Tissue Engineering and Regenerative Medicine, Vol. 2, No.

4, pp 347-355 (2005)

The Re-Expression of Collagen Type II, Aggrecan and

Sox 9 in Tissue-Engineered Human Articular Cartilage
Munirah Sha'ban , Aminuddin Bin Saim , Samsudin Osman Cassim , Chua Kien Hui ,
Fuzina Nor Hussein , and Ruszymah Bt Hj Idrus *
1,2

2,3

1,2

1,2,

Department of Physiology, Faculty of Medicine, Universiti Kebangsaan Malaysia,

Jalan Raja Muda Abdul Aziz, 50300 Kuala Lumpur, Malaysia
2
Tissue Engineering Laboratory, National University of Malaysia Hospital
3
Ear Nose and Throat Consultant Clinic, Ampang Puteri Specialist Hospital, Malaysia
4
Department of Orthopaedic and Traumatology, Faculty of Medicine, National University of Malaysia
5
Animal House Units, Institute for Medical Research, Malaysia
1

(Received: Jun. 22, 2005; Accepted: Jul. 7, 2005)

Abstract : This study was designed to verify the optimal basic culture media that promote chondrocytes prolifer-

ation in vitro in order to facilitate adequate amount of chondrocytes for cartilage reconstructionas well as maintaining cartilage specific phenotype. Human articular chondrocytes were cultured in three types of basic culture media
Ham's F12, DMEM and the equivalent mixture of F12:DMEM. Cultured chondrocytes were trypsinized as they
reached confluency. The viability and total number of cell were recorded at every passage. Large-scale culture
expansion was used to reconstruct tissue-engineered cartilage. Quantitative RT-PCR analysis was used to evaluate
the expression of collagen Type II, collagen Type I, aggrecan and Sox 9 gene, both in monolayer culture and in the
engineered cartilage. The mixture of F12:DMEM promotes significantly greater (p<0.05) chondrocytes proliferation at every passage compared to the individual medium. Monolayer cultured chondrocytes exhibited down-regulation expression pattern of collagen Type II gene, aggrecan and Sox 9, whilst the expression of collagen Type I is
up-regulated. Tissue-engineered cartilage morphologically and histologically resembled normal hyaline cartilage.
Moreover, tissue-engineered cartilage re-expressed the specific chondrogenesis markers; collagen Type II, aggrecan
and Sox 9. In conclusion, the mixture of F12:DMEM enhanced human articular chondrocytes proliferation thus provided adequate amount of chondrocytes for cartilage reconstruction. The new cartilage formed phenotypically
resembles native cartilage. This results hold promise for the use of tissue-engineered cartilage implant for future
orthopaedic reconstructive surgery.

Keywords: Human articular cartilage, collagen type II, aggrecan, Sox 9, tissue engineering

response. Currently, autologous chondrocytes implantation

(ACI) are widely used to promote healing of symptomatic
joints surface defects in human patients. However, some
studies reported failure to repair the chondral defect.
Urgent needs for alternative treatment have motivated tissue-engineering studies to aim at
generation of cartilage replacement implant. Grafting of the tissue-engineered
cartilage is one of the early treatment proposed for chondral
defects. It is a challenge to construct tissue-engineered
cartilage for implantation with the properties of normal tissue that provide natural repairin which later integrate with
the adjacent tissues.
Ideally, tissue-engineered cartilage should contain appro2

1. Introduction

Adult articular cartilage is an avascular, aneural and alymphatic tissue presumed to be composed by a single type of
cells, the articular chondrocytes which are dispersed in an
abundant extracellular matrix, rich in proteoglycans and
collagen Type II. Articular cartilage covers the end of the
bones to give nearly frictionless surface during movement.
The inability of articular cartilage to repair is due to its
avascular nature and lack of inflammatory healing

3,4

5,6

in vitro

7,8

*Tel: +603-40405428; Fax: +603-26939687

e-mail: ruszy@medic.ukm.my

347

Munirah Sha'ban

et al.

consented patients (n=6) aged range between 20~70 years

old (average 49.7) after joint surgery carried out at the
National University of Malaysia Hospital (Table 1). Specimen was placed in normal saline and transported to the Tissue Engineering Laboratory, National University of Malaysia
Hospital. All specimens were processed within 6 to 12
hours after surgery. Specimen was washed with phosphate
buffered saline (PBS) (Gibco, Grand Island, NY) containing
100 /ml penicillin and 100 /ml streptomycin (Gibco).
Sample was then minced and digested with 0.6% collagenase Type II (Gibco) in an orbital incubator (Stuart Scientific, Redhill, UK) at 37 C for 6 hours for chondrocytes
isolation. Next, the cells suspension was centrifuged and the
pellet was washed with PBS to remove the remaining
enzyme. After final centrifugation, cells pellet was suspended in PBS for total cell count with haemacytometer
(Weber Scientific International, Ltd. Middlx, England). Cell
viability was determined using trypan blue dye exclusion
test (Gibco). Harvested chondrocytes were then seeded in 6
well-plates (Falcon, Franklin Lakes, NJ) with the initial
seeding of 5000 cells/cm . Each sample was expanded into
three experimental groups; chondrocytes were cultured
either in F12 medium (Ham's F12 Nutrient Mix) (Gibco),
DMEM (Dulbecco's Modified Eagle Medium) (Gibco) or
inthe mixture of equal volume of F12:DMEM. The media
were supplemented with 10% fetal bovine serum (FBS)
(Gibco), antibiotic and antimycotic (Gibco), 200 mM Lglutamine (Gibco), 50 g/ml of ascorbic acid (Gibco) and
HEPES buffer (Gibco). All cultures were maintained in 5%
CO incubator (Jouan, Duguay Trouin, SH) at 37 C with the
medium changed twice per week. Once confluence, the primary culture, P0 was trypsinized using trypsin-EDTA
(Gibco) and counted for total cell and viability. The cultures
were then passaged for three more times (P1, P2 and P3)
and grown in the same condition as the primary culture.

priate amounts of primary extracellular matrix components

such as aggregating proteoglycans and collagen Type II.
Type II collagen is crucial to the development of form in
vertebrates as it is the major protein of cartilage and giving
the extracellular matrix tensile strength and compressive
stiffness. Aggrecan interacts with a strand of hyaluronan
and the cartilage proteoglycan link protein to form large
supramolecular aggregates embedded and trapped in the
collageneous meshwork. In culture, isolated primary mammalian chondrocytes steadily lose the expression of the cartilage-specific genes such as those encoding collagens and
proteoglycans. However, the loss of chondrocytes differentiated characteristics
has been linked to the reduction of expression of chondrocyte-specific transcriptional
factors, principally Sox 9 that is essential for chondrocyte
differentiation and cartilage formation.
When preparing cartilage implant for clinical use,
increased cell growth rates and shorter culture periods are
clearly beneficial. Since only limited amount of autologous
cartilage can be harvested without causing morbidity at the
donor site, monolayer culture expansion is a crucial step as
the production of sufficient amount of chondrocytes is
required to form constructs of an appropriate size. The culture medium plays an important role in supporting chondrocytes growth and to provide phenotype stability of tissueengineered cartilage. Various types of basal culture media
have been used to provide the basic nutrient needed for
human chondrocytes culture. However, comparison on
which type of basic medium will promote better human
articular chondrocytes growth is still not reported. Thus, the
aim of this study was to determine the optimal basic culture
medium which enhances human articular chondrocytes proliferation
to provide an adequate amount of cultured
chondrocytes for cartilage construction. We reported here
the serial changes and morphological appearance of the cultured chondrocyte and the constructed tissue-engineered
cartilage considering the specific cartilage phenotypic
expression such as collagen Type II, aggrecan and Sox 9.
9

in vitro

10

11

in vitro

Description of the samples collected for the study.

Patient Age
Sex
Medical history
1 25 years old Male Compound comminuted fractures
(emergency trauma)
2 63 years old Female Joint arthroplasty (elective case)
3 38 years old Female Compound comminuted fractures
(emergency trauma)
4 55 years old Male Joint arthroplasty (elective case)
5 74 years old Male Total knee arthroplasty (OA)
6 43 years old Male Joint arthroplasty (elective case)

Table 1.

2. Materials and Methods

2.1. Harvest of cartilage, chondrocytes isolation and

monolayer culture
This study was approved by Research and Ethical Committee Faculty of Medicine, National University of Malaysia. Cartilage was obtained as an excessive tissue from

348

The Re-Expression of Collagen Type II, Aggrecan and Sox 9 in Tissue-Engineered Human Articular Cartilage

chondrocytes from tissue engineered cartilage using TRI

reagent (Molecular Research Center, Cincinnati, USA)
according to the manufacturer to build up a profile of the
changes in gene expression. Cell suspension in the TRI
reagent was centrifuged at 12,000 rpm, at 4 C for 5 minutes
by using the Jouan centrifuge (Jouan, Duguay Trouin, SH).
The supernatant was then transferred into a 15 mL tube
(Falcon, Franklin Lakes, NJ, USA). Chloroform was added
into the tube with the supernatant and was then vigorously
shaken for 10 seconds. After 10 minutes incubation at the
room temperature, the mixture was then centrifuged for 15
minutes at 4 C, 12,000 rpm which result in formation of
three layers that consist of RNA, protein layer, and DNA.
The resulted uppermost liquid phase, the RNA layer was
carefully transferred into another tube. Polyacryl carrier
(Molecular Research Center) was used to get the total RNA.
The expression of collagen Type II, collagen Type I, aggrecan and Sox 9 (Table 2) were evaluated by using quantitative RT-PCR technique with human GAPDH gene was used
as control. The quantitative RT-PCR protocol was performed in a Bio-Rad iCycler. The data were analyzed using
Bio-Rad iCycler software. The level of expression of each
target gene was normalized to GAPDH.

Total cell number and the viability were recorded for every
passage. The morphological features of cultured chondrocytes were examined everyday using inverted light microscope (Olympus, Shinjuku-ku, Tokyo) and recorded with
the attached camera (Olympus). The growth rate (cells/day/
cm ) and total number of cells doubling were calculated and
documented at every passage. Data was expressed as mean
standard error of the mean (SEM). Results were analyzed
using Student's t-test and the difference are considered significance when p<0.05.

12

2.2. Tissue-engineered cartilage reconstruction and

implantation

The best culture medium was selected for large-scale culture expansion. Human articular chondrocytes were cultured in T75 cm culture flasks (Falcon, Franklin Lakes, NJ,
USA) at a density of 5000 cells/cm . The confluenced cells
were harvested by trypsinization and an approximately 30.0
10 cells/mL will be incorporated with fresh human fibrin
as the biomaterial to form a three-dimensional construct.
This human fibrin is derived from patient's own plasma that
was extracted directly from patient's whole blood by 5 min,
4800 rpm centrifugation at 37 C. The resulting three-dimensional constructs were maintained for 3 weeks
prior
to subcutaneous implantation at the dorsum of nude mice.
After 8 weeks, tissue-engineered cartilage was dissected
free from nude mice, weighed and processed for histological analysis and gene expression evaluation.
2

in vitro

2.4. Macroscopic observation, histological evaluation

and immunohistochemistry analyses of tissue-engineered cartilage
Each construct was observed grossly at room temperature
without any fixation and palpated with forceps to clinically
assess mechanical rigidity by an observer who was blinded
to the protocol. Specimens were then prepared for standard
histological procedure. After fixation with 10% formalin for

2.3. RNA isolation and quantitative RT-PCR analyses

Total RNA was extracted from 1.0 10 fresh isolated

chondrocytes, chondrocytes at serial passages and isolated
5

Description of the primers used for quantitative RT-PCR analysis (iScriptTM One-Step RT-PCR Kit with SYBR Green).
Gene
Ref.No.
Primers 5' 3'
PCR product (bp)
GAPDH
NM-002046
*F: tccctgagctgaacgggaag
218
**R: ggaggagtgggtgtcgctgt
Collagen Type I
NM-000088
F: agggctccaacgagatcgagatccg
222
R: tacaggaagcagacagggccaacg
Collagen Type II
NIH GenBank
F: ctggcaaagatggtgagacaggtg
294
R: tcccggccagccaggtcc
Aggrecan
NIH GenBank
F: cactgttaccgccacttccc
165
R: accagcggaagtccccttcg
Sox 9
NM-000346
F: gcggaggaagtcggtgaaga
237
R: ccctctcgcttcaggtcagc

Table 2.

*F: forward (sense) primer; **R: reverse (anti-sense) primer

349

Munirah Sha'ban et al.

chondrocytes adhered and multiplied faster in equal mixture

of F12:DMEM compared to cultured chondrocytes in basic
media alone. Chondrocytes in primary culture (P0) reached
confluence within 2 to 3 weeks and remained polygonal in
shape. After several passages, the polygonal morphology of
the cultured chondrocytes changed to more fibroblastic-like.
Moreover, the cultures have a propensity to grow slower
and take longer time to reach confluence. At P3, the cultured chondrocytes are more elongated and bigger in size.

24 hours, specimens were embedded in paraffin block and

sectioned. Sections were stained with Haematoxylin and
Eosin to assess cells morphology and Safranin O to detect proteoglycans accumulation. For immunohistochemistry analyses, all section were deparaffinized and were assigned for
immunohistochemical staining according to DAKO Cytomation Immunohistochemistry staining kit protocol. All
section were pre-treated with proteinase K at 37oC for 60
minutes and washed 3 times with tris buffered saline (TBS)
(DAKO Cytomation). All sections were then treated with
peroxidase block (DAKO Cytomation) at 37oC for 10 minutes prior to incubation with the monoclonal antibody.
Monoclonal antibody mouse anti-human collagen Type II
(Sigma Aldrich) and monoclonal antibody mouse antihuman collagen Type I (Sigma Aldrich) were diluted with
antibody DILUENT (1:200) (DAKO Cytomation) and were
applied to the sections for 40 minutes at 37oC. After washing with TBS, the sections were applied with peroxidase
labelled polymer conjugated to goat anti-mouse Ig horseradish peroxidase (HRP) (DAKO Cytomation) for 40 minutes at 37oC. After washing step with TBS, the signal was
finally visualized as a brownish precipitate using the freshly
prepared peroxidase substrate 3,3'-diaminobenzidine (DAB)
(DAKO Cytomation). Sections were then counterstained
with Haematoxylin and mounted in glycerol gel (DAKO
Cytomation).

3.2. Growth kinetics study of human articular chondrocytes culture

Cells viability was greater than 92.0% at every passage
and there was no significance difference between the culture media tested. Interestingly, cultured chondrocytes in the
combination medium showed an encouraging result, as
F12:DMEM promotes significantly better growth rate for
every passage (Figure 1A) compared to both individual
basal media. At primary culture, the population doubling
time (PDT) for combination medium was 4.70.3 days
compared to F12, 6.20.2 days and DMEM, 5.80.2 days.
While at P1, combination medium promoted the shortest
doubling time in only 3.80.1 days compared to F12 and
DMEM, 7.20.2 days and 5.40.2 days each. The PDT for
all culture media were increased at P2 and reached 8.30.8
days for combination media, 15.91.3 days in F12 and
16.40.5 days in DMEM. Total number of cells doubling
(TCD) indicates the magnitude of chondrocytes expansion
in culture. In this study, chondrocytes cultured in the equal
combination media scored the highest TCD (10.30.3)
compared to F12 (7.90.2) and DMEM (8.80.2) (Figure
1B).

3. Results

3.1. Morphological changes in monolayer culture of

human articular chondrocytes
Daily macroscopic observation demonstrate that cultured

(a) F12: DMEM+10% FBS enhanced significantly higher (p<0.05*) growth rate compared to individual media F12 and
DMEM at every passage. (b) Total number of cell doubling (TCD) indicatingthe magnitude of chondrocytes expansion in culture, F12:
DMEM+10% FBS scored the highest TCD (10.30.3) and significantly difference (p<0.05*) from F12 (7.90.2) and DMEM (8.80.2).
Figure 1.

350

The Re-Expression of Collagen Type II, Aggrecan and Sox 9 in Tissue-Engineered Human Articular Cartilage

3.3. Macroscopic observation of tissue-engineered

human cartilage

After 3 weeks incubation

, all constructs consisting
chondrocytes-fibrin aggregate demonstrated stable form
of
tissue-engineered neocartilage implant. The
fibrin clot that we produced without the incorporation of
cultured cells served as an
control has degraded
within 2 weeks of
incubation in the culture medium.
After 8 weeks implantation, tissue-engineered cartilage
demonstrated white and glistening appearance resembling
normal hyaline cartilage. We also found that tissue-engineered cartilage was formed when palpated, resisting compression comparable to that of normal hyaline cartilage.
However, no implant was macroscopically retrieved when
dissecting the implantation site of the control implant which
was fibrin clot with no cell.

tative RT-PCR using human-specific primers. Cultured

chondrocytes in various culture media showed a similar
gene expression pattern of collagen Type I, collagen Type II,
aggrecan and Sox 9. The quantitative RT-PCR results (Figure
2) showed the expression of collagen Type II, aggrecan and
Sox 9 was reduced with passages (P0P3) whilst collagen
Type I was increasingly expressed.
tissue-engineered cartilage from serial passages demonstrates similar
gene expression pattern to that of cultured chondrocytes,
respectively. This result confirmed the loss of mature chondrocytic phenotype on serial passaging and the inability of
tissue engineered cartilage to spontaneously form
stable mature cartilage. Interestingly, the expression of Collagen Type II, aggrecan and Sox 9 is increased markedly in
the new developed
tissue engineered cartilage (construct), confirming a mature cartilage phenotype.

3.4. Gene expression of monolayer culture and tissue

engineered cartilage

3.5. Histological and immunohistochemical evaluation

of tissue engineered cartilage

in vitro

in

vitro

In

in vitro

in vitro

vitro

in vitro

in vivo

Histological evaluation of the

tissue engineered
cartilage showed no sign of lacunae or cartilage-isolated
cells on H&E staining. Besides, all
engineered tissue sections were negatively stained with Safranin O stain-

This study can be considered a chimerical experiment

where human tissues have been implanted into a mice host.
This offers the opportunity to selectively monitor gene
expression of human tissue within the mice tissue by quanti-

in vitro

in vitro

Histological evaluation of the

bioengineered cartilage: (a) this photomicrograph showed well-distributed lacunae cells
embedded in basophilic ground substance, [H&E 100]. (b) Neocartilage was avascular and homogenous with histochemicals properties consistent with the presence of proteoglycans; the differentiated product of chondrocytes and stained orange with Safranin O staining [100]. Immunohistochemical localization of collagen Type II (c) is positive presented as a brown precipitation around the
pericellular matrix of the lacunae and deposited throughout the matrix [100] whilst immunohistochemical localization of collagen
Type collagen Type I (d) revealed a positive distribution throughout extracellular matrix, visualized by brown colour [100].
Figure 2.

in vivo

351

Munirah Sha'ban et al.

ing. Conversely, after implantation, tissue engineered cartilage

exhibited the histoarchitectural characteristics of well-distributed cartilage-isolated cells within basophilic ground
substance (Figure 3A). Moreover,
tissue engineered
cartilage was avascular and homogenous with histochemicals properties consistent with the presence of accumulated
proteoglycans as revealed in Safranin O staining (Figure
3B) and distributed collagen according to the immunoreactivity of collagen Type II and collagen Type I.
tissue
engineered cartilage demonstrates moderate expression of
localized collagen Type II around the under-developed pericellular matrix. In parallel, collagen Type I expression is
visibly visualized throughout the extracellular matrix. Interestingly,
tissue engineered cartilage shows strong
expression of collagen Type II around the pericellular
matrix of the lacunae. Additionally, collagen Type II distribution was notably seen throughout the matrix (Figure 3C),
confirming a mature cartilage phenotype. collagen Type I
deposition in the
tissue engineered cartilage was
shown in Figure 3D. Strong expression of collagen Type II
and negative expression of collagen Type I on native cartilage section was served as a control.

4. Discussion

Although research progress in cartilage tissue engineering

is rapidly emerging, some equivalent basic research is still
necessary to develop its full potential. For example, various
types of basal culture media have been used to provide the
basic nutrient needed for human articular chondrocytes culture. However, comparison on which type of basic medium
will promote better human articular chondrocytes growth is
still not reported. We report here the proliferation of human
articular chondrocytes is significantly faster in the combination culture medium compare to individual basal medium.
The number of chondrocytes increased greater than 1,000
times in the combination culture medium compared to 200
times in F12 and 400 times in DMEM alone. Cultured chondrocytes in the combination culture medium demonstrate
significantly shorter population doubling time compared to
both individual media. This result revealed the advantages
of the combination culture medium in shortening the population doubling time of the cultured chondrocytes as well as
increasing the cells yield. Concurrently, we found that all
samples that were randomly obtained from patients with
broad age range can be grown
and can be used to

in vivo

In vitro

in vivo

in vivo

in vitro

The quantitative RT-PCR analysis to determined gene expression of Collagen Type I gene (a), Collagen Type II (b), aggrecan
(c) and sox 9 gene (d). Note: (Native) represents isolated RNA from the normal native cartilage, (P0, P1, P2, P3) represent isolated RNA
that was collected from cultured chondrocytes at serial passages and (Construct) represents the isolated RNA from tissue-engineered
cartilage.
Figure 3.

352

The Re-Expression of Collagen Type II, Aggrecan and Sox 9 in Tissue-Engineered Human Articular Cartilage

articular cartilage is detectable if only the total RNA is isolated from construct at earlier passage, e.g. P0 and P1 stage.
We believe that at this stage the cells have not yet undergo
further dedifferentiation. Despite the fact that some studies
claimed for the re-expression of collagen II in their
tissue engineered cartilage after introducing the monolayer
cultured chondrocytes back onto their own developed
three-dimensional culture system, Willem
reported that their
tissue engineered articular cartilage never expressed collagen Type II during the
incubation period. Interestingly, after 8 weeks implantation,
the
tissue-engineered cartilage showed strong
expression of Sox 9, the transcriptional factor for cartilage
specific gene expression. Concurrently, the presence of specific cartilage extracellular matrices, collagen Type II and
aggrecan have indicated the presence of newly synthesized
cartilage-specific extracellular matrix molecules. Collagen
Type I is minimally expressed in our new developed tissueengineered cartilage. However Sasano
discovered
that chondrocytes synthesize collagen Type I and accumulate the protein in the matrix during the development of rat
tibial articular cartilage.
ACI is a relatively new treatment for defects of articular
cartilage. Since pioneer worked by Brittberg
ACI
has been used and accepted worldwide in the treatment of
knee injuries. It has been reported that patients can
expect a 90% chance of successful treatment using ACI.
But to date, the results remain controversial as some studies
revealed failure. The problems with this procedure are the
usage of periosteum to contain the chondrocytes and open
arthrotomy for implantation. The formation of tissue engineered autologous neocartilage will change the necessity for
open surgery and possibly use arthroscopic techniques for
implantation. The usage of periosteum to contain the chondrocyte would be unnecessary. Clinician and scientists are
now starting to discover alternative resurfacing techniques
for cartilage repair. This situation has lead tissue engineering aims at
neocartilage fabrication with incorporation of biodegradable scaffold to improve the structural and
biological properties of the graft, in addition to make it
more stable for implantation into chondral defects. We have
successfully formed an
tissue-engineered cartilage
that demonstrated stable three-dimensional structure of neocartilageimplant after three weeks incubation. This prelude
discovery seems important for future cartilage reconstruction.

regenerate the three dimensional construct in which, later

did formed a tissue engineered cartilage. This finding verified the reproducibility of the study for future articular cartilage research work. Nevertheless, due to the limited amount
of samples, we cannot conclude if there is any significant
correlation between the donor age and the chondrocytes
capacity. Future studies should involve more patients of a
broad age range in order to distinguish if there is any correlation between patients age with the changes in human
articular chondrocytes yield and proliferation.
During monolayer expansion in various culture media, we
found that morphological feature of the cultured chondrocytes has changed from polygonal to more elongated and
larger in size. The similar finding was also reported previously when culturing human nasal septum chondrocytes,
auricular chondrocytes and articular chondrocytes using this
conventional monolayer culture expansion. It has been
well documented that during growth in monolayer culture,
chondrocytes adopt many of the phenotypic traits of fibroblast, as they become elongated and synthesize Type I collagen rather than Type II collagen. Previous study concerning
the effects of serum supplementation on human articular
chondrocytes also showed that cultured chondrocytes lost
its phenotype and dedifferentiated in culture, which may be
due to modification on the cell cytoskeleton. Phenotypic
analysis on monolayer culture in various culture media
demonstrated similar expression pattern of chondrocytesspecific genes as collagen Type II, aggrecan and Sox 9 gene
expression decreased with time in culture, while collagen
Type I gene is increasingly expressed. Previous studies on
human articular chondrocytes documented that collagen
Type II expression is down regulated after the subsequent
passages whilst Collagen Type I is gradually up-regulated.
It has been suggested that the expression of collagen Type I by cultured chondrocytes is a marker of the
loss of the specific chondrocyte differentiation phenotype
during
multiplication.
Chondrocytes need a three-dimensional matrix in order to
maintain phenotypical stability. Hence, in order to get
back the cartilage specific gene, particularly collagen II; we
maintained the
tissue-engineered cartilage consisting fibrin-chondrocytes aggregate for 3 weeks in the culture medium prior to subcutaneous implantation. The RNA
from
tissue engineered cartilage showed a similar
gene expression pattern as the monolayer cultured cells.
Collagen Type II expression of
tissue engineered

in vitro

in

vitro

et al.

in vitro

in vitro

in

13,14

vivo

24

et al.

4,25

et al.

15,16

26,27

28,29

17,18,19

20

in vitro

22,23

in vitro

21

in vitro

in vitro

in vitro

in vitro

353

Munirah Sha'ban et al.

In order to reveal the reliability of the

tissue-engineered cartilage implant, we implanted the construct subcutaneously on the dorsum of the athymic mice for 8 weeks.
Grossly,
tissue-engineered cartilage appeared white,
smooth, glistening and felt to be firm, resisting compression
comparable to that of normal articular cartilage. Histochemical analysis demonstrated that the new tissue generated a
histoarchitecture consistent with that of normal hyaline cartilage on H&E staining. Moreover, Safranin O staining on
the sections confirmed the presence of accumulated proteoglycans within the new cartilaginous matrix comparable
to native articular cartilage, as previously reported.30 However, these characteristics give no absolute criteria to the
phenotypic stability of the constructs since they provide no
clues to the specific nature of the newly synthesize matrix.
Further assessment using immunohistochemical localizations with specific human monoclonal antibodies proved
that
tissue-engineered cartilage creates an accumulated pericellular matrix composed of newly synthesized
collagen Type II around the lacunae with sparse distribution
of collagen Type I throughout the section similar to previously reported.31
in vitro

References

1. HJ Mankin, VC Mow, JA Buckwalter, et al., Chapter 17:

Articular cartilage structure, composition and function. Ortho-

in vivo

paedic Basic Science. Biology and Biomechanics of the Musculoskeletal System, 2nd Ed, pp443-70, (2000).

2. HJ Mankin, VC Mow, JA Buckwalter, Chapter 18: Articular

cartilage repair and Osteoarthritis. Orthopaedic Basic Science.
Biology and Biomechanics of the Musculoskeletal System, 2nd
Ed, pp471-88, (2000).
3. G Bently, LC Biant, RW Carrington, et al., A prospective, randomized comparison of autologous chondrocytes implantation
versus mosaicplasty for osteochondral defects in the knee, J.
Bone Joint Surg. (Br).,
223 (2003).
4. M Brittberg, A Lindahl, A Nilsson, et al., Treatment of deep
cartilage defects in the knee with autologous chondrocyte
transplantation, N. Eng. J. Medi.,
889 (1994).
5. G Knutsen, L Engebretsen, TC Ludvigsen, et al., Autologous
chondrocyte implantation versus microfracture: a prospective
randomized Norwegian multicenter-trial, International Cartilage Repair Society 4th Symposium, June 15-18, Toronto,
2002. No 40.3.
6. T Muellner, Failed autologous chondrocyte implantation: complete a traumatic graft delamination after 2 years, Am. J.
Sports Med.,
, 516 (2001).
7. P Mainil-Varlet, F Riesert, S Grogan, et al., Articular cartilage
repair using a tissue-engineered cartilage-like implant: an animal study, Osteoarthr. Cartilage., , S6-15(A) (2001).
8. JCMM Willem, JVM Gerjo, A Joachim, et al., Tissue engineered cartilage using serially passaged articular chondrocytes. Chondrocytes in alginate combined in vivo with a
synthetic (E210) or biologic biodegradable carrier (DBM),
Biomaterials, , 571 (2000).
9. EJ Caterson, RS Tuan, SP Bruder, Cell-based approaches to
orthopaedic tissue engineering. Orthopedic Tissue Engineering: Basic Science and Practice. Chapter 3. pp21-50. 2004.
10. B Weimin, MD Jian, Z Zhaoping, et al., Sox9 is required for
cartilage formation, Nature Genetics, , 85 (1999).
11. RG LeBaron KA Athanasiou, Ex vivo synthesis of articular
cartilage, Biomaterials, , 2575 (2000).
12. H Tim, T Simon, M Alan, Tissue engineering: chondrocytes
and cartilage, Arthritis Res.,
, S63-S68 (2002).
13. BS Aminuddin, KH Chua, NH Fuzina, et al., Formation of tissue engineered human cartilage from nasal septum, KPJ Medi.
, 3 (2003).
J.,
14. BHI Ruszymah, KH Chua, S Munirah, et al., Tissue engineered cartilage with different human chondrocytes sources:
Articular, Auricular and Nasal Septum, Medi. J. Islamic Acad.
Sci.,
, 5 (2004).
15. K Daniels, M Solursh, Modulation of chondrogenesis by the
cytoskeleton and extracellular matrix, J. Cell Sci.,
249
(1991).
16. S Loty, JM Sautier, N Forest, Phenotypic modulation of nasal
septal chondrocytes by cytoskeleton modification, Biorheology, 117 (2000).
17. AHMY Badrul, BS Aminuddin, I Sharaf, et al., The effects of
autologous human serum on the growth of tissue engineered
85(2),

331(14),

in vivo

29(4)

5. Conclusion

The combination of basic culture medium, F12 and

DMEM promote significantly better chondrocytes proliferation that enables the reconstruction of tissue-engineered cartilage. The engineered cartilage demonstrated the reexpression of specific chondrogenesis marker particularly
collagen Type II, aggrecan and Sox 9. Hence, we have successfully reconstructed tissue engineered articular cartilage
with cartilage phenotypic expression resembling native hyaline cartilage. This preliminary finding might have a major
impact onfuture orthopaedic knee surgery, particularly for
autologous tissue-engineered cartilage implantation.

21

22

21

4(suppl 3)

1(1)

Acknowledgement: This study is made possible by grants-

from Ministry of Science, Technology and Environment,

Malaysia 06-02-02-0037-EA189 and 06-02-02-003 BTK/
ER/022, Faculty of Medicine, National University of
Malaysia and National University of Malaysia Hospital. We
would like to thank to Dr Badrul Akmal Hisham and Dr
Azmi Baharudin from Orthopaedic Department, Faculty of
Medicine, National University of Malaysia for providing
human cartilage samples for this study.

15(1)

100,

37,

354

The Re-Expression of Collagen Type II, Aggrecan and Sox 9 in Tissue-Engineered Human Articular Cartilage
human articular cartilage, Medi. J. Malaysia,
11
(2004).
B Azmi, BS Aminuddin, I Sharaf, et al., The significance of
using pooled human serum in human articular cartilage tissue
engineering. Medi. J. Malaysia,
, 13 (2004).
OC Samsudin, BS Aminuddin, S Munirah, et al., In vitro
development of autologous tissue engineered human articular
neocartilage for orthopaedic surgery, Medi. J. Malaysia,
, 15 (2004).
J Bonaventure, N Kadhom, SL Cohen, et al., Re-expression of
cartilage-specific genes by dedifferentiated human articular
chondrocytes cultured in alginate beads, Exp. Cell Res.,
97 (1994).
HJ Hauselmann, RJ Fernandes, SS Mok, et al., Phenotypic
stability of bovine articular chondrocytes after long-term culture in alginate beads, J. Cell Sci., , 17 (1994).
J Bonaventure, N Kadhom, SL Cohen, et al., Re-expression of
cartilage-specific genes by dedifferentiated human articular
chondrocytes cultured in alginate beads, Exp. Cell Res.,
, 97 (1994).
PC Yaeger, TL Masi, JL Buck de Ortiz, et al., Synergistic
action of TGF- and IGF-I induces expression of Type II collagen and aggrecan genes in adult human articular chondrocytes, Exp. Cell Res., , 318 (1997).
Y Sasano, M Furusawa, H Ohtani, et al., Chondrocytes synthesize type I collagen and accumulate the protein in the

matrix during development of rat tibial articular cartilage,

Anat. Embryol. (Berl).,
247 (1996).
25. M Brittberg, T Tommi, SJ Eva, et al., Autologous chondrocytes used for articular cartilage repair: an update. Clin. Orth.
Relat. Res.,
, S337 (2001).
26. L Peterson, T Minas, M Brittberg, et al., Two to nine year outcome after autologous chondrocyte transplantation of the
knee, Clin. Orth. Relat. Res., , 212 (2000).
27. JW Yates Jr, The effectiveness of autologous chondrocyte
implantation for treatment of full thickness articular cartilage
lesions in workers compensation patients, Orthopaedics,
, 295 (2003).
28. D Koulalis, W Schultz, M Heyden, Autologous chondrocyte
transplantation for osteochondritis dissecans of the talus, Clin.
Orth. Relat. Res., , 186 (2002).
29. M Clatworthy, R Chiu, C Chiu, et al., Autologous chondrocyte implantation: five years experience, J. Bone Joint Surg.
(Br).,
, 134 (2002).
30. S Munirah, BS Aminuddin, KH Chua, et al., Tissue engineered
human articular neocartilage using serial expanded chondrocytes, Medi. J. Malaysia.,
9 (2004).
31. BS Munirah, BS Aminuddin, OC Samsudin, et al., Tissueengineered human articular cartilage demonstrate intense
immunopositivity for collagen Type II, J. Biosciences, in
press.

59(Suppl B),

18.
19.

20.

21.
22.

23.

24.

194(3),

59(Suppl B)

391S

374

59(Suppl B)

26(3)

212(1),

395

107

84B-S2

212(1)

59(Suppl B),

237

355