DNA MICROARRAY

INTRODUCTION
A DNA microarray is a multiplex technology used in molecular biology
and in medicine. It consists of an arrayed series of thousands of microscopic
spots of DNA oligonucleotides, called features, each containing picomoles
of a specific DNA sequence. This can be a short section of a gene or other
DNA element that are used as probes to hybridize a cDNA or cRNA sample
(called target) under high-stringency conditions. Probe-target hybridization
is usually detected and quantified by fluorescence-based detection of
fluorophore-labeled targets to determine relative abundance of nucleic acid
sequences in the target.
In standard microarrays, the probes are attached to a solid surface by a
covalent bond to a chemical matrix (via epoxy-silane, amino-silane, lysine,
polyacrylamide or others). The solid surface can be glass or a silicon chip, in
which case they are commonly known as gene chip or colloquially Affy chip
when an Affymetrix chip is used. Other microarray platforms, such as
Illumina, use microscopic beads, instead of the large solid support. DNA
arrays are different from other types of microarray only in that they either
measure DNA or use DNA as part of its detection system.
Microarray technology evolved from Southern blotting, where fragmented
DNA is attached to a substrate and then probed with a known gene or
fragment. The use of a collection of distinct DNAs in arrays for expression
profiling was first described in 1987, and the arrayed DNAs were used to
identify genes whose expression is modulated by interferon. These early
gene arrays were made by spotting cDNAs onto filter paper with a pin-
spotting device. The use of miniaturized microarrays for gene expression
profiling was first reported in 1995,

and a complete eukaryotic genome
(Saccharomyce cerevisiae) on a microarray was published in 1997.


PRINCIPLE



The microarray technology consists of spotting PCR products or long
oligonucleotides (50mer-70mer) on glass slides at densities of up to 6000
spots / cm2. These slides are hybridized using fluorescent targets (cDNAs or
genomic DNAs). The fluorescent molecules most commonly used are
members of the cyanine family, Cy3 et Cy5. After hybridization, the signals
are detected using a fluorescence scanner. The use of two different
fluorochromes allows the determination of hybridization signals from two
distinct strains in one single experiment.
One the fluorescent intensities have been obtained, the major part of the
work is the analysis of the data in order to extract the biological information.




This analysis can be divided into five steps :
Target preparation
Hybridization
Slide scanning
Data analysis
Expression profile clustering

MATERIALS

DNA source
About 5200 human cDNA clones of the IMAGE library were obtained

from
the RZPD Resource Centre (Berlin, Germany). Some 21 000

random
shotgun clones representing the genome of Trypanosoma

brucei were
provided by Najib El-Sayed of the Institute for

Genomic Research (TIGR,
Rockville, USA). Nearly 4550 shotgun

clones covering the entire genome of
Pseudomonas putida as a

minimal tiling path were obtained from Helmut
Hilbert of Qiagen

(Hilden, Germany). PCR products for some 21 000
predicted open

reading frames (ORFs) of Drosophila melanogaster were
produced

directly from genomic DNA. The template for some 7300 ORF-
specific

PCR products of Candida albicans was strain SC5314 (Can14).



PCR amplification
PCR amplifications were performed in 384- or 96-well microtitre

plates. For
PCR on the cDNA and shotgun clones, 0.2 M

of the respective, vector-
specific primer pairs d(TCA CACAGGAAACAGCTATGAC)

and
d(GTAAAACGACGGCCAGTG) (human clones),
d(TTGTAAAACGACGGCCAGTG)

and
d(GCGGATAACAATTTCACACAGGA) (T.brucei) or
d(TCGGATCCACTAGTAACG)

and d(GGCCGCCAGTGTGATG)
(P.putida) (all from Interactiva, Ulm,

Germany) were used. The reactions
were started by inoculating

25 or 100 l of PCR mix, usually in 10 mM
TrisHCl,

pH 8.3, 2.25 mM MgCl
2
, 50 mM KCl, 0.2 mM each dATP, dTTP,
dGTP

and dCTP, 1.5 M betaine, 0.1 mM cresol red and 2 U Taq polymerase,

with a few Escherichia coli cells transferred from a growth

culture using a
plastic 384- or 96-pin gadget (Genetix, New

Milton, UK). The plates were
incubated for 3 min at 94C,

before 35 cycles of denaturation at 94C for 30
s, annealing

at 51C for 30 s and elongation at 72C for 90 s were

performed,
followed by a final elongation phase at 72C

for 10 min. In some cases, the
PCR was performed without betaine.

The Drosophila ORFs were initially
amplified on 100 ng genomic

DNA with some 43 000 gene-specific primers,
all of which contained

one of several common tag sequences of 15 nt length
at their

5'-ends. Subsequent re-amplification was carried out using the

fitting
primer pair. PCR products of C.albicans ORFs were produced

on 20 ng
genomic DNA with 7300 specific primer pairs.




MICROARRAY PRODUCTION PROCESS:
DNA fragments amplified by PCR technique are spotted on a microscopic
glass slide coated with polylysine prior to spotting process. The polylysine
coating goal is to ensure DNA fixation through electrostatic interactions.
PCR fragments are in our case the expressed part (ORF) of the 6200
Saccharomyces cerevisae genes (baker yeast). Slide preparation is achieved
by blocking the polylysine not fixed to DNA in order to avoid target
binding. Prior to hybridization, DNA is denatured to obtained a single strand
DNA on the microarray, this will allow the probe to bind to the
complementary strand from the target.

Target preparation:
RNA are extracted from two yeast cultures from which we want to
compare expression level. Messengers RNA are then transformed in cDNA
by reverse transcription. On this stage, DNA from the first culture with a
green dye, whereas DNA from the second culture is labeled with a red dye.
The available target-preparation methods can be divided into two groups:
first-strand cDNA that is labeled or tagged with a capture sequence, or the
generation of antisense RNA (aRNA) from double-stranded cDNA during an
in vitro transcription (IVT) reaction. Labeled cDNA can be prepared via
direct The incorporation of a fluorophore-labeled nucleotide or through
incorporation of an aminoallyl-labeled nucleotide, followed by coupling to a
fluorophore containing an amine-reactive group to the aminoallyl nucleotide
(Schena et al. 1995; for review, see Lockhart and Winzeler 2000).
Alternatively, the first-strand cDNA can be tagged with a capture sequence
that is used for subsequent detection steps (Stears et al. 2000). DNA
microarrays containing short oligonucleotide probes (<35 nucleotides long)
require more target for each hybridization, which requires an amplification
method with smaller sample sizes. Typically, the generation of aRNA
(aRNA is also commonly called complementary RNA or cRNA) is preceded
by first-strand synthesis of cDNA using an oligonucleotide primer
containing a bacteriophage T7 RNA polymerase promoter proximal to an
oligo(dT) sequence (van Gelder et al. 1990;Eberwine et al. 1992; Lockhart et
al. 1996). After second-strand cDNA synthesis and cDNA purification, an
IVT reaction is performed using T7 RNA polymerase in the presence of
labeled nucleotides. Alternatives to this labeling strategy produce unlabeled
aRNA, followed by a cDNA synthesis in the presence of a fluorophore-
labeled nucleotide (Wang et al. 2000). Any target preparation method
requires a linear amplification of the available transcripts to be
representative of the transcript population.


Hybridization:
Green labeled cDNA and red labeled ones are mixed together (call the
target) and put on the matrix of spotted single strand DNA (call the probe).
The chip is then incubated one night at 60 degrees. At this temperature, a
DNA strand that encounter the complementary strand and match together to
create a double strand DNA. The fluorescent DNA will then hybridize on the
spotted ones.


The discrepancies in microarray results are a consequence of

differences in
microarray measures, such as accuracy [i.e. the

degree of conformity of the
measured quantity to its actual

(true) value; sensitivity [i.e. the
concentration

range of target molecules in which accurate measurements can

be made; reproducibility [i.e. the degree

to which repeated measurements
of the same quantity will show

the same or similar results; and specificity
[i.e.

the ability of a probe to provide a signal that is influenced

only by the
presence of the target molecule.


Accuracy, sensitivity and reproducibility may be affected by

several
effectors. These measures and their effectors are discussed

by Dufva and
Draghici et al. , and will not be detailed

here. An example for an effector of
sensitivity, reproducibility

and accuracy is the type of microarray platform:
oligonucleotide

arrays have been found to be more reproducible and
sensitive

than cDNA arrays , and some oligonucleotide arrays have been

found to be more accurate than others. Sensitivity is also

affected by probe
density (i.e. the number of different probes

that are fabricated in a given
area), which has been shown to

be an effector for the availability of probes
for hybridization; this availability may also be affected by the steric

restrictions imposed by the solid microarray surface. A

higher availability of
probes for hybridization has been demonstrated

to increase sensitivity. In
addition, sensitivity is affected

by the hybridization signal-to-noise ratio (i.e.
the ratio between

the spot signal and that of the background): a low
background

increases microarray hybridization sensitivity
Low specificity of microarray hybridizations has been suggested

to be one of
the prime measures affecting discrepancies in gene-expression

profiles
between different probes targeting the same region

of a given transcript or
between different microarray

platforms; in the present review, we will
highlight

the issue of microarray - hybridization specificity as a key measure

that once improved, may increase the validity of microarray

results.


Microarrays consist of multiple probes. Hence, a prime key for

specificity
during microarray hybridization, for either short-oligomer

or cDNA
microarrays; is the ability of the probe to

discriminate between different
target molecules.


Probes are designed to be complementary to the target molecule

according to
the WatsonCrick rules of binding. Therefore,

a probe with high specificity
to its target molecule should

provide a signal influenced only by the presence
of the target

molecule. Nevertheless, a perfect match in terms of sequence-
similarity-based

complementarity between a probe and its target molecule
does

not guarantee specificity. This is due to the presence of thousands

of
target molecules during microarray hybridizationeach

target molecule
being composed of tens of hundreds or thousands

of four-nucleotide bases,
and to the effect of different effectors

(discussed subsequently) of
hybridization specificity, which

may alter the ability of a probe to bind to a
target molecule.

Hence, there is often some degree of microarray-probe
hybridization

to a target molecule which is not strictly complementary to

it
or vice versa, a variable number of target molecules that

are hybridized to a
microarray probe which is not exactly complementary

to them.



FOUR LEVELS OF HYBRIDIZATION SPECIFICITY
We define four levels of hybridization specificity in the context

of
microarray hybridization. The first is of hybridization between

a single probe
molecule and a single target molecule.

The two molecules may exhibit
perfect hybridization,

partial hybridization (i.e. the target molecule is only
partially

hybridized to the probe; or no hybridization.
The second level of specificity is of a spot. At

this level, multiple probe
molecules that compose one spot are

hybridized to multiple target molecules.
The spot probes may

exhibit perfect, partial or no hybridization with the
target

molecules.

Notably, at this level, partial hybridization may have one or

both of two forms: only some of the probes may be hybridized

to the target
molecule, or probes may be hybridized to only

some of the target molecules.
This partial hybridization, at

the spot level, may be a result of cross-
hybridization (i.e. hybridization

between sequences that are not strictly
complementary, due to the presence and hybridization of nontarget

molecules with sequences similar to that of the spot probes.

Since a spot is
composed of multiple probes, a single spot may

simultaneously bear all
combinations of one to four of the presented

probe-target molecule types of
binding.


The third level of specificity is of a spot-set [or, in Affymetrix

terminology,
probe-set, in

which multiple spots represent different segments of the same

reference sequence (e.g. different exons of a gene). At this

level, different
spots of a spot-set may exhibit perfect hybridization

with the target
molecule; partial hybridization

with the target molecule due to the presence
of

probes with mismatches to the target molecule as a result of,

for example,
an annotation error in the gene sequence, or intended

mismatches introduced
to quantify nonspecific hybridization;

no hybridization due to, for example,
alternative

splicing of a transcript, leading to probes with no match to

the
target molecule; cross hybridization due to,

for example, a spot, within a
spot-set that represents an evolutionarily

conserved gene segment, which
hybridizes with nontarget molecules

derived from various gene-family
members.


The fourth level of specificity is that of the microarray, in

which a variable
number of spot-sets may exhibit different forms

of hybridization with target
sequences perfect

hybridization (i.e. all target molecules are hybridized to
their

representative spot-sets and all spot-sets are hybridized to

the target
molecules they represent), partial hybridization

in either direction, no
hybridization (i.e. target molecules

are not hybridized to any spot-set or spot-
sets do not match

any target molecules) or cross- hybridization (e.g. target
molecules

of different genes hybridize to the same spot-set or target

molecules of a particular gene hybridize to several different

genes spot-
sets). These different forms may exist for

a large number of different target
molecules or spot-sets.


Slide scanning:
A laser excites each spot and the fluorescent emission gather through a
photo-multiplicator (PMT) coupled to a confocal microscope. We obtained
two images where grey scales represent fluorescent intensities read. If we
replace grey scales by green scales for the first image and red scales for the
second one, we obtained by superimposing the two images one image
composed of spots going from green ones (where only DNA from the first
condition is fixed) to red (where only DNA from the second condition is
fixed) passing through the yellow color (where DNA from the two
conditions are fixed on equal amount).


Data analysis:
We have now two microarray images from which we have to calculate the
number of DNA molecules in each experimental condition. To dos o, we
measure the signal amount in the green dye emission wavelength and the
signal amount in the red dye emission wavelength. Then we normalise these
amount according to various parameters (yeast amount in each culture
condition, emission power of each dye, ). We suppose that the amount of
fluorescent DNA fixed is proportional to the mRNA amount present in each
cell at the beginning and we calculate the red/green fluorescence ratio. If this
ratio is greater than 1 (red on the image), the gene expression is greater in
the second experimental condition, if this ration is smaller than 1 (green on
the image), the gene expression is greater in the first condition. We can
visualize these differences in expression using software as the one developed
in the laboratory call ArrayPlot (cf below image). This software allows from
the intensities list of spot to display the red intensities of each spot as a
function of the green intensities.

Fabrication
Microarrays can be manufactured in different ways, depending on the
number of probes under examination, costs, customization requirements, and
the type of scientific question being asked. Arrays may have as few as 10
probes to up to 2.1 million micrometre-scale probes from commercial
vendors.

Surface engineering
The first step of DNA microarray fabrication involves surface engineering of
a substrate in order to obtain desirable surface properties for the application
of interest. Optimal surface properties are those which produce high signal
to noise ratios for the DNA targets of interest. Generally, this involves
maximizing the probe surface density and activity while minimizing the
non-specific binding of the targets of interest. Methods of surface
engineering vary depending on the platform material, design, and
application.

Spotted vs. oligonucleotide arrays
Microarrays can be fabricated using a variety of technologies, including
printing with fine-pointed pins onto glass slides, photolithography using pre-
made masks, photolithography using dynamic micromirror devices, ink-jet
printing,

or electrochemistry on microelectrode arrays.
In spotted microarrays, the probes are oligonucleotides, cDNA or small
fragments of PCR products that correspond to mRNAs. The probes are
synthesized prior to deposition on the array surface and are then "spotted"
onto glass. A common approach utilizes an array of fine pins or needles
controlled by a robotic arm that is dipped into wells containing DNA probes
and then depositing each probe at designated locations on the array surface.
The resulting "grid" of probes represents the nucleic acid profiles of the
prepared probes and is ready to receive complementary cDNA or cRNA
"targets" derived from experimental or clinical samples. This technique is
used by research scientists around the world to produce "in-house" printed
microarrays from their own labs. These arrays may be easily customized for
each experiment, because researchers can choose the probes and printing
locations on the arrays, synthesize the probes in their own lab (or
collaborating facility), and spot the arrays. They can then generate their own
labeled samples for hybridization, hybridize the samples to the array, and
finally scan the arrays with their own equipment. This provides a relatively
low-cost microarray that may be customized for each study, and avoids the
costs of purchasing often more expensive commercial arrays that may
represent vast numbers of genes that are not of interest to the investigator.
Publications exist which indicate in-house spotted microarrays may not
provide the same level of sensitivity compared to commercial
oligonucleotide arrays, possibly owing to the small batch sizes and reduced
printing efficiencies when compared to industrial manufactures of oligo
arrays.
In oligonucleotide microarrays, the probes are short sequences designed to
match parts of the sequence of known or predicted open reading frames.
Although oligonucleotide probes are often used in "spotted" microarrays, the
term "oligonucleotide array" most often refers to a specific technique of
manufacturing. Oligonucleotide arrays are produced by printing short
oligonucleotide sequences designed to represent a single gene or family of
gene splice-variants by synthesizing this sequence directly onto the array
surface instead of depositing intact sequences. Sequences may be longer (60-
mer probes such as the Agilent design) or shorter (25-mer probes produced
by Affymetrix) depending on the desired purpose; longer probes are more
specific to individual target genes, shorter probes may be spotted in higher
density across the array and are cheaper to manufacture. One technique used
to produce oligonucleotide arrays include photolithographic synthesis
(Agilent and Affymetrix) on a silica substrate where light and light-sensitive
masking agents are used to "build" a sequence one nucleotide at a time
across the entire array. Each applicable probe is selectively "unmasked"
prior to bathing the array in a solution of a single nucleotide, then a masking
reaction takes place and the next set of probes are unmasked in preparation
for a different nucleotide exposure. After many repetitions, the sequences of
every probe become fully constructed. More recently, Maskless Array
Synthesis from NimbleGen Systems has combined flexibility with large
numbers of probes.


Two-channel vs. one-channel detection



Diagram of typical dual-colour microarray experiment.
Two-color microarrays or two-channel microarrays are typically hybridized
with cDNA prepared from two samples to be compared (e.g. diseased tissue
versus healthy tissue) and that are labeled with two different fluorophores.
Fluorescent dyes commonly used for cDNA labelling include Cy3, which
has a fluorescence emission wavelength of 570 nm (corresponding to the
green part of the light spectrum), and Cy5 with a fluorescence emission
wavelength of 670 nm (corresponding to the red part of the light spectrum).
The two Cy-labelled cDNA samples are mixed and hybridized to a single
microarray that is then scanned in a microarray scanner to visualize
fluorescence of the two fluorophores after excitation with a laser beam of a
defined wavelength. Relative intensities of each fluorophore may then be
used in ratio-based analysis to identify up-regulated and down-regulated
genes.
Oligonucleotide microarrays often contain control probes designed to
hybridize with RNA spike-ins. The degree of hybridization between the
spike-ins and the control probes is used to normalize the hybridization
measurements for the target probes. Although absolute levels of gene
expression may be determined in the two-color array, the relative differences
in expression among different spots within a sample and between samples is
the preferred method of data analysis for the two-color system. Examples of
providers for such microarrays includes Agilent with their Dual-Mode
platform, Eppendorf with their DualChip platform for fluorescence labeling,
and TeleChem International with Arrayit.
In single-channel microarrays or one-color microarrays, the arrays are
designed to give estimations of the absolute levels of gene expression.
Therefore the comparison of two conditions requires two separate single-dye
hybridizations. As only a single dye is used, the data collected represent
absolute values of gene expression. These may be compared to other genes
within a sample or to reference "normalizing" probes used to calibrate data
across the entire array and across multiple arrays. Three popular single-
channel systems are the Affymetrix "Gene Chip", the Applied Microarrays
"CodeLink" arrays, and the Eppendorf "DualChip & Silverquant". One
strength of the single-dye system lies in the fact that an aberrant sample
cannot affect the raw data derived from other samples, because each array
chip is exposed to only one sample (as opposed to a two-color system in
which a single low-quality sample may drastically impinge on overall data
precision even if the other sample was of high quality). Another benefit is
that data are more easily compared to arrays from different experiments; the
absolute values of gene expression may be compared between studies
conducted months or years apart. A drawback to the one-color system is
that, when compared to the two-color system, twice as many microarrays are
needed to compare samples within an experiment.


Expression profile clustering:
Then we can try to gather genes that share the same expression profile on
several experiments. This clustering can be done gradually as for
phylogenetic analysis, which consist in calculating similarity criteria
between expression profiles and gather the most similar ones. We can also
use more complex techniques as principal component analysis or neuronal
networks.
At the end hierarchical clustering is usually displayed as a matrix where
each column represent one experiment and each row a gene. Ratios are
displayed thanks to a colour scale going from green (repressed genes) to red
(induced genes).

USES
Arrays of DNA can be spatially arranged, as in the commonly known gene
chip (also called genome chip, DNA chip or gene array), or can be specific
DNA sequences labelled such that they can be independently identified in
solution. The traditional solid-phase array is a collection of microscopic
DNA spots attached to a solid surface, such as glass, plastic or silicon
biochip. The affixed DNA segments are known as probes (although some
sources use different terms such as reporters). Thousands of them can be
placed in known locations on a single DNA microarray.
DNA microarrays can be used to detect DNA (as in comparative genomic
hybridization), or detect RNA (most commonly as cDNA after reverse
transcription)that may or may not be translated into proteins. The process of
measuring gene expression via cDNA is called expression analysis or
expression profiling.
Since an array can contain tens of thousands of probes, a microarray
experiment can accomplish that many genetic tests in parallel. Therefore
arrays have dramatically accelerated many types of investigation.


APPLICATIONS

Technology or
Application
Synopsis
Gene expression
profiling
In an mRNAor gene expression profiling
experiment the expression levels of thousands of
genes are simultaneously monitored to study the
effects of certain treatments, diseases, and
developmental stages on gene expression. For
example, microarray-based gene expression
profiling can be used to identify genes whose
expression is changed in response to pathogens or
other organisms by comparing gene expression in
infected to that in uninfected cells or tissues.
Comparative genomic
hybridization
Assessing genome content in different cells or
closely related organisms.
Chromatin
immunoprecipitation
on Chip
DNA sequences bound to a particular protein can be
isolated by immunoprecipitating that protein
(CHIP), these fragments can be then hybridized to a
microarray (such as a tiling array) allowing the
determination of protein binding site occupancy
throughout the genome. Example protein to
immunoprecipitate are histone modifications
(H3K27me3, H3K4me2, H3K9me3, etc),
Polycomb-group protein (PRC2:Suz12, PRC1:YY1)
and trithorax-group protein (Ash1) to study the
epigenetic landscape or RNA Polymerase II to study
the transcription lanscape.
SNP detection
Identifying single nucleotide polymorphism among
alleles within or between populations. Several
applications of microarrays make use of SNP
detection, including Genotyping, forensic analysis,
measuring predisposition to disease, identifying
drug-candidates, evaluating germline mutations in
individuals or somatic mutations in cancers,
assessing loss of heterozygosity, or genetic linkage
analysis.
Alternative splicing
detection
An 'exon junction array design uses probes specific
to the expected or potential splice sites of predicted
exons for a gene. It is of intermediate density, or
coverage, to a typical gene expression array (with 1-
3 probes per gene) and a genomic tiling array (with
hundreds or thousands of probes per gene). It is used
to assay the expression of alternative splice forms of
a gene. Exon arrays have a different design,
employing probes designed to detect each individual
exon for known or predicted genes, and can be used
for detecting different splicing isoforms.
Tiling array
Genome tiling arrays consist of overlapping probes
designed to densely represent a genomic region of
interest, sometimes as large as an entire human
chromosome. The purpose is to empirically detect
expression of transcripts or alternatively splice
forms which may not have been previously known
or predicted.