Sunteți pe pagina 1din 42

1. (a) Desenai schema genei Guanilat-tansferazei i indicai secvenele codante, necodante, reglatoare.

(b) Numii funciile genei tubulinei: - la nivel molecular - la nivel celular - la nivel organismic 2. om!letai legenda figurii "################################################$

3. %e de secvena urm&toare de 'DN: 5'CAGGGATCGTGGGTA3'.


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. 'nalizati atent schemele ce caracterizeaza evenimentele celulei in diferite !erioade ale ciclului celular: a. ,dentificai !erioadele ciclului celular b. ,dentifica faza -fazele ce li!sese c. Desenati celula in faza ce li!seste

5. om!letai tabelul .rganizare molecular& romatin& rs / rs 0 0ivalent entromer 1elomer romatid& 0ra ! 0ra 2 3ineto4or 6. Caracteristica comparativa ADN polimeraza

Criterii de deosebire

ARN polimeraza

5. ,n medicina moderna sunt utilizate diferite clase de antibiotice !entru a distruge sau bloca activitatea bacteriilor !atogene - agentii !atogeni a diferitor boli infectioase. /odul lor de actiune bacteriostatica de!inde de com!onenta bacteriei cu care interactioneaza (tinta). 6a !rezentam citeva antibiotice care au tinte bacteriene diferite, analizati informatia !rezentata si incercati sa e7!licati mecanismul de actiune a antibioticelor din tabel. 'ntibiotic 1inta antibioticului 87!licati mecanismul de blocare a activitatii bacteriilor !atogene 9inezolid 5:%, im!edica asamblarea ;:%<=:% i!rofo7acin 1o!oizomeraza 8r>thromicin ')Nr ?;% (!entru =:%)

1. (a) Desenai schema genei @0A i indicai secvenele codante, necodante, reglatoare.

(c) Numii funciile genei @0A: o la nivel molecular o la nivel celular o la nivel organismic ?. om!letai legenda figurii "################################################$

;. %e d& molecula de ')Nm: G5'ppp5'GAAGUCCAAAUGACUUCAAAAUGAAAUUUAA... 3'


translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. ,dentificai !erioadele ciclului celular i formula crs.

B. om!letai tabelul /omentul !roducerii *n meioz& Dublarea 'DN crs Dublarea centriolilor Dublarea centromerilor )ecombinarea intracromozomial& )ecombinarea intercromozomial& DisCuncia cromozomilor DisCuncia cromatidelor onCugarea crs omologi rossing-overul Aormarea gameilor ha!loizi

D. (a) Desenai schema genei catalazei i indicai secvenele codante, necodante, reglatoare.

(c) Numii funciile genei catalazei: - la nivel molecular - la nivel celular - la nivel organismic E ?. om!letai legenda figurii "################################################$

;. %e de secvena urm&toare de 'DN: 5'CAGTTGGATCGTGGGTA3'.


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) Splicing constitutiv

Splicing alternativ

Splicing combinativ

5. ,dentificai fazele meiozei i formula crs:

B. om!letai tabelul /omentul !roducerii *n ciclul mitotic Dublarea 'DN crs Dublarea centriolilor Dublarea centromerilor Dublarea Nr de crs ondensarea crs Decondensarea crs DisCuncia cromatidelor Aormarea chinetocorilor Disocierea anvelo!ei nucleare 'socierea anvelo!ei nucleare

D. (a) Desenai schema genei insulinei i indicai secvenele codante, necodante, reglatoare.

(c) Numii funciile genei insulinei: o la nivel molecular o la nivel celular o la nivel organismic E ?. om!letai legenda figurii "################################################$

;. %e d& molecula de ')Nm:. G5'ppp5'GAAGUCUAUGUACCGUCAAAAUUAACGCAAUUUAA... 3'


translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. om!letai tabelul )ol biologic (la nivel celular Forganismic) /itoza

/eioza

'!o!toza

5. ,dentificai !rocesele !rin cate trec celulele de-a lungul ciclului celular:

B om!letai tabelul: 0iogeneza 0ivalentul elula somatic& rs 0 Ausul de diviziune Gametocitul , Gametocitul secundar Gametul .vulul %!ermatozoidul Gigotul

1. (a) Desenai schema genei 1A ,,,' i indicai secvenele codante, necodante, reglatoare.

(c) Numii funciile genei 1A ,,,': o la nivel molecular o la nivel celular o la nivel organismic E 2. om!letai legenda figurii "################################################$

3. %e de secvena urm&toare de 'DN: 5'CATTGGATCGTGGGTA3'


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) ARN-polimeraza I

ARN-polimeraza II

ARN-polimeraza III

5. ,dentificai fazele ciclului celular i formula crs:

B. om!letai tabelul /omentul !roducerii *n meioz& )educerea Nr de crs )educerea Nr de cromatide Aormarea gametociilor ha!loizi Aormarea gameilor ha!loizi onCugarea crs omologi %e!ararea crs omologi )ecombinarea crs omologi )ecombinarea crs neomologi Aormarea fusului de diviziune /aturizarea 4inetocorilor

1. (a) Desenai schema genei 1A ,,' i indicai secvenele codante, necodante, reglatoare.

(c) Numii funciile genei 1A,,': o la nivel molecular o la nivel celular o la nivel organismic ?. om!letai legenda figurii "################################################$

;. %e de secvena urm&toare de 'DN: 5'CATTGGATCGTGGGTA3'


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) onformaia !roteinei

Glicozilarea !roteinei

'socierea mai multor !oli!e!tide

5. ,dentificai fazele meiozei i formula crs:

B. om!letai tabelul /omentul !roducerii *n ciclul mitotic Dublarea 'DN crs Dublarea centriolilor Dublarea centromerilor Dublarea Nr de crs ondensarea crs Decondensarea crs DisCuncia cromatidelor Aormarea chinetocorilor Disocierea anvelo!ei nucleare 'socierea anvelo!ei nucleare

D. (a) Desenai schema genei !roteazei lizozomale i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei !roteazei lizozomale.

(c) Numii funciile genei !roteazei lizozomale: o la nivel molecular o la nivel celular -

o la nivel organismic ?. om!letai legenda figurii "################################################$

;. %e de secvena urm&toare de 'DN: 5'CGTCAGGGATGGGTA3'.


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) 'DN-!olimeraza ')N - !olimeraza He!tidil-transferaza

=. /ai Cos este !rezentat& secvena !oliribonucleotidic& a Hhe-')Nt.


5 GCGGAUUUAGCUCAGDDDGGAGAGCGCCAGACUGAA A!CUGGAGGUCCUGUGT!CGAUCCACAGAAUUCGCACCA 3

'nalizai atent secvena i g&sii situsurile funcionale ale ')Nt. ,ndicai cu cifre:
D. ?. ;. +. E secvena de recunoatere a ribozomului, E anticodonul E secvena de interacine cu Hhe-')Nt- sintetaza, E situsul de interaciune cu Hhe.

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 @ G ' G ' 'DN ')Nm 'nticodonii ')Nt

'

1r! 5. ,dentificai fazele ciclului celular i formula crs:

aminoacizii

". om!letai tabelul .rganizare molecular& 0ivalent 0ra ! 0ra 2 entromer romatid& romatin& rs 0 rs / 3ineto4or 1elomer

1. (a) Desenai schema genei riboforinei i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei riboforinei.

(c) Numii funciile genei riboforinei: o la nivel molecular o la nivel celular o la nivel organismic 2. 'nalizai schema unei celule somatice: Descriei evenimentele din celul& Jn ce faz& este celulaK e !roces caracterizeaz& aceast& faz&K @nde *n organismul Dv !utei g&si celule asem&n&toareK

3. %e d& molecula de ')Nm: G5'ppp5'AAAGUCCAAAUGUCAAAACUAUGAAAUUUAA... 3'


translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) )ibozom ')Nm ')Nt

5. /ai

Cos este !rezentat& o secven& !oliribonucleotidic& dintr-un !re')Nm. ,dentificai i delimitai e7onii i intronii.
G!!!'' G'''G ''@G @''''G@@@' G@'G@' 'G@'' 'G ''@''G G'''''''.....

a) b) c) d)

nr de e7oni E nr de introni E lungimea e7onului D E lungimea intronului D -

I. Jn laborator, un gru! de cercet&tori, studiau biosinteza !roteinelor in vitro. Hentru aceasta au utilizat *n calitate de matri& !oliribonucleotidul ')Nm: ; '@G'G@G@'@'G@'GGG@@' G@'= Jn a!aratul de biosintez& a !roteinelor au fost utilizate inclusiv i ioni /g?<, ribozomi 5:%, factori !roteici de translaie, G1H i 5 variante de aminoacil E ')Nt: Lis - ')Nt, 's! E ')Nt, 6al E ')Nt, 1r! E ')Nt, Gl> E ')Nt, /et E ')Nt. ,dentificai !oli!e!tidul obinut de cercet&tori.

5. ,dentificai !erioadele ciclului celular i formula crs.

B. om!letai tabelul /omentul !roducerii *n meioz& onCugarea crs omologi Aormarea fusului de diviziune Aormarea gametociilor ha!loizi Aormarea gameilor ha!loizi /aturizarea chinetocorilor )ecombinarea crs neomologi )ecombinarea crs omologi )educerea Nr de cromatide )educerea Nr de crs %e!ararea crs omologi

D. (a) Desenai schema genei a2ua!orinei i indicai secvenele codante, necodante, reglatoare.

(a) 8numerai i caracterizai eta!ele e7!resiei genei a2ua!orinei.

(b) Numii funciile genei a2ua!orinei: a. la nivel molecular b. la nivel celular c. la nivel organismic ?. %e de secvena urm&toare de 'DN: 5'CGGAAAGTTGGATCGTTG3'.
ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

;. om!letai legenda figurii "################################################$

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) CAP-are Poly-adenilare Splicing

=. /ai Cos este !rezentat& o secven& !oliribonucleotidic& dintr-un !re')Nm. ,dentificai i delimitai e7onii i intronii. G=!!!=' @'' ''@G @ G@ ' @@G'G 'G @ '@G@'' 'G'' '''''.....
a. b. c. d. nr de e7oni E nr introni E lungimea !rimului e7on E lungimea !rimului intron -

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 G @ G Gln 5. ,dentificai fazele meiozei i formula crs: @ ' 'DN ')Nm 'nticodonii ')Nt aminoacizii

B. om!letai tabelul /omentul !roducerii *n ciclul celular 'linierea crs la ecuator ondensarea csr Decondensarea crs Dublarea Nr de crs Dublarea Nr mol de 'DN )e!araia 'DN )e!licarea 'DN %egregarea crs 1ranscri!ia ,G 1ranslaia ,G

1. (a) Desenai schema genei melaninei i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei melaninei.

(c) Numii funciile genei melaninei: o la nivel molecular o la nivel celular o la nivel organismic E ?. om!letai legenda figurii "################################################$

;. %e d& molecula de ')Nm: G5'ppp5'CAAGAUGUCUUACCGUCAAAAUUAACGCAAUUUAA... 3'


translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) /itoza /eioza '!o!toza

=. /ai Cos este !rezentat& secvena !oliribonucleotidic& a Hhe-')Nt.


5 GCGGAUUUAGCUCAGDDDGGAGAGCGCCAGACUGAA A!CUGGAGGUCCUGUGT!CGAUCCACAGAAUUCGCACCA 3

'nalizai atent secvena i g&sii situsurile funcionale ale ')Nt. ,ndicai cu cifre: D. E secvena de recunoatere a ribozomului,
?. ;. +. E anticodonul E secvena de interacine cu Hhe-')Nt- sintetaza, E situsul de interaciune cu Hhe.

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 @ G 6al @ ' 'DN ')Nm 'nticodonii ')Nt aminoacizii

5. ,dentificai fazele ciclului celular i formula crs:

B. om!letai tabelul Hrocese moleculare la care !artici!& 'DN-ligaza 'DN-!olimeraza ')N-!olimeraza 8ndonucleaza Glicoliaza Lelicaza Hrimaza Hroteine %%0 1elomeraza 1o!oizomeraza

D. (a) Desenai schema genei M-globinei i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei M-globinei.

(c) Numii funciile genei M-globinei: a. la nivel molecular b. la nivel celular c. la nivel organismic E ?. 'nalizai schema unei celule somatice: Descriei evenimentele din celul& Jn ce faz& este celulaK e !roces caracterizeaz& aceast& faz&K @nde *n organismul Dv !utei g&si celule asem&n&toareK

;. %e de secvena urm&toare de 'DN: 5'CATTGGATCGTGGGTA3'


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) atena lider atena *nt*rziat& Hrimerul

=. /ai Cos este !rezentat& secvena !oliribonucleotidic& a Hhe-')Nt.


5 GCGGAUUUAGCUCAGDDDGGAGAGCGCCAGACUGAA A!CUGGAGGUCCUGUGT!CGAUCCACAGAAUUCGCACCA 3

'nalizai atent secvena i g&sii situsurile funcionale ale ')Nt. ,ndicai cu cifre:
D. ?. ;. +. E secvena de recunoatere a ribozomului, E anticodonul E secvena de interacine cu Hhe-')Nt- sintetaza, E situsul de interaciune cu Hhe.

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 G @ G Gln #. ,dentificai fazele meiozei i formula crs: @ ' 'DN ')Nm 'nticodonii ')Nt aminoacizii

B. om!letai tabelul /atri& !entru sintez& %inteza catenei *nt*rziare %inteza catenei lider %inteza centromerilor %inteza fragmetelor .4aza4i %inteza !oli!e!tidului %inteza !re')Nm %inteza !re')Nr %inteza !re')Nt %inteza !rimerului %inteza telomerilor

1. (a) Desenai schema genei N-globinei i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei N-globinei.

(c) Numii funciile genei N-globinei: o la nivel molecular o la nivel celular o la nivel organismic E 2. om!letai legenda figurii "################################################$

3. %e d& o molecula de ')Nm G=O!!!=OGG'@'@ '@G 'G@'@ ''''@''' G ''@@@''... ;O


translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) Hromotor ORI AUG

5. /ai

Cos este !rezentat& o secven& !oliribonucleotidic& dintr-un !re')Nm. ,dentificai i delimitai e7onii i intronii.
G!!!'' GG''G ''@G @''''G@@@@' G@'G@' a) nr de e7oni E b) nr introni E c) lungimea e7onului ; E d) lungimea intronului ? 'G@'' 'G ''@''G G'''''.....

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 @ G 6al @ ' 'DN ')Nm 'nticodonii ')Nt aminoacizii

5. ,dentificai !rocesele !rin cate trec celulele de-a lungul ciclului celular:

B om!letai tabelul: ind *n meioz& celulele se caracterizeaz& !rin formula crs de mai CosK ?n P ?c ?n P +c +n P+c n P ?c nPc +I crs / +I crs 0 Q? crs / ?; crs 0 ?; crs /

1. (a) Desenai schema genei nucleazei lizosomale i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei nucleazei lizosomale.

(c) Numii funciile genei nucleazei lizosomale: o la nivel molecular o la nivel celular o la nivel organismic 2. om!letai legenda figurii "################################################$

3. %e de secvena urm&toare de 'DN: 5'CAGGGATCGTGGGTA3'.


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

5. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) )e!araia N8) )e!araia 08) )e!araia re!licativ&

5. /ai

Cos este !rezentat& o secven& !oliribonucleotidic& dintr-un !re')Nm. ,dentificai i delimitai e7onii i intronii.
G!!!'' @@''G ''@G @'GGG@@@@' G@'G@' a) nr de e7oni E b) nr introni E c) lungimea e7onului ; E d) lungimea intronului ? 'G@'' 'G ''@''G@G' @'''''.....

I. Jn laborator, un gru! de cercet&tori, studiau biosinteza !roteinelor in vitro. Hentru aceasta au utilizat *n calitate de matri& !oliribonucleotidul ')Nm: ; '@G'G@G@'@'G@'GGG@@' G@'= Jn a!aratul de biosintez& a !roteinelor au fost utilizate inclusiv i ioni /g?<, ribozomi 5:%, factori !roteici de translaie, G1H i 5 variante de aminoacil E ')Nt: Lis - ')Nt, 's! E ')Nt, 6al E ')Nt, 1r! E ')Nt, Gl> E ')Nt, /et E ')Nt. ,dentificai !oli!e!tidul obinut de cercet&tori.

5. ,dentificai fazele ciclului celular i formula cromozomial&:

". om!letai tabelul .rganizare molecular& 0ivalent 0ra ! 0ra 2 entromer romatid& romatin& rs 0 rs / 3ineto4or

1elomer

D. (a) Desenai schema genei ')N-!olimerazei , i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei ')N-!olimerazei ,.

(c) Numii funciile genelei ')N-!olimerazei ,: o la nivel molecular o la nivel celular o la nivel organismic 2. om!letai legenda: figurii "################################################$

3. %e d& molecula de ')Nm: G5'ppp5'GAAGUCAUGCAACAUUCAAAAUGAAAUUUAA... 3'


translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) 1ranscri!ie 1ranslaie )e!licare

=. /ai Cos este !rezentat& secvena !oliribonucleotidic& a Hhe-')Nt.


5 GCGGAUUUAGCUCAGDDDGGAGAGCGCCAGACUGAA A!CUGGAGGUCCUGUGT!CGAUCCACAGAAUUCGCACCA 3

'nalizai atent secvena i g&sii situsurile funcionale ale ')Nt. ,ndicai cu cifre:
D. ?. ;. +. E secvena de recunoatere a ribozomului, E anticodonul E secvena de interacine cu Hhe-')Nt- sintetaza, E situsul de interaciune cu Hhe.

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 @ 1r!
5. ,dentific& fazele meiozei i formula crs:

' G '

'DN ')Nm 'nticodonii ')Nt aminoacizii

'

B. om!eteaz& tabelul:

8nzima caracteristic& itete matria 'DN *n tim!ul re!lic&rii itete matria 'DN *n tim!ul re!araiei itete matria 'DN *n tim!ul transcri!iei itete matria ')N *n tim!ul re!lic&rii telomerilor itete matria ')N *n tim!ul trnas!oziiei Holimerizeaz& dN1Huri Holimerizeaz& N1Huri Aormeaz& leg&turi fosfodiesterice ;RF=R Aormeaz& leg&turi fosfodiesterice =RF;R

Aormeaz& leg&turi !e!tidice

1. (a) Desenai schema genei Hol>(') - !olimerazei i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei Hol>(') - !olimerazei.

(c) Numii funciile genelei Hol>(') - !olimerazei: o la nivel molecular o la nivel celular o la nivel organismic E ?. om!letai legenda figurii "################################################$

;. %e de secvena urm&toare de 'DN: 5'TTCAGGGATGTCGTGGA3'.


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) Gene "housse 4ee!ing$ Gene esut s!ecifice Gene "de mediu$

=. /ai Cos este !rezentat& o secven& !oliribonucleotidic& dintr-un !re')Nm. ,dentificai i delimitai e7onii i intronii. G!!!'G @' '''@G 'G@
a) b) c) d) nr de e7oni E nr introni E lungimea e7onului D E lungimea intronului D -

' @@G'G'@

'G @G'@'' ''''''''''''''.....

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 G @ G Gln 5. ,dentificai fazele meiozei i formula crs: @ ' 'DN ')Nm 'nticodonii ')Nt aminoacizii

B. om!letai tabelul /omentul !roducerii *n ciclul celular 'linierea crs la ecuator ondensarea csr Decondensarea crs Dublarea Nr de crs Dublarea Nr mol de 'DN livarea centromerului )e!licarea 'DN %egregarea crs Dublarea centriolilor /aturizarea 4inetocorilor

D. (a) Desenai schema genei helicazei i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei helicazei.

(c) Numii funciile genei helicazei: a. la nivel molecular b. la nivel celular c. la nivel organismic E 2. 'nalizai figura. Descriei evenimentele din celul& Jn ce faz& este celulaK e !roces caracterizeaz& aceast& faz&K @nde *n organismul Dv !utei g&si celule asem&n&toareK

;. %e d& molecula de ')Nm:. G5'ppp5'GAAGUCUAUGCGUUACACAAAUUAACGCAAUUUAA... 3'


translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) elul& somatic& Gamet Gigot

=. /ai Cos este !rezentat& secvena !oliribonucleotidic& a Hhe-')Nt.


5 GCGGAUUUAGCUCAGDDDGGAGAGCGCCAGACUGAA A!CUGGAGGUCCUGUGT!CGAUCCACAGAAUUCGCACCA 3

'nalizai atent secvena i g&sii situsurile funcionale ale ')Nt. ,ndicai cu cifre:
D. ?. ;. +. E secvena de recunoatere a ribozomului, E anticodonul E secvena de interacine cu Hhe-')Nt- sintetaza, E situsul de interaciune cu Hhe.

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 @ G 6al 5. ,dentificai fazele ciclului celular i formula crs: @ ' 'DN ')Nm 'nticodonii ')Nt aminoacizii

B. om!letai tabelul /omentul !roducerii *n meioz& rossing-overul Aormarea bivalenilor Aormarea fusului de diviziune Aormarea gametociilor ha!loizi Aormarea gameilor ha!loizi /aturizarea chinetocorilor )ecombinarea crs neomologi )ecombinarea crs omologi )educerea Nr de crs

%e!ararea crs omologi

1.

(a) Desenai schema genei ')N-!olimerazei ,, i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei ')N-!olimerazei ,,.

(c) Numii funciile genelei ')N-!olimerazei ,,: a. la nivel molecular b. la nivel celular c. la nivel organismic 2. om!letai legenda figurii "################################################$

;. %e de secvena urm&toare de 'DN: 5'CAGTTGACTGGTGGTA3'


ar&tai catena anticodogen&( sintetizai ')Nm( decodificai ')Nm i ar&tai !oli!e!tidul sintetizat( numii cine a realizat transcri!ia( indicai translatorii(moleculele de ')Nt, s!ecific*nd anticodonii)( numii !ro!riet&ile codului genetic !e care le-ai urm&rit.

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) )e!licare /itoz& /eioz&

=. /ai Cos este !rezentat& o secven& !oliribonucleotidic& dintr-un !re')Nm. ,dentificai i delimitai e7onii i intronii. G!!!' '' ''@G ''@ G@ '@@ G'G 'G@ @G'@''G ' 'G@'' '''''.....
a) b) c) d) nr de e7oni E nr introni E lungimea e7onului ? E lungimea intronului D -

I. om!letai tabelul i indicai = i ; !entru ambele catene ale 'DNului, ')Nm, ')Nt. 1 @ 1r! G ' G ' 'DN ')Nm 'nticodonii ')Nt aminoacizii

'

5. ,dentificai !erioadele ciclului celular i indicai la fiecare celul& formula crs:

". om!letai tabelul .rganizare molecular& romatin& rs / rs 0 0ivalent entromer 1elomer romatid& 0ra ! 0ra 2 3ineto4or

1. (a) Desenai schema genei clatrinei i indicai secvenele codante, necodante, reglatoare.

(b) 8numerai i caracterizai eta!ele e7!resiei genei clatrinei.

(c) Numii funciile genei clatrinei: a. la nivel molecular b. la nivel celular c. la nivel organismic 2. om!letai legenda figurii "################################################$

3. %e d& o molecula de ')Nm G=O!!!=OG'@'G@ '@G'@'

G@ ''''@''' G ''@@@''... ;O
translai ')Nm( ar&tai !rodusul trnslaiei( ar&tai trnslatorii (moleculele de ')Nt, s!ecific*nd anticodonii)( evideniai !ro!riet&ile codului genetic

+. om!letai tabelul )ol biologic (la nivel molecular Fcelular Forganismic) )e!licare 'DN )e!araie 'DN )ecombinare 'DN

5. /ai

Cos este !rezentat& o secven& !oliribonucleotidic& dintr-un !re')Nm. ,dentificai i delimitai e7onii i intronii.
G!!!'' '@''G ''@GG'G@@@@' G@'G@' a) nr de e7oni E b) nr introni E c) lungimea e7onului ? E d) lungimea intronului ? 'G@'' 'G '' @''G G'''''''''''.....

I. Jn laborator, un gru! de cercet&tori, studiau biosinteza !roteinelor in vitro. Hentru aceasta au utilizat *n calitate de matri& !oliribonucleotidul ')Nm: ; '@G'G@G@'@'G@'GGG@@' G@'= Jn a!aratul de biosintez& a !roteinelor au fost utilizate inclusiv i ioni /g?<, ribozomi 5:%, factori !roteici de translaie, G1H i 5 variante de aminoacil E ')Nt: Lis - ')Nt, 's! E ')Nt, 6al E ')Nt, 1r! E ')Nt, Gl> E ')Nt, /et E ')Nt. ,dentificai !oli!e!tidul obinut de cercet&tori.

5. ,dentificai fazele ciclului celular i formula crs:

B. om!letai tabelul )es!onsabili @nete cromatidele surori %e!ar& cromatide surori @nete cromozomi omologi %e!ar& cromozomii omologi 'lungete telomerii %curteaz& telomerii ,nduce mitoza 0locheaz& mitoza elulele ce intr& *n meioz& elulele ce finalizeaz& meioza