PLAPHY3727_proof 7 August 2013 1/6

Plant Physiology and Biochemistry xxx (2013) 1e6

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55

Research article

Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco
Q2

Chang Dong a, b, Zhen Zhang a, **, Junpeng Ren a, Yang Qin b, Jinfeng Huang a, Yan Wang a, Binhua Cai a, Bailin Wang b, Jianmin Tao a, *
a b

College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China Department of Horticulture, Heilongjiang Academy of Agricultural Science, Harbin 150069, China

a r t i c l e i n f o
Article history: Received 4 June 2013 Accepted 25 July 2013 Available online xxx Keywords: Vitis amurensis ICE1 Tobacco Osmotic substances Cold tolerance Chilling tolerance

a b s t r a c t
We report the identication of the inducer of CBF expression 1 (ICE1) from Vitis amurensis, an upstream transcription factor that regulates the transcription of CBF-like genes. The structure of the basic helixloop-helix domain of VaICE1 is closely related to that of ICE1 in woody plants. This gene is strongly induced in leaves, roots, stems, and petioles by cold temperature. With longer duration of exposure to cold treatments, the expression patterns of organs exhibit differences, which are not observed in normal condition. Transgenic tobacco over-expressing VaICE1 has higher chilling tolerance and survival ability by improving the activities of superoxide dismutase, peroxidase, and catalase, as well as the chlorophyll yield. 2013 Published by Elsevier Masson SAS.

1. Introduction As one of the primary fruits consumed by human beings, grape holds a worldwide importance. However, the damage caused by low temperature to grapes is a difcult problem that hinders growth and development, seriously affects production and quality, and impedes the introduction of superior grape varieties with cold sensitivity. Bio-breeding engineering is an effective and economical approach to overcome these problems and obtain cold-tolerant grape varieties. Early studies have identied numerous genes in plants that change gene expression, namely, CBF1, CBF2, and CBF3 under cold stress [1e3]. The expression of CBFs activate the expression of genes with the DRE/CRT promoter element at warm temperatures, resulting in constitutive freezing tolerance [4,5]. The inducer of CBF expression 1 (ICE1), which acts upstream of the CBFs in the coldresponse pathway, has been recently identied. Arabidopsis ICE1 binds to the CBF3 promoter and activates CBF3 expression during cold treatment [6]. Subsequently, the activated CBF3 binds to the CRT/DRE cis-acting element (CCGAC) in the promoter regions and

induces the expression of downstream cold-responsive genes (COR15A) and other cold acclimation genes, thereby improving freezing tolerance [6]. Some cold-inducible genes have been isolated and identied [7,8], but homologous genes of Arabidopsis ICE1 have not been reported in grapes. Vitis amurensis is a freeze-tolerant wild grape species that is native to Northern China. V. amurensis is one of the most widely used species for rootstock and winemaking in grape cultivation, thus providing a potential molecular biological resource to improve cold tolerance in grapes by transforming V. amurensis ICE1. In this study, we successfully isolated the cDNA sequences and transferred VaICE1 into tobacco by the Agrobacterium-mediated transformation method, and studied the effects of VaICE1 overexpression on the cold tolerance of tobacco. 2. Results 2.1. Cloning and characterization of VaICE1 Based on the sequence analysis, we obtained a cDNA sequence of 1609 bp consisting of a 1548 bp ORF. The ORF encodes a deduced protein of 516 amino acids with a predicted molecular mass of 55.7 kDa and a pI of 5.42. The amino acid sequence analysis revealed that the deduced protein contains a basic helix-loop-helix (bHLH) domain [9] with 52 amino acids, and has high similarity to Arabidopsis ICE1 (Fig. 1A). Therefore, the gene was designated as

* Corresponding author. Fax: 86 25 84396724. ** Corresponding author. Fax: 86 25 84395724. E-mail addresses: dongchanggy@126.com (C. Dong), zzhang@njau.edu.cn (Z. Zhang), tjm266@sina.com (J. Tao). 0981-9428/$ e see front matter 2013 Published by Elsevier Masson SAS. http://dx.doi.org/10.1016/j.plaphy.2013.07.012

56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110

Please cite this article in press as: C. Dong, et al., Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.07.012

PLAPHY3727_proof 7 August 2013 2/6

C. Dong et al. / Plant Physiology and Biochemistry xxx (2013) 1e6

111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175

Fig. 1. Sequence alignment and phylogenic analysis of the ICE domain of VaICE1 and other ICE proteins. (A) Comparison of the deduced ICE domain of VaICE1 with other ICE proteins from AtICE1 (NP_189309), BrICE1 (ADZ24264), CbICE1 (AAS79350), ChICE1 (ADZ48234), EcICE1 (ADY68776), EsICE1 (ACT68317), RsICE1 (ADY68771), MdbHLH (ADL36591), BjICE (AEE00745), PtICE1 (ABN58427), and RcICE1 (XP_002511101). The putative bHLH domain is marked. The conserved amino acid residues are indicated in black. (B) The phylogenetic tree was constructed using VaICE1, together with other closely related genes. The genes were from PtICE1 (ABN58427), RcICE1 (XP_002511101), ChICE (ADZ48234), CsICE (ACT90640), GmICE (ACJ39211), VaICE1 (ADY17816), Vvinifera (XP_002274711), EgICE1 (AEF33833), EcICE1 (ADY68776), RsICE1 (ADY68771), BrICE1 (ACB70963), BnICE1 Q3 (AEL33687), EsICE (ACT68317), CbICE1 (AAS79350), and AtICE1 (NP_189309).

VaICE1 and submitted to GenBank (GenBank: ADY17816). The phylogenetic analysis for ICE1 of plants clearly divided data into two groups (Fig. 1B). VaICE1 was assigned to the wood group closest to Eucalyptus ICE1 (GenBank: AEF33833, ADY68776). 2.2. Expression of VaICE1 in different organs under cold stress The transcripts of the VaICE1 gene in organs were distinct under non-stress and low-temperature conditions. Transcript accumulation was not observed under non-stress condition in roots, leaves, stems, and petioles (Fig. 2A). This nding was further conrmed by qRT-PCR. However, the transcripts of roots, stems, leaves, and petioles were tremendously and rapidly induced under low temperature. A sharp increase was observed at 0.5 he72 h at 4  C, and different expression patterns were observed in the organs (Fig. 2B). 2.3. Chilling tolerance of transgenic tobacco To explore the function of VaICE, the overexpressing vector, including VaICE1, was transformed into tobacco and three

transgenic lines (4-1, 4-4, and 4-8) selected for further testing of VaICE1. Wilting and ooding of wild-type leaves were surveyed after storage at 4  C for 2 h. The survival rate reached 0% (Fig. 3A). However, the overexpressing transgenic lines showed no signicant morphological changes when stored at 4  C for 2 h, and the survival rate reached 53% (4-1), 71% (4-4), and 71% (4-8), respectively. The lines were placed in normal conditions for 12 d to recover. No vital changes were observed in the wild-type, whereas the transgenic lines showed no effects of low temperature (Fig. 3B). To explore the chilling tolerance of VaICE1 overexpression on owering time, wild-type and transgenic lines were exposed to 4  C for 4 h and then returned to normal conditions within 10 d. The results show that all leaves were ooded and tip stems curled after chilling treatment of all wild-type and transgenic lines. However, after returning to normal growth conditions, the leaves of the wild-type lines appeared dry. Some axillary buds at the foot of the branches germinated, but were weak, curled, and had dry leaves (Fig. 3C). For the transgenic lines, some ooded leaves recovered their green color, and all axillary buds germinated with strong, normal, and green leaves.

176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

Please cite this article in press as: C. Dong, et al., Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.07.012

PLAPHY3727_proof 7 August 2013 3/6

C. Dong et al. / Plant Physiology and Biochemistry xxx (2013) 1e6

241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305

Fig. 2. Expression patterns of the VaICE1 gene in various organs at 4  C. (A) RT-PCR analysis under non-stress condition; (B) qRT-PCR analysis at 4  C in organs. Bars indicate the standard deviation.

Fig. 3. Morphological changes of transgenic tobacco overexpressing VaICE1 under chilling treatments. (A) Morphological characteristics and survival rates upon storage at 4  C for 2 h. (B) Growth states after returning to normal condition for 12 d. (C) Germinating states of axillary bud after returning to normal condition within 10 d at 4  C for 4 h during owering time.

306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370

Please cite this article in press as: C. Dong, et al., Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.07.012

PLAPHY3727_proof 7 August 2013 4/6

C. Dong et al. / Plant Physiology and Biochemistry xxx (2013) 1e6

371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435

2.4. Enzyme activities and chlorophyll yield of transgenic tobacco The cold tolerance of VaICE1 in tobacco was further investigated by analyzing enzyme activities involved in osmotic regulation pathways in non-stress conditions and 4  C for 2 h. The results show that VaICE1 overexpression signicantly increased the activities of SOD, CAT, and POD under normal and cold conditions. Sharp increases were observed under low temperature, with the enzyme activities of transgenic lines being several times higher than that of wild-type lines (Fig. 4). A signicant increase was observed in the chlorophyll content under low temperature. These results reveal that VaICE1 acts as a causal factor for increasing osmotic accumulation and chloroplast protection in transgenic lines. 3. Discussion Plants are confronted with numerous stresses that induce or suppress the expression of a large number of genes. Low temperature triggers the transcription of the CBF family of transcription factors, which in turn activate the transcription of genes containing the DRE/CRT promoter element [1,4]. ICE1 is an important transcript factor for the CBF3 gene in Arabidopsis and has a critical function in the CBF cold accumulation pathway in plants [6,10]. Therefore, cold signaling for freezing tolerance requires a cascade of transcriptional regulations. In this study, we isolated and analyzed ICE1 of V. amurensis, an upstream transcription factor of this cascade. According to the genome of Vitis database, VaICE1, which consists of four exons and is located in chromosome 14, contains a sequence encoding a transcription factor of the bHLH family. Expression of the VaICE1 gene was strongly induced in leaves, roots, stems, and petioles by low temperature, but not by normal condition (Fig. 2). The Arabidopsis ICE1 gene was regulated by low temperature and participated in the CBF cold signal transduction pathway [6]. Badawi et al. (2008) demonstrated that wheat ICE gene is induced by low temperature and displays constitutive expression [11]. However, in our study, we found that VaICE1

expression does not occur in normal condition (Fig. 2A). No reports currently exist about that the ICE1 gene being non-constitutively expressed. qRT-PCR was carried out in V. amurensis to conrm this phenomenon. This phenomenon is possibly due to the genes of different materials appearing different and the numbers of ICE1, such as ICE1 and ICE2 in Arabidopsis [6,12], and ICE41 and ICE87 in Triticum [11]. These results need to be analyzed further for conrmation. Transgenic tobacco with VaICE1 overexpression displayed a chilling-responsive phenotype, which became more severe with higher survival rate (Fig. 3). A similar phenomenon was observed in transgenic Arabidopsis overexpressing TaICE gene [16], indicating that the biological function of this protein resembles that of transgenic plants. This function further activated the accumulation of osmotic enzyme and improved the chlorophyll yield of transgenic lines under chilling temperature (Fig. 4). Cold-responsive genes encode a diverse array of proteins, such as enzymes involved in respiration and metabolism of lipids, antioxidants, antifreeze proteins, and similar substances [10,13,14]. CAT, POD, and SOD are important osmotic substances that are synthesized or accumulated to balance the osmotic pressure of the stress environment [15]. The activities of SOD and POD enzymes increased in transgenic tobacco lines under chilling temperature, as well as the activity of CAT enzyme (Fig. 4). Antioxidant enzymes can reduce the toxicity caused by O2 production under stress. Thus, the increased activities of SOD, CAT, and POD can reduce the injury from cold stress. These results are consistent with the results of Liu et al. [8]. Under cold conditions, plants grow more slowly, and some even show growth defects or damage. Some of these cold-induced growth changes are attributed to the slowing of photosynthesis and generally low metabolic activities in the cold. Our data reveal that overexpressing VaICE1 altered plant growth and development at low temperatures. We also observed the increase of chlorophyll yield. Therefore, tobacco with overexpressed VaICE1 possibly protects chloroplasts, which subsequently improves plant growth in the cold.

Fig. 4. Enzyme activity and total chlorophyll content in transgenic tobacco. Fifty-day-old seedlings were withheld from below 4  C for 2 h before dates were taken. Bars indicate the standard deviation. **P < 0.01.

436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500

Please cite this article in press as: C. Dong, et al., Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.07.012

PLAPHY3727_proof 7 August 2013 5/6

C. Dong et al. / Plant Physiology and Biochemistry xxx (2013) 1e6

501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565

4. Conclusion In summary, we identied the cDNA clones and conducted coldresponsive characterization of VaICE1 from V. amurensis under low temperature. The information obtained from this study provides a foundation for further experiments to explore the gene regulatory network in the cold, to determine the function of cold-responsive genes in cold tolerance in Vitis through transgenic overexpression, and to investigate other molecular or cell biological approaches. 5. Materials and methods 5.1. Cloning and bioinformatics analysis of VaICE1 The sequence was cloned from the single-stranded cDNA synthesized from the RNA of wild V. amurensis in vitro under nonstressed or cold-stressed conditions. The primers I4JF (50 -GGACTAGTATGCTGTCCAGAGTGAACGGCGTCGT-) and I4JR (50 -GGGGTACC CTACAGCATACCGTGGAAGCCTGCCG30 ) were designed based on the genome of Vitis (http://www.vitisgenome.it), according to the sequence of Arabidopsis ICE1 (GenBank: AY195621). The completed open reading frame (ORF) was then obtained. The conserved domains in proteins were predicted using Motif Scan (http://scansite.mit.edu/motifscan_id.phtml). The amino acid sequences of ICE1 in Arabidopsis and other species were obtained from the National Center of Biotechnology Information (http:// www.ncbi.nlm.nih.gov/) database. Multiple sequence alignment of ICE-conserved domains was performed using Crustal 1.83. Shading was conducted using DNAMAN software (Version 5.2.2, Lynnon Biosoft) .The phylogenetic tree was constructed using CLUSTAL 1.8 with 1000 neighbor-joining bootstrap replicates and the substitution model of Poisson correction analysis. The obtained tree was viewed using MEGA 4.1 software. 5.2. RNA isolation and real-time quantitative reverse transcriptionpolymerase chain reaction (qRT-PCR) Sixty-day-old in vitro wild V. amurensis grown in Murashige and Skoog (MS) medium under a 16 h light/8 h dark regime at 25  C was transferred to 4  C at different times. Total RNA from different treatments and tissues were digested with RNase-free DNase I (TaKaRa, Japan) to remove genomic DNA contamination. cDNA fragments were synthesized as aforementioned. Transcript levels were determined on an ABI PRISM 7300 (Applied Biosystems, Foster City, CA, USA). For each reaction, 20 ng of cDNA was used with SYBR Premix Ex Taq mix (TaKaRa, Japan), including primers Irt1 (50 -CCTCACAGTCGCAGCCCTTC-30 ) and Irt2 (50 CCAGTTCGCAGCCCAAATCG-30 ) for the VaICE1 gene. A positive control was provided through a parallel analysis using the grape malate dehydrogenase gene as an internal reference [16]. The data of 0.5 h of leaves were used as basis for relative comparison. Relative expression was calculated relative to a calibrator using the formula 2DDCt. 5.3. Construction of expression vectors and transformation of tobacco The overexpression vector was constructed by subcloning VaICE1 into the vector pCAMBIA1300 containing the CaMV35S promoter. The recombinant plasmids were conrmed by sequencing, and then transformed into tobacco using Agrobacterium-mediated transformation following the methods described by Luo et al. [17]. The putative transgenic lines selected in one-half MS medium with high hygromycin content (50 mg mL1) were conrmed by PCR and RT-PCR amplication. Surviving tubers

under 5  C were harvested, and three transgenic lines were selected for physiological experiments. 5.4. Low-temperature treatment for morphological changes Fifty-day-old tobacco plants were transferred to 4  C for 2 h to assess their changes in terms of phenotypic responses to freezing stress. Eighty-day-old tobaccos with budding were kept at 4  C for 4 h to survey the physiological states of recovery after 10 d. 5.5. Assessment of enzyme activity and chlorophyll content Fifty-day-old tobacco plants were transferred to 4  C for 0 and 2 h to assess their enzyme activity responses to freezing stress. The tobacco leaves were subjected to peroxidase (POD) assay following the procedures of Sequeira and Mineo [18]. The activities of superoxide dismutase (SOD) and catalase (CAT) were measured following the methods described by Heath and Packer [19]. The chlorophyll yield was determined following the methods described by Heath and Packer [19]. Acknowledgments This work was supported by the National Key Project of 948 (No. 2011-G28), the National Public Agricultural Project of Science and Technique (No. 200903044), and the National Grape Industry Technology System (No. CARS-30-zp-4). References
[1] S.S. Baker, K.S. Wilhelm, M.F. Thomashow, The 50 -region of Arabidopsis thaliana cor15a has cis-acting elements that confer cold-, drought- and ABAregulated gene expression, Plant Mol. Biol. 24 (1994) 701e713. [2] P.L. Steponkus, M. Uemura, R.A. Joseph, S.J. Gilmour, M.F. Thomashow, Mode of action of the COR15a gene on the freezing tolerance of Arabidopsis thaliana, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 14570e14575. [3] F. Hadi, M. Gilpin, M.P. Fuller, Identication and expression analysis of CBF/ DREB1 and COR15 genes in mutants of Brassica oleracea var. botrytis with enhanced proline production and frost resistance, Plant Physiol. Biochem. 49 (2011) 1323e1332. [4] S.J. Gilmour, D.G. Zarka, E.J. Stockinger, M.P. Salazar, J.M. Houghton, M.F. Thomashow, Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression, Plant J. 16 (1998) 433e442. [5] H. Zhang, X. Liu, J. Liu, Y. Ou, Y. Lin, M. Li, B. Song, C. Xie, A novel ring nger gene, SbRFP1, increases resistance to cold-induced sweetening of potato tubers, FEBS Lett. 587 (2013) 749e755. [6] V. Chinnusamy, M. Ohta, S. Kanrar, B.H. Lee, X. Hong, M. Agarwal, J.K. Zhu, ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis, Genes Dev. 17 (2003) 1043e1054. [7] H. Xiao, M. Siddiqua, S. Braybrook, A. Nassuth, Three grape CBF/DREB1 genes respond to low temperature, drought and abscisic acid, Plant Cell Environ. 29 (2006) 1410e1421. [8] L. Liu, L. Duan, J. Zhang, Z. Zhang, G. Mi, H. Ren, Cucumber (Cucumis sativus L.) overexpressing cold-induced transcriptome regulator ICE1 exhibits changed morphological characters and enhances chilling tolerance, Sci. Hortic. 124 (2010) 29e33. [9] L. Jiang, S.T. Crews, The Drosophila dysfusion basic helix-loop-helix (bHLH)PAS gene controls tracheal fusion and levels of the trachealess bHLH-PAS protein, Mol. Cell. Biol. 23 (2003) 5625e5637. [10] E. Ruelland, M.-N. Vaultier, A. Zachowski, V. et Hurry, Cold signalling and cold acclimation in plants, Adv. Bot. Res. 49 (2009) 35e150. [11] M. Badawi, Y.V. Reddy, Z. Agharbaoui, Y. Tominaga, J. Danyluk, F. Sarhan, M. Houde, Structure and functional analysis of wheat ICE gene, Plant Cell Physiol. 49 (8) (2008) 1237e1249. [12] O.V. Fursova, G.V. Pogorelko, V.A. Tarasov, Identication of ICE2 a gene involved in cold acclimation which determines freezing tolerance in Arabidopsis thaliana, Gene 429 (2009) 98e103. [13] B.H. Lee, D.A. Henderson, J.K. Zhu, The Arabidopsis cold-responsive transcriptome and its regulation by ICE1, The Plant Cell 17 (2005) 3155e3175. [14] M.F. Thomashow, Plant cold acclimation freezing tolerance genes and regulatory mechanisms, Plant Physiol. 50 (1999) 571e599. [15] J. Huang, S.J. Sun, D.Q. Xu, X. Yang, Y.M. Bao, Z.F. Wang, H.J. Tang, H. Zhang, Increased tolerance of rice to cold, drought and oxidative stresses mediated by the overexpression of a gene that encodes the zinc nger protein ZFP245, Biochem. Biophys. Res. Commun. 389 (2009) 556e561.

566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 Q1 620 621 622 623 624 625 626 627 628 629 630

Please cite this article in press as: C. Dong, et al., Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.07.012

PLAPHY3727_proof 7 August 2013 6/6

C. Dong et al. / Plant Physiology and Biochemistry xxx (2013) 1e6 [18] L. Sequeira, L. Mineo, Partial puri cation and kinetics of indoleacetic acid oxidase from tobacco roots, Plant Physiol. 41 (1966) 1200 e 1208. [19] R.L. Heath, L. Packer, Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation, Arch. Biochem. Biophys. 125 (1968) 189e198.

631 632 633 634 635

[16] H. Xiao, E.A. Tattersall, M.K. Siddiqua, G.R. Cramer, A. Nassuth, CBF4 is a unique member of the CBF transcription factor family of Vitis vinifera and Vitis riparia, Plant Cell Environ. 31 (2008) 1e10. [17] K. Luo, X. Zheng, Y. Chen, Y. Xiao, D. Zhao, R. McAvoy, Y. Pei, Y. Li, The maize Knotted1 gene is an effective positive selectable marker gene for Agrobacteriummediated tobacco transformation, Plant Cell Rep. 25 (2006) 403e409.

636 637 638 639 640

Please cite this article in press as: C. Dong, et al., Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco, Plant Physiology and Biochemistry (2013), http://dx.doi.org/10.1016/j.plaphy.2013.07.012