Theriogenology 82 (2014) 834843

Contents lists available at ScienceDirect

Theriogenology
journal homepage: www.theriojournal.com

VEGF system expression by immunohistochemistry and

real-time RT-PCR study on collared peccary placenta
Tatiana C. Santos a, *, Moacir F. Oliveira b, Paula C. Papa c, Vibeke Dantzer d,
Maria A. Miglino c
a

Department of Animal Science, State University of Maring, Maring, Paran, Brazil

Department of Animal Science, Federal Rural University of the Semi-Arid, Costa e Silva Mossor, Rio Grande do Norte, Brazil
Department of Surgery, School of Veterinary Medicine, University of So Paulo, So Paulo, Brazil
d
Section Anatomy, Department of Veterinary Clinical and Animal Sciences, Faculty of Health and Medicine, Copenhagen University,
Frederiksberg C, Denmark
b
c

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 7 November 2013
Received in revised form 13 June 2014
Accepted 18 June 2014

Vascular endothelial growth factor (VEGF) is known to induce endothelial cell proliferation, to promote cell migration, and to inhibit apoptosis, thus playing a central role in
angiogenesis and in the regulation of vasculogenesis. The expression of the VEGFligand
receptor system was studied in the placenta and uterus of the collared peccary in
nonpregnant females in the luteal phase and throughout pregnancy (>35, 75, 115, and
135 days). The material was examined by immunohistochemistry and by real-time reverse
transcription polymerase chain reaction. Intense positive immunolabeling was observed
for VEGF and its receptors in the uterine epithelium, uterine glands, and trophoblast. The
endothelial cells and smooth muscle cells in the maternal and fetal vessels, as well as the
connective tissue and mesenchyme, had weak immunoreactivity during all periods of
pregnancy. The regression analysis of the real-time polymerase chain reaction results
demonstrated cubic behavior, showing a specic time-dependent prole during pregnancy, which increased over the last gestational period to VEGF and VEGFR-1. The relative
expression of VEGFR-2 decreased in the middle-third of the pregnancy and increased in
late pregnancy. In the collared peccary, the expression of the VEGFligand receptor system
was similar to that in porcine and ruminant placentas, suggesting that an epitheliochorial
placenta has the same physiological and interhemal barrier during vascular gestational
development. The expression of VEGF among cells not related to the vascular system, such
as those of the uterine epithelium, trophoblast, and uterine glands, suggests a distinct
regulatory role for these cells in vasculogenesis and also a different role of VEGF pathway.
2014 Elsevier Inc. All rights reserved.

Keywords:
VEGF
Tayassu
Placenta
Epitheliochorial
Microcirculation

1. Introduction
The collared peccary (Pecari tajacu) is a mammal that
belongs to the same order as large ruminants and to the
same family as the domestic swine and has a diffuse, folded, epitheliochorial, chorioallantoic placenta with an
areolar gland complex [1]. The peccaries are polytocous
* Corresponding author. Tel.: 55 44 3011 4919; fax: 55 44 3011 4729.
E-mail address: tcsantos@uem.br (T.C. Santos).
0093-691X/$ see front matter 2014 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.theriogenology.2014.06.016

with a gestation periods of 144 to 148 days and normally

with 2 offspring per parturition [2].
The placenta is a tissue with high metabolic activity that
allows for the exchange of nutrients, wastes, and, importantly, gases between maternal and fetal tissues. The
growth and remodeling of the maternal vasculature and
the development of a fetal vascular bed are essential for
many tissues [3]. The formation of new blood vessels [4] is
also critical for the growth and development of the
placenta [5].

T.C. Santos et al. / Theriogenology 82 (2014) 834843

To establish a placental vascular bed, certain angiogenic

factors are needed; several have been described in the literature. Among the most important factors cited is vascular
endothelial growth factor (VEGF), along with its respective
receptors, VEGFR-1 and VEGFR-2 [2]. The VEGF family contains four proteins: VEGF (VEGF-A), VEGF-B [6,7], VEGF-C [8],
and VEGF-D [9]. Herein, we will use the term VEGF for VEGFA, which is the most important and widely studied of the four
VEGF proteins. VEGF has ve isoforms with different molecular masses, biological properties, and its ability to bind to
receptors, which include the following: VEGF121, VEGF145,
VEGF165, VEGF189, and VEGF206, possessing 121, 145, 165,
189, and 206 amino acids, respectively [10,11].
Vascular endothelial growth factor binds to receptor
tyrosine kinase VEGFR-1, Flt-1 (fms-like tyrosine kinase receptor 1), VEGFR-2, KDR (kinase insert domain containing
receptor), or Flk-1 (fetal liver kinase), and VEGFR-3 is only
expressed in lymphatic vessels [12]. VEGFR-1 and VEGFR-2
play different roles in the angiogenic process. VEGFR-1 is
important for the formation of the yolk sacs blood islands
during vasculogenesis [12] and for the formation of capillary
tubes. Vasculogenesis occurs when VEGF binds to VEFGR-2,
promoting the differentiation of mesodermal cells into
endothelial cells and their subsequent proliferation.
Vascular hyperpermeability is crucial for angiogenesis,
and the action of VEGF results in the extravasation of
plasma proteins into the extravascular space, leaving a
deposit of brin gel that serves as a provisional matrix for
the growth of new blood vessels [1315].
The VEGFligand receptor system has been identied in
placental tissues from various mammals, including swine
[1619], cows [20,21], and sheep [22,23].
The studies of vascular casts from the maternal and fetal
sides of pig placentas [24] and collared peccary placentas
[25] showed that both species have a dense subepithelial
capillary network that forms bulbous protrusions on the
fetal side, which, in turn, t into the maternal troughs
formed by the primary and secondary ridges. The typical
capillary indentation on both sides of the placental barrier
that occurs in pigs [26,27] has also been observed in the
placentas of Tayassuidae [1]. These characteristics appear
to be common to other suiforms, as Macdonald and Fowden [28] described that the microscopic anatomy of
placenta of the genus Sus, Hylochoerus, Babyrousa, Phacochoerus, and Pecari is similar to that of domestic pigs.
In this study, we tested the hypothesis that the collared
peccary shares conserved features, common to swine and
ruminants, which promote the expression of angiogenic
factors in the placenta during pregnancy. Thus, we studied
the expression of VEGF and its receptors (VEGFR-1 and
VEGFR-2) in the placentas of collared peccaries during
pregnancy and in nonpregnant females (at the luteal phase)
by reverse transcription polymerase chain reaction (RTPCR) and immunohistochemistry.
2. Materials and methods
2.1. Animals
The materials necessary for this project were collected
from the Center for Wild Animals Multiplication (Centro de

835

Multiplicao de Animais Silvestres da Universidade Federal Rural do Semi-rido [CEMAS]/Ufersa, RN, Brazilian
Institute of Environment and Renewable Natural Resources
{Instituto Brasileiro do Meio Ambiente e dos Recursos
Naturais Renovveis} [IBAMA] no. 1/24/92/0040-4). This
research was approved by the Bioethics Committee of the
School of Veterinary Medicine of the University of Sao
Paulo (protocol nos.17/2002 and 362/2003) and is registered in IBAMA (no. 2001.003237/05).
Twenty animals were used in this experiment, 16
pregnant and 4 nonpregnant. The details of their animal
breeders and tissue collection are available in the report of
Santos et al., [29]. The pregnant females (n 16) were
divided into four pregnant groups according to the gestation period: 35 days (<35 days), 75 days (7080 days),
115 days (90120 days), and 135 days (>125 days). The fth
group comprised nonpregnant females (n 4), which
included females with a developed CL in at least one ovary.
Tissue samples from the uterus (nonpregnant) and
uterus placenta (pregnant) were collected in lateral wall
of uterus around mesometrium insertion and umbilical
cord area and xed by immersion or perfusion in 4%
buffered formaldehyde in 0.1 M phosphate buffer, pH 7.3,
for 24 to 48 hours. Samples were processed by standard
histological procedures before being embedded in the
paraplast and were subsequently sectioned for immunohistochemistry. Parallel tissue samples were immediately
snap-frozen in liquid nitrogen and stored at 80  C to be
used for PCR.
2.2. Immunohistochemistry
The paraplast blocks were sectioned (5 mm) using an
automatic microtome (Leica RM2155, Germany). Immunohistochemistry was performed for VEGF, VEGFR-1, and
VEGFR-2. The sections were rehydrated in an ethanol series, during the course of which they were submitted to
endogenous peroxidase blockage in 3% hydrogen peroxide
(vol/vol) in ethanol for 20 minutes. They were then placed
in 0.1 M citrate buffer at a pH of 6.0 and submitted to microwave irradiation at 700 MHz for 15 minutes. The sections were equilibrated in 0.1 M PBS at a pH of 7.4, and
nonspecic binding was blocked using Dako Protein Block
(DakoCytomation, Carpinteria, CA, USA) for 20 minutes.
Tissues were incubated with primary antibodies overnight
at 4  C in a humidied chamber. VEGF (anti-VEGFA (A-20):
sc-152), VEGFR-1 (anti-VEGFR-1 (C-17): sc-316), and
VEGFR-2 (anti-VEGFR-2 (C-20): sc-315) were detected by a
rabbit polyclonal antibody (diluted 1:300). All antibodies
were from Santa Cruz Biotechnology Inc. (Santa Cruz, CA,
USA). The slices were then rinsed in PBS and incubated rst
with the biotinylated secondary antibody for 45 minutes
and then with streptavidinhorse radish peroxidase for
45 minutes (Universal Dako labelled streptavidin biotin
(LSAB) Kit, Peroxidase System-horse radish peroxidase,
DakoCytomation). After rinsing with PBS, binding was
visualized using diaminobenzidine as the chromogen. The
sections were counterstained with hematoxylin and
mounted. Negative controls were prepared using PBS
instead of primary antibody solution. The specicities of
the antibodies were determined by the incubation of

836

T.C. Santos et al. / Theriogenology 82 (2014) 834843

tissues with antibodies preabsorbed with VEGF, VEGFR-1,

and VEGFR-2 antigens (Santa Cruz Biotechnology, Inc., sc152P, sc-316P, sc-315P) before incubation. Bovine placenta
was used as a positive control with a documented VEGF
system expression pattern [20].
Immunostaining was graded from 1 to 4, according to
intensity as follows: 1, negative (); 2, weak (); 3, moderate (); and 4, strong (). The slides were analyzed
at objective  100 (oil immersion) by one observer in at
least ve randomly areas. Values are reported as percentage (SE) of 300 cells/cell type/animal.
2.3. RNA extraction and reverse transcription
The total RNA from the frozen samples of the uterus and
placenta was isolated using Trizol Reagent (Invitrogen
Brazil Ltd.). The amount and concentration of the RNA in
each sample were estimated by the absorbance with a
Biophotometer (Eppendorf) at 260/280 nm. Then, the RNA
was diluted to 1 mg/microl and stored at 80  C. For
reverse transcription, a mixture of 1 mg RNA, 1 mL DNase
buffer, 1 mL of DNase (Invitrogen, Carlsbad, USA), and 7 mL of
water in tubes was used and held for 15 minutes at room
temperature. Each sample received 2 mL of EDTA (Invitrogen) and was incubated at 65  C for 10 minutes in the
thermal cycler (Eppendorf, Hamburg, Germany). Next, each
sample received 1 mL dNTP (10 mM) (Invitrogen) and then
1 mL oligo-DT (Invitrogen); these were incubated at 65  C
for 5 minutes. A 4-mL sample containing rst-strand buffer
(Invitrogen), 2 mL of DTT 0.1 M (Invitrogen), and 1 mL of
RNaseOUT (Invitrogen) were added to the samples, which
were placed at 42  C for 2 minutes. Finally, 1 mL of Superscript II (Invitrogen) was added, and the samples were
incubated at 42  C for 50 minutes, followed by a 70  C step
for 15 minutes. The cDNAs obtained were frozen at 20  C
until further use.
2.4. Real-time polymerase chain reaction
The probes and primer sets were designed from sequences of swine genes using the Primer Express Software
(Applied Biosystems) (Table 1). The mRNA levels of VEGF,
VEGFR-1, and VEGFR-2, as well as of swine GAPDH, were
analyzed in 96-well plates using quantitative real-time
PCR and an ABI 7500 sequencing machine (Applied Biosystems). Each well contained the following: 12.5 mL of
Power SYBR Green buffer (3 mM MgCl2; 200 AM of dATP,
dCTP, and dGTP; 400 AM dUTP; 1.25 U AmpliTaq GoldR

DNA polymerase; and 0.5 U AmpEraseR uracil-N-glycosylase (Applied Biosystems); 2.5 mL forward and 2.5 mL
reverse 900 mM primers (Invitrogen, Table 1); and 2.5 mL
water and 5 mL template (diluted 1:8 in nuclease-free
water) were added for a nal volume of 25 mL. All wells
were sealed with MicroAmp Optical Adhesive Covers
(Applied Biosystems), following the complete mixture of
all reagents. The amplication conditions were 2 minutes
at 50  C, 10 minutes at 95  C, 40 cycles of 15 seconds at
95  C (denaturation), and 1 minute at 60  C (annealing and
extension). For the dissociation curve, the samples ran for
15 seconds at 95  C, 1 minute at 60  C, and 15 seconds at
95  C.
The samples were analyzed in duplicate (one sample
and two PCR repeated on the same extracted sample), and
the expression of target genes was determined by relative
quantication with linear regression of the uorescence
data obtained by the real-time PCR. The relative expression
was determined by the ratio of the target gene and the
constitutive gene (GAPDH) by the following formula: relative expression N0 (target gene)/N0 (GAPDH). N0 values
were calculated in LinRegPCR 7.0 (linear regression PCR)
program [30].
We considered all of the samples that were obtained
with an accuracy of 1.8 and a correlation coefcient (R2)
between 0.9 and 1.0. The real-time PCR products were
transferred to an acrylamide gel (8%) and generated bands
consistent with the determined size of the amplicon
(Table 1).
2.5. Statistical analysis
The means obtained in each animal group were tested
for normality. The percentage of positive cells in the
immunohistochemical analysis were classied by score and
analyzed by the PROC GEN MOD of SAS [31] using Poisson
distribution. The difference between the percentage of cells
in each score (1 to 4) of each cell type (uterine epithelium,
uterine glands, and trophoblast) between the nonpregnant
and pregnant groups was analyzed by a contrast test for
each factor (VEGF, VEGFR-1, and VEGFR-2) and by t-test for
pregnant groups.
The results of the relative expression of the real-time
RT-PCR between pregnant and nonpregnant subjects
were compared using Dunnetts test. The relative means of
expression, assessed by real-time PCR, among the pregnant
groups were analyzed by regression analysis and the Tukey
test using PROC GLM of SAS.

Table 1
Oligonucleotide primers for swine VEGF, VEGFR-1, VEGFR-2, and GAPDH genes used in the real-time PCR assay in collared peccary.
Target genes

Oligonucleotide primers

Amplicon length

Gene (GenBank no.)

VEGF

50
50
50
50
50
50
50
50

71

Sus scrofa AF_3185002

75

Sus scrofa AJ_245445

75

Sus scrofa AJ_245446

82

Sus scrofa DQ_845173

VEGFR-1
VEGFR-2
GAPDH

TCGAGACCCTGGTGGACATC
CACACAGGACGGCTTGAAGA
TGAAGGAGGGCGTGAGGAT
GCCAACAGTCCAACATGATCTG
CGAGTGGAGGTGACAGATTGC
CCGATCACTTTTGGAATTGTGA
TCCCCACCCCCAACGT
TGTCATCATATTTTGCAGGTTTCTC

T.C. Santos et al. / Theriogenology 82 (2014) 834843

837

Table 2
Percentage of cells sorted by score in the immunolocalization of VEGF, VEGFR-1, and VEGFR-2 in the uterine epithelium, the glandular epithelium, and the
trophoblast of the placenta and uterus in collared peccary.
Scored

Group
VEGF
NP
35 d
75 d
115 d
135 d
VEGFR-1
NP
35 d
75 d
115 d
135 d
VEGFR-2
NP
35 d
75 d
115 d
135 d

% Uterine epithelium

% Uterine glands

% Trophoblast

1 ()

2 ()

3 ()

4 ()

1 ()

2 ()

3 ()

4 ()

1 ()

2 ()

3 ()

4 ()

05.83
12.44ea
00.22d
04.33eb
02.58ec

21.83
30.11ea
03.56ec
12.25eb
10.58eb

62.67
45.44ea
01.67ed
24.83ec
33.58eb

09.67
12.00c
94.56ea
58.58eb
53.25eb

00.00
00.22c
00.89ec
02.17eb
04.33ea

11.92
06.33ec
02.56ed
10.17b
13.17a

83.67
29.11ea
01.78ec
22.25eb
29.92ea

04.42
64.33eb
94.78ea
65.42eb
52.58ec

d
00.00
00.00
00.50
01.17

d
02.00c
00.56d
06.25a
04.17b

d
27.33b
00.00d
36.50a
14.75c

d
70.67c
99.44a
56.75d
79.92b

03.67
07.56ea
00.00e
01.83eb
01.42eb

14.42
26.33ea
01.33ec
08.42eb
09.25eb

76.75
52.89ea
05.67ec
17.67ec
19.83ec

05.17
13.22ec
93.00ea
72.08eb
69.50eb

00.25
00.78b
00.56b
03.67ea
03.00ea

03.42
04.11b
02.78b
12.75ea
11.08ea

88.33
30.33ea
03.89eb
26.08ea
32.92ea

08.00
64.78eb
92.78ea
57.50ec
53.00ec

d
00.83b
00.00c
02.25a
01.17b

d
06.92b
00.00c
11.17a
09.08ab

d
35.83c
66.67a
53.17b
53.25b

d
56.42a
33.33b
33.42b
36.50b

06.08
08.44ea
00.44ec
02.83eb
02.58eb

19.33
24.22ea
01.00ed
05.33ec
10.58eb

65.75
40.44ea
07.56ed
12.92ec
27.67eb

08.83
26.89ed
91.00ea
78.92eb
59.17ec

00.42
02.55eab
01.33eb
03.58ea
01.58eb

05.75
13.22ea
04.89b
06.58b
10.50ea

90.67
25.23ea
08.89eb
26.59ea
25.50ea

03.17
59.00eb
84.89ea
63.25eb
62.42eb

d
00.41
00.00
01.91
00.25

d
01.58b
00.00c
04.75a
03.50a

d
07.34c
01.00d
19.25a
12.83a

d
90.67ab
99.00a
74.09b
83.42b

a-c

Means in the same column with different superscripts differ by t test (P < 0.05).
Score: 1 negative, 2 positive weak, 3 positive medium, 4 positive strong; NP nonpregnant.
e
Mean difference compared with group NP by contrast test (P < 0.05).
d

3. Results
Collared peccaries females were studied in the luteal
phase and through pregnancy. VEGF and its receptors,
VEGFR-1 and VEGFR-2, were studied in the uterus and
placenta by immunohistochemistry (Table 2) and real-time
RT-PCR. Immunohistochemistry demonstrated that both
VEGF and its receptors showed a positive reaction in the
uterine and glandular epithelia and in the trophoblast of
both nonpregnant females and throughout pregnancy
(Figs. 14).

On the fetal side, moderate positive reactions for VEGF,

VEGFR-1, and VEGFR-2 in the allantoic epithelium luminalendoderm and in mesenchymal cells were observed (Fig. 2).
On the maternal side, the connective tissue cells showed only
weak reactions in all of the placentas studied (Figs. 24).
With regard to blood vessels, the endothelial cells and
smooth muscle presented weak immunoreactivity in
nonpregnant uteruses but strong immunoreactivity during
pregnancy in the maternal and fetal vessels (Figs. 14). The
smooth muscle cells from myometrium showed medium
immunostaining in all females.

Fig. 1. Immunohistochemical localization of (A,D) VEGF, (B,E) VEGFR-1, and (C,F) VEGFR-2 in the uterus and placenta of (AC) nonpregnant and (DF) early
pregnant (35 days) collared peccaries. In the nonpregnant uterus, the uterine epithelium has cells with medium and strong staining. Approximately 35 days the
allantochorion is attached onto the uterine mucosa, and both the trophoblast (tro) and uterine epithelium (ep) are positive for VEGF and its two receptors.
Positive immunolabeling is also observed in uterine glandular cells (gla) and in the smooth muscle cells of vessels. Fetal vessels (fv). Bars: 40 mm.

838

T.C. Santos et al. / Theriogenology 82 (2014) 834843

Fig. 2. Immunohistochemical localization of (AB) VEGF, (CD) VEGFR-1, (EF) VEGFR-2, and the (G) negative control in placentas of a collared peccary (AD; G: 115 days; E
F: 75 days). Note positive immunostaining (brown) for the VEGF-ligand receptor system for trophoblast (tro) and uterine epithelium (ep). Mesenchymal cells (mes) and some
connective cells in maternal side were also positive. In the uterine glands (gla), strong positive immunostaining into cytoplasm is visible and also some negative cells (blue).
The vascular endothelium was positive in the fetal (**) and maternal (*) vessels (head arrow). (G) In the negative control primary antibody was omitted and replaced by PBS
and displayed no immunostaining. Bars: 40 mm. (For interpretation of the references to color in this gure, the reader is referred to the web version of this article.)

The specicity of antibodies used was determined by

incubation of tissue sections with preabsorbed primary
antibodies to VEGF. These sections demonstrated no
immunoreactivity (not shown). The negative controls tissue sections where primary antibodies were replaced with
PBS displayed no immunostaining (Figs. 2G, 3D). The positive bovine placenta tissue controls (not shown) were
positive to VEGF system as expected.
Data from the quantitative analysis of the immunohistochemistry were collected, and the percentages of cells
were determined. The positive or negative percentage of
cells (uterine epithelium, uterine glands, and trophoblast)
for VEGF and its receptors are detailed in Table 2. In the
uterine epithelium, when percentage of cells classied in
each score were compared, we observed more cells with
score 3 (moderate) for VEGF and its receptors in females
with 115 and 135 days of pregnancy than in nonpregnant
females or in females after 35. For placentas at 75, 115, and
135 days of pregnancy, the highest percentage of cells was
strongly positive (score 4). In the uterine glands of
nonpregnant females, the frequency of cells with a score of
3 for VEGF and its receptors was the highest, whereas the
strongly positive cells (score 4) were more frequently found
in all stages of the studied pregnancies.
The means of cells in each score and period expressed in
percentage were compared by a contrast test. For the
uterine epithelium, the analysis was demonstrated to be
signicant according to the contrasts statistical test

(P < 0.05) of VEGF for all periods and scores tested. However, the percentages of cells with a score of 4 in
nonpregnant females or in females after 35 days of pregnancy showed no differences.
In the uterine glands, the groups at 115 and 135 days of
pregnancy were negative or weakly positive to VEGFR-1 in
greater numbers than other groups, compared with
nonpregnant subjects.
In the trophoblast, it was noted that VEGF and VEGFR-2
were strongly positive throughout the pregnancy. VEGFR-1
was positive, having the highest percentage of cells with
score 4 in early pregnancy (56.42%), whereas during other
periods of pregnancy, approximately 60% of cells received a
score of 3 (moderate).
The VEGF system mRNA transcripts were quantied and
detected in all of the females studied, and the relative
expression results are shown in Table 3. The results showed
that the means for the relative expression of VEGF and
VEGFR-1 did not signicantly differ between the
nonpregnant females and those at 35, 75, and 115 days of
pregnancy; the expression levels only differed after
135 days of pregnancy (P < 0.05). With respect to VEGFR-2,
there were no signicant differences between the mean
relative expression of the nonpregnant group (in the luteal
phase) and the pregnant groups studied.
When the relative expression of VEGF and its receptors
was examined by regression analysis among the groups
during pregnancy, and the levels of mRNA for VEGF

T.C. Santos et al. / Theriogenology 82 (2014) 834843

839

Fig. 3. Immunohistochemical localization of (A) VEGF, (B) VEGFR-1, (C) VEGFR-2, and (D) the negative control in placentas of a collared peccary in late pregnancy
(135 days). The trophoblast (tro) and uterine epithelium (ep) are strongly positive for the VEGFligand receptor system. The capillary endothelium had strong
immunostaining in the maternal (mc) and fetal capillaries (fc). Bars: 40 mm.

and VEGFR-1 demonstrated cubic behavior (VEGF

0.6998 0.0394x  0.0006x2 0.000003x3; VEGFR-1
0.0631 0.004x  0.00006x2 0.00000027x3), with a
reduction from Day 35 and during the rst half of pregnancy, as well as a considerable increase during the late
stage at 135 days (Table 3, Fig. 4). The level of VEGFR-2
mRNA demonstrated a quadratic behavior (VEGFR2 0.0072  0.00016x 0.0000008x2), with a steep
decrease up to 89 days of pregnancy, but a subsequent increase until the end of pregnancy (Table 3, Fig. 5).
The Tukey test provided the same results when the
means of relative expression were tested. The VEGF and
VEGF-R1 means were similar between the groups until the
end of pregnancy, whereas VEGFR-2 had reduced expression between 75 and 115 days (Table 3). When the
expression levels in the early pregnant group was
compared with the late pregnant group, VEGF was
observed to increase 6.3-fold and VEGFR-1 increased 3fold, whereas VEGFR-2 changes were not considered
signicantly different.

4. Discussion
The relative expression of VEGF and its receptors have
here been studied in placentas throughout pregnancy in
collared peccaries as well as in nonpregnant animals.
Metabolic demand is large in the placenta during pregnancy. The transfer of nutrients across the placenta can
occur by simple diffusion, facilitated diffusion, active
transport, and receptor-mediated endocytosis [32]. All of
these pathways are inuenced by the surface area available
for exchange [33].
From the start of the apposition of the trophoblast onto
the uterine epithelium, proliferation factors are involved.
The placenta of the peccaries, similar to that of other suiform, is epitheliochorial and lacks trophoblast invasion at
the uterine tissue. In the collared peccary, both the uterine
mucosa and the allantochorionic membrane form complementary folds, which increase throughout pregnancy in
height and complexity to provide an increase in the contact
area for exchange between maternal and fetal tissues

840

T.C. Santos et al. / Theriogenology 82 (2014) 834843

Fig. 4. Immunohistochemical localization of (A) VEGF, (B) VEGFR-1, and (C) VEGFR-2 of the uteri of the collared peccary in late pregnancy (135 days). Strongly
positive glandular cells (gla) are evident with some negative cells (*). The smooth muscle cells (arrows) and endothelial cells (head arrows) of vessels had strong
positive immunostaining of the VEGFligand receptor system. Bars: 40 mm.

[1,29]. The vascularization of these tissues also increases

considerably, and the placental blood ow in the collared
peccary has been described as moving in a countercurrent
to crosscurrent ow [25], creating a highly efcient exchange between the mother and fetus, which can also be
observed in the porcine placenta [24].
An increase in blood ow is necessary to provide the
nutrients and oxygen for a high metabolic demand and is
therefore dependent on placental vascular angiogenesis as
a major component in placental efciency [34]. The high
demand of placenta is met by increased vascularization,
and a capillary network and vascular factors, such as VEGF
is also needed. Receptors for VEGF promote angiogenesis
and increase vascular permeability. This effect is related to
the growth of new blood vessels by allowing the leakage of
serum factors essential for this phenomenon [35].
In our study, the relative expression of VEGF-A and the
receptors VEGFR-1 and VEGFR-2 were identied both by
immunohistochemistry and by real time RT-PCR with
temporal variations. These results reinforce the importance
of VEGF system in vasculogenesis and angiogenesis at the
maternalfetal interface.
The vascular-shaped baskets on the maternal side occur
around Day 32 of pregnancy in pigs [36]. During this phase,

vascular development is critical to the growth and maintenance of the placenta. In pigs, from Day 1 to Day 12 of
pregnancy, there is an increase in the mRNA for VEGF and
its receptors [37], which remains high throughout the
pregnancy [18]. In the present study, the VEGFligand receptor system of the collared peccary showed immunoreactivity at Day 35 in the uterine and placental cells and
were expressed in placental tissues, as assessed by real
time RT-PCR. The peccaries have longer pregnancies than
pigs, requiring about 146 days to produce two offspring
[2,38]. Despite differences, the morphological aspects of
the placenta are very similar between species and a proportional analysis throughout pregnancy reduces them.
Immunohistochemistry in this study demonstrated an
expression in maternal epithelial cells, trophoblastic cells,
and the uterine glands for VEGF, VEGFR-1, and VEGFR-2.
This result has been observed in porcine placentas [16,18].
Charnock-Jones et al. [17] also identied VEGF in these cells
by immunohistochemistry; however, when tested by in situ
hybridization, the uterine glands showed a weaker reaction
compared with immunohistochemical reactivity.
In our study, there was a pronounced reduction in the
relative expression of VEGFR-2 around Days 75 and 115 of
pregnancy, which was much lower compared with other

Table 3
Relative expression of the VEGF, VEGFR-1, and VEGFR-2 (means  SE) observed after analysis in LinRegPCR 7.0 program (Linear regression PCR).
Group

Relative expression

No pregnant
35 d
75 d
115 d
135 d
Regression
P value

0.0114
0.0574
0.0179
0.0194
0.3635
Cubicd
0.005

VEGF

a-b

VEGFR-1






0.030
0.013b
0.005b
0.014b
0.076ac

0.0039
0.0127
0.0082
0.0057
0.0375
Cubice
0.014







VEGFR-2
0.0013
0.0083b
0.0021b
0.0015b
0.0068ac

0.002028 
0.002718 
0.000722 
0.000042 
0.001863 
Quadraticf
0.003

Means signicantly different (P < 0.05) by Tukey test during pregnancy.

Means signicantly different (P < 0.05) by Dunnet test comparing with no pregnant group.
d
VEGF 0.6998 0.0394 (days of pregnancy)  0.0006 (days of pregnancy)2 0.000003 (days of pregnancy)3 (R2: 0.77).
e
VEGFR-1 0.0631 0.004 (days of pregnancy)  0.00006 (days of pregnancy)2 0.00000027 (days of pregnancy)3 (R2: 0.63).
f
VEGFR-2 0.0072  0.00016 (days of pregnancy) 0.0000008 (days of pregnancy)2 (R2: 0.53).
c

0.0009
0.00052a
0.00006b
0.00001b
0.00086a

T.C. Santos et al. / Theriogenology 82 (2014) 834843

841

Fig. 5. Regression analysis of the relative mRNA expressions of VEGF, VEGFR-1, and VEGFR-2 (/GAPDH)) in collared peccary placenta tissue during pregnancy.
VEGF 0.6998 0.0394x  0.0006x2 0.000003x3 (R2: 0.77); VEGFR-1 0.0631 0.004x  0.00006x2 0.00000027x3 (R2: 0.63); and VEGFR-2 0.0072 
0.00016x 0.0000008x2 (R2: 0.53).

periods. After this period, the activity of placental cells

positive for VEGF and its receptors increased considerably
from Day 115 to 135 days of pregnancy, showing 18.7, 6.6,
and 44.4 times more VEGF, VEGFR-1, and VEGFR-2,
respectively, and suggesting that vascular growth and
placental activity increased during the late period of
gestation. In swine, this increase at the end of pregnancy
was observed during the second half of pregnancy by
immunohistochemical staining for VEGF mRNA, which was
more intense than at the early pregnancy [18].
This incremental activity is reected by the gain in
placenta and the fetal growth during this time interval and
toward the birth. In a previous study, Santos et al. [29]
described the weights of the fetuses of the same material
used in this study. The fetuses increased in weight from
333 g to 595 g from Day 115 to 135 days of gestation; even
though there was no account of placental weight, we suggest that the placenta may have increased in weight and
transfer capacity. The increase in VEGF and its receptors
might contribute to this increase in placental transfer capacity, as reected by our ndings of the relative RT-PCR
expression in VEGFligand receptor system.
The real-time PCR results showed that the relative
expression of VEGF and receptors were similar between the
placentas of nonpregnant females in the luteal phase and
those up to 115 days of pregnancy. This similarity is most
likely explained by how the females were distributed into
groups according to the reproductive stage. The group of
nonpregnant females studied cannot be considered a control group, as all of the females showed CLs in their ovaries
(details in Santos et al., [29]), and, therefore, the females
were in the luteal phase of the estrous cycle and possibly
had high concentrations of circulating progesterone. Wollenhaupt et al. [37] suggested that the endometrial
expression of VEGF in the uterus of sows is sensitive to
levels of progesterone and that it may play an important
role in regulating these factors.
Hormones, such as progesterone and estrogen, have an
angiogenetic effect on endometrium via the VEGF system.
In water buffalo, the VEGF system expression was dependent of estrous cycle stage and superovulatory treatment,
strongly indicating the estrogens were able to increase the

translation rate of this system [39]. Ovariectomized ewes

treated with estrogen had a dramatic uterine microvascular
response, followed by incremental responses in the VEGF
and bFGF mRNA [40]. In baboons, studies described that
VEGF expression and angiogenesis are regulated by estrogen in a cell- and gestational age-specic manner [41]. A
modulatory action in trophoblastic function, specically in
steroidogenesis, was also cited in mink placentas [42].
With regard to the progesterone angiogenic modulation
in the endometrium, endothelial cell proliferation, which
was partly mediated by VEGF, was observed in pregnant
uteri of mice [43]. Similar effects were observed in postmenopausal women who experienced endometrial proliferation stimulated by estrogen and endometrial
angiogenesis, which was induced by progesterone through
the stimulation of VEGF secretion from endometrial cells;
this led to subsequent increases in subendometrial vascularity and blood ow [44].
The placenta is a steroidogenic organ that produces
hormones. Estrogen biosynthesis is catalyzed by aromatase
cytochrome P450 (P450arom), which is encoded by the
CYP19 gene in most mammals [45]. However, pigs and their
distant suiform relatives, including the peccaries, have
experienced CYP19 duplication [46]. Ruminants, horses,
and swine, which express P450arom in their placentas, also
use placenta-specic promoter regions to regulate CYP19
gene expression through alternative splicing [47]. Domestic
swine have high levels of P450arom in the testis and
placenta compared with peccaries [46]. Thus, suiform
CYP19 genes arose from an ancestral duplication that has
maintained gonad- and placenta-specic expression but
occurs at lower levels in peccaries than in pigs, perhaps
facilitating the emergence of different reproductive strategies as the suiforms diverged and evolved. This physiological difference was acquired in swine most likely to
protect females from androgens secreted by male fetuses in
mixed litters [46]; in peccaries, only two to three fetuses
exist in the uterus during pregnancy [1,2,25].
Another physiological function attributed to growth
factors such as VEGF is the mitogenic effect, which has also
been described in nonendothelial cell types, such as retinal
pigment epithelial cells [48], pancreatic duct cells [49], and

842

T.C. Santos et al. / Theriogenology 82 (2014) 834843

Schwann cells [50]. Particularly in the bovine placenta, the

results observed by Pfarrer et al. [20] suggested, beyond the
angiogenic function, a regulatory action for the VEGF system on placental cell functions in the chemotactic activity
of endothelial capillaries and on the autocrine inuences
on the migration of giant trophoblastic cells. This regulatory role for VEGF-modulating processes is related to steroid hormone secretion in the placenta and has also been
described by Sousa et al. [51] with in vitro experiments.
In conclusion, the placenta of collared peccaries expresses VEGF-A and receptors VEGFR-1 and VEGFR-2. This
expression also occurs in cells outside the vascular system,
such as the uterine epithelium, trophoblast, and uterine
glands, suggesting a distinct functional role for these cells.
Their location and expression throughout pregnancy,
which steadily increases until the end, resembles the progression described in swine, suggesting that the morphological closeness described previously is also reected on
the physiological and molecular level. These species
possibly developed similar endocrine and paracrine regulatory mechanisms in their placental tissues.

Acknowledgments
The authors thank the Wild Animal Multiplication
Center from UFERSA for the animals. This research was
supported by grants from the Fundao de Amparo a Pesquisa do Estado de So Paulo (FAPESP) (Processo n 02/
13946-5).

References
[1] Santos TC, Dantzer V, Oliveira MF, Jones CJP, Miglino MA. Macroscopic and microscopic aspects of collared peccary and white-lipped
peccary placenta. Placenta 2006;27:24457.
[2] Sowls LK. Gestation period of the collared peccary. J Mammal 1961;
42:4256.
[3] Reynolds LP, Borowicz PP, Caton JS, Vonnahme KA, Luther JS,
Buchanan DS, et al. Uteroplacental vascular development and
placental function: an update. Int J Dev Biol 2010;54:35565.
[4] Diaz-Flores L, Varela GH. Angiogenesis: an update. Histol Histopathol 1994;9:80743.
[5] Reynolds LP, Caton JS, Redmer DA, Grazul-Bilska AT, Vonnahme KA,
Borowicz PP, et al. Topical review: evidence for altered placental
blood ow and vascularity in compromised pregnancies. J Physiol
2006;572:518.
[6] Olofsson B, Pajusola K, Kaipainen A, Von Euler G, Joukov V, Saksela O,
et al. Vascular endothelial growth factor B, a novel growth factor for
endothelial cells. Proc Natl Acad Sci U S A 1996;93:247681.
[7] Paavonen K, Puolakkainen P, Jussila L, Jahkola T, Alitalo K. Vascular
endothelial growth factor receptor-3 in lymphangiogenesis in
wound healing. Am J Pathol 2000;156:1499504.
[8] Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, Kukk E, et al.
A novel vascular endothelial growth factor, VEGF-C, is a ligand for
the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases.
EMBO J 1996;15:2908.
[9] Achen MG, Jeltsch M, Kukk E, Makinen T, Vitali A, Wilks AF, et al.
Vascular endothelial growth factor D (VEGF-D) is a ligand for the
tyrosine kinases VEGF receptor 2 (Flk1) and VEGF receptor 3 (Flt4).
Proc Natl Acad Sci U S A 1998;95:54853.
[10] Park JE, Keller GA, Ferrara N. The vascular endothelial growth factor
(VEGF) isoforms: differential deposition into the subepithelial
extracellular matrix and bioactivity of extracellular matrix-bound
VEGF. Mol Biol Cell 1993;4:131726.
[11] Poltorak Z, Cohen T, Sivan R, Kandelis Y, Spira G, Vlodavsky I, et al.
VEGF145, a secreted vascular endothelial growth factor isoform that
binds to extracellular matrix. J Biol Chem 1997;272:71518.

[12] Shabaly F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF,

Breitman ML, et al. Failure of blood-island formation and vasculogenesis in Fltk-1-decient mice. Nature 1995;376:626.
[13] Dvorak HF, Brown LF, Detmar M, Dvorak AM. Vascular permeability
factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am J Pathol 1995;146:102939.
[14] Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular endothelial
growth factor (VEGF) and its receptors. FASEB J 1999;13:922.
[15] Nagy JA, Benjamin L, Zeng H, Dvorak AM, Dvorak HF. Vascular
permeability, vascular hyperpermeability and angiogenesis. Angiogenesis 2008;11:10919.
[16] Winther H, Ahmed A, Dantzer V. Immunohistochemical localization
of vascular endothelial growth factor (VEGF) and its two specic
receptors, VEGFR-1 and VEGFR-2, in the porcine placenta and nonpregnant uterus. Placenta 1999;20:3543.
[17] Charnock-Jones DS, Clark DE, Licence D, Day K, Wooding FB,
Smith SK. Distribution of vascular endothelial growth factor (VEGF)
and its binding sites at the maternal-fetal interface during gestation
in pigs. Reproduction 2001;122:75360.
[18] Vonnahme KA, Wilson ME, Ford S. Relationship between placental
vascular endothelial growth factor expression and placental/endometrial vascularity in the pig. Biol Reprod 2001;64:18215.
[19] Welter H, Wollenhaupt K, Tiemann U, Einspanier R. Regulation of
the VEGF-system in the endometrium during steroid-replacement
and early pregnancy of pigs. Exp Clin Endocrinol Diabetes 2003;
111:3340.
[20] Pfarrer CD, Ruziwa SD, Winther H, Callesen H, Leiser R, Schams D,
et al. Localization of vascular endothelial growth factor (VEGF) and
its receptors VEGFR-1 and VEGFR-2 in bovine placentomes from
implantation until term. Placenta 2006;27:88998.
[21] Campos DB, Papa PC, Marques Jr JEB, Garbelotti F, Ftima LA,
Artoni L, et al. Somatic cell nuclear transfer is associated with
altered expression of angiogenic factor systems in bovine placentomes at term. Genet Mol Res 2010;9:30923.
[22] Cheung CY, Brace RA. Developmental expression of vascular endothelial growth factor and its receptors in ovine placenta and fetal
membranes. J Soc Gynecol Investig 1999;6:17985.
[23] Bogic L, Brace RA, Cheung CY. Developmental expression of vascular
endothelial growth factor (VEGF) receptors and VEGF binding in
ovine placenta and fetal membranes. Placenta 2001;22:26575.
[24] Leiser R, Dantzer V. Structural and functional aspects of porcine
placenta microvasculature. Anat Embryol 1988;177:40919.
[25] Santos TC, Oliveira MF, Dantzer V, Miglino MA. Microvascularization
on collared peccary placenta: a microvascular cast study in late
pregnancy. Zool Sci 2012;29:43743.
[26] Friess AE, Sinowatz F, Skolek-Winnisch R, Trutner W. The placenta
of the pig I Fine structural changes of the placental barrier during
pregnancy. Anat Embryol 1980;158:17991.
[27] Dantzer V, Bjorkman N, Hasselager E. An electron microscopic study
of histiotrophe in the interareolar part of the porcine placenta.
Placenta 1981;2:1928.
[28] Macdonald AA, Fowden AL. Microscopic anatomy of the ungulate
placenta. Equine Vet J 1997;24:713.
[29] Santos TC, Tonarelli C, Teixeira FA, Oliveira MF, Reginato P,
Dantzer V, et al. Histomorphometrical and proliferative aspects of
placenta and uterus of the collared peccary (Tayassu tajacu). Histol
Histopathol 2012;27:793806.
[30] Roussel Y, Harris A, Lee MH, Wilks M. Novel methods of quantitative
real-time PCR data analysis in a murine Helicobacter pylori vaccine
model. Vaccine 2007;25:291929.
[31] SAS Institute. SAS/STAT users guide: statistics version 82. Cary, NC:
SAS Institute Inc; 2001.
[32] Atkinson DE, Boyd RDH, Sibley CP. Placental transfer. In: Neill JD,
editor. Physiology of reproduction. Amsterdam: Elsevier; 2006. p.
2787846.
[33] Burton GJ, Fowden AL. Review: the placenta and developmental
programming: balancing fetal nutrient demands with maternal
resource allocation. Troph Res 2012;26:S237.
[34] Reynolds LP, Redmer DA. Uteroplacental vascular development and
placental function. J Anim Sci 1985;73:183951.
[35] Connolly DT. Vascular permeability factor: a unique regulator of
blood vessel function. J Cell Biochem 1991;47:21923.
[36] Leiser R, Dantzer V. Initial vascularization in the pig placenta: II
demonstration of gland and areola-gland subunits by casts. Anat
Rec 1994;238:32634.
[37] Wollenhaupt K, Welter H, Einspanier R, Manabe N, Brussow K-P.
Expression of epidermal growth factor receptor (EGF-R), vascular
endothelial growth factor receptor (VEGF-R) and broblast
growth factor receptor (FGF-R) system in porcine oviduct and

T.C. Santos et al. / Theriogenology 82 (2014) 834843

[38]

[39]

[40]

[41]

[42]

[43]

[44]

endometrium during the time of implantation. J Reprod Dev 2004;

50:26978.
Mayor P, Guimares DA, Le Pendu Y, Da Silva JV, Jori F, Lpez-Bjar M.
Reproductive performance of captive collared peccaries
(Tayassu tajacu) in the eastern Amazon. Anim Reprod Sci 2007;102:
8897.
Papa PC, Moura CEB, Artoni LP, Campos DB, Marques Junior JEB,
Ftima LA, et al. VEGF-system expression in different stages of
estrous cycle in the corpus luteum of non-treated and
superovulated water buffalo. Domest Anim Endocrinol 2007;33:
37989.
Reynolds LP, Kirsch JD, Kraft KC, Redme DA. Time-course of the
uterine response to estradiol-17b in ovariectomized ewes: expression of angiogenic factors. Biol Reprod 1998;59:61320.
Robb VA, Pepe GJ, Albrecht ED. Placental villous vascular endothelial
growth factor expression and vascularization after estrogen suppression during the last two-thirds of baboon pregnancy. Endocrine
2007;31:2607.
Winther H, Dantzer V. Co-localization of vascular endothelial
growth factor and its two receptors t-1 and kdr in the mink
placenta. Placenta 2001;5:45765.
Walter LM, Rogers PA, Girling JE. The role of progesterone in
endometrial angiogenesis in pregnant and ovariectomised mice.
Reproduction 2005;129:76577.
Wen L, Chen LH, Li HY, Chang SP, Liao CY, Tsui KH, et al. Roles of
estrogen and progesterone in endometrial hemodynamics and

[45]
[46]

[47]

[48]

[49]

[50]

[51]

843

vascular endothelial growth factor production. J Chin Med Assoc

2009;72:18893.
Conley AJ, Hinshelwood M. Mammalian aromatases. Reproduction
2001;121:68595.
Corbin CJ, Hughes AL, Heffelnger JR, Berger T, Waltzek TB, Roser JF,
et al. Evolution of suiform aromatases: ancestral duplication with
conservation of tissue-specic expression in the collared peccary
(Pecari tayassu). J Mol Evol 2007;65:40312.
Hinshelwood MM, Liu Z, Conley AJ, Simpson ER. Demonstration of
tissue-specic promoters in nonprimate species that express aromatase P450 in placentae. Biol Reprod 1995;53:11519.
Guerrin M, Moukadiri H, Chollet P, Moro F, Dutt K, Malecaze F, et al.
Vasculotropin/vascular endothelial growth factor is an autocrine
growth factor for human retinal pigment epithelial cells cultured
in vitro. J Cell Physiol 1995;164:38594.
Oberg-Welsh C, Sandler S, Andersson A, Welsh M. Effects of vascular
endothelial growth factor on pancreatic duct cell replication and the
insulin production of fetal islet-like cell clusters in vitro. Mol Cell
Endocrinol 1997;126:12532.
Sondell M, Lundborg G, Kanje M. Vascular endothelial growth factor
has neurotrophic activity and stimulates axonal outgrowth,
enhancing cell survival and Schwann cell proliferation in the peripheral nervous system. J Neurosci 1999;19:573140.
Sousa LMMC, Campos DB, Buratini J, Binelli M, Papa PC. Growth
factors and steroidogenesis in the bovine placenta. Anim Reprod
2008;5:512.