.
Botanica Sinica, 43(5): 506-51 1. Zhu X, Galili G. 2003. Increased lysine synthesis coupled with a
Graves, L M, Switzer R L. 1990. Aspartokinase III, a new in knockout of its catabolism synergistically boosts lysine content
Bacillus subtilis 168. J Bacteriol, 172: 218-223. and also trans regulates the metabolism of other amino acids in
Grundy, F J, Lehman S C, Henkin T M. 2003. L box regulon: lysine Arabidopsis seeds. Plant Cell, 15: 845-853.
E-mail: xuebaoenglish@neau.edu.cn