ORI GI NAL ARTI CLE Aquaculture

Global gene expression analysis of gill tissues from normal

and thermally selected strains of rainbow trout
Engkong Tan

Chaninya Wongwarangkana

Shigeharu Kinoshita

Yutaka Suzuki

Kenshiro Oshima

Masahira Hattori

Toshinao Ineno

Koichi Tamaki

Akio Kera

Koji Muto

Takashi Yada

Shoji Kitamura

Shuichi Asakawa

Shugo Watabe
Received: 20 January 2012 / Accepted: 5 March 2012 / Published online: 18 July 2012
The Japanese Society of Fisheries Science 2012
Abstract The objective of the study reported here was to
investigate genes related to upper temperature tolerance in
rainbow trout Oncorhynchus mykiss, a cold-water species
with considerable economic importance, by global gene
expression analysis using a next generation sequencing
system. Fifty million paired sequences were collected from
the gill tissues of each of ve individuals of a thermally
selected strain developed by selective breeding and from the
gill tissues of a standard Donaldson strain and assembled into
transcripts. The data of both strains were integrated, and a
BLASTX search identied 13,092 independent, known
genes. A back-mapping of raw reads from both strains onto
the genes, conducted to investigate their frequency of
expression, revealed that 324 genes showed at least a twofold
higher expression in the thermally selected strain than in the
Donaldson strain. In addition, 44.4 % of commonly
expressed genes were categorized into 38 functional groups
by annotation. Genes encoding heat shock proteins and
c-fos-related proteins were highly expressed in the thermally
selected strain. Our strategy to employ next generation
sequencing proved to be very useful to nd genes responsible
for upper temperature tolerance of rainbow trout.
Keywords Oncorhynchus mykiss
Thermally selected strain Next generation sequencing
Gill Global gene expression HSP gene c-fos gene S. Asakawa and S. Watabe contributed equally to this work.
Electronic supplementary material The online version of this
article (doi:10.1007/s12562-012-0522-4) contains supplementary
material, which is available to authorized users.
E. Tan C. Wongwarangkana S. Kinoshita S. Asakawa
Laboratory of Aquatic Molecular Biology and Biotechnology,
Graduate School of Agricultural and Life Sciences,
The University of Tokyo, 1-1-1 Yayoi, Bunkyo,
Tokyo 113-8657, Japan
e-mail: asakawa@mail.ecc.u-tokyo.ac.jp
Y. Suzuki
Laboratory of Functional Genomics, Graduate School of Frontier
Science, The University of Tokyo, 5-1-5 Kashiwano-ha,
Kashiwa, Chiba 277-8561, Japan
K. Oshima M. Hattori
Department of Computational Biology, Graduate School
of Frontier Sciences, The University of Tokyo,
5-1-5 Kashiwano-ha, Kashiwa, Chiba 277-8561, Japan
T. Ineno K. Tamaki A. Kera
Kobayashi Branch, Miyazaki Prefectural Fisheries Research
Institute, Kobayashi, Miyazaki 886-0005, Japan
K. Muto T. Yada
Nikko Station, National Research Institute of Aquaculture,
Fisheries Research Agency, Nikko, Tochigi 321-1661, Japan
S. Kitamura
General Planning and Coordination Department, Headquarters,
Fisheries Research Agency, Yokohama, Kanagawa 236-8648,
Japan
S. Watabe (&)
Laboratory of Marine Biochemistry, Graduate School
of Agricultural and Life Sciences, The University of Tokyo,
1-1-1 Yayoi, Bunkyo, Tokyo 113-8657, Japan
e-mail: awatabe@mail.ecc.u-tokyo.ac.jp
1 3
Fish Sci (2012) 78:10411049
DOI 10.1007/s12562-012-0522-4
Introduction
Rainbow trout Oncorhynchus mykiss is a cold-water aqua-
culture species of considerable economic importance.
Between 1989 and 2009 the global annual production of
rainbow trout almost tripledfrom 259,161 to 732,432 tons
[1]. Rainbow trout is originally a North American native sh,
but since 1874 it has been introduced to all continents, and it is
currently one of the most popular aquaculture species. The
rst introduction of rainbowtrout to Japan was in 1877, and its
mass production started in the 1950s [2] when the Donaldson
strain (established by Dr. Donaldson of the University of
Washington [3]) was introduced into Japan. The Donaldson
strain has several advantages over wild-type rainbow trout,
such as increased growth rate, disease resistance, and
enhanced egg production.
The Miyazaki Prefectural Fisheries Research Institute
initiated a traditional selective breeding programin 1966 with
the aim of developing a thermally selected strain of rainbow
trout based on the Donaldson strain [4]. The strain thus
developed acquired upper temperature tolerance, as revealed
by the observation that the strain grows normally and feeds
actively at 24 C, in contrast to the optimum water tempera-
ture for the normal strain, which is \20 C. In addition, the
thermally selected strain survived from occasional exposure
to heated water at 3035 C for 15 min [4]. These qualities
have enabled the culture of this species in higher water tem-
perature regions, such as lower mountain areas or even in the
more southernareas of Japan. Furthermore, upper temperature
tolerance in rainbow trout is a desirable character in aqua-
culture production given the potential for exposure to climate
change, such as global warming.
Several studies have investigated the genes possibly
responsive to upper temperature tolerance in sh. Heat
shock proteins (HSPs) have been reported to be associated
with heat stress in tilapia Oreochromis niloticus [5], com-
mon killish Fundulus heteroclitus [6], and rainbow trout
[79]. Certain microsatellite loci have also been identied
as upper temperature tolerance-related candidates for
Arctic charr Salvelinus alpinus [10, 11] and rainbow trout
[1114] with quantitative trait loci analysis. Furthermore,
previous research indicates that mitochondrial cytochrome
c oxidase subunit II gene is associated with upper tem-
perature tolerance in eggs and embryos of rainbow trout
[15]. Although these studies provide clues on the identity
of upper temperature tolerance-related genes, current
knowledge on genes involved in upper temperature toler-
ance remains insufcient.
Next generation sequencing technologies are currently
being widely utilized [16] and have greatly improved the
speed and efciency of transcriptome analysis not only in
mammals [1719], but also in sh [20, 21], plants [22, 23],
and insects [24, 25].
The objective of the study reported here was to inves-
tigate genes related to upper temperature tolerance in
rainbow trout by utilizing next generation sequencing. The
comparative analysis between the thermally selected and
Donaldson strain revealed the identity of several strong
candidate genes that are responsible for the upper tem-
perature tolerance of the thermally selected strain.
Materials and methods
Fish candidates for sequencing
The thermally selected strain that has been developed since
1966 at the Kobayashi Branch, Miyazaki Prefectural
Fisheries Research Institute, as described above was used
in this study. Five 1-year-old juveniles of the thermally
selected strain (length 16.418.4 cm; weight 81107 g)
were selected as sequencing candidates. Five juveniles of
the Donaldson strain (length 1415.4 cm; weight 4051 g),
cultured at the Nikko Station, the National Research
Institute of Fisheries Science, Tochigi Prefecture, Japan,
were used as the normal control sh candidates. Prior to
collect samples, individuals of both strains were acclimated
in 10 C freshwater for 1 month, and no apparent unheal-
thy effects were observed.
RNA extraction and cDNA library construction
Prior to this study, we performed preliminary transcriptome
assemblies and back-mapping using sequence reads from
the brain, gill, heart, liver, and muscle tissues and found
that the gene encoding HSP70b had an extremely high
expression level in gill tissues. Thus, we chose gill tissues
as the target tissue to analyze in our study. Total RNAs
were extracted from the gill tissues of all study sh (those
of the thermally selected strain and Donaldson strain) with
QIAzol regent (QIAGEN, Valencia, CA) using standard
protocols. In order to obtain high-quality sequencing data,
we required a sufcient amount of total RNA for the fol-
lowing sequencing step. Thus, the sample containing the
highest amount of total RNA was selected and used as a
representative sequencing template for both the thermally
selected and Donaldson strains. Total RNAs of both strains
were used to construct cDNA libraries with the Illumina
Paired End Sample Prep kit (Illumina, San Diego, CA).
The average sizes of cDNAs for paired-end sequencing
were adjusted to be about 150 bp.
Next generation sequencing and data analysis
The cDNA libraries were sequenced with a HiSeq
2000 sequencing platform (Illumina) according to the
1042 Fish Sci (2012) 78:10411049
1 3
manufacturers protocol. Pair-end reads (76 bp 9 2) with
150-bp insert size were obtained from the sequencer. The
le formats were converted from the Illumina QSEQ for-
mat to the conventional FASTQ format by ABySS (abyss-
to-fastq) [26]. In order to perform high-quality assembly,
reads that contained N-base or low Q-score base were l-
tered out by the software FASTX-toolkit [27]. We then
selected 50 million paired reads among the ltered data of
the thermally selected and Donaldson strains. These data
were applied to the Velvet (ver. 1.2.01 [28]) and Oases
(ver. 0.2.04; http://www.ebi.ac.uk/*zerbino/oases/) soft-
ware packages to generate contigs and transcripts, respec-
tively. Twenty one-mer size was selected for the de Bruijn
graph [29] to build contigs from raw reads. Final transcripts
were constructed by linking contigs with the pair-end dis-
tance information.
To increase the accuracy of the homology search step,
we discarded de novo assembled transcripts of \1,000 bp.
Duplicated and highly similar sequences were removed by
the software CD-HIT (ver. 4.5.6. option, -c 0.9 [30]). The
homology searches of these transcripts were conducted
using BLASTX (e value 1e-10) against the NCBI protein
database. If two or more transcripts were matched to the
same gene after the BLASTX step, the numbers of mapped
reads were summed and counted as one gene. The tran-
scripts assigned as unnamed protein products or unchar-
acterized proteins by BLASTX were excluded from further
analysis. Expression proles of genes were obtained by
mapping 50 million raw reads back on the de novo
assembled transcripts of both strains using the software
Bowtie (ver. 0.12.7, option, -v 0 [31]). Only perfectly
matched reads were kept and counted. A read matched with
more than one transcript was always assigned to the rst
transcript. File conversion from SAM to BAM format and
counting were accomplished using software Samtools [32].
A comprehensive prole of common genes expressed in the
gill was constructed by joining the average expression
count for each gene from both the thermally selected and
Donaldson strains. These commonly expressed transcripts
were annotated by software Blast2Go (ver. 2.5.0 [33]) to
assign gene ontology (GO) terms, and matched genes were
then divided into three main ontologies: molecular func-
tion, biological process, and cell component.
Sequence data sets analyzed in this study have been
registered to DDBJ Sequence Read Archive (Project
number DRA000529).
Real-time PCR analysis
Selected genes that were up-regulated or down-regulated in
the thermally selected strain in comparison with the Don-
aldson strain in the global gene expression analysis were
examined by real-time PCR. The forward and reverse
primers were designed for each gene and the product size
was 101 bp. The sequences of primer sets are listed in
Table 1. Total RNAs extracted from ve individuals of
each two strain were used. The PCR mixture contained 1 ll
cDNA, 20 lM each of forward and reverse primers, 10 ll
29 SYBR premix ExTaq kit (Takara, Tokyo, Japan), and
0.3 lL ROX reference dye, lled to a nal volume of 20 ll
with sterilized distilled water. The PCR cycling program
consisted of denaturation at 95 C for 30 s, followed by 40
cycles of denaturation at 95 C for 5 s and annealing and
extension at 60 C for 1 min. Real-time PCR was per-
formed with an ABI Prism 7300 sequence detection system
(Applied Biosystems, Foster City, CA). A housekeeping
gene encoding elongation factor-1alpha (EF-1alpha) was
selected as reference. The relative expression levels of each
Table 1 Primer information of eight selected and one housekeeping genes examined by real-time PCR
Gene Accession no. Forward primer Reverse primer
Heat shock protein 70-kDa
isoform b
AB176855 TTAGTATCACTGCACACAATTTACTATTCAG ATGTCCAGCAATGCAATATGGTAT
dnaJ homolog subfamily a
member 1-like
XP_003440484 CTCTCAGACTCCGGGTTTGACTT TCAGAAGGGTCTCCTCCATTGA
c-fos protein BAC77046 CCTATGACCTAGTTAATTGCTTTTTTTG AGAGGAAATGGTGTTGTGTGGAA
ccaat enhancer-binding
protein beta
NP_001117919 TAGTTGTACATTCGTTGCACCTTCT TCCAGGATGTTACGTTTGTGTACAG
DNA damage-inducible
transcript 4 protein
ACO14087 CTCTCAGACTCCGGGTTTGACTT TCAGAAGGGTCTCCTCCATTGA
junB protein NP_001117992 CTTGCCCTTTTTTGGACTTATAAATT GTCATGATAGAAAGGCTGTTCCATT
dsx and mab-3 related
transcription factor 4
ABU53616 TCTGTAAACACCGTGCCAAGAATAT ATCCGTTGTTTAGGTTGTACTTGGT
Dual specicity protein
kinase clk2-like
XP_003452484 TTATGACCCTGTGTGTGCTTCATC ACTCACAAATCAGACCCCATACAAC
Elongation factor-1alpha AF498320 GGATTGCCACACTGCTCACA CGACGGTCGATCTTCTTCTTG
Fish Sci (2012) 78:10411049 1043
1 3
gene were calculated from the means of triplicated PCR
experiments, each with ve individuals, using the com-
parative C
T
difference method. The differences between
the two strains were examined using Students t test. The
results of real-time PCR were also compared with the back-
mapping results in which the sequencing read was mapped
to the target region in real-time PCR for each gene in order
to standardize the target size of back-mapping of individual
genes. The actual target size in back-mapping individual
genes was 300 bp (of which 101 bp was the real-time PCR
product in the center).
Results
De novo assembly of gill tissue transcripts
An analytical workow of bioinformatics is presented [Elec-
tronic Supplementary Material (ESM) Fig. S1]. The total
lengths of the sequenced reads were 9,918,270,256 bp for the
thermally selected strain and 8,081,204,488 bp for the Don-
aldson strain. Fifty million high-quality paired sequences
selected from gill tissues of each individual sh from the
thermally selected and Donaldsonstrains were assembled into
1,379,536 contig (127,022,700 bp) and 1,432,796 contig
(132,243,594 bp), respectively, by the Velvet software. These
contigs were further combined using the paired-end infor-
mationto formsequences of transcripts bythe Oases software.
For the thermally selected strain, 220,242 transcripts with a
mean length of 680 bp were assembled, whereas for the
Donaldson strain, 229,641 transcripts with a mean length of
750 bp were assembled (Table 2). After size selection, there
remained 47,750 and 55,498 transcripts for the thermally
selected strain and Donaldson strain, respectively. To obtain
unique transcripts, redundant and highly similar sequences
were removed. The nal transcripts for gill tissues of the
thermally selected strain contained 21,125 sequences with an
average length of 1,741 bp; in comparison, there were 23,838
sequences withanaverage lengthof 1,874 bpfor gill tissues of
the Donaldson strain.
Read mapping and gene annotation
BLASTX was used to identify genes from the assembled
transcripts. A search against the NCBI non-redundant
protein database revealed that there were 16,417 (78 %)
and 18,977 sequences (80 %) in the thermally selected and
Donaldson strains, respectively, which matched known
genes. After the BLASTX search, 1,804 sequences were
removed for future analysis because they were considered
to be hypothetical proteins, unnamed protein products, or
uncharacterized proteins. The transcripts matched with the
same gene were integrated into one gene. We then com-
bined the lists of the genes obtained from the thermally
selected and Donaldson strains and established an inte-
grated gene list consisting of 13,092 independent genes
(ESM Table S1). Concurrently, 50 million raw reads of the
thermally selected strain were mapped back onto the
transcripts of both the thermally selected and Donaldson
strains using the Bowtie software. The 50 million raw
reads of the Donaldson strain were also mapped. The
number of raw reads onto the multiple transcripts of a
single gene was then summed. Surprisingly, each gene was
shown to be commonly expressedthat is, at least one raw
read was mapped on each of 13,092 genes in both datasets
of the thermally selected and Donaldson strains after back-
mapping. For each gene, we then calculated an average
number of raw reads onto the datasets of the thermally
selected and Donaldson strains and regarded the score as an
expression frequency (ESM Table S1).
Among these 13,092 genes, 324 genes showed a twofold
or higher expression frequency in the thermally selected
strain than in the Donaldson strain. On the contrary, 413
genes were down-regulated (B0.5-fold) in the thermally
selected strain in comparison with the Donaldson strain. In
the thermally selected strain, compared to the Donaldson
strain, a higher number of genes were down-regulated than
up-regulated genes, whereas up-regulated genes showed a
much greater expression frequency than down-regulated
ones (ESM Table S1; Fig. 1). For the GO annotation, 5,818
genes (44.4 % of the 13,092 sequences) were annotated by
Table 2 Summary of
sequencing of cDNAs from gill
tissues of the thermally selected
and Donaldson strains
a
Transcript sequences which
had similarities of [90 % were
removed and the transcript with
the maximum length was
chosen by CD-HIT software
Feature Number
Thermally
selected
Donaldson
Raw reads for de novo assembly 50M 50M
De novo assembled transcripts (C100 bp) 220,242 229,641
Average length (bp) 680 750
Transcripts (C1,000 bp in length) 47,750 55,498
Transcripts after removing redundant transcripts
a
21,125 23,838
Average length of cDNAs annotated (bp) 1,741 1,874
Minimum/maximum length of transcripts (bp) 1,000/9,267 1,000/9,643
1044 Fish Sci (2012) 78:10411049
1 3
Blast2GO (Fig. 2a). These were separated into 38 func-
tional groups. Compositions of annotated the GO terms in
gill are shown in Fig. 2b.
Thermally selected strain-specic highly expressed
genes
Among the 324 genes that were more distinctly expressed
in the thermally selected strain than in the Donaldson
strain, extremely high expression levels were observed in
several genes, such as those encoding HSP70b (2,657-
fold), dnaj homology subfamily a member 1-like protein
(89-fold), and interleukin-1 beta (73-fold). Interestingly,
the expression frequency of the HSP70b gene varied from
112- (junb protein gene) to more than 2,800-fold (c-fos-
related antigen 1 gene) higher than that of the other dis-
tinctly expressed genes in the thermally selected strain
(Table 3). In contrast, the fold changes of those genes
down-regulated in the thermally selected strain relative to
the Donaldson strain were not less than 1:7 (Table 4, ESM
Table S1). Housekeeping genes, such as those encoding
EF-1 alpha, elongation factor 2 and beta actin, which are
commonly used as internal control genes in real-time PCR
analyses, showed comparable expression levels between
the two strains (Table 4).
The results of the expression ratio, as determined by
real-time PCR analyses, between the representative indi-
viduals sequenced from the thermally selected and Don-
aldson strains were almost consistent with those of the
standardized global gene expression analysis for the rep-
resentative six up-regulated and two down-regulated genes
(Table 5). In addition, the means of the mRNA expression
ratio, as determined by real-time PCR analyses for these
same genes, for the thermally selected and Donaldson
strains calculated from each of ve individuals were also
consistent with those of the global gene expression analysis
(Table 6).
Discussion
Taking the advantages of next generation sequencing
technologies and newly developed assembly software
packages, we generated comprehensive expression proles
of gill tissues of rainbow trout thermally selected and
Donaldson strains and examined the expression differences
between the two strains. Several projects have been
undertaken to sequence the rainbow trout transcriptome
[21, 34, 35], but the expression proles generated in these
studies were based on normalized cDNA libraries of mixed
tissues and were of low sequence coverage. To the best of
our knowledge, our study is the rst report of a global gene
expression analysis using such a deep coverage of next
generation sequencing data in rainbow trout. A total of
14,896 known genes (1,804 genes belonging to hypothet-
ical proteins, unnamed or uncharacterized) in the gill were
retrieved from the NCBI database. However, 9,569 novel
transcripts in our data sets remain without matches.
Many HSP genes were identied among those genes
which were more highly expressed in the thermally selec-
ted strain than in the Donaldson strain. HSP genes have
been extensively studied in many species [36, 37], and they
are the major stress-induced proteins responding to exter-
nal stimuli [38]. The 70-kDa HSPs are one of the most
extensively studied family of HSPs [79]. Two isoforms,
HSP70a and HSP70b, have been well characterized in
rainbow trout [7]. In our study, HSP70b was expressed at
an extremely high level in the thermally selected strain
compared with the Donaldson strain. In contrast, the
expression level of another HSP member, heat shock
cognate 70 kDa, was similar for both strains. This result is
consistent with the previous nding that the heat shock
cognate 70 kDa gene is expressed in a constitutive way
[39]. Ojima et al. [40] also demonstrated that under non-
heat-shock conditions HSP70, HSP60, and HSP40 were
expressed signicantly higher at the protein level in those
individuals with a high thermotolerance than in those with
a low thermotolerance. Earlier research indicated that
HSP70s are regulated by HSP40 [41], which may explain
why the homolog of HSP40, dnaJ homolog subfamily a,
was also highly expressed in the thermally selected strain.
Another HSP family member, HSP47, is also a well-known
heat stress-related protein [42, 43], and the gene encoding
it was up-regulated in the thermally selected strain relative
to the Donaldson strain.
-1
-0.5
0
0.5
1
1.5
2
2.5
10,000 13,091 5,000
Gene number in descending order
l
o
g
1
0
r
a
t
i
o
Fig. 1 Global gene expression proles of the thermally selected
strain compared with the Donaldson strain. The comparative expres-
sion levels of 13,091 commonly expressed genes in gill tissues of the
thermally selected strain compared with the Donaldson strain are
represented by their log
10
value, except for a highly expressed gene
encoding heat shock protein 70b (HSP70b), which was excluded from
this gure because it is the only gene having a log
10
value of [2.5
Fish Sci (2012) 78:10411049 1045
1 3
No GO
a
Commonly expressed genes in gill
7,274
5,818
Total
13,092
Molecular function Biological process Cellular component
Molecular function
%
Biological process Cellular component
1. molecular transducer
activity
2. structural molecule activity
3. antioxidant activity
4. enzyme regulator activity
5. binding
6. catalytic activity
7. channel regulator activity
8. transporter activity
9. transcription factor activity
10. multicellular organismal process
11. cellular component biogenesis
12. biological adhesion
13. multi-organism process
14. localization
15. metabolic process
16. signaling
17. cellular process
18. reproduction
19. response to stimulus
20. biological regulation
21. immune system process
22. growth
23. death
24. viral reproductive process
25. pigmentation
26. developmental process
27. cellular component organization
28. cell proliferation
29. locomotion
30. rhythmic process
31. cell part
32. cell projection
33. endomembrane system
34. extracellular region part
35. membrane-bounded organelle
36. protein complex
37. vesicle
38. organelle part
b
0
10
20
30
40
50
60
70
80
90
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38
D
i
s
t
r
i
b
u
t
i
o
n
Functional groups
Annotated with GO
Fig. 2 Annotation of commonly expressed genes in the gill (a) with
their terms in gene ontology (GO) (b). The 13,092 commonly
expressed genes in the gill were subjected to annotation by Blast2GO,
and 5,818 of these genes were assigned to 38 functional groups with
three main GO terms: molecular function, biological process, and cell
component
Table 3 List of genes showing higher expression in the thermally selected strain than in the Donaldson strain
Gene Accession no. Expression frequency
a
Thermally selected Donaldson Ratio
Heat shock protein 70 kDa isoform b AB176855 2,875,242 1,082 2,657.3
dnaJ homolog subfamily a member 1-like XP_003440484 6,326 71 89.1
Interleukin-1 beta 2 precursor CAB53541 6,254 86 72.7
c-fos related antigen 1 NP_001155024 1,009 21 48
c-fos protein BAC77046 9,409 293 32.1
Nuclear receptor subfamily 4 XP_003441554 1,713 68 25.1
ccaat enhancer-binding protein beta NP_001117919 10,081 749 13.4
DNA damage-inducible transcript 4 protein ACO14087 2,750 257 10.7
junB protein NP_001117992 25,670 2,812 9.1
Heat shock protein 47 precursor NP_001117706 8,318 1,283 6.4
a
The number in 50 million raw reads
1046 Fish Sci (2012) 78:10411049
1 3
The expression of HSP family genes in the thermally
selected strain seems to be in a state of continuous
up-regulation as there was no high temperature exposure or
other stressors prior to the sampling of both strains. This is
quite interesting because HSP family members act as
molecular chaperons in the protein quality control process
and give organisms tolerance to various stresses, including
high temperature, by protecting cells from damage (for
review, see [44]). Over-expression of HSPs by transgenesis
causes marked stress tolerance in plants [45] and mice [46].
Consequently, the up-regulated HSP family members in
our study are interesting candidate molecules for deter-
mining upper temperature tolerance in the rainbow trout.
Our previous study using this strain revealed that the
Table 4 Representative down-regulated genes in the thermally selected strain compared to the Donaldson strain and comparably expressed
genes in both strains
Gene Accession no. Expression frequency
a
Thermally selected Donaldson Ratio
Down-regulated
dsx and mab-3 related transcription factor 4 ABU53616 344 1,469 0.23
Serum albumin 1 precursor NP_001117137 240 1,016 0.23
Immunoglobulin heavy chain AAV48553 269 1,020 0.26
Type II cytoskeletal 8-like XP_003458136 657 2,196 0.3
Dual specicity protein kinase clk2-like XP_003452484 970 2,977 0.33
60 s ribosomal subunit protein L15 ACH70977 10,713 24,144 0.44
60 s ribosomal subunit protein L28 NP_001133165 4,401 9,669 0.46
Proteasome subunit beta type 8 NP_001158688 1,350 3,017 0.45
Galactose-specic lectin ACO13356 13,655 28,344 0.48
MHC class I heavy chain AAG53684 32,869 67,708 0.48
Comparably expressed
Elongation factor EF1 alpha ACP56687 153,661 173,687 0.88
Elongation factor 2 ACN58590 29,006 35,561 0.81
Beta actin NP_001117707 340,020 435,886 0.78
Heat shock cognate 70 kDa protein NP_001117704 249,165 218,832 1.14
a
The number in 50 million raw reads
Table 5 Comparison of the expression ratios, as determined by real-time PCR and the standardized global gene expression analysis, of the
representative six up-regulated and two down-regulated genes from the representative individuals of the thermally selected and Donaldson strains
Gene Accession no. Real-time PCR
a
Global gene expression analysis
b
Thermally
selected
Donaldson Ratio Thermally
selected
Donaldson Ratio
Heat shock protein 70 kDa isoform b AB176855 16.038 0.0037 4,332.4 217,342 45 4,829.8
dnaJ homolog subfamily a member 1-like XP_003440484 0.085 0.0021 40.3 1,607 15 107.1
c-fos protein BAC77046 0.148 0.0029 50.2 2,278 54 42.2
ccaat enhancer-binding protein beta NP_001117919 0.113 0.0084 13.5 2,783 145 19.2
DNA damage-inducible transcript 4 protein ACO14087 0.027 0.0023 11.4 523 39 13.4
junB protein NP_001117992 0.126 0.0131 9.7 6,581 634 10.4
dsx and mab-3 related transcription factor 4 ABU53616 0.003 0.0021 1.52 57 274 0.21
Dual specicity protein kinase clk2-like XP_003452484 0.0028 0.0072 0.39 115 238 0.48
a
The values were calculated from data collected on the representative individuals and normalized to the elongation factor-1alpha (EF-1alpha)
gene
b
The results obtained from the back-mapping of raw reads to the standardized regions (300 bp) in which the real-time PCR products were
included
Fish Sci (2012) 78:10411049 1047
1 3
cytochrome c oxidase (COX) gene in the thermally selec-
ted strain was constitutively up-regulated at early devel-
opmental stages [15]. It has been reported that HSP family
members are involved in the assembly of COX subunits
(for review, see [44]).
Notable differences in the expression level of several
c-fos protein-related genes, including genes coding for
interleukin, c-fos-related antigen, c-fos, and junb, were also
found in the thermally selected strain. The c-fos gene has
been reported to be one of the early immediate genes that
responds to a wide variety of stimulations [47]. Although
the relationships between the upper temperature tolerance
and the expression of the c-fos genes are still unclear,
Wilkerson et al. [48] reported that heat shock factor 2, a
transcription factor which binds to heat shock element
(HSE) in the promoter region of the HSP genes and induces
their expression, also binds to HSE in the c-fos gene pro-
moter and enhances its expression in the HeLa cell. These
lines of information, together with the over-expression of
HSP family members observed in this study, suggest that
genes containing HSE within their promoter region are
constitutively up-regulated in the thermally selected strain.
Other than gill tissues, we also collected heart, liver,
muscle, and brain tissues. Data from these tissues will
provide additional insights into upper temperature toler-
ance, which will be published elsewhere in the near future.
Future studies based on these results will provide more
detailed information for the genes and mutations that are
responsible for upper temperature tolerance in sh.
Acknowledgments This study was supported in part by a grant
from the Ministry of Agriculture, Forestry, and Fisheries of Japan.
References
1. Food and Agriculture Organization of the United Nations (2009)
Global aquaculture production of Oncorhynchus mykiss. FAO
Fishery Statistic, FAO, Geneva
2. Masuda H, Amaoka K, Araga T, Ueno T, Yoshino T (1992) The
shes of the Japanese archipelago. Tokai University Press, Tokyo
3. Donaldson LR, Olson PR (1955) Development of rainbow trout
bloodstock by selective breeding. Trans Am Fish Soc 85:93101
4. Ineno T, Tsuchida S, Kanda K, Watabe S (2005) High temper-
ature tolerance of rainbow trout Oncorhyncus mykiss selected by
high temperature breeding. Fish Sci 71:767775
5. Chen JD, Yew FH, Li GC (1988) Thermal adaptation and heat
shock response of tilapia ovary cells. J Cell Physiol 134:189199
6. Fangue NA, Hofmeister M, Schulte PM (2006) Intraspecic
variation in thermal tolerance and heat shock protein gene
expression in common killish, Fundulus heteroclitus. J Exp Biol
209:28592872
7. Ojima N, Yamashita M, Watabe S (2005) Comparative expres-
sion analysis of two paralogous Hsp70s in rainbow trout cells
exposed to heat stress. Biochim Biophys Acta 1681:99106
8. Ojima N, Yamashita M, Watabe S (2005) Quantitative mRNA
expression proling of heat shock protein families in rainbow
trout cells. Biochem Biophys Res Commun 329:5157
9. Heredia-Middleton P, Brunelli J, Drew RE, Thorgaard GH (2008)
Heat shock protein (HSP70) RNA expression differs among
rainbow trout (Oncorhynchus mykiss) clonal lines. Comp Bio-
chem Physiol Part B 149:552556
10. Quinn NL, McGowan CR, Cooper CA, Koop BF, Davidson WS
(2011) Identication of genes associated with heat tolerance in
Arctic charr exposed to acute thermal stress. Physiol Genomics
43:685696
11. Somorjai IML, Danzmann RG, Ferguson MM (2003) Distribution
of temperature tolerance quantitative trait loci in Arctic charr
(Salvelinus alpinus) and inferred homologies in rainbow trout
(Oncorhynchus mykiss). Genetics 165:14431456
12. Danzmann RG, Jackson TR, Ferguson MM (1999) Epistasis in
allelic expression at upper temperature tolerance QTL in rainbow
trout. Aquaculture 173:4558
Table 6 The ratios of the mean values for the expression levels, as
determined by real-time PCR analyses, of ve individuals from the
thermally selected strain to those of the Donaldson strain for the
representative six up-regulated and two down-regulated genes in
comparison with the corresponding ratios determined by global gene
expression analysis on the representative individuals
Gene Accession no. Real-time PCR
a
Global gene expression analysis
b
Thermally
selected
Donaldson Ratio Thermally
selected
Donaldson Ratio
Heat shock protein 70 kDa isoform b AB176855 26.27 0.027 985.3
c
2,875,242 1,082 2,657.3
dnaJ homolog subfamily a member 1-like XP_003440484 0.1 0.0035 27.9
c
6,326 71 89.1
c-fos protein BAC77046 0.097 0.0028 34.3
c
9,409 293 32.1
ccaat enhancer-binding protein beta NP_001117919 0.19 0.0193 9.8
c
10,081 749 13.5
DNA damage-inducible transcript 4 protein ACO14087 0.038 0.0025 14.9
c
2,750 257 10.7
junB protein NP_001117992 0.153 0.027 5.6
c
25,670 2,812 9.1
dsx and mab-3 related transcription factor 4 ABU53616 0.0014 0.0031 0.44 344 1,469 0.23
Dual specicity protein kinase clk2-like XP_003452484 0.0047 0.008 0.59 970 2,977 0.33
a
The values are calculated from the mean of ve individuals and normalized to those of the EF-1alpha gene
b
The results obtained from global gene expression analysis are listed for comparison (see Tables 3, 4)
c
The differences in the relative expression levels between the thermally selected strain and the Donaldson strain are signicantly different
(Students t test, P\0.05)
1048 Fish Sci (2012) 78:10411049
1 3
13. Perry GM, Danzmann RG, Ferguson MM, Gibson JP (2001)
Quantitative trait loci for upper thermal tolerance in outbred
strains of rainbow trout (Oncorhynchus mykiss). Heredity
86:333341
14. Jackson TR, Ferguson MM, Danzmann RG, Fishback AG, Ihssen
PE, OConnell M, Crease TJ (1998) Identication of two QTL
inuencing upper temperature tolerance in three rainbow trout
(Oncorhynchus mykiss) half-sib families. Heredity 80:143151
15. Ikeguchi K, Ineno T, Itoi S, Kondo H, Kinoshita S, Watabe S
(2005) Increased levels of mitochondrial gene transcripts in the
thermally selected rainbow trout (Oncorhynchus mykiss) strain
during embryonic development. Mar Biotechnol 8:178188
16. Shendure J, Ji H (2008) Next-generation DNA sequencing. Nat
Biotechnol 26:11351145
17. Pan Q, Shai O, Lee LJ, Frey BJ, Blencowe BJ (2008) Deep sur-
veying of alternative splicing complexity in the human transcrip-
tome by high-throughput sequencing. Nat Genet 40:14131415
18. Jager M, Ott C, Grunhagen J, Hecht J, Schell H, Mundlos S, Duda
GN, Robinson PN, Lienau J (2011) Composite transcriptome
assembly of RNA-seq data in a sheep model for delayed bone
healing. BMC Genomics 12:158
19. Martin JA, Wang Z (2011) Next-generation transcriptome
assembly. Nat Rev Genet 12:671682
20. Salem M, Rexroad CE, Wang J, Thorgaard GH, Yao J (2010)
Characterization of the rainbow trout transcriptome using Sanger
and 454-pyrosequencing approaches. BMC Genomics 11:564
21. Hale MC, McCormick CR, Jackson JR, Dewoody JA (2009)
Next-generation pyrosequencing of gonad transcriptomes in the
polyploid lake sturgeon (Acipenser fulvescens): the relative
merits of normalization and rarefaction in gene discovery. BMC
Genomics 10:203
22. Weber AP, Weber KL, Carr K, Wilkerson C, Ohlrogge JB (2007)
Sampling the Arabidopsis transcriptome with massively parallel
pyrosequencing. Plant Physiol 144:3242
23. Wang W, Wang Y, Zhang Q, Qi Y, Guo D (2009) Global char-
acterization of Artemisia annua glandular trichome transcriptome
using 454 pyrosequencing. BMC Genomics 10:465
24. Crawford JE, Guelbeogo WM, Sanou A, Traore A, Vernick KD,
Sagnon N, Lazzaro BP (2010) De novo transcriptome sequencing
in Anopheles funestus using Illumina RNA-seq technology. PLoS
One 5:e14202
25. Bonizzoni M, Dunn WA, Campbell CL, Olson KE, Dimon MT,
Marinotti O, James AA (2011) RNA-seq analyses of blood-
induced changes in gene expression in the mosquito vector spe-
cies, Aedes aegypti. BMC Genomics 12:82
26. Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ, Birol I
(2009) ABySS: a parallel assembler for short read sequence data.
Genome Res 19:11171123
27. Pearson WR, Wood T, Zhang Z, Miller W (1997) Comparison of
DNA sequences with protein sequences. Genomics 46:2436
28. Zerbino DR, Birney E (2008) Velvet: algorithms for de novo
short read assembly using de Bruijn graphs. Genome Res
18:821829
29. Pevzner PA, Tang H, Waterman MS (2001) An Eulerian path
approach to DNA fragment assembly. Proc Natl Acad Sci USA
98:97489753
30. Li W, Godzik A (2006) Cd-hit: a fast program for clustering and
comparing large sets of protein or nucleotide sequences. Bioin-
formatics 22:16581659
31. Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast
and memory-efcient alignment of short DNA sequences to the
human genome. Genome Biol 10:R25
32. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N,
Marth G, Abecasis G, Durbin R (1000) Genome Project Data
Processing Subgroup (2009) The sequence alignment/map (SAM)
format and SAMtools. Bioinformatics 25:20782079
33. Conesa A, Gotz S, Garc a-Gomez JM, Terol J, Talon M, Robles
M (2005) Blast2GO: a universal tool for annotation, visualization
and analysis in functional genomics research. Bioinformatics
21:36743676
34. Rexroad CE, Lee Y, Keele JW, Karamycheva S, Brown G, Koop
B, Gahr SA, Palti Y, Quackenbush J (2003) Sequence analysis of
a rainbow trout cDNA library and creation of a gene index.
Cytogenet Genome Res 102:347354
35. Govoroun M, LeGac F, Guiguen Y (2006) Generation of a large
scale repertoire of expressed sequence tags (ESTs) from norma-
lised rainbow trout cDNA libraries. BMC Genomics 7:196
36. Srensen JG, Kristensen TN, Loeschcke V (2003) The evolu-
tionary and ecological role of heat shock proteins. Ecol Lett
6:10251037
37. Feder ME, Hofmann GE (1999) Heat-shock proteins, molecular
chaperones, and the stress response: evolutionary and ecological
physiology. Annu Rev Physiol 61:243282
38. Roberts RJ, Agius C, Saliba C, Bossier P, Sung YY (2010) Heat
shock proteins (chaperones) in sh and shellsh and their
potential role in relation to sh health: a review. J Fish Dis
33:789801
39. Boone AN, Vijayan MM (2002) Constitutive heat shock protein
70 (HSC70) expression in rainbow trout hepatocytes: effect of
heat shock and heavy metal exposure. Comp Biochem Physiol C
132:223233
40. Ojima N, Mekuchi M, Ineno T, Tamaki K, Kera A, Kinoshita S,
Asakawa S, Watabe S (2012) Differential expression of heat-
shock proteins in F2 offspring of a thermally-selected rainbow
trout strain. Fish Sci. doi:10.1007/s12562-012-0523-3
41. Summers DW, Douglas PM, Ramos CH, Cyr DM (2009) Poly-
peptide transfer from Hsp40 to Hsp70 molecular chaperones.
Trends Biochem Sci 34:230233
42. Pearson DS, Kulyk WM, Kelly GM, Krone PH (1996) Cloning
and characterization of a cDNA encoding the collagen-binding
stress proteins Hsp47 in zebrash. DNA Cell Biol 15:263271
43. Basu N, Todgham AE, Ackerman PA, Bibeau MR, Nakano K,
Schulte PM, Iwama GK (2001) Heat shock protein genes and
their functional signicance in sh. Gene 295:173183
44. Vogt S, Portig I, Irqsusi M, Ruppert V, Weber P, Ramzan R
(2011) Heat shock protein expression and change of cytochrome
c oxidase activity: presence of two phylogenic old systems to
protect tissues in ischemia and reperfusion. J Bioenerg Biomembr
43:425435
45. Montero-Barrientos M, Hermosa R, Cardoza RE, Gutierrez S,
Nicolas C, Monte E (2010) Transgenic expression of the Trich-
oderma harzianum hsp70 gene increases Arabidopsis resistance
to heat and other abiotic stresses. J Plant Physiol 167:659665
46. Dedeoglu A, Ferrante RJ, Andreassen OA, Dillmann WH, Beal
MF (2002) Mice overexpressing 70-kDa heat shock protein show
increased resistance to malonate and 3-nitropropionic acid. Exp
Neurol 176:262265
47. Sheng M, Greenberg ME (1990) The regulation and function of
c-fos and other immediate early genes in the nervous system.
Neuron 4:477485
48. Wilkerson DC, Skaggs HS, Sarge KD (2007) HSF2 binds to the
Hsp90, Hsp27, and c-Fos promoters constitutively and modulates
their expression. Cell Stress Chaperones 12:283290
Fish Sci (2012) 78:10411049 1049
1 3