TH E E VO LU TIO N OF MO RP HO LO GI CAL DI V ER SI TY IN CL O SE LY R EL A TE D S P E CI E S OF DRO SO PHI LA

Maria Margarita Womack

A DI SS ER TA TI O N P RE S EN TE D TO TH E FA CUL TY OF P RI N CE TON U NI V ERI S TY I N CAN DI DACY F OR TH E DEG R EE OF DO CTOR OF P HIL O SO PH Y

RECOMMENDED FOR ACCEPTANCE BY THE DEPARTMENT OF ECOLOGY AND EVOLUTIONARY BIOLOGY

Advisers: David L. Stern and Peter R. Grant

June 2009

 Copyright by Maria Margarita Womack, 2009. All rights reserved.

There is a grandeur in this view of life, with its several powers, having been breathed into a few forms or into one; and that, whilst this planet has gone circling on according to the law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being evolved
Charles Darwin, 1859, On the origin of species by means of natural selection, or, The preservation of favoured races in the struggle for life, J. Murray, London.

I am not trying to prove anything, by the way. Im a scientist, and I know what constitutes a proof. But the reason I call myself by my childhood name is to remind myself that a scientist must also be absolutely like a child. If he sees a thing, he must say that he sees it, whether he thought he was going to see it or not. See first, think later, then test. But always see first. Otherwise you will only see what you were expecting. Most scientists forget that.
Douglas Adams, 1996, So long and thanks for all the fish, in The Ultimate Hitchhikers Guide, Wings Books, NY.

iii

DISSERTATION ABSTRACT
One of the central goals of evolutionary biology is to understand the processes that underlie the generation and diversification of phenotypes. Identifying the genetic changes underlying phenotypic differences between species is an essential component in understanding how diversity is generated. Species generally vary in form, and such variation often plays an essential role in adaptation to ecological conditions, sexual selection, and many other relevant evolutionary processes. Little information exists about the molecular genetic basis of complex morphological traits as multiple genes, environmental conditions and interactions between these two factors typically influence their expression making their study particularly challenging. Yet to answer important standing theoretical questions about the genetic basis of such traits, it is essential to streamline current methods to study quantitative variation and expand the number of empirical studies identifying genes underlying their variation. I studied the genetic basis of complex morphological differences between closely related species of Drosophila within the melanogaster species subgroup. I focused on variation in eye size/shape between D. simulans and D. mauritiana, and abdominal pigmentation between D. yakuba and D. santomea. In the case of eye size/shape I test several methods to accurately quantify the variation between species and generate a rough QTL map of the X-chromosome. In the case of abdominal pigmentation I generated for the first time a high-resolution map of most of the genes involved in the generation of differences in a quantitative trait between species. I show how through repeated backcrossing coupled with selection it is possible to isolate each of the four different QTLs affecting abdominal pigmentation in a common background. Three of these QTLs produce discrete, traceable phenotypes in isolation thus making the study of

iv

individual genes considerably simpler. I narrowed all four QTLs to a fraction of their original size, in one case to an interval 2 orders of magnitude smaller. Finally, I show how this method lead to identification of a gene of previously unknown function that affects abdominal pigmentation variation in Drosophila and is likely to be involved in the evolution of abdominal pigmentation differences between D. yakuba and D. santomea.

ACKNOWLEDGMENTS
I owe many for successfully completing my PhD. First of all, to my families: both my biological and academic families. The unconditional support and continuous encouragement of my biological family, in particular my mother Sylvia Vegalara, has been a decisive factor in fulfilling my dreams. I am also deeply grateful to my academic family. In earlier stages of my career, Dr. Duncan Irschick and Dr. Terry Christenson nurtured my passion for science and taught me the very basics of research. At Princeton University for my PhD, I had great academic parents: Dr. David Stern and Dr. Peter Grant (and by extension Dr. Rosemary Grant) have been generous guides through my academic growth as a graduate student. The others members of my committee, Dr. Leonid Kruglyak and during most of my time at Princeton Dr. Martin Wikelski, were always accessible and offered great insights into my research. Also, as an unofficial member of my committee, Dr. Enrico Coen support was instrumental to my research. The various members of the Stern lab, my academic siblings, played a significant role in my training. I am particularly indebted to Alistair McGregor, Virginie Orgogozo, Tony Frankino, and Dayalan Srinivasan and Nicolas Frankel. In my academic home while at Princeton, the Ecology and Evolutionary Biology department, I enjoyed a large extended academic family to share my passion for scientific research. The support of the administrative staff in EEB was also invaluable to sort out all the little things of academic life. Furthermore, I am grateful to the larger Princeton University community, where I was able to find everything I could need during these years: curing strange malaises brought back from field trips, enjoying activities outside my field, finding solace from the sometimes scabrous academic path. Finally, I am eternally grateful to my husband Andy Womack, yet another gift from my time at Princeton, for his continuous understanding, love and friendship.

vi

To all the mysteries of the world that stir our curiosity and allow us to rejoice in science .

vii

TABLE OF CONTENTS

Abstract Acknowledgements Table of contents Introduction

The study of morphological evolution The Genetic Basis of Evolutionary Change in Complex Traits Drosophila as a Model Organism Dissertation Overview References

iv vi viii

1 1 4 5 7 10 15

Section I: Evolution Through The eye of a Fly

Chapter 1: A primer to the study of the genetic of eye size and shape variation in Drosophila Abstract Introduction Methods Results Discussion References

16 17 18 21 28 37 45 48

Section II: A Tail of Two Flies

Chapter 2: Rapid, efficient dissection of an interspecific quantitative trait into its underlying Mendelian factors in Drosophila Abstract Introduction Methods Results Discussion References Appendix

49 50 51 56 60 66 75 78

Chapter 3: From QTL to gene: characterization and evolution of Truffle, a gene likely to be involved in the evolution of pigmentation differences in Drosophila Abstract Introduction Methods Results Discussion References

79 80 81 83 88 93 100

viii

Overall Discussion, Conclusions, and Future Research Overall Discussion and Conclusions Future Research References

102 102 105 108

ix

INTRODUCTION
An important challenge in evolutionary genetics is to map and examine the genetic polymorphisms that lead to phenotypic diversity. Understanding how variation at the genetic level affects variation at the phenotypic level is essential to elucidate general patterns of evolution such as the genetic architecture of phenotypic change, the number and types of changes at the nucleotide level that are necessary for generating variation in a trait, or whether some genes or parts of genes are more likely than others to generate phenotypic diversity. Few studies, however, have been able to point to a specific gene, and even less often to specific nucleotide differences responsible for variation in a phenotypic trait. This is particularly true in the case of complex traits, where only a handful of genes have been found (Glazier et al., 2002). Yet identifying and determining the properties of the individual genes underlying variation in complex traits is imperative to properly determine the molecular genetic basis of evolution (Mackay, 2001). THE STUDY OF MORPHOLOGICAL EVOLUTION Modifications in development, the link between genotype and phenotype, generate phenotypic variation upon which natural selection can act (Brakefield et al., 2003). The study of these processes falls within the realm of evolutionary development or evo-devo, a field that strives to understand the mechanisms and laws underlying morphological evolution (Gilbert & Burian, 2003; Stern, 2003). This is a comprehensive field drawing from disciplines that had been largely independent until recently, such as embryology, evolution, genetics, and phylogenetics (Gilbert & Burian, 2003; Carroll et al., 2005). Most research in evo-devo has focused so far on trends and differences at a macro scale (Stern, 2000b; Simpson, 2002) by comparing a small number of widely

disparate species both from a phylogenetic and morphological point of view. While this approach has generated a number of important concepts (Johnson & Porter, 2001; Burke & Brown, 2003; Gilbert, 2003; Gilbert & Burian, 2003; Laubichler, 2003; Love, 2003; Vergara-Silva, 2003; Raff & Love, 2004), the generation of morphological differences in natural populations is still poorly understood. To properly examine how evolutionarily relevant genetic variants first arise it is necessary to focus on a small evolutionary time-scale and study small phenotypic differences between closely related species (Stern, 1998; Stern, 2000a; Stern, 2000b; Simpson, 2002). In this way, it is possible to examine how small evolutionary changes might add up to give rise to larger differences in gene function and activity. In recent years, our general understanding of how morphology evolves has progressed substantially, providing the first few insights on its general patterns and slowly enabling evaluation of some of the standing theoretical hypotheses on the principles of morphological evolution. One of the oldest debates concerns whether evolution proceeds through the accumulation of many changes of small effect at multiple loci or through a few large effect mutations (Stern, 2000b; Orr, 2005a; Orr, 2005b). Though so far most studies suggest quantitative traits evolve through the accumulation of a few mutations of large or moderate effect and several mutations of small effect (e.g. Tanksley, 1993; Doebley et al., 1997; True et al., 1997; Zeng et al., 2000; Fishman et al., 2002; Kerje et al., 2003), a recent study (McGregor et al., 2007) suggest other intermediate mechanisms are possible, such as multiple mutations of small effect at a single locus of overall large effect. A second debate concerns whether morphological evolution occurs more often through changes in coding or cis-regulatory sequences (Carroll, 2000; Hoekstra & Coyne, 2007). Empirical data suggests it might depend in part on the term of divergence, so that between species (long-term evolution) the trend favors cis-regulatory mutations, while within species (short-term evolution) coding

mutations appear more frequent (Stern & Orgogozo, 2008; Stern & Orgogozo, 2009). Many other factors that are likely to influence the distribution of evolutionarily relevant mutations need to also be considered, such as pleoitropy, epistasis, population history, plasticity and strength of selection. Therefore, further resolution of this problem will require a fusion of molecular biology, development and population genetics (Stern & Orgogozo, 2008; Stern & Orgogozo, 2009). There is also no consensus on the importance of pleiotropy in evolution, particularly in the case of complex morphological structures (Fisher, 1930; Turelli, 1985; Wagner & Altenberg, 1996; Welch & Waxman, 2003; Wagner et al., 2008). One view posits that there is a cost of complexity (Orr, 2000), so that modularity can increase evolvability, and various mathematical models support this argument (Welch & Waxman, 2003; Otto, 2004). However, the sparse empirical data suggests that evolution is not hindered by such costs, as naturally occurring mutations affect a small number of traits and the magnitude of their effect does not scale with pleiotropy (Wagner et al., 2008). Finally, it is possible that certain genes are more likely than others to evolve between species to generate morphological variation, because their position in developmental networks allows for reduced pleiotropic and/or epistatic effects, thus making evolution predictable to a certain degree (Rockman & Stern, 2008; Stern & Orgogozo, 2008; Stern & Orgogozo, 2009). Various studies showing examples of parallel evolution of the same trait in different populations and species support this hypothesis (ffrench-Constant et al., 1998; Sucena et al., 2003; Colosimo et al., 2005; Hoekstra, 2006; Protas et al., 2006). Further studies on the genetic basis of morphological traits will gradually generate the necessary empirical data to further resolve these issues and thus define general laws of morphological evolution.

THE GENETIC BASIS OF EVOLUTIONARY CHANGES IN COMPLEX TRAITS Morphological variation is most often quantitative rather than qualitative, presenting a continuous distribution rather than falling into discrete categories (Falconer & Mackay, 1996; Liu, 1998; Griffiths et al., 2005). Medelian traits are usually the result of a single mutation of large but discrete effect at a single locus (Hartl, 2004). At the other end of the spectrum, quantitative traits are affected by multiple genes, often of small effect, that can interact in complex ways (Falconer & Mackay, 1996; Christians & Keightley, 2002; Erickson et al., 2004; Erickson, 2005). In addition, genes determining complex traits often interact with the environment so that a given genotype does not present a single phenotype but rather a norm of reaction: a pattern of expression according to an environmental variable (Falconer & Mackay, 1996; Griffiths et al., 2005). Non-additive effects and genotype-environment interactions add an extra level of complexity to the relationship between genotype and phenotype making the dissection of the genetics of quantitative traits a formidable task (Lynch, 1998; Mackay, 2001). Various aspects of the genetics of quantitative traits have been subject to extensive theoretical modeling (e.g. Barton & Turelli, 1987; Zeng et al., 1999; Otto & Jones, 2000; Barton & Keightley, 2002; Barton & Turelli, 2004; Blows & Hoffmann, 2005; Johnson & Barton, 2005). Quantitative trait locus (QTL) analysis is a method often used to assess the genetic basis of quantitative traits. QTLs, regions of the genome contributing to complex traits, can be identified through a combination of linkage mapping and quantitative genetic analysis (Lander & Botstein, 1989; Lynch, 1998). A QTL is identified based on the association of the trait value with visible or molecular polymorphic markers of known location on the genome (Falconer & Mackay, 1996; Liu, 1998; Doerge, 2002; Griffiths et al., 2005). Using this technique it is possible to infer the location of QTLs and the magnitude of their effect. QTL mapping has been used in an

extensive number of studies seeking to understand the genetic basis of a variety of phenomena, including adaptation, human disease, and crop productivity (Falconer & Mackay, 1996). However, QTL analysis usually does not provide enough resolution to identify the actual genes involved. Yet to successfully determine the molecular genetic basis of morphological evolution, it is necessary to identify and determine the properties of the individual genes underlying variation in complex traits. Few examples exist of genes and their relevant sequence variants that are partially responsible for variation in a complex trait (Glazier et al., 2002). In addition, the best-studied examples involve variation within species, such a bristle pattern variation in Drosophila (Mackay, 1996; Bourouis et al., 1997; Gurganus et al., 1999; Dilda & Mackay, 2002; Robin et al., 2002; Westerbergh & Doebley, 2002; Macdonald & Long, 2004; Gibert et al., 2005; Mackay & Lyman, 2005), characteristics of domesticated plant varieties (Paterson et al., 1995; Doebley et al., 1997; Grandillo et al., 1999; Frary et al., 2000; Fridman et al., 2002; Tanksley, 2004), or complex variation in mice (Flint & Mott, 2001; Nadeau, 2001; Hoekstra & Nachman, 2003; Christians et al., 2004; Darvasi, 2005; Arbilly et al., 2006; Darvasi, 2006). Understanding open questions such as the relationship between intra- and interspecies genetic variation, the role of evolutionary time scale, or the importance of the strength of selection will also require dissecting the genetic basis of complex morphological differences between species. DROSOPHILA AS A MODEL ORGANISM For nearly a century, research on Drosophila has generated some of the most important insights into genetics and other branches of biology. Other than the reasons that make Drosophila an amenable study organism, such as ease of culture, short life cycle and low cost, the wealth of molecular, genomic and technological tools make Drosophila a powerful model for the study of evolutionary genetics (Letsou & Bohmann,

2005). In addition, recent findings of evolutionary development suggest that broad generalizations can be made from conclusions drawn from studies on model organisms such as Drosophila (Carroll, 1995; Burke & Brown, 2003; Carroll et al., 2005; Mackay & Anholt, 2006). Thus, findings from this study might be relevant for understanding the evolution of complex traits in other taxa, such as humans (Mackay, 2001; Burke & Brown, 2003; Carroll, 2003; Mackay & Anholt, 2006). Species closely related to D. melanogaster are a suitable system for the study of morphological diversification. The melanogaster species subgroup is composed of 9 species of Afrotropical origin (Lachaise et al., 1988) (Figure 1). Many parallels exist between the pairs composed by D. simulans and D. mauritiana, and D. santomea and D. yakuba. A member of each pair is widely distributed while the second one is restricted to an island. D. simulans and D. yakuba exist throughout most of Africa, with D. simulans having also expanded to many other parts of the world (Lachaise et al., 1988; Lachaise & Silvain, 2004). D. mauritiana and D. santomea are restricted to islands off the coast of Africa, the first to the island of Mauritius (Indian Ocean, East Africa) (David et al., 1974; Lachaise & Silvain, 2004) and the latter to the island of Sao Tome (West Africa) (Lachaise et al., 2000). Both diverged only about 400 thousand years ago (Kliman et al., 2000; Cariou et al., 2001) and differ in various aspects of their morphology, physiology, and behavior. Each species within the pair is the closest known relative of the other. Although the resolution of the node between D. simulans, D. sechellia and D. mauritiana is controversial because nuclear and mtDNA yield different relationships (Tsakas & Tsacas, 1984; Solignac & Monnerot, 1986; Hey &

Kliman, 1993; Harr et al., 1998; Kliman et al., 2000), it is generally accepted that the split between D. simulans and D. mauritiana is more recent (Harr et al., 1998). In the case of D. yakuba and D. santomea, all phylogenetic evidence consistently groups them as sister species (Lachaise et al., 2000; Cariou et al., 2001). As the species in both pairs are so closely related, they are very similar at the genetic level, which facilitates the identification of genetic variation that influences phenotypic differences between them. Crosses between the species in each pair produce fertile females and sterile males (Lachaise et al., 1988; Lachaise et al., 2000; Cariou et al., 2001), so that genetic changes responsible for a particular morphological difference can be mapped by backcross designs (Stern, 1998; Stern, 2000a; Stern, 2000b; Simpson, 2002). Finally, the close relationship of all four species to D. melanogaster enables access to a large number of tools for genetic and functional analysis, particularly useful in the dissection of the genetic basis of morphological diversity. DISSERTATION OVERVIEW In the next three chapters, I characterize morphological differences between closely related species of Drosophila and examine the genetic changes responsible for their evolution. In chapter one, I examine eye size/shape differences between D. simulans and D. mauritiana. D. mauritiana has larger, differently shaped eyes than D. simulans (Figure 2A). However, a qualitative description is not informative enough to study variation, as it is necessary to assign each individual a numerical value. As with many quantitative traits, transitioning to a quantitative description for eye size/shape cannot be done with standard methods. I quantified eye size/shape variation between species using both simple linear methods and multivariate analysis. For the latter, I used software designed by the research group of Dr. Enrico Coen (John Innes Centre, UK) and collaboratively customized it for the quantification of Drosophila morphology. I

used the data generated with this program to build and visualize statistical models of variation in eye size/shape taking different considerations in hand, such as the value of size corrections or different ways of generating a phenotypic space. Finally, I compare a rough QTL map of the X-chromosome for eye size/shape variation generated with the different methods for quantifying eye size and shape. In chapter two, I examined variation in abdominal pigmentation patterns between D. yakuba and D. santomea. D. yakuba males have pigmented abdomen like the rest of the species within the melanogaster species subgroup, while D. santomea males have almost completely lost all pigmentation (Figure 2B). First I showed how this phenotype, in hybrid backcross males, produces visually tractable, quantitatively distinct phenotypes and how these phenotypic classes correspond to different QTLs. Next, through repeated backcrossing coupled with selection, I isolated 3 QTLs into separate lines, thus Mendelizing the trait. With this technique, I was able to overcome some of the downsides of QTL mapping, first identifying two different loci underlying the same QTL, and second generating a high resolution map for most of the effects involved in the evolution of abdominal pigmentation differences between D. santomea and D. yakuba. In chapter three, I focused on identifying one of the genes that evolved to modify pigmentation between D. santomea and D. yakuba. Employing the approach described in chapter 2, I narrowed a QTL on chromosome 3 to 27 Kbp (less than 0.01% of the size of the original QTL). This fragment encompassed only 5 genes. First, drawing upon the

many tools for functional and genetic analysis in D. melanogaster, I showed through quantitative methods that only one of these loci appears to be involved in abdominal pigmentation development. This gene of previously unknown function that I will name truffle (CG6353) is likely to partly explain the loss of abdominal pigmentation in D. santomea. I also carried out an evolutionary analysis of this gene to show how it is highly conserved across cellular organisms, thus suggesting it might play an essential role across many taxa. Also, I discussed how there are no coding differences at this locus between D. yakuba and D. santomea, so that any differences in the role of truffle would be most likely the result of cis -regulatory differences between these species.

LITERATURE CITED
ARBILLY, M., PISANTE, A., DEVOR, M. & DARVASI, A. (2006). An integrative approach for the identification of quantitative trait loci. Animal Genetics 37, 7-9. BARTON, N. H. & KEIGHTLEY, P. D. (2002). Understanding quantitative genetic variation. Nature Reviews Genetics 3, 11-21. BARTON, N. H. & TURELLI, M. (1987). Adaptive Landscapes, Genetic-Distance And The Evolution Of Quantitative Characters. Genetical Research 49, 157-173. . (2004). Effects of genetic drift on variance components under a general model of epistasis. Evolution 58, 2111-2132. BLOWS, M. W. & HOFFMANN, A. A. (2005). A reassessment of genetic limits to evolutionary change. Ecology 86, 1371-1384. BOUROUIS, M., CUBADDA, Y., HAENLIN, M., HEITZLER, P., PAPADOPOULOU, D., RAMAIN, P. & SIMPSON, P. (1997). The genetic control of bristle pattern in Drosophila. Developmental Biology 186, S32-S32. BRAKEFIELD, P. M., FRENCH, V. & ZWAAN, B. J. (2003). Development and the genetics of evolutionary change within insect species. Annual Review Of Ecology Evolution And Systematics 34, 633-660. BURKE, A. & BROWN, S. (2003). Homeotic genes in animals. In: Keywords and concepts in evolutionary developmental biology (B. K. Hall & W. M. Olson, eds). Harvard University Press, Cambridge, MA. CARIOU, M. L., SILVAIN, J. F., DAUBIN, V., DA LAGE, J. L. & LACHAISE, D. (2001). Divergence between Drosophila santomea and allopatric or sympatric populations of D. yakuba using paralogous amylase genes and migration scenarios along the Cameroon volcanic line. Molecular Ecology 10, 649-660. CARROLL, S. B. (1995). Homeotic Genes And The Evolution Of Arthropods And Chordates. Nature 376, 479-485. . (2000). Endless forms: the evolution of gene regulation and morphological diversity. Cell 101, 577-580. . (2003). Genetics and the making of Homo sapiens. Nature 422, 849-857. CARROLL, S. B., GRENIER, J. K. & WEATHERBEE, S. D. (2005). From DNA to diversity: molecular genetics and the evolution of animal design. Blackwell Publishing. CHRISTIANS, J. K. & KEIGHTLEY, P. D. (2002). Genetic architecture: Dissecting the genetic basis of phenotypic variation. Current Biology 12, R415-R416. CHRISTIANS, J. K., RANCE, K. A., KNOTT, S. A., PIGNATELLI, P. M., OLIVER, F. & BUNGER, L. (2004). Identification and reciprocal introgression of a QTL affecting body mass in mice. Genetics Selection Evolution 36, 577-591. COLOSIMO, P. F., HOSEMANN, K. E., BALABHADRA, S., VILLARREAL, G., DICKSON, M., GRIMWOOD, J., SCHMUTZ, J., MYERS, R. M., SCHLUTER, D. & KINGSLEY, D. M. (2005). Widespread parallel evolution in sticklebacks by repeated fixation of ectodysplasin alleles. Science 307, 1928-1933. DARVASI, A. (2005). Dissecting complex traits: the geneticists' - 'Around the world in 80 days'. Trends In Genetics 21, 373-376. . (2006). Closing in on complex traits. Nature Genetics 38, 861-862. DAVID, J., LEMEUNIER, F., TSACAS, L. & BOCQUET, C. (1974). Hybridization Of A New Species - Drosophila Mauritiana, With Drosophilia Melanogaster And Drosophilia Simulans. Annales De Genetique 17, 235-241. DILDA, C. L. & MACKAY, T. F. C. (2002). The genetic architecture of drosophila sensory bristle number. Genetics 162, 1655-1674.

10

DOEBLEY, J., STEC, A. & HUBBARD, L. (1997). The evolution of apical dominance in maize. Nature 386, 485-488. DOERGE, R. W. (2002). Mapping and analysis of quantitative trait loci in experimental populations. Nature Reviews Genetics 3, 43-52. ERICKSON, D. (2005). Quantitative trait loci - Mapping the future of QTL's. Heredity 95, 417-418. ERICKSON, D. L., FENSTER, C. B., STENOIEN, H. K. & PRICE, D. (2004). Quantitative trait locus analyses and the study of evolutionary process. Molecular Ecology 13, 2505-2522. FALCONER, D. S. & MACKAY, T. F. C. (1996). Quantitative genetics. Longman Group, Essex, England. FFRENCH-CONSTANT, R. H., PITTENDRIGH, B., VAUGHAN, A. & ANTHONY, N. (1998). Why are there so few resistance-associated mutations in insecticide target genes? Philosophical Transactions Of The Royal Society Of London Series B-Biological Sciences 353, 1685-1693. FISHER, R. A. (1930). The Genetical Theory of Natural Selection Claredon, Oxford. FISHMAN, L., KELLY, A. J. & WILLIS, J. H. (2002). Minor quantitative trait loci underlie floral traits associated with mating system divergence in Mimulus. Evolution 56, 2138-2155. FLINT, J. & MOTT, R. (2001). Finding the molecular basis of quantitative traits: Successes and pitfalls. Nature Reviews Genetics 2, 437-445. FRARY, A., NESBITT, T. C., FRARY, A., GRANDILLO, S., VAN DER KNAAP, E., CONG, B., LIU, J. P., MELLER, J., ELBER, R., ALPERT, K. B. & TANKSLEY, S. D. (2000). fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289, 85-88. FRIDMAN, E., LIU, Y. S., CARMEL-GOREN, L., GUR, A., SHORESH, M., PLEBAN, T., ESHED, Y. & ZAMIR, D. (2002). Two tightly linked QTLs modify tomato sugar content via different physiological pathways. Molecular Genetics and Genomics 266, 821826. GIBERT, J. M., MARCELLINI, S., DAVID, J. R., SCHLOTTERER, C. & SIMPSON, P. (2005). A major bristle QTL from a selected population of Drosophila uncovers the zincfinger transcription factor Poils-au-dos, a repressor of achaete-scute. Developmental Biology 288, 194-205. GILBERT, S. F. (2003). The morphogenesis of evolutionary developmental biology. International Journal Of Developmental Biology 47, 467-477. GILBERT, S. F. & BURIAN, R. M. (2003). Development, evolution, and evolutionary developmental biology. In: Keywords and concepts in evolutionary developmental biology (B. K. Hall & W. M. Olson, eds). Harvard University Press, Cambridge, MA. GLAZIER, A. M., NADEAU, J. H. & AITMAN, T. J. (2002). Finding genes that underlie complex traits. Science 298, 2345-2349. GRANDILLO, S., KU, H. M. & TANKSLEY, S. D. (1999). Identifying the loci responsible for natural variation in fruit size and shape in tomato. Theoretical and Applied Genetics 99, 978-987. GRIFFITHS, A. J. F., WESSLER, S. R., LEWONTIN, R. C., GELBART, W. M., SUZUKI, D. T. & MILLER, J. H. (2005). Introduction to genetic analysis. W.H. Freeman and Company, New York, NY. GURGANUS, M. C., NUZHDIN, S. V., LEIPS, J. W. & MACKAY, T. F. C. (1999). Highresolution mapping of quantitative trait loci for sternopleural bristle number in Drosophila melanogaster. Genetics 152, 1585-1604.

11

HARR, B., WEISS, S., DAVID, J. R., BREM, G. & SCHLOTTERER, C. (1998). A microsatellitebased multilocus phylogeny of the Drosophila melanogaster species complex. Current Biology 8, 1183-1186. HARTL, D. L., & E. W. JONES. (2004). Genetics: Analysis of Genes and Genomes. Jones and Bartlett, Sudbury, MA. HEY, J. & KLIMAN, R. M. (1993). Population-Genetics And Phylogenetics Of DnaSequence Variation At Multiple Loci Within The Drosophila-Melanogaster Species Complex. Molecular Biology And Evolution 10, 804-822. HOEKSTRA, H. E. (2006). Genetics, development and evolution of adaptive pigmentation in vertebrates. Heredity 97, 222-234. HOEKSTRA, H. E. & COYNE, J. A. (2007). The locus of evolution: Evo devo and the genetics of adaptation. Evolution 61, 995-1016. HOEKSTRA, H. E. & NACHMAN, M. W. (2003). Different genes underlie adaptive melanism in different populations of rock pocket mice. Molecular Ecology 12, 1185-1194. JOHNSON, N. A. & PORTER, A. H. (2001). Toward a new synthesis: population genetics and evolutionary developmental biology. Genetica 112, 45-58. JOHNSON, T. & BARTON, N. (2005). Theoretical models of selection and mutation on quantitative traits. Philosophical Transactions Of The Royal Society BBiological Sciences 360, 1411-1425. KERJE, S., CARLBORG, O., JACOBSSON, L., SCHUTZ , K., HARTMANN, C., JENSEN, P. & ANDERSSON, L. (2003). The twofold difference in adult size between the red junglefowl and White Leghorn chickens is largely explained by a limited number of QTLs. Animal Genetics 34, 264-274. KLIMAN, R. M., ANDOLFATTO, P., COYNE, J. A., DEPAULIS, F., KREITMAN, M., BERRY, A. J., MCCARTER, J., WAKELEY, J. & HEY, J. (2000). The population genetics of the origin and divergence of the Drosophila simulans complex species. Genetics 156, 1913-1931. LACHAISE, D., CARIOU, M. L., DAVID, J. R., LEMEUNIER, F., TSACAS, L. & ASHBURNER, M. (1988). Historical Biogeography Of The Drosophila-Melanogaster Species Subgroup. Evolutionary Biology 22, 159-225. LACHAISE, D., HARRY, M., SOLIGNAC, M., LEMEUNIER, F., BENASSI, V. & CARIOU, M. L. (2000). Evolutionary novelties in islands: Drosophila santomea, a new melanogaster sister species from Sao Tome. Proceedings Of The Royal Society Of London Series B-Biological Sciences 267, 1487-1495. LACHAISE, D. & SILVAIN, J. F. (2004). How two Afrotropical endemics made two cosmopolitan human commensals: the Drosophila melanogaster-D.simulans palaeogeographic riddle. Genetica 120, 17-39. LANDER, E. S. & BOTSTEIN, D. (1989). Mapping Mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics 121, 185-199. LAUBICHLER, M. D. (2003). Editorial: A new series of vignettes on the history of evolutionary developmental biology. Journal Of Experimental Zoology Part BMolecular And Developmental Evolution 299B, 1-2. LETSOU, A. & BOHMANN, D. (2005). Small flies - Big discoveries: Nearly a century of Drosophila genetics and development. Developmental Dynamics 232, 526528. LIU, B.-H. (1998). Statistical genomics: linkage, mapping, and QTL analysis. CRC Press LLC, Boca Raton, Florida. LOVE, A. C. (2003). Evolutionary morphology, innovation, and the synthesis of evolutionary and developmental biology. Biology & Philosophy 18, 309-345. LYNCH, M., AND B. WALSH. (1998). Genetics analysis of quantitative traits. Sinauer, Sunderland, MA.

12

MACDONALD, S. J. & LONG, A. D. (2004). A potential regulatory polymorphism upstream of hairy is not associated with bristle number variation in wild-caught drosophila. Genetics 167, 2127-2131. MACKAY, T. E. C. & ANHOLT, R. R. H. (2006). Of flies and man: Drosophila as a model for human complex traits. Annual Review of Genomics and Human Genetics 7, 339-367. MACKAY, T. F. C. (1996). The nature of quantitative genetic variation revisited: Lessons from Drosophila bristles. Bioessays 18, 113-121. . (2001). The genetic architecture of quantitative traits. Annual Review Of Genetics 35, 303-339. MACKAY, T. F. C. & LYMAN, R. F. (2005). Drosophila bristles and the nature of quantitative genetic variation. Philosophical Transactions Of The Royal Society B-Biological Sciences 360, 1513-1527. MCGREGOR, A. P., ORGOGOZO, V., DELON, I., ZANET, J., SRINIVASAN, D. G., PAYRE, F. & STERN, D. L. (2007). Morphological evolution through multiple cis-regulatory mutations at a single. Nature 448, 587-U6. NADEAU, J. H. (2001). Modifier genes in mice and humans. Nature Reviews Genetics 2, 165-174. ORR, H. A. (2000). Adaptation and the cost of complexity. Evolution 54, 13-20. . (2005a). The genetic theory of adaptation: A brief history. Nature Reviews Genetics 6, 119-127. . (2005b). Theories of adaptation: what they do and don't say. Genetica 123, 3-13. OTTO, S. P. (2004). Two steps forward, one step back: the pleiotropic effects of favoured alleles. Proceedings Of The Royal Society Of London Series B-Biological Sciences 271, 705-714. OTTO, S. P. & JONES, C. D. (2000). Detecting the undetected: Estimating the total number of loci underlying a quantitative trait. Genetics 156, 2093-2107. PATERSON, A. H., LIN, Y. R., LI, Z. K., SCHERTZ, K. F., DOEBLEY, J. F., PINSON, S. R. M., LIU, S. C., STANSEL, J. W. & IRVINE, J. E. (1995). Convergent Domestication Of Cereal Crops By Independent Mutations At Corresponding Genetic-Loci. Science 269, 1714-1718. PROTAS, M. E., HERSEY, C., KOCHANEK, D., ZHOU, Y., WILKENS, H., JEFFERY, W. R., ZON, L. I., BOROWSKY, R. & TABIN, C. J. (2006). Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature Genetics 38, 107111. RAFF, R. A. & LOVE, A. C. (2004). Kowalevsky, comparative evolutionary embryology, and the intellectual lineage of Evo-devo. Journal Of Experimental Zoology Part B-Molecular And Developmental Evolution 302B, 19-34. ROBIN, C., LYMAN, R. F., LONG, A. D., LANGLEY, C. H. & MACKAY, T. F. C. (2002). hairy: A quantitative trait locus for Drosophila sensory bristle number. Genetics 162, 155-164. ROCKMAN, M. V. & STERN, D. L. (2008). Tinker where the tinkering's good. Trends In Genetics 24, 317-319. SIMPSON, P. (2002). Evolution of development in closely related species of flies and worms. Nature Reviews Genetics 3, 907-917. SOLIGNAC, M. & MONNEROT, M. (1986). Race Formation, Speciation, And Introgression Within Drosophila-Simulans, Drosophila-Mauritiana, And Drosophila-Sechellia Inferred From Mitochondrial-Dna Analysis. Evolution 40, 531-539. STERN, D. L. (1998). A role of Ultrabithorax in morphological differences between Drosophila flies. Nature 396, 463-466. . (2000a). Evolutionary biology - The problem of variation. Nature 408, 529-531.

13

. (2000b). Perspective: Evolutionary developmental biology and the problem of variation. Evolution 54, 1079-1091. . (2003). The Hox gene Ultrabithorax modulates the shape and size of the third leg of Drosophila by influencing diverse mechanisms. Developmental Biology 256, 355-366. STERN, D. L. & ORGOGOZO, V. (2008). The loci of evolution: How predictable is genetic evolution ? Evolution 62, 2155-2177. . (2009). Is Genetic Evolution Predictable? Science 323, 746-751. SUCENA, E., DELON, I., JONES, I., PAYRE, F. & STERN, D. L. (2003). Regulatory evolution of shavenbaby/ovo underlies multiple cases of morphological parallelism. Nature 424, 935-938. TANKSLEY, S. D. (1993). Mapping polygenes. Annual Review of Genetics 27, 205233. . (2004). The genetic, developmental, and molecular bases of fruit size and shape variation in tomato. Plant Cell 16, S181-S189. TRUE, J. R., LIU, J. J., STAM, L. F., ZENG, Z. B. & LAURIE, C. C. (1997). Quantitative genetic analysis of divergence in male secondary sexual traits between Drosophila simulans and Drosophila mauritiana. Evolution 51, 816-832. TSAKAS, S. C. & TSACAS, L. (1984). A Phenetic Tree Of 18 Species Of The Melanogaster Group Of Drosophila Using Allozyme Data As Compared With Classifications Based On Other Criteria. Genetica 64, 139-144. TURELLI, M. (1985). Effects of pleiotropy on predictions concerning mutation-selection balance for polygenic traits. Genetics 111, 165-195. VERGARA-SILVA, F. (2003). Plants and the conceptual articulation of evolutionary developmental biology. Biology & Philosophy 18, 249-284. WAGNER, G. P. & ALTENBERG, L. (1996). Perspective: Complex adaptations and the evolution of evolvability. Evolution 50, 967-976. WAGNER, G. P., KENNEY-HUNT, J. P., PAVLICEV, M., PECK, J. R., WAXMAN, D. & CHEVERUD, J. M. (2008). Pleiotropic scaling of gene effects and the 'cost of complexity'. Nature 452, 470-U9. WELCH, J. J. & WAXMAN, D. (2003). Modularity and the cost of complexity. Evolution 57, 1723-1734. WESTERBERGH, A. & DOEBLEY, J. (2002). Morphological traits defining species differences in wild relatives of maize are controlled by multiple quantitative trait loci. Evolution 56, 273-283. ZENG, Z. B., KAO, C. H. & BASTEN, C. J. (1999). Estimating the genetic architecture of quantitative traits. Genetical Research 74, 279-289. ZENG, Z. B., LIU, J. J., STAM, L. F., KAO, C. H., MERCER, J. M. & LAURIE, C. C. (2000). Genetic architecture of a morphological shape difference between two drosophila species. Genetics 154, 299-310.

14

SECTION I E VO LUTION T HROUGH T HE EYE OF A F LY

15

CHAPTER 1

A P RI M ER

TO TH E

S TU DY

O F TH E

G E N E TI CS
IN

OF

EYE SIZE

AND

S HA PE V A R I ATI O N

D ROSO PH IL A

16

ABSTRACT
To generate a comprehensive understanding of the mechanisms underlying morphological evolution we need to characterize and identify genetic changes responsible for phenotypic variation. The eye is a complex morphological structure that has diversified into a large array of types to fit the lifestyle of its bearer. Within the melanogaster species subgroup, Drosophila mauritiana has larger eyes (about 30% more ommatidia) than its sibling species Drosophila simulans. Here I present two different approaches to quantifying variation in eye size and shape and rough quantitative trait locus (QTL) maps for the X chromosome. First, a preliminary analysis using simple linear measures revealed that the eyes of D. mauritiana are longer and wider than the eyes of D. simulans and that this difference is particularly pronounced in the males. In a small backcross population eye width mapped to the same location as in a previous publication mapping ommatidia number differences between these species. Second, using a MatLab based software I quantified eye size and shape variation applying principal component analysis in two large backcross populations. Five different models were built using these data and the resulting PC values were used as phenotypes in QTL mapping. In all models a large percent of the variation is due to photography artifacts or digitizing error. Most of the remaining PCs within the 95% variation affect eye size and shape and map to the X chromosome. While both phenotyping methods yield a significant association with markers on the X chromosome, both have caveats that should be considered in further mapping. Identifying the genetic basis of morphological differences between closely related taxa might help us to better understand patterns of morphological evolution. Such studies are likely to pinpoint important mechanisms generating variation in morphological characters from a conserved set of genes. 17

INTRODUCTION A large fraction of morphological diversity both within and between species involves variation in size and shape. Despite their prevalence, surprisingly little is known about the genetic basis of variation in these characters (Liu et al., 1996; Laurie et al., 1997; Zeng et al., 2000; Zimmerman et al., 2000; Klingenberg & Leamy, 2001; Klingenberg, 2002; Albertson et al., 2003; Tanksley, 2004; Albertson & Kocher, 2006). This can be explained in part by the difficulty of devising and adequate yet economical method to quantify the phenotype, particularly in the case of shape (Liu et al., 1996; Coen et al., 2004). Yet elucidating the number, nature and effect of the genes underlying such diversity will lead to important insights into the mechanisms of evolutionary processes driving the generation and diversification of complex phenotypes. In this chapter I characterize differences in eye size and shape between the sister species Drosophila simulans and Drosophila mauritiana and generate a rough QTL map of the X chromosome. The mapping of genetic factors responsible for morphological evolution is particularly successful in closely related species that can still be hybridized (Sucena & Stern, 2000; Zeng et al., 2000) such as D. simulans and D. mauritiana. D. mauritiana has approximately 30% more ommatidia than Drosophila simulans and D. melanogaster (994 vs 726 ommatidia on average) (Hammerle & Ferrus, 2003) thus subtly modifying its overall size and shape. Also, in Drosophila eye development has been extensively studied so that entire pathways and their mechanisms are known facilitating the study of how such processes might be modified to generate variation in size and shape. In addition, eye characteristics are clearly adaptive features: eye morphology and 18

physiology generally correlate with specific niche demands (Land & Fernald, 1992; Jonson et al., 1998; Land et al., 1999; Land, 2002). So the differences in eye size and shape between Drosophila species are likely to have evolved through natural selection.

Table 1: Summary of morphological measurements for the species studied and their hybrids. A
total of 211 individuals were included.
n D. mauritiana females D. mauritiana males D. simulans females D. simulans males Backcross to D. simulans (males) (males) 15 29 15 30 41 Wing Size SE Average Eye Length SE 676.70 7.03 278.79 5.89 600.33 3.75 276.71 2.60 720.93 6.27 610.89 5.51 698.00 3.42 705.30 4.33 266.67 4.41 215.63 7.36 270.46 2.15 272.25 2.15 Average Eye Width SE 135.88 2.54 138.97 2.9 112.81 1.50 112.62 2.91 135.55 1.41 133.76 1.27 Distance between Eyes SE 180.80 4.23 161.91 2.34 200.90 6.23 174.22 2.43 178.12 1.65 179.32 2.21

Backcross to D. mauritiana 75

Size and shape variation between species is generally polygenic and as such it is usually studied through quantitative trait locus (QTL) analysis (e.g. Liu et al., 1996; True et al., 1997; Bradshaw et al., 1998; Grandillo et al., 1999; Zeng et al., 2000; Klingenberg & Leamy, 2001; Albertson et al., 2005; Long et al., 2006; Bergland et al., 2008). The generation of a QTL map is frequently followed by higher resolution mapping approaches [for example, marker-assisted meiotic recombination mapping (e.g. Orgogozo et al., 2006), nearly isogenic lines (NILs) (e.g. Frary et al., 2000), deletion mapping (Presgraves, 2003), germline transformation (e.g. Jeong et al., 2008)] to identify individual genes and nucleotide changes within them responsible for phenotypic change.

19

An important first consideration for the genetic mapping of size and shape variation is how to quantify the trait. Proper measurement is essential for both the accuracy and resolution of the QTL map and later for detecting individual genes in high-resolution mapping. One obvious option in a regular lattice such as the eye is to count ommatidia and assess their distribution, but doing so in the large sample size needed for QTL mapping makes it unpractical. A second option is to use simple measurements such as width or length (e.g. Tanksley, 2004), and though easily captured, it is likely some of the intricate variation in a complex character such as eye size/shape might be missed. A third method, used successfully to quantify and map the genetic effects of shape variation in other complex morphological structures involves geometric morphometrics (Zimmerman et al., 2000; Klingenberg et al., 2001) or elliptic Fourrier analysis (Rohlf & Archie, 1984; Liu et al., 1996; Zeng et al., 2000). Though such analyses generate richer data sets and more detailed quantifications of shape variation, the large volume of data and correlation between different factors does not identify the best variable(s) for mapping. However, a combination of such shape analyses and principal component analysis (PCA) facilitates the process by reducing a large set of correlated variables into independent axes of variation while identifying the major sources of variation. Here I use both simple linear measurements and PCA of coordinates outlining the eye to quantify variation in eye size and shape in D. simulans, D. mauritiana, and their hybrids to determine what is the best method to use in QTL analysis. Eye width 20

appears to be sufficient to generate a significant association with visible markers on the X, but photography artifacts generate a large error that could hinder high-resolution mapping. PCA reveals that the variation between the species variation in eye size/shape is much richer than simple linear measurements captured and can easily correct for photography artifacts. Most PCs describing eye size/shape variation map to one of markers on the X. However, it is not clear what principal component should be used for further mapping as no PC discriminates fully between D. simulans and D. mauritiana and the basic map for any PC is not consistent in the reciprocal backcrosses.

Table 2: Scaling relationships for both males and females of the three head/eye variables
(based on wing length as the independent variable).
Species D. mauritiana D. mauritiana D. mauritiana D. simulans D. simulans D. simulans Dependent Distance Between Eyes Eye Length Eye Width Distance Between Eyes Eye Length Eye Width slope 0.25 0.14 -0.03 0.23 0.56 0.01 SE 0.05 0.06 0.06 0.05 0.07 0.03 r 0.42 0.13 0.01 0.41 0.63 0.01
2

P <0.001 <0.05 NS <0.001 <0.001 NS

MATERIALS AND METHODS

DROSOPHILA STRAINS Initial basic analysis For the scaling analyses, I used stock number 14021-0251.146 for D. simulans (y, v, f bb, Drosophila Species Stock Center), and stock 14021-0241.01 for D. mauritiana (Drosophila Species Stock Center). Formal multidimensional analysis I used stock number 14021-0251.147 for D. simulans (y, v, f bb, Drosophila Species Stock Center), and stock G105 D. mauritiana obtained from C. I. Wu. To look at variability in eye size and shape within the melanogaster species subgroup, I also used 21

stock number 14021-0261.00 (Drosophila Species Stock Center) for D. yakuba, stock number 14021-0271.00 (Drosophila Species Stock Center) for D. santomea, stock number 14021-0248.07 for D. sechellia (Drosophila Species Stock Center), and a wild isolate for D. melanogaster collected in Beltsville, MD part of the Stern lab collection. All flies were maintained on standard media enriched with live yeast in an incubator at 25C.

CROSSES To generate a backcross population for QTL analysis, virgin D. simulans females were crossed in groups of 6-10 to twice as many D. mauritiana males. F1 females were then crossed in groups of 6-10 to either twice as many D. simulans males or D. mauritiana males. PHENOTYPING
Basic preliminary analysis

Linear measurements of general morphology: I examined variation in wing length as a proxy for body size, eye width, length and distance between the eyes in D. simulans, D. mauritiana and their hybrids (Figure 1). The analysis was performed on wing and rostral

22

pictures of the severed head taken with a digital camera (Photometrics Coolsnap cf) connected to a Nikon E 1000 microscope at 40x. Linear measurements were obtained using the software tpsDIG version XX (F. J. Rohlf, available online at http://life.bio.sunysb.edu/morph/soft-dataacq.html).

Statistical analyses: Allometric relationships between body size, head and eye size were examined using linear regressions (linear least-squares) after log10 transforming all data as it is standard in scaling studies. To control for body size and thus compare variation in head and eye shape between species I used the residuals of these linear regressions. All statistical analyses were conducted on SYSTAT (version 10, SPSS 2000). Formal multidimensional analysis Measurements: To be able to capture the overall variation in eye size and shape in D. simulans and D. mauritiana I implemented a MatLab based software, the AAM Toollbox package, designed to build and visualize statistical models of shape and appearance using principal component analysis (available at http://www2.cmp.uea.ac.uk/~aih/). This software allows distinguishing biological relevant variation from non-biological variation resulting from positional or photographical effects common when working with live animals as in this case. Up to five individual flies at a 23

time were positioned on their side on small depressions carved on 4% 5mm x 3mm x 30mm apple juice/agar strips while anesthesized with CO2. I then captured an image of rostral view of the head with a digital camera (Photometrics Coolsnap cf) connected to a Nikon E 1000 microscope at 40x. The final image is the result of the combination (3D extended focus) of snapshots taken every 5 microns by programming the Z-stage with the help of IPlab software (version 3.9.4 r2), so that the whole head appears in focus. Light conditions were kept constant with a ring light attached to the microscopes objective. To quantify the variation in eye size and shape, each image was digitized

using the MatLab based software described above. I first created a point model template (Figure 2) using the Point Model Editor in the AAM ToolBox package. The 42 points capture the overall size and shape variation in the head and eyes. On the basis of these templates, corresponding points were placed on the images of individual flies of interest. Statistical analyses: I generated statistical models of size and shape using principal components analysis (Stats Model Generator in the AAM Toolbox). These models are based on the variation after alignment of the multi-dimensional coordinates of the points from the point model. The resulting principal components (PCs) can be visualized as

24

videos showing the variation across their axis ( 2 standard deviations) (Figure 3). I conducted six different analyses: 1) Backcross to D. simulans: in this model I included three groups, male D. simulans (n=50), male D. mauritiana (n=50), and male hybrids resulting from the backcross of F1 females to D. simulans (n=430). The statistical model was based solely on the hybrids, while the parentals were simply projected onto this multi-dimensional space. 2) Scaled backcross to D. simulans: the model includes the same groups as analysis (1), but this time a procrustes correction for size was included thus eliminating the effect of body size.

3) Backcross to D. mauritiana: in this model I included three groups, male D. simulans (n=50), male D. mauritiana (n=50), and male hybrids resulting from the backcross of F1 females to D. mauritiana (n=430). The statistical model was based solely on the hybrids, while the parentals were simply projected onto this multi-dimensional space.

25

4) Scaled backcross to D. mauritiana the model includes the same groups as analysis (3), but this time a procrustes correction for size was included thus eliminating the effect of body size. 5) A combination of both backcross populations: in this model I included four groups, male D. simulans (n=50), male D. mauritiana (n=50), male hybrids resulting from the backcross of F1 females to D. simulans (n=430), and male hybrids resulting from the backcross of F1 females to D. mauritiana (n=430). The statistical model was based solely on the hybrids, while the parentals were simply projected onto this multi-dimensional space. 6) Variation of eye size and shape in the melanogaster species subgroup: in this model I analyzed variation across males of 6 different species, D. melanogaster (n=5), D. simulans (n=20), D. mauritiana (n=20), D. sechellia (n=20), D. yakuba (n=20), and D. santomea (n=20). All 6 groups were used to generate the statistical model. All figures for these analyses were made with MatLab 7.0.2. (MathWorks). GENOTYPING Only the four visible markers (y, v, f for the basic analysis and y, v, f, bb for the formal analysis) on the X chromosome from the D. simulans parental strains were used for genotyping. However, phenotyped backcross individuals from the formal multidimensional analysis were kept at -20C for further genotyping in the future. QTL ANALYSIS Basic preliminary analysis: using QTL cartographer (version 1.17), I mapped eye width variation based on the segregation on 3 visible markers on the X chromosome (y, v, f). The analysis was performed on small backcross populations (backcross to D. simulans n=42, backcross to D. mauritiana n=45). 26

Table 3: Scaling relationships between head and eye variables (corrected for body size) in
males of D. simulans and D. mauritiana.
Species D. mauritiana D. mauritiana D. mauritiana D. simulans D. simulans D. simulans Independent Eye Length Distance Between Eyes Distance Between Eyes Eye Length Distance Between Eyes Distance Between Eyes Dependent Slope SE r P Eye Width 0.54 0.18 0.34 <0.01 Eye Length 0.68 0.22 0.00 NS Eye Width -0.30 0.21 0.10 NS Eye Width -0.03 0.07 0.01 NS Eye Length 1.60 0.55 0.26 <0.01 Eye Width -0.29 0.20 0.12 NS
2

Formal

multidimensional analysis: composite interval mapping was performed using R/qtl (Broman et al., 2003) and was based on the segregation on 4 visible markers on the X chromosome (y, v, f, bb). The most relevant principal components were used as phenotypes. Statistical significance was calculated using permutation analysis (Churchill & Doerge, 1994). I carried out a separate QTL mapping for each of the statistical models 1 through 5 described above. For analysis 5, though the PCs were generated by combining both backcross populations, the QTL map was performed on each population separately.

27

RESULTS
BASIC PRELIMINARY ANALYSIS OF EYE SIZE AND SHAPE VARIATION BETWEEN D. SIMULANS
AND

D. MAURITIANA

I found differences in body size associated with species and sex: D. simulans is in general larger than D. mauritiana; also, as is the general case in Drosophila, the strains studied show reverse sexual size dimorphism. All variables, but eye width, follow theses trends suggesting a strong association with body size (Table 1). Scaling analyses show indeed a significant association of body size with eye length and distance between the eyes but not eye width in both species (Table 2). The relationship in both cases is hypoallometric (Table 2). Correcting for body size, D. mauritiana has the longest and widest eyes in both sexes. D. mauritiana females have eyes approximately 12% longer and wider than D. simulans females, while the difference between the males is approximately 50%. Also, eye size is a dimorphic trait in D. mauritiana: the eyes of males are 12% longer and 15% wider than those of females, while in D. simulans the eyes of the two sexes are not significantly different. There are no strong relationships between the three variables for head and eye shape consistent between the two species (Table 3). Yet in D. mauritiana, eye length and eye width are correlated, while in D. simulans eye length and distance between the eyes are correlated (Table 3). A QTL analysis on eye width yielded a significant result for the marker forked on the backcross to D. mauritiana but not D. simulans (Table 4).

28

Table 4: results from a basic QTL analysis of eye width on the backcross to D. mauritiana
(males only, n=45).
Marker b0 b1 2ln(L0/L1) F(1,n-2) y 131.401 -4.096 1.277 1.238 v 131.102 -6.603 3.042 3.007 f 128.843 -13.444 21.575 26.452 P 0.272 0.09 >0.001

MULTI-DIMENSIONAL ANALYSIS OF EYE SIZE AND SHAPE VARIATION BETWEEN D. SIMULANS

AND

D. MAURITIANA

Individual models:

1) Backcross to D. simulans PCs 1-9 represent 95% of the total variation in the model. Approximately 66.8% of the variation, primarily represented by 3 PCs (1,2 and 4), was considered the result of photography artifacts or digitizing error (Table 5). The 6 remaining PCs clearly affect eye size and shape and map to one of the four markers on the X chromosome used in the QTL analysis (Table 5). Three of these PCs (3, 5 and 6) explain 79.1% of the biological variation in the model (Figure 4). All three show significant overlap between the parental species even though the means for each are in some cases more than 2 standard deviations (SD) apart (PC3: 1.5 SD, PC5: 3SD, PC6: 0.7 SD), and even though these PCs explain most of the difference in terms of Eucledian distance between D. simulans and D. mauritiana (Table 5). Only by combining the three PCs (Figure 4D) it is possible to obtain a good, but not complete, resolution between the species. In PC3 and 5, the backcross population presents transgressive variation; i.e. the range of the data is larger than in either parental species (Figure 4). Except for PC3, the mean of the backcross population is closer to the mean of D. simulans than to the mean of D. mauritiana as expected (Figure 4). PC3 is correlated with body size (using wing length as a proxy, Figure 1) (n = 25, r2 = 0.2, P<0.05).

29

2) Backcross to D. simulans (corrected for body size) PCs 1-10 represent 95% of the total variation in the model. Approximately 86% of the variation, primarily represented by 3 PCs (1,2 and 3), was considered the result of photography artifacts or digitizing error (Table 6). All of the remaining PCs clearly affect eye size and shape (Table 6). Within these relevant PCs, 6 (86%) map to one of the four markers on the X chromosome used in the QTL analysis (Table 6). Three of these PCs (4, 5 and 6) explain 53.6% of the biological variation in the model (Figure 5). All three show almost complete overlap between the parental species even though the means for each are in some cases more than 2SD apart (PC4: 2 SD, PC5: 1.2SD, PC6: 3 SD), and even though these PCs explain most of the difference in terms of Eucledian distance between D. simulans and D. mauritiana (Table 6). Only by combining the three PCs (Figure 5D) it is possible to obtain a good, but not complete, resolution between the species. In PC4 and 6, the backcross population presents transgressive variation. Except for PC4, the mean of the backcross population is closer to the mean of D. simulans than to the mean of D. mauritiana as expected.

30

Table 5: Summary of PCA results and QTL analysis for the backcross to D. simulans. PC 1-9 explain 95% of the total variation. Together, the
PCs presenting significant LOD values explain 84.6% of the biological variation, and 91% of the Eucledian distance between the mean D. mauritiana and D. simulans in multidimensional space. Note however that most of the biological variance is due to PC3, and most of the Eucledian distance between the parentals is accounted by PC 3 and 5.

PC 1 2 3 4 5 6 7 8 9 other

Effect rotation back-front rotation left-right overall eye size/bulginess asymmetry eye top-tier shape eye shape/width eye shape eye shape eye shape various

Tot. Variance explained (%) 38.7 24 22.2 4.1 2.5 1.7 0.9 0.6 0.3 5

Biological variance explained 1 (%) 0 0 66.5 0 7.5 5.1 2.7 1.8 1 5.4

Eucledian distance between parental species 2 explained (%) 10 3 35 0 30 4 7 8 0 3

LOD scores y v f bb

4.27 1.08 3.42 1.56 2.3 4.42 2.3 3.33 4 2.43

1.13

After eliminating PCs that are clearly an artifact of the photography; i.e. indicating variation in the positioning of the head or rotation or digitizing error; i.e. pints

moving in discordance generating asymmetry or unrealistic deformities.

2 3

The distance moved on each PC to move from the mean of D. simulans to the mean D. mauritiana in multidimensional space. Significance threshold = 1 (based on permutation analysis, Churchill and Doerge, 1994)

31

3) Backcross to D. mauritiana: PCs 1-8 represent 95% of the total variation in the model. Approximately 57.6% of the variation, primarily represented by 5 PCs (1, 3 and 5-7), was considered the result of photography artifacts or digitizing error (Table 7). The three remaining PCs (2, 4 and 8) clearly affect eye size and shape and map to one of the four markers on the X chromosome used in the QTL analysis (Table 7). These PCs explain 88.4% of the biological variation in the model (Figure 6). All three complete overlap between the parental species (Figure 6), even though these 3 PCs account for 75% of the Eucledian distance between D. simulans and D. mauritiana (Table 7). In all three cases, the mean of the parental species is very close to the mean of the backcross population (0 in all cases as the PCA is based on this population). Even combining the three PCs (Figure 6D) it is not possible to obtain a good resolution between the species. In all three PCs, the backcross population presents some degree of transgressive variation (Figure 6). PC2 is correlated with body size (using wing length as a proxy, Figure 1) (n = 25, r2 = 0.6, P<0.001) 4) Backcross to D. mauritiana (corrected for body size) PCs 1-9 represent 95% of the total variation in the model. Approximately 83.4% of the variation, primarily represented by 3 PCs (1, 2 and 4), was considered the result of photography artifacts or digitizing error (Table 8). Of the remaining PCs, 5 (83.3%) clearly affect eye size and shape. Within these relevant PCs, 4 (80%) map to one of the four markers on the X chromosome used in the QTL analysis (Table 8). Three of these PCs (3, 6 and 7) explain 52.3% of the biological variation in the model (Figure 7). Except for PC7, the range of the data shows partial overlap between the parental species though the means are always far apart (PC: 3 1.5 SD, PC 6: 3 SD, PC 7: 3.5 SD). In all three PCs, the mean of the backcross population is closer to the mean of D. mauritiana than to the mean of D. simulans as expected. When combining the three PCs 32

Table 6: Summary of PCA results corrected for body size and QTL analysis for the backcross to D. simulans. PC 1-10 explain 95% of the total
variation. Together, the PCs presenting significant LOD values explain 82% of the biological variation, and 66.4% of the Eucledian distance between the mean D. mauritiana and D. simulans in multidimensional space. Note however that most of the biological variance is due to PC4 and 5, and most of the Eucledian distance between the parentals is accounted by PC 4 and 6.

PC 1 2 3 4 5 6 7 8 9 10 other

Effect rotation back-front rotation left-right asymmetry eye top-tier shape/forehead width eye width eye roundness eye shape eye shape eye shape eye shape various

Tot. Variance explained (%) 49.1 31.4 5.5 4.2 2.1 1.2 0.8 0.5 0.2 <0.1 5

Biological variance 1 explained (%) 0 0 0 30 15 8.6 5.7 3.6 1.4 0.7 35

Eucledian distance between parental 2 species explained (%) 20 5.8 0 42.2 6 12.5 4.8 0.2 0.3 0.1 8.1

LOD scores y v f bb

3.36 3.61 1.87 2.00 2.05 2.79

1.94

2.14 1.49

After eliminating PCs that are clearly an artifact of the photography; i.e. indicating variation in the positioning of the head or rotation or digitizing error; i.e. pints moving in discordance

generating asymmetry or unrealistic deformities.

2

The distance moved on each PC to move from the mean of D. simulans to the mean D. mauritiana in multidimensional space. Significance threshold = 1 (based on permutation analysis, Churchill and Doerge, 1994).

33

(Figure 7D) the two parental species fall in distinct, barely overlapping clouds, while the backcross to D. mauritiana encapsulates most of the range of D. mauritiana. In all three PCs however, the backcross population presents transgressive variation. These three PCs explain together only 37.4 % of the difference in terms of Eucledian distance between D. simulans and D. mauritiana, while the 3 PCs (1, 2 and 4), considered the result of photography artifacts or digitizing error explain 57.5% of the Eucledian distance between the parental species in this model (Table 8).

5) A combination of both backcross populations: PCs 1-9 represent 95% of the total variation in the model. Approximately 84.8% of the variation, primarily represented by 4 PCs (1, 2, 4 and 9), was considered the result of photography artifacts or digitizing error (Table 9). All of the remaining PCs clearly affect eye size and shape. Within these relevant PCs, 4 (80%) map to one of the four markers on the X chromosome used in the QTL analysis (Table 9). One of these PCs map in one backcross but not the other or just marginally (3 and 8), and in the remaining there

34

Table 7: Summary of PCA results and rough QTL analysis for the backcross to D. mauritiana. PC 1-8 explain 95% of the total variation. Together,
the PCs presenting significant LOD values explain 98.2% of the biological variation, and 77.3% of the Eucledian distance between the mean D. mauritiana and D. simulans in multidimensional space. Note however that most of the biological variance is due to PC2, and most of the Eucledian distance between the parentals is accounted by PC 2 and 4.

PC 1 2 3 4 5 6 7 8 other

Effect rotation back-front overall head and eye size/eye to-tier shape rotation left-right eye top-tier width/forehead width asymmetry asymmetry asymmetry eye roundness various

Tot. variance explained (%) 38 33 15.1 3.6 2.1 1.4 1 0.9 5

Biological variance 1 explained (%) 0 77.8 0 8.5 0 0 0 2.1 11.6

Euclidean distance between parental 2 species explained (%) 4 38 5 12 2 3 5 25 6

LOD scores y v 3.94 1.42 1.27 f bb

1.29

1.17 2.04

After eliminating PCs that are clearly an artifact of the photography; i.e. indicating variation in the positioning of the head or rotation or digitizing error; i.e. pints moving in discordance

generating asymmetry or unrealistic deformities.

2

The distance moved on each PC to move from the mean of D. simulans to the mean D. mauritiana in multidimensional space. Significance threshold = 1(based on permutation analysis, Churchill and Doerge, 1994).

35

is often a disagreement in the markers showing a significant LOD (Table 9). Three of the PCs mapping in both populations (3, 5 and 6) explain most of the biological variation and Eucledian distance between the parental species in the model (Figure 8). All three present a significant overlap between the parental species despite the means for each being in some cases more than 2SD apart (PC 3: 1.7 SD, PC5: 3.2 SD, PC 6: 1.5 SD), and despite of these PCs explaining most of the difference in terms of Eucledian distance between D. simulans and D. mauritiana (Table 9). Combining the three PCs (Figure 8D) it is possible to obtain a complete resolution between the species. The average shape for D. simulans and D. mauritiana when considering only the combination of these three PCs is a good representation of the main size and shape differences between these two species (Figure 9). The backcross populations present transgressive variation in most instances (except for the backcross to D. simulans in PC5), though in general the backcross to D. mauritiana presents higher variation than any of the other groups (Figure 8). In all three cases, the mean of the each backcross population is closer to the mean of the respective parental species as expected. For comparison, plots of the three PCs explaining most non-biological variation show both parental species and the two backcross populations with practically indistinct mean and ranges (Figure 10) so that a in 3D plot the clouds overlap completely. All four groups show similar cloud shapes, while the backcross to D. mauritiana has the highest variation and thus encapsulates the other three groups (Figure 10D). 5) Variation of eye size and shape in the melanogaster species subgroup PCs 1-10 represent 95% of the total variation in the model (Table 10). Approximately 71.7% of the variation (PCs 1, 2,5 and 10) was considered the result of photography artifacts or digitizing error (Table 10). All of the remaining PCs affect head and eye size and shape (Table 10). Three of these PCs (3, 4 and 6) explain 65.1% of the biological variation in the model and are sufficient to discriminate between the species (Figure 11). 36

Each species mean shape shows that each has subtle differences in eye size and shape (Figure 12).

DISCUSSION
The eye in Drosophila is a complex three-dimensional morphological structure whose shape and size variation are not easy to capture in an efficient yet detailed manner for large sample sizes. A preliminary analysis using simple linear measurements revealed several differences in the size and shape of the eyes in D. simulans and D. mauritiana, especially between the males. Variation in how the different head and eye shape variable correlate in the two species suggest the overall shape and scaling is different between the two species. This analysis also revealed some common trends in both species. Length and width are hypoallometric (regression slope < 1) in both D. simulans and D. mauritiana, consistent with other studies on eye morphology in other fly species (Stevenson et al., 1995; Blanckenhorn & Llaurens, 2005). However, it is important to consider that the expected isometric slope for eye width is not necessarily 1. The simple measurement in this analysis ignores the 3D nature of the structure and the possible changes in curvature. Through the formal multi-dimensional analyses it is possible to further describe and quantify how the eyes of D. simulans and D. mauritiana differ in shape while correcting for certain types of error. All 5 models on D. simulans, D. mauritiana and their hybrids suggest variation in the shape of the dorsal, top-tier part of the eye and maximum eye width are major axis of variation in eye shape between these species. Consistently, more than 60% of the variation in the various multidimensional analyses was the result of photography artifacts or digitizing error. Elimination of such PCs mathematically corrects for this type of error, as PCs are orthogonal by definition. In general, the remaining PCs (within 95% of the total variation in the model) clearly define 37

Table 8: Summary of PCA results corrected for body size and QTL mapping for the backcross to D. mauritiana PC 1-9 explain 95% of the total variation. Together, the PCs presenting significant LOD values explain 93.1% of the biological variation, and 40.4% of the Eucledian distance between the mean D. mauritiana and D. simulans in multidimensional space. Note however that most of the biological variance is due to PC3, and most of the Eucledian distance between the parentals is accounted by PC3, 6 and 7.

PC 1 2 3 4 5 6 7 8 9 other

Effect rotation back-front rotation left-right eye top-tier size and shape/forehead width asymmetry eye shape? eye roundness eye width eye shape eye shape various

Total variance explained (%) 57.2 22.8 6.1 3.4 1.5 1.4 1.2 0.8 0.6 5

Biological variance 1 explained (%) 0 0 36.7 0 9 8.4 7.2 4.8 3.6 30.3

Euclidean distance between parental 2 species explained (%) 39 18.5 14.5 0 2.2 11.5 11.4 0.2 0.1 2.6

LOD scores y v f bb

1.15

1.55

2.4 2.17 2.06

After eliminating PCs that are clearly an artifact of the photography; i.e. indicating variation in the positioning of the head or rotation or digitizing error; i.e. pints moving in discordance

generating asymmetry or unrealistic deformities.

2

The distance moved on each PC to move from the mean of D. simulans to the mean D. mauritiana in multidimensional space. Significance threshold =1 (based on permutation analysis, Churchill and Doerge, 1994).

38

eye size and shape variation. Using the three PCS explaining most of this variation is sufficient in some of the models to obtain a good resolution between the 2 species. No single PC on its own is however enough to discriminate between D. simulans and D. mauritiana. Both backcrosses were analyzed separately with and without Procrustes correction for size. This correction made only an obvious difference in the analysis in the case of the backcross to D. mauritiana: without the Procrustes correction in all three main PCs the backcross population and both parental species are indistinguishable. This might be associated with the fact that body size was a larger factor in the backcross to D. mauritiana than in the backcross to D. simulans. As some aspects of eye morphology are highly correlated with body size in the strains studied in the preliminary analysis, and body size is likely to introduce noise in the QTL analysis, adding the Procrustes correction for scaling might be appropriate. While PCA captured in detail the variation in eye size and shape, interpreting the different PCs and comparing them across analyses is difficult. Thus, while visually some of the PCs in the separate analyses for each backcross yielded visually similar PCs, these are unlikely to be identical mathematically. For the QTL analysis this is an issue, as if the phenotypes mapped for each backcross population are not the same the two resulting maps are not comparable. The combined analysis might be a proper solution for this problem, as the multidimensional space is defined on the variation in both populations so that each PC is exactly the same for each population in QTL analysis. This combined space is more likely to also encompass more variation in eye size and shape for two main reasons: First, simply because of the larger sample size (430 vs 860); second, each population has a different genetic background so they are likely to show different phenotypes. This larger phenotypic space might explain why only in this

39

model there is no overlap between the two parental species this larger space might provide a better fit for their variation. Most PCs in all analyses affecting eye size or shape map to one of the four markers on the X chromosome. However, all of the LOD scores are particularly low, and for the preferred combined analysis there is considerable mismatch in the resulting rough map between the two populations. This might be explained by the presence of many factors on the X chromosome and a strong genetic background effect. Nevertheless, all PCs resulting from photography artifacts or digitizing error (within 95% of the total variation) do not show a significant LOD thus suggesting this quantification technique might be a good approach. All 5 models on D. simulans, D. mauritiana and their hybrids suggest variation in the shape of the dorsal, top-tier part of the eye is the largest difference between the species. In D. mauritiana males the eyes bulge sideways, in particular at the dorsum (Figure 9). Therefore, it is likely that this area possesses derived physiological characteristics generating most of the observed difference in size and shape between the species. A model including other four species within the melanogaster species subgroup also suggests this axis is important in eye shape variation across the group as a whole. Functional studies in Drosophila and other fly species show this part of the eye can have specialized roles in vision and suggest some possible explanations for the enlarged eye in D. mauritiana. The eye of D. melanogaster is composed of at least 4 subtypes of ommatidia (Pichaud et al., 1999; Wernet et al., 2003; Mazzoni et al., 2008). The most common two kinds, called pale (short wave discrimination) and yellow (long wave discrimination) are randomly interspersed in a 30 to 70% ratio throughout the eye. The third kind of ommatidia are located in the first few lanes of the dorsal rim area (DRA) of the eye and are specialized detect polarized light (Wernet et al., 2003). Finally, a newly described fourth class of specialized ommatidia called dorsal y are located in the 40

Table 9: Summary of PCA results corrected for body size and QTL mapping for the backcross to D. simulans and D. mauritiana. The PCA
analysis in this case was based on both backcross populations PC 1- 8 explain 95% of the total variation. Together, the PCs presenting significant LOD values in both backcross populations (3, 5 and 6) explain 61.2% of the biological variation, and 62.2% of the Eucledian distance between the mean D. mauritiana and D. simulans in multidimensional space. Note however that most of the biological variance is due to PC, and most of the Eucledian distance between the parentals is accounted by PC 3 and 5.

PC 1 2 3 4 5 6 7 8 9 other

Effect rotation back-front rotation left-right eye top-tier size and shape/forehead width asymmetry eye width eye length digitizing error eye shape asymmetry various

Total variance explained (%) 53.5 26.1 5.3 3.8 2.2 1.8 1.2 0.8 0.2 5

Biological variance explained (%) 0 0 34.9 0 14.5 11.8 0 5.9 0 32.9

Euclidean distance between parental species explained (%) 12.5 21 15 <1 35.2 12 <1 <1 <1 0.6

LOD scores, backcross to D. simulans y v f bb

LOD scores, backcross to D. mauritiana y v f bb

2.58 1.46 1.99 4.42

1.58 2.28 1.71 3.15 1.1

1.12 1.44

After eliminating PCs that are clearly an artifact of the photography; i.e. indicating variation in the positioning of the head or rotation or digitizing error; i.e. pints moving in discordance

generating asymmetry or unrealistic deformities.

2

The distance moved on each PC to move from the mean of D. simulans to the mean D. mauritiana in multidimensional space. Significance threshold = 1(based on permutation analysis, Churchill and Doerge, 1994).

41

dorsal eye (Mazzoni et al., 2008). These ommatidia have unique molecular and physiological properties and it is speculated that they might have a specialized role for navigation (Mazzoni et al., 2008). In other fly species unique eye characteristics likely to be associated with shape modifications have been described. In domestic and simuliid flies there is a forward or upward pointing area in the eye of particularly high acuity (i.e. higher ommatidia density, higher facet surface area, and anatomical differences at the receptor level (Land, 2002). This acute zone is frequently only present in the male and is related to mate detection or pursuit during flight (Land, 1992; Land & Fernald, 1992; Land, 2002). In Musca domestica this dimorphism involves just a local increase in the acuity of the forward flight acute zone (Wehrhahn, 1979; Wehrhahn & Hausen, 1980; Land, 2002; Burton & Laughlin, 2003) commonly referred as the love spot.

Table 10: PCA of eye size and shape discriminates 6 species from the melanogaster species
subgroup. PC 1-10 explain 95% of the total variation in the model (results corrected for body size). After eliminating PC 1,2, 5 and 10 (as they represent artifacts of photography or digitizing error) the remaining PCs explain 72.9% of the biological variation.
PC Effect Total variance explained Biological variance explained (%) 1 rotation back-front 46.2 0 (%) 2 rotation left-right 22 0 3 eye/head size 13.6 41 4 Top-tier size and shape 6.2 18.7 5 asymmetry 3.2 0 6 mid-eye width 1.8 5.4 7 eye length/width 1.3 3.9 8 eye shape 0.8 2.4 9 eye shape 0.5 1.5 10 asymmetry 0.3 0 1 After eliminating PCs that are clearly an artifact of the photography; i.e. indicating variation in the positioning of the head or rotation or digitizing error; i.e. pints moving in discordance generating asymmetry or unrealistic deformities.
1

42

In simuliid flies the dimorphism is more pronounced, the males have divided eyes and the upper part is used to detect females against the sky (Land, 2002). In D. mauritiana, the enlarged top-tier part of the eye might be caused by physiological modification such as the ones described above: the number of specialized ommatidia in the dorsal eye might be expanded (DRA and/or dorsal y ommatidia) in comparison to D. melanogaster and D. simulans, or this area could house an acute zone such as in house flies or simuliids. Finally, the extensive data available for eye development in Drosophila might be useful in understanding the genetic basis of modification in eye size and shape in D. mauritiana. The external structures of the adult Drosophila body are mostly derived from epithelial sacs held inside the larval body known as imaginal discs (Lawrence, 1992; Yamamoto, 1996). The eyeantennal disc gives rise to the eye, the antenna, the ocelli, and most of the head capsule. In the early embryo, the eye-antennal disc is only about 20 cells (Yamamoto, 1996). These continue to proliferate up to the mid-third instar stage when retinal pattern formation takes place. At this stage the morphogenetic furrow, a dorsoventral indentation, moves across the eye disc from posterior to anterior initiating the differentiation of the various cells composing an ommatidium (Yamamoto, 1996). Eye size modification is most likely tied to either the number of cells in the disc before retinal differentiation, or by a higher recruitment of ommaditial founder cells as the morphogenetic furrow moves across the eye. Shape modifications on the other hand are 43

likely to be tied to the distribution of rows and columns of cells in the disc allowing some predictions about the possible differences in eye development in species with different eye shapes. For instance, the morphogenetic furrow moves from posterior to anterior, one column at a time. Therefore, a higher number of columns would likely imply a longer time during retinal differentiation. In conclusion, both linear and multidimensional quantification for eye size and shape have their caveats and trade-offs: linear measurements are quicker but do not capture as much variation, do not reflect a priori which variables represent most variation or correlations between them, and cannot be corrected a posteriori for measurement error. The multidimensional analysis captures in detail most variation, generates a rich data set where variables explaining most variation are easily identified, can be corrected a posteriori for error, but the variables are abstract and hard to relate back to the biological context. Either one might be appropriate for QTL mapping while keeping in mind these caveats. Future work using both eye width and PCA on both backcross populations will expand the QTL map to the whole genome allowing for a better assessment of the impact of these methods on QTL mapping and to examine in higher detail the genetic basis of eye size and shape differences between D. simulans and D. mauritiana.

44

LITERATURE CITED
ALBERTSON, R. C. & KOCHER, T. D. (2006). Genetic and developmental basis of cichlid trophic diversity. Heredity 97, 211-221. ALBERTSON, R. C., STREELMAN, J. T. & KOCHER, T. D. (2003). Directional selection has shaped the oral jaws of Lake Malawi cichlid fishes. Proceedings Of The National Academy Of Sciences Of The United States Of America 100, 52525257. ALBERTSON, R. C., STREELMAN, J. T., KOCHER, T. D. & YELICK, P. C. (2005). Integration and evolution of the cichlid mandible: The molecular basis of alternate feeding strategies. Proceedings Of The National Academy Of Sciences Of The United States Of America 102, 16287-16292. BERGLAND, A. O., GENISSEL, A., NUZHDIN, S. V. & TATAR, M. (2008). Quantitative trait loci affecting phenotypic plasticity and the allometric relationship of ovariole number and thorax length in Drosophila melanogaster. Genetics 180, 567582. BLANCKENHORN, W. U. & LLAURENS, V. (2005). Effects of temperature on cell size and number in the yellow dung fly Scathophaga stercoraria. Journal Of Thermal Biology 30, 213-219. BRADSHAW, H. D., OTTO, K. G., FREWEN, B. E., MCKAY, J. K. & SCHEMSKE, D. W. (1998). Quantitative trait loci affecting differences in floral morphology between two species of monkeyflower (Mimulus). Genetics 149, 367-382. BROMAN, K. W., WU, H., SEN, S. & CHURCHILL, G. A. (2003). R/qtl: QTL mapping in experimental crosses. Bioinformatics 19, 889-890. BURTON, B. G. & LAUGHLIN, S. B. (2003). Neural images of pursuit targets in the photoreceptor arrays of male and female houseflies Musca domestica. Journal Of Experimental Biology 206, 3963-3977. CHURCHILL, G. A. & DOERGE, R. W. (1994). Empirical Threshold Values For Quantitative Trait Mapping. Genetics 138, 963-971. COEN, E., ROLLAND-LAGAN, A. G., MATTHEWS, M., BANGHAM, J. A. & PRUSINKIEWICZ, P. (2004). The genetics of geometry. Proceedings Of The National Academy Of Sciences Of The United States Of America 101, 4728-4735. FRARY, A., NESBITT, T. C., FRARY, A., GRANDILLO, S., VAN DER KNAAP, E., CONG, B., LIU, J. P., MELLER, J., ELBER, R., ALPERT, K. B. & TANKSLEY, S. D. (2000). fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289, 85-88. GRANDILLO, S., KU, H. M. & TANKSLEY, S. D. (1999). Identifying the loci responsible for natural variation in fruit size and shape in tomato. Theoretical and Applied Genetics 99, 978-987. HAMMERLE, B. & FERRUS, A. (2003). Expression of enhancers is altered in Drosophila melanogaster hybrids. Evolution & Development 5, 221-230. JEONG, S., REBEIZ, M., ANDOLFATTO, P., WERNER, T., TRUE, J. & CARROLL, S. B. (2008). The evolution of gene regulation underlies a morphological difference between two Drosophila sister species. Cell 132, 783-793. JONSON, A. C. J., LAND, M. F., OSORIO, D. C. & NILSSON, D. E. (1998). Relationships between pupil working range and habitat luminance in flies and butterflies. Journal Of Comparative Physiology A-Sensory Neural And Behavioral Physiology 182, 1-9.

45

KLINGENBERG, C. P. (2002). Morphometrics and the role of the phenotype in studies of the evolution of developmental mechanisms. Gene 287, 3-10. KLINGENBERG, C. P. & LEAMY, L. J. (2001). Quantitative genetics of geometric shape in the mouse mandible. Evolution 55, 2342-2352. KLINGENBERG, C. P., LEAMY, L. J., ROUTMAN, E. J. & CHEVERUD, J. M. (2001). Genetic architecture of mandible shape in mice: Effects of quantitative trait loci analyzed by geometric morphometrics. Genetics 157, 785-802. LAND, M. F. (1992). Visual Tracking And Pursuit - Humans And Arthropods Compared. Journal Of Insect Physiology 38, 939-951. LAND, M. F. & FERNALD, R. D. (1992). The Evolution Of Eyes. Annual Review Of Neuroscience 15, 1-29. LAND, M. F., GIBSON, G., HORWOOD, J. & ZEIL, J. (1999). Fundamental differences in the optical structure of the eyes of nocturnal and diurnal mosquitoes. Journal Of Comparative Physiology A-Sensory Neural And Behavioral Physiology 185, 91103. LAND, M. F. A. N. D.-E. (2002). Animal Eyes. Oxoford University Press Inc., New York. LAURIE, C. C., TRUE, J. R., LIU, J. J. & MERCER, J. M. (1997). An introgression analysis of quantitative trait loci that contribute to a morphological difference between Drosophila simulans and D-mauritana. Genetics 145, 339-348. LAWRENCE, P. A. (1992). The making of a fly: the genetics of animal design. Blackwell Scientific publications, Oxford. LIU, J., MERCER, J. M., STAM, L. F., GIBSON, G. C., ZENG, Z. B. & LAURIE, C. C. (1996). Genetic analysis of a morphological shape difference in the male genitalia of Drosophila simulans and D-mauritiana. Genetics 142, 1129-1145. LONG, F., CHEN, Y. Q., CHEVERUD, J. M. & WU, R. L. (2006). Genetic mapping of allometric scaling laws. Genetical Research 87, 207-216. MAZZONI, E. O., CELIK, A., MATHIAS, F. W. C., VASILIAUSKAS, D., JOHNSTON, R. J., COOK, T. A., PICHAUD, F. & DESPLAN, C. (2008). Iroquois complex genes induce coexpression of rhodopsins in Drosophila. Plos Biology 6, 825-835. ORGOGOZO, V., BROMAN, K. W. & STERN, D. L. (2006). High-resolution quantitative trait locus mapping reveals sign epistasis controlling ovariole number between two Drosophila species. Genetics 173, 197-205. PICHAUD, F., BRISCOE, A. & DESPLAN, C. (1999). Evolution of color vision. Current Opinion In Neurobiology 9, 622-627. PRESGRAVES, D. C. (2003). A fine-scale genetic analysis of hybrid Incompatibilities in drosophila. Genetics 163, 955-972. ROHLF, F. J. & ARCHIE, J. W. (1984). A comparison of Fourier methods for the description of wing shape in mosquitoes (Diptera, Culicidae). Systematic Zoology 33, 302-317. STEVENSON, R. D., HILL, M. F. & BRYANT, P. J. (1995). Organ And Cell Allometry In Hawaiian Drosophila - How To Make A Big Fly. Proceedings Of The Royal Society Of London Series B-Biological Sciences 259, 105-110. SUCENA, E. & STERN, D. L. (2000). Divergence of larval morphology between Drosophila sechellia and its sibling species caused by cis-regulatory evolution of ovo/shaven-baby. Proceedings Of The National Academy Of Sciences Of The United States Of America 97, 4530-4534. TANKSLEY, S. D. (2004). The genetic, developmental, and molecular bases of fruit size and shape variation in tomato. Plant Cell 16, S181-S189.

46

TRUE, J. R., LIU, J. J., STAM, L. F., ZENG, Z. B. & LAURIE, C. C. (1997). Quantitative genetic analysis of divergence in male secondary sexual traits between Drosophila simulans and Drosophila mauritiana. Evolution 51, 816-832. WEHRHAHN, C. (1979). Sex-specific differences in the chasing behavior of houseflies (Musca). Biological Cybernetics 32, 239-241. WEHRHAHN, C. & HAUSEN, K. (1980). How is tracking and fixation accomplished in the nervous-system of the fly - a behavioral-analysis based on short-time stimulation. Biological Cybernetics 38, 179-186. WERNET, M. F., LABHART, T., BAUMANN, F., MAZZONI, E. O., PICHAUD, F. & DESPLAN, C. (2003). Homothorax switches function of Drosophila photoreceptors from color to polarized light sensors. Cell 115, 267-279. YAMAMOTO, D. (1996). Molecular dynamics in the developing Drosophila eye R.G. Landes Company, Austin, TX. ZENG, Z. B., LIU, J. J., STAM, L. F., KAO, C. H., MERCER, J. M. & LAURIE, C. C. (2000). Genetic architecture of a morphological shape difference between two drosophila species. Genetics 154, 299-310. ZIMMERMAN, E., PALSSON, A. & GIBSON, G. (2000). Quantitative trait loci affecting components of wing shape in Drosophila melanogaster. Genetics 155, 671683.

47

SECTION II A TAIL OF T WO FLIES

48

CHAPTER 2

R AP I D , E FFI CI EN T D IS S E CTI ON T RA IT
IN TO I TS

OF AN

I N TE RS P ECIFI C Q UA N TI TATI V E
IN

U N DER LY I NG M EN DEL I AN F AC TO R S

D RO SOP HIL A

49

ABSTRACT
One of the central goals of evolutionary biology is to elucidate processes that underlie the generation and diversification of phenotypes. Despite several decades of research, as well as their importance in fields such as agriculture and medicine, surprisingly little is known about the genetic basis of quantitative traits. Pigmentation patterns across animal taxa are diverse and often have a complex genetic basis, yet their simple development is well understood offering the opportunity to dissect the genetic basis of their variation. Among Drosophilids, Drosophila yakuba presents the typical abdominal pigmentation pattern of the melanogaster species subgroup, while its sister species Drosophila santomea has lost most pigmentation in the abdomen. In this chapter, I show how this quantitative trait can be dissected into individual Mendelian effects through repeated backcrossing and selection. This process generates a map with significantly higher resolution of all major genetic factors than can be achieved with traditional quantitative trait locus (QTL) mapping. Through repeated backcrossing and selection, I generated introgression lines that presented distinct abdominal pigmentation patterns. Using these lines, I have showed that: 1) three of the four QTLs previously identified generate discrete, traceable pigmentation phenotypes and behave similarly to Mendelian loci; 2) mapping of the introgressions carried in these lines narrowed all four QTLs to a fraction of their original size; 3) with this method it is possible to identify multiple genes underlying a QTL. Identifying the genetic basis of morphological differences between closely related taxa might help us to better understand patterns of morphological evolution. Such studies are likely to pinpoint important mechanisms generating variation in morphological characters from a conserved set of genes.

50

INTRODUCTION
In recent years our general understanding of how morphology evolves has progressed substantially. These first insights into the general patterns of morphological evolution have enabled the evaluation of standing theoretical hypotheses. Because of their complex nature, the molecular genetic basis of quantitative traits has perhaps been the most elusive, and the few well-studied examples are primarily of intraspecific variation (Mackay, 1996; Flint & Mott, 2001; Barton & Keightley, 2002; Mackay, 2004). Yet understanding important aspects such as the relationship between intra- and interspecies genetic variation, the role of evolutionary time scale, or the importance of epistasis will also require dissecting the genetic basis of complex morphological differences between species. Multiple genes, environmental conditions and their interaction typically influence the expression of complex traits so that their inheritance does not follow the simple rules of Mendelian genetics (Falconer & Mackay, 1996; Christians & Keightley, 2002; Erickson et al., 2004; Erickson, 2005). The resulting non-linear relationship between genotype and phenotype makes the dissection of the genetic basis of quantitative traits a formidable task. However, to successfully determine the molecular genetic basis of morphological evolution, it is necessary to identify and determine the properties of the individual genes underlying variation in complex traits (Mackay, 2001). Quantitative trait locus (QTL) analysis has provided some important insights into the genetic basis of complex traits (Mackay, 2001; Mauricio, 2001; Erickson et al., 2004). However, QTL mapping usually identifies broad chromosomal regions and does not provide sufficient resolution to implicate individual genes. By surveying 7 QTL analyses in Drosophila, Mackay (2001) estimates that the average QTL is 8.9 cM or 4,459 kb,

51

thus encompassing about 507 genes (assuming an average of 8.8 kb/gene), with a range of 11 to 2101 genes. In organisms where genetic manipulation is possible such as Drosophila, generating genetically identical lines except for a defined region encompassing the QTL can help to resolve an interval containing a locus contributing to variation in a complex trait. This region might be a whole chromosome (chromosome substitution lines), or a fragment (introgression, congenic lines or near-isoallelic lines, 52

NIL) (Mackay, 2001). Usually this is achieved by introgressing a previously identified region of interest with the aid of flanking markers. This methodology has been applied successfully to narrow down a QTL to a handful of or sometimes to specific genes. For example, a susceptibility allele for diabetes in mice maps to a 145 kb interval which contains the gene IL2 (Lyons et al., 2000), and the QTL determining tomato weight was mapped to a 1.6 cM interval bearing only the gene ORFX (Frary et al., 2000). A second, similar approach originally proposed by Wright (Wright, 1952) and modeled formally by others (Zeng, 1993; Beebe et al., 1997; Hill, 1998; Luo et al., 2002; Hospital, 2005), suggests that QTL of large effect can be mapped in detail by simply backcrossing repeatedly two distinct inbred lines while selecting for a specific value of the trait. For instance, a hybrid between a high and low line for any given trait would be backcrossed to the low line while selecting individuals to breed presenting the high value of the trait. At each backcross generation, the frequency of genes that do not affect the trait will be halved, while genes of large effect would be more likely to be present in selected individuals. Theoretically, through time, the genome of congenic lines generated in this way will be primarily like the low parental line except for introgressed loci of large effect causing the trait of interest to be high. Provided that the effect is large enough that genotypes can be assigned accurately, different congenic lines carrying the same introgressed region can be used to narrow a QTL interval (Darvasi, 1997). If a quantitative trait could be dissected into its individual genetic components in this way so that different populations would carry a single QTL or gene in an identical background, traditionally separate approaches could be brought together, so that the simple methods of Mendelian genetics could be applied to the study of the genetic basis of quantitative traits (Paterson et al., 1988; Lander & Botstein, 1989).

53

54

Drosophila species within the melanogaster subgroup are well suited to apply this mapping method as they are phenotypically diverse, many sibling species are interfertile, and the wealth of available molecular tools facilitate high-throughput genotyping. D. santomea and D. yakuba, sister species within the melanogaster subgroup, differ conspicuously in patterns of abdominal pigmentation (Lachaise et al., 2000; Llopart et al., 2002; Carbone et al., 2005; Jeong et al., 2008). This difference is particularly pronounced in the males, as abdominal pigmentation in these species is sexually dimorphic (Figure 1 A and B). A previous analysis identified four QTLs that cause most of this difference (two on chromosome X, one each on chromosomes 2 and 3) (Carbone et al., 2005). In this chapter, I characterize the genetic basis of abdominal pigmentation differences between D. yakuba and D. santomea using repeated backcrossing combined with selection to obtain a more accurate estimate than traditional QTL mapping of the number, location and identity of genes determining this trait. Through this method, I show first how three out four of the QTLs previously identified for this trait produce qualitative, tractable patterns that can be mapped through simple techniques. Second, I demonstrate how it is possible to obtain resolution of all major QTLs up to three orders of magnitude higher than traditional QTL 55

mapping. Finally, I show how at one of these QTLs actually contains at least two genes affecting abdominal pigmentation.

METHODS
DROSOPHILA STRAINS We used one strain for each species obtained through the Tucson Stock Center (stock number 14021-0261.00 for D. yakuba, and stock number 14021-0271.00 for D. santomea). All flies were maintained on standard media enriched with live yeast in an incubator at 18C. GENERATION OF INTROGRESSION LINES In preliminary experiments I observed that male progeny resulting from a backcross to male D. santomea segregated into four distinguishable pigmentation patterns. I therefore aimed to isolate the genetic regions associated with each of these phenotypic classes by generating independent lines through repeated backcrossing coupled with selection (Figure 2). F1 females resulting from the cross of D. yakuba virgin females and D. santomea males were backcrossed in mass to D. santomea. One hundred and twenty of the resulting backcross female offspring were crossed individually to D. santomea males. To generate each of the subsequent backcross generations, 5 females whose male siblings presented abdominal pigmentation were crossed individually to D. santomea males. This selection scheme was necessary because only the hybrid females are fertile, but the pigmentation phenotype is evident only in the males as this trait is sexually dimorphic. After 6 generations of backcrossing, the lines gained male fertility, and I was able then inbreed for 10 to 20 additional generations to produce homozygote introgression fertile lines.

56

57

PHENOTYPING Pigmentation patterns on last three abdominal segments visible from the dorsal view (A4 though A6) of individual males were examined under a stereomicroscope (Figure 3A). The different pigmentation patterns observed were classified in 4 discrete phenotypic classes by eye (Classes 1-4, Figure 1). However, to show objectively how these different classes differ, I also quantified variation in abdominal pigmentation through image analysis. Individual flies were pinned to a small apple juice plate filled with a 2% Triton-X solution with their abdomens facing up using #000 insect pins. I then captured 3 to 5 pictures at different depths of field with a digital camera (Photometrics Coolsnap cf) connected to a Nikon E1000 microscope at 40x. Light conditions were kept constant with a ring light attached to the microscopes objective. With the help of IPlab software (version 3.9.4 r2) the pictures were combined (3D extended focus) into a single image showing the whole abdomen in focus. To quantify the variation in abdominal pigmentation, each image was digitized using MatLab based software, the AAM Toolbox package (available at http://www2.cmp.uea.ac.uk/aih/), designed to build and visualize statistical models of shape and appearance using principal component analysis (PCA). Appearance in this case is pigmentation variation. I first created an abdomen point model template using the Point Model Editor in the AAM ToolBox package (Figure 3B). The 23 points in this model capture the overall size, shape and color variation of the last three segments of the abdomen. On the basis of this template, corresponding points were placed on 20 individual male flies from each of the following groups: D. santomea, D. yakuba, F1 (D. yakuba mother), Class 1, Class 2, Class 3 and Class 4. To correct for size and shape variation across images so that the only difference between them is pigmentation differences, I generated a mean abdomen shape from all groups and warped the corresponding images to this identical shape.

58

Based on the RGB values of these warped images I generated a statistical model of appearance using PCA (Stats Model Generator in the AAM Toolbox).

GENOTYPING Marker genotypes: DNA was extracted using the Quick Fly genomic DNA extraction protocol (Gloor, 1992) from individual flies of interest. When the flies were needed alive for crosses, I assessed their genotype by clipping and extracting DNA from their wings (McGregor et al., 2007). Genetic basis of qualitative phenotypes: To determine the association between the fourQTLs identified in Carbone et al (2005) and the 4 different phenotypes observed, I genotyped 94 individual hybrid males from the third generation backcross belonging to 59

the 4 phenotypic classes observed (24 individuals from Class 1, 40 from Class 2, 26 from Class 3, 4 from Class 4) using 11 molecular markers that discriminate between D. yakuba and D. santomea [(2 markers spanning QTL Xa, and 3 markers spanning each of the remaining QTLs (QTL Xb, QTL 2 and QTL 3)]. Eight of these markers were taken from Carbone et al 2005, the remaining three were generated by direct sequencing (GENEWIZ, Inc., South Plainfield, NJ) of PCR amplified regions from both species to identify restriction enzyme site polymorphisms. All primers primer sets were based on the D. yakuba genome assembly (2005). Recombination mapping: To narrow the location of the genes of interest within each QTL, I designed 62 new markers based on the D. yakuba genome assembly for scoring through PCR-SSCP (single stranded conformation polymorphism of PCR products) with the Phast Gel system (Amersham Biosciences, Separation Technique File No. 131) or through restriction enzyme site polymorphism (see appendix 1).

RESULTS
In the first backcross generation I identified four discrete, visually tractable abdominal pigmentation classes (Class 1-4, Figure 1). Class 1 individuals show a brown dot in the bottom center of tergite 7 that is only visible from the dorsal view (Figure 1E). Class 2 individuals show a T-like black pattern on tergite 7; the top leg of the T lies at bottom of the tergite, while the other leg extends almost to tergite 6 along the middle of 60

tergite 7, so that from a profile view the abdomen it is possible to see a pigmented ring around tergite 7 (Figure 1F). Class 3 individuals show the same pattern as Class 2 plus some light pigmentation on all of tergite 7 and part of 6, so that the darker T is still visible (Figure 1G). Finally, Class 4 individuals show dark pigmentation on segments 5 and 6, and a pronounced band in the lower portion of segment of 4 (Figure 1H). The segregation patterns of these four different pigmentation patterns in sibling male progeny from 50 individual backcross lines suggest the genetic basis of each of these phenotypic classes. Most D. yakuba alleles are dominant or partially dominant, as 98% the backcross males to D. santomea show some degree of abdominal pigmentation. Classes 1 and 2 are likely to be caused by single effects, as 22% and 27% of the lines presented only one of these phenotypes respectively. On the other hand, the most complex two phenotypes, Class 3 and 4, appear to be affected by more than one factor, as 51% of the lines presented a combination of these phenotypes, and in all cases these phenotypic classes were in combination with class 1 and class 2. To further test these hypotheses, we genotyped 94 individuals from the third backcross generation representing all 4 phenotypic classes from 39 independent lines with markers spanning each of the 4 QTLs described in Carbone et al (Figure 4). We found that class 1 is linked to either QTL 2 or 3, while class 2 is associated only with the markers on QTL Xb. Class 3 appears to be associated tightly with QTL Xb and the presence of QTL 2 or 3, while Class 4 might require the presence of QTL Xb, 2 and 3. We found no significant association of any phenotype and QTLXa (Figure 4).

61

62

Principal component analysis of the variation in pigmentation in D. santomea, D. yakuba and their hybrids yielded three primary PCs explaining 85% of the total variation (Figure 5). D. santomea and D. yakuba fall 2.4 standard deviations (SD) apart along PC1, 2.2 SD along PC2, and 2 SD along PC3. Each qualitative phenotype shows similar variation as the parental phenotypes, and falls in a discrete cloud barely overlapping with others; yet it is possible to walk in phenotypic space from D. yakuba to D. santomea through the different hybrid phenotypes. Class 4 (the darkest backcross phenotype; presumably associated with QTL Xb, QTL2 and 3) and the F1 (D. yakuba mother) are the only data clouds that overlap significantly. Efforts to isolate the different QTLs in separate lines yielded a total of 32 fertile lines from 125 original single F1 female crosses (Table 1). In 13/19 Class 1 lines, the introgressed D. yakuba DNA spanned a single QTL (Table 1). The 6 remaining lines however, while presenting a clear Class 1 phenotype, could not be tied to any of the four QTLs after extensive genotyping (Table 1). The introgression lines were unstable and difficult to make homozygous despite selection at every generation for pigmented individuals. Only 11/32 of the initial lines became homozygous, usually after 20-30 generations of selection (Table 1).

Table 1: List of the introgression lines obtained through repeated backcrossing and selection
according to phenotypic class and the introgressed QTL.
# of lines Class 1 Class 2 Class 3 Class 4
19 7 3 4

QTLXa
0 0 1 n/a

QTLXb
0 7 1 n/a

QTL2
8 0 2 n/a

QTL3
5 0 2 n/a

Unknown
6 0 0 4

Homozygous lines
6 (2 for QTL2, 4 for QTL3) 1 2 ( 1 QTLXa+QTLXb, 1 2 (unknown distribution) QTL2+QTL3)

63

To narrow the location of the gene of interest within each QTL, I genotyped third generation backcross individuals and introgression lines to identify recombination or introgression breakpoints. QTLXa (1 introgression line only) was reduced to 8Mb, about 80% of its original 95% confidence interval (Figure 6). QTLXb was reduced to a 0.5 Mb fragment (approximately 5% of its 2 LOD confidence interval) ranging from the marker bnb (at approx. 17,307 kb, X) to the marker Bcl7-like (at approx. 17,840 kb, X). Third generation backcross individuals and introgression lines yielded identical resolution (Figure 7). The fragment contains tan, a gene recently shown to affect pigmentation differences between D. santomea and D. yakuba (Jeong et al., 2008) (Figure 7). In

QTL2, the original 2 LOD interval was narrowed to less than 10% (2 Mb) raging from the marker CadN (at approx. 3,288 kb, 2R) to the marker Rpl30 (at approx. 5,526 kb, 2R) (Figure 8). This resolution was obtained with the introgression lines, while third generation backcross individuals defined an interval close to 10 times larger (18Mb) (Figure 8). The mapping of QTL3 went through several stages resulting in the end in two closely linked intervals for two different genetic factors. Using third generation backcross individuals, I identified a 29 Mb interval ranging from the marker N74 (at approx. 1,660 kb, 3L) to the marker int3CG31176 (at approx. 6,340 kb, 3R) (Figure 9). This interval overlaps with the original 2 LOD interval for this QTL (Carbone et al., 2005). Adding the information obtained from the introgression lines, I narrowed the interval to 40 kb (approx. 2% of QTL3 2 LOD interval) defined on the left by an introgression line (at approx. 6,300 kb, 3R by sequencing of introgression 8p2) and on the right by a third generation backcross individual (marker int3CG31176 at approx. 6,340 kb, 3R) (Figure 9). All introgression lines carrying a fragment within QTL3 supported this interval.

64

65

However, once homozygous in later generations two lines gained new recombination breakpoints within the introgressed QTL3 fragment, and one of them lost the interval (Figure 10) though it still presented some abdominal pigmentation. As a possible explanation for this observation, I tested the possibility of two closely linked genes within QTL3. First, I examined whether lines carrying different fragments within QTL3 look different. The males from the four different homozygote lines carrying only fragments of QTL3, while presenting an identical phenotype as heterozygotes (a single dot, Class 1, Figure 1), look different as homozygotes (Figure 11A). The darker lines carry a large fragment of the QTL, while the lighter lines carry either the left or right side of the QTL (Figure 11B). Next, I generated new recombinants within QTL3 by crossing F1 females heterozygous for the largest QTL3 introgression (the product of crossing the largest introgression line to D. santomea) to males from this same introgression line. The 188 scored offspring show all three abdominal pigmentation patterns, and the 28 recombinants having only the left or right side of QTL3 (determined by genotyping them at a right (dsx) and left (I3) markers) match the phenotypes of the two lighter introgression lines carrying either the left or right of QTL3 (Figure 11C). Therefore, it is likely that at least two genes underlie QTL3, one corresponding to the previously defined interval (Figure 12), and a second one approximately 6 Mb to the right. In summary, all four QTLs were narrowed to a fragment spanning only a fraction of their original 2 LOD confidence interval (Carbone et al., 2005), and at least one QTL as defined in Carbone (2005) contains multiple genes (Figure 14). In all three cases where the interval reduction was significant, the final fragment was near the peak of the original QTL, though did not include it.

66

67

68

DISCUSSION
In this chapter, I showed how it is possible to dissect a complex trait into individual QTLs, most producing a tractable discrete phenotype. Functionally, a quantitative trait was mendelized thus facilitating its study. Lines carrying a single QTL can then be used to locate the responsible genes through simple recombination mapping thus generating resolution substantially higher than through QTL analysis. The controversy between Darwins original observation of subtle continuous variation for most traits and the Mendelian theory of particulate inheritance was reconciled during the Modern Synthesis by the notion that quantitative traits are based on many genes of small effect modified by environmental influence (Hartl, 2004). Abdominal pigmentation differences between D. santomea and D. yakuba support this theory, though most genes involved have an effect large enough to be visually tracked on their own. All hybrid phenotypes identified in the backcross are well defined quantitatively in phenotypic space and present little overlap. Hybrid groups form, from darker to lighter, a U-shaped cloud connecting the distant D. yakuba and D. santomea clouds (Figure 5). This might be a representation of a possible minimal evolutionary pathway for the loss of abdominal pigmentation. Three genomic regions are responsible for most of this variation, and when each is isolated into a common background, they produce a visually tractable and qualitative trait that can be maintained indefinitely in fertile, homozygote introgression lines. Introgression lines have been used for isolating and mapping genetic effects underlying quantitative traits in various organisms (Paterson et al., 1988; Paterson et al., 1990; Paterson et al., 1991; Paran et al., 1995; Grandillo et al., 1999; Monforte et al., 2001), and have eventually resulted in the cloning of a gene underlying a complex trait (Doebley et al., 1997; Frary et al., 2000; Fridman et al., 2000; El-Assal et al., 2001).

69

70

To my knowledge however, no study had previously dissected to such resolution all genes of major effect determining a difference in a quantitative trait between species. My approach here, generation of congenic introgression lines through backcrossing and selection, produces a higher resolution map for both the number and location of genetic effects than traditional QTL mapping. For the three major QTLs the interval delimited was close to, but did not include, the highest scoring marker from the original QTL mapping (Carbone et al., 2005) indicating consistency between the two methods. The introgression lines yielded however much smaller intervals for all QTLs, an in the case of QTL3, nearly two orders of magnitude higher resolution (3200 vs 40 kb). Genotyping of third generation backcross individuals was in some cases also useful for refining QTL locations. It was not possible to narrow the interval for QTLXa using this method presumably because of its small effect. In the case of the other three QTLs however, genotyping of third generation backcross individuals generated various degrees of resolution. In the case of QTLXb, the resolution obtained through either third generation backcross individuals or introgression lines was similar. In QTL2, introgression lines defined an interval an order of magnitude smaller than third generation backcross individuals. Finally, in QTL3, the best resolution for the left interval is defined by both third generation backcross individuals and introgression lines, while the right would have been missed if only third generation backcross individuals had been genotyped. Therefore, though genotyping individuals during the backcrossing process was useful in refining the location of QTLs, the introgression lines yielded much higher resolution and this approach was also sensitive enough to show that a single QTL contains at least two effects. In this study it was possible to narrow the interval for each QTL significantly because of series of advantages. Some of these benefits were expected: D. santomea and D. yakuba are very closely related (< 0.4 million years apart), so that synteny and lack of 71

inversions facilitate genetic screens. Also, the availability of the full D. yakuba genome was essential to design large numbers of markers. Others were unexpected but likely to be useful for other mapping efforts. Recombination rates in the backcross hybrids, one of the main constraints in mapping (Darvasi, 1998), were particularly high in this experiment. Some of the lines carry introgressions as little as 1 Mb in QTLXb and QTL3 (see for example line 7P3 for QTLXb, Figure 7). The probability of two recombination events happening within such small distance in a few backcrossing generations are likely to be small. This is most likely the consequence of inviability or infertility factors (speciation genes) linked to the genes responsible for pigmentation differences between D. santomea and D. yakuba. Specifically, individuals presenting recombination events between the inviability/infertility loci and the pigmentation genes have a higher survival or fertility so that their particular recombinant chromosome is more likely to be

represented in the following generations.

Small introgressions with few generations of backcrossing have been observed in crosses of other Drosophila species (Masly & Presgraves, 2007), and can be expected generally in interspecies crosses as inviability/infertility factors are expected to be randomly distributed throughout the genome. It might be possible however to recreate such situation for mapping within species through mutagenesis. In Drosophila,

72

mutagenesis generates in average one lethal factor per chromosome (Ashburner, 2005). If a large number of lines are generated, then some are likely to gain lethal mutations tightly linked with regions containing genes of interest. Genotyping of individuals with recombination events between lethal mutations and the closely linked region of interest (and thus likely increasing viability) might contribute towards mapping efforts. Another essential factor for the success of this study was the ease for scoring the phenotype itself. Abdominal pigmentation is a particularly suitable trait for this kind of experiment, as the discrete nature of the phenotype produced by each QTL can be easily scored visually. Whether this approach is likely to be successful in the case of other continuous traits depends on how accurately their phenotype can be measured so that the effect of individual factors can be properly assessed. How morphological differences arise in natural populations is still poorly understood (Stern, 2000b; Stern, 2000a; Orr, 2001; Simpson, 2002). Further elucidation of how such differences are genetically determined and become fixed in populations might be facilitated by focusing on a small evolutionary time-scale and on morphological differences between closely related species. At this level, it is possible to compare subtle 73

differences arising from a small number of evolutionary steps responsible for recently evolved phenotypic differences (Stern, 1998; Stern, 2000a; Stern, 2000b; Simpson, 2002). In the case of quantitative traits, the daunting yet essential task of identifying genes and mutations underlying a QTL can be further simplified by dissecting the trait into its individual Mendelian components as shown here for abdominal pigmentation evolution in D. yakuba and D. santomea. Further recombination mapping and functional assays for the handful of genes in these intervals should help to identify individual genes and mutations within them causing variation in abdominal pigmentation.

74

LITERATURE CITED
ASHBURNER, M., KENT G., GOLIC R. & HAWLEY R.S. (2005). Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, New York, NY. BARTON, N. H. & KEIGHTLEY, P. D. (2002). Understanding quantitative genetic variation. Nature Reviews Genetics 3, 11-21. BEEBE, A. M., MAUZE, S., SCHORK, N. J. & COFFMAN, R. L. (1997). Serial backcross mapping of multiple loci associated with resistance to Leishmania major in mice. Immunity 6, 551-557. BIOSCIENCES, A. Separation Technique Flie No. 131. In: PCR-SSCP Analysis (G. H. L. S.-. Instruction/Protocol, ed). CARBONE, M. A., LLOPART, A., DEANGELIS, M., COYNE, J. A. & MACKAY, T. F. C. (2005). Quantitative trait loci affecting the difference in pigmentation between Drosophila yakuba and D. santomea. Genetics 171, 211-225. CHRISTIANS, J. K. & KEIGHTLEY, P. D. (2002). Genetic architecture: Dissecting the genetic basis of phenotypic variation. Current Biology 12, R415-R416. DARVASI, A. (1997). Interval-specific congenic strains (ISCS): An experimental design for mapping a QTL into a 1-centimorgan interval. Mammalian Genome 8, 163167. . (1998). Experimental strategies for the genetic dissection of complex traits in animal models. Nature Genetics 18, 19-24. DOEBLEY, J., STEC, A. & HUBBARD, L. (1997). The evolution of apical dominance in maize. Nature 386, 485-488. EL-ASSAL, S. E. D., ALONSO-BLANCO, C., PEETERS, A. J. M., RAZ, V. & KOORNNEEF, M. (2001). A QTL for flowering time in Arabidopsis reveals a novel allele of CRY2. Nature Genetics 29, 435-440. ERICKSON, D. (2005). Quantitative trait loci - Mapping the future of QTL's. Heredity 95, 417-418. ERICKSON, D. L., FENSTER, C. B., STENOIEN, H. K. & PRICE, D. (2004). Quantitative trait locus analyses and the study of evolutionary process. Molecular Ecology 13, 2505-2522. FALCONER, D. S. & MACKAY, T. F. C. (1996). Quantitative genetics. Longman Group, Essex, England. FLINT, J. & MOTT, R. (2001). Finding the molecular basis of quantitative traits: Successes and pitfalls. Nature Reviews Genetics 2, 437-445. FRARY, A., NESBITT, T. C., FRARY, A., GRANDILLO, S., VAN DER KNAAP, E., CONG, B., LIU, J. P., MELLER, J., ELBER, R., ALPERT, K. B. & TANKSLEY, S. D. (2000). fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289, 85-88. FRIDMAN, E., PLEBAN, T. & ZAMIR, D. (2000). A recombination hotspot delimits a wildspecies quantitative trait locus for tomato sugar content to 484 bp within an invertase gene. Proceedings Of The National Academy Of Sciences Of The United States Of America 97, 4718-4723. GLOOR, G. B., AND W. R. ENGELS. (1992). Single fly DNA preps for PCR. Drosophila Information Services, 148-149. GRANDILLO, S., KU, H. M. & TANKSLEY, S. D. (1999). Identifying the loci responsible for natural variation in fruit size and shape in tomato. Theoretical and Applied Genetics 99, 978-987. HARTL, D. L., & E. W. JONES. (2004). Genetics: Analysis of Genes and Genomes. Jones and Bartlett, Sudbury, MA. 75

HILL, W. G. (1998). Selection with recurrent backcrossing to develop congenic lines for quantitative trait loci analysis. Genetics 148, 1341-1352. HOSPITAL, F. (2005). Selection in backcross programmes. Philosophical Transactions Of The Royal Society B-Biological Sciences 360, 1503-1511. JEONG, S., REBEIZ, M., ANDOLFATTO, P., WERNER, T., TRUE, J. & CARROLL, S. B. (2008). The evolution of gene regulation underlies a morphological difference between two Drosophila sister species. Cell 132, 783-793. LACHAISE, D., HARRY, M., SOLIGNAC, M., LEMEUNIER, F., BENASSI, V. & CARIOU, M. L. (2000). Evolutionary novelties in islands: Drosophila santomea, a new melanogaster sister species from Sao Tome. Proceedings Of The Royal Society Of London Series B-Biological Sciences 267, 1487-1495. LANDER, E. S. & BOTSTEIN, D. (1989). Mapping Mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics 121, 185-199. LLOPART, A., ELWYN, S., LACHAISE, D. & COYNE, J. A. (2002). Genetics of a difference in pigmentation between Drosophila yakuba and Drosophila santomea. Evolution 56, 2262-2277. LUO, Z. W., WU, C. I. & KEARSEY, M. J. (2002). Precision and high-resolution mapping of quantitative trait loci by use of recurrent selection, backcross or intercross schemes. Genetics 161, 915-929. LYONS, P. A., ARMITAGE, N., ARGENTINA, F., DENNY, P., HILL, N. J., LORD, C. J., WILUSZ, M. B., PETERSON, L. B., WICKER, L. S. & TODD, J. A. (2000). Congenic mapping of the type 1 diabetes locus, ldd3, to a 780-kb region of mouse chromosome 3: Identification of a candidate segment of ancestral DNA by haplotype mapping. Genome Research 10, 446-453. MACKAY, T. F. C. (1996). The nature of quantitative genetic variation revisited: Lessons from Drosophila bristles. Bioessays 18, 113-121. . (2001). The genetic architecture of quantitative traits. Annual Review Of Genetics 35, 303-339. . (2004). The genetic architecture of quantitative traits: lessons from Drosophila. Current Opinion In Genetics & Development 14, 253-257. MASLY, J. P. & PRESGRAVES, D. C. (2007). High-resolution genome-wide dissection of the two rules of speciation in Drosophila. Plos Biology 5, 1890-1898. MAURICIO, R. (2001). Mapping quantitative trait loci in plants: Uses and caveats for evolutionary biology. Nature Reviews Genetics 2, 370-381. MCGREGOR, A. P., ORGOGOZO, V., DELON, I., ZANET, J., SRINIVASAN, D. G., PAYRE, F. & STERN, D. L. (2007). Morphological evolution through multiple cis-regulatory mutations at a single. Nature 448, 587-U6. MONFORTE, A. J., FRIEDMAN, E., ZAMIR, D. & TANKSLEY, S. D. (2001). Comparison of a set of allelic QTL-NILs for chromosome 4 of tomato: Deductions about natural variation and implications for germplasm utilization. Theoretical and Applied Genetics 102, 572-590. ORR, H. A. (2001). The genetics of species differences. Trends In Ecology & Evolution 16, 343-350. PARAN, I., GOLDMAN, I., TANKSLEY, S. D. & ZAMIR, D. (1995). Recombinant inbred lines for genetic-mapping in tomato. Theoretical and Applied Genetics 90, 542-548. PATERSON, A. H., DAMON, S., HEWITT, J. D., ZAMIR, D., RABINOWITCH, H. D., LINCOLN, S. E., LANDER, E. S. & TANKSLEY, S. D. (1991). Mendelian factors underlying quantitative traits in tomato - comparison across species, generations and environments. Genetics 127, 181-197.

76

PATERSON, A. H., DEVERNA, J. W., LANINI, B. & TANKSLEY, S. D. (1990). Fine mapping of quantitative trait loci using selected overlapping recombinant chromosomes, in an interspecies cross of tomato. Genetics 124, 735-742. PATERSON, A. H., LANDER, E. S., HEWITT, J. D., PETERSON, S., LINCOLN, S. E. & TANKSLEY, S. D. (1988). Resolution of quantitative traits into Mendelian factors by using a complete linkage map of restriction fragment length polymorphisms. Nature 335, 721-726. SIMPSON, P. (2002). Evolution of development in closely related species of flies and worms. Nature Reviews Genetics 3, 907-917. STERN, D. L. (1998). A role of Ultrabithorax in morphological differences between Drosophila flies. Nature 396, 463-466. . (2000a). Evolutionary biology - The problem of variation. Nature 408, 529-531. . (2000b). Perspective: Evolutionary developmental biology and the problem of variation. Evolution 54, 1079-1091. WRIGHT, S. (1952). The genetics of quantitative variability. In: Quantitative Inheritance (E. C. R. Reeve, & C.H. Waddington, ed). Her Majesty's Stationary Office, London, UK, p. 5-14. ZENG, Z. B. (1993). Theoretical basis for separation of multiple linked gene effects in mapping quantitative trait loci. Proceedings Of The National Academy Of Sciences Of The United States Of America 90, 10972-10976.

77

APPENDIX

Chromosome cyt position

X X X X X X X X X X X X X 2L 2L 2L 2L 2L 2R 2R 2R 2R 2R 2R 2R 2R 2R 2R 2R 2R 2R 3L 3L 3L 3L 3L 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R 3R X X X X X X 8C15 8C4 8B4-B6 17D6 8D1 8D1 8D1 8D2 8D2 8D9 8E10 19C1 20E 32E4-F1 34C4-C6 35A4 46A1 46E1-E3 47B7 36E3 36D2 36D3 36D1 36D2 36A2 37B9 38B1-2 50A13-A14 49A6 57E6 39D3 74C3 72B1-B2 79B1-B2 76C1 80B2 91C5 93E4 93E4 93E1-F1 93E1-F1 93E1-F2 93F1 93F2 93F2 93F3 93F2-F6 93F2-F6 93F2-F6 93F2-F6 93F2-F6 93F2-F6 93F2-F6 84E9 84E6 84E5-E6 84E5 84D8-D9 93F7 84E12-E13 84F1 84F11 84F15 84F16-85A1 85A3 87D9 93F9 93F13 93F14 1A5 6C4-C5 3B1-2 12A7 12B4 13E1

Aprox. physical position (kb)

12255 12280 12533 17307 17690 17700 17720 17720 17730 17840 18070 19330 22200 7765 9998 14459 18210 18598 2546 3008 3288 3300 3508 3509 4595 5526 6523 7561 8600 11807 2025? 1660 1852 2240 20889 23347 3221 6215 6247 6255 6300 6300 6333 6335 6336 6336 6337 6338 6339 6340 6360 6370 6374 6402 6472 6487 6530 7023 7950 8010 8060 8228 8262 8305 8465 13155 18411 18481 18537 183 2530 5760 7773 7920 9695

Name
Mei-P26 Hp1b moe2 bnb_mmr_2 CG12119 Obp8A tan Gr8a CG12124 BCL7 Hex-A AnnX su(f) salr Kuz 2 RAB14 UBA1 egr Rab3 NinaD CadN CadN2 Oli Oli dig Trp2 Rpl30 barr mars Dyb Sara His3 N74 Pka-C3 TyR Tey Ssl1 Mekk1 slou InR mirII/E2F E2F2 E2F2 dig BCGs DNApoI Dpol2 Dpol ms 3UTR CG3116 int 5 CG31176 int 4 CG31176 int 3 CG31176 int 2 CG31176 int 1 CG31176 CG31176 Tom34 CG2791 dsx LDS alpha-Est10 CG34034 puc grn poxm stck PQBP-1 Cenp-C ry burs Gr93a Fit y Mcm6 per Up G2 sog

Forward primer
CAAACGGTTATTTTCGAGTGCAGC CCACTTCATCAGGAACATCAGGTGG CCAAGTGCCAGAAAGAGAGGAGTG CAAAAAGTTGCACCGAAATGGC TGGAATTGCCTGGAGTGCAAG GAATGGCAGGAGGCGTCATTTC GGACTGGTCTTCAGCATCAACAC CCACAATACCAAATGGATCGCCAC CCAGAAACAACACCCTCCCACAAG GCAGTTTATGGCTGTCAGGTGTTC GGTACCCAGCTCTTCGATCA AAACCAGAGAGCTGCCTTCA TGGTGGGCAAAAGTCAAAAT AGCTGACTGATCCCAACCAG CTCTACAACTTCAGAGCCCCAGAC AGAAATATCGGGGCCAGTTT CATCTTCAACCGCATTCCGCTC GCGAAAAACATGACACAACAACCC TCGGTCCTTCTACACCAAGTCGTTC GGATCTTGAGTGGCACGACAATG ACATCCTGCTCATCCAGTTCCCTTC GTGTTTGAGTTTTGGCTGGCAAGG GATTGCTTATCAGTTGAACCGTGG GATTGCTTATCAGTTGAACCGTGG TTAGCCCCCTGGAAAGTGCTCAAC AAGGATTCGTCAAGGCATTCGG GCAGTGCAGGATGAAGATCA GACACTTCAGTTTGACCAGCCC GGAAAACCGAGCGGTGAGTAAG CGACCACAAACCCTGAATTT TTTCAGGACCACAAACCACA GACACCTTTATGTAGCTCACCTTGGG TTTTAGGCAGGGTTGGTAACTCC CAACGAAGCCCAAAGATGGTGC TGTCTGCCAGGAAGTATTTTACGG GGTGCCCAGTAGTGGTGAGT TCCTTCCAGGATCTTTAGCTCTTCG CAGCCACTCGCACTCATAAAATTG GCAGATGGCAGGTGTGACTATTAGC CAAAATTGGGATTCTGGGGGTG GCCGAATATCACCACGATTAACCG GCCGAATATCACCACGATTAACCG TGGTTTCTTCGGTCTTGGAGTGG TAGTTCGTCGGGATTGGTCTCAGC TTCAAACCGCCCAAAGCTGTC TTCAAACCGCCCAAAGCTGTC TGCCATGTCTGTGGCTTACAAG GTTTTCCACATACTGAAGACGCACG GGCAGAGAAGTTGATCGAACCTTG ACAAGGCAAACAAAACTGACTGGC GAGGTTGAGGGCACTTGAAGAGAAG GCCCCTTCACCTCGACGTTTATAC TTTGGCACCCACATTTGACAGC ATGAGTTACAGCAGCGAGTAGCCTG CCGAATTGGAAAGTGGTTTGCTTG AGCAGGAAAGGAGGGATAGAAAAGG TCTGGGCGAGAAAGCCTTAGATGG CACAAAGCTATCGTAATGTCGGGC TTACGGGTTCACCAACATTGTGG TGTGAGTTTGTGTGTGTTTGCCCC AGCTCAGAAACAAAATGCCTGGC GCCAACCTCATTTTGGACGTGTATC TCGATGGAGTAAACATCTGGCAG TGTTTTATAGATGCAGTTCGCCGC TGGCATGTCGGCGTAGTTTATCAG CGCTTTGAGCAAAAATCCA CCTGGATATAACTGGCACAGCGAC CGTAGTGCGGCATATCCTTTGG GAAACGAATGCGAATACGCCC CGCTGCGTGTTTGTTTATTT TCTGATCGTTGTGCCCGATGTG TTCCAGTTCTCCGAATCAGC TGAGGCTGAGGAGAAGAAGCAG CAGCGTGGTGTTCACAATGTGC GCTGGCGTACAACATTGAAA

Reverse primer
CGCCCTCCAACCAAAAACTTTC CTACTTGAAATGGAAGGGCTATCCG TCGAGTCCAAGCAACAGGCATAG ACACCGTGACAAATCGCTGTG GCCCAGTTTGTCCATCATCTGG GGTCACACTCGTGCCTGACATAAAC CACATTGTAGCACATCTGGCGG TCGTACTGGTGTGCCTTTTCAGC CCAGTAGGAACCTTTGGGGAAAAAG CGTTTTCGAGTCAGTTTTATGGGG GGCAATGGCATCCTTTAGAA ATTCTCCTTGCGACGTCTTG AAAATCTTAGCCGCCTGGAC GATGATGCCGTTGGAGAACT AAGTTGCCTGCCGATGCAG TGCAGTCATGTTGGGACCTA GAAAACCTGCCAGTTGGGGATTC CGTGAACGTCGCAGATAGGCTAAC TTATCCCTGTCACGTCTCTGGGAG GAACAGCCATTCAGATGCCGTG CAAAAGTGTTGTCTTGGTGGCGG CCATTTCCACCCATCCTCGTTTTC GCAAAATGCCCTCGAAGAGTTG GCAAAATGCCCTCGAAGAGTTG TTTTGTGTTTGCCCCCAACTGC CGCCCAAGTGACCACGTTTTTG TTGGAGTCCACCTCCAGAAC TGTTCGGTATGCTTCTTGTCCAG ATTTGCTCTGTCTCCTGCTGACGC CATGTTATCCGGCACCCATA CCGTTTGCCCCTTATAAACA TTGCTCATACGTCGTGTTGCGTCA GGCATCCGAAATAATGTTTGCC CTTGCGGAAAAGCGGTTCTTG CGAAGGAGGGATTTTCCACAG GACGCACATTTTCGAGATCA TGCGGCAGGAACGAGTTAGAGATG GCATTCGAGGTTCTAAGCACTAGC CGTAGGAGATTTTCTCGTTTGGCTG GCTCTTCTTGCTAGGCTTTTTCCC CGTGCGAGAGTAGCGGTATTTTTCC CGTGCGAGAGTAGCGGTATTTTTCC TCAGTTTGGCGGTTGCATTTG ACCATATCGCCCTTTTTGTAGCG CCTGCGATTCATGTTCGACCTC CCTGCGATTCATGTTCGACCTC AGAATTTCTGCGTTTGCAGTCG CGGCAATTATATCGTAATGCCTGC TTGCTTACAGCCGTTGCTCTTTG ACAGAGGTGACGATTTGAGGTGGG ATGGGCGGCAATGAAAGAGC TTTGCCCGAAATGTGTGTGACC GAAGTGAAGCGGGAAACCCTACAG GGTTAAATAAGCCAGACCATCGGC CGGGGAAAACAGTCAACCCAACAAC TTGGCTGACTGGCATTCGGTTG ATCGAGTACAGCGATGGTTGCAGC TGGCTCCAGCTATTCTGCATCG GCAGTGTAACATGCACACGGATTG GCTCTGCTTCAAAATAGCGGTGC GCCCAAAACCCCACAAAAAAAC TGGGACGCAGAGTGTTTCCATACC GAAAAGCCCACAGAATGCCG CAAAAGTGCCTCTGTTTAGCAGGC CCAGCACAGAATGACAACCTCTTTG GAAGAACAAGCTCACCACCA GCCACGAGAACAACAAGGTCTTTG GTTGCCTGAATATCCTGTGGCG TCGATTGGATTCACCATGTCCTTC GCGAATGTTCAAAGAATAATTTC TCGGCATCCGTCATCTGCTTCTTC CCTTAGGGCTGAGCCACTCT AGGAAGAGAGAGAGAGACAAATGGG GTGGGCAGTAAGTTATTCGCATGG CTCGGTGGCCACATTCAC

PCR conditions
94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 96 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 54 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 53 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 15min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 15min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 15min x 1, (94 X 30s, 60 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 15min x 1, (94 X 30s, 53.5 x 30 s, 72 x 60s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 58 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57.2 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 57.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 57.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 96 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 57.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57.2 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 53 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 15min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 15min x 1, (94 X 30s, 53 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 96 x 2min x 1, (94 X 30s, 54 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 50 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 54.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 55.9 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 96 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 96 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 2min x 1, (94 X 30s, 55.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 54 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 55.5 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 52 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 55 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 59 x 30 s, 72 x 30s) x35, 72 X 5min x 1 95 x 15min x 1, (94 X 30s, 54.5 x 30 s, 72 x 30s) x35, 72 X 4min x 1 94 x 2min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 2min x 1, (94 X 30s, 56 x 30 s, 72 x 30s) x35, 72 X 5min x 1 94 x 15min x 1, (94 X 30s, 57 x 30 s, 72 x 30s) x35, 72 X 4min x 1

Digest
N/A N/A N/A ClaI N/A N/A N/A N/A N/A N/A HhaI TaqI, 65 NcoI ScrF1 MseI N/A N/A N/A N/A N/A N/A N/A N/A MseI N/A N/A HaeIII N/A N/A HphI MfeI ApoI, 50 N/A N/A N/A BSrI, 65 N/A N/A N/A N/A N/A MseI N/A N/A N/A Ava II N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A SacI N/A N/A N/A AvaII N/A BbvI N/A N/A XhoI

Gel Conditions
PhastGel PhastGel 4% SFR 3% PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel 3% 3% 3% 3% 3% PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel 3% PhastGel PhastGel 3% PhastGel PhastGel 3% 3% 3% PhastGel PhastGel PhastGel 4% SFR PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel 3% PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel PhastGel 3% PhastGel PhastGel PhastGel 3% PhastGel 3% PhastGel PhastGel 3%

Origin
MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW Carbone et al 2005 Carbone et al 2005 Carbone et al 2005 Carbone et al 2005 MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW Carbone et al 2005 MMW MMW Carbone et al 2005 Carbone et al 2005 MMW MMW MMW MMW Carbone et al 2005 MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW MMW Carbone et al 2005 MMW MMW MMW Carbone et al 2005 MMW MMW MMW MMW Carbone et al 2005

78

CHAPTER 3

F RO M QTL

TO

G EN E : C HA R ACTE RI Z ATI O N
A

AND

E VO LU TI O N

OF

TRU FF LE (CG6353), E VO LU TIO N

OF

G EN E L IK E LY

TO BE I N VO LV E D IN THE IN

A BDOM IN AL P IG M EN TATI ON

D RO SO PH IL A

79

ABSTRACT
Further understanding of how morphological diversity evolves requires identifying the genes and the mutations within them underlying variation in quantitative traits. Previously, I had narrowed a QTL on chromosome 3 affecting abdominal pigmentation variation between D. yakuba and D. santomea to five genes. In this chapter, I test the possible role of these genes in the determination of abdominal pigmentation through functional assays in D. melanogaster. In these assays, I tested changes in abdominal pigmentation levels with multivariate statistics on measures of luminance (pigmentation darkness) and pigmented surface area in the abdomen. The results suggest only one of these genes affects abdominal pigmentation through repression. This gene, now named truffle (CG6353), had no known function but is highly conserved across cellular organisms suggesting it might have other important functions. A sequence alignment for truffle in D. yakuba and D. santomea revealed significant variation in intergenic regions, introns and UTRs but no coding differences. truffle is likely to be one of the loci that evolved between these species generating variation in abdominal pigmentation; an ongoing rescue experiment in these species might support this hypothesis.

80

INTRODUCTION
Studying the genetic basis of morphological variation can produce important insights into evolution by connecting genetics, developmental biology and phenotypic diversity. As described in the previous chapter, Drosophila santomea is the only species within the melanogaster species subgroup that has lost most of its abdominal pigmentation. A QTL mapping between D. santomea and its sibling, fully pigmented species D. yakuba, identified 4 different QTLs affecting pigmentation variation in males (Carbone et al., 2005). Through the generation of introgression lines, 2 orders of magnitude higher resolution was obtained for a QTL on chromosome 3 (QTL3 left): its original 2 LOD confidence interval (approximately 32 Mb) was reduced in this way to a 27kb interval encompassing 5 genes only (Figure 1). In this chapter, I show through assays in D. melanogaster how only one of these genes affects abdominal pigmentation. Therefore, this gene of previously unknown function is probably one of the loci that lead to the evolutionary loss of abdominal pigmentation in D. santomea. It is generally assumed that the genetic regulation of homologous processes is directly comparable between closely related species (Simpson, 2002). Because D. santomea and D. yakuba are closely related to D. melanogaster, it is possible to draw upon the extensive functional and molecular tools developed for this model organism to study some aspects of the genetic basis of pigmentation differences between them. When working with a small interval such as the one delimited for QTL3 (chapter 2), it is possible to directly assay every gene instead of selectively study candidates, or previously studied genes likely to play a role in the development of the trait of study. In the interval for QTL3, three of the genes have no function (CG15497, CG6353, CG31176), and the other two, though well studied, have no known role in pigmentation (DNApol Alpha 180, E2F) (Figure 1). To determine whether any of these genes are 81

82

involved in the deposition of pigment in the abdomen in Drosophila I tested their effect on abdominal pigmentation patterns and levels through deletions, disruptions, and mRNA level manipulation (silencing and over-expression). As abdominal pigmentation in Drosophila is a highly plastic trait (Das et al., 1993; Crill et al., 1996; Gibert et al., 1998a; Gibert et al., 1998b; Gilbert et al., 1999; Gibert et al., 2000; Chakir et al., 2002; Gibert et al., 2007), most functional assays were complemented with a quantitative analysis to properly evaluate phenotypic effects. Here I show how only CG6353, that I will name truffle, affects pigmentation and is thus likely to be involved in the evolution of pigmentation loss in D. santomea.

METHODS
DROSOPHILA STRAINS AND EXPERIMENTS Functional assays in Drosophila melanogaster Deletion of whole region: stock number 7665 (w[1118]; Df(3R)Exel6186, P{w[+mC]=XP-U}Exel6186/TM6B, Tb[1]), obtained through Bloomington stock center. This stock carries a deficiency for all 5 genes within the interval of interest. I crossed this stock to a wild type D. melanogaster and to a yellow and tan D. melanogaster double mutant (yt5jj). As all the candidates genes are deleted in this stock, the male offspring resulting from theses crosses (individuals carrying the deletion and a full normal chromosome) should present different levels and/or patterns of abdominal pigmentation in comparison to the wild or yt5jj parental stock. Disruption of CG31176: stock number 14457 (y[1] w[67c23]; ry[506] P{y[+mDint2] w[BR.E.BR]=SUPor-P}KG05782), obtained through Bloomington stock center. This stock carries a P-element insertion that disrupts the normal functioning of CG31176. I crossed this stock to wild type and a y- D. melanogaster stocks. If this gene affects pigmentation, male offspring resulting from this (carrying the P-element insertion and a 83

full normal chromosome) would present different levels and/or patterns of abdominal pigmentation in comparison to the wild or y- parental stock. Overexpression for CG31176: Stock number EP3662 (P{EP}CG31176EP3662), obtained through Szeged Stock Center. This stock was crossed to a heat-shock Gal4 (hsGal4) to over express CG31176. If this gene affects pigmentation, over-expressing it will change pigmentation levels and/or patterns in males. Disruption of DNApol ! 180: stock number NP:280, obtained through Tokyo Stock Center. This stock carries a Pelement insertion that disrupts the normal functioning of DNApol !180. I crossed this stock to wild type and a y- D. melanogaster stocks If this gene affects pigmentation, male offspring resulting from theses crosses (individuals carrying the Pelement insertion and a full normal chromosome) would present different levels and/or patterns of abdominal pigmentation in comparison to the wild or y- parental stock. Disruption of CG6353: stock number C01013, (y[1] w[67c23]; ry[506] P{y[+mDint2] w[BR.E.BR]=SUPor-P}KG05782) from the Exelixis collection, Harvard Medical School. This stock carries a P-element insertion that disrupts the normal functioning of CG6353. I crossed this stock to wild type D. melanogaster and to a yellow and tan D. melanogaster double mutant (yt5jj). If this gene affects pigmentation, male offspring resulting from theses crosses (individuals carrying 84

85

the disruption and a full normal chromosome) would present different levels and/or patterns of abdominal pigmentation in comparison to the wild or yt5jj parental stock. RNAi lines for each of the 5 genes of interest: E2F: stock number 15886, and 15887 CG 15497: stock number 12663, 12664, and 41584 CG6353: stock number 40363 and 40364 DNApol!180: stock number 11227 CG31176: stock number 33782 These lines were obtained through VDRC, Austria. All stocks are heterozygote, carrying a balancer depending on the chromosome carrying the insertion. Each contains an inducible UAS-RNAi construct against the gene of interest allowing to down-regulate its expression (Dietzl et al., 2007). All of the stocks were crossed to a homozygous hs Gal4 and kept at 25C. Pupae were collected with a moist brush immediately after puparation formation and kept covered with a moist piece of tissue paper in a small Petri dish and were heat-shocked every 24h during pupal development by submerging the Petri dish for 2 hours in a water bath at 86

37C. If any of these genes affect pigmentation, male offspring resulting from theses crosses carrying the RNAi and the Gal4 inducer would present different levels and/or patterns of abdominal pigmentation in comparison to their siblings carrying only the RNAi and the balancer. Further experiments were only conducted on stock 40364 (for gene CG6353, see results), as this gene was the only one to show changes in pigmentation levels in the assay described above. To be able to compare pigmentation level changes within the same individual, stock 40364 was crossed to a pannier Gal4 stock (yw, pnr Gal4/TM3 UAS y). In this case, Gal4 is only expressed in the PNR domain, so that the affected tissue is only along the dorsal midline. UAS line for CG6363: As CG6353 was the only gene to show pigmentation changes in other assays (an increase in pigmentation level, see results), I made a stock to be able to over-express this gene. The D. melanogaster cDNA (BDGP, SD28072) (Rubin et al., 2000; Stapleton et al., 2002) was inserted into the vector PUASTattB to use with the PhiC31 integrase system (Bischof et al., 2007). This vector includes a UAS sequence that allows for spatio/temporal expression with the Gal4 system. First, the D. melanogaster cDNA was excised through digestion with BglII and XhoI and the recipient vector PUASTattB was cut with these same enzymes. Second, the cDNA was ligated into the recipient vector using T4 DNA ligase (New England BioLabs Inc.), and the construct transformed into JM109 competent cells (Promega Inc.). Finally, the construct was confirmed through sequencing. D. melanogaster eggs (M{3xP3-RFP.attP} ZH-51D with M{vas-int.DmZH-2A}) were then injected with this construct (through BestGene Inc., stock number 24483). Five transgenic lines were generated and balanced with yw; cyo. One of these stocks (UAS CG6353-1) was crossed to a homozygous hsGal4 (offspring were heat shocked in a 37C water bath for two hours every 24h during pupal development) and a pannier Gal4 (yw, PNR Gal4/TM3 Sr UAS 87

Y). If this gene affects pigmentation as suggested by the RNAi experiments, then male offspring resulting from theses crosses carrying the UAS construct and the Gal4 inducer, will present lower levels of abdominal pigmentation in comparison to their siblings with a different genetic makeup. Drosophila yakuba and Drosophila santomea We used one strain for each species obtained through the Tucson Stock Center (stock number 14021-0261.00 for D. yakuba, and stock number 14021-0271.00 for D. santomea). IMAGE CAPTURE AND ANALYSIS To image the variation in abdominal pigmentation, 2 to 4 day old male flies were pinned to a small apple juice plate filled with a 2% Triton-X solution with their abdomens facing up using #000 insect pins. Three to five pictures were then captured at different depths of field with a digital camera (Photometrics Coolsnap cf) connected to a Nikon E 1000 microscope at 40x. Light conditions were kept constant with a ring light attached to the microscopes objective. With the help of IPlab software (version 3.9.4 r2), the pictures were combined (3D extended focus) into a single image showing the whole abdomen in focus. To quantify the variation in abdominal pigmentation, each image was digitized using ImageJ 1.41 (Wayne Rasband, NIH available at http://rsb.info.nih.gov/ij) (Figure 2). The different measurements were analyzed separately and also using Principal Component Analysis (PCA). Only principal components with an Eigenvalue >1 were considered significant (Jackson, 1993), and they were rotated with varimax to enhance variable clustering while maintaining orthogonality. Differences between treatments were tested using one-way ANOVA followed by Tukey-Kramer HSD (honestly significance difference) to establish post facto which pairs of means are significantly different at Alpha 0.05. Using the Shapiro-Wilk W test, all data sets were tested for

88

normality before further analysis. JMP (Version 7.01, SAS) was used for all statistical analyses.

SEQUENCE ANALYSIS Primer design, sequence alignment and other sequence analyzes were performed on Geneious (version 4.0.2, Biomatters Ltd.). All sequencing was outsourced to GENEWIZ, 89

Inc. (South Plainfield, NJ). To examine the evolution of truffle (CG6353), I performed a Linnaeus Blast on the truffle and DNApol!180 using Geneious. This analysis does a simple Blastp search in National Center for Biotechnolgy Information (NCBI) database, aligns the compiled sequences, and presents the results as nested taxonomic boxes and gene phylogenies allowing the visualization of the evolutionary relationships between different hits.

Table 1: Summary of morphological measurements for the four genotypes studied in the wholebody manipulation of expression assays in D. melanogaster. RNAi test (UAS RNAi truffle/hsGal4) RNAi control (UAS RNAi truffle/TM3), UAS test (UAS truffle; hsGal4), and UAS control (UAS truffle; TM3).
RNAi test Mean gray value dorsal midline Height of pigmented band A4 Height of pigmented band peak A4 Mean gray value A4 Height of pigmented band A3 Height of pigmented band peak A3 Mean gray value A3 Height of pigmented band A2 Mean gray value A2 A1 width Mean gray value A1 37.64 7.59 54.659.76 101.1613.83 29.994.78 43.305.90 83.5811.26 40.378.05 34.464.21 46.9510.17 317.2124.80 79.7814.71 RNAi control 50.58 10.38 36.826.08 96. 52 12.61 48.569.47 27.145.13 50.0112.97 50.387.45 16.565.05 55.7410.99 310.6524.42 79.7113.08 UAS test 71.27 20.57 39.923.07 82.2427.00 70.2520.36 30.7410.75 65.7120.12 71.3416.91 12.055.32 72.3829.43 328.3814.50 96.2520.67 UAS control 78.51 14.21 45.813.94 93.1514.83 81.1515.75 35.645.64 66.358.06 83.9016.81 17.605.13 78.0216.90 317.5129.41 143.5618.09

RESULTS
FUNCTIONAL ASSAYS IN DROSOPHILA MELANOGASTER In functional assays of individual genes, only truffle (CG6353) consistently affected pigmentation levels, and its effect matched the observation from the interval deletion (Figure 3). The deletion of the five genes within the interval increases pigmentation levels in the abdomen of males (Figure 4). The disruption of truffle also 90

increased pigmentation levels in the abdomen when compared to a yellow and tan double mutant stock (Figure 4). Through manipulations of mRNA levels for truffle (silencing and over-expression) it was possible to replicate this pattern in a fully wild type background for yellow and tan as well as to generate the reciprocate effect, a decrease in pigmentation (Table 1). PCA on the combined data set for down-regulation and overexpression of truffle yielded 3 PCs explaining 78.9% of the total variation in the data set (Table 2). The first two PCs are highly correlated with pigmentation variables, while PC3 explains primarily body size. All variables related to luminance (pigmentation darkness) were highly correlated and load positively with PC1 while variables related to pigmented area load with PC2. Variables associated positively with PC1 are negatively correlated with PC2 and vice-versa indicating that luminance and pigmented area are negatively correlated (i.e. the darker the abdomen, the more surface area is pigmented - low values of luminance indicate darker pigmentation). As indicated by the low loading of most variables in PC3, A1 width is loosely associated with pigmentation (Table 2). Down regulating truffle significantly increased pigmentation levels, while its over-expression significantly decreased pigmentation levels (Figure 5). In the tissue specific assays using pnrGal4 to knockdown or over-express truffle, mean gray value along the dorsal midline differed significantly across the different treatments (one-way ANOVA, F (3, 77) = 102.53, P< 0.001). A Tukey-Kramer HSD post-hoc test reveals that all groups differ significantly from one another at p < 0.05. (Figure 6). Some individuals in this assay presented pronounced deformities along the dorsal midline (Figure 7). SEQUENCE ANALYSIS I performed Linnaeus Blast search and sequence alignment (Geneious version 4.0.2) for the truffle protein, and for comparison I performed to same analysis on the

91

DNA!180 protein from D. melanogaster. DNA!180 is a gene involved across cellular organisms in DNA strand elongation during replication and thus its sequence is likely to

be highly conserved (Table 3). The 116 hits for truffle belonged to a large variety of cellular organisms including Metazoa, Fungi, Bacteria and Archea. In comparison to the results for DNA!180, these 116 sequences revealed a surprisingly high degree of conservation across taxa: while across all cellular organisms their minimal identity is similar, at lower taxonomic levels truffle shows consistently a higher identity conservation than DNA!180 (Table 3). An alignment of 16 of these sequences from a variety of taxa shows domains scattered along the protein of high conservation (Figure 8). A basic sequence alignment revealed no differences in the coding region of truffle 92

between D. yakuba and D. santomea, but many single nucleotide polymorphisms (SNPs) and small indels in the intergenic regions, UTRs, and introns (Figure 9).

DISCUSSION
Only one of the 5 genes within the interval for a QTL on chromosome 3 involved in the evolutionary loss of pigmentation in D. santomea affects pigmentation levels in D. melanogaster. This gene, truffle (CG6353), is highly conserved across cellular organisms. There are no differences in the coding region of this gene between D. yakuba and D. santomea suggesting that if this locus is partly responsible for the evolutionary loss of pigmentation in D. santomea the relevant changes will reside in its cis-regulatory region.

Table 2: Results from a principal component analysis of size and abdominal pigmentation
variables in whole-body down-regulation and over-expression assays of truffle in D. melanogaster.
PC1 Eigenvalue % of variation explained Loadings Midline mean gray value A4 midline maximum height A4 midline mean gray value A4 pigmented band height A3 midline maximum height A3 midline mean gray value A3 pigmented band height A2 pigmented band height A2 midline mean gray value A1 width A1 mean gray value 5.29 48.11 0.90 -0.18 0.91 -0.02 -0.21 0.97 -0.06 -0.53 0.87 0.08 0.73 PC2 2.23 20.25 -0.23 0.53 -0.25 0.88 0.84 -0.04 0.88 0.65 -0.18 -0.11 -0.02 PC3 1.16 10.54 0.06 -0.23 0.11 -0.16 0.05 0.07 0.01 0.14 0.01 0.94 0.55

93

After identification of a broad chromosomal region through QTL analysis, the frequently conserved roles of genes across taxa and the profound understanding of development in model organisms might allow an educated guess to point at a known locus at which genetic variation might be responsible at least in part for the variation at the character of interest. The candidate gene approach is based on the phyletic phenocopy paradigm or the hypothesis that changes in morphology or physiological response in non-model organisms will mimic the phenotypes in closely related model organisms (reviewed in Desalle & Carew, 1992; Haag & True, 2001). The application of the candidate gene approach, though effective in a number of cases (i.e. Kopp et al., 2000; Shapiro et al., 2006; Miller et al., 2007; Jeong et al., 2008), is rather limited by the pre-existing understanding of the underlying pathways leading to phenotypic expression of the trait. Even in the better studied model organisms such as Drosophila, many predicted genes exist with unknown functions (Mackay, 2001) such as truffle. Forward, high-resolution mapping was essential for the identification of this gene as a loci possibly involved in the evolution of abdominal pigmentation differences between D. yakuba and D. santomea. Candidate gene approach in this case would have been misleading, as at least 7 genes known to affect pigmentation fall within this QTLs confidence interval (Carbone et al., 2005). Functional assays for truffle clearly show that this gene is involved in abdominal pigmentation deposition. Its effects were primarily observed in the segments A2, A3, A4. Manipulation of this genes mRNA levels modified both the total surface area covered in 94

95

pigmentation and how dark the pigment is. These two aspects are correlated, so that an increase in the pigmented bands in each segment involved a decrease in luminance (and thus an increase in pigmentation darkness). As silencing truffle increased pigmentation levels, while its over-expression decreased pigmentation levels it is likely that truffle acts as normally as a pigmentation repressor. Though In situ stainings in QTL3 introgression lines for major structural genes involved in pigmentation suggest that ebony is a trans target of the gene underlying QTL3 (Mark Rebeiz, personal communication), the details of the role of truffle in the pigmentation pathway remain to be investigated. Pronounced deformities observed in some of the functional assays and the highly conserved sequence of this gene across all cellular organisms suggests truffle might have other important functions. truffle is a member of the protein family archease, whose members present highly conserved polar residues likely to present catalytic activity (Canaves, 2004). Structural analyses of ortholog of this gene suggest this gene might be a protein chaperone (Canaves, 2004; Auxilien et al., 2007)

Table 3: Comparison of the conservation level of truffle and DNA!180 across cellular
organisms.
# seq Identity and E-value range Metazoa Drosophilidae melanogaster species subgroup Homo

truffle DNApol! 180

116 822

24.8% to 100%, 2.3 20.7% to 100%, 0 ! 72 e- ! E-value ! 9.6 7 E-value ! 4.2 e7 e-

Quantification of the

essential, especially when the trait is particularly variable as in the case of abdominal pigmentation. Even though in this study temperature and age, the main factors influencing plastic pigmentation variation in Drosophila (Das et al., 1993; Crill et al., 1996; Gibert et al., 1996; Gibert et al., 2007) were controlled, most pigmentation 96

46.2% ! 85.9% ! 21.4% ! 23.8% ! identity ! identity ! identity ! identity ! 100%, n = 100%, n = 13 observed 100%, phenotypic n = 100%, changes n = 44 19 205

87.8% ! identity ! 24.1% ! identity ! 100%, n = 8 100%, n = 24

during functional

47.3%! 24.8% ! identity ! identity ! 65.4%, assays 39.2%, is n = n=11 11

97

variables showed high variance within presumably isogenic groups. Also, control groups were often distinct from one another suggesting pigmentation is highly sensitive to genetic background. Therefore, high variability in abdominal pigmentation patterns, presumably because of environmental effects and genetic background could have been biased the conclusions from these assays without proper quantification. Functional assays for truffle in D. melanogaster suggest that the evolutionary changes in D. santomea might involve a gain of function: silencing truffle increased pigmentation levels, while over-expressing it decreased pigmentation levels. Thus, in D. santomea, loss of pigmentation is likely associated with increased expression levels of truffle. There are no differences in the coding region of truffle between D. santomea and D. yakuba, so any evolutionary changes at this locus would involve cis-regulatory modifications and thus consistent with the hypothesis that because of low pleiotropic effects, long term evolutionary change favor mutations in cis-regulatory regions(Stern, 2000; Sucena & Stern, 2000; Sucena et al., 2003; Hoekstra & Coyne, 2007; Rockman & Stern, 2008; Stern & Orgogozo, 2008; Stern & Orgogozo, 2009). Ongoing experiments will soon reveal whether truffle is indeed one of the loci that evolved between D. yakuba and D. santomea to modify abdominal pigmentation patterns between these two species. A rescue construct (approx. 7.5 kb, truffle plus intergenic regions from D. santomea in a EYFP Pbac) was injected into a QTL3 introgression line (carrying only a small fragment of D. yakuba DNA corresponding to the left side of QTL3 in D. santomea background). Using the introgression line rather than D. yakuba will make any changes in abdominal pigmentation more obvious as all other genes affecting pigmentation between these species are absent. As a control, the same protocol, but with the equivalent D. yakuba insert, was carried out. Identifying the remaining major genes involved in the evolution of abdominal pigmentation loss in D. santomea is feasible with the methods described here and in 98

Chapter Two; this would be the first time that such information would be available for variation in a interspecific quantitative trait. Mapping is a relatively unbiased approach to examining the genetic basis of phenotypic variation and facilitates the discovery of novel genes. Defining small intervals allows carrying out functional tests in all the included genes. At least another four loci already isolated into introgression lines are involved in the evolution of abdominal pigmentation differences between these species. Identifying these would constitute a unique data set useful for examining directly the genetic architecture of evolution, or the role of pleiotropy and other standing, major questions in evolutionary biology.

99

LITERATURE CITED
AUXILIEN, S., EL KHADALI, F., RASMUSSEN, A., DOUTHWAITE, S. & GROSJEAN, H. (2007). Archease from Pyrococcus abyssi improves substrate specificity and solubility of a tRNA m(5)C Methyltransferase. Journal Of Biological Chemistry 282, 1871118721. BISCHOF, J., MAEDA, R. K., HEDIGER, M., KARCH, F. & BASLER, K. (2007). An optimized transgenesis system for Drosophila using germ-line-specific phi C31 integrases. Proceedings Of The National Academy Of Sciences Of The United States Of America 104, 3312-3317. CANAVES, J. M. (2004). Predicted role for the archease protein family based on structural and sequence analysis of TM1083 and MTH1598, two proteins structurally characterized through structural genomics efforts. Proteins-Structure Function and Bioinformatics 56, 19-27. CARBONE, M. A., LLOPART, A., DEANGELIS, M., COYNE, J. A. & MACKAY, T. F. C. (2005). Quantitative trait loci affecting the difference in pigmentation between Drosophila yakuba and D. santomea. Genetics 171, 211-225. CHAKIR, M., CHAFIK, A., GIBERT, P. & DAVID, J. R. (2002). Phenotypic plasticity of adult size and pigmentation in Drosophila: thermosensitive periods during development in two sibling species. Journal Of Thermal Biology 27, 61-70. CRILL, W. D., HUEY, R. B. & GILCHRIST, G. W. (1996). Within- and between-generation effects of temperature on the morphology and physiology of Drosophila melanogaster. Evolution 50, 1205-1218. DAS, A., MAHAPATRA, N. & PARIDA, B. B. (1993). Growth temperature and abdominal pigmentation in females of Indian Drosophila melanogaster. Drosophila Information Service 72, 128-129. DESALLE, R. & CAREW, E. (1992). Phyletic Phenocopy And The Role Of Developmental Genes In Morphological Evolution In The Drosophilidae. Journal Of Evolutionary Biology 5, 363-374. DIETZL, G., CHEN, D., SCHNORRER, F., SU, K. C., BARINOVA, Y., FELLNER, M., GASSER, B., KINSEY, K., OPPEL, S., SCHEIBLAUER, S., COUTO, A., MARRA, V., KELEMAN, K. & DICKSON, B. J. (2007). A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151-U1. GIBERT, J.-M., PERONNET, F. & SCHLOTTERER, C. (2007). Phenotypic plasticity in Drosophila pigmentation caused by temperature sensitivity of a chromatin regulator network. PLoS Genet 3, e30. GIBERT, P., MORETEAU, B. & DAVID, J. R. (2000). Developmental constraints on an adaptive plasticity: reaction norms of pigmentation in adult segments of Drosophila melanogaster. Evolution & Development 2, 249-260. GIBERT, P., MORETEAU, B., DAVID, J. R. & SCHEINER, S. M. (1998a). Describing the evolution of reaction norm shape: Body pigmentation in Drosophila. Evolution 52, 1501-1506. GIBERT, P., MORETEAU, B., MORETEAU, J. C. & DAVID, J. R. (1996). Growth temperature and adult pigmentation in two Drosophila sibling species: An adaptive convergence of reaction norms in sympatric populations? Evolution 50, 23462353. . (1998b). Genetic variability of quantitative traits in Drosophila melanogaster (fruit fly) natural populations: analysis of wild-living flies and of several laboratory generations. Heredity 80, 326-335. 100

GILBERT, P., MORETEAU, B., MUNJAL, A. & DAVID, J. R. (1999). Phenotypic plasticity of abdominal pigmentation in Drosophila kikkawai: Multiple interactions between a major gene, sex, abdomen segment and growth temperature. Genetica (Dordrecht) 105, 165-176. HAAG, E. S. & TRUE, J. R. (2001). Perspective: From mutants to mechanisms? Assessing the candidate gene paradigm in evolutionary biology. Evolution 55, 1077-1084. HOEKSTRA, H. E. & COYNE, J. A. (2007). The locus of evolution: Evo devo and the genetics of adaptation. Evolution 61, 995-1016. JACKSON, D. A. (1993). Stopping rules in principal components-analysis - a comparison of heuristic and statistical approaches Ecology 74, 2204-2214. JEONG, S., REBEIZ, M., ANDOLFATTO, P., WERNER, T., TRUE, J. & CARROLL, S. B. (2008). The evolution of gene regulation underlies a morphological difference between two Drosophila sister species. Cell 132, 783-793. KOPP, A., DUNCAN, I. & CARROLL, S. B. (2000). Genetic control and evolution of sexually dimorphic characters in Drosophila. Nature 408, 553-559. MACKAY, T. F. C. (2001). The genetic architecture of quantitative traits. Annual Review Of Genetics 35, 303-339. MILLER, C. T., BELEZA, S., POLLEN, A. A., SCHLUTER, D., KITTLES, R. A., SHRIVER, M. D. & KINGSLEY, D. M. (2007). cis-regulatory changes in kit ligand expression and parallel evolution of pigmentation in sticklebacks and humans. Cell 131, 11791189. ROCKMAN, M. V. & STERN, D. L. (2008). Tinker where the tinkering's good. Trends In Genetics 24, 317-319. RUBIN, G. M., HONG, L., BROKSTEIN, P., EVANS-HOLM, M., FRISE, E., STAPLETON, M. & HARVEY, D. A. (2000). A Drosophila complementary DNA resource. Science 287, 2222-2224. SHAPIRO, M. D., MARKS, M. E., PEICHEL, C. L., BLACKMAN, B. K., NERENG, K. S., JONSSON, B., SCHLUTER, D. & KINGSLEY, D. M. (2006). Genetic and developmental basis of evolutionary pelvic reduction in threespine sticklebacks (vol 428, pg 717, 2004). Nature 439, 1014-1014. SIMPSON, P. (2002). Evolution of development in closely related species of flies and worms. Nature Reviews Genetics 3, 907-917. STAPLETON, M., LIAO, G. C., BROKSTEIN, P., HONG, L., CARNINCI, P., SHIRAKI, T., HAYASHIZAKI, Y., CHAMPE, M., PACLEB, J., WAN, K., YU, C., CARLSON, J., GEORGE, R., CELNIKER, S. & RUBIN, G. M. (2002). The Drosophila gene collection: Identification of putative full-length cDNAs for 70% of D-melanogaster genes. Genome Research 12, 1294-1300. STERN, D. L. (2000). Perspective: Evolutionary developmental biology and the problem of variation. Evolution 54, 1079-1091. STERN, D. L. & ORGOGOZO, V. (2008). The loci of evolution: How predictable is genetic evolution ? Evolution 62, 2155-2177. . (2009). Is Genetic Evolution Predictable? Science 323, 746-751. SUCENA, E., DELON, I., JONES, I., PAYRE, F. & STERN, D. L. (2003). Regulatory evolution of shavenbaby/ovo underlies multiple cases of morphological parallelism. Nature 424, 935-938. SUCENA, E. & STERN, D. L. (2000). Divergence of larval morphology between Drosophila sechellia and its sibling species caused by cis-regulatory evolution of ovo/shaven-baby. Proceedings Of The National Academy Of Sciences Of The United States Of America 97, 4530-4534.

101

OVERALL DISCUSSION , CONCLUSIONS AND FUTURE RESEARCH

OVERALL DISCUSSION AND CONCLUSIONS In my dissertation, I examined the genetic basis of eye size/shape and abdominal pigmentation variation between closely related species of Drosophila. From a methodological and conceptual point of view, my research highlights the challenge of phenotyping and the value of simple crossing schemes in the study of the genetic basis of complex traits. Making use of these insights, I generated for the first time a highresolution map for most of the genes involved in the evolution of a complex morphological difference between species. This technique might facilitate the rapid identification of genes underlying quantitative traits, as exemplified here by linking a gene of previously unknown function to the determination of pigmentation in Drosophila. Chapter one was an investigation of quantification methods for QTL mapping of shape and size variation in the eye, a complex 3D morphological structure. All the methods considered have their caveats and it is likely that this will always be the case in studies on other traits with such characteristics. This chapter, however, alludes to conceptual and methodological issues likely to be important in most mapping studies of complex traits. The phenotype is a broad term often loosely defined. D. mauritiana, the species used in chapter one, has larger, differently shaped eyes than its sibling D. simulans. An attempt at translating this variation into quantitative variables revealed variation in the number of ommatidia, eye length, eye width, distance between the eyes, and prominence of the top-tier of the eye, among others. It is likely this also involves differences in other aspects that were not investigated, such as brain size, differing ommatidia composition of the eye, ommatidia size and distribution, or vision acuity. So eye size and shape, originally conceived as one or maybe two traits, become a long list

102

of phenotypes and raise the issue of the possible impacts of using one variable over the others in mapping. Probably the most interesting strategy, given unlimited resources, would be to actually map all of these variables, as it would be possible in this way to examine particularly interesting aspects about the evolution of complex traits. Many of these variables are correlated, as indicated by the scaling and PCA analyses. One obvious question is whether the observed phenotypic correlations involve developmental and genetic correlations: are all these variables determined by the same developmental network? If not, is there some sort of master gene regulating them and causing the observed correlations? Are the same genes dictating variation within them? How important is pleiotropy in these relationships? Because so much information already exists about the development of the Drosophila eye, answering some of these questions might be feasible and provide some insights into how sets of associated phenotypes can evolve. Chapter two and three demonstrate that repeated backcrossing coupled with selection is a better approach to genetic mapping than traditional QTL approaches. Through this technique, three out of four QTLs were isolated into an identical background, thus turning a quantitative trait into a collection of monogenic traits that are easily mapped. By simply defining the breakpoints of the introgressed regions, it was possible to narrow each QTL to a fraction several orders of magnitude smaller than the original confidence interval. In addition, using this technique, it was possible to overcome another shortcoming of traditional QTL mapping: discriminating between multiple loci underlying a single QTL peak. Chapter three underscores the value of the introgression lines for identifying the actual genes underlying QTLs. Because of the significantly smaller intervals obtained, it was possible to test every single gene for function, thus avoiding possible biases from candidate gene approaches and facilitating the discovery of novel genes. In this particular case, the original QTL map was useful to

103

identify the starting point for mapping the introgression lines otherwise, such an endeavor might have required just as much effort as generating a QTL map. Toward this end, the Stern lab has been developing CGH mapping arrays for sets of sibling species within the melanogaster species subgroup that will allow for an efficient and quick survey of the genetic make up of a hybrid individual. How applicable repeated backcrossing coupled with selection will be to mapping the genetic basis of other traits remains to be tested. The main challenge in elucidating the genetic basis of other traits is likely to be properly quantifying their variation. Abdominal pigmentation variation between D. santomea and D. yakuba is simple in this regard the phenotype of the hybrids is rather discrete and most QTLs produced a visibly tractable phenotype. In a more traditional quantitative trait, for instance height, it might be harder to associate a unique phenotype to a particular locus. Also, a mappable locus has to produce a large enough phenotypic effect on its own so that it can be detected and selected for. In the case of abdominal pigmentation, QTLXa, possibly because of its small effect, could not be isolated into introgression lines. Most QTL studies report a few QTLs of medium or large effect that might be easy to score on their own, but also a variable number of QTLs of small effect that might behave in a similar way to QTLXa (e.g. Tanksley, 1993; Doebley et al., 1997; True et al., 1997; Zeng et al., 2000; Fishman et al., 2002; Kerje et al., 2003). Therefore, to map a given QTL down to specific genes, especially when the magnitude of their effect is small, the most accurate and sensitive phenotyping method is desirable. As discussed in relation to Chapter one, identifying the best alternative for phenotyping can be challenging and might require some extensive research before delving into actual mapping. QTL studies suggest the evolution of quantitative traits between species might often involve a smaller number of loci than variation in the same trait within species (Stern & Orgogozo, 2008; Stern & Orgogozo, 2009). The genetic abdominal

104

pigmentation variation between D. yakuba and D. santomea, determined primarily by five genes, supports this idea. Because of its relatively simple genetic determination and with the techniques outlined in Chapters two and three, it might be possible to map most of these effects. I am in the process of finishing an experiment that might prove that truffle (CG6353), shown here to affect pigmentation (Chapter three) is the locus underlying the left side of QTL3 affecting abdominal pigmentation variation between D. yakuba and D. santomea. My collection of introgression lines might facilitate mapping most the remaining unknown effects. Such a unique data set could offer insights into many unsolved questions about the general patterns governing morphological evolution. FUTURE RESEARCH In the previous section, I outlined some possible interesting avenues for future research on the two projects I examined for my dissertation. These are a continuation of the same aspects I investigated in my thesis. Yet a comprehensive understanding of how phenotypic differences between species are generated also requires identifying the reason why such differences exist and how such variants spread through populations and became fixed. This involves understanding issues such as the importance of population processes and the role of natural selection in the evolution of genetic variant, or the relationship between genetic variation within and between species. Molecular evolution studies have found considerable evidence that positive selection has acted on DNA sequence polymorphisms (Hellberg et al., 2000; Malik & Henikoff, 2005; Vermaak et al., 2005; Ponting & Lunter, 2006; Presgraves, 2006; Schully & Hellberg, 2006), but these approaches do not identify the functional consequences or the selective forces involved. Conversely, traditional field studies connect natural phenotypic variation with specific adaptive values in the wild, but do not usually delve into the genetic differences producing this variation. To fully understand the proximate and ultimate causes of

105

evolutionary change, it is important to address the variation at the nucleotide level in a gene sequence, the resulting functional basis upon which selection can operate, the possible fitness advantage of the resulting phenotype, and how population processes affect the frequencies of the different variants. This formidable task is slowly being achieved by bridging different fields. A good example concerns the fusion of molecular genetics and evolutionary ecology (Shimizu, 2002; Greenberg & Wu, 2006). For example, in Darwins finches, ecological diversification correlates with differences in beak size and shape that allow the different species to exploit a variety of ecological niches (Grant, 1999). The expression of Bmp4 in the mesenchyme of the upper beak of some of the Darwins finches is associated with the development of species-specific beak characteristics, so that species expressing earlier and higher levels of this protein develop deeper and broader beaks (Abzhanov et al., 2004). Bmp4 seems to also play a role in the determination of beak size and shape in other species of birds (Wu et al., 2004) and in cichlid fish (Albertson et al., 2005; Albertson & Kocher, 2006; Streelman & Albertson, 2006). More recently, Abzhanov et al (2006) showed that regulation of the CaM dependent pathway also played a role in the evolution of Darwin finch species, as higher expression of this pathway is correlated with the natural development of the elongated beak morphology of the cactus finch, and its artificial upregulation also replicates this phenotype in the upper beak of chicks. In sticklebacks, similar studies have revealed the genetic basis of morphological diversification in the pelvis (Shapiro et al., 2003; Shapiro et al., 2004; Shapiro et al., 2006), upper jaw morphology (Shapiro et al., 2002), and armor plating (Colosimo et al., 2004); all ecologically relevant characters. This kind of research is currently limited to a handful of groups where the required molecular tools and detailed studies of wild populations exist.

106

Even though Drosophila is traditionally a model system for laboratory studies, it is also amenable to field studies. Therefore, combining molecular genetics, population genetics and studies of natural populations to gain a comprehensive understanding of phenotypic evolution is feasible in this group. The same traits I studied in my dissertation could be used to examine these questions. Eye characteristics are clear adaptive features, and eye morphology and physiology generally correlate with specific niche demands (Land & Fernald, 1992; Jonson et al., 1998; Land et al., 1999; Land, 2002) and vary within and between species. Pigmentation patterns in Drosophila are extremely diverse both within and between species, and in some cases presumably adaptive. Complementing studies of the genetic basis of morphological diversity in these systems with population genetics and behavioral/ecological studies might provide a comprehensive view of the evolution of phenotypic diversity.

107

LITERATURE CITED
ABZHANOV, A., KUO, W. P., HARTMANN, C., GRANT, B. R., GRANT, P. R. & TABIN, C. J. (2006). The calmodulin pathway and evolution of elongated beak morphology in Darwin's finches. Nature 442, 563-567. ABZHANOV, A., PROTAS, M., GRANT, B. R., GRANT, P. R. & TABIN, C. J. (2004). Bmp4 and morphological variation of beaks in Darwin's finches. Science 305, 1462-1465. ALBERTSON, R. C. & KOCHER, T. D. (2006). Genetic and developmental basis of cichlid trophic diversity. Heredity 97, 211-221. ALBERTSON, R. C., STREELMAN, J. T., KOCHER, T. D. & YELICK, P. C. (2005). Integration and evolution of the cichlid mandible: The molecular basis of alternate feeding strategies. Proceedings Of The National Academy Of Sciences Of The United States Of America 102, 16287-16292. COLOSIMO, P. F., PEICHEL, C. L., NERENG, K., BLACKMAN, B. K., SHAPIRO, M. D., SCHLUTER, D. & KINGSLEY, D. M. (2004). The genetic architecture of parallel armor plate reduction in threespine sticklebacks. Plos Biology 2, 635-641. DOEBLEY, J., STEC, A. & HUBBARD, L. (1997). The evolution of apical dominance in maize. Nature 386, 485-488. FISHMAN, L., KELLY, A. J. & WILLIS, J. H. (2002). Minor quantitative trait loci underlie floral traits associated with mating system divergence in Mimulus. Evolution 56, 2138-2155. GRANT, P. R. (1999). The Ecology and Evolution of Darwin's Finches. Princeton Univ. Press, Princeton, NJ. GREENBERG, A. J. & WU, C. I. (2006). Molecular genetics of natural populations. Molecular Biology And Evolution 23, 883-886. HELLBERG, M. E., MOY, G. W. & VACQUIER, V. D. (2000). Positive selection and propeptide repeats promote rapid interspecific divergence of a gastropod sperm protein. Molecular Biology And Evolution 17, 458-466. JONSON, A. C. J., LAND, M. F., OSORIO, D. C. & NILSSON, D. E. (1998). Relationships between pupil working range and habitat luminance in flies and butterflies. Journal Of Comparative Physiology A-Sensory Neural And Behavioral Physiology 182, 1-9. KERJE, S., CARLBORG, O., JACOBSSON, L., SCHUTZ , K., HARTMANN, C., JENSEN, P. & ANDERSSON, L. (2003). The twofold difference in adult size between the red junglefowl and White Leghorn chickens is largely explained by a limited number of QTLs. Animal Genetics 34, 264-274. LAND, M. F. & FERNALD, R. D. (1992). The Evolution Of Eyes. Annual Review Of Neuroscience 15, 1-29. LAND, M. F., GIBSON, G., HORWOOD, J. & ZEIL, J. (1999). Fundamental differences in the optical structure of the eyes of nocturnal and diurnal mosquitoes. Journal Of Comparative Physiology A-Sensory Neural And Behavioral Physiology 185, 91103. LAND, M. F. A. N. D.-E. (2002). Animal Eyes. Oxoford University Press Inc., New York. MALIK, H. S. & HENIKOFF, S. (2005). Positive selection of Iris, a retroviral envelopederived host gene in Drosophila melanogaster. Plos Genetics 1, 429-443. PONTING, C. P. & LUNTER, G. (2006). Signatures of adaptive evolution within human noncoding sequence. Human Molecular Genetics 15, R170-R175. PRESGRAVES, D. C. (2006). Intron length evolution in drosophila. Molecular Biology And Evolution 23, 2203-2213.

108

SCHULLY, S. D. & HELLBERG, M. E. (2006). Positive selection on nucleotide substitutions and indels in accessory gland proteins of the Drosophila pseudoobscura subgroup. Journal Of Molecular Evolution 62, 793-802. SHAPIRO, M. D., MARKS, M. E., PEICHEL, C. L., BLACKMAN, B. K., NERENG, K. S., JONSSON, B., SCHLUTER, D. & KINGSLEY, D. M. (2004). Genetic and developmental basis of evolutionary pelvic reduction in threespine sticklebacks. Nature 428, 717-723. . (2006). Genetic and developmental basis of evolutionary pelvic reduction in threespine sticklebacks (vol 428, pg 717, 2004). Nature 439, 1014-1014. SHAPIRO, M. D., MARKS, M. E., PEICHEL, C. L., SCHLUTER, D. & KINGSLEY, D. M. (2003). Genetic basis of pelvic reduction in sticklebacks. Integrative And Comparative Biology 43, 917-917. SHAPIRO, M. D., SCHLUTER, D. & KINGSLEY, D. M. (2002). The genetic control of upper jaw morphology in threespine sticklebacks. Integrative And Comparative Biology 42, 1310-1310. SHIMIZU, K. K. (2002). Ecology meets molecular genetics in Arabidopsis. Population Ecology 44, 221-233. STERN, D. L. & ORGOGOZO, V. (2008). The loci of evolution: How predictable is genetic evolution ? Evolution 62, 2155-2177. . (2009). Is Genetic Evolution Predictable? Science 323, 746-751. STREELMAN, J. T. & ALBERTSON, R. C. (2006). Evolution of novelty in the Cichlid dentition. Journal Of Experimental Zoology Part B-Molecular And Developmental Evolution 306B, 216-226. TANKSLEY, S. D. (1993). MAPPING POLYGENES. Annual Review of Genetics 27, 205-233. TRUE, J. R., LIU, J. J., STAM, L. F., ZENG, Z. B. & LAURIE, C. C. (1997). Quantitative genetic analysis of divergence in male secondary sexual traits between Drosophila simulans and Drosophila mauritiana. Evolution 51, 816-832. VERMAAK, D., HENIKOFF, S. & MALIK, H. S. (2005). Positive selection drives the evolution of rhino, a member of the heterochromatin protein 1 family in Drosophila. Plos Genetics 1, 96-108. WU, P., JIANG, T. X., SUKSAWEANG, S., WIDELITZ, R. B. & CHUONG, C. M. (2004). Molecular shaping of the beak. Science 305, 1465-1466. ZENG, Z. B., LIU, J. J., STAM, L. F., KAO, C. H., MERCER, J. M. & LAURIE, C. C. (2000). Genetic architecture of a morphological shape difference between two drosophila species. Genetics 154, 299-310.

109