ARTICLE IN PRESS

Crop Protection 27 (2008) 189197 www.elsevier.com/locate/cropro

Control of damping-off caused by Rhizoctonia solani and Fusarium solani using olive mill waste water and some of its indigenous bacterial strains
` t Yanguia, Ali Rhoumab,, Mohamed Ali Trikib, Kamel Gargouric, Jalel Bouzida Thabe
nieurs de Sfax, Rte de Sokra Km 4.5, 3038 Sfax, Tunisia Laboratoire Eau, Energie et Environnement, Ecole Nationale des Inge de recherche Protection des Plantes Cultive es et Environnement, Institut de lolivier de Sfax, Rte de Sokra Km 1.5, 3003 Sfax, Tunisia Unite c lioration de la Productivite de lOlivier et des Arbres fruitiers, Institut, de lOlivier, BP 1087 3000 Sfax, Tunisia Laboratoire de recherche Ame
b a

Received 8 February 2007; received in revised form 9 May 2007; accepted 13 May 2007

Abstract Olive mill waste water (OMW) and some of its indigenous bacterial strains were tested in vitro and in vivo for their efcacy against damping-off caused by two soilborne fungi Rhizoctonia solani and Fusarium solani. OMW and polyphenols displayed a high level of antifungal activity against R. solani. However, F. solani was more resistant and only the highest dose (2%) prevented its mycelial growth. In pot experiments, the percentage of tomato plants showing symptoms of damping-off was signicantly reduced with different doses of OMW (0.5%, 1% and 2%) as compared to the control (soil treated with water). Nine indigenous bacterial strains isolated from OMW exhibited an antagonistic effect against the two fungi. Based on the gene 16S rRNA sequence analysis, four isolates showed 99.2% similarity to known sequences of Bacillus subtilis, three isolates demonstrated low percentage similarities (94.396.5%) to the genera Bacillus, whereas two isolates were associated with Burkholderia caryophylli and Pseudomonas uorescens (98.299.6% similarities). Among these bacteria, the strain B1 proved efcient against the two soilborne pathogens in vitro and in pot experiments. Our study in controlled conditions suggested that addition of OMW to soil exerts signicant disease suppressiveness against R. solani and F. solani. r 2007 Elsevier Ltd. All rights reserved.
Keywords: Olive mill waste water; Polyphenols; Indigenous bacteria; Damping-off; Rhizoctonia solani; Fusarium solani

1. Introduction Damping-off is a serious disease complex worldwide of a wide range of seedlings in nurseries, glasshouses, gardens, crops and forests (Agrios, 2005), and can kill both germinating seeds and young seedlings. Several fungi that are widely distributed in soils can cause this disease, including Rhizoctonia solani, Pythium spp., Phytophthora spp., Sclerotinia spp. and Fusarium spp. (Stephens et al., 1982). Strategies to control soilborne diseases are limited because cultivars with complete resistance are not available (Li et al., 1995). Control of the soilborne pathogens is difcult because of their ecological behaviour, their
Corresponding author. Tel.: +216 74 241 442; fax: +216 74 241 033.

E-mail address: roumaal@yahoo.fr (A. Rhouma). 0261-2194/$ - see front matter r 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.cropro.2007.05.005

extremely broad host range and the high survival rate of resistant forms such as chlamydospores and sclerotia under different environmental conditions. Many research studies have shown that biological control offers an environmentally friendly alternative to protect plants from soilborne pathogens (Emmert and Handelsman, 1999; Whipps, 2001; Weller et al., 2002). Although the number of biocontrol products is increasing, these products still represent only a very small proportion of fungicides (Fravel, 2005). In recent years, several bacterial and fungal antagonists against soilborne plant pathogenic fungi have been described (Howell, 2003; Faltin et al., 2004). However, many of these showed inconsistent in vitro effects and only very few antagonists were analysed under open eld conditions (Grosch et al., 2005). Therefore, other alternatives to control damping-off and root rot are currently of

ARTICLE IN PRESS
190 T. Yangui et al. / Crop Protection 27 (2008) 189197

great importance. The use of organic amendments plays an important role in the outcome of the plantpathogen interactions (Hoitink and Boehm, 1999; Abawi and Widmer, 2000). The decomposition level of organic matter affects the composition of bacterial taxa as well as activities of biocontrol agents (Hoitink and Boehm, 1999). The decomposition of organic matter increases the population of saprophytic micro-organisms and some of them act as antagonists to plant pathogens (Mazzola, 2002; Manici et al., 2004). Olive mill waste water (OMW) is a major environmental problem owing to its high organic load and antimicrobial properties, particularly for Mediterranean countries. Many studies established that these wastes have a high fertilizer value when applied to the soil because of the high organic matter content and some mineral nutrient content (Paredes et al., 1999). However, despite the potential agronomic value, soil amendment with OMW is also known for its antimicrobial activity (Capasso et al., 1995; Kistner et al., 2004). The incorporation of fresh OMW into the soil increases the number of soil microorganisms and induces a change in the microbial population (Tardioli et al., 1997). In this context, Kotsou et al. (2004) reported that soil treatment with OMW created an r-environment that selectively enhanced and sustained the bacterial population of r-strategists for a prolonged time period and consequently induced the soil suppressiveness against the plant pathogen R. solani and possibly also against other telluric pathogens. In the same way, Kistner et al. (2004) found that the addition of OMW to hydroponic nutrient solutions provided an environment suppressing plant pathogens while favouring benecials. In this project, we studied the biofungicide effect of OMW against two soilborne pathogens R. solani and Fusarium. solani. We analysed the direct effect of OMW on mycelial growth of these fungi in Petri dishes. This effect was veried in pot experiments containing sterile soil inoculated by R. solani and F. solani and amended with three dosage rates of OMW. We isolated some OMW indigenous bacteria in order to verify their possible antagonism against these two soilborne pathogenic fungi.

2.2. Plant pathogenic fungi R. solani and F. solani were originally isolated from tomato plants exhibiting symptoms of tomato dampingoff. The isolates were stored at 4 1C in tubes containing potatodextroseagar (PDA, 200 g of potato, 20 of dextrose and 20 g of agar agar) and at 20 1C in tryptone salt medium (tryptone: 1 g, NaCl: 8.5 g, Tween 20: 1%, glycerol: 15% and distilled water: 1 l).

2.3. Effect of OMW on mycelial growth of R. solani and F. solani To study the activity of OMW against mycelial growth of R. solani and F. solani, different concentrations were prepared (0.5%, 1%, 2%, 4%, 6%, 8%, 10%, 15% and 20%) by OMW incorporation in the PDA medium at approximately 45 1C. After mixing, the amended PDA was dispensed into 9-cm-diameter Petri dishes and allowed to cool. Five-millimetre-diameter plugs of agar from young pure cultures of R. solani and F. solani was placed with the surface mycelium facing down on the test PDA medium. The plates were incubated at 25 1C, and the radial growth of mycelium was measured at 24-h intervals for a week. Controls were run with inoculated PDA without OMW addition. Four replicates of each concentration were used, and three separate tests were performed. Plates showing contamination were discarded.

2.4. Antifungal activity of total polyphenols extracted from OMW 2.4.1. Polyphenol extraction and analysis OMW was centrifuged at 7000 rpm for 20 min. The supernatant (SP) was extracted three times with ethyl acetate. The collected organic fraction was dried and evaporated under vacuum. The residue was extracted twice with dichloromethane in order to remove the non-phenolic fraction (lipids, aliphatic fractions and sugars). The liquid phase was discarded, while the washed residue was weighed and re-suspended in ethyl acetate (4.2 mg ml1). The latest compound was analysed by gas chromatography coupled with mass spectroscopy according to Sampedro et al. (2005). Gas chromatographymass spectrometric (GCMS) analyses were performed on OMW ethyl acetate extract derivatized with N,O-bis (trimethylsilyl) triuoroacetamide in pyridine. Mass spectra were recorded by the use of a Hewlet-Packard 5973 spectrometer equipped with a capillary column HP 5 MS (30 0.25 mm) at 100280 1C with an isothermal programme at 100 1C for 2 min, then at 5 1C up to 280 1C and nally isothermal at 280 1C for 5 min. Identication of aromatic compounds was based on comparison with retention times and mass spectra of pure standards.

2. Materials and methods 2.1. OMW and its characteristics OMW was taken from a three-phase continuous extraction factory located in the region of Sfax (south-east of Tunisia) and was kept at 20 1C until use. Its physical and chemical characteristics were pH: 4.96, electrical conductivity: 10 mS cm1, chemical of oxygen demand: 100 g l1, total organic carbon: 38.64 g l1, fat matter: 10.5 g l1, total polyphenols: 5.8 g l1, K: 830 mg l1, Fe: 3.04 mg l1, P: 4.2 mg l1, NO3: 17 mg l1, SO4: 17 mg l1, Cl: 210 mg l1, Ca: 12.3 mg l1 and Na: 356 mg l1.

ARTICLE IN PRESS
T. Yangui et al. / Crop Protection 27 (2008) 189197 191

2.4.2. Effect of polyphenols on mycelial growth Spore and mycelium suspensions of F. solani and R. solani (100 ml) were spread on the plates containing PDA medium, and wells of 6-mm diameter were punched in the agar with a sterile steel borer. Twenty microlitres of total polyphenols was ltered through 0.45-mm lters under sterile conditions and pipetted into the wells on PDA plates inoculated with the fungi. The plates were incubated for 48 h at 25 1C and then examined for haloes of inhibition around the well. 2.5. Effect of OMW in suppressing damping-off diseases in pot experiments 2.5.1. Soil preparation An agricultural soil sample (clay: 6%, silt: 3%, sand: 91%, pH: 8.2, electrical conductivity: 1.1 mS cm1, organic matter content: 0.17%, Ntotal: 176 mg g1, P: 42 mg g1 and K: 130 mg g1) was taken from a eld located in the region of Cha al (60 km to the south-west of Sfax). The soil was moistened with distilled water to 60% of its water-holding capacity and autoclaved for 1 h at 121 1C twice, on 2 successive days. The soil was maintained at 60% of its water-holding capacity for a week under sterile conditions. After that, the soil was again autoclaved twice for 20 min at 121 1C. It was placed in plastic pots (dimensions: 20 cm 20 cm 5 cm, 2 kg of soil per pot). 2.5.2. Soil inoculation R. solani and F. solani were cultured in a liquid medium of potato dextrose for 7 d on a shaker at 200 rpm. Mycelium was separated from the liquid medium by ltration using Whatman paper No. 1. Soil was inoculated with 25 mg of prepared mycelium mixed with 1 kg of autoclaved soil. Seven days after inoculation, three doses of fresh OMW were added (0.5%, 1% and 2% (w/w)) to the inoculated soil. Fifteen days after the addition of OMW, 30 tomato seedlings (cv. Riogrande) at the stage of two true leaves were transplanted into 10 pots (three plants/pot) for each dose. There were three replicates for each dose. Pots were placed under ambient conditions and monitored for a growing period of 4 weeks. Plants showing symptoms of damping-off were noted. There were two controls, one for non-infested soil with each dose of fresh OMW and another for infested soil without amendment with OMW. 2.6. Isolation of bacteria from OMW For isolation of bacterial strains, 10 g of OMW was suspended in 90 ml of sterile distilled water and shaken for 10 min at 250 rpm. One millilitre of this suspension was used to prepare serial 10-fold dilutions in 0.9% of NaCl. Aliquots (100 ml) of a dilution of each suspension were spread on Lauria-Bertani agar (LBA: tryptone: 10 g, yeast extract: 5 g, NaCl: 5 g, agar: 18 g and distilled water: 1 l). Some representative colonies, which differed morphologi-

cally, were selected from the countable plates and restreaked on a new plate of the same media to obtain pure colonies. Puried bacterial isolates were stored in 30% glycerol at 20 1C. 2.7. In vitro antagonistic activity of bacteria isolated from OMW 2.7.1. Dual culture The in vitro inhibition of mycelial growth of R. solani and F. solani by the bacterial isolates was tested using the dual culture method as described by Landa et al. (1997). Three 50 ml drops from a suspension of antagonistic bacteria (108 cfu ml1) were equidistantly placed on the margins of PDA medium and incubated at 25 1C for 24 h. A 4-mm agar disc from fresh PDA cultures of R. solani and F. solani was placed at the centre of the PDA plate for each bacterial isolate tested and incubated at 25 1C for 7 d. Growth diameter of the pathogen mycelium was measured and compared with the control growth where the bacterial suspension was replaced by sterile distilled water. Each experiment was run in triplicate and was repeated at least three times. The percentage growth inhibition was calculated using the following formula: % inhibition (1(fungal growth/control growth)) 100. 2.7.2. Production of diffusible metabolites The ability of the OMW indigenous bacterial strains to produce diffusible metabolites was tested according to the agar well diffusion assay (AWDA) as reported by Tagg and Given (1971). All bacterial isolates were transferred individually to 50 ml of Luria-Bertani broth medium (LB broth) in 250-ml Erlenmeyer asks and incubated by shaking each culture at 200 rpm for 4 d under ambient conditions. LBA medium (20 ml) was poured into each sterile Petri dish (90 mm diam.). Spore and mycelium suspensions of F. solani and R. solani (100 ml) were spread on the plates containing PDA medium, and wells of 6-mm diameter were punched in the agar with a sterile steel borer. The bacterial cultures were centrifuged at 15 000 rpm for 30 min to remove cell debris. After centrifugation, 20 ml of each sample was ltered through 0.45 mm lters under sterile conditions and pipetted into wells on PDA plates inoculated with the fungi. The plates were incubated for 48 h at 25 1C and then examined for haloes of inhibition around the well. The diameter (di) of the zone of inhibition was calculated using the following formula: di dDw, where di is the diameter of the inhibition zone, d is the diameter of the halo and Dw represents the diameter of the well (6 mm). Four replicates of each bacterial isolate were used, and three separate tests were performed. 2.8. Identication of the potential antagonistic bacteria The identication of bacterial strains was achieved by sequencing the 16S rRNA gene (rrs). Amplication was

ARTICLE IN PRESS
192 T. Yangui et al. / Crop Protection 27 (2008) 189197

carried out by PCR with primers F667-pA-rrs AGAGTTTGATCCTGG CTCAG and F668-pH-rrs AAGGAGGTGATCCAGCCGCA designed by Bruce et al. (1992). Standard PCR conditions were 1 min DNA denaturation at 94 1C, 1 min annealing at 57 1C and 1 min extension at 72 1C for 35 cycles. The 16S rDNA sequences were compared with sequences in the GenBank database with the Basic Alignment Search Tool (Altschul et al., 1990). 2.9. Effect of potential antagonistic bacteria against R. solani in pot experiments To investigate the effect of suppression of damping-off caused by R. solani, 25 mg of hyphae separated from PDA liquid medium as mentioned above was mixed with 1 kg of the autoclaved soil with 2% cornour. Each pot (300 ml volume) was inoculated 7 days before seeding. Twenty millilitres of SP or cell suspension (108 cfu ml1 bacteria pelleted, washed twice and resuspended in distilled sterile water) was added to pathogen-infested pots 3 days before seeding. One additional treatment with pathogen inoculum only served as the inoculated control (C). Thirty sterilized tomato seeds (Lycopersicon esculentum, CV. Riogrande)

were sown in 10 pots and then placed under eld conditions. There were three replicates for each treatment. Disease incidence was expressed as the percentage of the number of plants showing typical symptoms caused by R. solani. 2.10. Microscopic observations Morphological aspects of the mycelia of R. solani and F. solani treated by either OMW or the antagonists including fragmentation, vacuolization and lyses were examined microscopically at 40 magnication. 2.11. Data analysis Data were subjected to analysis of variance using SPSS software (version 11). Means values among treatments were compared by Duncans multiple range test at the 5% (p 0.05) level of signicance. 3. Results 3.1. In vitro effect of OMW and polyphenols against R. solani and F. solani The incorporation of OMW in the culture medium showed a potent antifungal activity against R. solani and a complete inhibition of mycelium growth was observed for all the tested doses (Fig. 1). However, for F. solani, only the high dose (2%) was efcient in preventing mycelium growth. The microscopic observation of mycelia showed sliming of cell walls, deformation and vacuolization (Fig. 2). These results indicated that R. solani was probably more sensitive to the OMW than F. solani. The results with OMW were conrmed by the effect of polyphenols. Indeed, F. solani was found to be more resistant to polyphenols than R. solani. This resistance is expressed by the very small inhibition zone recorded around the well and by the intensive formation of chlamydospores (data not shown). GCMS analysis of polyphenols revealed the presence of vanilline, M-hydroxyphenylethanol, 4-hydroxyphenylethanol, 1,2-dihydroxyl4-(1-propyl) benzene, 4-hydroxyphenyl-propionic acid,

12.0 10.0 Mycelial growth (cm) 8.0 6.0 4.0 2.0 0.0 0.0 0.5 1.0 OMW doses

R. solani F. solani

2.0

Fig. 1. Effect of OMW doses on mycelial growth of R. solani and F. solani. Different letters denote signicant difference according to Duncans multiple range test at po0.05.

Fig. 2. Mycelium deformation and vacuolization of Fusarium solani treated by OMW. (a) Control intact mycelia. (b) Deformation and vacuolization of mycelia.

ARTICLE IN PRESS
T. Yangui et al. / Crop Protection 27 (2008) 189197 193

Fig. 3. GCMS chromotogram (total ion current) of phenolic compounds extracted from olive mill waste water. The following identied compounds have been numbered according to their retention times: vanilline [1], M-hydroxyphenylethanol [2], 4-hydroxyphenylethanol [3], 1,2-dihydroxyl-4-(1-propyl) benzene [4], 4-hydroxyphenyl-propionic acid [5], vanillethanediol [6], 2-hydroxyphenyl acetic acid [7], 3,4-dihydroxyphenylglycol [8].

Percentage of damping-off of tomato

100 90 80 70 60 50 40 30 20 10 0

a
F. solani R. solani

c c

0.5 OMW doses

Fig. 4. Percentage of tomato damping-off incidence by Rhizoctonia solani and Fusarium solani after incorporation of OMW in soil at different doses. Bars topped by a different letter denote signicant reduction of damping-off according to Duncans multiple range test at po0.05.

vanillethanediol, 2-hydroxyphenyl 3,4-dihydroxyphenylglycol (Fig. 3).

acetic

acid

and

3.2. Suppression of damping-off disease by OMW in pot experiments The percentage of tomato plants showing symptoms of damping-off was signicantly reduced by all doses of OMW (0.5%, 1% and 2%) (Fig. 4), and the suppressive effect was observed against both R. solani and F. solani. However, the highest dose (2%) of OMW signicantly reduced the percentage of infected tomato seedlings

compared with the lower doses. This could be related to the high toxicity of OMW to the tomato seedlings. This nding was conrmed by results of seed germination of tomato in soil free from the soilborne pathogen but containing different doses of OMW (Fig. 5). 3.3. In vitro effect of the indigenous bacterial strains of OMW Nine bacterial strains isolated from OMW exhibited antifungal activity towards R. solani and F. solani in agar well diffusion assays and in dual culture (Table 1). Based

ARTICLE IN PRESS
194 T. Yangui et al. / Crop Protection 27 (2008) 189197

on 16S rRNA sequences analysis, the strains B2, BM2, BT211 and BM3 were identied as Bacillus subtilis, BM16 as Burkholderia caryophylli, PsM2 as Pseudomonas uorescens and the other isolates B1, BM8 and BM14 were associated with the genus Bacillus.

90 Seed germination (%) 85 80 75 70 65 60 55 50 0.0

a a a

There was an absence of physical contact between the antagonistic bacteria and the pathogenic fungi in direct antagonism through dual cultures. The presence of a wide inhibition zone with the AWDA test indicated that the antagonism could be related to extra-cellular metabolites released in the culture medium. Mycelium of R. solani was darker brown after a dual culture with strain B1 (data not shown). Microscopic observation showed an abnormal leakage, collapse and rupture of mycelium (Fig. 6). Similar results were found by Fiddaman and Rossall, 1993 (cited by Montealegre et al., 2003), who observed hyphal vacuolization and deformation in R. solani and Pythium ultimum as a consequence of treatment with a B. subtilis strain that secreted a volatile metabolite with fungicidal properties. 3.4. Effect of OMW indigenous bacteria in pot experiments Among the antagonistic bacterial isolates, the supernatant and washed cells of strain B1 reduced signicantly the incidence of damping-off of tomato caused by R. solani (Fig. 7). 4. Discussion The results obtained demonstrate that suppression of damping-off of tomato using OMW is due to chemical

0.5 1.0 OMW doses

2.0

Fig. 5. Percentage of seed germination of tomato plants in soil free from the soilborne pathogens but added with different doses of OMW. Different letters denote signicant difference according to Duncans multiple range test at po0.05.

Table 1 Diameters of the inhibition zones and percentage of growth inhibition observed with Rhizoctonia solani and Fusarium solani treated with bacterial isolates of OMW Diameter of inhibition zones in agar well diffusion agar test (cm) Rhizoctonia solani B1 BT211 BM2 B2 BM14 BM8 BM16 BM3 PsM2 1.570.16 1.870.12 0.070.00 1.870.18 1.570.18 1.270.22 2.070.11 1.470.15 2.570.16 Fusarium solani 1.970.51 1.070.14 1.770.11 2.070.21 0.070.00 0.070.00 2.570.31 0.070.21 1.570.11 Percentage of growth inhibition in dual culture (%) Rhizoctonia solani 46.570.70 43.570.70 40.070.00 4271.15 43.070.05 41.570.70 42.571.00 41.570.70 40.570.57 Fusarium solani 45.070.00 4270.70 42.570.00 4271.73 40.070.00 40.070.57 38.571.15 42.570.00 38.571.41

7 Indicate standard error of the mean.

Fig. 6. Mycelium aspect of Rhizoctonia solani after dual culture with the antagonistic bacteria strain B1. (a) Control hyphae of R. solani. (b) Sliming cell wall, rupture and collapse of mycelium of R. solani.

ARTICLE IN PRESS
T. Yangui et al. / Crop Protection 27 (2008) 189197 195

a 100 Percentage of tomato damping-off incidence 90 80 70 60 50 40 30 20 10 0 Rz SC_Rz Traitements

Fig. 7. Effect of treatments by strain B1 on the percentage of damping-off incidence of tomato plants caused by Rhizoctonia solani. Bars with different letters are signicantly different according to the test of Duncan (to p 0.05) RZ: Rhizoctonia solani, SC: suspension cell-free bacteria, SP: supernatant.

b c SP_Rz

compounds such as polyphenols, and probably to some of its indigenous bacterial strains that act as antagonists. The complete growth inhibition of R. solani demonstrated that this fungus cannot grow on media containing OMW. This result was not consistent with that reported by Kotsou et al. (2004), who demonstrated that R. solani is able to grow on solid media containing OMW as the only carbon source. The total inhibition could be due to the direct effect of the acid pH of OMW and to chelating transition metals by polyphenols. Wong and Kitts (2006) reported that phenolic compounds are able to chelate transition metals and also lower the reactivity of metal iron by forming an inert metalligand complex. Chelating of transition metals, such as iron and copper, reduces bioavaibility for fungal growth. The growth inhibition of mycelia could be due to phenolic compounds that can potentially impair cellular function and membrane integrity (Ciafardini and Zullo, 2003). It has been demonstrated that phenolic compounds bond tightly on the cell walls, thus damaging them, and are characterized by a very strong protein-cross-linking and protein-denaturizing activity (Bais et al., 2002; Ciafardini and Zullo, 2003). Besides, the complete inhibition of growth of R. solani indicated the possible presence of fungicidal compounds in the volatile fraction of the extract. Volatile polyphenols could be stronger and react with nucleotides and proteinaceous materials. Among the polyphenols, avonoids inhibited pathogenic growth by reacting with DNA and disrupting DNA replication, thus explaining the observed growth inhibition of soilborne pathogens in this study (Wong and Kitts, 2006). The inhibition of F. solani occurred only at the highest dose of OMW. This result was conrmed by the microscopic observation showing a deformation and a vacuolization of the fungal mycelium. Celar (2003) reported that phytopathogenic Fusarium sp. used a higher rate of

nitrogen in the nitrate form (concentration of NO3: 115.75 mg l1). In addition, Sampedro et al. (2005) found that Fusarium lateritium had an extracellular enzyme activity in solid-state cultures on OMW with a dilution of upto 25%. The signicant reduction of damping-off incidence on tomato plants using the OMW amendment was attributed to the effect of polyphenols and other chemical compounds. Several researchers have demonstrated that only a few micro-organisms are able to survive in this byproduct, because it contains various simple and complex phenolic compounds characterized by high antimicrobial activity (Capasso et al., 1995; Kistner et al., 2004). Some phytopathogenic bacteria like Pseudomonas syringae pv. savastanoi, Corynebacterium michiganense and Xanthomonas campestris are inhibited by polyphenols present in OMW in their original concentration (Ciafardini and Zullo, 2003). With regard to the effect induced by the microbiological component of OMW, it is possible that indigenous bacterial strains were also involved. The present work showed that some OMW indigenous bacteria played a major role against soilborne plant pathogenic fungi. The study conducted by Kotsou et al. (2004) demonstrated that the signicant disease suppressiveness against R. solani that was induced in the OMW-treated soil was mainly attributed to the shift in the soil microbial community from K- to r-strategy. Our results showed that species of Bacillus, Burkholderia and Pseudomonas were isolated from OMW and exhibited antimicrobial activity against the two soilborne plant pathogenic fungi F. solani and R. solani. These antagonists may have different mechanisms of action including interference with spore germination or germ tube elongation inhibition through abnormal hyphal swelling (Jung et al., 2003). They can also be responsible for lyses and complete degradation of the fungal hyphae (Wang

ARTICLE IN PRESS
196 T. Yangui et al. / Crop Protection 27 (2008) 189197 soil bacteria by using the polymerase chain reaction. Appl. Environ. Microb. 58, 34133416. Capasso, R., Evidenti, A., Schivo, L., Marcialis, M.A., Cristinzio, G., 1995. Antibacterial polyphenols from olive mill waste waters. J. Appl. Bacteriol. 79, 393398. Celar, F., 2003. Competition for ammonium and nitrate forms of nitrogen between some phytopathogenic and antagonistic soil fungi. Biol. Control 28, 1924. Ciafardini, G., Zullo, B.A., 2003. antibacterial activity of oil mill water nols on the phytopathogen Xanthomonas campestris spp. Ann. polyphe Microbiol. 53, 283290. Emmert, E.A.B., Handelsman, J., 1999. Biocontrol of plant disease: a Gram positive perspective. FEMS Microbiol. Lett. 171, 19. Faltin, F., Lottmann, J., Grosch, R., Berg, G., 2004. Strategy to select and assess antagonistic bacteria for biological control of Rhizoctonia solani Kuhn. Can. J. Microbiol. 50, 811820. Fravel, D.R., 2005. Commerzialization and implementation of biocontrol. Annu. Rev. Phytopathol. 43, 337359. Grosch, R., Faltin, F., Lottmann, J., Kofoet, A., Berg, G., 2005. Effectiveness of three antagonistic bacterial isolates to suppress Rhizoctonia solani Ku hn on lettuce and potato. Can. J. Microbiol. 51, 345353. Hoitink, H.A.J., Boehm, M.J., 1999. Biocontrol within the context of soil microbial communities: a substrate-dependent phenomenon. Annu. Rev. Phytopathol. 37, 427446. Howell, C.R., 2003. Mechanisms employed by Trichoderma species in the biological control of plant diseases: the history and evolution of current concepts. Plant Dis. 87, 410. Jung, J.W., An, K.N., Jin, Y.L., Park, R.D., Lim, K.T., Kim, K.Y., Kim, T.H., 2003. Biological control of damping-off caused by Rhizoctonia solani using chitinase-producing Paenibacillus illinoisensis KJA-424. Soil Biol. Biochem. 35, 12611264. Kistner, T., Nitz, G., Schnitzler, W.H., 2004. Adding olive mill waste water to hydroponic nutrient solutions: a potential agent against microbial diseases. Acta Hortic. 659, 315321. Kotsou, M., Ioanna, M., Katia, L., Iordanis, C., Costas, B., Adamantini, K., 2004. The effect of olive oil mill wastewater (OMW) on soil microbial communities and suppressiveness against Rhizoctonia solani. Appl. Soil Ecol. 26, 113121. Landa, B.B., Hervas, A., Bethiol, W., Jimenez-Diaz, R.M., 1997. Antagonistic activity of bacteria from chickpea rhizosphere against Fusarium oxysporum f. sp. ciceris. Phytoparasitica 25, 305318. Li, Z., Pinson, S.R.M., Marchetti, M.A., Stansel, J.W., Park, W.D., 1995. Characterization of quantitative trait loci (QTLs) in cultivated rice contributing to eld resistance to sheath blight (Rhizoctonia solani). Theor. Appl. Genet. 91, 382388. Manici, L.M., Caputo, F., Bambini, V., 2004. Effect of green manure on Pythium spp. population and microbial communities in intensive cropping systems. Plant Soil 263, 133142. Mazzola, M., 2002. Mechanisms of natural soil suppressiveness to soilborne diseases. Antonie van Leewenhoek 81, 557564. Montealegre, J.R., Rodrigo, R., Luz Maria, P., Rodrigo, H., Poyana, S., Ximena, B., 2003. Selection of bioantagonistic bacteria to be used in biological control of Rhizoctonia solani in tomato. Electron. J. Biotechnol. 6, 116127. Paredes, C., Ceggara, J., Roing, A., Sanchez-Monedero, M.A., BNernal, M.P., 1999. Characterization of olive mill wastewater (alpechin) and its sluidge for agricultural purposes. Bioresource Technol 67, 111115. Sampedro, I., DAnnibale, A., Ocampo, J.A., Satazi, S.R., GargiaRomera, I., 2005. Bioconversion of olive-mill dry residue by Fusarium lateritium and subsequent impact on its phytotoxicity. Chemosphere 60, 13931400. Stephens, C.T., Herr, L.J., Schmitthenner, A.F., 1982. Characterization of Rhizoctonia isolates associated with damping-off of bedding plants. Plant Dis. 66, 700703. Tagg, J.R., Given, M.C., 1971. Assay system for bacteriocins. Appl. Environ. Microbiol. 21, 943.

et al., 1999). A suppression by competition for nutrients could occur (Yoshida et al., 2001; Bailey and Lazarovits, 2003). The colour change of mycelium observed for R. solani and hyphal deformation of F. solani could be due to the antibiotics secreted by these bacteria, which may have fungicidal properties. This nding conrm the hypothesis of Mazzola (2002), who considered that the control of soilborne plant pathogenic fungi by using organic amendments is due to a specic suppression, which is related to an increase in the population of specic or groups of microorganisms that act as antagonists to the plant pathogens. The suppressive effect of the antagonist B1 against the soilborne plant pathogen R. solani is likely to be due to competition for nutrients and an antibiosis effect. Antibiosis by strain B1 would play a major role in the suppression of damping-off caused by R. solani since the number of plants exhibiting characteristic symptoms was signicantly less than the number of plants treated with a bacterial cell-free suspension. In addition, inhibition of damping-off disease on tomato plants by the bacterial supernatant of B1 was observed when it was applied after fungal inoculation, suggesting that the ltrate had a therapeutic effect. Hydrolytic enzymes may also play an important role in the control of disease caused by soilborne plant pathogens (Jung et al., 2003). Altogether, it is reasonable to suggest that suppression of damping-off incidence in tomato plants caused by R. solani is associated with hydrolytic enzymes that act alone or synergistically causing hyphal lyses and deformation of fungal cell walls. Further studies with other crops and soilborne pathogens of interest are required to extend our knowledge about the management of OMW for soil sanitation. Acknowledgements This work was supported by the funds of the Project CFC/IOOC/04. We would like to thank Dr. Xavier Nesme from Laboratoire dEcologie Microbienne (Universite Claude Bernard, France) for his contribution in the identication of the bacterial strains. References
Abawi, G.S., Widmer, T.L., 2000. Impact of soil health management practices on soilborne pathogens, nematodes and root diseases of vegetable crops. Appl. Soil Ecol. 15, 3747. Agrios, G.N., 2005. Plant Pathology, 5th ed. Elsevier Academic Press, San Diego. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403410. Bailey, K.L., Lazarovits, G., 2003. Suppressing soilborne diseases with residue management and organic amendments. Soil Tillage Res. 72, 169180. Bais, H., Travis, P., Walker, S., Herbert, P., Schweizer, J., Vianco, M., 2002. Root specic elicitation activity of rosmaric acid in hairy root cultures of Ocimum basilicum. Plant Physiol. Biochem. 40, 983995. Bruce, K.D., Hiorns, W.D., Hobman, J.L., Osborn, A.M., Strike, P., Ritchie, D.A., 1992. Amplication of DNA from native populations of

ARTICLE IN PRESS
T. Yangui et al. / Crop Protection 27 (2008) 189197 Tardioli, S., Toth, E.G., Santori, F., 1997. Species-specic selection of soil fungal populations after olive mill wastewater treatment. Chemosphere 34, 23292336. Wang, S.L., Yieh, T.C., Shih, I.L., 1999. Production of antifungal compounds by Pseudomonas aeruginisa K-187 using shrimp and crab shell power as a carbon source. Enzyme Microb. Tech. 25, 142148. Weller, D.M., Raaijmakers, J.M., Gardener, B.B., Thomashow, L.S., 2002. Microbial populations responsible for specic soil suppressiveness to plant pathogens. Annu. Rev. Phytopathol. 40, 309348. 197 Wong, P.Y.Y., Kitts, D.D., 2006. Studies on the dual antioxidant and antibacterial properties of parsley (Petroselinum crispum) and cilantro (Coriandrum sativum) extracts. Food Chem. 97, 505515. Whipps, J.M., 2001. Microbial interactions and biocontrol in the rhizosphere. J. Exp. Bot. 52, 487511. Yoshida, S., Hiradate, S., Tsukamoto, T., Hatakeda, K., Shirata, A., 2001. Antibacterial activity of culture ltrate of Bacillus amyloliquefaciens RC-2 isolated from mulberry leaves. Biol. Control 91, 181187.