Rapid Construction of a Plant RNA Interference

Expression Vector for Hairpin RNAMediated Targeting

Using a PCR-Based Method
Ji-Ren Chen,
13
Xingyao Xiong,
2,3
Tian-Xiang Wang,
1
Jing-Jing Lu ,
1
Shou-Yi Chen,
4
and Hua-Fang Wang
1
Here we describe a rapid and efcient PCR-mediated ligation protocol for constructing a plant RNA interference
vector to express long hairpin RNA (hpRNA). In the protocol, four oligonucleotide primers were used and three
rounds of PCRs performed. The product of the rst PCRwas usedas a megaprimer for the secondPCRto generate a
chimeric molecule with a gene-specic sequence and a spacer spliced together. The chimeric product could be used
as another megaprimer for the third PCR to ligate another gene-specic sequence to the other end of the spacer, but
in the reverse orientation. Thus, within a few days, two gene-specic sequences could be ligated to a spacer in the
antisense and sense orientations using the PCR-mediated ligation method, without reliance on restriction cleavage
and DNA ligation. The ligated product could be inserted into the plant expression vector for plant transformation.
The transcribed RNA formed hpRNA constructs containing sense=antisense arms for specic gene targeting.
Overexpression of hpRNAconstructedby a Medicago truncatula xyloglucan endotransglycosylase gene retarded the
growth of transgenic M. truncatula roots.
Introduction
R
NA interference (RNAi), a posttranscriptional gene
regulatory mechanism inherent in many eukaryotes, is a
powerful reverse genetic tool to study gene function. RNAi is
induced by double-strand RNA (dsRNA). In plants, the long
dsRNA is converted into functionally different short (21
22 nt) and long (2426 nt) short-interfering RNA duplexes
(Hamilton et al., 2002) by different Dicer-like enzymes (Tang
et al., 2003), leading to sequence-specic RNA degradation
and gene silencing in a posttranscriptional fashion. RNAi can
be triggered in living plant cells using several different ap-
proaches, such as stable gene transformation that generates
stable transgenic plants expressing RNA capable of forming a
double-stranded hairpin (Chuang and Meyerowitz, 2000;
Smith et al., 2000; Wesley et al., 2001; Stoutjesdijk et al., 2002),
transient expression mediated by Agrobacterium tumefaciens
( Johansen and Carrington, 2001), root transformation medi-
ated by A. rhizogenes (Kumagai and Kouchi, 2003; Limpens
et al., 2004), and biolistic delivery of dsRNA by particle bom-
bardment at the single-cell level (Schweizer et al., 2000).
In most cases, the RNAi expression vector is constructed, prior
to gene transformation to generate hairpin RNA (hpRNA), by
ligating sense and antisense gene sequences to an intron or a
spacer. This type of ligated product is mainly created using
conventional techniques, specically restriction cleavage and
DNA ligation (Smith et al., 2000; Stoutjesdijk et al., 2002; Miki
and Shimamoto, 2004; Dafny-Yelin et al., 2007). However, this
technique has limitations resulting from the lack or the mul-
tiplicity of restriction sites (Fang et al., 1999).
Here we describe a detailed protocol for rapid construction
of a plant RNAi vector without reliance on restriction sites, in
which three segments, an antisense gene fragment, a spacer
sequence, and a sense gene fragment, were joined together by
a PCR-mediated ligation method. PCR-mediated methods,
such as overlap-extension PCR (Urban et al., 1997; Heckman
and Pease, 2007), asymmetric PCR (Sandhu et al., 1992; Fang
et al., 1999), fusion PCR (Kuwayama et al., 2002; Szewczyk
et al., 2007), RNA- and DNA-overhang cloning (Coljee et al.,
2000), and megaprimer PCR (Kammann et al., 1989; Sarkar
and Sommer, 1990; Ke and Madison, 1997; So derberg and
Lang, 2006), have been exploited to create chimeric molecules.
Among these methods, megaprimer PCR seems the simplest;
this requires only three primers and two PCRs that can even
1
College of Biological Sciences and Biotechnology, Beijing Forestry University, Beijing, Peoples Republic of China.
2
College of Horticulture and Gardening, Hunan Agricultural University, Changsha, Peoples Republic of China.
3
Hunan Provincial Key Laboratory for Germplasm Innovation and Utilization of Crop, Changsha, Peoples Republic of China.
4
Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, Peoples Republic of China.
DNA AND CELL BIOLOGY
Volume 28, Number 12, 2009
Mary Ann Liebert, Inc.
Pp. 605613
DOI: 10.1089=dna.2009.0897
605
be run in one tube (Picard et al., 1994; Barik, 1997; Ke and
Madison, 1997). However, the yield for gene fusion or gene
splicing is relatively poor (Barik, 1997). With a minor modi-
cation in our experiments (Chen et al., 2008), megaprimer
PCR can be used to create a chimeric product with two or
more different gene segments spliced together, and also to
construct an RNAi vector to express hpRNA.
To test the generality of this new protocol, we used the
protocol to generate several antisense-spacer-sense products
with size range 7481474 bp. Moreover, four other sets of
primers were designed for generation of several other sense-
spacer-antisense products. All antisense-spacer-sense or
sense-spacer-antisense products were generated (Supple-
mental Materials, available online at www.liebertonline
.com).
Materials and Methods
Amplication templates
PCR amplication was used to generate a chimeric gene
composed of the antisense Medicago truncatula xyloglucan
endotransglycosylase (MtXET) gene and the sense MtXET
gene linked to a spacerGenBank accession numbers
DQ855285 (MtXET) and AF485783 (the b-glucuronidase=GUS
gene in pBI121, acting as a spacer; Chuang and Meyerowitz,
2000; Hirai et al., 2007). The 3.9kb pGEM-T Easy Vector (Pro-
mega, San Luis Obispo, CA) containing 0.9 kb MtXET cDNA
(cloned by our lab) and the 14.8kb pBI121 (conserved in our
lab) plasmid-carrying GUS gene were used as the templates.
The plasmid DNA templates were prepared by Qiagen puri-
cation (Shanghai, China), and their concentrations deter-
mined by SMA3000 (Kaiao, Beijing, China) measurement in
this report.
Oligonucleotide primers
Megaprimer PCR requires three oligonucleotide primers:
two anking primers, which are forward and reverse, and
one internal primer. Our protocol aimed to splice three seg-
ments (an antisense gene fragment, a spacer, and a sense
gene fragment) together, and consisted of three PCRs: one
initial PCR and two megaprimer PCRs. The product gener-
ated in the initial PCR was used as megaprimer in the rst
megaprimer PCR to generate an intermediate chimeric
product. This chimeric product was then used as mega-
primer again in the second megaprimer PCR to generate a
full-length product. At least two anking primers and two
internal primers were used in this protocol. To test the new
gene splicing strategy, three forward anking primers and
two internal primers were synthesized from Invitrogen
(Carlsbad, CA) (Fig. 1A). The three forward primers were
also used as reverse anking primers in the second mega-
primer PCR.
Alternative anking primers. Each can be used for both
forward and reverse (restriction sites are underlined).
a1: 5
0
AGTTGAGTCTCAGAACCACCAT
0
3
a2: 5
0
CGGGATCCCACAATCTGGTACATGTTCCATA
G
0
3 (BamHI)
a3: 5
0
ACGCGTCGACTTCTTGAACACCCTGATTGG
0
3
(SalI)
Internal primers. Each includes two parts: one from gene
MtXET, and the other from the spacer (GUS gene fragment
indicated by dashed lines).
b: 5
0
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
GACAAGGCACTAGCGGGACCAACTTAAAAA
CAACACAC
0
3
c: 5
0
GGTGTGTTGTTTTTAAGTTGTCCACGCCATTTG
AAGCCGATGT
0
3
Initial PCR reactions generating products
with a complementary 3
0
-end of the spacer
Each 50 mL reaction contained 1 U of Pfu DNA polymerase
(Stratagene, La Jolla, CA), 1 reaction buffer [10 mM KCl,
10 mM (NH
4
)
2
SO
4
, 20 mM Tris-Cl (pH 8.75), 2 mM MgSO
4
,
0.1% Triton X-100, and 100 mg=mL BSA], 125 mM dNTPs
(Tiangen, Beijing, China), 5 ng template DNA (pGEM-T
containing the MtXET gene), and primers (primer b and one
of anking primers: a1, a2, or a3) at 0.5 mM each. The step
program for PCR was as follows: one cycle at 948C for 5 min;
followed by 30 cycles at 948C for 30 s, 558C for 30 s, and 728C
for 1.5 min; and then one cycle at 728C for 7 min in a
T-gradient PCR machine (Biometra, Goettingen, Germany).
The intended products (namely, mpA1, mpA2, and mpA3,
respectively; mp, megaprimer) were puried by Qiagen ex-
traction kit, and their concentrations quantied by SMA3000
measurement. At least 500 ng of each intended product was
required for the next step.
Megaprimer PCR#1 generating products by splicing
together MtXET and GUS segments
To produce the ligated gene product (MtXET and GUS
segments ligated together in a MtXET-GUS product),
megaprimer PCRs were performed using the same concen-
trations of PCR buffer, Pfu, and dNTPs as those of the initial
PCR. Approximately 50100 ng of each puried PCR product
(above) was added as megaprimer in separate experiments,
with 0.5 mM primer c and 0.05 mM primer a1, a2, or a3 (same
as the anking primer used for generation of the mega-
primer, trigger primer) (Chen et al., 2008). About 25 ng of
pBI121 plasmid (carrying the GUS gene) was used as a
template. Two controls were set: one without template and
trigger primer (negative control), and the other with tem-
plate but without trigger primer (standard protocol). Tem-
plate and primers used for 50 mL PCR reaction are listed in
Table 1.
The PCR program was identical to that for the initial re-
actions except that the annealing temperature was 588C.
We poured a 1.5% (w=v) agarose gel, loaded 5 mL DNA
ladder and PCRs in the wells, and then ran the gel at 160 V
for 30 min, followed by taking photographs to check the
amplication efciency and verify the presence of amplied
DNA of the correct size in the reaction mixture. The intended
products (namely, A1C, A2C, and A3C, respectively) were
puried and quantied again. At least 500 ng of each in-
tended product was prepared for the following step.
Subcloning and sequencing of the longest
product (optional)
To ensure the accuracy of the ligation, subcloning and
sequencing were performed. To obtain PCR products with
- - - - - - - - - - - - - - - - - - - - - - - - - -
- - - - - - - - - - - - - - - - - - - - - - - - - -
606 CHEN ET AL.
Table 1. Template and Primers Used for Generation of Medicago truncatula Xyloglucan
Endotransglycosylase-b-Glucuronidase Product by Use of Three Protocols
Component Modied protocol Negative control Standard protocol
Template DNA (pBI121-GUS) 25 ng 25 ng
mpA1 (mpA2 or mpA3) 50100 ng 50100 ng 50100 ng
Internal primer c 0.5 mM 0.5 mM 0.5 mM
Trigger primer a1 (a2 or a3)
a
0.05 mM
a
The trigger primer was the same anking primer as used for generation of the megaprimer. The concentration of the trigger primer was
10% of that of internal primer c, because normal concentration (0.5 mM) would preferentially generate more nonspecic products.
FIG. 1. Ligation of a gene-specic sequence to a spacer using megaprimer-based PCR. (A) Schematic diagram showing the
primers used and their relationships to megaprimers and amplied products. Dark box with white left arrow represents the
antisense strand, and gray box indicates a spacer. The antisense strand and spacer are also indicated by solid and dashed
lines, respectively, in the bottom part of the diagram for simplicity. Forward primers a1, a2, and a3, together with internal
primer b, generated megaprimers mpA1, mpA2, and mpA3 (mp, megaprimer) in base pairs. Ligated products A1C, A2C, and
A3C with specic sizes were expected to be generated by megaprimers and primer c. (BD) Effect of trigger primer on
megaprimer PCR. Specic ligated products A1C (578 bp, B), A2C (904 bp, C), and A3C (942 bp, D) (indicated by asterisk)
generated by PCR using primers mpA1 a1 c, mpA2 a2 c, and mpA3 a3 c, respectively, in each well, 5 mL of 50 mL
reactions were loaded. M1, 200 bp ladder, 5 mL; neg, negative control, samples in the absence of template and trigger primers
(primer a1 for amplication of A1C; a2, a3 for that of A2C, A3C, respectively); SP, standard protocol, samples in the absence
of trigger primer. The megaprimers used for 50 mL reactions were also loaded and indicated by arrowheads.
RAPID CONSTRUCTION OF PLANT RNAI VECTOR 607
blunt ends, dATP was added to the 3
0
-ends before TA liga-
tion. Each 10 mL dATP addition reaction was performed in
1Taq buffer [20 mM Tris-HCl pH 8.4, 20 mM KCl, 10 mM
(NH
4
)
2
SO
4
and 15 mM MgCl
2
], supplemented with 200 mM
dATP, and 2 U of Taq polymerase (Tiangen). Approximately
150 ng of puried A3C (the longest product generated by
megaprimer PCR#1) was used as a template. The PCR step
program was one cycle at 728C for 30 min. Approximately
50 ng A3C (3.5 mL addition reaction above) and 50 ng pGEM-
T Easy Vector (Promega) were combined in a nal volume of
10 mL and ligated for 16 h at 48C in 1T4 ligase buffer with 3
Weiss U of T4 DNA ligase (Promega). Ligation reaction was
transformed to TOP10 competent cell (Tiangen). Transfor-
mation and selection were performed according to the
manual. PCR-veried positive clones were used for se-
quencing on an ABI 3730xl automatic DNA sequencer (ABI,
Foster City, CA).
Megaprimer PCR#2 generating chimeric products
composed of an antisense gene and the sense gene
linked to a spacer
To generate the chimeric antisense-spacer-sense (MtXET-
GUS-MtXET in this protocol) PCR product (Fig. 2A), we
previously designed primer c as an internal primer to gen-
erate an overlapping, complementary 3
0
-end of the MtXET
gene. Thus, the products (A1C, A2C, and A3C, also named
mpA1C, mpA2C, and mpA3C in this step) generated by the
rst megaprimer PCR or products amplied from positive
clones were used as megaprimers in this step. Megaprimer
PCRs were performed in the same conditions of PCR buffer,
Pfu, and dNTPs as described in the initial PCR. The plasmid
pGEM-MtXET was used as the template again. Four com-
binations of megaprimers, reverse anking primers, and
trigger primers were used to generate different products.
Template and primers used for 50 mL PCR reaction are listed
in Table 2.
Subcloning, sequencing, and construction
of plant RNAi vector
Subcloning and sequencing were performed as described
above. Product A2A3 was selected for subcloning and se-
quencing because the product contains BamHI and SalI
restriction sites and facilitates the insertion into plant ex-
pression vector pBin438 (Clontech, Mountain View, CA)
driven by the Cauliower mosaic virus 35S promoter. Posi-
tive colonies from subcloning experiments were screened by
both PCR of bacterial DNA and restriction digestion of ex-
tracted plasmids from the bacterial colonies. Each 20 mL of
digestion reaction contained 8 U BamHI, 8 U SalI (TaKaRa,
Dalian, China), 1T buffer (33 mM Tris-Ac [pH 7.9], 10 mM
Mg-Ac, 0.5 mM dithiothreitol, 66 mM K-Ac, bovine serum
albumin [BSA]-free), and 5001000 ng DNA. The reactions
were performed at 378C for 2 h. Sequencing of the digestion-
veried colonies was performed on an ABI 3730xl automatic
DNA sequencer.
Separate digestion reactions were set up to cut Qiagen-
puried A2A3 plasmid(veried by digestion and sequencing)
and pBin438. After the second purication, the cut product
A2A3 was ligated into cut vector overnight at 48C using T4
ligase (Promega). TOP10 competent cell was transformed
with the ligation reaction and plated on solidied LB medium
with 50 mg=L kanamycin. PCR and digestion were performed
for screening.
Analysis of the constructed vector
using M. truncatula transformation
The plasmids containing pBin438-35S-MtXET-GUS-
MtXET constructed in this protocol, together with the intact
pBin438 and the pBin438-35S-MtXET, were introduced to
A. tumefaciens GV3101, and transformed into M. truncatula
roots using Agrobacterium-mediated transformation, (Lim-
pens et al., 2004). The roots of 5-day-old seedlings were re-
moved at the hypocotyl, and the wound surface was
inoculated with Agrobacterium GV3101 containing the ap-
propriate plasmid. The seedlings were cocultivated with
Agrobacterium for 5 days at 218C (16=8 h light=darkness) and
subsequently transferred to PGR-free half-strength MS me-
dia with sucrose agar 7 g=L, cefotaxime (250 mg=L) for in-
hibition of Agrobacterium growth, and geneticin (5 mg=L) for
selection of transgenic M. truncatula (Chen et al., 2009). Plants
were grown for 20 days on the medium. In this period, new
roots were formed that were potentially cotransformed with
the T-DNA. The phenotype of rooted transgenic plants was
photographed.
Results
Addition of low concentration of forward anking
primer could greatly trigger amplication of specic
chimeric product with two gene fragments spliced
together in megaprimer reaction
We made a minor modication to the megaprimer-based
protocol for generating chimeric DNA molecules by splicing
together different regions of two or more genes. We designed
three forward anking primers to generate three mega-
primers of size 209, 535, and 573 bp (Fig. 1A). All three chi-
meras were generated by directional megaprimer-based
ligation. As shown in Figure 1BD, each product (A1C, A2C,
or A3C) was generated specically in the presence of mega-
primer (mpA1, mpA2, or mpA3), reverse anking primer c,
and low concentration (10% used in this protocol) of trigger
primer (forward anking primer a1, a2, or a3). Little or no
specic product was efciently generated in the absence of the
trigger primer. These results were identical to our previous
results (Chen et al., 2008) and suggest that low concentrations
of forward anking primer triggered the amplication of the
specic product.
Product A3C was subcloned into pGEM-T Easy Vector
(Promega). Sequencing of plasmid DNA from the bacterial
colonies demonstrated that the two gene segments were
perfectly ligated (Supplemental Material, SM 1).
Two gene-specic sequences could be ligated
to a spacer in the antisense and sense orientations
by PCR method for construction of plant RNAi vector
To minimize the labor and costs involved in plant RNAi
vector construction relying on specically restriction cleavage
and DNA ligation, we developed a detailed megaprimer-
based protocol to ligate an antisense and a sense gene segment
to a spacer for construction of a plant RNAi vector. Three
PCRs were included in this protocol: an initial one and two
megaprimer PCRs. Products generated in the initial PCRs
608 CHEN ET AL.
were used as megaprimers in the following PCR reactions to
generate products with the additional 3
0
-ends (Fig. 1A), which
could anneal the sense gene fragment for another PCR.
The products A1A1, A2A3, and A3A3 could be generated
and amplied specically, whereas A1A3 could not (Fig. 2A,
B). The specic band shows that mpA1C preferentially gen-
erated A3C (942 bp) since it annealed the template (pGEM-
MtXET) with its long complementary region (190 bp) for
extension. However, mpA2C could not generate A3C even
though it had a longer complementary region of the template
(506 bp). The reason for this might be that the 3
0
-end of the
longer region with restriction site and anking bases (primer
a2) could not anneal the template for extension (see the section
Oligonucleotide primers in Materials and Methods).
FIG. 2. Chimeric antisense-spacer-sense products were created by megaprimer PCRmethod. (A) Schematic diagramshowing
primers used and their relationships to megaprimers and amplied products. Dark boxes represent the antisense strand (with
white left arrowin it) and sense strand (with white right arrow), and gray box indicates a spacer. The MtXET gene segments and
GUS spacer are also indicated by solid lines and dashed lines in the bottompart of the diagram. Forward primers a1, a2, and a3,
together with internal primer c, generated megaprimers mpA1, mpA2, and mpA3 in base pairs. Ligated products A1A1, A1A3,
A2A3, and A3A3 with specic sizes were expected to be generated by megaprimers and reverse anking primers a1 or a3. (B)
Generation of different chimeric products. Specic ligated products A1A1 (748 bp), A2A3 (1436 bp), and A3A3 (1474 bp)
(indicated by white asterisk) generated by PCR using primers mpA1Ca1, mpA2Ca2 a3, and mpA3Ca3, respectively.
However, the product A1A3 of size 1110 bp did not show specic band at the position indicated by the white asterisk (in lane
A1A3). The main product (main band) might be mpA3C (942 bp). In each well, 5 mL of 50 mL reactions was loaded. M1, 200 bp
ladder, 5 mL; M2, 100 bp ladder, 5 mL. (C) A2A3 was inserted into plant expression vector pBin438 (vec I, approximately 13 kb)
and cloning vector pGEM-T Easy Vector (vec II, 3 kb). Recombined plasmids (approximately 12 mg in each well) were digested
with restriction enzymes BamHI and SalI for verication of the A2A3 insertion presence. Sequencing the plasmid pGEM-A2A3
using sequencing primers T7 and SP6 veried the perfect ligation of the three segments: antisense MtXET, GUS, and sense
MtXET. ctr, control; MtXET, Medicago truncatula xyloglucan endotransglycosylase.
RAPID CONSTRUCTION OF PLANT RNAI VECTOR 609
There were a few nonspecic bands in all lanes (Fig. 2B),
and one nonspecic band of nearly half the size of the spe-
cic product in each lane was expected to be generated in
antisense-spacer-sense ligation reactions. These nonspecic
products might be single-strand DNA fragments of hairpin
structure.
Final products A1A1 and A2A3 were subcloned to pGEM-T
Easy Vector, selected by the blue=white screening system.
Only a few white colonies grew, while there were >200 blue
colonies in both subcloning experiments. PCR screening (data
not shown) indicated that none of the white colonies were the
desired clones. From each subcloning experiment, 50 blue
colonies were randomly selected for PCR screening; 42 A1A1-
positive colonies and 7 A2A3-positive colonies were veried
using primer pairs a1 c (data not shown). The plasmids were
extracted from the 7 A2A3 colonies and digested by BamHI,
SalI, or both BamHI and SalI, separately. Only two of them
were veried to be A2A3 with both BamHI and SalI restriction
sites. Others were veried to be A2A2 product with two
BamHI sites. Plasmids of one A2A3 colony were sequenced
using sequencing primers T7 and SP6. Sequencing results
showed that the antisense and sense MtXET gene segments
were ligated to the spacer perfectly (Supplemental Material,
SM 2). The BamHI=SalI-digested A2A3 was ligated into plant
expression vector pBin438 to generate plant RNAi vector (Fig.
2C).
Overexpression of MtXET-GUS-MtXET retarded
the growth of transgenic M. truncatula roots
XET is a key enzyme in all plant processes that require cell
wall remodeling ( Johansson et al., 2004). Bean (Phaseolus
vulgaris L.) cells treated with dichlobenil, a specic inhibitor
of cellulose biosynthesis, had increased XET activity and an
increased growth rate (Alonso-Simo n et al., 2007). We pre-
viously cloned the MtXET gene in the roots of young M.
truncatula seedlings (data not shown). To test the function of
MtXET in root and to test the function of the constructed
RNAi vector, both pBin438-35S-MtXET-GUS-MtXET and
pBin438-35S-MtXET were transformed into M. truncatula
Table 2. Template and Primers Used for Generation of Medicago truncatula Xyloglucan
Endotransglycosylase-b-Glucuronidase-Medicago truncatula Xyloglucan
Endotransglycosylase Products
Component A1A1 A1A3 A2A3 A3A3
Template DNA (pGEM-XET)
a
25 ng 25 ng 25 ng 25 ng
mpA1C 50100 ng 50100 ng
mpA2C 50100 ng
mpA3C 50100 ng
Reverse anking primer
b
a1 0.5 mM a3 0.5 mM a3 0.5 mM a3 0.5 mM
Trigger primer
c
a1 0.05 mM a2 0.05 mM
a
In some cases, the megaprimer itself could be used as the template, and similar results appeared in the negative control. However,
addition of template DNA enhanced PCR amplication efciency.
b
Forward anking primers were used as reverse anking primers in this step.
c
The trigger primer is the same anking primer used for generation of the megaprimer. If the trigger primer is the same as reverse anking
primer, it is not necessary to add it again.
FIG. 3. Effect of overexpression of MtXET hairpin RNA (hpRNA) on root development of M. truncatula. Shown are 4-week-
old M. truncatula seedlings carrying intact pBin438 (wt), those carrying the 35S:RNAi transgene with undeveloped-root
phenotype (35S:RNAi), and those carrying the 35S:MtXET transgene with developed-root phenotype (35S:XET). hpRNA,
hairpin RNA; RNAi, RNA interference.
610 CHEN ET AL.
roots mediated by A. tumefaciens GV3101. The intact pBin438
was also transformed as a negative control. The RNAi plants
(with pBin438-35S-MtXET-GUS-MtXET) grew and devel-
oped signicantly slower than wild-type plants (with intact
pBin438) and the 35S:MtXET (with pBin438-35S-MtXET)
(Fig. 3). The results indicate that overexpression of MtXET-
GUS-MtXET retarded growth of transgenic M. truncatula
roots, and may also indicate that the constructed vector
worked well in plants.
Discussion
The experiments presented here demonstrate the ligation
of antisense and sense gene sequences to a spacer sequence
by PCR method for constructing a plant RNAi vector. Three
PCRs were performed to splice together an antisense se-
quence, a spacer sequence, and a sense sequence (Fig. 4).
In PCR#1, the product AB generated from the gene-
specic sequence carried an overlapping, complementary
3
0
-end of the spacer. It was important to design primer b as an
internal one consisting of two parts of nucleotides spanning
the junction of two sequences, the antisense, and the spacer.
In PCR#2, product AB was used as a megaprimer for
generation of AC, based on the method described by Barik
(1997) with a minor modicationadding 0.05 mM trigger
primer a in the megaprimer PCR reactions (Chen et al., 2008).
In our experiments, the highly efcient amplication of
product AC was mainly dependent on the addition of trigger
primer a. In this megaprimer PCR reaction, the template
added was not the same as that used in the rst PCR. The
mpAB and its complementary strand preferentially annealed
to each other for the lack of a homologous template, which
blocked the extension of primer c for generating the entire
double-strand product. When trigger primer a was added, it
annealed the complementary strand of mpAB and generated
a new megaprimer. As a result, the amounts of mpAB and its
complementary strand were asymmetric, and single-strand
mpAB was generated. This was quite similar to the asym-
metric PCR as described by Sandhu et al. (1992). However,
for same-template amplication reactions, the addition of
primer a was not necessary (Kammann et al., 1989; Sarkar
and Sommer, 1990), possibly since mpAB and its comple-
mentary strand could anneal the double-strand template
separately and extend normally, driven by primer c.
In PCR#3, trigger primer a was also added to generate a
two-restriction-site product AD (with BamHI and SalI re-
striction sites). The product AD could be inserted into the
expression vector after being puried and restricted by BamHI
and SalI.
However, the single-primer product with two BamHI sites
(generated by only primer a) was preferentially generated in
PCR#3. Five of seven positive colonies were not A2A3, but
A2A2. Especially, 42 of 50 randomly selected blue colonies
were veried as A1A1-positive colonies when a1 was used as
the single primer, indicating that 84% of blue colonies con-
tained the intended products. This protocol could be simpli-
ed with three primers (primer a instead of primer d) without
restriction sites. The single-primer product could be more
efciently generated, and could be cloned to the appropriate
cloning vector for restriction cleavage and insertion into the
expression vector. Using pGEM-gene and pBI121 and tem-
plates, three PCRs (including two megaprimer PCRs) and
three DNA purications were enough to construct a gene-
spacer-gene fragment. In later experiments using this proto-
col, within 3 days we constructed four other single-primer
products, each composed of an antisense gene and sense gene
linked to a spacer (Supplemental Materials). These results
suggested that several RNAi expression vectors could be
constructed at the same time by one technician within 1 week.
Interestingly, A1A1 (or A2A2) could not be efciently
amplied from positive colonies by a single primer a1 (or a2)
without megaprimer mpA1 (or mpA2); instead, there was
signicant generation of a molecule with approximate half
the molecular weight. The reason might be that the gener-
ated DNA would preferentially form a hairpin structure
after denaturing. However, when megaprimer mpA1 (or
mpA2) was added, the product A1A1 (or A2A2) was gen-
erated. These results suggested that the megaprimer-based
protocol could be used in amplication of complex DNA
fragments, such as DNA with the potential to form hairpin
structures.
FIG. 4. A schematic illustration for construction of RNAi
vector using PCR-mediated method. GUS segment of this
molecule (black rectangle) was targeted for the ligation of an
antisense sequence and a sense sequence (indicated by gray
rectangles) that generated hpRNA after vector construction
and plant transformation. Internal primers b and c contained
two parts that overlapped parts of the ligated sequences.
Flanking primers a and d contained BamHI and SalI restric-
tion enzyme sites, respectively. Intermediate products AB
and AC were generated by the rst and second PCR, and
used as megaprimers (mpAB and mpAC) in the subsequent
PCR. The full-length product ADwith three sequences spliced
together was amplied in the third PCR, and then digested
with BamHI and SalI and inserted into vector pBin438 (with
Cauliower mosaic virus 35S promoter and NOS terminator)
for plant transformation and RNA interference. Transcribed
RNA formed hpRNA and was processed to short interfering
RNA (siRNA) by Dicers or Dicer-like enzymes.
RAPID CONSTRUCTION OF PLANT RNAI VECTOR 611
More interestingly, the positive colonies containing A1A1,
A2A2, or A2A3 were found to be blue clones in the pGEM-T
Easy Vector Screening Systems. Clones that contain PCR
products, in most cases produce white colonies, but blue
colonies can result for several reasons (instructions for use of
pGEM-T Easy Vector Systems, Part# TM042; Promega); these
include PCR fragments that are cloned in-frame with the lacZ
gene (a multiple of three bases long), mutations that might
change the frame, and fragments that do not contain in-frame
stop codons. In our experiments, we usually used Pfu to avoid
unintended mutations. We investigated 27 clones generated
in our lab (Supplemental Materials), and analyzed the char-
acteristics of their inserted DNA fragments. We found that all
clones containing a gene-spacer-gene fragment with potential
to express hpRNA were blue clones. This was not included
in the reasons described by instructions for use of pGEM-T
Easy Vector Systems. These results suggested that translation
of lacZ RNA containing hairpin insertion to b-galactosidase
should be normal in Escherichia coli.
In conclusion, we described a simple, versatile protocol for
construction of a plant RNAi vector. Two gene-specic se-
quences can be ligated to a spacer in the antisense and sense
orientations using PCR-mediated ligation method without
reliance on restriction sites, and a plant RNAi vector can be
constructedusing this protocol in a rapidandeconomical way.
Acknowledgments
The authors gratefully acknowledge the laboratory sup-
port provided by Prof. Xiaofang Luo. This research was
supported by the China National 948 Program (Grant No.
2005-4-34, 2007-4-02); National High Technology Pro-
gram (2006AA10Z182); State Public Welfare Forest Project
(200704017); and the National Natural Science Foundation of
China (30371148). This article has been edited by Interna-
tional Science Editing.
Disclosure Statement
No competing nancial interests exist.
References
Alonso-Simo n, A., Garc a-Angulo, P., Encina, A.E., A

lvarez,
J.M., Acebes, J.L., and Hayashi, T. (2007). Increase in XET ac-
tivity in bean (Phaseolus vulgaris L.) cells habituated to di-
chlobenil. Planta 226, 765771.
Barik, S. (1997). Mutagenesis and gene fusion by megaprimer
PCR. In Methods in Molecular Biology, vol. 67. PCR cloning
protocols: from molecular cloning to genetic engineering. B.A.
White, ed. (Humana Press Inc., Totowa, NJ), pp. 173182.
Chen, J.R., Lu , J.J., and Wang, H.F. (2008). Rapid and efcient
gene splicing using megaprimer-based protocol. Mol Bio-
technol 40, 224230.
Chen, J.R., Lu , J.J., Wang, T.X., Chen, S.Y., and Wang, H.F.
(2009). Activation of a DRE-binding transcription factor from
Medicago truncatula by deleting a Ser=Thr-rich region. In Vitro
Cell Dev Biol Plant 45, 111.
Chuang, C., and Meyerowitz, E. (2000). Specic and heritable
genetic interference by double-stranded RNA in Arabidopsis
thaliana. Proc Natl Acad Sci USA 97, 49854990.
Coljee, V.W., Murray, H.L., Donahue, W.F., and Jarrell, K.A.
(2000). Seamless gene engineering using RNA- and DNA-
overhang cloning. Nat Biotechnol 18, 789791.
Dafny-Yelin, M., Chung, S.M., Frankman, E.L., and Tzra, T.
(2007). pSAT RNA interference vectors: a modular series for
multiple gene down-regulation in plants. Plant Physiol 145,
12721281.
Fang, G., Weiser, B., Visosky, A., Moran, T., and Burger, H. (1999).
PCR-mediated recombination: a general method applied to
construct chimeric infectious molecular clones of plasma-
derived HIV-1 RNA. Nat Med 5, 239242.
Hamilton, A., Voinet, O., Chappell, L., and Baulcombe, D.
(2002). Two classes of short interfering RNA in RNA silencing.
EMBO J 21, 46714679.
Heckman, K.L., and Pease, L.R. (2007). Gene splicing and
mutagenesis by PCR-driven overlap extension. Nat Protoc 2,
924932.
Hirai, S., Oka, S.I., Adachi, E., and Kodama, H. (2007). The
effects of spacer sequences on silencing efciency of plant
RNAi vectors. Plant Cell Rep 26, 651659.
Johansen, L.K., and Carrington, J.C. (2001). Silencing on the spot
induction and suppression of RNA silencing in the Agro-
bacterium-mediated transient expression system. Plant Physiol
126, 930938.
Johansson, P., Brumer, H., Baumann, M.J., Kallas, A.M., Hen-
riksson, H., Denman, S.E., Teeri, T.T., and Jones, T.A. (2004).
Crystal structures of a poplar xyloglucan endotransglyco-
sylase reveal details of transglycosylation acceptor binding.
Plant Cell 16, 874886.
Kammann, M., Laufs, J., Schell, J., and Gronenborn, B. (1989).
Rapid insertional mutagenesis of DNA by polymerase chain
reaction (PCR). Nucleic Acids Res 17, 5404.
Ke, S.H., and Madison, E.L. (1997). Rapid and efcient site-
directed mutagenesis by single-tube megaprimer PCR
method. Nucleic Acids Res 25, 33713372.
Kumagai, H., and Kouchi, H. (2003). Gene silencing by expres-
sion of hairpin RNA in Lotus japonicus roots and root nodules.
Mol Plant Microbe Interact 16, 663668.
Kuwayama, H., Obara, S., Morio, T., Katoh, M., Urushihara, H.,
and Tanaka, Y. (2002). PCR-mediated generation of a gene
disruption construct without the use of DNA ligase and plas-
mid vectors. Nucleic Acids Res 30, e2.
Limpens, E., Ramos, J., Franken, C., Raz, V., Compaan, B.,
Franssen, H., Bisseling, T., and Geurts, R. (2004). RNA inter-
ference in Agrobacterium rhizogenes-transformed roots of Ara-
bidopsis and Medicago truncatula. J Exp Bot 55, 983992.
Miki, D., and Shimamoto, K. (2004). Simple RNAi vectors for
stable and transient suppression of gene function in rice. Plant
Cell Physiol 45, 490495.
Picard, V., Ersdal-Badju, E., Lu, A., and Bock, S.C. (1994). A
rapid efcient one-tube PCR-based mutagenesis technique
using Pfu DNA polymerase. Nucleic Acids Res 22, 2587
2591.
Sandhu, G.S., Aleff, R.A., and Kline, B.C. (1992). Dual asymmetric
PCR: one-step construction of synthetic genes. Biotechniques
12, 1416.
Sarkar, G., and Sommer, S.S. (1990). The megaprimer method
of site-directed mutagenesis. Biotechniques 8, 404407.
Schweizer, P., Pokorny, J., Schulze-Lefert, P., and Dudler, R.
(2000). Double-stranded RNA interferes with gene function at
the single-cell level in cereals. Plant J 24, 895903.
Smith, N.A., Singh, S.P., Wang, M.B., Stoutjesdijk, P.A., Green,
A.G., and Waterhouse, P.M. (2000). Total silencing by intron-
spliced hairpin RNAs. Nature 407, 319320.
So derberg, M., and Lang, M.A. (2006). Megaprimer-based
methodology for deletion of a large fragment within a repeti-
tive polypyrimidine-rich DNA. Mol Biotechnol 32, 6571.
612 CHEN ET AL.
Stoutjesdijk, P.A., Singh, S.P., Liu, Q., Hurlstone, C.J., Water-
house, P.A., and Green, A.G. (2002). hpRNA-mediated tar-
geting of the arabidopsis FAD2 gene gives highly efcient and
stable silencing. Plant Physiol 129, 17231731.
Szewczyk, E., Nayak, T., Oakley, C.E., Edgerton, H., Xiong, Y.,
Taheri-Talesh, N., Osmani, S.A., and Oakley, B.R. (2007). Fu-
sion PCR and gene targeting in Aspergillus nidulans. Nat Pro-
toc 1, 31113120.
Tang, G., Reinhart, B.J., Bartel, D.P., and Zamore, P.D. (2003). A
biochemical framework for RNA silencing in plants. Gene Dev
17, 4963.
Urban, A., Neukirchen, S., and Jaeger, K.E. (1997). A rapid and
efcient method for site-directed mutagenesis using one-step
overlap extension PCR. Nucleic Acids Res 25, 22272228.
Wesley, S.V., Helliwell, C.A., Smith, N.A., Wang, M.B., Rouse,
D.T., Liu, Q., Gooding, P.S., Singh, S.P., Abbott, D., Stoutjesdijk,
P.A., Robinson, S.P., Gleave, A.P., Green, A.G., and Water-
house, P.M. (2001). Construct design for efcient, effective
and high-throughput gene silencing in plants. Plant J 27, 581
590.
Address correspondence to:
Hua-Fang Wang, Ph.D.
College of Biological Sciences and Biotechnology
Beijing Forestry University
Beijing 100083
P.R. China
E-mail: hfwang@bjfu.edu.cn
Received for publication April 1, 2009; received in revised
form July 2, 2009; accepted July 6, 2009.
RAPID CONSTRUCTION OF PLANT RNAI VECTOR 613
Copyright of DNA & Cell Biology is the property of Mary Ann Liebert, Inc. and its content may not be copied
or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission.
However, users may print, download, or email articles for individual use.