0 evaluări0% au considerat acest document util (0 voturi)
16 vizualizări4 pagini
This report describes the isolation, mapping and parM sequencing of the fourth gene (rP TPI ALI) that was demonstrated here to be functionally active and expressed in human brain and kidney. Limited DNA sequencing of the ATPI ALI exow allowed one to suggest that the gene probably encodes a new ion transport ATPase.
This report describes the isolation, mapping and parM sequencing of the fourth gene (rP TPI ALI) that was demonstrated here to be functionally active and expressed in human brain and kidney. Limited DNA sequencing of the ATPI ALI exow allowed one to suggest that the gene probably encodes a new ion transport ATPase.
This report describes the isolation, mapping and parM sequencing of the fourth gene (rP TPI ALI) that was demonstrated here to be functionally active and expressed in human brain and kidney. Limited DNA sequencing of the ATPI ALI exow allowed one to suggest that the gene probably encodes a new ion transport ATPase.
0 1991 Federation of European Biochemical Societies 00145793/91/$3.50
ADONS 001457939100029V January 1991 The family of human Na,K-AT&se genes A TPLUJ gene is transcriptionally competent and probably encodes the related ion transport ATpase N.N. Msdyanov, K.E. Petrukhin, V.E. Sverdlov, A-V. Grishin, M.Y. Orlova, MB. Kostina, 0.1. Makarevich, N.E. Broude, G.S. Monastyrskaya and E.B. Sverdlov Sitemyakin Institute of Bioorganic Chemistry, USSR Academy of Sciences, GSP-7 V-437 I1 7871, Moscow, USSR Received 15 November 1990 The multigene family of human Na,K-ATPase is composed of 5 u-subunit genes, 3 of which were shown to encode the functionally active al, a2 and a3 isoforms of the catalytic subunit. This report describes the isolation, mapping and parM sequencing of the fourth gene (rP TPI ALI ) that was demonstrated here to be functionally active and expressed in human brain and kidney. Limited DNA sequencing OF the ATPI ALI exow allowed one to suggest that the gene probably encodes a new ion transport ATPase rather than an isoform of the Na,K-ATPase or the closely related F&K-ATPase. 1, INTRODUCTION Na+,K+-ATPase; Ion transport ATPase; Gene family; Wuman genome Na+,K+-activated adenosia,: triphosphatase is an in- tegral membrane protein that transduces the energy from the hydrolysis of ATP into a gradient for Na+ and K across the cell membrane. The enzyme molecule consists of the catalytic ru-subunit and glycosylated ,& subunit of unknown function. As of now, 5 a-subunit genes and one closely related gene for the catalytic subunit of H,K-ATPase were identified in the human genome [1,2]. Three of the Na,K-ATPase u-subunit genes encoding the crl, ~2 and ru3 isoform were shown to be expressed in a variety of human and animal tissues (for review see [S]). The functional status of the remaining two genes designated as ATPlALl and ATFlAL2 [4] was still unknown. Were we report the data on cloning, mapping and partial sequencing of ATPZALl. In addition, we present results indicating that A TPlALZ is a new functionally active member of the Na,K-ATPase gene family and expressed in the human brain and kidney, chromosome walking, high-stringency hybridization was performed at 65C as described [9]. Phage DNAs of hybridizable clones were isolated according to the procedure of Yamamoto [lo] and mapped for &oRI and HindlIl sites, combining the double digestion method [6] and the technique of partial digestion [!!I. The exon-containing fragments of ,the phage inserts were identified after the low- stringency hybridization with pig kidney cDNA [12] at SSC!. The cDNA-hybridizable fragments were subcloned into Ml3mplg and se- quenced by the method of Sanger [13]. The poly(A*)-fraction of total cellular RNA was isolated from frozen human tissues as previously described [14]. The random-primed cDNA was generated from 0.5 pg of the poly(A)-RNA following the standard technique [6] and one- tenth of the synthesized cDNA was subjected to 25-30 cycles of en- zymatic amplification [IS] at 94OC, 1 min; 4gC, 1.5 min; and 72C, 2 min, using the AGATTCCGAGAAGAAGACCA and GCTGGGGCTCAGACTCCCCCGTGAGA oligonucleotides as gene-specific primers. The PCR product was analyzed by elec- trophoresis on 8% polyacrylamide gels [6], followed by transferring to Mybond N membranes (Arnersham, England) and low-stringency hybridization with a pig kidney cDNA probe. The part of the PCR product was cloned to the undephosphorylated SmaI-cut Mlfmplg and sequenced by the dideoxy method [13]. 2. EXPERIMENTAL Genomic DNA was isolated from the human sperm [g] partially digested with Suu3A [fi] and fractionated by NaCl gradient cen- trifugation [S]. Fractions containing 15-23 kb in length were used for cloning in the AEMBL3 vector according to [7]. To make a Correspondence address: K.E. Petrukhin, Shemyakin InStitUte of Bioorgamc Chemistry, USSR Academy of Sciences, GSP-7 V-437 11787 1, Moscow, USSR Published by Elsevier Science Publishers B. V. (Biomedical Division) The ATplALl gene was described as a member of the human Na,K-ATPase gene family under the names of aNKaSW3.2 [l] and LYD [2]. Sverdlov et al. [I], and Shull and Lingrel [%] published the nucleotide sequence of exons 6, 7 [2] and 9 Cl] as well as the partial physical map of this gene [%]. The chromosomal location of A TFlALl was determined by somatic cell hybrid map- ping studies and assigned to,the human chromosome 13 [4]. The objective of tliis study was to clone and map ATPlALl completely, and to determine whether the gene is transcriptionally competent. To isolate the A 91 Volume 218, number 1 FEBS LETTERS January 1991 / Giw13.2 , L xsw 15 I XSW3L 4 xsw14 xsw 21 , I 1 :NKsSW 3 2 1.2 1.0 Fig. 1. Restriction enzyme map of the human ATPlALl gene. The gene is represented as a thick line in the middle of the figure, overlapping inserts from the recombinant phages are shown above. Below the gene structure is a map for two restriction endonucleases with fragment sizes indicated in kb. phage inserts which encompass the entire A TPdALZ we performed two steps of bidirectional chromosome walking starting from the end fragments of the primary clone ANKaSW3.2. The set of overlapping clones span- ning more than 60 kb were characterized. Hybridiza- tion analysis with the pig kidney cul cDNA probe revealed that the gene itself is Z-30 kb in length. The restriction enzyme map of the ATPlALl depicted in Fig. 1 shows some differences when compared with pdblished data 121. We failed to find the 2.2 and 0.6 kb fragments which were positioned by Shull and Lingrel between the 2.9 and 12.3 kb cDNA hybridizable fragments. In addition, the locations of the 15th and 20th exons (Fig. 1) indicate that the ATPI ALl .is longer than was presented earlier 121. DNA sequence analysis of the h phage portions that hybridized with pig kidney cul cDNA allowed us to determine the structtire of ex- ons 5, 9 and 20, and part of the 15th exon, as well as exons 6 and 7 which were sequenced by Shull and Lingrel [Z] . The deduced amino acid sequences showed 65-75% homology for exons 5i 6 and 20, and 85-9OVo homology for the highly conservative exons 9 and 9 when compared with the corresponding regions of cul, CY~, and a3 isoforms, as well as with the c+subunit of human M,K-ATPase. The degree of homology could be sufficient to consider the putative ATPlALZ product as an isoform of the satalytic subunit of either Na,K- ATPase or H,K-ATPase, but several features of the ATPlALZ nucleotide sequences caution against this conclusion. Fig. 2A presents the comparison of amino acid sequences encoded by the Sth, 6th and 20th exons of the human genes for a*l, cu2, ru3 isoforms of Na,K- ATPase, a-subunit of I-&K-ATPase and ATPI ALI . The comparison revealed that the ~1, (~2, and CY~ se- quences represent one class of homology exhibiting abaut 90% identity, while the ATPlALl and I-I,K- ATPase form a second class which is only ,7-69% _, homologous when compared with human cul . In addi- tion, the exon/intron boundary at the 3-end of the ex- on 20 is identical for the M,K-ATPase g&e and ATPI ALI but differs from the al, cu2, and a3 genes, which have a three nucleotide (one amino acid) deletion at that position (Fig. 2A). On the other hand, it is not very likely that the A TPlALl represents the isoform of the H,K-ATPase because the pairwise comparison of the amino acid sequences encoded by exons 5,6 and 20 ma ATPlAl ATPlA2 WLCVVLSAVVIITGCFRYYQEAKSStil!4ESFKWtVPQ 100. ATPl.43 LYLqVVt.aAVVIvTCCFSYYQE.,WSKIt4dsFKNt4VPQ 92. LYLQiVLeAVVXlTGCFSYYQEAKsSKIMESFKN,tVPQ 95. ATPlALI vYLGCVLOL\vILTGIFAYYQEAKSTSI~sSFSK~IPQ lOOI ATPlALl VYLGCVL~~VVIITG~F~YYQEAKS~~~~~SFI~~~~QQ 66, tI.K-ATPdse IYLaiaLia\YvvTCcFgYYOEfRSTNIlaSFLnlvPO 55. H,K-ATPeW LYLaiaLiAVVvvTGCFgYYQStKStflIi~SFKSl~PQ 66% ATM Al l%Z QALVIRHGEKWINAEEVYVODLVEVKGGDR~PADLRIISANOCK 100% QALVIR&EKnqINAEEYVVGDLVEVKGoDRVPADLRIlSst,G~K 89, QALVIRsGEKnqvNAEEVVVGDLvSiKooDRvPADLRllSAhqcK SC\ ATP1AL.i QALVIRdsEKktI~.EqlVVGDi~EVKGGDqIPAD~R~lSSqq~r HrK-ATPLae QAtVIRdGdKCqINAdqlVVG,,U,EmKoGDRVPADI~~laAqOCK 6,. 69, ESH 20 ATPlAl AWlA TY~QRKIVEFTCMTAFFVSIVVVQkADUJICKTRRNSVFQQGN-K 100, ATPlAJ TYEQRSVVR~C~~TAFF~S~VVVQ~~ADUICKTRRNSVF~~+K 93, ATP1ALI PRIQREYLEYTCYT~~F~OILV~I~DLI~RKTRRYSIF~LFR 100. ATP1AL.l TYGQRKvVE~C~TA~FVS~~~~Q~ADLIICKTR~NS~F~~-~ 93% TLYQReylE~TgyTAFFVgI1VqQlADLiIrKTRRNSiFQQOltR H.P-ATPase T~~QR~YQ~YTcYTvFF~oI~VCQIAD~~IRKTRRIS~FQ~~FR ti,K-ATPam TfgPRlyqqyTC,TVFFiSIoYcglADVllrKTRRlSaFQQG~fR 55, ma 57% Fig. 2. Analysis of the amino acid sequences deduced from the structure of the ATPI ALl exons and the corresponding regions of al cDNA, ATPlA2 (cd gene), ATPI A3 (a3,gene), and the human H,K-ATPase gene (data from ref. 17, 18, 19, 16 respectively). eeicentage identity is indicated on the right, non-identical residues are indicated in lower case. A: Homology of amino acid sequences encoded by ihe members of the Na,K-ATPase gene family and the H,KLATPase iene. B: Comparison of the ATPlALl and human H,K-ATPase amino acid sequences. 92 Fig. 3. Nucleotide sequence of the ATPfALl fragment flanked by two oligonucleotides which were used for the PCR analysis of the ATPJ ALI transcript. The intron sequence is shown in lower case. PCR primers are underlined. 210 Ifi: (Fig. X4) exhibits about 60% homology. This level is markedly 1 ess than that of the 3 sodium pump cy- subunit ge :nes. In addition, a recently published genomic s sequence of human H,K-ATPase 1161 demonstrated the absence of an intron between the-6th and 7th exon. In contrast, the ATPlALl gene possesses n the 126 bp intron at this position (Fig. 3). Thus, the limited sequence information on the ATPlALZ struc- 12 3 4 5 ' 6 7 1159 1093 805 514 468 449 339 284 249 Fig. 5. PCR-based search for the presence of the ATPfALl transcript in poly(A+)-RNA of human tissues. Poly(A+)-RNA w as converted to single stranded cDNA and subjected to 25 cycles of PCR with ATPfALI-specific oligonucleotides. The PCR products were electrophoretically analyzed on an 8% polyacrylamide gel (A) followed by Southern blotting and hybridization to the P-labeled Cal Pig cDNA (B). Lanes 3, 4, 5 and 6, PCR from poly(A+)-RNA of the human brain, kidney, liver, and renal carcinoma, respectively. Lane 2, PCR from the DNA of genomic clone MWZI (contains intron 6 that increases the size of the fragment). Lanes 1. 7, size markers (PlincIl digest of #X 174 DNA and Hue111 digest of pBR 322 DNA, respectively). Fig. 4. Test for the specificity of the oligonucleotides which were used to detect the ATPlALI gene transcript. 1 ng of the phage A and cosmid DNAs from the clones containing exons 6 and 7 of five II- subunit genes were subjected to 25 cycles of PCR followed by gel electrophoresis in 2% agarose. Lanes 1, 2, 3, 4 and 5 represent PCR from the DNA of ASW21 (gene A TPI ALI ), ARS9-1 (gene ATPIAI), cosRC16-10 (gene ATPfA2), ARSB.l (gene ATPI AS) and hSAKS35 (gene ATPI ALI ), respectively. Lane 6, PCR from the 10 ng of the pGC 35 DNA (full-length pig cul cDNA). Lane 7, size markers (PstI digest of phage h DNA). ture allowed to suppose that the gene is evolutionary distant from either a Na,K-ATPase or a H,K-ATPase and can represent a gene for the related ion transport ATPase, although the possibility that ATPlALZ en- codes the marginal forms of a Na,K-ATPase or a H,K- ATPase cannot be excluded. I t should be noted that the determined nucleotide se- quence of the ATPlALl exons as well as the structure of the exon/intron boundaries gave no indication that ATPiALi represents a pseudogene but its functional 93 Voh i l l l ,~ 2714. l l t l l i l b l ~ I l q : l i q f.i ~; It ' I~ .R~ J ~i t | l l af) l q g t ~ l l i l l i ~ r el i l l i h l ed I l f l k l i O W l l . I l l of d ~ l ' 1o d l cl ' nl i ne w h et h er l l l i ~ t I1i ~ i ~ l i ' ~ ui ~ cr i p l i O l i al l y oni p l cni w e d eci d ed i o 11~ t t i e l l l ~ l h od of l l Ol v i i l l ' ~ l ~ v h ah t r ~ i l h l l l ( P( ' I # . } f or l h ni R N A d l ct ; l i O l ~ l l l ' l ~: i ' l t l ~ O l l ~ el ' ~ h l i l of i i R N A i ~ i ' ~ l ~ al ' i l l i Ol l ! o i l l ~ conl l ! l l i l l l l i ~ i r y I ) N A. l ' h ~peci fi i i y of PCR amp Ii fi cai i ol ~ is ba~d oi l Ihc ~peci fi i t y of lWO pfhnl' S i l l l i i f h i i i k t he I ) N A s- q t i l i Ce. I l l i l i ~ case of A F PI A L / l i l I ~ { N A d t ~ l i O l l w e 110i t wo ol i g onucl eol i d es f l ' om C X O I U i 6 al l t l 7 (s F i g , 3} , r h p r i mer s w er e ~dlOWll t o be ver y sp ci f i , : f oi ' . 4 T P ' I A I . I al l ; ! g; r ' e i l o al np l i f i cat i oi l p l ' od l i ct Whl~ p l l ag e A I ) N A~ , onl ai i l i l i 8 t h e cor i ' e. ~ p O l l d i i l g r cg i ol l f ( i f l h e oi l i er ct . sl i b l i i l i t gel l CS w er e l i sed i i .~ l emD l at cs i l l l h c I ' C R r eact i on (Fig, ,1), Sear chh/g f or t he A77' I ALt tran.~cripl in the poly(A' ~)-fraction of the human brain, kidney, liver and retail carcinonm RNA illcluded eDNA synthesis and 25~30 cycles of PCR followed by elec- iropl~oresis, hybridization analysis and sequeucing of the amplified product. The PCR analysis revealed the presence of the ATPI ALi transcript in the human braiu and kidney (FIB. 5) . Direct sequencing confirmed the identity of ~l~e P CR p r od u c t a nd the d ed u c ed A TPI ALI trans cript. This resul t c l ea r l y d emons tr a ted that the ATPI ALI is cpres s ed at l east at the l evel of m R N A a nd c a n enc od e th e fu nc ti ona l i s ofor m of an i on tr a ns por t ATP a s e. Th e p os s i b l e c a nd i d a tes for the ATPI ALI g ene p r od u c t c ou l d be the ou a b a m- ins ens itive Na +- a nd K+ - ATP a s es wh i c h wer e identified in differ ents parts of ma mma l kidney [ 20, 211. Th e s eq u enc e i nf or ma t i on on th e s tr uc tur e of the A TPl ALI eons a l l owed us to s y nth es i z e the i s ofor m- s pec ific ol i g onu c l eoti d es a nd beg in the a na l y s is of ,'1 h u ma n k id ney eD N A l ibrary. Acknowletlgement: The autllors arc grateful to Dr 1, Chernov for the synthesis of the oligonulcotidcs, R E F E R E N C E S [1] Sveralov, E.D,. Monastyrskaya, G.S.. Broude, N,E,, Ushkarev. Y.A.. Allikmeis. R,L,, Melkov, A. M. , Smirnov Y.V,. Malyshev, [,V., Dulub0va, I,E,, Peirukhin. K,E,, Grishin, A,V., Kijatkin, N. i. . Kostina, M,B,, Sverdlov, V, E, Modyanov. N.N. and Ovchinnikov. Y,A. (1987) FEBS Leu 2t7, 275-278, [}1 '~ll~itt, M , M al~d t i i l ~ f l , I,I1 i I~t ~?l 1"1,>~ Nai l Acri d. ~,~i, I ; ~, A b t,t, . l i l l , l , t i ) . t l . t } l 1 .i i l! lfl. 1.11. ( l l t ~* ~ki , l , , ~l t l t l t . M- M, ail~t I ' I i . t+.~,1. I l' t~mi f' t l ~'iillt~,l't~l|t~, I<1 ,. %hiwt~lel, .1,~ it ,, i .l t t d~l l l , ~l'.. Shllll %l,kl . It 11.~ I' _ I , , l . i l l l ~l . I . I 1, ,li~d I f~lll~k, |~ i l ' l ~ ] t .i llOllli ,~ ~. I~1 Kai .~i ' , 1~, ; llt d Nhi fl' i ly, N, I ; , i I ' l ~ i t i t : I i N A ( hi tli l~tL A l~ft lli ~ll Al~Pl't~clch I( i { o~ i . I } , M, ~d,t ,.>1, I, i~l,. I - .i l q IRI. I'1 ,Nlani ali ~, r ,, I q ' i i ~ h , I ' . 1 <, ,l i l d 7~lt llbi ~ok. I. i lu.' t 2i <Nlt~tuhlf (' lolt i lt b~: A l>aboflllor ) $1111ut~tl. ( ' ol d .~l~fi llt~ }l.,ifl~i~f l,i lbof.lt Ol' ~. ( ' ol d Spfi li ~ 11.lfbof. ~ t ' . I?1 l : l ' i ~ h auf , A . . M , , I,hi ' i ~dl I I , Pou~lka, A , i u~d <MiIl'fa), N 119~Jl J. Mol . I l i ol li D..,,i 27 -1f.12 I~1 .~hapi fo, Y . A. , /,;iyI~cV. I,/.,, VIIft t ~, Y,II,, ~ ' ak ~ l cv , A. ( I . i l l l d ( i t udi t i ~. V . M. 119~2} Il i oofg , i ~li i llt , ~, l J J 9 - I' J .t 2, i ' l l ( h cl i i i l l l i k ov , Y , A, , Moi lll~t yf~kllyll, ( l ,S., llfoud, N . t i . . ..%lliknil~. R , I . , Udlki li ' ~ Y, A, , ,Mclko~, ," i ,M., Si li i fno~, Y . V , , ,Maiy~h~',. I,V,, I)ulubo~a, I . l i , , Pli ' ukhun, K.E., ( i f i ~ l i i n. A , V . , S~ l t d l ov . V . l ! . . Ki v l l l k i i i , N,t ., K ~ t i i i l l . HI,It ., Mod y l i i l ov , N . N . . t f i d Swl ' d l ov , I L l ) . t t g KII f: I( t lS I.el l . ] l J . 7J,.80. l i l t ] Y; i l; i i , lll~lll, K . R. . AIl~rl~, II,M , I| ~n~i li l! f, R., I,i l~hol' n, 1,, ar i d l'*fibl'. ( } ( 197oi Vi r ok q l y ,l(i , 7J.1.-739. f111 l i nk er , R.T, and Boar d. l / . ( i , (t l)~l~l Nudci A~hts 14~, 16, I I 0~, 1121 Ov ch i l l l l i k ov , Y , A, , Modyano~. I N, N. i l r oud, N,E., I~i i ' ti khi i ~, K , E, , Gr i ~t l i l l , A, V , , Af/al l ' l i l z ov Il , N, M, , Al d anov a, N.A,..MOli ~l~lyl' ~kli ya, ( I , S . . ' | l i d SVl' dlov, E.D, (1986) I; EI} S Left . 201. 23%..2.t$, l l 31 Sai lgl' , F., Ni ck l en, S, ai ld ( : oi i h oi l . A,R, (1977} Pro, Nai l, Ai ~ml, Sci . I.JSA 74, $,163-:$467, 1141 Sv ~ r d l o v , E. I ), , l l l l ' uk hi i l . K,E,, Ak0pyt llll~i . N,S,, lh' oli d N. [ ! . (h=i shhl, A,V., Svcr dl0v, V.E. ~illd ModyallOV, N,N, (1988) Dokl. Akad. Nauk SSSR 298, 236..239. [151 Saiki R,K,,(]lfaild, D. H. , SIoff~l, S, , Slliil' f, S. , I. , lliguchi R,, tlolm, G. T, . Mullis K,I}, and l'.'rlh:h, II,A. (1988) ,Science 239, 487--491. [161 Macda, M. , Oshhll~i n, K. - I , , Taml i r a, S mi d Ft l l t l i , M. (1990) J, Bi ol . Chen~, 265, 9027.-9032, [17] Kawak ami , K,, Oh l a, T. , Noj h i l a, t l . and Ntigan0> K, (1986) J, I]i 0henL 100, 389- 397, Di l l Shu| l, M , M . , l J ul h , I.).G. and IAngr l, J.IL (1989} J. Bi ol. C{lem. 264. 17532.-17543, [191 Ovchinnikov. Y,A,, Monastyrskaya, G,S., Broud, N.E., Ushkarev. Y. A. , Melkov, A,M., Smimov, Y.V,, Mnlyshev, I,V.. Allikmets, R, L. Kostina, M,B,, Dulubova, I,E,, Kiyatkin. N.I., Grishin, A,V., Modyanov, N.N. a~ld Sverdlov. E, D. (1988) FEBS Leti 233. 87-94 [20] Doucet, A, and Marsy, S, (1987) Am, J. Physiol, 253, F418-F423. [211 Matin, R,, Gomes, D.C.. Rodrigues, G,A,, Proverbio, T, and Proverbio, F, (1990) FEBS Left, 269. 77-78. 94