Sunteți pe pagina 1din 5
GENÉTICA REVERSA Análisis genotípico de plantas de líneas mutantes de Arabidopsis thaliana mediante PCR Integrantes:

GENÉTICA REVERSA

Análisis genotípico de plantas de líneas mutantes de Arabidopsis thaliana mediante PCR

Integrantes:

biotecnología Vegetal, BIT210. Profesor Miguel Ibeas.

Karla

Delgado,

Daniel

Tichy.

Laboratorio

Ingeniería

genética

y

Introducción El estudio de los genes ha sido clásicamente estudiado para, con ayuda de técnicas moleculares, situar y clonar genes de organismos cuyos fenotipos se presentan mutados en ciertos aspectos (1) . Sin embargo, el desarrollo de nuevas técnicas, (como tilling, mRNAi o mutagénesis insercional, en la cual se enfocará este práctico), ha permitido generar una extensa base de datos de organismos, (por secuenciación), por lo que conociendo ya la secuencia de genomas, se puede realizar una mutación en sectores de éste y estudiar su implicancia en el fenotipo de los organismos mutados, estudio que es conocido como genética reversa. Para la generación de estas mutantes, se puede realizar mutagénesis con T- DNA, la cual se basa en la inserción de un fragmento de ADN por medio de la bacteria Agrobacterium tumefaciens, fragmento que se encuentra codificado en un plásmido que se inserta en el genoma del organismo en cuestión de forma azarosa (2) . El uso de estos agentes insercionales permite la identificación de genes mutados de manera relativamente sencilla, por medio de comparación con el genoma de la base de datos o con el organismo silvestre, realizando además técnicas menos costosas como electroforesis (2) . La planta mutante estudiada en este práctico es de la línea Salk_123659, que tiene una mutación realizada

mediante inserción de T-DNA en el gen Atg310800 que se encuentra en el cromosoma 3. (Ver figura 1). Este gen codifica para proteína Bzip28, factor de transcripción putativo atado a la membrana (4) . El objetivo de este práctico es realizar la genotipificación de esta línea mutante para así determinar si la inserción es de forma heterocigota u homocigota. Esto se realizará mediante PCR utilizando 3 partidores distintos, (uno para el borde RB o LB, y otros dos: uno forward y otro reverse). (5)

RB o LB, y otros dos: uno forward y otro reverse). ( 5 ) Figura 1.

Figura

1.

Representación

de

la

inserción

de

T-DNA

en

el

gen

At3g10800.

 

Materiales y métodos Extracción de material genómico Para la extracción, se utilizó una planta de Arabidopsis thaliana que había sido crecida y mutada previamente, realizándose una extracción de DNA para la planta completa debido a que su tamaño era reducido, asegurando así mayor cantidad de material genético para extraer. Se homogenizó en 200 µl de buffer TNE/SDS, (200 mM Tris-HCl pH 8, 250 mM NaCI, 25 mM EDTA pH 8, 0.5%SDS) durante unos minutos.

Se realizó centrifugación durante 5 minutos a 12000 rpm y se recuperó el sobrenadante. Se agregó 200 µl de isopropanol para precipitar el DNA presente y se realizó un vortex por 5 segundos. Para concentrar el material genético presente en un pellet, se centrifugó por 5 minutos a 12000 rpm y se eliminó el sobrenadante. El pellet se lavó con 200 µl de Etanol 70%, y luego se centrifugó por 5 minutos a 12000 rpm. Se eliminó el sobrenadante, y en este paso, se debía mantener el tubo sobre papel durante una hora para asegurar una mayor pureza del material genético obtenido. Finalmente, el pellet se resuspendió en 20 µl de agua. Paralelamente, se realizó esta misma extracción para la planta silvestre (WT), para que sirviera de control. Reacción de PCR Para este paso, se agregaron 9 µl de cada mezcla, (que se diferencian en los primers utilizados; un mezcla WT y una mezcla MT) y 2 µl de DNA genómico extraído anteriormente. Cada tubo se marcó como 4.1 (para la mezcla WT) y 4.2 (para la mezcla MT). Los contenidos de cada tubo se muestran en las tabla 1.

Mix

 

Contenido

Marca

 

10X buffer (+MgCl2) 2,5 µl

 

10

mM dNTPs 0,25 µl

Taq polimerasa 0,2 µl Agua 20 µl DNA genómico 2 µl

4.1

1)

2)

4.2

 

10

µl Primer Scr659F 0,5 µl

1) WT

10 µl Primer Scr659R 0,5 µl

4.1

2) MT

10

µl Primer LBb1.3 0,5 µl

4.2

Tabla 1. Se muestra la información de los tubos que contienen cada Mix utilizado en el práctico, Mix 1 WT y Mix 2 MT. El número 4 corresponde al grupo correspondiente, y se muestra que contenía cada mix. Mix se refiere a mezcla.

El programa que se utilizó para la amplificación fue el siguiente:

Desnaturalización inicial 94°C 10 min Desnaturalización 94°C 30 seg. Annealing 50°C 30 seg. Extensión 72°C 1 min 30 seg. Extensión Final 72°C 10 min Realizándose 35 ciclos.

Las secuencias de los partidores utilizados se muestran en la tabla 2:

Partidor

Secuencia

Scr659F

5' CGAACTACATTCATCATACAACACA 3'

Scr659R

5'CAACTATCTCTCTCACCATGACTAA 3'

LBb1.3 5'

5' ATTTTGCCGATTTCGGAAC 3'

Tabla 2. Se muestran los partidores y su correspondiente secuencia usados en cada mix (ver tabla 1).

Electroforesis Se preparó un gel de agarosa al 1% en buffer TAE 1X, donde se cargó 20 ul de cada muestras, (las mutantes realizadas por cada grupo con cada mix, y además la extracción realizada de la planta silvestre con cada mix), además 5ul del marcador de peso molecular, (100 bp NEB DNA ladder). Se agregó 5 µl de buffer de carga 6X a cada muestra y se cargó en el gel, se encendió la fuente de poder y se corrió el gel a 100 volt entre 30 y 40 minutos.

Resultados

Visualización de las ampliaciones PCR en gel de agarosa

Tal como se explicó previamente el material genómico extraído, que en total fue de 8 plántulas completas de Arabidopsis thaliana, 6 de ellas previamente transformadas y 2 de cepas silvestres, fue sometido a amplificación por PCR usando las dos

A
A
B
B

Fig.2

A) Gel de electroforesis de agarosa al 1% de los fragmentos amplificados por PCR, de Arabidopsis thaliana,

obtenidos con los partidores Scr659F y Scr659R en 1.1(wt),2.1, 3.1, 4.1, 5.1, 5.1(wt) y 6.1. Y con los partidores Scr65 Scr659F y LBb1.3 5' en 1.2, 1.2(wt), 2.2, 3.2, 4.2, 5.2, 5.2(wt) y 6.2. Por otra parte corresponden a plantas cepa silvestre 1.1(wt) 1.2(wt) 5.1(wt) y 5.2(wt) St corresponde al estándar de peso molecular 100 bp DNA Ladder de New England Biolabs© inc.

B) Gel de electroforesis de agarosa al 1% con los resultados esperados de los fragmentos amplificados por PCR,

de Arabidopsis thaliana, obtenidos con los partidores Scr659F y Scr659R en los carriles wt y con los partidores Scr65 Scr659F y LBb1.3 5' en mut. Col-0 corresponde a la cepa silvestre, bZip´28-1.5 corresponde a una línea de mutantes insercionales homocigotos del gen Atg310800,bZip´28-1.6 corresponde a una línea de mutantes insercionales heterocigotos del gen Atg310800. L corresponde al estándar de peso molecular1 kb Plus DNA Ladder de O’GeneRuler©.

mezclas de partidores previamente

mezcla de partidores mencionadas en la tabla 1 y 2, con los 16 productos obtenidos se realizó una electroforesis, como se explicó previamente, cuyos resultados fueron los siguientes:

(Fig. 2A) De estos 16 productos, solamente 3 se amplificaron correctamente, 1.2(wt) 5.1 (wt) y 5.2. El primero mostró una banda de aproximadamente de 400pb y otra de 1000pb, la segunda mostró resultados similares y la tercera solamente mostró una banda de aproximadamente

400pb. De las 13 que no mostraron ninguna, una (3.2) mostró un degradado signo de fragmentación. Los resultados esperados (Fig. 2B) difieren totalmente de los obtenidos pues se esperaban bandas de aproximadamente 500pb para la presencia del alelo silvestre y una banda de aproximadamente 200pb para el alelo mutante. La presencia de una sola banda es prueba de homocigosis y la presencia de ambas prueba de heterocigosis.

Discusión

Los resultados en primera instancia parecen ser contradictorios, y los son, de los 16 productos esperados solo se obtuvieron 3, esto puede ser explicado debido a en primera instancia una extracción de material genético deficiente, ya sea porque en el proceso de homogenización se perdió la gran mayoría de la muestra, porque no se recuperó suficiente sobrenadante después de la primera centrifugación o porque se eliminó el pellet junto con el sobrenadante después de la segunda centrifugación o después de la tercera. En segunda instanciar esto pudo haber sido debido a problemas al momento de realizar la amplificación PCR, ya sea por haber tomado una alícuota de mezcla WT/MT carente de partidores o que la muestra haya sido tan pequeña que se haya evaporado tras la primera subida de temperatura, otra posibilidad pero más pequeña es que el partidor LBb1.3 5' se haya encontrado degradado o mal diseñado, lo cual explicaría la ausencia de amplificaciones en los productos que fueron amplificados con este partidor, a excepción de 1.2(wt) y 5.2 pero esto se explicará a continuación. En tercera instancia puede haberse debido a una deficiente carga de los productos en el gel de agarosa, pero esta posibilidad es la menos probable, siendo la primera la más plausible. Una vez analizadas las bandas obtenidas estas vuelven a ser contradictorias entre sí, tanto 1.2 (wt) como 5.1 (wt) muestran la misma banda de aproximadamente 400pb, a pesar de que supuestamente se usaron mezclas de partidores distintas para amplificar cada uno, una posible explicación a esto es que al momento de tomar la alícuota de la mezcla, o de cargar la muestra en el gel la1.2(wt) se haya cambiado por la 1.1(wt) o la

5.1(wt) se haya cambiado por la 5.2(wt). También se observa una banda del mismo tamaño en 5.2 usando la mezcla de partidores MT, una posible explicación a este resultado es que como ocurrió con las muestras de las cepas silvestres, la muestra mutante 5.2 se haya intercambiado con la 5.1 al momento de cargar el gel, o se hayan tomado las alícuotas de mezcla de partidores al revés, así mismo la presencia de una banda del mismo tamaño que la plantas de cepa silvestre es otra contradicción, una posible explicación a esto es que o las cepas silvestres no eran silvestres y eran mutantes o que la muestra 5.2 de la cepa mutante posee al menos un alelo silvestre que fue amplificado con la mezcla de partidores WT y no MT como se supone debió haber sido. Otro incógnita es la presencia de una banda de 1000pb tanto en 5.2 como en 1.2(wt) una posible explicación a esto es que los partidores hayan hibridado en zonas distintas a las originalmente ideadas y se haya amplificado un fragmento que está al límite de la procesividad de la Taq polimerasa, estando así en baja proporción en comparación a la otra banda. En síntesis como principal teoría para explicar estos resultados y su diferencia con respecto a los resultados esperados, teniendo en cuenta que la hipótesis con mayor probabilidad de ser cierta es aquella que se basa en menos asunciones es que la muestra 5.2 posee al menos una banda con el alelo silvestre y que se cargó al cambiada con respecto a 5.1, lo mismo ocurrió para 1.2(wt) con 1.1(wt), mientras que la ausencia de bandas en los otros 13 productos se debió probablemente a una extracción deficiente.

Conclusiones

 

Referencias

En vista

 

de

los

resultados

(1) Griffiths, J .F. A. et al.

contradictorios y la gran cantidad de asunciones que hay que formular para

(2002). Genética. McGraw-Hill Interamericana

explicarlos, junto con el hecho de que

(2) Patrick J. Krysan1, Jeffery C.

menos del 20% de

los

productos

Young. (1999)T-DNA as an Insertional

esperados

 

fue

amplificado

Mutagen in Arabidopsis. The plant Cell.

exitosamente es pertinente concluir que

(3) Jakoby, M.,Weisshaar, B.,Droge-

no se logró realizar la genotipificación

Laser, (2002). bZIP transcription

de

la

línea mutante es decir, no se

factors in Arabidopsis. Encontrado a

logró

determinar

si

las

plantas

de

través de www.arabidopsis.org

estudio

son

heterocigotas

u

(4) Guía de laboratorio N°4:

homocigotas para analizada.

la

inserción

Genotipificación de Mutantes Insercionales mediante PCR, Universidad Andrés Bello.

Biolabs. 100 bp NEB DNA ladder, producto N3231, www.neb.com

Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual (2nd Ed.). 1989.