Mol Biol Rep (2010) 37:33353343

DOI 10.1007/s11033-009-9920-9

Molecular characterization and expression analysis

of lipopolysaccharide and b-1,3-glucan-binding protein
(LGBP) from pearl oyster Pinctada fucata
Dianchang Zhang Jianjun Ma Jingjing Jiang
Lihua Qiu Caiyan Zhu Tianfeng Su
Youning Li Kaichang Wu Shigui Jiang

Received: 31 July 2009 / Accepted: 22 October 2009 / Published online: 4 November 2009
Springer Science+Business Media B.V. 2009

Abstract The lipopolysaccharide and b-1,3-glucanbinding protein (LGBP) plays an important function in the
innate immune response of invertebrates as a pattern recognition receptor (PRR). Herein, we described the isolation
and characterization of pearl oyster Pinctada fucata LGBP
(designated as poLGBP). The poLGBP cDNA was
2,075 bp long and consisted of a 50 -untranslated region
(UTR) of 18 bp, a 30 -UTR of 299 bp with one cytokine
RNA instability motifs (ATTTA), and an open reading
frame (ORF) of 1,758 bp encoding a polypeptide of 585
amino acids with an estimated molecular mass of 65.1 kDa
and a theoretical isoelectric point of 5.80. Homology
analysis of the deduced amino acid sequence of the poLGBP with other known LGBP sequences by MatGAT
software revealed that the poLGBP shared 26.356.7%
identity and 40.570.9% similarity to the other known
LGBP sequences. SMART and alignment analysis revealed
that the poLGBP possessed a potential polysaccharidebinding motif, a glucanase motif, a LPS-binding site, a

Dianchang Zhang and Jianjun Ma authors contributed equally to this

work.
D. Zhang  J. Ma  J. Jiang  L. Qiu  C. Zhu  T. Su  Y. Li 
K. Wu  S. Jiang (&)
Division of Aquaculture and Biotechnology, South China Sea
Fisheries Research Institute, Chinese Academy of Fishery
Science, 510300 Guangzhou, China
e-mail: jiangsg@21cn.com
J. Ma
School of Life Science and Technology, Jinan University,
510632 Guangzhou, China
J. Jiang
School of Fisheries and Life Science, Shanghai Ocean
University, 200090 Shanghai, China

b-1,3-linkage of polysaccharide, a glycine-rich region, a

threonine-rich region and two N-glycosylation sites. In
healthy pearl oyster, the poLGBP mRNA was specifically
expressed in digestive gland, and not detected in gill,
adductor muscle, gonad, intestine, mantle and hemocytes.
However, after bacteria stimulation, the expression of the
poLGBP mRNA was significantly up-regulated in digestive
gland and also weakly detected in haemocytes, gonad and
intestine. After LPS stimulation, the poLGBP mRNA
expression was significantly up-regulated at 8 and 12 h in
digestive gland, and the expression level was 10.7-fold
higher than the PBS group at 12 h. After bacteria stimulation, the expression level of the poLGBP mRNA was also
significantly up-regulated in digestive gland and was 12.9fold higher than the PBS group at 8 h. However, during the
experiment, the poLGBP mRNA expression was not
detected in gill after LPS or bacteria stimulation. The tissue-specific expression and the expression up-regulation
after LPS or bacteria stimulation in digestive gland suggested that the poLGBP was an inducible acute-phase
protein and might play an important function in digestion
as digestive enzyme and pattern recognition receptor.
Keywords Pearl oyster  Pinctada fucata 
Lipopolysaccharide and b-1,3-glucan-binding protein 
Pattern recognition protein

Introduction
Pearl oyster Pinctada fucata is distributed over coastal area
of South China and is the most important bivalve mollusk
for seawater pearl production in China. However, since the
mid-1990s, pearl oyster has suffered serious disease caused
mainly by bacteria, rickettsia-like organism and parasites,

123

3336

which could be related to the dramatic decline in South

China seawater pearl production [13]. Therefore, in order
to control disease and enhance the yields and quality of
seawater pearl, it is necessary to understand the innate
immune defense mechanisms of pearl oyster.
Pearl oyster like other invertebrates lacks the adaptive
immune system and exclusively relies on the innate
immune response to combat invading organism [4]. A
critical step in the innate immune response is to recognize
an invading organism as non-self [5]. Microorganisms have
b-1,3-glucan (bG), lipopolysaccharide (LPS) or peptidoglycan (PG) on their surface, which are known as pathogen-associated molecular patterns (PAMP) and can be
recognized by pattern recognition receptor (PRP) of the
host, and then elicit cellular and humoral immune response
of invertebrates [5, 6]. Such non-self recognition is a fundamental aspect of immunity of invertebrates.
Lipopolysaccharide and b-1,3-glucan-binding protein
(LGBP) is one important member of the PRPs in invertebrate and displays various biological functions. For
example, in the horseshoe crab Tachypleus tridentatus,
LPS and b-1,3-glucan both bind specifically to LGBP, and
then the coagulation cascade is activated [7, 8]. In addition,
the opsonic effect [9] and degranulation of blood cells by
the b-1,3-glucan-binding protein in the freshwater crayfish
Pacifastacus leniusculus, the opsonic effect of the LPSbinding protein in the cockroach Periplaneta americana
[10], and the hemocyte nodule formation by the LPSbinding protein in the silkworm Bombyx mori [11] have
already been reported as special biological properties of
pattern recognition receptors.
At present, the studies about LGBPs are mainly focused
on arthropods, and several LGBPs have been cloned and
characterized from Chinese shrimp Fenneropenaeus chinensis [12, 13], kuruma shrimp Marsupenaeus japonicus
[14], white shrimp Litopenaeus vannamei [15], tobacco
hornworm Manduca sexta [16], earthworm Eisenia foetida
[17] and freshwater crayfish P. leniusculus [18], and
demonstrated that LGBP played an important function in
the innate immune recognition. Recently, zhikong scallop
Chlamys farreri LGBP and disk abalone Haliotis discus
discus HdPRP were characterized and their expression
pattern in different tissues and stress condition also were
investigated [19, 20]. However, there are very few LGBP
genes characterized from bivalve mollusks so far, and
whether bivalve LGBP functions as arthropod LGBP in the
innate immune response still remain unclear. Moreover, to
our knowledge, there is no information about gene characterization or gene expression of pearl oyster PRPs.
Therefore, to further understand the function of bivalve
PRPs in the innate immune response, it is necessary to
clone and characterize more PRP genes from bivalve
mollusks. In the present study, we cloned and characterized

123

Mol Biol Rep (2010) 37:33353343

the lipopolysaccharide and b-1,3-glucan-binding protein

(designated as poLGBP) from pearl oyster, and its
expression pattern in different tissues and LPS or bacteria
stimulation condition also were investigated. The results
demonstrated that the poLGBP mRNA was specifically
expressed in digestive gland and its expression was significantly up-regulated after LPS or bacteria stimulation,
the poLGBP might play an important function in digestion
and immunity as digestive enzyme and pattern recognition
receptor.

Materials and methods

Pearl oyster and immune challenge
Pearl oyster P. fucata (shell length 5.236.35 cm, body
weight 18.225.6 g) were obtained from pearl oyster culture base of South China Sea Fisheries Research Institute in
Xincun village, Hainan province, China and maintained at
2628C in tanks with the recirculating seawater for
1 week before experiment. The pearl oyster were fed twice
daily on Tetraselmis suecica and Isochrysis galbana. The
experiment contained three groups: the PBS group, the LPS
stimulation group and bacterial challenge group, each
group was divided into three replicates. Five individuals of
each replicate were randomly sampled at the same time
point, which were pooled together as one sample.
The LPS stimulation group was performed by injecting
with 50 ll of LPS dissolved in PBS (LPS 10 lg ml-1) into
the adductor muscles of each pearl oyster. The bacterial
challenge group was performed by injecting with 50 ll of
Vibrio alginolyticus resuspended in PBS to OD600 = 0.4
(1 OD = 5 9 108 bacteria ml-1) into the adductor muscles
of each pearl oyster. The PBS group was injected with 50 ll
of PBS. At the each time point (0, 2, 4, 8, 12 and 24 h), the
digestive gland and gills from the PBS group, the LPS
stimulation group and the bacterial challenge group were
collected and stored in liquid nitrogen for RNA extraction.
For tissue expression patterns of poLGBP, haemocytes,
gills, digestive gland, mantle, gonad, muscle and intestine
were collected respectively from three apparently healthy
pearl oysters and three pearl oysters injected with 50 ll of
V. alginolyticus at 8 h, and stored in liquid nitrogen until
used. Total RNA samples were extracted using the TRIzol
reagent (Invitrogen) according to the manufactures
instructions.
cDNA library construction and EST analysis
A cDNA library was constructed from the whole body of a
pearl oyster challenged by V. alginolyticus, using the ZAPcDNA synthesis kit and ZAP-cDNA GigapackIII Gold

Mol Biol Rep (2010) 37:33353343

3337

cloning kit (Stratagene). Random sequencing of the library

using T3 primer yielded 6,741 successful sequencing
reactions. BLAST analysis of all the EST sequences
revealed that an EST of 510 bp (pmpca0_008043) was
homologous to the PRPs of pacific oyster Crassostrea
gigas (BAG82629) and disk abalone Haliotis discus discus
(ABO26613). This EST was selected for further cloning of
the LGBP gene of pearl oyster.
Cloning the full-length cDNA of poLGBP
Based on the identified EST sequence, two gene-specific
primers LGBP-F1 and LGBP-R1 (Table 1) were designed
to amplify the full-length cDNA of poLGBP by rapid
amplification of cDNA ends (RACE) technique. To obtain
50 -end of the poLGBP cDNA, PCR reaction was performed
in a T-1 Thermocycler (Biometra) by using the T3 and
LGBP-R1 primers (Table 1) in a 25 ll of reaction volume,
containing 2.5 ll of 10 9 PCR buffer, 1.5 ll of MgCl2
(25 mmol l-1), 2.0 ll of dNTP (2.5 mmol l-1), 1 ll of
each primer (10 lmol l-1), 15.8 ll of double-distilled
water, 0.2 ll (1.0 U) of Ex Taq (TaKaRa) and 1 ll of 100fold diluted cDNA library as template. The cycle condition
was one initial denaturation cycle of 94C for 2 min, then
35 PCR cycles of 94C for 20 s, 59.5C for 30 s, 72C for
1.5 min, and a final extension step at 72C for 5 min. PCR
amplification of 30 -end of the poLGBP was carried out
using the T7 and LGBP-F1 primers (Table 1), the PCR
cycling conditions were similar to those previously described. The PCR products were separated by agarose gel
(1.2%) electrophoresis, and then the bands were excised and
purified using a DNA Gel Extraction Kit (KeLi, China).
Finally, the purified DNA fragments were cloned into the
pMD18-T vector (TaKaRa) and sequenced.
Sequence analysis of poLGBP
The poLGBP amino acid sequence was predicted using DNA
Tool version 6.0 software. The percentage of similarity and
identity of the known LGBP sequences was calculated using
Table 1 Primers used in this
study

the MatGAT program [21] with default parameters. The

protein domain was predicted with the simple modular
architecture research tool (SMART) version 4.0 program
[22, 23] (http://www.smart.emblheidelberg.de/) and ScanProsite (http://expasy.org/tools/). The protein sequence of
the poLGBP was compared to its counterpart sequences
currently available in GenBank using the BLAST program
[24] (http://www.ncbi.nlm.nih.gov). Multiple alignment of
poLGBP was carried out with the ClustalW program (http://
www.ebi.ac.uk/clustalw/). The phylogenetic tree was constructed with MEGA program version 4 [25] based on amino
acid sequences alignment. The phylogenetic tree was tested
for reliability using 1,000 bootstrap replications.
Quantitative real-time RTPCR analysis of poLGBP
For the tissue distribution analysis, total RNA was
extracted from haemocytes, gills, digestive gland, mantle,
gonad, intestines and adductor muscle of three healthy
pearl oysters and three challenged pearl oysters respectively. For the temporal expression analysis, total RNA was
extracted from the above mentioned digestive gland and
gills using Trizol reagent (Invitrogen). Subsequently, the
first-strand cDNA was synthesized based on manufactures
instruction of PrimerScriptTM 1st Strand cDNA Synthesis
Kit (TaKaRa) using the DNase I (Promega)-treated total
RNA as template and adaptor-dT primer (Table 1). cDNA
mix was diluted to 1:5 and stored at -80C for subsequent
quantitative real-time RTPCR.
Two poLGBP gene-specific primers, LGBP-F and LGBPR (Table 1), were designed to amplify a product of 318 bp. A
housekeeping gene, the ribosomal protein L37 (designated as
poRPL37), was used as the internal control to verify the RT
PCR reaction and adjust the cDNA templates. The poRPL37
gene (FJ763349) was identified as an EST sequence (EST no.
pmpca 0_006273) from the cDNA library of pearl oyster. This
EST sequence was 342 bp long and showed significant
similarity (Score = 162; Expect = 8e-39; Identities = 85%)
to Artemia franciscana ribosomal protein L37 gene (ACB05775). Two poRPL37 gene-specific primers RPL37-F

Primer name

Sequence (50 30 )

Application

LGBP-F1

GAATTTGAATACTACACTAAC

For RACE PCR

LGBP-R1

TCACCAAATCTGTCGGCAGTAAG

LGBP-F

GTCACGATGGCAAGCTCTTC

LGBP-R

CAGGCCAAGTACCGTAAGCA

RPL37-F

CCAAGAAGGTTGGAATTGTG

RPL37-R

TCCCTCAATCTTCTGACTGC

For real-time RT- PCR

Adaptor-dT

GGCCACGCGTCGACTAGTACT17

For reverse transcription

T3

AATTAACCCTCACTAAAGGG

For sequencing and RACE PCR

T7

GTAATACGACTCACTATAGGGC

123

3338

and RPL37-R (Table 1) were designed on the basis of

pmpca0_006273 sequence to amplify a 250-bp fragment of
pearl oyster poRPL37 gene.
The quantitative real-time RTPCR was performed in a
total volume of 20 ll containing 10 ll of 2 9 SYBR
Green Real-time PCR Master Mix (TaKaRa), 1 ll of
cDNA, 0.4 ll of each primer and 8.2 ll of double-distilled
water. Quantitative real-time RTPCR program consisted
of denaturation step at 95C for 5 min, followed by 40
amplification cycles of 20 s denaturation at 95C, 10 s
annealing at 55C, 30 s extension at 72C. Dissociation
curve analysis of amplification products was performed at
the end of each PCR reaction to confirm that only one PCR
product was amplified and detected. After the PCR program, data were analyzed with the Realplex2 software
(Eppendorf). To maintain consistency, the baseline was set
automatically by the software. The comparative CT
method (2-DDCT method) was used to analysis the poLGBP
mRNA expression level. The CT for the target amplified
poLGBP and the CT for the internal control RPL37 were
determined for each sample. Differences in the CT for the
target and the internal control, called DCT, were calculated
to normalize the differences in the amount of total cDNA
added to each reaction and the efficiency of the RTPCR.
The control group was used as the reference sample, called
the calibrator. The DCT for each sample was subtracted
from the DCT of the calibrator, the difference was called
DDCT. The poLGBP mRNA expression level could be
calculated by 2-DDCT, and the value stood for an n-fold
difference relative to the calibrator.
Statistical analysis
Statistical analysis was carried out with commercially
available statistical software (GraphPad Prism 5.0,
GraphPad Software). The data were given in terms of relative mRNA expressed as mean S.E. (n = 3). Differences between groups were considered significant at
P \ 0.05.

Results
cDNA cloning and characterization of poLGBP
Random sequencing of the pearl oyster cDNA library with
T3 primer (Table 1) yielded 6,741 EST sequences, which
were clustered into 808 contigs and 2,456 singlets.
BLASTX analysis showed that a 510 bp fragment (EST no.
pmpca0_008043) was homologous to the PRPs of pacific
oyster (BAG82629) and disk abalone [20]. Based on the
sequence of this EST, two gene-specific primers (LGBP-F1
and LGBP-R1) (Table 1) were designed to amplify the

123

Mol Biol Rep (2010) 37:33353343

full-length poLGBP cDNA, and two fragments of 1,250

and 920 bp were amplified by 30 -RACE and 50 -RACE
respectively. A 2,075 bp nucleotide sequence representing
the complete poLGBP cDNA was obtained by overlapping
the two fragments amplified above with the EST sequence.
The poLGBP sequence was deposited in GenBank under
accession no. FJ775601.
The complete sequence of the poLGBP cDNA consisted
of a 50 -untranslated region (UTR) of 18 bp, an open
reading frame (ORF) of 1,758 bp encoding a polypeptide
of 585 amino acids with an estimated molecular mass of
65.1 kDa and a theoretical isoelectric point of 5.80, and a
30 -UTR of 299 bp with and a typic canonical polyadenylation signal sequence (AATAAA), a 22 bp poly (A) tail
and one cytokine RNA instability motif (ATTTA) (data not
shown). SignalP 3.0 analysis revealed that a signal peptide
cleavage site was predicted between A21 and M22. SMART
analysis showed that the amino acid region from 299 to 502
belonged to the glycoside hydrolase family 16. Furthermore, the poLGBP contained a b-1,3-glucanase site with
active residues of W (Trp), E (Glu), I (Ile) and D (Asp) at
positions of 387, 392, 393 and 394, respectively. Motif
scan analysis showed that the poLGBP contained a threonine-rich region between 118 and 154, and a glycine-rich
region between 163 and 221. The poLGBP contained a
protein kinase C phosphorylation site (S343AK345), a
modified cell adhesive site (K367GD369). Moreover, similar
to disk abalone HdPRP sequence [20], a polysaccharidebinding motif (R362AKMPKGDWLWPAIWLLP379), a
LPS-binding site (K402DYHDPNGKSLGVDSFGST420)
and a b-1,3-linkage recognition motif of polysaccharides
(F450HTWVMIWDEQHINISFEG468) also were found in
the poLGBP sequence. Two potential N-linked glycosylation sites were identified at positions N277RS279 and
N463IS465 (data not shown).
Alignments and phylogenetic analysis of the poLGBP
Multiple alignment of the poLGBP with other known different PRP amino acid sequences, including BGBP, LGBP,
GNBP, BGRP and CCF-like protein, revealed the strong
amino acid conservation in the glycoside hydrolase domain
(data not shown). The poLGBP had the highest identity
(56.7%) to pacific oyster b-glucan recognition protein 1
(BAG82629), and shared 40.570.9% similarity and 26.3
56.7% identity to the other known PRP sequences
(Table 2). Using representative invertebrate PRP sequences, the phylogenetic tree was reconstructed by the
neighbor-joining method based on the multiple alignment
built with Clustal W. As shown in Fig. 1, insect GNBP
were grouped into one cluster, crustacean BGBP and
LGBP were grouped into one cluster, and insect BGRP
were grouped into another cluster. The poLGBP was

Mol Biol Rep (2010) 37:33353343

3339

Table 2 Homology analysis of poLGBP amino acid sequence with other known PRP amino acid sequences determined by MatGat software
Title

Species

Accession number

Similarity (%)

Identity (%)

Amino acids

cgBGRP

Crassostrea gigas

BAG82629

70.9

56.7

555

hdBGRP

Haliotis discus discus

ABO26613

52.3

38.3

420

cfLGBP

Chlamys farreri

AAP82240

50.6

39.3

440

bgBGRP

Biomphalaria glabrata

ABL63380

50.1

39.2

393

agGNBP

Anopheles gambiae

ABU80037

48.4

34.8

395

aaGNBP

Aedes aegypti

EAT38985

45.8

33.8

386

pmBGRP

Penaeus monodonbeta

AAM21213

44.6

32.4

366

bmBGR

Bombyx moribeta

NP_001036840

44.3

28.8

495

lvBGRP

Litopenaeus vannameibeta

AAW51361

44.1

31.8

367

mjBGRP

Marsupenaeus japonicusbeta

BAD36807

43.9

32.9

366

plLGBP
dvCCF

Pacifastacus leniusculus
Dendrobaena veneta

CAB65353
AAY85745

41.9
40.5

30.8
26.3

361
384

grouped into the PRPs identified from other mollusk species, pacific oyster BGRP, zhikong scallop LGBP, freshwater snail BGRP and disk abalone LGBP. The poLGBP
was sub-grouped with zhikong scallop LGBP and pacific
oyster BGRP with a high bootstrap value. Interestingly, the
GNBP of mollusk freshwater snail (ABO40828) was not
positioned within the same mollusk cluster and was
grouped with annelids CCF-like proteins.
poLGBP mRNA expression profile in different tissues
Quantitative real-time RTPCR analysis was employed to
quantify the poLGBP mRNA expression in gills, digestive
gland, mantle, gonad, adductor muscle, intestine and haemocytes. The specific amplification for the poLGBP and
RPL37 was determined by analyzing the dissociation
curves. Only one peak presented in the dissociation curves
for both the poLGBP and RPL37, demonstrated that the
amplifications were specific. As showed in Fig. 2, in the
healthy pearl oysters, the poLGBP mRNA was specifically
expressed in digestive gland, and the expression of the
poLGBP mRNA was not detected in gills, mantle, adductor
muscle, intestine, gonad and haemocytes. In the challenged
pearl oysters, the expression level of the poLGBP mRNA
was significantly up-regulated in digestive gland, the
expression of the poLGBP mRNA were also weakly
detected in haemocytes, gonad and intestine, but still not
detected in gills, mantle and adductor muscle.
Temporal expression of poLGBP after LPS stimulation
The temporal expression of the poLGBP mRNA in digestive gland and gills after LPS stimulation was researched
by quantitative real-time RTPCR and the results were
shown in Fig. 3. In digestive gland, after 2 h LPS stimulation, the poLGBP mRNA expression was gradually up-

regulated, the expression level was significantly different

between the PBS group, and LPS stimulation groups at 8
and 12 h after LPS stimulation, and the highest expression
was observed at 12 h after LPS stimulation and was 10.7fold higher than the PBS group, then after that time point,
the expression level of the poLGBP became down-regulated and returned to the similar expression level with the
control at 24 h after LPS stimulation (Fig. 3). In gills,
during the experiment, the poLGBP mRNA expression was
not detected (data not shown).
Similar to LPS stimulation, the expression of the poLGBP gene in digestive gland was also time-independent
after V. alginolyticus challenge (Fig. 4). At 4 h after
V. alginolyticus challenge, the expression of the poLGBP
gene increased gradually, and reached the peak at 8 h. The
expression level of poLGBP gene was 12.9-fold higher
than the relevant PBS group at 8 h. After 8 h, the poLGBP
expression dropped gradually. The statistical analysis
indicated that the expression of the poI-jB gene at 4, 8, 12
and 24 h after V. alginolyticus challenge had significant
difference (P \ 0.05) compared to the relevant PBS group.
In gills, during the experiment, the poLGBP mRNA
expression was also not detected (data not shown).

Discussion
In the present study, the LGBP cDNA was cloned and
characterized from pearl oyster and its mRNA expression
pattern in different tissues and LPS stimulation condition
also was investigated. The poLGBP cDNA was 2,075 bp
long, including an 18 bp 50 -UTR, a 299 bp 30 -UTR, and an
1,758 bp ORF encoding a 585 amino acid polypeptide. The
poLGBP polypeptide was found to be longer than other
known LGBPs in the upstream part, this part contained a
threonine-rich region and a glycine-rich region, this

123

3340

Mol Biol Rep (2010) 37:33353343

Fig. 1 A phylogenetic tree of poLGBP with 28 other invertebrate

PRR species was reconstructed by the neighbour-joining method. The
tree is based on an alignment corresponding to full-length amino acid
sequences, using ClustalW and MEGA 4.0. The number shown at the
branches denote the bootstrap majority consensus values of 1,000
replicates. The GenBank accession numbers for the sequence
designations are as follows: Anopheles merus GNBP, ABU80009;
Anopheles quadriannulatus GNBP, ABU80018;Anopheles gambiae
GNBP, ABU80037;Aedes aegypti GNBP, EAT38985;Culex quinquefasciatus GNBP, XP_001845963; Mastotermes darwiniensis GNBP1,
AAZ08492; Nasutitermes longipennis GNPB1, AAZ08485; Tumulitermes pastinator GNBP1, AAZ08490; Biomphalaria glabrata BGRP,
ABL63380; Haliotis discus discus BGRP, ABO26613; Chlamys

farreri LGBP, AAP82240; Pinctada fucata LGBP, FJ775601;

Crassostrea gigas BGRP, BAG82629; Pacifastacus leniusculus
LGBP, CAB65353; Homarus gammarus BGRP, CAE47485; Marsupenaeus japonicus BGRP, BAD36807; Marsupenaeus japonicus
LGBP, ABY89089; Penaeus monodon BGRP, AAM21213; Fenneropenaeus chinensis LGBP, AAX63902; Litopenaeus vannamei
BGRP, AAW51361; Litopenaeus vannamei LGBP, ABU92557;
Biomphalaria glabrata GNBP ABO40828; Aporrectodea rosea
CCF-like protein, AAY85744; Lumbricus rubellus CCF-like protein,
AAY85746; Dendrobaena veneta CCF-like protein, AAY85745;
Bombyx mori BGRP, NP_001036840; Galleria mellonella BGRP,
CAK22401; Manduca sexta BGRP, AAN10151; Plodia interpunctella BGRP, AAM95970

difference of structure maybe imply variance in the functions. RGD (ArgGlyAsp) motif was a putative cell
adhesive site [26], which existed in some crustacean
LGPBs [13, 14, 27]. However, there was no RGD motif in
zhikong scallop LGBP [19] and disk abalone HdPRP [20],
the poLGBP also didnt contain RGD motif, but the

modified KGD was found at position 367 compared with

shrimp PRP sequences. A conserved potential recognition
motif for
b-1,3-linkage of polysaccharide was observed in the poLGBP at position of 450468, the amino acid sequence of
this motif was slightly modified in the blue shrimp Penaeus

123

PoLGBP expression relative to RPL37

3341

3.5
3.0
Blank
2.5
Stimulation
2.0
1.5
1.0
0.5

e
In
t

es
tin

A
M

ad
on
G

M
an
t

ill
s

le

H
e

0.0
D
G

PoLGBP expression relative to RPL37

Mol Biol Rep (2010) 37:33353343

Tissues

PoLGBP expression relative to RPL37

Fig. 2 Expression level of the poLGBP mRNA in different tissues.

Quantitative real-time RTPCR was carried out with RNA samples
from digestive gland (DG), gills, mantle, adductor muscle (AM),
gonad, intestine and haemocytes of the adult tissues of pearl oyster.
The pearl oyster RPL37 gene was used as an internal control to
calibrate the cDNA template for all the samples. Vertical bars
represented the mean S.E (N = 3)

***

20
PBS
LPS

15

10

*
5

0
0

12

24

Time (hours)

Fig. 3 Real-time RTPCR analysis of the poLGBP expression level

after LPS stimulation in digestive gland. The poLGBP mRNA
expression in LPS treated samples was normalized to that in the PBS
group. In this experiment, the pearl oyster RPL37 gene was used as an
internal control to calibrate the cDNA template for all the samples.
Vertical bars represented the mean S.E (N = 3). Significant
differences were indicated with the asterisk (** represented
P \ 0.01; *** represented P \ 0.001)

stylirostris [28], white shrimp L. vennamei [15] and crayfish P. leniusculus [18]. A LPS-binding site also was
observed in the poLGBP, which was similar to the zhikong
scallop LGBP [19]. The carbohydrate recognition domains
in the scallop might facilitate the interaction of immunocytes with the pathogen and subsequently induce cellular
defenses [19].

25

***

PBS
V. alginolyticus

20

15

***

10

0
0

12

24

Time (hours)

Fig. 4 Real-time RTPCR analysis of the poLGBP expression level

after bacteria stimulation in digestive gland. The poLGBP mRNA
expression in LPS treated samples was normalized to that in the PBS
group. In this experiment, the pearl oyster RPL37 gene was used as an
internal control to calibrate the cDNA template for all the samples.
Vertical bars represented the mean S.E (N = 3). Significant
differences were indicated with the asterisk (** represented
P \ 0.01; *** represented P \ 0.001)

It was generally believed that the invertebrate LGBP

genes might have evolved from bacterial glucanase and lost
the glucanase activity during evolution, but retained the
glucan-binding properties and therefore played a role in
innate immune response [18]. However, recently, Pauchet
and coworkers identified a 40 kDa b-1,3-glucan-binding
protein from midgut of lepidopteran, which was similar to
previously characterized lepidopteran bGRPs from hemolymph, and demonstrated that this bGRP was an active
b-1,3-glucanase and was mainly expressed in midgut, this
type of PRP was named as catalytic PRP [29]. At present, a
similar glucanase domain with the conserved active sites has
also been observed in the kuruma shrimp LGBP [14],
earthworm LGBP [17], zhikong scallop LGBP [19] and disk
abalone HdPRP [20]. In this present study, SMART analysis
revealed that the poLGBP also had a glucanase motif with the
conserved active sites, similar to the lepidopteran bGRP
[29], the poLGBP might also be an active glucanase.
It was extremely important to detect the tissue-specific
expression pattern of LGBP gene in order to understand its
functions. The previous studies demonstrated that the LGPB
was expressed in tissue-specific pattern. The kuruma shrimp
LGBP was expressed specifically in hemocyte, but not
detected in gills, hepatopancreas, muscle, eyestalk and
intestine [14]. The fleshy prawn LGBP was mainly expressed in hemocyte, and very low transcripts also was detected
in hepatopancreas and gills, but not detected in heart,
stomach and intestine [15]. In the present study, the poLGBP
mRNA were specifically expressed in digestive gland, but
not detected in gills, mantle, adductor muscle, intestine,
hemocyte and gonad. However, after bacterial stimulation,

123

3342

the expression level of the poLGBP mRNA was significantly

up-regulated in digestive gland, and the expression of the
poLGBP mRNA was weakly detected in haemocytes, gonad
and intestine. It has been demonstrated that some LGBP and
bGRP possessed the glucanase activity and played an
important function in digestion [29], the tissue-specific
expression pattern of the poLGBP in digestive gland might
imply its important functions in digestion.
To further understand the possible biological function of
the poLGBP, its temporal expression pattern was quantified
at different time point after LPS or bacteria stimulation in
digestive gland and gills. The gills represent the main
interface between aquatic organisms and the external
environment, bivalve mollusk gills are one of the first lines
against bacterial infection [30]; the digestive gland of
mollusk could secrete various enzymes to hydrolyze
microorganisms and involve in digestive and defense
functions [31]. So we selected the gills and digestive gland
to research the temporal expression pattern of poLGBP
after LPS or bacteria simulation. In gills, during the
experiment, the poLGBP mRNA expression all was not
detected. However, in digestive gland, after 2 h LPS
stimulation, the poLGBP mRNA expression was gradually
up-regulated, the expression level was significantly different between the PBS group and LPS stimulation groups
at 8 and 12 h after LPS stimulation, and was 10.7-fold
higher than the PBS group at 12 h. After bacteria stimulation, the expression level of the poLGBP mRNA was also
significantly up-regulated and was 12.9-fold higher than
the PBS group at 8 h. As the main structure component of
most Gram-negative bacteria outer membrane and potent
stimulator of proinflammatory cytokines [32, 33], LPS
could significantly up-regulated the mRNA level of LGBPs
in several marine invertebrates, including kuruma shrimp
[14], crayfish [18] and disk abalone [20]. The remarkable
up-regulation in digestive gland suggested that the poLGBP could be effectively induced by LPS or bacteria and
strong transcripts of the poLGBP took place to recruit the
proteins in response infection.
Acknowledgments We are grateful to all the laboratory members
for their technical advice and helpful discussions. This research was
supported by the major science and technology projects of Guangdong (A200701C02; 2008A020100004), national sci-tech platform
projects (2005DKA30470) and central institutes of public welfare
projects (ZD-02; 2009TS23).

References
1. Wu X, Pan J (1999) Studies on rickettsia-like organism disease of
the tropical marine pearl oyster I: the fine structure and morphogenesis of pinctada maxima pathogen rickettsia-like organism. J Invertebr Pathol 73(2):162172

123

Mol Biol Rep (2010) 37:33353343

2. Lau KW, Ren J, Wai NL, Lau SC, Qian PY, Wong PK, Wu M
(2006) Marinomonas ostreistagni sp. nov., isolated from a pearloyster culture pond in Sanya, Hainan Province, China. Int J Syst
Evol Microbiol 56(10):22712275
3. Wang AM, Shi YH, Wu X (2004) The comparison among effects
of four treatments to reduce polychaete infestation in pearl oyster,
Pinctada martensi. Mar Fish Res 25(2):4146
4. Iwanaga S, Lee BL (2005) Recent advances in the innate
immunity of invertebrate animals. J Biochem Mol Biol 38(2):
128150
5. Medzhitov R, Janeway CA Jr (1997) Innate immunity: the virtues
of a nonclonal system of recognition. Cell 91:295298
6. Janeway CA Jr, Medzhitov R (2002) Innate immune recognition.
Annu Rev Immunol 20:197216
7. Muta T, Miyata T, Misumi Y, Tokunaga F, Nakamura T, Toh Y,
Ikehara Y, Iwanaga S (1991) Limulus factor C: an endotoxinsensitive serine protease zymogen with a mosaic structure of
complement-like, epidermal growth factor-like, and lectin-like
domains. J Biol Chem 266(10):65546561
8. Seki N, Muta T, Oda T, Iwaki D, Kuma K, Miyata T, Iwanaga S
(1994) Horseshoe crab (1,3)-h-D-glucan sensitive coagulation
factor G. A serine protease zymogen heterodimer with similarities to b-glucan-binding proteins. J Biol Chem 269(2):13701374
9. Cerenius L, Liang Z, Duvic B, Keyser P, Hellman U, El Palva T,
Iwanaga S, Soderhall K (1994) Structure and biological activity
of a 1,3-beta-D-glucan-binding protein in crustacean blood. J Biol
Chem 269(47):2946229467
10. Jomori T, Natori S (1992) Function of the lipopolysaccharidebinding protein of Periplaneta americana as an opsonin. FEBS
Lett 296(3):283286
11. Johansson MW (1999) Cell adhesion molecules in invertebrate
immunity. Dev Comp Immunol 23(45):303315
12. Liu F, Li F, Dong B, Wang X, Xiang J (2009) Molecular cloning
and characterization of a pattern recognition receptor, lipopolysaccharide and beta-1,3-glucan binding protein (LGBP) from
Chinese shrimp Fenneropenaeus chinensis. Mol Biol Rep 36(3):
471477
13. Du XJ, Zhao XF, Wang JX (2007) Molecular cloning and characterization of a lipopolysaccharide and b-1,3-glucan binding
protein from fleshy prawn (Fenneropenaeus chinensis). Mol
Immunol 44:10851094
14. Lin YC, Vaseeharan B, Chen JC (2008) Identification and phylogenetic analysis on lipopolysaccharide and b-1,3-glucan binding protein (LGBP) of kuruma shrimp Marsupenaeus japonicus.
Dev Comp Immunol 32(11):12601269
15. Cheng W, Liu CH, Tsai CH, Chen JC (2005) Molecular cloning and
characterization of a pattern recognition molecule, lipopolysaccharide- and beta-1,3-glucan binding protein (LGBP) from the
white shrimp Litopenaeus vannamei. Fish Shellfish Immunol
18(4):297310
16. Yu XQ, Zhu YF, Ma C, Fabrick JA, Kanost MR (2002) Pattern
recognition receptors in Manduca sexta plasma. Insect Biochem
Mol Biol 32(10):12871293
17. Bilei M, De Baetselier P, Van Dijck E, Stijlemans B, Colige A,
Beschin A (2001) Distinct carbohydrate recognition domains of an
invertebrate defense molecule recognize Gram-negative and
Gram-positive bacteria. J Biol Chem 276(49):4584045847
18. Lee SY, Wang R, Soderhall K (2000) A lipopolysaccharide- and
beta-1,3-glucan-binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization, and cDNA cloning. J Biol Chem 275(2):13371343
19. Su JG, Song LS, Xu W, Wu LT, Li HL, Xiang JH (2004) cDNA
cloning and mRNA expression of the lipopolysaccharide- and
beta-1,3-glucan-binding protein gene from scallop Chlamys
farreri. Aquaculture 239:6980

Mol Biol Rep (2010) 37:33353343

20. Nikapitiya C, De Zoysa M, Lee J (2008) Molecular characterization and gene expression analysis of a pattern recognition
receptor from disk abalone, Haliotis discus discus. Fish Shellfish
Immunol 25:638647
21. Campanella JJ, Bitincka L, Smalley J (2003) MatGat: an application that generates similarity/identity matrices using protein or
DNA sequences. BMC Bioinformatics 4(29):14
22. Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a
simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci USA 95:58575864
23. Letunic I, Copley RP, Pils B, Pinkert S, Schultz J, Bork P (2006)
SMART 5: domains in the context of genomes and networks.
Nucleic Acids Res 34:257260
24. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller
W et al (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res
25:33893402
25. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular
evolutionary genetics analysis (MEGA) software version 4.0.
Mol Biol Evol 24:15961599
26. Johansson MW (1999) Cell adhesion molecules in invertebrate
immunity. Dev Comp Immunol 23(45):303315
27. Padhi A, Verghese B (2008) Detecting molecular adaptation at
individual codons in the pattern recognition receptor, lipopolysaccharide- and b-1,3-glucan-binding protein of decapods. Fish
Shellfish Immunol 24:638648

3343
28. Roux MM, Pain A, Klimpel KR, Dhar AK (2002) The lipopolysaccharide and beta-1,3-glucan binding protein gene is upregulated in white spot virus infected shrimp, Penaeus stylirostris. J Virol 71407149
29. Pauchet Y, Freitak D, Heidel-Fischer HM, Heckel DG, Vogel H
(2009) Immunity or digestion: glucanase activity in a glucanbinding protein family from Lepidoptera. J Biol Chem 284(4):
22142224
30. Lichtenfels AJ, Lorenzi-Filho G, Guimaraes ET, Macchione M,
Saldiva PH (1996) Effects of water pollution on the gills apparatus of fish. J Comp Pathol 115:4760
31. Tiscar PG, Mosca F (2004) Defense mechanisms in farmed
marine mollusks. Vet Res Commun 28:5762
32. Chappell VL, Le LX, LaGrone L, Mileski WJ (2000) STAT
proteins play a role in tumor necrosis factor alpha gene expression. Shock 14:400403
33. Marrack P, Kappler J (1988) T cells can distinguish between
allogeneic major histocompatibility complex products on different cell types. Nature 332:840843

123

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.