UNIVERSITE TOULOUSE III PAUL SABATIER

U.F.R SVT
THESE
Pour obtenir le grade de
DOCTEUR DE LUNIVERSITE TOULOUSE III
Discipline : Biosciences vgtales
Spcialit : Phytopathologie Cellulaire et Molculaire
Prsente par

Seyed Kazem SABBAGH

Soutenue le 17 Janvier 2008 14 heures
Salle de Sminaire de lIFR40
Ple de Biotechnologie Vgtale,
Chemin de Borde Rouge, 31326 Castanet-Tolosan

Titre :
Adaptation la pntration racinaire de deux Ustilaginaceae parasites du mas : Ustilago
maydis et Sporisorium reilianum Analyse microscopique et transcriptomique

JURY
Pr Patrice REY, ENITA de Bordeaux
Dr Philippe REIGNAULT, Universit Littoral Cte d'Opale
Pr. Grgory DECHAMP-GUILLAUME, ENSA de Toulouse
Pr Philippe DELAVAULT, Universit de Nantes
Pr Christophe ROUX, Universit de Toulouse

Rapporteur
Rapporteur
Examinateur
Examinateur
Directeur de thse

UNIVERSITE TOULOUSE III PAUL SABATIER

U.F.R SVT
THESE
Pour obtenir le grade de
DOCTEUR DE LUNIVERSITE TOULOUSE III
Discipline : Biosciences vgtales
Spcialit : Phytopathologie Cellulaire et Molculaire
Prsente par

Seyed Kazem SABBAGH

Le 17 Janvier 2008

Titre :
Adaptation la pntration racinaire de deux Ustilaginaceae parasites du mas : Ustilago
maydis et Sporisorium reilianum Analyse microscopique et transcriptomique

JURY
Pr Patrice REY, ENITA de Bordeaux
Dr Philippe REIGNAULT, Universit Littoral Cte d'Opale
Pr. Grgory DECHAMP-GUILLAUME, ENSA de Toulouse
Pr Philippe DELAVAULT, Universit de Nantes
Pr Christophe ROUX, Universit de Toulouse

Rapporteur
Rapporteur
Examinateur
Examinateur
Directeur de thse

Remerciements
Je tiens tout dabord spcialement exprimer ma gratitude de mon responsable de thse,
Monsieur le Professeur Christophe ROUX pour le confiance quil ma tmoigne en me
proposant ce sujet, pour sa disponibilit, sa gentillesse et son ouverture desprit tout au long
de cette thse.
Je remercie Professeur Guillaume Bcard de mavoir accueilli au sein de laboratoire et
dans son quipe.
Je remercie galement Dr. Nathalie Sjalon-Delmase pour ses conseils scientifique et sa
disponibilit.
Je tiens remercier Messieurs Patrice REY et Philippe REIGNAULT, Philippe DELAVAULT,
Grgory DECHAMP-GUILLAUME ont accept de participer au jury de thse. Je les en
remercie.
Je tiens remercier galement professeur Ahmad SARRAFI pour son aide prcieuse sur le
plan professionnel et galement Yves Martinez pour la dcouverte en toute dcontraction
de la microscopie.
Je remercie chaleureusement toute lquipe du Symbiose Endomycorhizienne et
Signalisation chez les vgtaux (les chercheurs et les techniciens) ainsi que tous les
personnel de laboratoire
En fine, un grand merci ma femme, Dr. Mahta MAZAHERI et ma petite fille Sahel pour leur
soutien chaleureux ainsi qu nos familles en IRAN.
Cette thse a t ralise dans le cadre dune bourse accord par le Ministre de lEducation
National et la Recherche en Iran. Jexprime ici mon remerciement pour le financement de
mes tudes en France ainsi quau service de lEducation de lAmbassade d Iran en France.

Table des matires

Table des matires

Table des matires ____________________________________________________________ 1

Rsum _____________________________________________________________________ 4
Summary ____________________________________________________________________ 5
Prambule ___________________________________________________________________ 6
Introduction gnrale __________________________________________________________ 7
Le monde des champignons : de lobservation microscopique lobservation des gnomes _______ 7
Les types trophiques des champignons _________________________________________________ 9
Les Ustilaginaceae : des basidiomyctes parasites biotrophes facultatifs______________________ 12
Les Ustilaginaceae au sein des Basidiomycotina _______________________________________ 12
Diversit des Ustilaginaceae ______________________________________________________ 14
Divergence de Ustilaginaceae et domestication des plantes _____________________________ 15
Le cycle des Ustilaginaceae _______________________________________________________ 16
Cycle typique et variations _______________________________________________________ 16
Mating-type chez les Ustilaginaceae ________________________________________________ 21
Solopathognie chez les Ustilaginaceae _____________________________________________ 23
Le mas, plante modle en pathologie vgtale ? ________________________________________ 24
Le mas _______________________________________________________________________ 24
Rsistance du mas aux charbons __________________________________________________ 25
La rhizosphre ___________________________________________________________________ 26
Le sol, une matrice entre les organismes du sol et les plantes ____________________________ 26
Les exsudats racinaires __________________________________________________________ 26
Rle des exsudats racinaires dans les tapes prcoces des interactions racinaires ____________ 27
Les strigolactones ______________________________________________________________ 28
Objectifs de la thse_______________________________________________________________ 30
1-Quel est le taux de souches solopathognes formes par diffrentes Ustilaginaceae ? _______ 30
2-Ustilago maydis est il un agent pathogne racinaire ?_________________________________ 30
3-Quelle est la rponse des Ustilaginaceae aux strigolactones ? __________________________ 31

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de

dissmination ? ______________________________________________________________ 33
Avant Propos _____________________________________________________________________ 33
1-1 Rsum ______________________________________________________________________ 34

Table des matires

1-2 Introduction___________________________________________________________________ 34
1-3 Materials and Methods__________________________________________________________ 36
Fungal material _________________________________________________________________________ 36
Protocole of obtention of solopathogenic strains of S. reilianum __________________________________ 36
Comparison of fuzzy strain production _______________________________________________________ 37
Plant infection test ______________________________________________________________________ 37
Microscopic observations _________________________________________________________________ 37
Molecular analysis. ______________________________________________________________________ 37

1-4 RESULTS ______________________________________________________________________ 39

Isolation of fuzzy strains of S. reilianum ______________________________________________________ 39
Stable fuzzy strains of S. reilianum are monocaryotic and diploid __________________________________ 40
Monocaryotic diploid fuzzy strains of S. reilianum are solopathogen, but do not form sori ______________ 41
Frequency of production of solopathogenic strains differs according to Ustilaginaceae species __________ 41

1-5 Conclusion ____________________________________________________________________ 42

1-6 References ____________________________________________________________________ 44

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez
les plantes hte et non-hte ____________________________________________________ 46
Avant Propos _____________________________________________________________________ 46
II-1 Abstract ______________________________________________________________________ 47
II-2 Introduction __________________________________________________________________ 47
II-3 Materials and methods __________________________________________________________ 49
Fungal strains and culture condition_________________________________________________________ 49
Plants and culture conditions ______________________________________________________________ 49
Microscopic observations _________________________________________________________________ 49
PCR detection __________________________________________________________________________ 50
Effect of GR24 on cell respiration ___________________________________________________________ 50
RNA extraction and RT-PCR________________________________________________________________ 51
Primer design and qRT-PCR________________________________________________________________ 51

II-4 Results _______________________________________________________________________ 53

Ustilago maydis infects maize roots _________________________________________________________ 53
Maize root infection by Ustilago maydis didnt cause symptoms___________________________________ 55
Ustilago maydis can infect Medicago roots ___________________________________________________ 55
A strigolactone analogue stimulates U.maydis cell respiration ____________________________________ 57

Table des matires

II-5 Discussion ____________________________________________________________________ 58

II-6 References ____________________________________________________________________ 60

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un

analogue de synthse de strigolactone ___________________________________________ 63
Avant propos _____________________________________________________________________ 63
III-1 Summary ____________________________________________________________________ 65
III-2 Introduction __________________________________________________________________ 65
III-3Experimental procedures ________________________________________________________ 66
Fungal strain and cultural condition _________________________________________________________ 66
GR24 induction _________________________________________________________________________ 66
Cell respiration _________________________________________________________________________ 67
RNA isolation and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) _______________________ 67
Suppressive Subtractive Hybridization (SSH) __________________________________________________ 68
Probe labelling _________________________________________________________________________ 68
cDNA array and hybridization ______________________________________________________________ 69
Detection and quantification of hybridization signals ___________________________________________ 69
Sequence analysis and annotation __________________________________________________________ 70
Primers design__________________________________________________________________________ 71
RT-qPCR_______________________________________________________________________________ 71

III-4 Results ______________________________________________________________________ 71

GR24 increases cell respiration of S. reilianum _________________________________________________ 71
Construction of SSH cDNA libraries and macroarray design _______________________________________ 72
Hybridization of macroarray _______________________________________________________________ 73
cDNA sequence analysis __________________________________________________________________ 73
RT-q PCR ______________________________________________________________________________ 75

III-5 Discussion ____________________________________________________________________ 77

III-6 References ___________________________________________________________________ 78
Supplementary data _______________________________________________________________ 80

Discussion et perspectives _____________________________________________________ 85

Les Ustilaginaceae : modles fongiques dtude des interactions biotrophes parasites racinaires _ 85
Les Ustilaginaceae, modles dtude pour la perception des strigolactones ___________________ 88

BIBLIOGRAPHIE GENERALE _____________________________________________________ 92

Rsum

Rsum

Les Ustilaginaceae constituent une famille de champignons basidiomyctes parasitant essentiellement les
Poaceae (gramines). Les 33 genres constituant cette famille induisent sur leur hte une pathologie appele
charbon, du fait de la formation de sores remplis de millions de spores noirtres paroi paisse : les tliospores.
Une espce reprsentative de cette famille, Ustilago maydis, responsable du charbon commun du mas, sest
impose au cours des 3 dernires dcennies comme un modle majeur en pathologie vgtale pour 3 raisons
essentielles : i) linduction de la physiologie parasitaire, de mme que sa morphologie (transition levure-myclium)
sont contrles par les gnes de compatibilit sexuelle, ce qui a permis den tudier les mcanismes de
transduction de signaux ; ii) les nombreux outils molculaires disponibles (vecteurs de transformation, gnes de
slection, promoteurs inductibles) en font un modle de gnie gntique ; iii) le gnome de cette espce, mis
disposition de la communaut scientifique en avril 2004, permet dsormais denvisager des tudes globales
sappuyant sur des ressources gnomiques exhaustives. Si cette espce constitue un formidable outil de
laboratoire, les connaissances sur sa biologie restent encore incompltes. Mon travail de thse a consist tablir
les capacits dinfection racinaire dUstilago maydis en tablissant un comparatif avec une espce trs proche
phylogntiquement : Sporisorium reilianum f.sp. zeae. Cette dernire espce est responsable du charbon des
inflorescences du mas. S. reilianum infecte uniquement via les racines, crot in planta vers le mristme caulinaire
apical et sporule lors de la transition florale, aprs une vie biotrophe endophyte de plusieurs semaines. Dans une
premire partie de mes travaux, jai tudi la capacit de trois espces dUstilaginaceae produire des souches
solopathognes, souches infectieuses en absence de croisement avec une souche compatible. Il apparat une
corrlation entre la frquence de production de telles cellules et le mode de dissmination : frquente chez
lespce dissmine de faon arienne et rare chez lespce tellurique. La capacit dUstilago maydis est
intermdiaire, laissant supposer que la voie de pntration racinaire pourrait intervenir dans ltiologie de la
maladie. Jai ensuite suivi par diffrentes approches microscopiques et par PCR les processus de la pntration
racinaire du mas par Ustilago maydis. Aprs pntration, le champignon se dveloppe majoritairement de faon
intracellulaire et envahit les racines. Nos analyses de diagnostic PCR montrent que le champignon peut atteindre
les tissus vgtatifs ariens. La formation de sore na toutefois pu tre observe sur la varit teste. Ainsi la mise
en vidence de la capacit dUstilago maydis pntrer au niveau racinaire fait de cet agent pathogne, modle
gntique, une espce de choix pour tudier les mcanismes dinfection racinaire des plantes, particulirement en
comparaison avec des symbiotes racinaires biotrophes. Dans une dernire partie de mon travail, jai tudi la
perception par les Ustilaginaceae de molcules prsentes dans les exsudats racinaires : les strigolactones. Ces
composs induisent la respiration cellulaire dU. maydis et de S. reilianum. Une analyse du transcriptome par
construction dune banque SSH de S. reilianum en rponse un analogue de strigolactones a rvl une induction
rapide de gnes de la respiration et du dveloppement cellulaire. Ces molcules, dj identifies pour leur rle
signaltique dans linteraction plante parasite-plante hte et dans linteraction endomycorhizienne, pourraient
ainsi avoir une incidence plus large dans lorganisation de la flore rhizosphrique.

Summary

Summary

Ustilaginaceae are a family of basidiomycete fungi infecting grass plants (Poaceae). All species of
the 33 genera belonging to this family are responsive of a smut disease, due to the presence of sori full
of black encysted spores: teliospores. The representative species of this family, Ustilago maydis, the
causal agent of the common smut of maize, became since the 3 last decades a major model in plant
pathology. The discovery that mating type genes control parasitism induction and morphology (yeasthypha transition) allowed investigating of cell transduction mechanism. Second, this species is a model
in genetic analysis as many molecular tools were developed (transformation vector, selectable marker
genes, inducible promoters ). Third its genome is available since April 2004, and it is now possible to
perform global genetic studies based on complete genomic resources. Although this species is a
powerful tool for laboratory uses, some knowledge on its biology are still missing. My thesis work
consisted in evaluating the ability of two phylogenetically related Ustilaginaceae, U. maydis and S.
reilianum f.sp. zeae, to interact with plant roots. S. reilianum f.sp. zeae causes maize head smut. This
species infects maize roots, grows up to the caulinar apex as a biotrophic endophyte during several
weeks, then sporulates when floral transition is induced. In a first part, I compared the ability of three
species of Ustilaginaceae to produce solopathogen strains i.e. infectious strains in absence of mating. I
observed a correlation between the frequency of formation of solopathogenic form and the dispersal
way of each species: from a high frequency for airborne species to low frequency for soil-borne one. U.
maydis present an intermediate behavior, suggesting that root infection could participate in the etiology
of this disease. Root infection process was investigated in a second part by using different microscopic
techniques and PCR detection. After penetration, the fungus grows mostly intracellularly and invades
root tissue. PCR detection revealed that the fungus could migrate systemically up to the aerial tissue.
However we didnt observe formation of sori in the maize variety used. As conclusion, this result makes
U. maydis as a paradigm to study mechanism of root infection by a biotrophe pathogen. In a third part
of my works, I investigated the perception by U. maydis and S. reilianum of root exuded molecules:
strigolactones. These molecules induce the cell respiration on the two species. A transcriptomic SSHbased analysis of a S. reilianum strain in presence of a strigolactone analogue revealed a rapid induction
of genes involved in cell respiration and in cell division. These molecules, already described in plantparasitic weeds and plant-arbuscular mycorrhizal fungi interactions, could be involved in a larger extend
in the establishment of the rhizospheric flora.

Prambule

Prambule

Ce travail constitue la conclusion de quatre annes de travaux au laboratoire Surface Cellulaire

et Signalisation chez les Vgtaux, UMR Universit Toulouse III-CNRS, dans lquipe actuellement
nomme Symbiose Endomycorhizienne et Signalisation Cellulaire dirige par le Pr Guillaume Bcard. Ces
travaux sinscrivent dans le projet dquipe qui porte actuellement sur ltude de la perception de
molcules impliqus dans les phases prcoces dinteraction plante-champignon endomycorhizien, et
moyen terme sur les mcanismes mis en jeu dans de dveloppement biotrophe in planta de ces
champignons. Ces champignons tant inaptes toute manipulation gntique (absence de systme de
transformation donc aucun promoteur valid ou systme de slection connus ; sexualit inconnue ;
plodie et taille du gnome controverses ; tentative de squenage du gnome en cours depuis 4 ans)
une stratgie dtude consisterait utiliser un organisme de validation des hypothses permettant
lexpression htrologue de gnes identifis sur les champignons endomycorhiziens par des techniques
transcriptomiques ou gnomiques. Les mots cls pour obtenir de tels organismes sont infection
racinaire et biotrophie . Cest dans ce contexte que sinsre dsormais ce travail, initi en 2002
aprs quil eut t observ une induction de la respiration cellulaire par les exsudats racinaires sur un
champignon du sol, Sporisorium reilianum.

Introduction gnrale

Introduction gnrale
Le monde des champignons : de lobservation microscopique lobservation des gnomes
Les

champignons

constituent

un

phylum part entire parmi les eucaryotes.

Plus de 80000 espces sont actuellement
dcrites et nommes (Hawksworth DL. 2001).
Compar

au

vertigineux

travail

des

entomologistes qui ont propos prs de 1

million de binmes taxonomiques et autant de
descriptions, on pourrait croire la faible
diversit du groupe des champignons. Cette
image trompeuse peut tenir la discrtion et la
difficult

dobservation

microscopiques.

Prenant

des
en

organismes
compte

les

espces collectes mais non dcrites, le

nombre despces associes au groupe des
insectes, les rgions du globe qui restent Figure 1 : L'arbre du vivant.
encore explorer par les mycologues, que ce

Vision dartiste sur www.tolweb.org/tree/

soit les zones de forte diversit comme les forts quatoriales, mais aussi les zones o la curiosit
humaine sest peu exerce comme en milieu marin, certains auteurs ont estim plus de 1,5 million le
nombre despces fongiques (Hawksworth, 2001). Au rythme actuel des descriptions, de lordre de
quelques centaines despces nouvelles par an, il faudra quelques milliers dannes pour recenser la
diversit des espces existantes actuellement, et il est probable que nombre dentre elles auront
disparus avec la rgression des zones cologiquement fragiles.
La systmatique de ce vaste groupe dorganismes prsente bien des difficults. Principales
raisons cela, la raret des caractres ontogniques (bien peu de caractres ancestraux et drivs
peuvent tre dduits des processus de dveloppement chez les champignons) et la quasi-absence de
donnes palontologiques. Certes quelques clbres chantillons reliques sont disponibles, inclus dans
lambre fossile (Gewin, 2007; Poinar Jr & Buckley, 2007) ou observs dans des tissus vgtaux cas de
structure rappelant les structures arbusculaires des actuels champignons endomycorhiziens (Remy et
al., 1994). Mais ces chantillons sont rares, les champignons sont des organismes lappareil vgtatif
microscopique et se conservant peu. Ainsi ne sont disponibles pour tenter dtablir une classification

Introduction gnrale

naturelle des champignons que les seuls caractres morphologiques. Pour aussi perspicaces que furent
les mycologues dans leurs descriptions et leurs comparaisons, ils ne pouvaient chapper aux nombreux
piges de la convergence morphologique que leur tendaient ces espces aux caractres parfois trs
discrets. Lutilisation des donnes nuclotidiques dans les phylognies molculaires a dbut en milieu
des annes 70. Pour des raisons techniques, ces premires analyses ont t ralises sur des ARN
ribosomiques, abondants dans la cellule vgtale et pouvant tre spars par centrifugation. Ainsi ds
1984 tait propos une premire brve rvision de la classification des Ustilaginales par comparaison
des squences ARN 5S chez 10 espces dUstilaginaceae, isoles par centrifugation sur chlorure de
csium puis squences selon la technique de Sanger (Blanz & Gottschalk, 1984). Mais il faut attendre
lavnement de lamplification gnique par PCR en 1986 (Mullis et al., 1986) et surtout dans sa forme
actuelle en 1988 (utilisation de DNA polymrase thermostable, Saiki et al., 1988) pour voir ces
approches se dmocratiser dans les laboratoires. Lapplication en phylognie molculaire est immdiate
chez les organismes dont la diffrenciation sur la base des critres morphologiques tait difficile. Le
gne, avec lvolution graduelle de squence au cours des temps, devient la donne palontologique
qui faisait dfaut. En mycologie, la publication dun grand choix damorces ribosomiques dites
universelles (Bruns et al., 1991; Gardes & Bruns, 1993; White et al., 1990) permettra trs rapidement la
multiplicit des tudes. Des avances considrables ont t ralises ces dernires annes sur la
classification des champignons. La classification des champignons labore depuis deux cents ans a ainsi
t profondment remanie, aussi bien pour certaines grandes lignes (qui prtendrait encore que les
Oomycota, ex phycomyctes, sont encore des champignons ?) que dans le dtail des diffrents taxons.
Linterrogation de banques de donnes gntiques (Genbank, EMBL) au 8/12/2007 rvle que
68166 squences ribosomiques fongiques de type ITS1-5.8S-ITS2, 67070 squences 18S et 47792
squences 28S sont prsentes. Il ne faut pas pour autant en conclure que la quasi-totalit des espces
identifies ce jour (70 000) ont t analyses au niveau molculaire, de nombreuses redondances sont
prsentes, et linterrogation taxonomique ne recense que 12155 binmes d'espces fongiques.
Mais les mthodologies et les concepts sont tablis et les grandes lignes taxonomiques sont proposes
avec une plus grande robustesse des caractres. Le monde des champignons souvre nous avec une
nouvelle cohrence.
Ce recensement de la diversit et des ressources naturelles nen est qu ses dbuts que dj se profile
une nouvelle rvolution des connaissances. Genbank recense 10 gnomes fongiques complets, 65 en
cours dassemblage, et 46 en cours de squenage, soit 121 gnomes fongiques allant de 2,5 Mb pour
Pneumocystis murina 81.5 Mb pour Puccinia graminis (pour 193 gnomes animaux - allant de 104 Mb
pour un nmatode 3800 Mb pour le kangourou Macropus eugenii - et 46 gnomes vgtaux - allant de
212,5 Mb pour Ostreococcus tauri 2365 Mb pour le mas). Si lon prend en considration que GenBank
ne recense pas lensemble des gnomes disponibles ou en cours de squenage, on comprend que des

Introduction gnrale

analyses comparatives tant sur la syntnie des gnomes que sur leur squence aient dj commenc
(Kuramae et al., 2006). Une tude rcente effectue sur 33 gnomes fongiques (Kuramae et al., 2007) a
valu la pertinence de 4852 gnes orthologues pour dfinir des phylognies, ainsi que les algorithmes
applicables pour de telles analyses multiples. A nen pas douter, le temps de la mtagnomique
fongique est arriv.
A travers ce bref aperu nous mesurons leffort consenti en systmatique et en gnomique fongique
depuis 15 ans.

Les types trophiques des champignons

La grande majorit des champignons sont saprotrophes, c'est--dire prolifrant sur de la matire
inerte, approximativement 10% de toutes les espces connues peuvent causer des maladies de la plante
(Hibbett et al., 2007). Qui des saprophytes ou des parasites seraient apparus les premiers ? Il nest pas
certain que cette question se pose en ces termes simplistes, mais elle rvle notre Il nest pas certain
que cette question se pose en ces termes simplistes, mais elle rvle notre mconnaissance actuelle de
lvolution globale des champignons. Des approches de phylognie globale base sur la comparaison de
plusieurs gnes (James et al., 2006) nont pu apporter de rponse formelle. Tout au plus ces auteurs
proposent que les premiers basidiomyctes furent parasites. En effet les rouilles (Urdiniomyctes) et
charbons (Ustilaginomyctes) sont en position basale de cette branche (figure 2). Rien ne permet de
certifier toutefois que lanctre des espces actuelles de ces groupes fongiques ntait pas saprotrophe.
La mtagnomique apportera peut tre de nouvelles rvlations sur ces rapports entre clades, mais ne
rpondra pas toutes les interrogations.

Introduction gnrale

Figure 2 : phylognie des champignons.

Analyse combinant six gnes. (James et al 2006)

10

Introduction gnrale

11

Les mcanismes de parasitisme chez les champignons sont diversifis. Certains de ces champignons sont
des parasites obligatoires, associs leur plante hte tout au long de leur cycle de vie, tandis que
dautres parasites facultatifs ninfectent les plantes que pour accomplir une partie de leur cycle,
gnralement la reproduction sexue.
De nombreux parasites sont des biotrophes. Ce terme dans
son acception stricte signifie que le champignon tablie avec la
plante une zone dinterface. Parmi ces parasites, certains sont des
parasites biotrophes obligatoires (les agents des rouilles, de lodium)
dautres des parasites biotrophes facultatifs (les agents des
charbons). Une interface membrane membrane seffectue entre
cellule fongique et cellule vgtale. Une rgulation fine de la
signalisation cellulaire et de lexpression gnique, encore dcouvrir,
permet au champignon de se fournir en nutriments auprs de la
cellule vgtale. Ce type dinteraction, apparue trs tt dans les
interactions plante-champignon avec la mise en place de linteraction
mutualiste endomycorhizienne, a conduit M. Parniske proposer le
nologisme symbiosome pour dcrire cette zone dinterface

Figure 3 : interaction biotrophes.

(figure 3 ; Parniske, 2000). Quoiquil en soit, ce procd (a) Haustoria de Peronospora (Oomycota)
dans une cellule foliaire de msophylle (b)

dinteraction semble avoir connu un certain succs dans les Haustorium de Blumeria graminis dans une
diffrentes branches volutives des champignons.
Enfin nombreux champignons sont ncrotrophes, tuant les

cellule foliaire pidermique. (c) Arbuscule

de Glomus sp. Dans une cellule racinaire
corticale.

cellules htes grce leur batterie de gnes dagressivit : toxines spcifiques ou non spcifiques,
scrtion denzymes lytiques, protases et inhibiteurs de protases. Ils peuvent ainsi rcuprer les
nutriments sur les ruines de la structure vgtale.
Cette diffrence dinteraction entraine des stratgies diffrentes de contournement des
ractions de dfense de lhte. Les champignons biotrophes obligatoires, tels que les agents des rouilles
et les odiums, tablissent un long contact intime avec leurs plants htes, retardant leur mort et limitant
les rponses de dfense de cellules, du moins durant les phases prcoces de linfection. Le squenage
du gnome dUstilago maydis vient de rvler la prsence de clusters de gnes codant pour de
nombreux petits peptides de fonction inconnue (Kamper et al., 2006). La dltion de ces clusters de
gnes ne permet plus lespce dtablir une interaction biotrophe avec la cellule hte et une
hypothse serait que ces peptides ont un rle de confusion des ractions de dfense de la cellule hte.
De leur ct les agents pathognes ncrotrophes sont moins prcautionneux avec les tissus infects : ils
peuvent causer la ncrose avant la pntration et ainsi crotre dans rencontrer de difficults.

Introduction gnrale

Les Ustilaginaceae : des basidiomyctes parasites biotrophes facultatifs

Les Ustilaginaceae constituent une famille de champignons pathognes responsables de maladie
des Poaceae appeles charbon, en raison de la formation de sores remplis de spores noirtres. Le
spectre dhte de ces agents pathognes est toujours trs troit. Cette particularit peut tre corrle
linteraction biotrophe que toutes ces espces tablissent avec leur hte. Cette interaction ncessite
une collaboration physiologique et gntique entre les cellules des deux organismes, et lon peut
admettre que ceci rsulte dune covolution troite entre les deux partenaires. Le parasitisme biotrophe
sur les Poaceae nest pas une spcificit des Ustilaginaceae : les agents des rouilles et de lodium par
exemple sont des parasites biotrophes majeurs en phytopathologie. Une distinction toutefois est que
ces derniers sont des parasites obligatoires, ne pouvant se maintenir que sur les cultures ou sur les
plantes adventices. Les Ustilaginaceae sont pour leur part des parasites biotrophes facultatifs, que lon
peut maintenir en culture sur un milieu glos riche. Il faut toutefois noter que dans de telles conditions,
on peut induire les premires phases de la sexualit (fusion de souches compatibles), mais cette fusion
ne se poursuit jamais par la caryogamie et linduction de la miose.
Les Ustilaginaceae infectent souvent les pices florales et limpact sur la production
agronomique peut tre lev (Agrios, 1988). La gestion des tolrances et le traitement des semences
ont contribu limiter fortement lincidence de ces maladies. Malgr tout, certains de ces agents
pathognes sont trs prsents sur les cultures. Tel est le cas dUstilago maydis, prsent dans toutes les
zones mascicoles, induisant des pertes pouvant atteindre sur varits sensibles 30 % de la production et
ncessitant un suivi strict dans le cas de production de mas semence. Par ailleurs, le dveloppement de
pratiques culturales plus respectueuses pour lenvironnement, limitant lutilisation de certaines
molcules antifongiques notamment dans le traitement de semence, remet sous les feux de lactualit
phytopathologique plusieurs de ces espces spcialises dans linfection des jeunes plantules en
germination.
Les Ustilaginaceae au sein des Basidiomycotina
Les basidiomyctes (Basidiomycotina) constituent une division des champignons qui regroupe
des espces caractrises par des miospores formes de faon exogne partir de cellules
spcialises, les basides. Cette division est forme denviron 22.300 espces distinctes, soit plus dun
quart des champignons dcrits actuellement. Morphologiquement, les Basidiomycotina ont t
traditionnellement diviss en Homobasidiomyctes (les champignons carpophore) et les
Heterobasidiomyctes parmi lesquels les tliomyctes (basides formes partir de spores dissmines :
agents responsables des rouilles et des charbons). Mais cette dichotomie a t invalide par les analyses
molculaires. Dsormais, sur la base de caractres morphologiques et molculaires (gnes ribosomiques

12

Introduction gnrale

18S, ITS, 28S) trois groupes majeurs sont diffrencis : Agaricomycotina, Ustilaginomycotina et
Pucciniomycotina (Bauer, 1997; Begerow et al., 1997).

Figure 4 : Phylognie des Basidiomyctes.

Ralise par comparaison des gnes ribosomiques LSU + SSU (Bauer et al., 2006)

La classe des Ustilaginomycotina regroupe tout au plus 70 genres, avec environ 1400 espces.
Ce sont tous des parasites des phanrogames. La question de la monophylie des espces responsables
de charbons sest pose. Les relations phylogntiques entre ces espces fongiques traditionnellement

13

Introduction gnrale

regroupes dans la famille des Ustilaginales (genres Microbotryum, Sphacelotheca, Ustilago,

Sporisorium) ont t prcises par diffrentes analyses par comparaison des gnes ribosomiques
(Begerow et al., 1997; Roux et al., 1998). Ces analyses appuient la division des charbons en deux
groupes : les Ustilaginaceae s. str. regroupent les espces responsables des charbons sur inflorescences
des Poaceae et des Juncaceae, et les Microbotryaceae regroupent les espces responsables de charbon
sur diffrentes Dicotyldones (souvent au niveau des tamines), et sont inclus dans les
Pucciniomycotina.
Diversit des Ustilaginaceae
Les Ustilaginaceae constituent une famille dont la taxinomie a t fortement remanie ces
dernires annes.

Figure 5 : Phylognie des Ustilaginaceae.

Ralise par comparaison des rgions ribosomiques ITS. La position relative dU. maydis et de S. reilianum est surligne en
rouge (Roux, C non publi)

14

Introduction gnrale

Cette famille comprend 600 espces connues ce jour (Piepenbring, 2003), toutes parasites des
Poaceae. Deux genres majeurs constituent actuellement cette famille : Sporisorium et Ustilago. La
distinction entre ces deux genres nest pas clairement tablie tant par les caractres molculaires que
par les caractres morphologiques. Les analyses bases au niveau des rgions ITS (internal transcribed
spacer, ITS1-5.8S-ITS2) rvle que lespce Ustilago maydis particulirement est un taxon intermdiaire
entre les Ustilago typiques et les Sporisorium (Stoll et al., 2005; Stoll et al., 2003).
Divergence de Ustilaginaceae et domestication des plantes
Hormis des relevs sur les anctres sauvages du mas, les teosintes Zea sp., Ustilago maydis est
une espce dcrite comme uniquement parasite du mas Zea mays L.. Sporisorium reilianum est une
espce parasite sur mas mais aussi sur diffrentes espces de sorgho. Il a t dfini que des populations
diffrentes infectent les 2 plantes, formant ainsi deux formes spciales : S. reilianum f.sp. zeae parasite
du mas, S. reilianum f.sp. reilianum parasite du sorgho. Frederiksen (Frederiksen, 1977) a montr par
des infections croises que cette distinction est justifie, hormis pour certaines varits de mas doux
qui se montrent hte de S. reilianum f.sp. reilianum. Etant donne la proximit phylogntique entre ces
deux espces, certains auteurs ont cherch dfinir si cette distinction entre ces deux espces
fongiques et entre formes spciales de S. reilianum pouvait tre concomitante la diffrenciation des
espces vgtales htes (Munkacsi et al., 2007). Au-del de ces deux espces, la question porte sur
lincidence de la domestication des espces vgtales cultives sur la sparation gntique de
populations dagents pathognes, et donc sur les processus de spciation.
Munkacsi et al. (2007) ont ainsi choisi quatre espces responsables de charbon : U. maydis
parasite du mas, S. reilianum parasite du mas et du sorgho, S. sorghi parasite du sorgho, S.
scitamineum parasite de la canne sucre. Par une analyse de vitesse de substitution au niveau de
plusieurs gnes fongiques (calculs dhorloge molculaires), et en prenant pour date de domestication
des espces vgtales -10.000 ans, les auteurs concluent une divergence des espces fongiques avant
le dveloppement de lagriculture du fait dune sparation des espces fongiques datant de plusieurs
millions dannes. La domestication des espces vgtales nest pas une chelle de temps susceptible
dtre lorigine des divergences actuelles des espces responsables de charbon des Poaceae, du moins
ces isolements gntiques ne sont pas encore perceptibles. Les auteurs analysent ensuite partir de
donnes historiques sur les civilisations andines la sparation entre formes spciales de S. reilianum. Le
fait que S. reilianum ntait pas rfrenc sur le mas avant lintroduction du sorgho au XVIIme sicle
dans le Nouveau Monde souligne que limpact de lHomme et de la domestication des espces vgtales
sur lapparition de ces formes spciales tiendrait dans ce cas lintroduction dune espce hte nouvelle
et une adaptation de souches prexistantes ce nouvel hte, et non une divergence ancienne de cet
agent pathogne.

15

Introduction gnrale

Le cycle des Ustilaginaceae

La sexualit des Ustilaginaceae est lorigine de lintrt port ce groupe de champignons.
Deux raisons cela : i) ces champignons se dveloppent in vitro sous une forme levure, facile
manipuler ; ii) ce sont des champignons dimorphiques passant dune forme levure haplode saprotrophe
une forme filamenteuse dicaryotique parasite. Ainsi ds le dbut du XXme sicle (Hanna, 1929;
Kniep, 1926), il a t observ la possibilit deffectuer des croisements intra et interspcifiques qui ont
pour effet de gnrer des structures filamenteuses. Ces travaux, initialement trs descriptifs se sont
ensuite orients vers lhritabilit des facteurs de compatibilit et ont particip llaboration des bases
gntiques de la compatibilit fongique par Holliday (Holliday, 1974).
Les Ustilaginaceae sont le plus souvent htrothalliques, avec un systme de compatibilit
monognique-bipolaire (Ustilago hordei) ou dignique-ttrapolaire (Ustilago maydis). Comme la plupart
des Basidiomyctes, une longue phase dicaryotique est observe chez les Ustilaginaceae, mais celle-ci
nest observe quin planta.
Le parasitisme des Ustilaginaceae comprend gnralement trois phases :
1) Une phase saprotrophe o le champignon est prsent sous forme levure, peut crotre la
surface des tissus ou dans le sol. La fusion de deux souches compatibles gnre une souche dicaryotique
infectieuse.
2) Une phase biotrophie o le champignon se dveloppe dans les tissus infects sous forme
filamenteuse de faon le plus souvent intracellulaire. Ce dveloppement se caractrise par un
comportement biotrophe de linfection : le champignon traverse les cellules, entour dune membrane
de biotrophie. Cette phase du parasitisme, qui correspond une phase de croissance systmique plus
ou moins longue selon les espces, induit une trs faible symptomatologie.
3) Une phase ncrotrophe, observe la fin du cycle de dveloppement lorsque la sporognse
du champignon est induite.
Cycle typique et variations
Le cycle de vie typique gnralement propos pour les Ustilaginaceae est le cycle dUstilago maydis

Ustilago maydis

16

Introduction gnrale

Figure 6 : illustration du cycle dU. maydis (Kamper 2006)

La figure 6a rsume ce cycle illustr dans les photographies suivantes. Comme toutes les Ustilaginaceae,
U. maydis produit dans des sores (Fig 6-b, g) des spores enkystes dicaryotiques qui assurent la
dissmination de lespce : les tliospores (Fig 6-i). Celles-ci sont dissmines par le vent et restent au
niveau du sol. Passe la mauvaise saison, la caryogamie seffectue au niveau des tliospores, puis une
baside se forme, produisant des basidiospores levuriformes haplodes saprotrophes (Fig6-c). Chaque
tliospores produit 4 types de cellules compatibles deux deux. Lors de la conjugaison cellulaire, les
cellules arrtent transitoirement leur cycle cellulaire en phase G2 (Garcia-Muse et al., 2003), forment
des tubes de conjugaison (Snetselaar & Mims, 1992; Spellig et al., 1994) et gnrent un filament
dicaryotique (figure 6-d). Ce filament va former une structure de type appressorium, lgrement renfle
(fig6-e, f), qui permettra linfection de lhte, le mas. Seules les parties ariennes semblent tre
infectes par cette espce. Cette infection gnre la formation dune galle : sores forms par des

17

Introduction gnrale

cellules hypertrophies de lhte (dformation des organes) dans lesquels le champignon sporule (fig 6g, h, i), dtruisant les structures vgtales.
Plusieurs aspects de ce cycle ont t dcrits en dtail.
Lors de la formation de l'appressorium un matriel fibreux se produit entre l'appressorium et
le paroi de cellule hte qui pourraient indiquer la production d'adhsines (Snetselaar & Mims, 1993a).
Les appressoria constitus par U. maydis ne sont pas les structures trs prominentes mais apparaissent
seulement comme des gonflements en bout dhyphe, ils ne sont pas isols des hyphes par un septum
avant la pntration, et il n'y a aucune vidence de mlanisation. A ces gards, l'appressorium dU
maydis diffre sensiblement des appressoria produits par Magnaporthe grisea et Colletotrichum
graminicola o l'entre se produit par la force mcanique par mlanisation de lappressorium et
cration dune forte pression de turgescence (Bechinger et al., 1999; de Jong et al., 1997).
Plus rcemment, en utilisant des souches transformantes GFP, il a t montr que la
pntration peut prcder la formation de l'appressorium. Ceci a laiss suggrer un mode de
pntration principalement bas sur la libration denzymes lytiques (Snetselaar & Mims, 1992;
Snetselaar & Mims, 1993). La question qui reste adresser est comment le champignon parvient
arrter et rorienter sa croissance d'un angle de 90 degrs ce stade, comment des enzymes de
dgradation de la paroi cellulaire vgtale sont excrtes avec prcision au point d'entre. Comme par
ailleurs il n'a pas t possible de produire jusquici des structures d'infection in vitro, cela indiquerait le
besoin de certains signaux de la plante impliqus dans le dclenchement des mcanismes de
pntration, et accessoirement dans la diffrentiation dappressorium.
Bien que les parois cellulaires de la plantes htes soient traverses laissant passer les hyphes,
le plasmalemme de la cellule hte reste intact et sinvagine autour des hyphes intracellulaires
(Snetselaar & Mims, 1992). Plus prcisment, il sagit de pseudo hyphes : seules les parties apicales sont
viables. Les parties plus anciennes dgnrent, se vident de leur cytoplasme, sont deviennent isoles et
s'effondrent. Entre 3 et 4 jours aprs linfection, les hyphes commencent brancher et former des
tliospores. Les cellules vgtales deviennent alors ncroses. Les facteurs de contrle qui dclenchent
cette transition, susceptible d'impliquer des divisions mitotiques, sont actuellement inconnus. Ce
changement dramatique du mode de croissance concide avec le commencement du dveloppement de
tumeur autour de 5 jours aprs linfection. 9 jours aprs linfection, les structures fongiques sont
entours par un mucilage dont lorigine nest pas encore identifie (polysaccharides exsuds par le
champignon, produits de dgradation du contenu cellulaire).

Sporisorium reilianum f.sp. zeae

Appartenant la mme famille quU. maydis et parasitant la mme espce vgtale, S. reilianum
zeae est responsable du charbon des inflorescences (Matyac & Kommedahl, 1985a, b). Il fut dcrit pour

18

Introduction gnrale

19

la premire fois par Khn en 1875, qui le nomma Ustilago reiliana en hommage au Dr Reil qui le
dcouvrit en Egypte en 1868. Ce champignon a t depuis observ dans toutes les rgions du monde. Sa
taxonomie actuelle est Sporisorium reilianum (Langdon & Fullerton, 1975).
Son cycle de dveloppement est comparable celui dU. maydis. Il convient toutefois den souligner les
diffrences.
La symptomatologie entre ces deux charbons diffre.
Dune part les sores forms par S. reilianum napparaissent
quau niveau des inflorescences, il ny a jamais de galle sur
lappareil vgtatif (do le nom donn la maladie : charbon
des inflorescences). Les sores correspondent la formation
damas noirtre initialement entoure dun priderme dorigine
fongique mais form en dehors des tissus de la plante : il ny a
pas formation de galle. Enfin le sore, form le plus souvent au
niveau de lpi, correspond une transformation totale de lpi
o seuls subsistent les faisceaux libro-ligneux du rachis et les
glumes. Il persiste rarement des grains lintrieur. Cette
disparition totale des grains de lpi explique que cette Figure 7 : formation de sores sur panicule
(haut) et pi (bas) par S. reilianum (gauche)

pathologie ait une incidence forte sur les rendements : un et U. maydis (droite)
champ infect peut entrainer une perte de 80 % de la production. Dans une
moindre mesure, le sore peut se former au niveau de la panicule.
Sur lappareil vgtatif, un nanisme peut tre observ chez certaines lignes
de mas sensibles, mais ce symptme est rare chez les hybrides
commercialiss (Christensen, 1963).
Par ailleurs des taches chlorotiques peuvent apparaitre au niveau foliaire,
correspondant au dveloppement du champignon dans les tissus (figure 8 ;
Martinez et al., 1999).Ce symptme discret est difficile observer au champ.

Figure 8 : taches foliaires dues

la prsence de S. reilianum dans
les feuilles de mas

Introduction gnrale

20

S. reilianum est un champignon du sol infectant le mas

uniquement au niveau racinaire (Martinez et al., 2002). De fait linteraction
avec la plante se caractrise par une longue phase biotrophe, cest dire un
comportement de parasitisme aux effets attnus. De mme que pour U.
maydis, le champignon vient puiser ses nutriments au contact des cellules
htes, sans pour cela traverser leur plasmalemme et nuire durablement
lintgrit de ces cellules et de la plante. Cette phase de biotrophie est trs
longue puisque aprs infection racinaire au stade plantule, le champignon
crot vers le mristme caulinaire o il reste ltat biotrophe durant toute
la dure de croissance vgtative du mas (Martinez et al., 2002). Ce nest
que lors de linduction florale que le champignon va dvelopper une
physiologie ncrotrophe, dtruisant les prmices des pices florales et
formant le sore (figure 9). Il sagit donc dun cycle hmi-biotrophie, comme
U. maydis, mais fortement dcal dans le temps (quelques jours pour U.
maydis, plusieurs semaines pour S. reilianum). Cette caractristique en fait
Figure 9 : croissance biotrophe (haut)

un modle de choix pour ltude de la biotrophie chez les champignons et ncrotrophe (bas) de S. reilianum
selon le stade de dveloppement du
phytopathognes. Le cycle complet est illustr dans la figure 10.
mas

Figure 10 : cycle de vie de S. reilianum

Introduction gnrale

Mating-type chez les Ustilaginaceae

Chez les Ustilaginaceae, la reproduction sexue implique des tapes spares dans le temps : i)
La fusion de cellules haplodes formant des hyphes dicaryotiques, ii) la caryogamie qui seffectue dans
les tliospores iii) la miose qui seffectue lors de la germination de la baside avec migration des 4
noyaux haplodes, puis sporulation des cellules de la baside.
La fusion cellulaire est donc une tape importante de
la sexualit. Elle est gre par des gnes de
compatibilit cellulaire ou mating type (facteurs
daccouplement) : les gnes MAT. La fusion seffectue
entre types cellulaires de compatibilit diffrente. Il a
t mis en vidence par des expriences de
croisement (figure 11) quun nombre limit de gnes
contrlent la compatibilit. Selon les espces, un ou

Figure 11 : formation d'une zone de confrontation

deux gnes interviennent avec une variabilit filamenteuse entre deux colonies levuriformes
alllique qui diffre selon les espces et les gnes.

compatibles

Ainsi chez U. hordei, agent du charbon de lorge, deux types cellulaires sont forms lors de la
germination des tliospores, correspondant deux allles dun mme gne (MATA1, MATA2) (bakkeren,
1993). Ce systme est appel bipolaire car une tliospore va gnrer 2 types de cellules (a1 ou a2),
compatibles 2 2. Chez U. maydis, deux gnes sont impliqus (MATA et MATB), avec deux allles pour
le gne MATA (MATA1 et MATA2) et plus de 40 allles pour le gne MATB (Holliday, 1974). Ce systme
de compatibilit est appel ttrapolaire car une tliospore va gnrer 4 types de cellules (a1b1, a1b2,
a2b1, a2b2), compatibles 2 2. Les tudes molculaires menes dans les annes 90 ont permis de mieux
comprendre ces mcanismes. MAT A et MATB constituent des loci sur lesquels sont prsents plusieurs
gnes. Les allles du locus MATA (figure 12) sont idiomorphes (squences diffrentes sur le mme
locus), constitu notamment dun gne mfa1-2 codant pour une phromone de type lipopeptide qui
sera perue par un rcepteur produit par le gne pra1-2 prsent sur le locus complmentaire.

21

Introduction gnrale

Figure 12 : organisation des loci MATA, MATB et schma dinteraction des protines codes par les gnes BE et BW chez U.
maydis

La cytoduction est contrle par le locus MATA, mais linduction de la croissance filamenteuse et
lentre en phase parasitaire ncessite la prsence dallles MATB diffrents (Kahmann et al., 2004). Le
locus MATB code entre autres pour deux facteurs de transcription avec des homodomaines trs
conservs dans leur rgion N-terminale (exons IIbE et IIbW), mais variables dans leur rgion C-terminale
(exons IbW et IbE). Les protines bW et bE forment des dimres, mais uniquement par des
combinaisons provenant de locus b diffrents : protines bW1 et bE2, et entre bW2 et bE1 (Kahmann et
al., 1995). Lhtrodimre ainsi form un rle de facteur de transcription permettant lexpression de
gnes impliqus dans les processus de filamentisation et de pathognie. Lidentification des gnes cibles
des facteurs de transcription htrodimrique a dbut (Brachmann et al., 2001), mais une avance
importante est attendue avec lutilisation de puces Affymetrix reprsentatives du gnome dU. maydis
(6200 gnes estims, Kamper et al., 2006). En effet, depuis 2003, le gnome de cette espce a t
squenc

et

mis

disposition

de

la

communaut

scientifique

(http://www.broad.mit.edu/annotation/genome/ustilago_maydis/Home.html ). Lobjectif est alors de

mettre en vidence les rseaux dexpression de gnes. Le dfi sera de prolonger ces tudes aux tapes
o le champignon se dveloppe l'intrieur du tissu vgtal.

22

Introduction gnrale

Ces tudes sur U. maydis ont permis de dfinir plus prcisment les gnes de mating sur
dautres Ustilaginaceae. Dans un premier temps, il a t dfini que des rgions les loci a et b hybridaient
avec des ADN de nombreuses espces dUstilaginaceae (Bakkeren et al., 1992), y compris les espces
bipolaires. Dautres tudes ont permis de dfinir que les espces bipolaires comme U. hordei prsentait
bien des loci MATB en plus du locus MATA (Bakkeren & Kronstad, 1993), mais les 2 loci tant lis, ils cosgrgent pour ne laisser apparaitre que deux types de compatibilit (Anderson et al., 1999). Plus
rcemment, une tude permis de dcrire le systme de compatibilit chez S. reilianum zeae. Cette
espce est ttrapolaire comme U. maydis est lorganisation des gnes est trs comparables dans les 2
loci MATA et MATB, a tel point que des complmentations fonctionnelles ont pu tre ralises
(Schirawski et al., 2005). Curieusement, lanalyse de souches collectes dans diffrentes zones du globe
a rvl quil existait 3 allles pour le locus A (5 allles pour le locus B).
Solopathognie chez les Ustilaginaceae
Certaines souches dUstilaginaceae peuvent infecter la plante hte sans ncessit de croiser
avec une souche compatible pour tre pathogne, de telles souches sont dites solopathognes. Il sagit
de souches infectieuses stables (les souches dicaryotiques ou diplodes tant normalement instables
chez les Ustilaginales). Plusieurs types de souches solopathognes ont t obtenus chez U. maydis ou
dautres Ustilaginaceae.
Les souches solopathognes naturelles.
Chez les Ustilaginales, la solopathogenie a t observe dans les essais disolement partir de
tliospores en germination. Chez Tilletia caries, certaines souches issues disolements monospores ne
fusionnent avec aucune souches haplode de cette espce normalement htrothallique (Kendrick E.L.,
1960, 1975). Chez Ustilago maydis la solopathognie serait assez frquente (de lordre de 1%,Holliday,
1974). Ces lignes monospores conservent leur capacit parasitaire pendant 30 repiquages, alors que
dautres sont redevenues non pathognes aprs quelques mois. De telles souches seraient
monocaryotiques (Chilton S.P., 1938, 1943; Christensen J.J., 1931; Eddins A.H., 1929). Lexistence des
souches solopathognes a t interprte par la prsence dun facteur hrditaire dont laction se
manifesterait par des accidents miotiques (Chilton S.P., 1938, 1943; Christensen J.J., 1931). A vrai dire
lorigine et le rle de telles souches sont totalement mconnus, et hormis des travaux anciens, il na
gure t port dintrt sur ces souches solopathognes naturelles.
Souches solopathognes artificielles.
Parmi les premiers travaux de gntiques raliss sur U. maydis, lintrt sest port initialement
sur le contrle de la filamentisation. Suite aux travaux de Holliday (1974), plusieurs publications ont
port sur la recherche de mutants EMS ou UV drguls pour leur filamentisation. Flora Banuett et Ira
Herskowitz (Banuett & Herskowitz, 1988) ont gnr des souches solopathognes stables par

23

Introduction gnrale

croisement de souches auxotrophes compatibles obtenues par mutations chimiques sur les souches
FBD1 et FBD2 isoles par Holliday. Aprs croisement et slection sur milieu carenc, les souches ayant
complment sont solopathognes. Ces souches (FBD11, FBD 12) sont toujours utilises dans les travaux
rcents pour valider lexpression de gnes, 20 ans aprs avoir t obtenues.
Souches solopathognes haplodes.
La mise en vidence du rle du locus MATB et des htrodimres bEx et bWy dans linduction de
la filamentisation et du parasitisme a entran la mise en place de stratgie dobtention de souches
haplodes infectieuses par transformation. Cette stratgie a consist transformer des cellules dun type
de compatibilit donne avec une squence codant pour lallle complmentaire. Ainsi la souche CL13
par exemple (a1 bE1 bW2) a-t-elle t gnre (Bolker et al., 1995). L'expression un niveau lev du
complexe bE/bW dans des cellules haplodes transformantes est suffisante pour l'induction de la
croissance filamenteuse. Ces souches prsentes un grand intrt dans les tudes gntiques :
lutilisation de souches haplodes permet de raliser les exprimentations de dltion de gnes
impliqus dans linfection ou de complmentation fonctionnelle bien plus aisment que sur des souches
diplodes. Les validations dinfection sont plus rapides raliser car ne ncessitent par de croisement
pralable. Une limitation est videment que ces infections ne permettent pas une sporulation, la miose
ne pouvant tre induite sur une souche haplode.
Le mas, plante modle en pathologie vgtale ?
Lespce vgtale hte dUstilago maydis et de Sporisorium reilianum tant le mas cette
introduction dcrit quelques points particuliers de cette espce et de son interaction avec des agents
pathognes fongiques.
Le mas
Le mas (Zea mays L.ssp.mys) est une gramine de la famille des Poceae, sous famille de
Panicoideae. Le mas, originaire dAmrique centrale tait la culture dominante chez les Incas, les
Mayas, les Aztques ainsi que chez certains peuples du sud-ouest des Etats-Unis. Le mas constituait la
base de lalimentation de toutes la civilisation prcolombienne et ce titre tait vnr comme lun des
principaux dieux chez les Aztques et les Mayas. Les premiers mas dcouverts dans cette rgion datent
de 7000 ans et seraient le rsultat de la domestication dune varit mutante de tosinte par les
civilisations amrindiennes (Kato, 1984). Certains auteurs proposent que lanctre du mas moderne
puisse tre une varit de tosinte diplode (n=10), Zea mays ssp. Parviglumis , originaire des valles du
sud-ouest de Mexico (Matsuoka et al., 2002). Les mas cultivs de nos jours prsents encore 78% de la
diversit des mutations silencieuses observes chez Zea mays ssp. Parviglumis (Rafalski & Morgante,
2004). Si les premiers mas furent imports en Europe au dbut du XVIme sicle, le dveloppement de
cette culture date surtout des annes 1950 avec limportation des premiers hybrides en provenance des

24

Introduction gnrale

USA (Meyers et al., 2001). Ces hybrides ont de multiples avantages agronomiques, le haut niveau de
production, mais aussi une meilleure rsistance aux agents pathognes que leur confre la vigueur
hybride.
Sil a un grand intrt agronomique (encore accru par la volont politique de transformer une
partie de la production en biothanol), si de nombreuses pathologies de cette plante sont tudies, et si
la premire plante gntiquement modifie commercialise est un mas (mas Bt), le mas nest pas
encore un grand modle gntique pour la phytopathologie. Il possde au moins deux caractristiques
dfavorables : lnorme taille de son gnome (2400 Mb 3000 Mb pour Homo sapiens) et un trs fort
contenu en squences rptes (80-85% du gnome) impliquant massivement des lments mobiles. Le
mais est considr par certains comme le plus grand cimetire de rtrotransposons qui constituent
entre 65 et 70 % de son gnome (Meyers et al., 2001). Malgr cela le squenage de son gnomes est
en

cours

et

de

nombreuses

ressources

gnomiques

annotes

sont

dj

disponibles

(http://maize.tigr.org/ , www.maizegdb.org/map.php ).
Rsistance du mas aux charbons
Les charbons du mas tant des pathologies trs prsentes, plusieurs travaux ont port sur
lanalyse de la rsistance cette maladie. Un premier point souligner est quil na t identifi aucune
rsistance totale chez le mas ces agents pathognes. Il ne sagit pas dune impossibilit intrinsque
lie au mcanisme dinfection trs particulier des agents pathognes responsables de charbon
(biotrophes induisant peu de symptmes avant la sporulation), un gne davirulence Avrh1
correspondant au gne de rsistance Ruh1 ayant t identifi sur Ustilago hordei (Linning et al., 2004).
Les recherches nont permis lheure actuelle que didentifier des rsistances partielles. Des
croisements entre des varits plus ou moins tolrantes U. maydis montrent que la rsistance est
polygnique. Selon les gnotypes et les souches utilises, certaines tudes suggrent la prsence de QTL
(Quantitative trait Loci) contribuant fortement la rsistance (Lubberstedt et al., 1999; Parisseaux &
Bernardo, 2004), dautres indiquent la prsence de nombreux gnes mineurs (Kerns et al., 1999;
Lubberstedt et al., 1998). Par ailleurs, les facteurs environnementaux affectent la rsistance U.maydis.
Les rsultats obtenus rcemment montrent que plusieurs QTLs contribuent la rsistance dans
diffrents tissus du mas. Ainsi certains loci contribuent prfrentiellement la rsistance au niveau des
pis et des inflorescences (Baumgarten et al., 2007).
Divers gnotypes tolrants S. reilianum ont t identifis. Certains des QTL identifis sont
majeurs, et prsentent surtout un effet additif, mais ils ne sont que trs partiellement communs ceux
dfinis sur U. maydis (Lu & Brewbaker, 1999; Lubberstedt et al., 1999).

25

Introduction gnrale

La rhizosphre
Le sol, une matrice entre les organismes du sol et les plantes
La rhizosphre constitue une
zone de sol un espace autour des
racines des plantes dfinissant des
microrgions du sol en contact direct
avec

les

racines

des

plantes

suprieures. Le sol rhizosphrique est

notamment caractris par une flore
fongique

et

bactrienne

trs

spcifique (Walker et al., 2003b). A

lorigine

de

cela,

les

abondants

exsudats racinaires mis par les

plantes, dont on diffrencie les rhizodpts

-forms

de

composs

organiques issus du mtabolisme

primaire et exsuds en quantit
apprciable (sucres, acides amins)des autres nombreuses molcules
issues du mtabolisme secondaires,
exsudes

en

quantit

souvent

infinitsimale. Ces molcules exsudes

constituent un vecteur de dialogue

Figure 13 : dialogues molculaires au niveau de la rhizosphre

(Biais et al 2006)

molculaire entre la plante et les organismes de la rhizosphre (figure 13).

Les exsudats racinaires
les racines de plantes scrtent continuellement des composs dans le sol (Bais et al., 2001;
Gleba et al., 1999). Ces exsudats racinaires inclus la scrtion dions, d'oxygne, deau libre, denzymes,
de mucilage, et de molcules carbones varies, mtabolites primaires et secondaires (Bertin et al.,
2003; Uren, 2000). Si une grande partie des mtabolites exsuds sont considrs comme des dchets
mtaboliques, cette vision est plus lie la mconnaissance du rle de ces molcules. Pour dautres
composs, leur rle dans la lubrification ou la dfense contre les agents pathognes a pu tre
dmontre (Bais et al., 2004; Uren, 2000).
Lexsudation de molcules peut tre un mcanisme actif. Les molcules exsudes sont transportes
travers la membrane cellulaire vers lenvironnement (la rhizosphre). Des exsudats sont aussi librs par

26

Introduction gnrale

des cellules de la coiffe, qui se dtachent ensuite mais demeurent viables quelque temps dans
lenvironnement rhizosphrique.
On diffrencie souvent deux classes de composs parmi les exsudats racinaires : i) Les molcules en de
faible poids molculaires tels les acides amins, organiques acides, les sucres, phnoliques, et les autres
mtaboliques secondaires reprsentent une grande partie de la diversit des exsudats racinaires ii) les
molcules, ou macromolcules de haut poids molculaire, tels le mucilage (polysaccharides) et les
protines, moins diversifis mais composant une grande proportion des exsudats racinaires en masse
(de lordre de 90 % du carbone exsud chez le mas). Les exsudats racinaires reprsentent un cot non
ngligeable pour la plante en terme de carbone relargu (Marschner, 1995), mais l'importance des
photosynthtats scrts dans les exsudats de racine est variable selon le type du sol, l'ge, l'tat
physiologique de la plante et la disponibilit de matire nutritive (Brady & RR., 1999; Brimecombe et al.,
2001). Les implications des molcules exsudes dans des processus biologiques ont t dfinies pour
certaines dentre elles, mais pour beaucoup ce rle reste dcouvrir (Bais et al., 2001; Bais et al., 2003a;
Bais et al., 2003b; Kneer et al., 1999).
Rle des exsudats racinaires dans les tapes prcoces des interactions racinaires
De nombreux travaux ont port sur le rle biologique des mtabolites secondaires mis par les
plantes (Walker et al., 2003a). Il y a des exemples clbres daction de ces mtabolites secondaires dans
les interactions plantes-microorganismes : implication des flavonodes dans lactivation des gnes NOD
dans la symbiose Rhizobium/Lgumineuse ou encore activation par lacetosyringone des gnes VIR d
Agrobacterium tumefaciens. La rhizosphre constitue en fait un milieu dynamique dans lequel
interviennent des microbes, des invertbrs, dautres plantes qui sont autant dorganismes
comptiteurs ou interagissant (Hirsch et al., 2003). En particulier, parmi les centaines de molcules
prsentes, certaines constituent des signaux chimiques intervenant dans les tapes prcoces des
interactions entre la plante et les micro-organismes du sol. La signalisation chimique entre les racines et
des organismes du sol, y compris les racines des plantes voisines, est souvent base sur des molcules
issues de la racine en trs faible quantit. Par ailleurs les mmes signaux chimiques peuvent provoquer
des rponses diffrentes selon le destinataire, repoussant un organisme et attirant un autre, ou deux
organismes trs diffrents peuvent tre stimuls avec des consquences diffrentes la plante. Un
exemple concret des divers sens pour un signal chimique est la scrtion des isoflavones par les racines
de soja, qui attirent une bactrie symbiotique (Bradyrhizobium japonicum) mais aussi un Oomycte
pathogne (Phytophthora sojae ; Morris et al., 1998). Un exemple plus rcent constitue le cas de leffet
des strigolactones sur les plantes parasites et sur les champignons endomycorhiziens.

27

Introduction gnrale

Les strigolactones
Les strigolactones sont des composs synthtiss par les plantes et exsuds par leurs racines.
Des travaux encore parcellaires indiquent que ces composs sont issus de la voie de biosynthse des
apocarotnodes (Matusova et al., 2005). Il est intressant de dcrire lhistorique de leur dcouverte et
lidentification successive de leur rle car cela jette un clairage particulier sur le hasard des
dcouvertes, et sur la complexit des mcanismes de signalisation entre les organismes.
Strigolactones et plantes parasites

Les strigolactones ont t caractrises lors dtudes sur linduction des graines de plantes parasites
Striga (Orobanchaceae, Buchnereae) et Orobanche (Orobanchaceae, Orobanchae) par les exsudats
racinaires de plantes. Ces espces vgtales crent des dgts importants dans les zones chaudes,
induisant des dgts importants (Musselman, 1980, 1987). Striga et Orobanche sont deux genres de
plantes parasites obligatoires : ces plantes ne peuvent se dvelopper sans infecter un hte. De plus elles
ont pour caractristique commune de former des milliers de graines trs pauvres en rserve. La plante
doit germer au voisinage dune racine hte pour pouvoir former un appressorium, puis connecter son
systme vasculaire celui de la plante parasite. Des travaux des annes 40 avaient dcrit lincidence
des exsudats racinaires sur la germination des graines de Striga (Brown & Edwards, 1944). Des travaux
initis dans les annes 60 ont permis disoler le compos inducteur dans des exsudats de cotonnier
(Cook et al., 1966). La structure chimique en a t obtenue quelques annes plus tard partir des
exsudats 300.000 plants de cotonniers (Cook et al., 1972), et appel strigol (figure 14). A ce jour, 9
strigolactones seulement ont t identifies. La difficult danalyse explique cette faible diversit de
structures trouves. Toutefois ces molcules ont t identifies dans des familles vgtales diverses
(Poaceae, Lgumineuses) et lactivit biologique est retrouve dans des exsudats racinaires de trs
nombreuses plantes. Ces lments laissent supposer une prsence de ces molcules dans un trs large
groupe de vgtaux.
Figure 14 : Strigolactones et
analogue de synthse.
Les
strigolactones
comportent
actuellement 9 structures chimiques
qui ont mme ossature carbone,
mais des radicaux varis. Le GR24
constitue un analogue de synthse
chimique qui reprend lossature
carbone et les 4 cycles ABCD mais
sans dcoration. Au-del des 5
molcules naturelles reprsentes,
on trouve le 2-epi orobanchol
(sorghumol), le strygil actate et
strygil orobanchol, le solanacol.

28

Introduction gnrale

Ces molcules ont longtemps intress une communaut scientifique implique dans ltude de la
dfense des plantes contre ces plantes parasites (Bouwmeester et al., 2003), ce qui a permis didentifier
des varits de sorgho tolrantes ce parasitisme par une production moindre de strigolactones (Siame
et al., 1993) Dernirement il a t propos que les strigolactones drivent de la voie de biosynthse des
carotnodes (Matusova et al., 2005).
Strigolactones et champignons endomycorhiziens

La symbiose mycorhizienne au arbuscules (MA) est une symbiose mutualiste entre les champignons du
sol appartenant au groupe Glomeromycota et les racines des plantes. Cette symbiose favorise la
nutrition minrale (surtout phosphate) et hydrique de la plante. On estime que 80% des plantes
terrestres sont mycorhizes ltat naturel. La majorit des plantes cultives qui servent
l'alimentation humaine et animale sont mycorhizables. Ces particularits soulignent lintrt qui est
accord actuellement la mycorhization, et notamment la comprhension des mcanismes
dtablissement de la symbiose mycorhizienne. Plus particulirement il convient de mieux apprhender
le dialogue molculaire qui stablit entre ces champignons et la plante hte avant tout contact. Dans un
stade encore non symbiotique (en absence dune plante hte), les spores du champignon germent
spontanment. La croissance des hyphes est alors trs limite et cesse rapidement. Le cytoplasme des
hyphes produit est mme capable de se rtracter et de refluer dans la spore. En prsence dune plante
hte mais avant contact avec les racines, cest le stade pr-symbiotique caractris par une croissance
fongique beaucoup plus importante. Le champignon ragit la prsence de certaines molcules
racinaires exsudes. Comme la montr Akiyama (Akiyama et al., 2005), les strigolactones sont
impliques dans la ramification des hyphes de champignon endomycorhizien. Une rponse trs rapide
est induite par ces molcules. Des essais raliss avec le GR24 montrent une rapide induction du
mtabolisme mitochondrial (1h) prcdent la ramification des hyphes ( partir de 12h) (Besserer et al.,
2006). Cette ramification favorise la rencontre des 2 partenaires et les tapes suivantes de colonisation
symbiotique. Lutilisation dinhibiteur de la synthse des carotnodes (fluridone) ou de mutants de ces
synthses montre que ces plantes sont moins mycorhizes, mais que cet effet est rvers par laddition
de GR24 (Gomez-Roldan et al., 2007).
Strigolactones et autres champignons

Des organismes aussi distants que les plantes et les champignons AM rpondent aux strigolactones, et
chez ces derniers les mitochondries prsentent une rponse prcoce lajout de GR24 (Besserer et al.
2006). Des rsultats prliminaires doxygraphie obtenus au laboratoire montrent que Sporisorium
reilianum rpond au GR24 par une augmentation de la respiration cellulaire. Il est tentant de rapprocher
ces arguments et de se demander si les strigolactones nagissent pas sur un large spectre dorganismes
possdant des mitochondries, c'est--dire chez les eucaryotes en gnral.

29

Introduction gnrale

Les strigolactones ayant t dtectes dans les exsudats racinaires dune large gamme de plantes, ces
composs pourraient agir en tant que signaux non seulement sur les champignons AM mais galement
sur dautres champignons du sol. Cette hypothse a dailleurs t envisage dans un article rcent.
Leffet du GR24 sur la germination des spores et/ou la ramification des hyphes a t test sur des
champignons de diffrents groupes : basidiomyctes ectomycorhiziens (Laccaria bicolor, Paxillus
involutus), champignons bnfiques du sol (Trichoderma sp. et Pyriformospora indica) et champignons
pathognes des plantes (Fusarium oxysporum, Botrytis cinerea et Cladosporium sp.) (Steinkellner et al.,
2007). Aucune rponse de ramification na t observe, ni de germination de microconidies de
Fusarium oxysporum. Les auteurs concluent que les strigolactones sont des signaux spcifiques
linteraction plante-champignon AM. Cependant si les strigolactones nont pas deffet morphogne sur
dautres champignons, certaines rponses plus discrtes pourraient intervenir, et des tudes autres que
la ramification dhyphes ou la germination de conidies (surtout chez des organismes dont les spores
germent et dont les hyphes croissent et ramifient sans intervention exogne) sont ncessaires pour
envisager le spectre dactivit des strigolactones et leur rle dans la formation de la flore microbienne
rhizosphrique.

Objectifs de la thse
Les travaux prsents dans ce mmoire ont plusieurs objectifs imbriqus qui tout en sadressant
des questions simples, entrainent des implications multiples.
1-Quel est le taux de souches solopathognes formes par diffrentes Ustilaginaceae ?
Les souches solopathognes nont pas intress les phytopathologistes, mais ont t
trs utilises par les gnticiens. Lhypothse mise est que ces souches pourraient avoir une
incidence sur ltiologie et lpidmiologie de ces maladies en fonction des mcanismes de
dissmination.
Une consquence ce travail est la possibilit de gnrer des souches solopathognes
de S. reilianum, non disponibles lheure actuelle. Des utilisations gntiques de telles souches
sont envisageables.
2-Ustilago maydis est il un agent pathogne racinaire ?
Cette question a tout dabord pour intrt de dfinir si les deux Ustilaginaceae
considrs, U. maydis et S. reilianum, diffrent dans leur interaction avec la plante par leur
mcanisme de pntration (foliaire vs racinaire). Cela peut avoir pour incidence de reconsidrer
la lutte contre ce pathogne.

30

Introduction gnrale

Un autre intrt cette question est de dfinir les conditions pour utiliser les
Ustilaginaceae comme modles fongiques dtude de la biotrophie au niveau racinaire. Cette
problmatique rsulte dun double constat : i) lintrt de raliser des analyses
transcriptomiques comparatives entre interactions diffrentes pour mettre en vidence des
caractres communs et des caractres distincts. Ainsi une analyse ralise sur le riz (Guimil et
al., 2005) a dmontr lexistence de patrons de gnes communs et diffrents entre interactions
biotrophe

symbiotique, biotrophe

pathogne

et ncrotrophe.

ii)

les

champignons

endomycorhiziens constituent des agents biotrophes dun intrt agronomique lev, et

comprendre les interactions quils tablissent avec les plantes pourrait apporter des lments
marquant pour leur exploitation. La difficult est quil y a trs peu dagents pathognes
biotrophes racinaires pour effectuer un comparatif. Or la gnomique et les outils de gntique
molculaire disponibles sur U. maydis en font un modle biologique biotrophe phytopathogne
extraordinaire. Certains outils sont certes extrapolables sur S. reilianum (vecteurs de
transformations), mais des diffrences gnomiques ne manquent pas : lhybridation
htrologue dADNc S. reilianum sur puces ADN U. maydis semble montre que 40 % des gnes
ne shybrident pas (R. Kahmann, comm. personnelle). La question vaut dtre tranche.
Enfin, en tant que pathogne biotrophe, U. maydis constitue un organisme intressant
pour tenter lexpression htrologue de gnes dintrts identifis chez les champignons
endomycorhiziens, ces derniers tant rtifs toute manipulation gntique.
3-Quelle est la rponse des Ustilaginaceae aux strigolactones ?
Lobservation prliminaire chez S. reilianum de linduction de la respiration par le GR24
ncessite de prciser cette rponse. Une analyse plus fine de la rponse respiratoire tait raliser. Par
ailleurs, il tait tentant de tester si U. maydis rpond aussi au GR24. Au-del, nous avons voulu dfinir si
cette rponse se refltait par une modification au niveau transcriptomique, notamment sur des gnes
impliqus dans le dveloppement in planta. Une banque SSH partir des transcrits de cellules de S.
reilianum cultives en prsence ou non de GR24 a t ralise. Cette analyse a deux intrts :
-Dune part elle pourrait aider prciser les mcanismes de perception des strigolactones. Sil
est peu probable quun rcepteur soit identifiable par des approches transcriptomiques, les
gnes induits pourraient favoriser ou non la piste mitochondrie comme cible primaire daction
de ces molcules.
-Par ailleurs, mme si ce travail est focalis sur les tapes qui prcdent linfection, il pourrait
tre concevable didentifier des gnes impliqus dans les tapes prcoces de la biotrophie. En
effet il est possible quil existe un continuum entre phase pr-infectieuse et phase infectieuse, et

31

Introduction gnrale

que certains facteurs vgtaux, dont peut tre les strigolactones actifs sur la respiration
cellulaire, pourraient agir comme un rgulateur.
La justification technique de cette approche tient la ralisation dun systme simplifi, initiant la
rgulation des gnes fongiques en absence de la plante hte, et permettant ainsi ltude de lexpression
des gnes sans contamination par les ARN vgtaux.

32

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au

mode de dissmination ?
Avant Propos
Lobjectif premier de cette tude consistait isoler des souches solopathognes de S. reilianum,
jusquici non disponibles. Ces souches solopathognes ont un grand intrt pour ltude de la
pathognie (expression in planta de transformant GFP pour ltude de promoteur par exemple). Il
convenait aussi de caractriser au mieux de telles souches pour en dfinir les conditions dutilisation au
laboratoire.
Ce premier chapitre correspond la valorisation sous forme darticle de rsultats conduits au
laboratoire par plusieurs contributeurs. Madame Diagne-Lye est Matre assistante lUniversit Cheikh
Anta-Diop de Dakar et a effectu un stage de plusieurs mois au laboratoire pour tudier ltiologie et
lpidmiologie de Moesziomyces penicillariae, agent responsable du charbon du mil. Cette maladie est
trs prsente en zone sub-saharienne et constitue la deuxime pathologie sur cette culture vivrire.
Cest dans le cadre de son travail quelle a isol des sporidies partir de tliospores rcolts par ses
soins, vrifi leur aspect filamenteux et effectu les infections sur plantes, rsultats repris dans cet
article. Mathieu Naudan a effectu un stage de DESU au laboratoire en 2003 et a effectu des essais
dobtention de souches solopathognes sur S. reilianum et U. maydis. Le protocole prsent dans ce
chapitre pour obtenir les souches solopathognes est celui mis au point au cours de son stage.

33

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

Solopathogeny of Ustilaginaceae: an adaptative strategy to dispersal?

Sabbagh, Seyed Kazem, Lye, Gagna-Diagne, Mathieu, Naudan and Roux, Christophe
Key words: Moeszyomyces penicillariae, Ustilago maydis, Sporisorium reilianum, solopathogenic strains,
aerial and soil fungi

1-1 Rsum
*Une des caractristiques communes aux champignons de la famille des Ustilaginaceae est de
prsenter un cycle biologique dimorphique, avec une alternance entre des formes levures haplodes
saprotrophes et des formes filamenteuses dicaryotiques parasites. Cette transition morphologique
rsulte dune fusion de levures compatibles.
*Sur certaines espces, il a t dcrit la formation des souches filamenteuses infectieuses en
absence de toute fusion entre levures compatibles. Ces souches sont dites solopathognes. Dun grand
intrt gntique, le rle biologique de ces souches na jamais t pos.
*Un protocole permettant disoler des formes solopathognes partir des tliospores a t
dfini, permettant disoler la souche solopathogne SRZS1 de Sporisorium reilianum.
*Ltude microscopique de la souche SRZ1 montre quil sagit dune souche filamenteuse
monocaryotique diplode. Par dtection PCR, cette souche sest rvle infectieuse, bien quelle ne
forme pas de sore sur mas.
*Nous avons analys la propension de trois espces diffrentes dUstilaginaceae former des
souches solopathognes : Moesziomyces penicilliarae, agent du charbon du mil, Ustilago maydis, agent
du charbon commun du mas, et Sporisorium reilianum, agent du charbon des inflorescences du mas.
Toutes les souches de M. penicilliarae sont solopathognes, trs rares chez S. reilianum, et en
proportion intermdiaire chez U. maydis.
*Ces trois espces diffrent notamment par leur mode dinfection de leur plante hte :
linfection seffectue uniquement par les stigmas des inflorescences pour M. penicilliarae, uniquement
par les racines pour S. reilianum, et sur lensemble de la partie arienne pour U. maydis. Laptitude
former des tliospores semble tre corrle au mode de dissmination de ces espces : la dissmination
arienne serait favorise par la formation de cellules infectieuses solopathognes.

1-2 Introduction
Among Basidiomycetes fungi, around 600 species are grouped in the Ustilaginaceae family.
Except Pseudozyma sp., anamorphic yeasts non parasite on plants (Begerow et al., 2000), all species are

34

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

pathogens of monocotyledonous plants and cause smut diseases: The main symptom corresponds to
the formation of a sorus filled of black spores: teliospores. These dicaryotic structures are dispersed,
overwinter in soil, then germ after caryogamy and meiosis in a basidium which sporulates haploid
sporidia. Sporidia are haploid saprotrophic yeast-form cells. To infect a host, haploid yeast must fuse
with compatible partner to form an infectious dicaryotic hypha. As yeast-hyphal switch and
saprotrophic-parasitic transition are concomitant, Ustilaginaceae fungi are of great interest to study the
mechanisms of pathogenicity in plants. Ustilago maydis, causing a common smut of maize, was
specifically used to investigate the genetic base of the dimorphism, and it was define that cell signaling
transduction pathway of mating, virulence and cell cycle are intertwined process (Kahmann & Kamper,
2004). This species is a paradigm in plant pathology since its genome has been sequenced (Kamper et
al., 2006). As several works deal with the description of maize infection by U. maydis, this species is the
reference usually used to describe life cycle of Ustilaginaceae. Although all Ustilaginaceae species have
many similarities with the biology of U. maydis, it is obvious that each species is adapted to its own host.
Infection mechanisms and dispersal ways are correlated events. On Ustilaginaceae, different dispersal
units have been described: teliospores and sporidia, but also fragmented basidia and infected host
organs. These dispersal units could be disseminated by wind, rain, insect or human activities and are
adapted to these vectors of dissemination (Piepenbring et al., 1998). For instance Moeszyomyces
penicilliarae (syn. Tolyposporium penicilliarae and Moesziomyces bullatus) is an air-borne fungus
infecting inflorescences of Pear millet (Baht, 1946). The teliospores of this species are grouped in spore
balls harboring empty sterile cells. This organization is known to limit desiccation by wind. The presence
of empty cells also lowers the density of the spore-balls, and the cell walls of degenerated sterile cells
form wing-like structures all around spore-balls which could facilitate air spreading. Although the role of
teliospores in dispersal is unambiguous, studies on Ustilaginaceae underline that the formation of non
infectious haploid sporidia limit the efficiency of dispersal. As sporidia need to meet a compatible
partner, the genes involved in compatibility could be considered as a limitation to cell fusion and then
infection. On U. maydis, the mating system is controlled by two loci, MATA and MATB. Two alleles have
been identified on A locus and around forty on B locus (Holliday, 1974). Sporidia could fuse when alleles
are different and generate a dicaryotic hypha. It was proposed that the multiplicity of B alleles is an
adaptation to dispersal as the probability of cells of different alleles to meet are higher, limiting the risk
of incompatible crossing (Kamper et al., 1995).
In this context, we focused on the biological implication of diploid sporidia in dispersal of
Ustilaginaceae and in infectious process. Diploid sporidia have been identified during the earlier studies
on crossing of haploid sporidia (Ehrlich, 1958; Holton et al., 1968; Puhalla, 1968). These works concluded
that some strains could be isolated, which spontaneously form pseudohyphae and are infectious in
absence of crossing with a compatible strain. Due to their phenotype, these strains were called

35

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

solopathogen. Using experiments of auxotrophic complementation on U. maydis, Holliday established

that these strains are stable diploids which harbor the complementary mating types (see Holliday, 1974
for review). These descriptions allowed to produce solopathogenic strains of U. maydis which greatly
contribute to describe the transduction pathway involved during the induction of pathogenicity of
Ustilaginaceae (Banuett & Herskowitz, 1988, 1989). In spite of the genetic interest of solopathogenic
strains, their biological incidence was not investigated. Our objective was to investigate the hypothesis
that solopathogeny could be an adaptative mechanism of Ustilaginaceae to consider.
We used three species of smut fungi belonging to Ustilaginaceae: Sporisorium reilianum f.sp.
zeae, Ustilago maydis and Moeszyomyces penicilliarae. S. reilianum zeae is the causal agent of maize
head smut. It is a strict root infecting fungus (Martinez et al., 2002). U. maydis, causing common smut of
maize, is known to be infective on different aerial part (Agrios GN., 1988). Lastly, M. penicilliarae is a
pathogen of pearl Millet, largely present in sub-sahelian zone. This is an airborne disease spread by wind
and insects infecting young inflorescence (Baht, 1946; Wilson, 1995). Using an original protocol to
isolate solopathogenic strain, we compare on these three species the frequency of formation of such
strains.

1-3 Materials and Methods

Fungal material
S. reilianum sori were collected from a field in Saint Ciers (33-France). M. penicilliarae sori were
collected in Pearl millet fields from different areas of Senegal (Diagne-Lye, 2005). U. maydis galls were
collected in a maize field at Le Vernet (31-France).
Protocole of obtention of solopathogenic strains of S. reilianum
Teliospores were sterilized by Chloramine T 3% during 15 min, rinsed twice with sterilized water,
resuspended in water at the concentration of 500 cells.mL-1 before spreading a volume of 100 L of
suspension on water-agar (3%) medium. After 2 days at 24C, most of the teliospores germinated,
forming basidia and sporidia. At this time, colonies formed by 10-15 yeast-cells were selected under a
stereomicroscope; picked up with a sterile toothpick and placed in 100 L of water. The cell suspension
was spread on solid medium (PDA) and placed at 24C. It was reported that the fuzzy development of
filamentous strains of U. maydis is more abundant on solid rich medium containing 1% charcoal
(Holliday, 1974). Previous test of plate mating with S. reilianum strains showed that fuzzy morphology of
colonies is easier to obtain and observe on PDA medium for this species. After 4-7 days of growth, small
separated colonies appeared. The fuzzy colonies were sub-cultured in liquid medium (10 mL of PDB)
during 1 week (24C, 100 rpm). Cell cultures were diluted at 500 cell.mL -1, than spread on solid medium

36

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

(PDA) for cultivation during 4-7 days. At this step, when isolates presented 100% of fuzzy colonies, they
were subcultured again in liquid medium and then spread on solid medium. Isolates showing 100% of
fuzzy colonies after subculture 2 were defined as stable fuzzy strains and tested for their
solopathogenicity.
Comparison of fuzzy strain production
Teliospores of the three Ustilaginaceae species used for these experiments were collected in
field to ensure genetic variability of strains. Isolation of solopathogen strains was performed according
to the previous protocol. Fifty teliospores were analysed for each species. Assays of growth of colonies
on soil medium were performed on PDA medium with charcoal for U. maydis, on PDA for S. reilianum,
and on the two media by plate replicating for M. penicilliarae as fuzzy colonies are more difficult to
identify for this species.
Plant infection test
Solopathogenicity of one fuzzy strain for each species was tested on corresponding host. For S.
reilianum, inoculation were performed by using a sterile seringue to inoculate the fungus in 2-week-old
plantets (Martinez et al., 1999). For U. maydis, foliar inoculations were performed on 3-week-old maize
plantlets according to the protocol described by Holliday (Holliday, 1974). Inoculation of Pearl Millet was
realized by infecting young floral spicklets as described by (Wilson, 1995).
Microscopic observations
For confocal microscopy, cells were observed after propidium iodide (Molecular Probes) staining
to observe nuclei with a confocal laser scanning system (SP2 SE, Leica, Germany) equipped with an
upright microscope (DM 6000, Leica, Germany). Cells from young cultures (24h) were fiwed in Ethanol
70C, rinsed with water, treated with RNase A (65C 10 min) and then incubated with propidium iodide
0.1 M as final concentration during one hour.
Molecular analysis.
PCR diagnostic of S. reilianum was based on the amplification of Internal transcribed spacer (ITS)
ribosomal regions using specific primers. Plants infected with haploid, solopathogenic or a mix of
compatible SRZNxSRZM strains were grown in a greenhouse under controlled condition described
above. PCR diagnostic was based on ribosomal ITS amplication using the primers pITS1 (5'-TCC GTA GGT
GAA CCT GCG G-3') and pSRZ4 (5'-ACT CGT GAG GCC GGC CTG A-3). PCR reactions was performed in 35
cycle (5 min 94C 35 cycles 1min 54 C 1 min 72 C 1 min 94C 10 min 72 C) and PCR products were
separated by electrophoresis in 2% (wt/vol) agarose gels, stained with ethidium bromide (EtBr) at
0.1 g/ml and DNA bands were visualized by the fluorescence of the intercalated EtBr under UV light
and photographed.

37

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

CAPS (cleaved amplified polymorphism sequence) was used to analysis the MATB gene of S.
reilianum. The primers pMAT9 and pMAT10 were defined on homeodomain of U. maydis. After
sequencing of the 1300 pb region for the parental strains SRZN and SRZM, RE enzyme were defined
using BioEdit software. DNA extractions were performed using the CTAB procedure (Gardes & Bruns,
1993). PCR reaction products of haploid strains and solopathogenic isolate were digested directly
without further purification with single-endonuclease restriction enzyme, Eco 1301(Sty I) (Fermentas,
France). Per each 20-l reaction, 15 l of amplified product was mixed with 2 l restriction reaction
buffer and finally 3l (10U) of restriction enzyme was added and then incubated for 2 h at 37C .
Restriction fragments of amplicons were separated by electrophoresis on agarose 1.5%.

38

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

1-4 RESULTS
Isolation of fuzzy strains of S. reilianum
As diploid solopathogenic strain formation could result from meiotic dysfunction, we attempt to
isolate such strains from germinating teliospores. To limit the formation of dicaryotic strains issuing
from mating of compatible sporidia, young colonies formed by 10-20 sporidia around germinating
teliospores were selected under stereomicroscope, picked up in water and then spread on solid
medium. Colonies obtained from this first isolation were mainly smooth, formed by haploid yeast. In a
lower ratio, fuzzy colonies appeared (Fig 1-1 a-c).

Figure I-1: Isolation of fuzzy colonies of S. reilianum

a. Fuzzy and yeast colonies observed during the first isolation. b and c. 1week-old colonies of yeast and fuzzy
colonies cultivated on PDA. d-f. Stable fuzzy colonies observed on solid medium (d), forming pellets in liquid
culture (e), formed by pseudo-hyphae visible under microscope (e).Bars in a-c and e: 0,5 mm; in d: 1cm; in f: 8 m

Usually, fuzzy colonies correspond to dicaryotic pseudo-hyphae. In Ustilaginaceae, dicaryotic

cells are unstable, reversing in haploid yeast, whereas solopathogenic strains are stable. This
characteristic was used to eliminate from the first isolation the dicaryotic strains issuing from mating,
reversing in yeast like colonies. Fuzzy colonies were sub-cultured in liquid PDB medium during one week
in view to induce the reversion of dicaryotic strains in haploid yeast. These liquid sub-cultures were
plated on PDA to verify apparition of non fuzzy colonies. Isolates forming 100 % of fuzzy colonies on PDA
were sub-cultured again on liquid PDB and afterward on solid PDA media to verify their stability. Using
this protocol we isolated stable fuzzy strains (Figure 1-1 d). In liquid medium, young cultures appear as
small pellets (Figure 1-1 e) formed by aggregates of pseudo-hyphae (Figure 1-1 f).

39

40

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

Stable fuzzy strains of S. reilianum are monocaryotic and diploid

Confocal observations of the pseudo-hyphae after nucleus staining with propidium iodide
indicate that they are formed by rounded shape cells which are monokaryotic (Figure 1-2).

Figure I-2 : Nucleus staining of a stable fuzzy strains of S. reilianum.

Stacking images of fluorescent and visible confocal observations.
Nuclei were stained by using propidium iodide. The fungus grew in
liquid medium as a pseudo mycelium formed by monokaryotic cells.

To assess that these monokaryotic pseudo-hyphae correspond to diploid cells, the presence of
two B alleles was investigated by using CAPS. We first inoculated a maize plant with two compatible
yeasts, SRZN and SRZM. Teliospores resulting from this infection were treated to isolate a fuzzy strain
SRZS1. The B alleles of Ustilaginaceae contain two highly conserved homeodomain box. Primers defined
on these regions allowed amplifying a 1300 bp region on the parental yeast SRZM and SRZN from which
SRZS1 was obtained (Fig 1-3A).
Figure I-3 : CAPS of B loci of S. reilianum.
The strain SRZS1 shared the restriction
enzyme patterns of SRZM and SRZN, and
appeared as a diploid strain.
The B loci were amplified on SRZM and
SRZN strains with pMATBSrz primers, and
then cut with StyI enzyme.
Sty1 sites and fragments deduced from B
locus sequences on SRZM and SRZN (1334
bp). B. Electrophoretic pattern: 1 and 5:
DNA 100 bp ladder; 2: SRZM and SRZN; 3:
Sty1 digestion of SRZM (959 and 324 bp); 4:
Sty1 digestion of SRZN (1245 bp); 6: Sty1
digestion

of

SRZS1.

C-

Analysis

of

electrophoregram using ImageJ software.

Based on sequences analysis, a StyI enzyme was identified to differentially cut this B allele region on
SRZM and SRZN. As observed in figure 1-3, The MATB RE pattern of SRZS1 (line 6) corresponds to the
superposition of the patterns of the two parental strains: SRZM (line 3) and SRZN (line 4). The presence
of the two alleles in SRZS1 suggests that this monocaryotic strain is diploid.

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

Monocaryotic diploid fuzzy strains of S. reilianum are solopathogen, but do not

form sori
The solopathogenicity of SRZS1 was analysed. Infections were carried out by artificial infection
on stem of 10-days plantlets of maize. After 10 weeks of culture, no sorus was observed on ears.
However, several typical symptoms of S. reilianum were observed: on 40 infection tests, 8 plantlets
were dwarf, 36 presented chlorotic spots on leaves and 4 had no symptom. PCR diagnostic using specific
primers confirmed that the fungus is present in chlorotic spots of leaves and in caulinar apex of dwarf
plants (Figure 1-4).

Figure I-415 : In planta detection of S. reilianumSRZS1.

PCR was performed with the specific primers pSRZ4-pITS4. Lanes 1 and 11: DNA ladder 100 bp. Lanes 2-3: DNA from non
inoculated maize apex. Lanes 4-5: DNA from non inoculated maize leaves. Lanes 6a 7a 8a: DNA from apex of maize inoculated
with SRZS1. Lanes 6b 8b: DNA from chlorotic spots of leaves of maize inoculated with SRZ1. Lanes 7b 8c-e: DNA from inoculated
leaves without chlorotic spots. Lane 9: DNA from maize inoculated with a mix of SRZNxSRZM. Lane 10: DNA from S. reilianum
strain SRZS1.

These experiments indicate that SRZS1 strain of S. reilianum is infectious, induces typical
symptoms in maize, could be detected in leaves and caulinar apices but could not sporulate and form
sori.

Frequency of production of solopathogenic strains differs according to

Ustilaginaceae species
The ability of three species of Ustilaginaceae to form solopathogenic strains was tested using
the protocol elaborate for S. reilianum. To ensure the variability and limit genotype effect on
solopathogen strain production, teliospores were collected from different areas. Results in table I
indicate that the three species tested have different behavior on solopathogenic strain production,
according to the experimental procedure used. All stable fuzzy strains were infectious, but as previously
observed with SRZS1, infection by the fuzzy strains didnt lead to spore formation. It must be noticed
than the galls obtain with the solopathogen forms of U. maydis contained few spores compared to galls
usually obtained in the laboratory by infecting with two compatible strains (not shown).

41

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

Tableau I-1: Potentiality of three Ustilaginaceae to produce solopathogenic strains.

The percentage of stable fuzzy strains appears in red in the table. All strains obtained from M. penicilliarae were filamentous
and solopathogenic, while this phenomenon is rare for S. reilianum (0.15 %). U. maydis has an intermediate behavior: 2.6%
of strains were solopathogenic in our experimental conditions.
fuzzy strains
teliospores
analysed

S.reilianum
U. maydis
M. penicilliarae

100
100
100

initial
culture

final

subculture subculture subculture

1

38

32

27
61

549

50

50

pathogenicity

percentage
infectionf

of stable
fuzzy strains

sorus
formation

0,15%

15/20

0/40

32

2,60%

18/20

100,00%

10/10

50

a: total of 1322 colonies analysed

b: total of 1239 colonies analysed
c: total of 549 colonies analysed
d: for M. penicilliarae, only 50 strains were used in each subculture as all of them were filamentous and stable
e: R=(number of stable fuzzy strains in subculture 3) / (total of colonies isolated in the initial culture) x 100
f: evaluated on the 2 isolated strains by PCR detection on caulinar apices ( 10 plantlets each strain)

Comparing to the initial number of colonies isolated from germinating teliospores, S. reilianum
showed the lower potentiality to produce fuzzy colonies whereas all strains of M. penicilliarae were
solopathogen. U. maydis has an intermediate behavior. Although all pure strains of M. penicilliarae were
solopathogen, attempts to amplify MAT genes to assess the diploid character of this species failed.
Curiously, this species has a low potentiality to form fuzzy colonies: pseudo hyphae are only visible on
young colonies (36 h in our conditions), and are rapidly masked by yeast forms.
1-5 Conclusion
The Ustilaginaceae are dimorphic fungi: their life cycle is characterized by a transition of a
haploid saprotrophic yeast form in a dicaryotic parasitic hyphal form. The life cycle of Ustilago maydis is
usually used to illustrate this feature (Agrios, 1988). Variations of the life cycle among the different
species occur according to the host plant, the area of distribution and many other ecological factors
which could involve a specific adaptation. For instance it was observed that teliospore morphology is
correlated with dispersal (Piepenbring et al., 1998; Vanky, 1998): species adapted to wind dispersal are
grouped in spore balls, lowering desiccation, and present wing structures corresponding to cell wall of
degraded sterile cells. Depending on the organ infected (root, leaves and flowers), a great discrepancy
of the systemic growth ability was observed between species (Vnky, 1994). It must be noticed that
among the features shared by Ustilaginaceae, the biological incidence of smut fungi to form
solopathogenic strains was poorly investigated. Two major reasons could be involved. First,
solopathogenic strains have always be considered as useful strains for laboratory uses, but abnormal
cells resulting from a deviance on the normal cell cycle. The fact that solopathogenic strains of U. maydis

42

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

were less efficient in term of spore production comforted the idea of degenerated cells (Holliday, 1974).
Secondly the properness of different smut species to form such strains was not measured as a standard
protocol was not proposed. In the literature, solopathogenic forms were either obtained by genetic
approaches using mutants (Holliday, 1974) either by simply crossing compatible strains (Ehrlich, 1958;
Puhalla, 1968). Our strategy to use teliospores allowed comparing the ability of different species to
produce such strains.
Although filamentous strains issuing from the genetic transformation of a haploid strain by the
complementary allele B has been recently obtained (Schirawski et al., 2005), we report here the first
isolation of natural solopathogenic strains of S. reilianum. We inoculated maize plants with two
compatible haploid strains (SRZM and SRZN) to obtain teliospores and then isolate a stable fuzzy SRZS1
strain. As reported for a natural solopathogen form of U. maydis (Ehrlich, 1958), the strain SRZS1 is
monokaryotic. By using a CAPS approach, we were able to assess that SRZS1 possess the two alleles
MATB present in the parental strains SRZM and SRZN, indicating that this monokaryotic strain is diploid.
The pathogenicity of the two isolated solopathogenic strains of S. reilianum is weak. These
strains are infectious as all inoculated plants show symptoms like chlorotic spots and in a lesser extend a
reduction of plant growth. It was observed that this fungus infects maize in field via roots, growing to
the caulinar apex until floral induction and then inducing its sporogenesis (Martinez et al., 2002). A PCR
diagnostic revealed that most inoculated plants are infected in the caulinar apex. However, in spite of
different attempts, we were unable to induce formation of sorus in infected plants. These
solopathogenic strains seem unable to promote the entire life cycle, although the fungus is infectious.
We used the same protocol to compare the ability of S. reilianum, U. maydis and M. penicilliarae
to form solopathogenic strains. Surprisingly this last species form only solopathogenic strains. It was
already proposed that mono-isolates of M. penicilliarae were infectious (Wilson & Bondari, 1990). All
the strains that we isolated didnt need mating to be infectious. Although we were not able to amplify
MATB genes and to demonstrate diploid of these strains, this result reveals that solopathogeny does not
correspond to an abnormal mechanism and could be involved in the biology of smuts. At the opposite of
M. penicilliarae, the proneness of S. reilianum to form solopathogen strains is very low. In our condition,
less than 1% of the strains formed are solopathogenic. More, these strains are infectious, but cannot
sporulate. In this condition, it can be proposed that solopathogenic strains are not useful in the life cycle
of this species and this feature has been lost by this species. The situation of U. maydis is intermediate.
This species produced around 3 % of solopathogenic strains in the condition used. The solopathogenic
strains tested were infectious, although galls formed are smaller as observed previously (Holliday, 1974).
It is interesting to link up the ability of the three Ustilaginaceae species tested to form
solopathogenic strains to their mode of dispersal. M. penicilliarae is as strict aerial pathogen: infection
of pearl millet occurs only via stigmas of inflorescence, and the disease is spread by the insects or by the

43

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

wind (Baht, 1946; Kousik et al., 1988). S. reilianum is a strict telluric pathogen infecting maize only via
roots (Martinez et al., 2002). These two species differ by their properness to form solopathogenic
strains, and it could be proposed that this discrepancy has a strong biological signification. It was already
mentioned that the formation of dicaryotic strains could be an advantage as the probability to found a
compatible partner to mate lowers respectively to the distance of dispersal (Piepenbring et al., 1998).
Dispersal of diploid or dicaryotic strains, forming a full genetic tank ready to infect is not rare among
Basidiomycetes: rust fungi form dicaryotic spores (ecidiospores and uredospores) which contribute to
the epidemiologic cycle of these diseases, allowing long distance airborne diffusion. Solopathogeny
could then be considered as an adaptative advantage for anemophilous fungal species such M.
penicilliarae. In the case of S. reilianum, the distances of dispersal are very short. This species could find
a compatible partner in soil. In this condition, the biological interest to form solopathogenic strains is
low and could have lead to the lost of the ability to form solopathogenic forms. In this hypothesis, the
intermediate position of U. maydis is interesting to discuss. This species is described to infect be
infectious on different aerial tissues of maize (leaves, stems, inflorescences via silks) and not only
inflorescence as M. penicilliarae. In this condition, the selective advantage to form solopathogenic
strains could be less stringent and could result in a lower properness to produce such strains. It could
then be proposed that U. maydis has a dispersal aptitude intermediate between M. penicilliarae and S.
reilianum in term of distance and of tissue infection.
Our results strengthen the biological role of solopathogenic strains in the life cycle of
Ustilaginaceae species and reinforce the interest to investigate the cellular events involved in.

1-6 References
Agrios GN. 1988. Plant Pathology. San Diego: Academic Press.
Baht RS. 1946. Studies in the Ustilaginales.I. The mode of infection of the bajra plant (Pennisetume typhoides
Stapf.) by the smut Tolyposporium penicillariae Bref. Journal of the Indian Botanical Society 25:163-186.
Banuett F, Herskowitz I. 1988. Ustilago maydis, smut of maize. In: Advances in Plant Pathology: Academic Press. p
427-455.
Banuett F, Herskowitz I. 1989. different a alleles of Ustilago maydis are necessary for maintenance of filamentous
growth but not for meiosis. Proceedings of the National Academy of Sciences of the United States of
America 86:5878-5882.
Begerow D, Bauer R, Boekhout T. 2000. Phylogenetic placements of ustilaginomycetous anamorphs as deduced
from nuclear LSU rDNA sequences. mycological research 104 Part 1:53-60.
Diagne-Lye G. 2005. La pathologie du charbon du mil[pennisetum glaucum (l.) R. Br.]- (brefeld) vanky:
phylogenie, biocycle, variabilit gnotypique de l'agent pathogne, et relations hte-parasite. In:
Dpartement de Biologie Vgtale. Dakar: Cheikh Anta Diop.
Ehrlich HG. 1958. Nuclear Behavior in Mycelium of a Solopathogenic Line and in a Cross of Two Haploid Lines of
Ustilago maydis (DC.) Cda. Mycologia 50:622-627.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes-applicatin to the
identification of mycorrhizae and rusts. Molecular Ecology 2:113-118.
Holliday R. 1974. Ustilago maydis. In: King RC, editor. Hanbook of Genetics. New York: Plenum Press. p 575-595.
Holton CS, Hoffmann JA, Duran R. 1968. Variation in the smut fungi. Annual Review of Phytopathology 6:213-241.

44

CHAPITRE I Les formes solopathognes des Ustilaginaceae : une adaptation au mode de dissmination ?

Kahmann R, Kamper J. 2004. Ustilago maydis: how its biology relates to pathogenic development. New Phytologist
164:31-42.
Kamper J, Kahmann R, Bolker M, Ma L-J, Brefort T, Saville BJ, Banuett F, Kronstad JW, Gold SE, Muller O, Perlin
MH, Wosten HAB, de Vries R, Ruiz-Herrera J, Reynaga-Pena CG, Snetselaar K, McCann M, Perez-Martin
J, Feldbrugge M, Basse CW, Steinberg G, Ibeas JI, Holloman W, Guzman P, Farman M, Stajich JE,
Sentandreu R, Gonzalez-Prieto JM, Kennell JC, Molina L, Schirawski J, Mendoza-Mendoza A, Greilinger
D, Munch K, Rossel N, Scherer M, Vranes M, Ladendorf O, Vincon V, Fuchs U, Sandrock B, Meng S, Ho
ECH, Cahill MJ, Boyce KJ, Klose J, Klosterman SJ, Deelstra HJ, Ortiz-Castellanos L, Li W, Sanchez-Alonso P,
Schreier PH, Hauser-Hahn I, Vaupel M, Koopmann E, Friedrich G, Voss H, Schluter T, Margolis J, Platt D,
Swimmer C, Gnirke A, Chen F, Vysotskaia V, Mannhaupt G, Guldener U, Munsterkotter M, Haase D,
Oesterheld M, Mewes H-W, Mauceli EW, DeCaprio D, Wade CM, Butler J, Young S, Jaffe DB, Calvo S,
Nusbaum C, Galagan J, Birren BW. 2006. Insights from the genome of the biotrophic fungal plant
pathogen Ustilago maydis. Nature 444:97-101.
Kamper J, Reichmann M, Romeis T, Bolker M, Kahmann R. 1995. Multiallelic recognition: Nonself-dependent
dimerization of the bE and bW homeodomain proteins in Ustilago maydis. Cell 81:73-83.
Kousik CS, Thakur RP, Subba Rao KV. 1988. Influence of environmental factors on production and dispersal of
Tolyposporium penicillariae sporidia. Indian Journal of Aerobioliology 1:85-91.
Martinez C, Roux C, Dargent R. 1999. Biotrophic Development of Sporisorium reilianum f. sp. zeae in Vegetative
Shoot Apex of Maize. Phytopathology 89:247-253.
Martinez C, Roux C, Jauneau A, Dargent R. 2002. The biological cycle of Sporisorium reilianum f.sp. zeae: an
overview using microscopy. Mycologia 94:505-514.
Piepenbring M, Hagedorn G, Oberwinkler F. 1998. Spore liberation and dispersal in smut fungi. Botanica Acta
111:444-460.
Puhalla JE. 1968. Compatibility reactions on solid medium ans interstrain inhibition in Ustilago maydis. Genetics
60:461-474.
Schirawski J, Heinze B, Wagenknecht M, Kahmann R. 2005. Mating Type Loci of Sporisorium reilianum: Novel
Pattern with Three a and Multiple b Specificities. Eukaryotic Cell 4:1317-1327.
Vanky K. 1998. A survey of the spore-ball-forming smut fungi. mycological research 102 Part 5:513-526.
Vnky K. 1994. European Smut Fungi. Stuttgart: Gustav Fisher Verlag.
Wilson JP. 1995. Mechanisms associated with the tr allele contributing to reduced smut susceptibility of pearl
millet. Phytopathology 85:966-969.
Wilson JP, Bondari K. 1990. Quantitative genetic analysis of pathogenicity and virulence of Moesziomyces
penicillariae. Phytopathology 80:1173-1177.

45

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections

racinaires chez les plantes hte et non-hte
Avant Propos

Ustilago maydis est un champignon dcrit pour tre infectieux au niveau arien. Mais y
regarder de prs, il y a peu de travaux pidmiologique sur U. maydis. Si cette espce est strictement
arienne, comment seffectue la primo infection au champ partir de tliospores dissmines lanne
prcdente au sol ? En effet, il nest pas identifi dinoculum infectieux dans la flore adventice, il faut
admettre que linoculation primaire prsent dans le sol passe sur les parties ariennes de la plantes par
le vent, la pluie, laction humaine, les vecteurs animaux etc. On peut aussi imaginer que lorsque la
plantule pousse, les tissus au contact du sol peuvent se chargent en formes levures saprotrophes du
champignon, qui une fois en surface des tissus, pourront tre prsent dans la phyllosphre et assurer
une infection ultrieure. Aucune tude de ce type nest disponible sur cette espce emblmatique de la
gntique fongique pathogne. A travers cette tude sur la pntration racinaire dU. maydis, nous
voulons contribuer prciser ltiologie et les risques pidmiologiques de cette maladie. Une
consquence cette tude tien lintrt de cette espce dans ltude de la biotrophie fongique au
niveau racinaire : U. maydis pourrait savrer un modle utile pour comparer cette infection parasite
biotrophe avec des infections symbiotique biotrophe, ainsi que pour permettre des validations
dexpression htrologues de gnes dintrts identifis chez les champignons endomycorhiziens,
espces rtives aux approches gntiques. Enfin certains auteurs, prenant pour prsuppos quU.
maydis est un parasite strictement arien, estiment quun comparatif gnomique avec S. reilianum
pourrait rvler des traits expliquant lorigine de la spcificit tissulaire de linfection. Encore faut il que
cette dichotomie soit vrifie.
Par ailleurs certains travaux indiquent quU. maydis prsente un spectre dhte plus large que
celui considr actuellement. Nous avons cherch dfinir si cette espce pouvait infecter des plantes
non htes, rservoir potentiel dinoculum arien.
Cette tude avait aussi pour objectif de renforcer la signification biologique de la perception par
Ustilago maydis de molcules exsudes par les racines des plantes, les strigolactones (cf cet article et
chapitre III) : si cette espce a des potentialits dinfection racinaire, on peut mieux apprhender
lintrt de cette perception, si tant est que lincidence des strigolactones se limite la rhizosphre
(avant dtre exsudes, elles sont in planta !).

46

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

Ustilago maydis: a root proliferating fungus

Seyed Kazem Sabbagh1, Yves martinez2, Maria Martoub1, Nathalie Sjalon-Delmas1 and Christophe
Roux1
1

University of Toulouse. Laboratory "Cell Surface and Signaling in Plants", University Toulouse-CNRS

Joint Unit 5546 - Plant Biotechnology Institute, 24 Chemin de Borde Rouge, Auzeville, BP42617, F31326
Castanet Tolosan France.
2

IFR40 Plant Biotechnology Institute, 24 Chemin de Borde Rouge, Auzeville, BP42617, F31326 Castanet

Tolosan France.
II-1 Abstract

*We evaluated the capacity of the corn smut fungus Ustilago maydis to penetrate into plant roots.
*The fungus penetrates between epidermic root cells and then forms inter and intracellular
pseudohyphae. Root infection didnt lead to gall formation on the maize line tested, the use of a PCR
detection protocol showed that U. maydis has a weak aptitude to grow from the roots up to the aerial
part of maize.
*U. maydis also infects Medicago truncatula hairy roots as an alternative host. This plant species is a
model host to study root symbiosis, and this pathosystem can provide new insights on root-microbe
interactions.
*Considering that U. maydis could be a soil fungus, we tested its responsiveness to GR24, a strigolactone
analogue. Strigolactones are root exuded molecules which activate mitochondrial metabolism of
arbuscular mycorrhizal fungi. Physiologic and molecular analysis revealed that GR24 also increase cell
respiration of U. maydis. This result points out that strigolactones could have an incidence on several
rhizospheric microbes.
*These data give evidences that the biotrophic pathogen U. maydis can be considered as a model to
study root infection.

II-2 Introduction

Among plant parasites, biotrophic and hemibiotrophic pathogenic fungi are described as highly
adapted to their hosts, showing a tissue-specific infection site and a limited host spectrum: Blumeria
graminis f.sp. hordei infects leaves of barley, Colletotrichum lindemuthianum is pathogen on leaves of
bean. One limitation of this restricted description is that the tissue specificity and the host range of a
pathogen are usually defined by observation of the symptoms. Symptom formation and severity are not

47

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

always strictly correlated to the level of invasion of a plant by a fungus, particularly in the case of
biotrophic fungi which can interact with a host cell without causing major damage. Ustilago maydis for
instance is a biotrophic fungus causing corn smut disease, described in mycological Flora as a strict
pathogen of Zea genus (Vnky, 1994). Recent works showed that a number of monocot and dicot
species, like papaya or Arabidopsis thaliana, were susceptible to inoculation (Leon-Ramirez et al., 2004;
Mndez-Morn et al., 2005). Although U. maydis didnt sporulate in these alternative hosts, these
observations underline that this biotrophic fungus has extended capacity to infect plants and point out
the interest to revisit its biology.
Ustilago maydis is a major fungal model to study biotrophy. It is a dimorphic fungus: compatible
saprotrophic haploid yeasts mate and form pathogenic dicayotic hyphae. A great interest in this model is
that sexual cycle, morphology and pathogenicity are interconnected processes (Kahmann & Kamper,
2004). Based on symptom formation -e.g. gall formation- U. maydis is considered as infecting maize via
different aerial part of maize (Christensen, 1963 and references therein; Wenzler & Meins, 1987).
Several works described with accuracy the penetration process of dicaryotic hyphae issuing from fusion
of compatible yeast strains on stem, young and aged leaves and silks (Mills & Kotz, 1981; Snetselaar,
1993; Snetselaar & Mims, 1992, 1993, 1994).
We investigated here whether this pathogen could efficiently infect maize plantlets via roots. Different
inoculum forms were tested: teliospores, a mix of compatible haploid yeasts, a solopathogenic strain,
and a haploid yeast strain as control. Solopathogenic strains are diploid strains of the fungus which can
infect plants in absence of mating with a compatible one (Holliday, 1974). The efficiency of infection was
analysed by using a set of complementary microscopic techniques and PCR detection.
To further evaluate the potentialities of U. maydis as a rhizospheric pathogen, we also tested its ability
to infect alternative host roots and to perceive root exuded molecules. Inoculations were carried out on
Medicago truncatula hairy roots. This plant species is a model plant to investigate root biotrophic
symbiosis. As the main root pathosystems available on barrel medic involve necrotrophic fungi (Tivoli et
al., 2006), it was interesting to test on this plant the infectious potential of the biotrophic fungus U.
maydis. The second evaluation consisted in monitoring the response of U. maydis to root exuded
molecules. Many soilborne organisms were described to perceive molecules exuded by plant roots. This
is the case for Sporisorium reilianum f.sp. zeae, a root infecting pathogen phylogenetically related to U.
maydis, causing maize head smut, which was described to be sensitive to a lipophilic fraction of maize
root exudates (Martinez et al., 2001). We particularly tested the response of U. maydis to GR24, a
synthetic chemical analogue of strigolactones. These molecules, present in root exudates of a broad
spectrum of plants, have been described as important signals occurring in previous steps of interactions
of plants with parasitic weeds (Cook et al., 1972) and with (AM) mycorrhizal fungi (Akiyama et al.,
2005). On AM fungi, strigolactones boost mitochondrial activity causing a putative metabolic switch

48

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

(Besserer et al., 2006).We then tested the effect of GR24 on cell respiration of U. maydis and S.
reilianum, this last species being considered as a root infecting pathogen of maize.
The aim of these investigations is to evaluate Ustilago maydis as a pathogenic fungal model to study
root infection.

II-3 Materials and methods

Fungal strains and culture condition

Haploid strains FB6a and FB6b (Banuett & Herskowitz, 1989), teliospores obtained from artificial
contamination of maize with the strains FB6axFB6b, and a solopathogenic strain FBD11/pOTEF
expressing the green fluorescent protein GFP (Spellig et al., 1996) were used in this study. Haploid
(CRM) and solopathogenic (CRS1) strains of Sporisorium reilianum were isolated in our laboratory. All
yeast strains were cultivated in liquid potato dextrose broth medium (PDB) at 24C under shaking 100
rpm.
Plants and culture conditions
A maize line susceptible to Ustilago maydis (LMZ66 - France) was used as natural host. Corn seeds free
of microbial contamination were cultivated in Magenta boxes on solidified M medium or in pot on
sterilized peat (1 h at 120C) as previously described (Martinez et al., 2002). In Magenta boxes,
inoculations on 1-week-old maize plantlets were carried out by adding in the vicinity of roots 500 L of
cell suspension at 107 cells/ml. In pot, inoculations were carried out by pouring directly on roots 1 ml of
cell suspension at 107 cells ml-1. For these experiments, the plants were grown in a night/day
temperature of 18/24 5C for 3 to 5 weeks, except for symptom observation where cultivation was
performed in greenhouse up to floral formation. Infection of hairy roots of Medicago truncatula cv
Jemalong grown on M medium were performed by adding droplets of a culture of FBD11/pOTEF on root
tips, followed by a 2-week co-cultivation before observation.
Microscopic observations
Observations of infection and development of U. maydis in roots were performed by macroscopic and
microscopic observation. For light microscopy, samples of root were embedded in agarose before
cutting sections of 150 m width. The sections were stained with lactophenol-cotton blue and rinsed in
lactophenol for 10 min. All the specimens were mounted on a glass slide and observed under brightfield optics or differential interference contrast (DIC). Observations under bright field, DIC, or
epifluorescence were carried out in a Leica DMIRB Microscope (Leica, Wetzlar, Germany). Images were
acquired using a colour video camera (Hyper Had, Japan). For TEM observations, we used the method

49

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

described by Martinez et al. 1999. Ultrathin sections (50-60 nm in thickness) were stained with uranylacetate or PATAg (periodic acid thiocarbohyrazide - silver) and examined using a Philips 301
transmission electron microscope at 80 KV (Philips, Eindhoven, The Netherlands). For confocal
microscopy, roots inoculated with a solopathogenic strain of U.maydis expressing the green
fluorescence protein (FBD11-pOTEF) were observed by a spectral confocal laser scanning system (SP2
SE, Leica, Germany) equipped with an upright microscope (DM 6000, Leica, Germany). An Argon laser
emitted at 488nm was used to detect GFP fluorescence in the range between 500 and 530 nm. The ray
line of the He-Ne laser emitted at 543nm was able to excite the cell wall coloured by a solution of blue
evans 0.01% for 30 sec and the fluorescence was collected in the range 590-710nm. The images were
acquired in the dual mode. The overlay images were then computed by projection of 20 to 30 planconfocal images acquired in Z dimension with 0.8m increments between two focal planes.
PCR detection
Plants used for these experiments were cultivated in pots for 5 weeks after addition of different
inoculum sources on root plantlets. A set of 10 plants was used for each inoculum, and the experiments
were triplicated. Aerial parts were then collected and caulinar apices were isolated to avoid risk of
contamination by the inoculum on plant surface. DNA extractions from 50 mg of plant material were
performed

using

the

CTAB

procedure.

We

designed

the

specific

primer

pUM1

(5-

CGGTCGGTCTGTCGAAACC-3) on the ribosomic internal transcribed spacer 1 region of U. maydis. PCR

reactions (5 min 94C 35 cycles 1min 54 C 1 min 72 C 1 min 94C 10 min 72 C) using pUM1-pITS4
primers were followed by electrophoresis of amplicons on agarose 1.5%. The presence of U. maydis in
samples is assessed by the presence of a 680 bp band.
Effect of GR24 on cell respiration
Respiratory measurements were performed by polarography and by a fluorescent assay 1 h after
addition of GR24, a strigolactone analogue. For all strains (FB6b and FBD11/pOTEF for U. maydis, CRM
and CRS1 for S. reilianum), young cultures of ten-hour-old were used for these assays. Cell density was
measured in assay and control at the end of the experiment and compared to the starting respective
concentration. Polarography was performed by using a Clark electrode according to Besserer et al.,
2006. A volume of 10 mL of cells (106 cells.mL-1) were incubated during 1h with GR24 or with the
corresponding solvent (0.01% acetone/water) for control before measuring oxygen consumption. For
fluorescent assays, the protocol used is adapted from the recommendation of the manufacturer. A
volume of 20 l of CellTiter-Blue reagent (CTBR Promega, Madison, USA) was added to 100 l of cell
suspension at 107 cell.ml-1. The blue dye (resazurin) could be reduced in resorufin, a fluorescent
compound, by the cell redox potential. Specific inhibitors of cell respiration (carboxin 300 M, di-nitrophnol 100 M) totally inhibited fluorescence formation on cell cultures (data not shown), indicating

50

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

that the Redox potential formed and then the resulting fluorescence emitted is essentially issuing from
mitochondrial activity. Cell respiration was measured on 96-well-optical reaction plates at 25C by
recording fluorescence with an excitation wavelength of 560nm and an emission wavelength of 590nm
using a Fluoroskan FL600 (bio-tek, Vermont, USA).
RNA extraction and RT-PCR
Control (acetone 0.01%) and GR24-stimulated cells (FBD11) were harvested by centrifugation after
elicitation for 1h and conserved at -80C for RNA extraction. Total RNAs were isolated using a standard
phenol-chloroform procedure, purified using RNA purification Kit (promega) and treated by the RNaseFree DNase Set (Promega) according to the manufacturers recommendations. Contamination of residual
genomic DNA in all RNA samples was verified by conventional PCR amplification on total RNA using
the designed primers. Total RNA yield and concentration were measured with Nanodrop ND-1000
spectrophotometer and the concentration of each sample was adjusted to 100 ng.l -1. Quality of RNA
was assessed by 1% agarose gel electrophoresis stained by ethidium bromide and evaluated with Agilent
2100 bioanalyzer (Agilent technologies). For reverse transcription step, ImPromII enzyme (Promega) was
used according to the manufacturers recommendations. First strands of cDNA were purified and
concentration of final working solution was adjusted according to ND-1000 spectrophotometer
quantification.
Primer design and qRT-PCR
Oligonucleotide

primers

used

in

this

study

were

(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi).

designed

Ras1

using

(GenBank

Primer3

accession

site

number

CAA51689, fp 5-TACCATTGAGGACTCTTACC-3 and rp 5-CGGCAGTATCCAACACATC-3, Muller et al.,

2003), Rop1 (GenBank accession number CAA51689, fp 5-CAGAGGTTTGGGACAAGCTC-3 and rp 5TAGGACGAGGAAGAGGACGA-3, Brefort et al., 2005) and mig2-2 (fp 5-AACCCAAAGCAGCCGTACCT3and rp 5- GCTCTTCCACCAACGAATCG-3, Basse et al., 2002) were used as marker genes involved in
pathogenicity. Cytochrome c1 Oxydase -Cytc1 (GenBank accession number ABQ96919, fp 5CTATGGCTGAGGAGGTCGAG-3and rp 5- TAAGGTCGGGGCATGTAGTC-3) is a gene marker of cell
respiration, hypothetical 60S ribosomal protein (GenBank accession number UM02518.1 fp 5GCAGGTGACTTTCGAGATCC-3 and rp 5-GGTCCGTGTGAATTTTGGTC-3) is as gene marker of cell
translation.

Elongation

factor-EF1

(GenBank

accession

number

XP_757071,

fp

5-

TGGTAAGACCCTCCTTGACG-3 and rp 3-ACCGCCGATCTTGTAGACAT-5) and glycine N-acyltransferase

GNAT

(GenBank

accession

no

EDN60858,

fp

5-TGCCATCCTCGACTTTATCC-3

and

rp

3-

TCAGCAATCAACACCTCTGC-5) were used as housekeeping genes deduced from a preliminary

transcriptomic analysis (not shown). Real-time PCR was performed on cDNA templates using a
lightcycler ABI PRISM 7900 HT sequence detection system (Perkin Elmer/Applied Biosystem, Foster City,

51

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

USA) and PCR Master Mix for Syber Green Assays (Applied Biosystems, Foster City, USA) according to
the manufacturers protocol. Real-time PCR were carried out in optical 384-well plates using the ABI
PRISM 7900 HT sequence detection system (Applied biosystems) using the following concentration: 8 l
of SYBR Green PCR MasterMix (Applied Biosystems), 10 M of each oligonucleotide primer (final
concentration) and 2 ng of cDNA template in 10 l reaction volume. Each gene amplification was
prepared in triplicates. Two biological repetitions were carried out. Triplicates were validated with
technical error under 0.5 CT. The amplification condition was: 50C for 2min, 95C for 10min, 40 cycles
at 95C for 15sec, 60C for 1 min. Melting curves analysis were performed after each reaction, to
exclude non specific amplifications, with the thermal cycle at 95C for 15sec, 60C for 15sec and 95C for
15sec. The optimal baseline and threshold values were determined using automatic CT function
available with the SDS 2.2 software (Applied Biosystems). The equation of the line that best fits the data
was determined by minimizing error for regression analysis. The R 2 value was calculated to estimate the
accuracy of the real-time RT-PCR as a quantification method. The slope of the standard curve was used
to calculate the efficiency of the real-time QRT-PCR according to the formula E = 10-1/slope (Ptaffi, 2001;
Wen et al., 2005). The calibration curves were created using series of cDNA dilutions from 10 to 100 ng.
EF1 gene was used for normalization experimental design. All data exported from SDS 2.2 software were
calculated with Microsoft Excel software.

52

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

II-4 Results

Ustilago maydis infects maize roots

The ability of U.maydis to penetrate and proliferate in maize roots, then to systemically grow up to
aerial parts was respectively investigated by using microscopy techniques and PCR diagnostic. Mock
plants but also plants inoculated with the non pathogen haploid strain Fb6b were used as controls. After
3 weeks of culture in Magenta box, roots of maize inoculated with the pathogenic inoculums forms
of U. maydis (FB6 a xFB6 b mix; teliospores; FBD11/pOTEF) were covered with a hyphal net (not
shown). Transverse sections stained with cotton blue reveals that the fungus penetrates the
roots by growing at the junction of epidermic cells, then breaches the cell wall and forms
hyphae in host cells (Fig. 1a). Fungal growth is mainly intracellular, the fungus growing from cell
to cell through the host cell wall in the inner part of the roots (Fig. 1b). In larger roots, the
observation was performed in confocal microscopy with a fluorescent solopathogenic strain
(FBD11 solo-pOTEF) expressing GFP. The fungus can invade all root tissues except xylem (Fig.
1c). The density of fungal cells in roots increased between 3 and 5 weeks. In general, we observed
that U. maydis was less abundant in secondary roots and in the central pith. Although the fungus is
mainly intracellular, growth in intercellular space is often observed in root epidermis (Fig. 1d).
In Transmission Electron Microscopy (TEM) observations, the fungus appeared as rounded cells or part
of pseudo-hyphae depending on the angle of cutting (Fig. 1e,f). The fungus hydrolyses the outer cell wall
of root cells, penetrates by growing in the middle lamella of cell wall, then penetrates root cells and
grows intracellularly from cell to cell. Same observations were obtained whatever the inoculum source,
except with the non pathogenic haploid FB6b strain (not shown).

53

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

Figure II-1 : Observation of Ustilago maydis in maize roots.

(a-b) Transverse section of 2-week-old roots stained by cotton blue. (a) The fungus penetrates essentially into the junction
of epidermis cells (double arrows) and then develops intercellular and intracellular pseudo-hyphae (arrows). (b) The fungus
invades the epidermis and the root cortex, passing from cells to cells through host cell wall (arrows).
(c-d) Confocal microscopy of 5-week-old roots infected by a solopathogenic strain expressing GFP (FBD11-pOTEF). (c) The use of
a bi-photon apparatus allows revealing the different root cell tissues and the fungus. The fungus is present in all inner tissues of
roots, except xylem. (d ) In cortical cells, the fungus is visible in intercellular space (white double arrow) and inside host cells,
forming hyphae crossing host cell wall (white arrows).
(e-f) Transmission electron microscopy of infected roots, stained with PATAg. (e) External fungal cells (*) are tightly stuck to the
epidermal cell wall by peeling the outer root matrix (m). The fungus develops wedge cells which penetrate between two
epidermal host cells (white arrow) before being intracellular (black arrow). (f) Perforation of the host cell wall (arrow) by the
fungus.
Magnification bars: (a-c) 30 m; (d) 10 m; (e-f) 5 m.

54

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

Maize root infection by Ustilago maydis didnt cause symptoms

Microscopic observations on the aerial part of the maize, 3 weeks after root inoculation, didnt
reveal the presence of fungal structure either by light or fluorescence microscopy. To define if the
fungus could migrate systemically from roots to stem on more lignified 5 week-old maize, we designed a
specific primer to detect the presence of the fungus by using PCR. The primer pUM1 was designed on
the ribosomal ITS1 region after alignment of several ITS sequences of Ustilaginales. Its specificity was
assessed by amplification of a 680 bp sequence on DNA of Ustilago maydis, but not with DNA from
Sporisorium reilianum, Ustilago hordei or maize (not shown). We used the primers pUM1-pITS4 to the
fungus in stems of 5-week-old infected maize. To prevent DNA contamination by fungal cells outside
plant tissues, we extracted DNA on isolated caulinary apices. As reported in Fig. 2, the fungus could be
detected in aerial part of the maize after root infection, whatever the pathogenic inoculum tested
(FB6axFB6b, teliospores, FBD11/pOTEF). However, among all inoculations performed, only 16% of
inoculated plants showed a PCR signature, indicating that systemic growth of Ustilago maydis from
roots to aerial parts is weak. No significant difference was noticed according to fungal inoculum. In a last
series of experimentation, three independent series of 10 maize plants were inoculated on roots with
teliospores and cultivated for 12 weeks in greenhouse. No symptom appeared on the aerial part of the
maize line used, and overall we never observe any difference of growth during our assays in magenta
boxes or in pot between infected, mock and control (FB6b inoculation) plants.

Figure II-2 : Electrophoresis of amplicons after PCR amplication of ITS regions using the primers pUM1-pITS4.
Lane 1: maize inoculated with a haploid strain of U. maydis FB6b. Lane 2: non inoculated maize. Lane 3: U. maydis FB6b strain.
Lanes 4 and 10: 100 bp DNA ladder. Lanes 5 and 6: maize inoculated with (FB6a x FB6b) strains. Lanes 7: maize inoculated with
FBD11-pOTEF strain. Lanes 8 and 9: maize inoculated with teliospores. The arrow represents the size of amplicon (680 bp).

Ustilago maydis can infect Medicago roots

Hairy roots of Medicago truncatula cv Jemalong cultivated on Petri dishes were inoculated by FBD11pOTEF. The inoculum was applied at root tips for a 2-week co-culture, until formation of fuzzy colonies
at the tip of the roots (Fig 3a). Some aerial roots, not in contact with the solidified medium, appeared

55

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

swollen with a visible white hyphal development at the surface (Fig 3b). Green fluorescence allowed to
assess that this mycelium corresponded to the FBD11-pOTEF strain (Fig. 3c). Fluorescence is not limited
to external hyphae and could be observed into root tissue (Fig. 3c double arrow). Confocal observations
confirm the presence of typical pseudo-hyphae of U.maydis inside root tissues (Fig. 3d). Observation of
root slides after staining with lactophenol-cotton blue revealed that the mycelium is more abundant in
epidermal root cells than in the cortical zone (not shown). When observed by TEM (Fig. 3e), the fungus
could be observed inside tissues, sometimes forming grouped hyphae inside root cells. These results
indicate that U.maydis is able to penetrate the roots of Medicago truncatula in absence of wounding.

Figure II-3 : Infection of hairy roots of Medicago truncatula with Ustilago maydis FBD11-pOTEF strain.
(a) Spots of Ustilago in the vicinity of roots on surface of gelified medium, forming white filamentous colonies (arrows).
(b-c) Observation of an aerial root with a stereomicroscope under visible and epifluorescence light. (b) Parts of roots appear
swollen (white arrow), and white mycelium is sometime visible outside the root (black arrow). (c) Under fluorescent light, green
fluorescence is visible in the areas where fungal structures are present (simple arrows), but also inside the root tissues (double
arrow). (d) Fluorescent hyphae are observed inside Medicago root tissue using confocal microscopy (arrow). The hyphae cells
are passing from cell to cell through host cell wall (white arrow).
(e) Transmission electron microscopy of infected medicago roots, stained with PATAg. The fungus is observed inside non host
root cell. Some cells are heavily infected.
Magnification bars: (a) 1 cm; (b-c) 1 mm; (d) 20 m; (e) 5 m.

56

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

57

A strigolactone analogue stimulates U.maydis cell respiration

The effect of GR24 on cell respiration of S. reilianum and U. maydis was evaluated.
-8

Tableau II-1 Effect of GR24 10 M on cell respiration of Ustilago maydis and Sporisorium reilianum.

O2 consumption

Redox potential

U. maydis haploid strain

+11.9%

+14.1%

U. maydis solopathogenic strain

ND

+9.2%

S. reilianum haploid strain

+13.1%

+11.6 %

S. reilianum solopathogenic strain

ND

+11.8%

Oxygen consumption was measured by using polarographic method. Values correspond to the ratio of slopes (100 x (s GR-sCt)/sCt)
obtained on cells elicited or not with GR24 during 1h. Redox potential, resulting mainly from cell respiration (see Material and
Methods) was measured by using CellTiterBlue reagent. Values correspond to the ratio of fluorescence measured 1h post
addition of GR24 and in control condition (100 x (fGR-fCt)/fCt). No significant difference of cell density was noticed on assays and
controls before and after 1h for the different experiments. ND: Not Determined. Values correspond to one of three
independent experiments.

Results in Table I indicate that GR24 have a positive effect on cell respiration of S. reilianum and U.
maydis whereas the density of cells remained unchanged on control and assay during the experiment.
This induction was observed on the two fungi either on haploid or solopathogenic strains, and whatever
the technique used (polarography or Cell Titer Blue). Using the Cell Titer Blue method, the optimal
concentration to induce cell respiration was reached at 10-11M whereas a toxic effect was observed at
10-5M (Fig. 4).
Figure II-4: Dose response effect of GR24 on cell respiration
of Ustilago maydis.
Respiration was measured using the CellTiter Blue reaction.
The relative cell respiration (Rc) was calculated from the
respiration rate measured 1h post addition of a range of
concentration of GR24 (RGR24) and the corresponding control
(RCtrol) (Rc = 100 x (RGR24-RCtrol)/RCtrol).

In order to have a better understanding of such a response, we analyzed the effect of GR24 on the
expression of some genes involved in cell respiration (cytochrome C oxidase), transcription (ribosomal

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

protein), and genes identified in their role in the previous (ras1, rop1) and later step (mig2.2) of
pathogenicity. Data acquired on the solopathogenic strain by qRT-PCR showed that 1 h post
addition of GR24, transcription of genes Cytc1 (2.7 fold) and prib60S (3.24 fold) was up -regulated,
but not the other genes.

QRT- PCR analysis

Fol d Change

4
3
2
1
0
Prib2

Cyt

Ras

Smu

Khd

Ubc1

Ubc2

GNA

Ump

Ukb1

Ef1

Kpp2

Genes

Figure II-5: Quantitative real-time PCR analysis of U.maydis induced cells by GR24 10-7M after 1h of treatment.
RNA was extracted from induced cells by GR24 for 1h and control cells of U.maydis haplois FB6a strain. cDNA was synthesized
from 100 ng mRNA purified and used for real-time PCR with specific primer pairs for genes involved in biotrophy (mig2-2), in
the transduction cascade elicited by pheromone (see Kahmann & Kamper 2004) and genes coding for ribosomal protein and
cytochrome oxidase. Ratios are given as logarithmic values (base 2) of means of three independent experiments. Only
cytochrome C oxydase and ribosomal protein (Prib2) are differentially expressed (P-value 0.001). An ANOVA analysis of our
data indicated that the genes involved in pathogenecity of U.maydis were not significantly differentially regulated in cells
elicited by GR24 compared to control condition.

II-5 Discussion

Our experiments show that U. maydis is able to infect maize roots. All the pathogenic forms of the
fungus tested (teliospores, mix of compatible sporidia, solopathogenic strains) were infective, whereas
the non pathogen haploid strain didnt penetrate roots. Penetration occurs by pseudo-hyphae which
degrade epidermic root cell surface, form an infection wedge between two epidermic cells and then
penetrate into epidermic or cortical cells. A similar mechanism of penetration between two adjacent
epidermic cells was observed when U. maydis penetrates maize stigmas (Snetselaar & Mims, 1993). This
behavior is in accordance with the fact that U. maydis possesses only discrete appressorium-like
structures, showing slightly swollen cells (Snetselaar & Mims, 1993, Snetselaar et al., 2001) and doesnt

58

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

have the capacity to penetrate plant tissue by mechanical force. After penetration, hyphae grow
intracellularly and intercellularly and invade all parts of maize roots. In spite of this growth in root of
maize plantlets, aerial tissues were weakly infected: PCR detection revealed that only 16 % of maize
stems were infected 5 weeks after root infection and we were unable to observe hyphae in aerial
tissues. The systemic growth of the fungus from root to stem seems to be insufficient to allow
sporulation and induce formation of gall. Interestingly, maize is a host of another smut fungus,
Sporisorium reilianum f.sp. zeae, causing maize head smut disease. Typical symptom corresponds to a
black sorus full of teliospores instead of ear or tassel. S. reilianum infects maize only via roots of
plantlets and sporulates only if it reaches apical meristem (Martinez et al., 2000). Based on the
observation of gall and sorus formation, it was supposed that these two smut fungi have different
strategies of penetration in maize U maydis on aerial parts, S. reilianum on roots. It is likely that their
difference seems to be related more to their ability to growth systemically in planta than to their
potentiality to infect roots.
Infection of aerial parts of alternative hosts by U maydis has been already observed (Leon-Ramirez et al.,
2004; Mndez-Morn et al., 2005). We observed here that U. maydis could parasite roots of Medicago
truncatula. The fungus penetrated in the absence of wounding on the apical zone of roots, and then
grew on all parts of hairy roots. M. truncatula is a model Legume to study root biotrophic symbiosis by
rhizobia and AM fungi. Several comparative transcriptomic works have been developed to find shared
signalling and metabolic pathways involved in these two biotrophic symbiotic interactions (Journet et
al., 2002; Manthey et al., 2004). The use of a root pathogenic partner would be helpful for these
investigations. The interest of such cross analysis between symbiotic and pathogenic interactions was
demonstrated on rice: comparison of the root transcriptomes in presence of AM fungi and
Magnaporthe grisea revealed common traits (Guimil et al., 2005).
The ability of U. maydis to infect alternative host is intriguing. Although U. maydis is one of the best
known fungal models to study biotrophic interaction, its epidemiology is poorly documented:
teliospores formed at the end of life cycle are widespread in soil and overwinter, but the primo infective
inoculum in field is not clearly identified. In alternative hosts, the fungus doesnt form teliospores but
external hyphae were observed on different parts of Medicago roots not in contact with the inoculum.
Aerial mycelium was also observed on different alternative hosts (Mendez Roldan 2005). These discrete
fungal structures were only observed in controlled conditions but it seems necessary to evaluate the
incidence of infected weeds as a source of inoculum in field, discarding airborne pathogenic structures.
In a last series of experiments to define that U. maydis could be a soilborne organism, we tested its
ability to perceive root exuded molecules. We tested the effect of GR24, a chemical analogue of
strigolactones. This chemical family is involved in plant-parasitic weeds interaction (see Bouwmeester et
al., 2003 for review) and in arbuscular mycorrhizal symbiosis (Akiyama et al., 2005; Gomez-Roldan et al.,

59

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

2007). On arbuscular mycorrhizal fungi, GR24 elicits cell respiration prior hyphal branching (Besserer et
al., 2006). It was recently reported that GR24 has no effect on hyphal branching of different soil
filamentous fungi and on microconidia germination of Fusarium oxysporum (Steinkellner et al., 2007),
suggesting the strigolactones to be specific signals for AM fungi but not for other plant interacting fungi.
We observed here that GR24 rapidly affects cell respiration of U. maydis and S. reilianum. The optimal
concentration defined of U. maydis (10-11M) is in accordance with the most active concentrations
already observed on AM fungi (Besserer et al., 2006). Their response differs on the inhibitory effect
observed on U. maydis at the higher concentrations of GR24, indicating putative differences of cellular
mechanism of action and environmental incidence of strigolactones according to the target organism.
The increase of cell respiration is confirmed by the observed induction of cytc1 gene transcription one
hour post addition of GR24. At this time of induction, we didnt observe induction of genes involved in
early (ras1, rop1) or late (mig2.2) pathogenic events of U. maydis. More information about the biological
incidence of the perception of strigolactones in U. maydis and S. reilianum pathogenesis would need the
use of maize mutant lines repressed in strigolactones biosynthesis. To date, such mutants are still not
available, but this result underlines that strigolactones could have a larger spectrum of targeted
organisms than considered and could be root signaling components involved in the establishment of the
rhizospheric flora. Incidently, this result shows that U. maydis doesnt differ from the root infecting
pathogen S. reilianum about its ability to perceive root exuded molecules and argued to the fact that it
could be considered as a rhizospheric fungus.
This new insight into the ability of U.maydis to penetrate roots of maize and barrel medic and to
perceive strigolactones makes it a powerful tool to better understand the underground interactions.

II-6 References

Akiyama K, Matsuzaki K-I, Hayashi H. 2005. Plant sesquiterpenes induce hyphal branching in arbuscular mycorrhizal fungi.
Nature 435:824-827.
Banuett F, Herskowitz I. 1989. different a alleles of Ustilago maydis are necessary for maintenance of filamentous growth but
not for meiosis. Proceedings of the National Academy of Sciences of the United States of America 86:5878-5882.
Basse CW, Kolb S, Kahmann R. 2002. A maize-specifically expressed gene cluster in Ustilago maydis. Molecular Microbiology
43:75-93.
Besserer A, Puech-Pags V, Kiefer P, Gomez-Roldan V, Jauneau A, Roy S, Portais J, Roux C, Bcard G, Sjalon-Delmas N. 2006.
Strigolactones Stimulate Arbuscular Mycorrhizal Fungi by Activating Mitochondria. PloS Biology 4:1239-1247.
Bouwmeester HJ, Matusova R, Zhongkui S, Beale MH. 2003. Secondary metabolite signalling in host-parasitic plant
interactions. Current Opinion in Plant Biology 6:358-364.
Bouwmeester HJ, Roux C, Lopez-Raez JA, Bcard G. 2007. Rhizosphere communication of plants, parasitic plants and AM fungi.
Trends in Plant Science 12:224-230.

60

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

Brefort T, Muller P, Kahmann R. 2005. The High-Mobility-Group Domain Transcription Factor Rop1 Is a Direct Regulator of prf1
in Ustilago maydis . Eukaryotic Cell 4:379-391.
Christensen JJ. 1963. Corn smut caused by Ustilago maydis - Monography 2. St Paul: American Phytopathological Society
Cook CE, Whichard LP, Wall ME, Egley GH, Coggon P, Luhan PA, McPhail AT. 1972. Germination stimulants. II. Structure of
strigol, a potent seed germination stimulant for witchweed (Striga lutea). Journal of American Chemical Society 94:6198-6199.
Gomez-Roldan V, Roux C, Girard D, Bcard G, Puech V. 2007. Strigolactones: promising plant signals. Plant Signaling &
Behavior 2:163-164.
Guimil S, Chang H-S, Zhu T, Sesma A, Osbourn A, Roux C, Ioannidis V, Oakeley EJ, Docquier M, Descombes P, Briggs SP,
Paszkowski U. 2005. Comparative transcriptomics of rice reveals an ancient pattern of response to microbial colonization.
Proceedings of the National Academy of Sciences of the United States of America 102:8066-8070.
Holliday R. 1974. Ustilago maydis. In: King RC, editor. Hanbook of Genetics. New York: Plenum Press. p 575-595.
Journet EP, Van Tuinen D, Gouzy J, Crespeau H, Carreau V, Farmer MJ, Niebel A, Schiex T, Jaillon O, Chatagnier O, Godiard L,
Micheli F, Kahn D, Gianinazzi-Pearson V, Gamas P. 2002. Exploring root symbiotic programs in the model legume Medicago
truncatula using EST analysis. Nucleic Acids Research 30:5579-5592.
Kahmann R, Kamper J. 2004. Ustilago maydis: how its biology relates to pathogenic development. New Phytologist 164:31-42.
Leon-Ramirez CG, Cabrera-Ponce JL, Martinez-Espinoza AD, Herrera-Estrella L, Mendez L, Reynaga-Pena CG, Ruiz-Herrera J.
2004. Infection of alternative host plant species by Ustilago maydis. New Phytologist164:337-346.
Manthey K, Krajinski F, Hohnjec N, Firnhaber C, Phler A, Perlick AM, Kster H. 2004. Transcriptome Profiling in Root Nodules
and Arbuscular Mycorrhiza Identifies a Collection of Novel Genes Induced During Medicago truncatula Root Endosymbioses.
Molecular Plant Microbe Interactions 10: 1063-1077.
Martinez C, Bue M, Jauneau A, Bcard G, Dargent R, Roux C. 2001. Effects of a fraction from maize root exudates on haploid
strains of Sporisorium reilianum f. sp. zeae. Plant and Soil 236:145-153.
Martinez C, Jauneau A, Roux C, Savy C, Dargent R. 2000. Early infection of maize root by Sporisorium reilianum f.sp. zeae.
Protoplasma 213:83-92.
Martinez C, Roux C, Jauneau A, Dargent R. 2002. The biological cycle of Sporisorium reilianum f. sp. zeae: an overview using
microscopy. Mycologia 94:505-514.
Mndez-Morn L, Reynaga-Pea C, Springer PS, Ruiz-Herrera J. 2005. Ustilago maydis infection of the nonnatural host
Arabidopsis thaliana. Phytopathology 95:480-488.
Mills LJ, Kotz JM. 1981. Scanning electron microscopy of the germination, growth and infection of Ustilago maydis on maize.
Phytopathologie Zurnal 102:21-27.
Muller P, Weinzierl G, Brachmann A, Feldbrugge M, Kahmann R. 2003. Mating and pathogenic development of the Smut
fungus Ustilago maydis are regulated by one mitogen-activated protein kinase cascade. Eukaryot Cell 2:1187-1199.
Ptaffi M. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acid Research 29:2002-2007.
Snetselaar KM. 1993. Microscopic Observation of Ustilago maydis Mating Interactions. Experimental Mycology 17:345-355.
Snetselaar KM, Carfioli MA, Cordisco KM. 2001. Pollination can protect maize ovaries from infection by Ustilago maydis, the
corn smut fungus. Canadian Journal of Botany 12:1390-1399.
Snetselaar KM, Mims CW. 1992. Sporidial fusion and infection of maize seedlings by the smut fungus Ustilago maydis.
Mycologia 84:193-203.
Snetselaar KM, Mims CW. 1993. Infection of maize stigmas by Ustilago maydis : light and electron microscopy. Phytopathology
83:843-850.
Snetselaar KM, Mims CW. 1994. Light and electron microscopy of Ustilago maydis hyphae in maize. Mycological Research
98:347-355.

61

CHAPITRE II - Ustilago maydis : un nouveau modle pour ltude des infections racinaires chez les plantes hte et non-hte

Spellig T, Bottin A, Kahmann R. 1996. Green fluorescent protein (GFP) as a new vital marker in the phytopathogenic fungus
Ustilago maydis. Molecular & General Genetics 252:503-509.
Steinkellner S, Lendzemo V, Langer I, Schweiger P, Khaosaad T, Toussaint J, Vierheilig H. 2007. Flavonoids and strigolactones
in root exudates as signals in symbiotic and pathogenic plant-fungus interactions. . Molecules 5:1290-1306.
Tivoli B, Baranger A, Sivasithamparam K, Barbetti MJ. 2006. Annual Medicago: From a Model Crop Challenged by a Spectrum
of Necrotrophic Pathogens to a Model Plant to Explore the Nature of Disease Resistance. Ann Bot 98:1117-1128.
Vnky K. 1994. European Smut Fungi. Stuttgart: Gustav Fisher Verlag.
Wen K, Seguin P, St-Arnaud M, Jabaji-Hare S. 2005. Real-time Quantitative RT-PCR of Defence-Associate Gene Transcripts of
Rhizoctonia solani - Infected Bean Seedling in Response to Inoculation with a Nonpathogenic Binucleate Rhizoctonia Isolate.
Phytopathology 95:345-353.
Wenzler H, Meins F. 1987. Persistent changes in the proliferative capacity of maize leaf tissues induced by Ustilago infection.
Physiological and Molecular Plant Pathology 30:309-319.

62

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au

GR24, un analogue de synthse de strigolactone
Avant propos

Depuis 2002, la thmatique strigolactone est centrale dans lquipe de recherche Symbiose
Endomycorhizienne et Signalisation chez les vgtaux . Les travaux raliss sur S. reilianum on t
effectus en parallle ceux sur les champignons endomycorhiziens, ce qui a conduit des approches
communes.
Avant mon arrive dans lquipe en novembre 2003, des travaux prliminaires raliss par
Carole Martinez et Marc Bue montraient que des fractions lipophiles dexsudats de racinaires de mas
avaient un effet morphogne sur Sporisorium reilianum (Martinez et al., 2001). Les fractions actives
utilises taient celles identifies pour leur activit sur la ramification de Gigaspora rosea et G.
gigantea, deux champignons endomycorhiziens (Bue et al., 2000). Ces rsultats constituaient les
premiers arguments dune perception de composs aux caractristiques physico-chimiques proches par
S. reilianum et G. rosea, mais montraient aussi une convergence de rponse entre ces deux espces
phylogntiquement trs loignes (Basidiomycota vs Glomeromycota). Ces convergences se sont
prcises par la suite. Tout dabord en 2001, il a t montr que la respiration cellulaire tait induite lors
de lajout de fractions lipophiles dexsudat racinaire (Tamasloukht et al., 2003). Les tests respiratoires en
oxygraphie raliss en dans lquipe par N. Sjalon-Delmas ont montr que cette rponse tait
galement obtenue chez S. reilianum. Ce travail a conduit gnrer une premire banque dexpression
diffrentielle SSH en rponse aux exsudats racinaires sur S. reilianum en 2001-2002 (Janzac, 2002). En
octobre 2002, un criblage de molcules initi au laboratoire par C. Roux rvlait que les molcules
actives prsentes dans les fractions lipophiles dexsudats racinaires pourraient tre des composs de la
famille des strigolactones. Ces tudes ont conduit au dpt dun brevet dexploitation des strigolactones
pour promouvoir la symbiose endomycorhizienne (brevet franais 2004 et internationalisation en 2005,
Bcard et al., 2005). Durant ce temps, une quipe de recherche concurrente russissait raliser la
caractrisation biochimique de ces molcules, prsents ltat de trace dans les exsudats racinaires
(Akiyama et al., 2005).
Cest dans ce contexte que cette tude a dbut en janvier 2004. En parallle des approches
prsentes dans les deux chapitres prcdents, les travaux ont dabord consist valider les mesures
oxygraphiques de respiration cellulaire en utilisant une technique colorimtrique permettant deffectuer
plusieurs mesures en parallle de cintiques de rponses. Ces mesures ont permis dentreprendre une

63

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

nouvelle approche transcriptomique dexpression diffrentielle par SSH sur S. reilianum, cette fois ci en
rponse au GR24, un analogue de synthse des strigolactones.
Prcisons que lorsque cette analyse transcriptomique a t entreprise, la souche solopathogne
SRZS1 dcrite en chapitre I ntait pas encore isole, et il navait pas t dtermin quU. maydis
prsentait une rponse aux strigolactones. Pour ces raisons, ce travail a t ralis sur une souche
haplode de S. reilianum.
Une partie des rsultats sur la rponse des Ustilaginaceae au GR24 (respiration cellulaire, RTqPCR) est prsente dans larticle en chapitre II. Ce chapitre correspond lensemble de lanalyse
transcriptomique.

64

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Transcriptomic analysis of the response of to GR24, a strigolactone analogue

Seyed Kazem Sabbagh and Christophe Roux
University of Toulouse. Laboratory "Cell Surface and Signaling in Plants", University Toulouse-CNRS Joint
Unit 5546 - Plant Biotechnology Institute, 24 Chemin de Borde Rouge, Auzeville, BP42617, F31326
Castanet Tolosan France.

III-1 Summary
*A suppression subtractive hybridization (SSH) approach was used to generate cDNA libraries
representing genes differentially expressed in the haploid cells of maize head smut agent (S .reilianum)
exposed to GR24, a strigolactone analogue.
*The cDNA library contained 1440 clones. cDNA ESTs were deposited on macro-array
membranes and hybridized with P32 cDNA probes obtained from mRNA isolated from S. reilianum yeast
cultures exposed or not to GR24 10-7 M during, 1, 5 and 8 hours.
*A total of 678 ESTs were identified as differentially expressed for the three times in response
to addition of GR24. After sequencing, 418 unigenes were obtained, among which 307 had no
similarities with the known protein, 18 were of unknown function, 23 ribosomic proteins, and 70
corresponded to protein with hypothetical function.
*A set of 36 candidate genes were analysed by qRT-PCR and presented an induction of these
genes at time 1h, confirming hybridization data. No induction was obtained at 5 and 8 hours of culture,
maybe due to the ageing of culture in our trial conditions as observed by measures of cell respiration.
*Induced genes deal in majority with catalysis functions (45%) like cell respiration (27%), and cell
signaling (26%).
*Although the biological signification of this perception remains hypothetical, these results on S.
reilianum point out that strigolactones could have a biological implication in rhizosphere wider than
actually supposed.

III-2 Introduction
The Plant roots release a wide range of compounds which are involved in complex
communication processes in the rhizosphere. These compounds include sugars, polysaccharides, amino
acids, aliphatic acids, aromatic acids, fatty acids, sterols, phenolic derivates, enzymes, vitamins, plant
growth regulators and other secondary metabolites (Dakora & Donald, 2002; Uren, 2000). Several of
these exuded molecules were described as involved in plant-microbe interaction (Bais et al., 2004).
There is no doubt that sugars and amino acids are potential microbe stimuli, but our knowledge on

65

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

secondary metabolites, which trigger microbe responses in the rhizosphere, is relatively limited (Bais et
al., 2006; Nelson, 1991). Several examples illustrate that communication between plants and microorganism before infection can be a key step in the interaction process. Flavonoids for instance are
involved in the legume-Sinorhizobium communication (Peters et al., 1986; Peters & Long, 1988).
Strigolactones were defined as important signal for arbuscular mycorrhiza (AM) fungi (Akiyama et al.,
2005). These compounds induce hyphal branching of hypha from germinated spores of Gigaspora
margarita at concentration below nanomolar. Strigolactones were first identified as inducers of
germination of seeds of parasitic weed (see Bouwmeester et al., 2003 for review). The double incidence
of these molecules is intriguing and several reviews relate on the benefits vs harmful effects of these
molecules (Akiyama & Hayashi, 2006; Bouwmeester et al., 2007; Humphrey et al., 2006; Paszkowski,
2006)
The fact that highly phylogenetically divergent organisms like parasitic weeds and AM fungi are sensitive
to strigolactones raises the question of the spectrum range of influence of these molecules. In a recent
paper, it was suggested that strigolactones are specific signals for AM fungi as these molecules have no
branching effect on other fungal species (Steinkellner et al., 2007). Based on the observation that
strigolactones rapidly trigger O2 consumption of the AM fungi (Besserer et al., 2006), we tested the
incidence of GR24 on cell respiration of a plant pathogenic soil fungus: Sporisorium reilianum. S.
reilianum (Basidiomycota, Ustilaginales) is the causal agent of maize head smut disease. We focused our
interest on this fungus as it is a soil fungus infecting maize only via roots (Martinez et al., 2000). As
dimorphic fungus, S.reilianum is easy to manipulate in its yeast form for assays in liquid medium. Lastly,
this species is closely related to Ustilago maydis, the genetic phytopathogenic model which annotated
genome is available (Kamper et al., 2006). Our objective was to describe the early response of
S.reilianum cells to GR24.

III-3Experimental procedures
Fungal strain and cultural condition
Haploid S. reilianum (SRZM) strain was used in this assay. This strain was cultivated in rich
medium (PDB) at 24C under shaking 100 rpm until cultures reached mid-log phase (19h). The
Escherichia coli K-12 derivative DH5 was used for cloning. Bacteria were grown in LB medium added 2%
Ampycilin antibiotic on a rotary shaker at 245 rpm at 37C overnight.
GR24 induction
The strigolactone chemical analogue GR24 (Chiralix, Nijmegen, NL) was prepared as a
concentrated solution at 10-2 M in 100% acetone and then diluted with water to get a solution at 10-4 M

66

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

(1% acetone/H2O). Ten l of this solution as treatment and 10l acetone 1% as control were added to
10ml of fungal culture (107 cells/ml-1) in PDB medium, respectively.
Cell respiration
Respiratory measurements were performed at three independent point time (1h, 5h, 8h) from
cells cultured supplemented by GR24 or acetone. From the 10 ml cell culture, an aliquot of 100l was
analyzed at each time by adding 20 l of CellTiter-Blue reagent (CTBR Promega, Madison, USA). Cell
respiration was measured using 96-well-optical reaction plates at 25C using a Fluoroskan FL600 (Biotek, Vermont, USA) and fluorescence was recorded with an excitation wavelength of 560nm and an
emission wavelength of 590nm. Stimulated and control cells were collected from cultures by
centrifugation and kept at -80c for further RNA extraction.
RNA isolation and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
Total RNAs from S.reilianum cells (treated and control) were isolated using a standard phenolchloroform procedure and purified using RNA purification Kit (promega) folowing protocol. 10 ml of the
fungal cells growth at 28 oC with an OD600 0.3-0.5 were transferred to a 15 ml falcon tube.and was
centrifuged at 3600 rpm for 10 min. Most of the supernatant were pour off, resuspend pellet in 500l
H2O sterile and transferred to a 1.5 ml Eppendorf fresh tube and centrifuged at 8000 rpm for 20 min. the
supernatant was removed and the pellet was frozen in liquid nitrogen for 3 min (the pellet can be stored
at 80 oC). 500 l aqua-phenol and 500 l ASE buffer (50mM NaAcetate, pH=5.3, 10 mM Na2EDTA and
1%SDS) was added, vortexed for 3 min and incubated at 65 oC for 5 min. The samples were placed at 80
o

C for 20min, centrifuged for 45 min at 4C at 18000rpm. 500 l of clear supernatant were transferred to

1.5 ml Eppendorf fresh tube, add 500 l volume of phenol/chloroform, homogenised vigorously for 30
sec and centrifuge at 18000 rpm for 30 min at 4C. 400 l of aqueous layer was transferred to a new 1.5
ml Eppendorf tube and 40l of NaAcetate 3M and 1ml of cold absolute ethanol (-20C) was added to
mixture, shaked for 1 min and centriguged at 18000rpm for 30 min at 4C. The supernatant was
removed and pellet was resuspended in 500 l of Rnase free water. RNA precipatation was performed
by adding 0.5 ml of isopropanol per ml of reagent, vortex, and keep the samples at room temperature
for 5-15 min. RNA was purificated by adding 50L of DNase solution (5l buffer 1x +5l DNase
enzyme,Promega). The mix was incubated at 37C for 1h30 then at 65C for 10min. 30 l of NaAcetate
3M and 800l of absolute methanol(-20C) was added, incubated at -80C for30 min and centrifuged at
18000 rpm for 40 min at 4C.Upper layer was removed, decanted and pellet was washed twice with 500
l Ethanol(70%) then centrifuged at 10000 rpm for 8 min at 4C and supernatant phase was decanted
(optional; centrifuge for another 2 minutes at 15 000 rpm at 4 oC and remove the remaining of the
supernatant) and the pellet was dried by placing the Eppendorf tubes with the lid open in an upwards
position in a luminar flow for 5 min or until the RNA pellet is dry. Pellet was dissolved in 30 l H2Odd

67

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

sterile (H2Odd was added and mixed carefully with pipett for 2 min). Analyse quality and quantity of
isolated RNA was performed by gel electrophoresis (and absorbance measurements). 3 l of each
sample + 7 l H2Odd + 2 l 10 x loading buffer was loaded on a 1 % agarose gel (0.5x TBE buffer) at150 V
for 10 minutes.
First-strand cDNA was synthesized from total RNA using Superscript First-strand Synthesis System
(Superscript II RNAaseH Invitrogen). Total RNA was quantified using a Nanodrop (ND-100)
spectrophotometer and RNA quality was assessed by 1% agarose gel electrophoresis stained by
ethidium bromide and Agilent Bioanalyser (Agilent Technologies).50-100ng of total RNA each from of
the non-stimulated and GR24 stimulated cells used to prepare double-strand cDNA using SmartTM PCR
cDNA Kit (Bioscience, Clontech, USA.) according to manufacturers protocol.
Suppressive Subtractive Hybridization (SSH)
All the SSH experiments were done with the haploid S.reilianum strain (M). SSH was carried out
using double stranded cDNA derived from the cells treated by GR24 as the tester and acetone as the
driver. At these times points, > 90% of cells were in the exponential growth phase. A cDNA subtraction
kit (Clontech lab.Inc.USA) was used as recommended by the manufacturer. Briefly, the tester and driver
cDNAs were first digested with 20 units of RsaI restriction endonuclease, a restriction enzyme with a 4-bp
recognition site that yields cDNA fragments with blunt ends. After digestion, the cDNA was extracted
with phenol, precipitated and then resuspended in 5L of water. The tester cDNA fragments were
divided into two equal aliquots (60ng) and each one was ligated to the different adaptor sets 1 and 2R,
resulting in two distinct populations of tester cDNAs. 20 units of T4 DNA ligase (Clontech lab.Inc.USA)
used to ligation and buffer supplied by the manufacturers protocol. Ligations were carried out
overnight at 16 C and then stopped by incubating for 5 min at 70 . A small amount of each cDNA tester
population (approximately 300 ng) was mixed with an excess of driver (2 g) and the mixture was
heat-denatured and allowed to anneal for 8 h at 68C. The two samples from the first hybridization
were then combined and annealed with an additional, freshly denatured, sample of driver cDNA at
68C overnight. An initial PCR using adapter primers was performed to amplify those cDNAs that
represent differentially expressed genes. A second PCR amplification was carried out using nested
adapter primers to minimize non-specific amplification. PCR amplification products were cloned into the
pGEM-T easy vector (Promega). The ligation mixture was used to transform Escherichia coli DH5
competent cells. Clones were plated on LB medium supplemented with X-gal (100 g/ml), IPTG (60
g/ml) and Ampicilin (50 g/ml) and regrown in 96-well plates at 37C for 24h and stored at -80 C.
Probe labelling
Radioactive labelling was performed using prime-a-gene kit (promega) as described by
manufactures instructor. Briefly, in 50 l of a mixture containing three types dNTP unlabeled as dATP,

68

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

dTTP, dGTP (1.5mM each), 5l radionucleotide [-32P] dCTP( 3000Ci/mM) , 25ng of cDNA denaturated ,
200 U MMLV reverse transcriptase (Promega), and 5x buffer for reverse transcription that contains
random synthetic hexadeoxynucleotide primers for random-primed labelling of linear template DNA
were added and the resultant mixture was incubated at 20 overnight to generated probes with higher
specific activity. The probes were synthesized at 20C overnight in bin-marry. Probes was denatured at
94C for 3min and immediately chilled in ice water and reaction was stopped adding 2.5l of EDTA (0.5
M). Unincorporated nucleotides were removed on a Sefadex gel G50 column. A typical reaction gave
50% incorporation of the [-32P] dCTP and generated >1 x 109 cpm). Prior to hybridization, probes were
denatured at 95C for 5min and added to tampon hybridization.
cDNA array and hybridization
All clones of cDNA library were PCR amplified (35 cycles 94 C/ 50 C /72 C) in a 50 L reaction
by using Master mix kit (Promega), by using oligonucleotide primers SP6 (5-ATTTAGGTGACACTATAG-3)
and T7 (5-TAATACGACTCACTATAGGG-3). The amplified PCR fragments were controlled by 1% agarose gel
electrophoresis for multiple bands and for estimated DNA concentration. An average amplification rate
of 90% was observed. After two-fold concentration by vacuum rotation resulting in an estimated DNA
concentration of 40 ng/l PCR products were denaturised in 50% Dimethyl Sulfoxide (DMSO) and were
mixed with 5 l bromophenol blue. DNA was spotted on to nylon membranes (Millipore inc. UK) using a
BioGrid Robot (BioRobatics, Cambridgeshire, UK) equipped with a 0.2-mm pin tool. Five strokes of the
pin tool were applied to each spot, resulting in the transfer of approximately 50 nl cDNA, and each cDNA
fragment was spotted twice on a 6x6 grid organization (Duplicates for every spot in each grid). Each
membrane was then treated with SDS 10% for 3 min, denatured by a NaOH 0.5 M / NaCl 1.5 M solution
for 5 min, neutralized with a NaCl 1.5 M / Tris HCl 0.5 M pH 7.5/ EDTA 1mM solution for 5 min and
rinsed in 2 SSC (1 SSC: NaCl 0.1 M, Na citrate, 0.01 M pH 7.0) for 5 min. Finally, DNA was fixed to the
membrane by incubating for 2 h at 80 C or ultraviolet cross-linking. These arrays were nylon
membranes containing immobilized denatured 1440 PCR products. cDNA macroarrays were
prehybridized for 16 h at 65C in hybridization churches buffer (0.5M Phosphate Buffer pH7,1M EDTA,
1%BSA 7% SDS) in a Hybridization Oven/Shaker (HIRI10M, Grant Boeker). Hybridization was carried
out in 20 ml of hybridization buffer containing 5 x 106 cpm/ ml cDNA for 20 h at 65C in the
hybridization oven. After hybridization, the cDNA macroarray was washed two times in 2 SSC with 0.5%
SDS (15min/wash) at 65C and two times in 1 SSC with 0.5% SDS (15min/wash) at 65C and finally
membranes were incubated in 0.5 SSC with 0.5% SDS for 15 min at 65C.in the same hybridisation oven
Detection and quantification of hybridization signals
Washed macroarrays were exposed to a phosphor image screen (Fuji, Japan) for 18 h and scanned using
Storm 820 scanner (Amersham Bioscience) with resolution of 50 m. Macroarray griding and gene

69

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

expression levels were measured with ImagQuant 5.0 software (Molecular Dynamics, Amersham
Pharmacia, Little Chalfont,UK) and Bioplot program (http://biopuce.insa-toulouse.fr ) using 6x6 grids.
Griding was adjusted manually and tested in regards to distance of maximal value to the centroid of the
measured area on the X and Y axis. Expression data for all gene sequences were analyzed using
Microsoft Excel. For analyses, spots intensity ratios were expressed as a log 10 expression ratio values.
Preliminary analyses were first performed assess the inner-membrane variation of duplicate spot in
each grid (for each gene) and between the two grids where the same gene was present on the same
membrane. Data were normalized using the median of all signals on that median by Excel software
(Microsoft). The average value from duplicate spots in each grid and their standard deviation were
calculated. The genes whose standard deviation exceeds their average signal values were eliminated
from the spreadsheet gene list. Expression data was then transformed from normalized intensity values
to percentage of expression by dividing the values for each gene by its expression in control condition.
Genes presenting more than a 1.5-fold difference in average signal values in each comparison were
therefore defined as differentially expressed genes.
Sequence analysis and annotation
Selected cDNA clones were screened using PCR with plasmid primers (T7, SP6). Plasmid
minipreps of clones containing inserts of 300-400 bp or more were made using Minipreps Kit (Promega,
Wizard Plus SV Minipreps, Madison,WI,USA) as described by manufacturers protocol. In brief, cDNA
clones were grown in 4 ml of LB broth on a rotary shaker at 245 rpm at 37C overnight. The plasmid was
isolated by standard alkaline protease lyses, precipitated with isopropanol and re-dissolved in 30 L TE
(10 mM Tris-HCl, 1 mM EDTA, pH 9). Prior to sequencing, all plasmids were checked for concentration
and presence of an insert by Ras1 digestion and electrophoresis on agarose gels. The 5-end DNA
sequencing was conducted at the Toulouse Genopole using the T7 primer, Big Dye Terminator chemistry
(Applied Biosystems, Foster City, CA) and an ABI3700 sequencer (Applied Biosystems). Selected cDNA
clones were also sequenced from the 3- end using the T7 primer by gene express institute
(Genomexpress, France). The cDNA sequences were edited onto our interface databank script (H. San
Clemente personal data), then screened for quality and were trimmed of cloning vector using
CROSSMATCH (Copyright, Green, P.). Then DNA sequences were queried using the NCBI standalone
BlastAll program (Alschul et al., 1997) against the NCBI non-redundant (nr) protein reference library, U.
maydis genome, Swissprot, version6 UniProt and UniRef100. Sequence similarities above 50% with an E
value less than 1E-10 were considered as statistically significant positive matches. Sequences that
matched to hypothetical proteins or having low similarity to a known protein were considered as
unknown genes. Gene ontology was performed using the accession number of Uniref protein blast
results.

70

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Primers design
Primers used in this study were designed with Primer3 http://frodo.wi.mit.edu/cgibin/primer3/primer3_www.cgi by using the parameters selected as follow: product sizes range 80-120
bp.

The

primers

were

checked

for

secondary

structures

with

oligoanalyser

software.

http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx). The primers used in this

study are summarized in the table III-2.
RT-qPCR
Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) was carried out in optical 384well plates using a lightcycler ABI PRISM 7900 HT sequence detection system (Perkin Elmer/Applied
Biosystem, Foster City, USA) and PCR MasterMix for Syber Green Assays (Applied Biosystems, Foster
City, USA), according to the manufacturers protocol. The amplifications were performed using the
following concentration: 8 l of SYBR Green PCR MasterMix (Applied Biosystems), 10 M of each
oligonucleotide primer (final concentration) and 2 ng of cDNA template in 10 l reaction volum. Each
gene amplification was prepared in triplicates. Two biological repetitions were carried out. Triplicates
were validated with technical error under 0.5 CT. The amplification condition was: 50C for 2min, 95C
for 10min, 40 cycles at 95C for 15sec, 60C for 1 min. Melting curves analysis were performed after
each reaction, to exclude non specific amplifications, with the thermal cycle at 95C for 15sec, 60C for
15sec and 95C for 15sec. The optimal baseline and threshold values were determined using automatic
CT function available with the SDS 2.2 software (Applied Biosystems). The equation of the line that best
fits the data was determined by minimizing error for regression analysis. The R 2 value was calculated to
estimate the accuracy of the real-time RT-PCR as a quantification method. The slope of the standard
curve was used to calculate the efficiency of the real-time QRT-PCR according to the formula E = 10-1/slope
(Ptaffi, 2001 Wen et al., 2005). The calibration curves were created using series of cDNA dilutions from
10 to 100 ng. EF1 housekeeping gene was used for normalization experimental design. The first point of
kinetic (time 0) was the reference in the developmental effect evaluation. All data exported from SDS
2.2 software were calculated with Microsoft Excel software.

III-4 Results
GR24 increases cell respiration of S. reilianum
Prior to isolation of transcript, the eliciting effect of GR24 on cell respiration was monitored by
measuring redox potential. Cells used for this assay were freshly collected from a culture in the
exponential mid-log phase. Three independent experimental stimulations were performed with GR24 at
10 -7 M as final concentration and 0.01% acetone/H2O as control. The redox potential was measured by

71

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolacton e

the cellTiter blue method at 1h, 5h and 8h post addition of GR24. As mentioned in table III-1, a burst of
cell respiration was observed at 1h post addition of GR24 (+ 13 %). This induction decreased at 5 and 8
hours to 5% and 1 % of induction respectively (Table III-1).

Table III-1: Cell respiration measured by using the CellTiterBlue reagent

Time induction after addition of GR24

Cell respiration variation between treated and
control

1h

5h

8h

+13%1

+5%1

+1%1

1: Values correspond to Slopeassay-Slopecontrol/Slopecontrol

For each time, values correspond to the mean of three trials.

Construction of SSH cDNA libraries and macroarray design

A SSH cDNA library was constructed with mRNA isolated from stimulated cells by GR24 (Tester) and nonstimulated by acetone ( Driver) from S.reilianum for 1h, 5h and 8h (see material and methods). 1440
ESTs of this cDNA library was converted into plasmid clones ( pGEM-T easy vector ) by mass excision for
library screening and analysis. Clones of the library were picked and arrayed into fifteen 96-well plates
and spotted on high density nylon grid filters (8 12 cm) in a 6 6 pattern in which each clone was
spotted in duplicate for use as a positive control during hybridization. Constitutive desmin gene was
spotted on membrane as control. The macroarray filters were probed with cDNA populations which
have been obtained from cells stimulated (GR24, 10-7M) and non- stimulated (acetone, 0.01%) at three
times point independently. Signal intensities for each of the 1440 cDNA spots were quantified, filtered,
corrected, normalised, and transformed as described in Materials and methods. Macroarray
reproducibility from three technical and two biological repetition was analysed by comparing
normalized spot intensity values form three independents hybridization performed on three
independent membranes with probes from two independent samples of each condition stimulated
(GR24) and control (Acetone/H2O). The significance threshold was then determined by the analysis of the
log10 duplicate ratio for each gene under all hybridizing condition. In the same grid, more than 95% of
duplicates must be reproducible. A variation ranging from R2=0.956 to 0.988 was observed (Figure III-1).
Linear coefficients determination between the three reproducibility experiments was calculated,
thereby defining a high reproducibility between independent hybridizations more than 95% of the
values confined within a 1-fold limit.

72

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Figure III-1: Control of

reproducibility of the array
experiments.
Reproducibility is characterized by
comparing signal values from three
differential biological and technical
experiments

Hybridization of macroarray
Differential hybridization of probes for three-time point stimulation independently with 1440
cDNA clones arrayed on high-density nylon filters yielded 678 positively hybridizing clones. Only those
clones that gave a clearly visible hybridization signal were recorded. For comparative purposes, signal
intensity was compared to signals from known human desmin clones. To reduce background noise and
select genes of interest, clones which did not present a clear pattern of differential expression during
three time point stimulation were filtered out using ANOVA analysis (P value cut-off >0.5). Only
duplicate genes with P-values < 0.5 were considered as reproductible. Clones with ratio value >1.5 were
selected as genes up-regulated and clones with ratio value < 0.3 were considered as genes downregulated. We considered genes as differentially expressed whose expression level was 5-fold above
back ground.
cDNA sequence analysis
Sequencing reaction was performed on the 678 clones obtained from macroarray approach.
Clones with cDNA inserts shorter then 80pb, vector only clones and clones that produced low quality
sequence read were eliminated, giving rise to 418 quality sequences. Contigs were performed by CAP3
software. Between these sequences qualified, 356 were singleton and 62 contigs contained multiple
sequences. The average EST number in each contig was 5.2 ESTs. The average nucleotide number was
393 and 604 pb for singeletons and contigs, respectively. Maximum and minimum ESTs number in each
contig was 39 and 2 ESTs, respectively. The BLAST searches were carry out on 418 unigenes against all
sequences available in NCBI database, Ustilago genome and also against Swis-Port, TAIRpeptidesAvril06,
Uniprot and Uniref100 data base. General sequence analysis of the SSH library showed that 23
sequences (5.5%) corresponded to ribosomal protein, 70 sequences to hypothetical protein (17%), 18
sequences to unknown protein (4.5%) and 307 ESTs (73%) did not show any homology with sequences
deposited in data base (Figure III-2).

73

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Figure III-2: Blast results of 678 ESTs from S. reilianum obtained by macroarray experiment
Among the 678 ESTs selected after macroarray experiments, assembling with CAPS software gave rise 356 singletons and 322
ESTs grouped in 62 contigs (average of 5.19 ESTs/contig). From these 418 unigenes, 307 did not show similarity with the
genes present in different databases used (see material and methods) and 111 showed similarities with known genes.
Among the 70 genes having hypothetical function, 36 were highly similar to genes present in data bases and were selected as
candidate genes for further analysis.

Functional annotations (Gene ontology) of the 70 hypothetical proteins showed that 18%
correspond to anabolism and 72% to catabolism function (Table III-S1).All data is stored on a MySQL
server that can be accessed through a web interface. Based on the examination of the highest matches
of sequence similarity, 70 putative functional identities were obtained and among which 35 unigenes
with E-value < 10-20 were selected as candidate genes (Table III-2).
Tableau III-2: Gene annotation for 36 candidate genes issuing from macroarray experiments
Name of Gene
Srz1-P11E9
Srz2-P11D11
Srz3-P12A9
Srz4-P12C4
Srz5-P12C7
Srz6-P12D9
Srz7-P12F8
Srz8-P13A7
Srz9-P15B1
Srz10-P15G10
Srz11-P1F12
Srz12-P2B3
Srz13-P2D1
Srz14-P5A8
Srz15-P5C7
Srz16-P5F1
Srz17-P5F10
Srz18-P5F12

Gene annotation
Small ubiquitin-related modifier (SUMO)
Succinate dehydrogenase/fumarate reductase
DNA binding protein
Hsp70 protein
actin
ATPase
Ustilago maydis 521 hypothetical protein
cytochrome-c oxidase
rho GTPase; RhoA"
calcium binding protein
actin
Annexin;
isocitrate dehydrogenase NADH
Uncultured Prochlorococcus marinus clone
NADH:ubiquinone oxidoreductase
cytochrome C oxidase
ubiquitine
Succinate dehydrogenase/fumarate reductase

74

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Srz19-P5G5
Srz20-P6C3
Srz21-P8A1
Srz22-P1C8
Srz23-P1C9
Srz24Co3
Srz25C6
Srz26Co7
Srz27Co15
Srz28Co16
Srz29Co18
Srz30Co25
Srz31Co26
Srz32Co29
Srz33Co32
Srz34Co33
Srz35Co37
Srz36Co48

N-acetyltransferase activity
Na+/proline symporter
Ustilago maydis 521 hypothetical protein
aldolase
Dihydrosphingosine phosphate lyase
HESB-like domain-containing protein
Sporisorium reilianum translation elongation factor1-alpha (tef1) gene
Ustilago maydis translation elongation factor EF1-alpha (tef1) gene
ubiquitin
Ustilago maydis 521 hypothetical protein
Succinate deshydrogenase
EF-hand, calcium binding motif
Histone H2A [Ustilago maydis 521]
12 kda heat shock protein (glucose and lipid-regulated protein)
NAD/FAD-utilizing enzyme apparently involved in cell division
Glycosyl hydrolases family"
Ustilago maydis 521 hypothetical protein
ubiquitin-conjugating enzyme E2

Gene ontology analysis of the 36 selected genes showed that the distribution of these genes is: 28%cell
respiration (10 EST), 19%amino-acid and carbohydrate metabolism (7 EST), 16% ubiquitin (6 EST), 6%
factor elongation (2 EST), 6% calcium binding protein (2 EST), 6% heat shock and HESB-like protein (2
EST). Among this functional analysis, 19% (7 EST) did not match with any G.O in gene ontology research
(Figure III-3).

Figure III-3: Functional classification of differentially regulated genes.

A total of 36 candidate genes were classified using Gene Ontology database.

RT-q PCR
RT-qPCR was used to independently assess the validity of the variation in gene expression
detected by macro-array hybridization. Primers were designed (table III-2) and tested against cDNA from
GR24-induced haploid cells of S. reilianum before quantitative mRNA assay. Two biological repetitions
for each time point experiment were carried out and each gene amplification was carried out in

75

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

triplicates. Amplification results were treated using Sequence Detection System software (S.D.S) version
2.2 (Applied Biosystems). At 1h post addition of GR24, the relative changes in transcript level
determined by RT-qPCR and macroarray hybridization were similar and the majority of candidate genes
were over expressed.

Tableau III-3: Relative expression of candidate genes from cells treated by GR24 during 1h.
R eal-time PCR analysis of cell stimulated by GR24 was performed on 36 candidate genes issuing from macroarray hybridization.
Real-time PCR experiments were performed with RNA extracted from three independent experiments. Transcript levels of 20
genes were strongly up-regulated in the cells stimulated by GR24 compared to the control.

Name

Left primer

Right primer

Srz1-P11E9

ATACGCCGACCATCAAAGAG

CGAGGTACCACCAAGCTCTC

Srz2-P11D11

CGGAGAGGGATGATGTCAAT

ACAGCACGGTAGTCGAGCTT

Srz3-P12A9

TACTGATGCGTCTCGCAGTT

AACTTTGACGACCTCGTTGG

Srz4-P12C4

GTGTATGCGGTTAGGGGATG

GACAGGGCACTCTCCAAAAA

Srz5-P12C7

AGTGCTTCTAAGCGCTGGTC

AGGATTTGCAGGAGCAGCTA

Srz6-P12D9

AGCTGGTCATGAGCGACTTT

TCGATGTGCTTCTCGATGTC

Srz7-P12F8

GGTGGTGACGAGGTTCTTGT

GACGAGCATAGGTCCGAGAA

Srz8-P13A7

GTGGCATACCACCAAGACCT

GGACGAATCCATTTCTGGAC

Srz9-P15B1

AACACGAGAGGAAAGCGTGT

CTCGTCTCCCTCAACGACTC

Srz10-P15G10

GAAAGAGGTGCGAACGAGAC

AAGCTGTTCACGACACATCG

Srz11-P1F12

AGTGCTTCTAAGCGCTGGTC

AGGATTTGCAGGAGCAGCTA

Srz13-P2D1

GGCGGACTACGTTTACAAGC

ACGCCATCTTCAAGACCATC

Srz17-P5F10

GTCAAGACCCTCACGGGTAA

CTGGATCTTGGCCTTGACAT

Srz18-P5F12

CGGAGAGGGATGATGTCAAT

ACAGCACGGTAGTCGAGCTT

Srz19-P5G5

ATCGCTGAACAGCACCAAG

ATAGAGCGATGGCTTTGACG

Srz20-P6C3

CGTTTGCTCCCTCTTTTCCT

AAGCTTTCCGAAACAAAGCA

Srz27Co15

GTCAAGACCCTCACGGGTAA

ATGTCAAGGCCAAGATCCAG

Srz31Co26

ATGATGCCTGATGTTGCGTA

GCAGTCGTCTCCTTTCTCGT

Srz32Co29

GTTTGATTGCGAGTGGAACA

CAGCATGGACATCGACTCAT

Srz33Co32

TTTGATTTCCAGTCGGTTCC

GACTTGAGTGCAGCCAATGA

Gene annotation
ubiquitin-related modifier
(SUMO)
Succinate
dehydrogenase/fumarate
reductase
DNA binding protein
Hsp70 protein
actin
ATPase
Ustilago maydis 521
hypothetical protein
cytochrome-c oxidase
rho GTPase; RhoA"
calcium binding protein
actin
isocitrate dehydrogenase
NADH
ubiquitine
Succinate
dehydrogenase/fumarate
reductase
N-acetyltransferase activity
Na+/proline symporter
EF-hand, calcium binding motif
Histone H2A [Ustilago maydis
521]
12 kda heat shock protein
(glucose and lipid-regulated
protein)
NAD/FAD-utilizing enzyme
apparently involved in cell
division

FC
1.9
4.2

2.3
3.8
10.6
2.5
3.1
1.54
1.8
2.3
9.7
2.9
7.3
2.6

1.7
2.7
5.6
4.5
2.7

2.9

FC: Fold Change

It must be pointed out that 5 of the genes induced 1 hour post addition of GR24 correspond to cell
respiration (Table III-3), in relation to the observed induction of cell respiration measure at 1h. This
increase of cell respiration is lower at 5h, and null at 8h. At these time-points, no respiration gene
induction was observed, but a 2-fold induction of actin -Srz5- and a 2.8-fold induction of putative 12 kda

76

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

heat shock protein -Srz32. The quantitative analysis of cells induces for 8h did not show any increase of
the candidate genes.
III-5 Discussion
As many soil micro-organisms, Sporisorium reilianum, the causal agent of maize head smut,
could perceive root exudates (Martinez et al., 2001). Here, we investigated the effect of GR24, a
strigolactone analogue, on the transcriptome of haploid cells on this fungus. Strigolactones are root
excused molecules which are involved in plant-soil organism interactions. These molecules induce
germination of seeds of parasitic weed but are also involved in the endomycorrhizal symbiosis (see
Bouwnmester et. al. 2007 for review). Arbuscular mycorrizal fungi respond to these molecules by an
active branching of hyphae (Akiyama et al., 2005) and an induction of mitochondrial respiration
(Besserer et al., 2006). In a recent analysis Steinkellner and coauthors (2007) assess that strigolactones
have no effect on branching of different filamentous soil fungi or on germination of microconidia of
Fusarium oxysporum. However, we described that GR24 induces cell respiration of Ustilago maydis and
Sporisorium reilianum (Sabbagh, Submitted). The purpose of this study was to identify genes involved in
the respiratory response and to identify candidate genes which could participate in the previous step of
interaction of Sporisorium reilianum with the root. We choose to use a SSH approach to obtain a cDNA
library enriched in genes expressed during induction with GR24. A set of 418 unigenes was obtained,
where 307 ESTs showed no homology to gene data banks, 18 ESTs had no identified function, 23 were
ribosomal sequences, and 70 EST have putative function among which 36 genes showed a strong
homology to known proteins. A qRT-PCR analysis was run to validate induction data. At 1h post addition,
most of the 36 selected genes revealed by SSH were confirmed to be induced. But no induction occurred
at time 5h and 8 hpa GR24. It must be noticed that in our test conditions (assays in 10 ml of liquid
medium), the log-phase of the culture is short and steady state is rapidly reached (12h). In these
conditions the time point 8 h corresponds to an ageing culture. Among the genes induced at 1h, several
genes involved in cell respiration, cell wall development, growth cellular, heat shock protein, HESB-like
protein and actin biosynthesis were up-regulated.
The incidence of the respiratory response of S. reilianum to strigolactones is still speculative. It
could be proposed that these molecules participate to the perception of a putative host plant in their
environment, activating the global metabolism of these fungi, leading to an active invasive growth,
meeting and mating of compatible strains in soil and a further infection of roots. On the other side, an
activation of 13-20% of cell respiration 1 hpa of GR24 on cells present in a rich medium and harboring an
active metabolism in absence of external inducer could be considered as an oxidative burst. We
described in a previous article (Sabbagh, submitted) that at high concentration (10-5M), GR24 has an
inhibitory effect on cell redox potential. These two results must be correlated. The increase of cell

77

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

respiration estimated by redox potential measurement with the CellTiter Blue assay (and validate by RTqPCR) could be related to an increase of oxygen ions free in mitochondria, then inducing the production
of NA(P)DH by NA(P)DH oxido-reductase. These enzymes have been proposed to carry out a number of
different physiological function as cell proliferation and differentiation (Takemoto et al., 2007). In this
case, strigolactone could be considered as a stress factor which must be detoxified by cells, and could
participate to plant defense.
The biological incidence of strigolactones on the pathogenesis of S. reilianum is still to define.
The use of maize mutants deficient in strigolactone production will be very useful for this study. Maize
mutants (named y9, vp5) impaired in the biosynthesis of carotenoids have been described as lesser
producers of strigolactones (Matusova et al., 2005). These mutants are less mycorrhized and addition of
GR24 complements their phenotype (Gomez-Roldan et al., 2007). However these mutations on
carotenoid biosynthesis are pleiotropic, plants are albinos and dwarf, and mutants directly targeted on
strigolactone biosynthesis could be more interesting to test the incidence of these molecules on smut
pathology. To date, such plant mutants are still not available.
In conclusion, the increase of cell respiration genes induced by GR24 on S. reilianum can lead us
to propose that strigolactones could have a general physiological effect on soil-born fungi and be
implied in the organization of the rhizosphere.

III-6 References

Akiyama K, Hayashi H. 2006. Strigolactones: Chemical Signals for Fungal Symbionts and Parasitic Weeds in Plant
Roots. Annals of Botany 97:925-931.
Akiyama K, Matsuzaki K-i, Hayashi H. 2005. Plant sesquiterpenes induce hyphal branching in arbuscular
mycorrhizal fungi. Nature 435:824-827.
Alschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a
new generation of protein detabase search programs. nucleic acid rresearch 25:3389-3402.
Bais H, Park S, Weir T, Callaway R, Vivanco J. 2004. How plants communicate using the underground information
superhighway. Trends Plant Sci. 9:2 6-3 2.
Bais HP, Weir TL, Perry LG, S. Gilroy, Vivanco JM. 2006. The Role of Root Exudates in Rhizosphere Interactions
with Plants and Other organisms. Annu. Rev. Plant Biol. 57:233-266.
Bcard G, Roux C, Sejalon-Delmas N, Puech V, Roy S. 2005. Modulators of the development of mycorrhizal fungi
with arbuscules, and uses thereof. In: WO Patent 2005/077177 A2. France.
Besserer A, Puech-Pags V, Kiefer P, Gomez-Roldan V, Jauneau A, Roy S, Portais J, Roux C, Bcard G, SjalonDelmas N. 2006. Strigolactones Stimulate Arbuscular Mycorrhizal Fungi by Activating Mitochondria. PLoS
Biology 4:226.
Bouwmeester HJ, Matusova R, Zhongkui S, and Beale M.H (2003) , Current Opinion in Plant Biology 6:. 2003.
Secondary metabolite signalling in host-parasitic plant interactions. 6: 358-364.
Bouwmeester HJ, Roux C, Lopez-Raez JA, Bcard G. 2007. Rhizosphere communication of plants, parasitic plants
and AM fungi. Trends in Plant Science 12:224-230.
Bue M, Rossignol M, Jauneau A, Ranjeva R, Bcard G. 2000. The pre-symbiotic growth of arbuscular mycorrhizal
fungi is induced by a branching factor partially purified from plant root exudates. Molecular Plant Microbe Interactions 13:693-698.

78

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Dakora FD, Donald AP. 2002. Root exudates as mediators of mineral acquisition in low-nutrient environments,
Plant and Soil. 245: 35-47.
Gomez-Roldan V, Roux C, Girard D, Bcard G, Puech V. 2007. Strigolactones: promising plant signals. Plant
Signaling & Behavior 2-3:e1-e2.
Humphrey AJ, Galster AM, Beale MH. 2006. Strigolactones in chemical ecology: waste products or vital
allelochemicals? Nat Prod Rep 23:592-614.
Janzac B. 2002. Analyse sur filtres micro-arrays de gnes induits par des exsudats racinaires chez Sporisorium
reilianum partir d'une approche SSH. UMR 5546. Toulouse, Universit Paul Sabatier: 36.
Kamper J, Kahmann R, Bolker M, Ma L-J, Brefort T, Saville BJ, Banuett F, Kronstad JW, Gold SE, Muller O, Perlin
MH, Wosten HAB, de Vries R, Ruiz-Herrera J, Reynaga-Pena CG, Snetselaar K, McCann M, Perez-Martin
J, Feldbrugge M, Basse CW, Steinberg G, Ibeas JI, Holloman W, Guzman P, Farman M, Stajich JE,
Sentandreu R, Gonzalez-Prieto JM, Kennell JC, Molina L, Schirawski J, Mendoza-Mendoza A, Greilinger
D, Munch K, Rossel N, Scherer M, Vranes M, Ladendorf O, Vincon V, Fuchs U, Sandrock B, Meng S, Ho
ECH, Cahill MJ, Boyce KJ, Klose J, Klosterman SJ, Deelstra HJ, Ortiz-Castellanos L, Li W, Sanchez-Alonso P,
Schreier PH, Hauser-Hahn I, Vaupel M, Koopmann E, Friedrich G, Voss H, Schluter T, Margolis J, Platt D,
Swimmer C, Gnirke A, Chen F, Vysotskaia V, Mannhaupt G, Guldener U, Munsterkotter M, Haase D,
Oesterheld M, Mewes H-W, Mauceli EW, DeCaprio D, Wade CM, Butler J, Young S, Jaffe DB, Calvo S,
Nusbaum C, Galagan J, Birren BW. 2006. Insights from the genome of the biotrophic fungal plant
pathogen Ustilago maydis. 444:97-101.
Martinez C, A. Jauneau, C. Roux, C. Savy, R. Dargent. 2000. Early infection of maize roots by Sporisorium reilianum
f. sp. zeae. Protoplasma 213:83-92.
Martinez C, Bue M, Jauneau A, Bcard G, Dargent R, Roux C. 2001. Effects of a fraction from maize root exudates
on haploid strains of Sporisorium reilianum f. sp. zeae. Plant and Soil 236:145-153.
Matusova R, Rani K, Verstappen F, Franssen M, Beale M, Bouwmeester H. 2005. The strigolactone germination
stimulants of the plant-parasitic Striga and Orobanche spp. are derived from the carotenoid pathway.
Plant Physiology 139:920-934.
Nelson EB. 1991. Exudate molecules initiating fungal response to seed and roots. In: The rhizosphere and plant
growth. Keister, D. L.; Cregan, P. B., Eds.; Kluwer: Dortrecht.197-209.
Paszkowski U. 2006. Mutualism and parasitism: the yin and yang of plant symbioses. Current Opinion in Plant
Biology 9:364-370.
Peters NK, Frost JW, Long SR. 1986. A plant flavone, luteolin, induces expression of Rhizobium meliloti nodulation
genes. Science 233:977-980.
Peters NK, Long SR. 1988. Alfalfa Root Exudates and Compounds which Promote or Inhibit Induction of Rhizobium
meliloti Nodulation Genes. Plant Physiol. 88:396-400.
Ptaffi MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. nucleic acid rresearch
29:2002-2007.
Steinkellner S, Lendzemo V, Langer I, Schweiger P, Khaosaad T, Toussaint JP, Vierheilig H. 2007. Flavonoids and
Strigolactones in Root Exudates as Signals in Symbiotic and Pathogenic Plant-Fungus Interactions.
Molecules 12:1290-1306.
Takemoto D, Tanaka A, Scott B. 2007. NADPH oxidases in fungi: Diverse roles of reactive oxygen species in fungal
cellular differentiation. Fungal Genetics and Biology 44:1065-1076.
Tamasloukht MB, Sejalon-Delmas N, Kluever A, Jauneau A, Roux C, Becard G, Franken P. 2003. Root Factors
Induce Mitochondrial-Related Gene Expression and Fungal Respiration during the Developmental Switch
from Asymbiosis to Presymbiosis in the Arbuscular Mycorrhizal Fungus Gigaspora rosea. Plant Physiology
131:1468-1478.
Uren N. 2000. Types, amounts and possible functions of compounds released into the rhizosphere by soil grown
plants. In The Rhizosphere: Biochemistry and Organic Substances at the Soil Interface, ed. R Pinton, Z
Varanini, P Nannipieri. New York: Marcel Dekker:pp. 19-40.
Wen K, Sejuin P, St-Arnaud M, Jabaji-Hare S. 2005. Real-time Quantitative RT-PCR of Defence-Associate Gene
Transcripts of Rhizoctonia solani - Infected Bean Seedling in Response to Inoculation with a
Nonpathogenic Binucleate Rhizoctonia Isolate. Phytopathology 95:345-353.

79

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Supplementary data
Tableau III-S1: Functional classification of differentially regulated genes in S.reilianum cells exposed to Strigolactone (GR24).
Gene ontology annotation of 70 genes issuing from macroaarays hybridization was performed with Uniref100 protein database.
The genes were distributed in 7 super classes of protein.

Super classe
binding (GO:0005488)

Classe
Homologues
nucleic acid binding Q5KDD6_CRYNE (Q5KDD6) 40s ribosomal protein
(GO:0003676)
s23, putative
Q4PEZ6_USTMA (Q4PEZ6) Hypothetical protein
Q4P5P9_USTMA (Q4P5P9) Hypothetical protein
Q2GVK4_CHAGB (Q2GVK4) Hypothetical protein

FAD binding
(GO:0050660)

Q4PFE1_USTMA (Q4PFE1) Hypothetical protein

Q4PFE1_USTMA (Q4PFE1) Hypothetical protein

RNA binding
(GO:0003723)

Q4PFQ3_USTMA (Q4PFQ3) Hypothetical protein

Q4P5P9_USTMA (Q4P5P9) Hypothetical protein

rRNA binding
Q4PFQ3_USTMA (Q4PFQ3) Hypothetical protein
(GO:0019843)
calcium ion binding Q4P173_USTMA (Q4P173) Hypothetical protein
(GO:0005509)
Q4PFY7_USTMA (Q4PFY7) Hypothetical protein
Q4P8I3_USTMA (Q4P8I3) Hypothetical protein
DNA binding
(GO:0003677)

Q28F61_XENTR (Q28F61) Histone 2, H2ab

Q777E1_EBVG (Q777E1) EBNA-1 protein

nucleotide binding
(GO:0000166)

Q4P5P9_USTMA (Q4P5P9) Hypothetical protein

Q4TWI7_9BASI (Q4TWI7) Translation elongation
factor 1-alpha (Fra...
Q4PFA4_USTMA (Q4PFA4) Hypothetical protein
Q4P2C9_USTMA (Q4P2C9) Hypothetical protein
Q4P0Z6_USTMA (Q4P0Z6) ACT_PHARH ACTIN

Q4PDZ4_USTMA (Q4PDZ4) Hypothetical protein

zinc ion binding
(GO:0008270)

Q4P737_USTMA (Q4P737) Hypothetical protein

Q4PGU4_USTMA (Q4PGU4) Hypothetical protein

sequence-specific
DNA binding

Q4P737_USTMA (Q4P737) Hypothetical protein

Sequences
Contig10
Contig19
Contig28
MYC_515_405_5_G0
8_XX
MYC_457_402
Contig18
PL1_KAZEM_5F12C0
7T796_X
PL1_KAZEM_11D11G
12T796_X
Contig18
PL1_KAZEM_5F12C0
7T796_X
PL1_KAZEM_11D11
Contig24
Contig28
Contig24
Contig25
PL2_KAZ_ARN_15G1
0H07T796_X
PL1_KAZEM_2B3A02
T796_X
Contig26
MYC_543_405_5_C1
2
Contig28
Contig7
PL2_KAZ_ARN_12C4
E09T796_X
PL1_KAZEM_15B1H1
2T796_XX
Seq265Banque_X
PL2_KAZ_ARN_12C7
F02T796_X
PL2_KAZ_ARN_12D9
F06T796_X
Contig37
MYC_642_SERVCOM
_SMCV
Contig37

80

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

(GO:0043565)
GTP binding
(GO:0005525)

ATP binding
(GO:0005524)

Q4P8A8_USTMA (Q4P8A8) Hypothetical protein

Q4TWI7_9BASI (Q4TWI7) Translation elongation
factor 1-alpha (Fra...
Q4P2C9_USTMA (Q4P2C9) Hypothetical protein
Q4PFA4_USTMA (Q4PFA4) Hypothetical protein
Q4P0Z6_USTMA (Q4P0Z6) ACT_PHARH ACTIN

Q4PDZ4_USTMA (Q4PDZ4) Hypothetical protein

unfolded protein
binding
(GO:0051082)
iron ion binding
(GO:0005506)
metal ion binding
(GO:0046872)
protein binding
(GO:0005515)

Q4PFA4_USTMA (Q4PFA4) Hypothetical protein

Q4PF19_USTMA (Q4PF19) Hypothetical protein

Q4PF19_USTMA (Q4PF19) Hypothetical protein
Q4P0Z6_USTMA (Q4P0Z6) ACT_PHARH ACTIN

Q4PGU4_USTMA (Q4PGU4) Hypothetical protein

structural molecule
activity (GO:0005198)

calcium-dependent
phospholipid
binding
(GO:0005544)
chitin binding
(GO:0008061)
structural
constituent of
ribosome
(GO:0003735)

Q4P8I3_USTMA (Q4P8I3) Hypothetical protein

PL2_KAZ_ARN_12A9
Contig7
PL1_KAZEM_15B1H1
2T796_XX
PL2_KAZ_ARN_12C4
E09T796_X
Seq265Banque_X
PL2_KAZ_ARN_12C7
F02T796_X
PL2_KAZ_ARN_12D9
F06T796_X
PL2_KAZ_ARN_12C4
E09T796_X
PL2_KAZ_ARN_12F8F
12T796_X
PL2_KAZ_ARN_12F8F
12T796_X
Seq265Banque_X
PL2_KAZ_ARN_12C7
F02T796_X
MYC_642_SERVCOM
_SMCV
PL1_KAZEM_2B3A02
T796_X

Q7Q5H5_ANOGA (Q7Q5H5)
ENSANGP00000021035 (Fragment)
Q5KDD6_CRYNE (Q5KDD6) 40s ribosomal protein
s23, putative

PLATE_III_1E1C04T7
96_X
Contig10

Q5QBL8_9DIPT (Q5QBL8) Hypothetical protein

(Fragment)
Q4PEZ6_USTMA (Q4PEZ6) Hypothetical protein
Q4PHH7_USTMA (Q4PHH7) Hypothetical protein
Q4PFQ3_USTMA (Q4PFQ3) Hypothetical protein
Q4PE29_USTMA (Q4PE29) Hypothetical protein
Q4PG96_USTMA (Q4PG96) Hypothetical protein
Q4P4D2_USTMA (Q4P4D2) Hypothetical protein
Q8J0Z0_CRYNV (Q8J0Z0) RPL39
Q4PBJ8_USTMA (Q4PBJ8) Hypothetical protein
Q4PBS3_USTMA (Q4PBS3) Hypothetical protein

Contig15

Q4P991_USTMA (Q4P991) Hypothetical protein

Q4P736_USTMA (Q4P736) Hypothetical protein
Q4PA41_USTMA (Q4PA41) Hypothetical protein
Q4PGA0_USTMA (Q4PGA0) Hypothetical protein
Q4PB08_USTMA (Q4PB08) Hypothetical protein
Q757G1_ASHGO (Q757G1) AER052Wp
Q4I2J7_GIBZE (Q4I2J7) Hypothetical protein

Contig19
Contig20
Contig24
Contig30
Contig31
Contig36
Contig45
Contig8
PL2_KAZ_ARN_15H1
1H05T796_X
PL1_KAZEM_3C8B12
T796_X
MYC_520_405_5_D0
96C2_XX
PLATE_I_6D5F04T79
6_X
PLATE_8D5_F05T796
_X
PL1_KAZEM_8H6E03
T796_X
PL2_KAZ_ARN_15E9
_H11T796_X
PLATE_III_12E12B10

81

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

Q4PI65_USTMA (Q4PI65) Hypothetical protein

Q4P5M5_USTMA (Q4P5M5) Hypothetical protein
Q4PH22_USTMA (Q4PH22) Hypothetical protein
Q2GVK4_CHAGB (Q2GVK4) Hypothetical protein

Q4P5I0_USTMA (Q4P5I0) Hypothetical protein

structural molecule Q4P0Z6_USTMA (Q4P0Z6) ACT_PHARH ACTIN
activity
(GO:0005198)

structural
constituent of
cytoskeleton
(GO:0005200)

structural
constituent of cell
wall (GO:0005199)

catalytic activity
(GO:0003824)

oxidoreductase
activity
(GO:0016491)

Q4P0Z6_USTMA (Q4P0Z6) ACT_PHARH ACTIN

PL2_KAZ_ARN_12C7
F02T796_X
Seq265Banque_X

Q4A2S9_9PHYC (Q4A2S9) Putative membrane

protein precursor

PL2_KAZ_ARN_12C7
F02T796_X
PLATE_II_10A5B09T7
96_XX

Q4A2B5_9PHYC (Q4A2B5) Putative membrane

protein
Q4PFE1_USTMA (Q4PFE1) Hypothetical protein

MYC_472_402_71_D
0511C7_X
Contig18

Q4P661_USTMA (Q4P661) Hypothetical protein

Q4PFE1_USTMA (Q4PFE1) Hypothetical protein

oxidoreductase
Q4PFE1_USTMA (Q4PFE1) Hypothetical protein
activity, acting on
the CH-CH group of
donors
(GO:0016627)

PL1_KAZEM_5F12C0
7T796_X
PL1_KAZEM_11D11G
12T796_X
Contig32
Contig18
PL1_KAZEM_5F12C0
7T796_X
PL1_KAZEM_11D11G
12T796_X
Contig18

Q4PBK3_USTMA (Q4PBK3) Hypothetical protein

PL1_KAZEM_5F12C0
7T796_X
PL1_KAZEM_11D11G
12T796_X
Contig18
PL1_KAZEM_5F12C0
7T796_X
PL1_KAZEM_11D11G
12T796_X
Contig33

Q4PBK3_USTMA (Q4PBK3) Hypothetical protein

Contig33

Q803T5_BRARE (Q803T5) S-

PLATE_III_5A8C08T7

Q4PFE1_USTMA (Q4PFE1) Hypothetical protein

polygalacturonase
activity
(GO:0004650)
hydrolase activity
(GO:0016787)

T796_X
PL2_KAZ_ARN_11D6
F04T796_XX
MYC_507_405_5_G0
7_X
PL1_KAZEM_14B3XH
09T796_X
MYC_515_405_5_G0
8_XX
MYC_457_402_71_E
037G8_X
MYC_643_SERVCOM
_SMCV
Seq265Banque_X

82

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

adenosylhomocysteine hydrolase
Q4P4I4_USTMA (Q4P4I4) Hypothetical protein

transporter activity
(GO:0005215)

hydrolase activity,
acting on glycosyl
bonds
(GO:0016798)
ubiquitin-protein
ligase activity
(GO:0004842)
ligase activity
(GO:0016874)
isocitrate
dehydrogenase
(NAD+) activity
(GO:0004449)
oxidoreductase
activity, acting on
NADH or NADPH,
NAD or NADP as
acceptor
(GO:0016652)
NADH
dehydrogenase
(ubiquinone)
activity
(GO:0008137)
electron carrier
activity
(GO:0009055)
cytochrome-c
oxidase activity
(GO:0004129)
lyase activity
(GO:0016829)
carboxy-lyase
activity
(GO:0016831)
adenosylhomocyst
einase activity
(GO:0004013)
D-alanyl-D-alanine
endopeptidase
activity
(GO:0008717)
catalytic activity
(GO:0003824)
phosphoric
monoester
hydrolase activity
(GO:0016791)
nucleosidetriphosphatase
activity
(GO:0017111)
N-acetyltransferase
activity
(GO:0008080)
hydrogentransporting ATP
synthase activity,
rotational

Q4PBK3_USTMA (Q4PBK3) Hypothetical protein

96_X
PL2_KAZ_ARN_15H9
H04T796_X
Contig33

Q2U549_ASPOR (Q2U549) Ubiquitin-protein

ligase

Contig48

Q2U549_ASPOR (Q2U549) Ubiquitin-protein

ligase
Q4PEY5_USTMA (Q4PEY5) Hypothetical protein

Contig48

Q4PEY5_USTMA (Q4PEY5) Hypothetical protein

PL1_KAZEM_2D1C03
T796_X

Q4P6C6_USTMA (Q4P6C6) Hypothetical protein

PL1_KAZEM_5C7B04
T796_X

Q4P6C6_USTMA (Q4P6C6) Hypothetical protein

PL1_KAZEM_5C7B04
T796_X

O47563_AGRAE (O47563) Cytochrome c oxidase

subunit 1

PL2_KAZ_ARN_13A7
G04T796_X

Q6C4B5_YARLI (Q6C4B5) Similar to tr|Q05567

Saccharomyces cerevisiae
Q6C4B5_YARLI (Q6C4B5) Similar to tr|Q05567
Saccharomyces cerevisiae

PLATE_III1C9G11T79
6_X
PLATE_III1C9G11T79
6_X

Q803T5_BRARE (Q803T5) Sadenosylhomocysteine hydrolase

PLATE_III_5A8C08T7
96_X

Q4PAY4_USTMA (Q4PAY4) Hypothetical protein

PL2_KAZ_ARN_10F6E
03T796_X

Q4P4I4_USTMA (Q4P4I4) Hypothetical protein

PL2_KAZ_ARN_15H9
H04T796_X
PL2_KAZ_ARN_15H9
H04T796_X

Q4P4I4_USTMA (Q4P4I4) Hypothetical protein

PL1_KAZEM_2D1C03
T796_X

Q4PDZ4_USTMA (Q4PDZ4) Hypothetical protein

PL2_KAZ_ARN_12D9
F06T796_X

Q4PED0_USTMA (Q4PED0) Hypothetical protein

PLATE_I_5G5D05T79
6_X

Q4P326_USTMA (Q4P326) Hypothetical protein

Contig23

83

CHAPITRE III - Analyse du transcriptome de Sporisorium reilianum en rponse au GR24, un analogue de synthse de strigolactone

molecular function
unknown
(GO:0005554)

mechanism
(GO:0046933)
hydrogentransporting
ATPase activity,
rotational
mechanism
(GO:0046961)
ion channel activity
(GO:0005216)
sodium channel
activity
(GO:0005272)
transporter activity
(GO:0005215)
molecular function
unknown
(GO:0005554)

Q4P326_USTMA (Q4P326) Hypothetical protein

Contig23

Q2PFW4_MACFA (Q2PFW4) Hypothetical protein

Contig56

Q2PFW4_MACFA (Q2PFW4) Hypothetical protein

Contig56

Q4PAB0_USTMA (Q4PAB0) Hypothetical protein

PL1_KAZEM_6C3H02
T796_X
Contig3

Q4WPW4_ASPFU (Q4WPW4) Iron-sulfur cluster

assembly accessory pro...

Q4P661_USTMA (Q4P661) Hypothetical protein

transcription regulator transcription factor Q4P737_USTMA (Q4P737) Hypothetical protein
activity (GO:0030528) activity
(GO:0003700)
Q4P8A8_USTMA (Q4P8A8) Hypothetical protein
translation regulator
activity (GO:0045182)

translation
elongation factor
activity
(GO:0003746)

Q4TWI7_9BASI (Q4TWI7) Translation elongation

factor 1-alpha (Fra...

Contig32
Contig37

PL2_KAZ_ARN_12A9
F11T796_X
Contig7

84

Discussion et perspectives

Discussion et perspectives

Les travaux prsents dans ce mmoire se situent dans le cadre de ltude des interactions
prcoces entre un microorganisme et une plante hte au niveau de la rhizosphre. La particularit de
ces interactions tient la prsence du sol environnant, permettant lorganisation de zones de
confinement. Ainsi le sol, avec toute la diversit de structure quil peut prsenter, constitue une
interface entre les deux organismes, une matrice vectrice de signaux prparant linteraction dans le
cadre dun dialogue molculaire, terme qui prend ici toute sa signification (di lgos discours
travers ).
Mon travail de thse sinscrit dans ce cadre et a port sur deux thmes centraux :
-dterminer que deux Ustilaginaceae agents de charbons sur mas (U. maydis et S.
reilianum) sont deux modles fongiques de grand intrt pour tudier les mcanismes
dinfection racinaire
-analyser la perception du GR24 (analogue de synthse des strigolactones) par les
Ustilaginaceae, plus particulirement par S. reilianum. Le GR24 est un analogue de synthse des
strigolactones, molcules prsentes dans les exsudats racinaires intervenant dans les
interactions entre plante parasites et plante hte, et entre les champignons endomycorhiziens
et les plantes. Ces molcules pourraient avoir un rle plus large dans lorganisation de la
rhizosphre.

Les Ustilaginaceae : modles fongiques dtude des interactions biotrophes parasites

racinaires
La racine des vgtaux est un organe au niveau duquel stablissent des symbioses
mutualistes dintrt agronomique. Les interactions rhizobiennes et endomycorhiziennes sont dfinies
comme biotrophes : ces organismes traversent la paroi des cellules htes, tablissent une interface
cellule cellule (membrane membrane avec une matrice dinterface) permettant de puiser des
photosynthtats. Ces interactions sont in fine bnfiques pour la plante car la cellule infecte rcupre
en retour de lammonium provenant de la fixation de lazote atmosphrique pour la symbiose
rhizobienne, des sels minraux (principalement des phosphates) et un apport hydrique complmentaire
pour la symbiose endomycorhizienne. Cette interaction biotrophe sensu stricto nest pas lapanage des
symbiotes biotrophes : de nombreux agents pathognes ont aussi cette capacit que lon observe le plus
souvent avec la formation dun haustorium : suoir permettant au champignon de puiser des nutriments
dans la cellule infecte. Ce suoir ne plonge pas dans le cytoplasme de la cellule infecte, mais permet
dtablir une interaction l aussi membrane contre membrane avec une matrice intermdiaire. Dans ce

85

Discussion et perspectives

type dinteraction, le champignon ne procure aucun bnfice trophique la plante, et linteraction

constitue in fine un parasitisme. Cette tape de biotrophie via un haustorium est cruciale dans de
nombreuses maladies fongiques trs importantes en agriculture (rouilles, charbons, odium,
anthracnoses telle la pyriculariose du riz). Des gnes conservs permettant la mise en place de la
biotrophie sont attendus chez les vgtaux : des essais raliss sur les mutants LjSym4 de Lotus
japonicus et DMI3 de Medicago truncatula montrent que ces mutants non nodulants ne sont pas
mycorhizs et prsentent un profil dinfection trs diffrents par rapport aux pathologies biotrophes
(Balestrini et al., 2007; Bonfante et al., 2000).
Utiliser des systmes dinteraction modles (i.e. gnomes squencs des deux organismes,
approches de gntique directe et inverse disponibles) pour raliser des analyses comparatives entres
les interactions symbiotiques et parasites biotrophes racinaires permettrait de mieux comprendre les
mcanismes mis en jeu et de grer ces interactions. Comment favoriser les unes en limitant les autres ?
Pour rpondre cette question, plusieurs analyses transcriptomiques comparatives ont dj t
entreprises :
-symbiose rhizobienne vs symbiose endomycorhyzienne chez les Lgumineuses (Manthey et al.,
2004)
-parasitisme et symbiose rhizobienne chez les Lgumineuses (Ameline-Torregrosa et al., 2006;
Nyamsuren et al., 2003)
-parasitisme vs symbioses mycorhizienne chez le riz (Guimil et al., 2005)
Une difficult de ces approches est quil existe peu de modles fongiques parasites racinaires
biotrophes. Ceux ci sont le plus souvent ncrotrophes. Dans ltude ralise sur le riz par Guimil et al
(2005), un comparatif a t ralis en ralisant des infections racinaires avec Magnaporthe grisea.
Certes il sagit dun parasite hmibiotrophe : la formation dappressorium pour former une aiguille
dinfection conduit la formation dun hyphe primaire biotrophe, rapidement suivi par la formation
dhyphes ncrotrophes. Dautre part il sagit dun parasite foliaire. Des travaux ont montr que M. grisea
pouvait infecter les racines de riz en condition de laboratoire (Dufresne & Osbourn, 2001).Toutefois la
pntration ne semble pas seffectuer comme au niveau foliaire : labsence de cuticule sur les tissus
racinaires entrane une induction rare dappressoria et hyphes primaires biotrophes, et le champignon
infecte souvent en pntrant entre les cellules de lpiderme racinaire et en dveloppant par hyphe
ncrotrophe (Sesma & Osbourn, 2004). Dans les conditions utilises dans ltude de Guimil (2005),
linteraction nest pas proprement parle biotrophe, et mme si lexpression de gnes communs avec
la symbiose endomycorhizienne a t dfinie, il est dlicat didentifier des gnes caractristiques de la
biotrophie conservs dans la biotrophie parasitaire et dans la biotrophie mutualiste. Ainsi, si des
analyses comparatives du transcriptome au niveau des racines des plantes entre symbiotes et parasites

86

Discussion et perspectives

ont t ralises, elles nont pas permis lheure actuelle didentifier des gnes cibles marqueurs de
laptitude la biotrophie des vgtaux.

Dans cet objectif, les Ustilaginaceae constituent des modles de choix. Nous nous sommes
attachs dfinir quUstilago maydis, jusque l dcrit comme un pathogne strictement foliaire,
prsente la facult de pouvoir infecter au niveau racinaire et pouvait tre un modle parasite biotrophe
de rfrence pour de telles tudes. Dans le chapitre II, nous dcrivons que la dichotomie qui spare S.
reilianum et U. maydis, savoir une pntration uniquement racinaire pour le premier et uniquement
arienne pour le second, est artificielle. U. maydis pntre les racines de mas, mais aussi de Medicago
truncatula. Il avait dj t rapport quU. maydis peut infecter dautres plantes (Leon-Ramirez et al.,
2004), sans toutefois former de spores. Il en va de mme pour linfection racinaire qui nentrane pas la
formation de sore.
Laptitude la pntration racinaire dU. maydis peut tre corrle galement au rsultat
obtenu en chapitre I sur la formation de souches solopathognes. Ce travail a plusieurs consquences
pour la suite des travaux. Dune part la caractrisation de souches solopathognes de S. reilianum est
dun grand intrt pour les tudes de gntique inverse chez cette espce. Mais cette tude nous a
aussi permis de mettre en vidence quU. maydis a une propension former des souches
solopathognes intermdiaire entre celle observe chez une espce strictement arienne
(Moesziomyces penicillariae, agent du charbon du mil) et celle observe chez une espce strictement
tellurique (S. reilianum). Nous avons propos lhypothse que la formation de souches solopathognes
est un avantage pour linfection arienne. Sil ne faut pas conclure sur ce seul argument que de fait U.
maydis est infectieux au niveau foliaire et au niveau racinaire, force est de constater quU. maydis ne
semble pas subir la mme pression slective que M. penicillariae pour former des souches
solopathognes.
Lobservation dune pntration racinaire par U. maydis permet denvisager lutilisation de cette
espce pour rechercher des mcanismes conservs qui seraient mis en uvre pour tablir les
interactions biotrophes entre plantes htes et champignons, parasite ou mutualiste. Par ailleurs loutil
gnomique que constitue U. maydis pourrait constituer un outil trs utile dans lquipe de recherche
Symbiose Endomycorhizienne et Signalisation Cellulaire dont le thme principal est ltude des
champignons endomycorhiziens. Une des limitations ltude de ces champignons est quils constituent
des anti-modles gntiques : gnome de plodie encore controverse, hyphes coenocytiques
multinucls, espces difficiles cultiver (symbiotes obligatoires croissance lente), non
transformables, sans mcanisme de sexualit avr ou du moins matrise. Seul loutil transcriptomique
est actuellement disponible. Ces approches seront dailleurs rendues plus efficaces par la ralisation
prochaine du squenage de son gnome, ou du moins par la mise disposition de donnes

87

Discussion et perspectives

gnomiques quasi exhaustives (le contigage du gnome nest pas assur du fait du fort taux de rgions
rptes, du faible %GC, et de la mconnaissance de la taille du gnome et de la plodie). Dans ce
contexte, les donnes transcriptomiques ne pourront tre valides que par une approche fonctionnelle
htrologue. Lutilisation de Saccharomyces cerevisiae en complmentation fonctionnelle est trs
performante pour les aspects mtaboliques, mais ntant pas un pathogne, cet outil de gntique
inverse par excellence (un mutant disponible pour chaque gne) ne peut tre utilise pour valider les
mcanismes lis linfection ou la biotrophie in planta. En cela, les Ustilaginaceae (U. maydis et S.
reilianum) pourront tre des vecteurs dexpression in planta de gnes de champignons
endomycorhiziens trs utiles. Il restera dmontrer la fonctionnalit chez les Ustilaginaceae de
lexpression des gnes issus de ces curiosits gntiques que constituent les champignons
endomycorhiziens.
Les Ustilaginaceae, modles dtude pour la perception des strigolactones

Les Strigolactones sont des molcules dont lintrt ne cesse de grandir. Depuis leur dcouverte
en 1966 (Cook et al., 1966), ces molcules ont t trs tudies dans le cadre de linteraction entre les
plantes parasites et leur htes. Sur le plan chimique, laboratoires privs et publics se sont appliqus
dfinir des analogues de synthse dans lventualit dune application au champ : lpandage de ces
molcules avant semis permettrait dans lide des concepteurs de faire germer les graines de plantes
parasites prsentes dans un sol infest et dinduire une germination suicide, ces parasites tant
obligatoires. Ainsi ont t synthtiss puis brevets diffrents stimulants de germination des graines
de plantes parasites, appels GR, acronyme du chimiste Gerald Roseberry (Johnson et al., 1981; Johnson
& Roseberry, 1977; Johnson et al., 1976; Musselman, 1980). Parmi les nombreuses molcules
synthtises (au moins 60 tant donn lexistence dun GR62), le GR24 serait le plus actif, et le GR7
serait un bon compromis entre lactivit et la facilit de mise en uvre de la synthse (cycle A absent).
Malheureusement pour les concepteurs, ces molcules ont un mauvais comportement au sol
(limination du cycle D), et surtout des techniques de lutte plus simples ont t dveloppes (injection
dthylne dans les sols - Musselman, 1987). Enfin, hormis dans le sud des Etats-Unis o le genre Striga
est prsent, les autres zones o ces plantes parasites taient largement distribues sont trs
majoritairement reprsentes par des pays en voie de dveloppement que lindustrie agrochimique ne
prenait pas comme march dintrt. Pour ces raisons, les brevets sont tombs dans le domaine public.
Toutefois ce contexte change (en relation avec le rchauffement climatique ?) car le risque Orobanche
devient de plus en plus prgnant en Europe du sud (France inclue) sur diffrentes cultures (tournesol
entre autres).

88

Discussion et perspectives

Durant les annes 85-95, la recherche publique a maintenu lintrt port lexploitation en
agrochimie des strigolactones travers deux laboratoires : le laboratoire du Pr Zwanenburg aux Pays Bas
et le laboratoire du Pr Takeuchi au Japon ( lheure actuelle, seul le Dr Yoneyama au Japon continu ces
recherches, plus axes vers la chimie analytique). Ces deux groupes de chimie organique ont dvelopp
les stratgies de synthse (Mangnus et al., 1992a; Mangnus et al., 1992b; Mori et al., 1997; Mori et al.,
1999; Thuring et al., 1997; Wigchert et al., 1999; Yoneyama et al., 1998), cherchant travers des tudes
de relation structure-activit dfinir les motifs minimaux actifs et identifier les rcepteurs ces
molcules (Reizelman et al., 2003). Par ailleurs lquipe du Pr Zwanenburg a fourni pendant plusieurs
annes le GR24 la communaut scientifique travaillant sur les plantes parasites. Durant ces annes,
une controverse a eu lieu sur le fait que les strigolactones ne seraient pas les seuls inducteurs de
germination des graines de plantes parasites (Wigchert & Zwanenburg, 1999; Yoder, 2001). Lorigine de
cette controverse tient ce que les strigolactones ne sont pas prsentes que dans les plantes htes des
plantes parasites, mais semblent tre chez la quasi-totalit des espces vgtales, avec toutefois des
diffrences de concentration (i.e. chez Arabidopsis thaliana) et de structures (ce qui semble intervenir
dans la spcificit dhte dOrobanche sur certaines espces). Ceci est dailleurs mis profit pour
proposer des stratgies de lutte biologique pour diminuer la pression dinoculum de graines de plantes
parasites dans les sols en ralisant des alternances de cultures avec des plantes fortes productrices de
strigolactones mais faux-htes rsistantes et non htes (trap crop comme le cotonnier, le bl, larachide)
ou sensibles mais rcoltes avant que les plantes parasites ne fleurissent (catch crop). Parmi les
molcules concurrentes, ont t travaills les sesquiterpnes lactones chez le tournesol (de Luque et al.,
2000) et la sorgoleone (Chang et al., 1986). A noter que de tels composs ne sont pas actifs chez les
champignons endomycorhiziens (Besserer et al., 2006). Si les strigolactones ne sont srement pas les
seuls marqueurs de compatibilit avec les plantes, des travaux ont montr que les plantes produisant
moins de strigolactones taient moins parasites (Matusova et al., 2005; Siame et al., 1993;
Weerasuriya et al., 1993) ce qui est un argument majeur de limplication biologique des strigolactones
dans cette interaction. Avant que lintrt des strigolactones dans linteraction endomycorhizienne ne
soit rvl, des travaux avaient montr que la mycorhization limitait linfection par les plantes parasites
(Lendzemo & Kuyper, 2001; Lendzemo et al., 2005). Des travaux ultrieurs indiquent que cet effet
rsulterait dun moindre pouvoir des exsudats de plantes mycorhizes induire la germination des
plantes parasites via une diminution de stimulants suite la mycorhization (Vierheilig et al., 2003). Cette
rgulation pourrait impliquer les phosphates comme signal (Yoneyama et al., 2007) dautant que les
champignons endomycorhiziens ont une forte capacit transporter les phosphates in planta (Harrison
& van Buuren, 1995). Ces dernires annes, la dcouverte que ces molcules taient relies la
synthse des carotnodes (Matusova et al., 2005) marque une nouvelle tape. Avec ce rsultat,
lintrt des strigolactones in planta redouble : le rle propos denzymes de clivage CCD/NCED des

89

Discussion et perspectives

apocarotnodes dans cette synthse (Bouwmeester et al., 2007) apporte de nouveaux dveloppements
suite limportance de ces enzymes dans des processus de dveloppement des plantes (Auldridge et al.,
2006). Les hypothses en cours sont analyses dans diffrents laboratoires, et constituent un domaine
trs

concurrentiel.

Dernirement,

la

publication

de

leur

implication

dans

la

symbiose

endomycorhizienne apporte une nouvelle vision sur ces molcules et le double visage que prsente ces
molcules travers leur implication dans une interaction parasite et une interaction parasite (le ying et
le yang des interactions selon Paszkowski, 2006) pourrait offrir encore de nouvelles facettes avec les
rsultats prsents dans ce mmoire sur leffet du GR24 sur deux champignons parasites, U. maydis et
S. reilianum.
Au cours de ces 40 annes dtude qui ont suivi la dcouverte du strigol, nous retiendrons que
des analogues de synthse des strigolactones sont disponibles, que leur voie de biosynthse est en lien
avec la synthse des carotnodes, que limplication biologique des strigolactones dans les interactions
implique les plantes parasites, les champignons endomycorhiziens, mais aussi dautres champignons
pathognes.
Aprs un descriptif du chemin parcouru, il convient dapprhender le chemin poursuivre.
i)

Quelle est la signification biologique de la perception des strigolactones par U. maydis

et S. reilianum ?
Lutilisation de plantes hypo-productrices en strigolactones au niveau de leurs exsudats
racinaires permettrait de dfinir si elles sont plus tolrantes ces pathologies, ou plus
sensibles.

ii)

La synthse des strigolactones est elle organe spcifique et diffusent-elles ?

Des essais raliss sur sorgho ont permis de trouver ces molcules dans les tissus
foliaires (V. Puech et C. Gomez-Roldan, non publi), mais ces analyses doivent tre
poursuivies.

iii)

Les strigolactones ont-elles une incidence sur la pathologie in planta, ou uniquement

sur les tapes prcoces ?
Avant dtre exsudes, les strigolactones sont assurment prsentes dans les tissus
vgtaux et pourraient avoir une incidence sur les microorganismes in planta.

iv)

Quel est le mcanisme de perception des strigolactones ?

U. maydis, par ses avantages en temps quoutil de laboratoire, permettrait deffectuer
des approches dans ce sens (essais de localisation intracellulaire avec des drivs
fluors, isolement de mitochondries pour tester un effet direct sur la respiration). Le fait
que des organismes si diffrents - plantes parasites, champignons endomycorhiziens,
Ustilaginaceae- rpondent ces molcules soulve la question de la perception :

90

Discussion et perspectives

mcanisme conserv ou convergence ? Dans le premier cas, cela soulverait lincidence

de ces molcules en pharmacologie humaine.
v)

Dautres espces fongiques telluriques sont elles sensibles ces molcules ?

Un screening des rponses respiratoires pourraient tre ralis.

vi)

Les strigolactones ont-elles une incidence, parmi dautres molcules, sur lorganisation
de la rhizosphre ?
Ltude de la rhizosphre de plantes mutantes rprimes sur leur biosynthse de
strigolactones, en comparaison au type sauvage, permettrait daborder cette question.

Quarante deux ans et toujours de nombreuses questions restent adresss sur les strigolactones,
molcules davenir.

91

BIBLIOGRAPHIE GENERALE

BIBLIOGRAPHIE GENERALE

Agrios GN. 1988. Plant Pathology. San Diego: Academic Press.

Akiyama K, Hayashi H. 2006. Strigolactones: Chemical Signals for Fungal Symbionts and Parasitic Weeds in Plant
Roots. Annals of Botany 97:925-931.
Akiyama K, Matsuzaki K-i, Hayashi H. 2005. Plant sesquiterpenes induce hyphal branching in arbuscular
mycorrhizal fungi. Nature 435:824-827.
Alschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a
new generation of protein detabase search programs. Nucleic Acid Research 25:3389-3402.
Ameline-Torregrosa C, Dumas B, Krajinski F, Esquerre-Tugaye M-T, Jacquet C. 2006. Transcriptomic approaches
to unravel plantpathogen interactions in legumes. Euphytica 147:25-36.
Anderson CM, Willits DA, Kosted PJ, Ford EJ, Martinez Espinoza AD, Sherwood JE. 1999. Molecular analysis of
the pheromone and pheromone receptor genes of Ustilago hordei. Gene 240:89-97.
Auldridge ME, McCarty DR, Klee HJ. 2006. Plant carotenoid cleavage oxygenases and their apocarotenoid
products. Current Opinion in Plant Biology 9:315-321.
Baht RS. 1946. Studies in the Ustilaginales.I. The mode of infection of the bajra plant (Pennisetum typhoides
Stapf.) by the smut Tolyposporium penicillariae Bref. Journal of the Indian Botanical Society 25:163-186.
Bais H, Loyola-Vargas V, Flores H, Vivanco J. 2001. Root-specific metabolism the biology and biochemistry of
underground organs. In Vitro Plant. 37:30-41.
Bais H, Park S, Stermitz F, Halligan K, Vivanco J. 2003a. Exudation of fluores antimicrobial activity of rosmarinic
acid in hairy root cultures of sweet basil (0cimum basilicum L.). Plant Physiol. Biochem. 40:83-87.
Bais H, Park S, Weir T, Callaway R, Vivanco J. 2004. How plants communicate using the underground information
superhighway. Trends Plant Sci. 9:2 6-3 2.
Bais H, Vepachedu R, Gilroy S, Callaway R, Vivanco J. 2003b. Allelopathy and exoticplant invasion: from
molecules and genes to species interactions. Science 301:77-80.
Bais HP, Weir TL, Perry LG, S. 2006. The Role of Root Exudates in Rhizosphere Interactions with Plants and Other
organisms. Annual Review of Plant Biology 57:233-266.
Bakkeren G, Gibbard B, Yee A, Froeliger E, Leong S, Kronstad J. 1992. The a and b Loci of Ustilago maydis
Hybridize with DNA sequences from other smut fungi. Molecular Plant-Microbe Interactions 5:347-355.
Bakkeren G, Kronstad JW. 1993. Conservation of the b mating-type gene complex among bipolar and tetrapolar
smut fungi. the plant cell 5:123-136.
Balestrini R, Gomez-Ariza J, Lanfranco L, Bonfante P. 2007. Laser Microdissection Reveals That Transcripts for Five
Plant and One Fungal Phosphate Transporter Genes Are Contemporaneously Present in Arbusculated Cells.
Molecular Plant-Microbe Interactions 20:1055-1062.
Banuett F, Herskowitz I. 1988. Ustilago maydis, smut of maize. In: Advances in Plant Pathology: Academic Press. p
427-455.
Banuett F, Herskowitz I. 1989. Different a alleles of Ustilago maydis are necessary for maintenance of filamentous
growth but not for meiosis. Proceedings of the National Academy of Sciences of the United States of
America 86:5878-5882.
Basse CW, Kolb S, Kahmann R. 2002. A maize-specifically expressed gene cluster in Ustilago maydis. Molecular
Microbiology 43:75-93.
Bauer R, Begerow D, Sampaio J, Wei M, Oberwinkler F. 2006. The simple-septate basidiomycetes: a synopsis.
Mycological Progress 5:41-66.
Bauer R, Begerow, Dominik, and Oberwinkler, Franz. 1997. Ustilaginomycetes. The true smut fungi.
http://tolweb.org/Ustilaginomycetes/20530/1997.11.30 in The Tree of Life Web Project.
Baumgarten A, Suresh J, May G, Phillips R. 2007. Mapping QTLs contributing to Ustilago maydis resistance in
specific plant tissues of maize. TAG Theoretical and Applied Genetics 114:1229-1238.
Bcard G, Roux C, Sejalon-Delmas N, Puech V, Roy S. 2005. Modulators of the development of mycorrhizal fungi
with arbuscules, and uses thereof. In: WO Patent 2005/077177 A2. France.
Bechinger C, Giebel K, Schnell M, Leiderer P, Deising H, Bastmeyer M. 1999. Optical measurements of invasive
forces exerted by appressoria of a plant pathogenic fungus. Science 285:1896-1899.
Begerow D, Bauer R, Boekhout T. 2000. Phylogenetic placements of ustilaginomycetous anamorphs as deduced
from nuclear LSU rDNA sequences. Mycological Research 104 Part 1:53-60.

92

BIBLIOGRAPHIE GENERALE

Begerow D, Bauer R, Oberwinkler F. 1997. Phylogenetic studies on nuclear large subunit ribosomal DNA
sequences of smut fungi and related taxa. Canadian Journal of Botany 12:1390-1399. 75:2045-2056.
Bertin C, Yang X, Weston L. 2003. The role of root exudates and allelochemicals in the rhizosphere. Plant Soil
256:67-83.
Besserer A, Puech-Pag&egrave V, Kiefer P, Gomez-Roldan V, Jauneau A, Roy S, Portais J, Roux C, Bcard G,
Sjalon-Delmas N.
2006. Strigolactones Stimulate Arbuscular Mycorrhizal Fungi by Activating
Mitochondria. PLoS Biology 4:226.
Blanz PA, Gottschalk M. 1984. A comparison of 5S rRNA nucleotide sequences from smut fungi. Systematic and
applied Microbiology 5:518-526.
Bolker M, Bohnert HU, Braun KH, Gorl J, Kahmann R. 1995. Tagging pathogenicity genes in Ustilago maydis by
restriction enzyme mediated integration (REMI). Molecular & General Genetics 248:547-552.
Bonfante P, Genre A, Faccio A, Martini I, Schauser L, Stougaard J, Webb J, Parniske M. 2000. The Lotus japonicus
LjSym4 Gene Is Required for the Successful Symbiotic Infection of Root Epidermal Cells. Molecular PlantMicrobe Interactions 13:1109-1120.
Bouwmeester HJ, Matusova R, Zhongkui S, and Beale M.H (2003) , Current Opinion in Plant Biology 6:. 2003.
Secondary metabolite signalling in host-parasitic plant interactions. 6: 358-364.
Bouwmeester HJ, Roux C, Lopez-Raez JA, Bcard G. 2007. Rhizosphere communication of plants, parasitic plants
and AM fungi. Trends in Plant Science 12:224-230.
Brachmann A, Weinzierl G, Kamper J, Kahmann R. 2001. Identification of genes in the bW/bE regulatory cascade
in Ustilago maydis. molecular microbiology 42:1047-1063.
Brady N, RR. W 1999. The Nature and Property of Soils. Upper Saddle Hall, NJ:Prentice Hall.
Brefort T, Muller P, Kahmann R. 2005. The High-Mobility-Group Domain Transcription Factor Rop1 Is a Direct
Regulator of prf1 in Ustilago maydis . Eukaryotic Cell 4:379-391.
Brimecombe M, De Leij Frans A, Lynch J. 2001. Nematode community struc-ture as a sensitive indicator of
microbial perturbations induced by a genetically modified Pseudomonasflaorescens strain. Biol. Fertil. Soils
34:270-275.
Brown R, Edwards M. 1944. The germination of the Seed of Striga lutea 1.Host Influence and the Progress of
germination. Annals of Botany 8:131-148.
Bruns TD, White TJ, Taylor JW. 1991. Fungal Molecular Systematics. Annual Review of Ecology and Systematic
22:525-564.
Bue M, Rossignol M, Jauneau A, Ranjeva R, Bcard G. 2000. The pre-symbiotic growth of arbuscular mycorrhizal
fungi is induced by a branching factor partially purified from plant root exudates. Molecular Plant - Microbe
Interactions 13:693-698.
Chang M, Netzly DH, Butler LG, Lynn DG. 1986. Chemical regulation of distance : characterization of the first
natural host germination stimulant for Striga asiatica. Journal of American Chemical Society 108:7858-7860.
Chilton S.P. 1938. The occurance of lysis in certain crosses of Ustilago zeaz. Phytopathology 28:5-10.
Chilton S.P. 1943. A heritable abnormality in the germination of chlamydospores of Ustilago zeae. Phytopathology
33:749-765.
Christensen J.J. 1931. Studies on the genetics of Ustilago zeae. Phytopathology Zeitschr 4:129-188.
Christensen JJ. 1963. Corn smut caused by Ustilago maydis - Monography 2. St Paul: American Phytopathological
Society
Cook CE, Whichard LP, Turner B, Wall ME, Egley GH. 1966. Germination of witchweed (Striga Lutea Lour.) :
isolation and properties of a potent stimulant. Science 154:1189-1190.
Dakora FD, Donald AP. 2002. Root exudates as mediators of mineral acquisition in low-nutrient environments.
Plant and Soil. 245: 35-47.
de Jong J, McCormack B, Smirnoff N, Talbot N. 1997. Glycerol generates turgor in rice blast. Nature 389:244-245.
de Luque AP, Galindo JCG, Macias FA, Jorrin J. 2000. Sunflower sesquiterpene lactone models induce Orobanche
cumana seed germination. Phytochemistry 53:45-50.
Diagne-Lye G. 2005. La pathologie du charbon du mil[pennisetum glaucum (l.) R. Br.]- (brefeld) vanky:
phylogenie, biocycle, variabilit gnotypique de l'agent pathogne, et relations hte-parasite. In:
Dpartement de Biologie Vgtale. Dakar: Cheikh Anta Diop.
Dufresne M, Osbourn AE. 2001. Definition of Tissue-Specific and General Requirements for Plant Infection in a
Phytopathogenic Fungus. Molecular Plant-Microbe Interactions 14:300-307.
Eddins A.H. 1929. Pathogenecity and cultural behavier of Ustilago zeae(Beckm.) Ung. from different localities.
Phytopathology 19:885-916.
Ehrlich HG. 1958. Nuclear Behavior in Mycelium of a Solopathogenic Line and in a Cross of Two Haploid Lines of
Ustilago maydis (DC.) Cda. Mycologia 50:622-627.

93

BIBLIOGRAPHIE GENERALE

Frederiksen RA. 1977. Head smuts of corn and sorghum. In: WILKINSON HALaD, editor. 32nd Annual Corn and
Sorghum Research Conference. Chicago (Illinois): American Seed Trade Association, Washington D.C.
Garcia-Muse T, Steinberg G, Perez-Martin J. 2003. Pheromone-induced G2 arrest in the phytopathogenic fungus
Ustilago maydis. Eukaryotic Cell 2:494-500.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes-applicatin to the
identification of mycorrhizae and rusts. Molecular Ecology 2:113-118.
Gewin V. 2007. Amber collectors hit on oldest mushroom find. In: 11 June Nature.
Gleba D, Borisjuk N, Borisjuk L, Kneer R, Poulev A, Skarzhinskaya Mea. 1999. Use of plant roots for
phytoremediation and molecular farming:. Proceedings of the National Academy of Sciences of the United
States of America 25:5973-5977.
Gomez-Roldan V, Roux C, Girard D, Bcard G, Puech V. 2007. Strigolactones: promising plant signals. Plant
Signaling & Behavior 2:163-164.
Guimil S, Chang H-S, Zhu T, Sesma A, Osbourn A, Roux C, Ioannidis V, Oakeley EJ, Docquier M, Descombes P,
Briggs SP, Paszkowski U. 2005. Comparative transcriptomics of rice reveals an ancient pattern of response
to microbial colonization. Proceedings of the National Academy of Sciences of the United States of America
102:8066-8070.
Hanna WF. 1929. Studies in the physiology and cytology of Ustilago zeae and Sorosporium reilianum.
Phytopathology 19:415-443.
Harrison MJ, van Buuren ML. 1995. A phosphate transporter from the mycorrhizal fungus Glomus versiforme.
Nature 378:626-629.
Hawksworth DL. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revised. Mycological
Reseach 109:1422 - 1432.
Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S, James T, Kirk PM, Lucking R,
Thorsten Lumbsch H, Lutzoni F, Matheny PB, McLaughlin DJ, Powell MJ, Redhead S, Schoch CL, Spatafora
JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer R, Begerow D, Benny GL, Castlebury LA, Crous PW,
Dai Y-C, Gams W, Geiser DM, Griffith GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka K, Humber
RA, Hyde KD, Ironside JE, Koljalg U, Kurtzman CP, Larsson K-H, Lichtwardt R, Longcore J, Miadlikowska J,
Miller A, Moncalvo J-M, Mozley-Standridge S, Oberwinkler F, Parmasto E, Reeb V, Rogers JD, Roux C,
Ryvarden L, Sampaio JP, Schuler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker C, Wang Z,
Weir A, Weiss M, White MM, Winka K, Yao Y-J, Zhang N. 2007. A higher-level phylogenetic classification of
the Fungi. Mycological Research 111:509-547.
Hirsch A, Bauer W, Bird D, Cullimore J, Tyler B, Yoder J. 2003. Molecular signals and receptors: controlling
rhizosphere interactions between plants and other organisms. Ecology 84:858-868.
Holliday R. 1974. Ustilago maydis. In: King RC, editor. Hanbook of Genetics. New York: Plenum Press.
Holton CS, Hoffmann JA, Duran R. 1968. Variation in the smut fungi. Annual Review of Phytopathology 6:213-241.
Humphrey AJ, Galster AM, Beale MH. 2006. Strigolactones in chemical ecology: waste products or vital
allelochemicals? Natural Product Report 23:592-614.
James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Gueidan C, Fraker E, Miadlikowska J,
Lumbsch HT, Rauhut A, Reeb V, Arnold AE, Amtoft A, Stajich JE, Hosaka K, Sung G-H, Johnson D,
O/'Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z, Wilson AW, Schuszler A, Longcore JE,
O/'Donnell K, Mozley-Standridge S, Porter D, Letcher PM, Powell MJ, Taylor JW, White MM, Griffith GW,
Davies DR, Humber RA, Morton JB, Sugiyama J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K,
Hambleton S, Shoemaker RA, Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW,
Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA, Lucking R, Budel B, Geiser DM, Aptroot A,
Diederich P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin DJ, Spatafora JW, Vilgalys R.
2006. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature 443:818-822.
Janzac B. 2002. Analyse sur filtres micro-arrays de gnes induits par des exsudats racinaires chez Sporisorium
reilianum partir d'une approche SSH. UMR 5546. Toulouse, Universit Paul Sabatier: 36.
Johnson AW, Gowda G, Hassanali A, Knox J, Monaco, Razavi Z, Roseberry G. 1981. The preparation of synthetic
analogs of Strigol. Journal of the Chemical Society Perkin Transaction 1:1734-1743.
Johnson AW, Roseberry G, Parker CA. 1976. A novel approach on Striga and Orobanche control using synthetic
germination stimulants. Weed Research 16:223-227.
Johnson AW, Roseberry G. 1977. Germination Factors. In. USA: International Development Research Center,
Ottawa, Canada.
Journet EP, Van Tuinen D, Gouzy J, Crespeau H, Carreau V, Farmer MJ, Niebel A, Schiex T, Jaillon O, Chatagnier O,
Godiard L, Micheli F, Kahn D, Gianinazzi-Pearson V, Gamas P. 2002. Exploring root symbiotic programs in
the model legume Medicago truncatula using EST analysis. Nucleic Acid Research 30:5579-5592.

94

BIBLIOGRAPHIE GENERALE

Kahmann R, Kamper J. 2004. Ustilago maydis: how its biology relates to pathogenic development. New
Phytologist 164:31-42.
Kahmann R, Romeis T, Bolker M, Kamper J. 1995. Control of mating and development in Ustilago maydis. Current
Opinion in Genetics & Development 5:559-564.
Kamper J, Kahmann R, Bolker M, Ma L-J, Brefort T, Saville BJ, Banuett F, Kronstad JW, Gold SE, Muller O, Perlin
MH, Wosten HAB, de Vries R, Ruiz-Herrera J, Reynaga-Pena CG, Snetselaar K, McCann M, Perez-Martin J,
Feldbrugge M, Basse CW, Steinberg G, Ibeas JI, Holloman W, Guzman P, Farman M, Stajich JE, Sentandreu
R, Gonzalez-Prieto JM, Kennell JC, Molina L, Schirawski J, Mendoza-Mendoza A, Greilinger D, Munch K,
Rossel N, Scherer M, Vranes M, Ladendorf O, Vincon V, Fuchs U, Sandrock B, Meng S, Ho ECH, Cahill MJ,
Boyce KJ, Klose J, Klosterman SJ, Deelstra HJ, Ortiz-Castellanos L, Li W, Sanchez-Alonso P, Schreier PH,
Hauser-Hahn I, Vaupel M, Koopmann E, Friedrich G, Voss H, Schluter T, Margolis J, Platt D, Swimmer C,
Gnirke A, Chen F, Vysotskaia V, Mannhaupt G, Guldener U, Munsterkotter M, Haase D, Oesterheld M,
Mewes H-W, Mauceli EW, DeCaprio D, Wade CM, Butler J, Young S, Jaffe DB, Calvo S, Nusbaum C,
Galagan J, Birren BW. 2006. Insights from the genome of the biotrophic fungal plant pathogen Ustilago
maydis. Nature 444:97-101.
Kamper J, Reichmann M, Romeis T, Bolker M, Kahmann R. 1995. Multiallelic recognition: Nonself-dependent
dimerization of the bE and bW homeodomain proteins in Ustilago maydis. Cell 81:73-83.
Kato Y. 1984. Chromosome morphology and the origin of maize and its races. Evolutionary Biology 17:219-253.
Kendrick E.L. 1975. The effect of culture temprature on the sex associated pigmentation phenomenon in
monosporidial lines of Tilletia caries. Phytopathology 47:19-25.
Kendrick E.L. 1960. a solopahtogenic line of Tilletia caries. Phytopathology 50:641-658.
Kerns MR, Dudley JW, Rufener GK. 1999. QTL for resistance to common rust and smut in maize. Maydica 44:3745.
Kneer R, Poulev A, Olesinski A, Raskin I. 1999. Characterization of the elicitor-induced biosysnthesis and secretion
of genistin from roots ofLupinuslateus.,7. Experimental Botany 50:1553-59.
Kniep H. 1926. Ueber Artkreuzungen bei Brandpilzen. Zeitschr. f. Pilzkunde 5:217-247.
Kousik CS, Thakur RP, Subba Rao KV. 1988. Influence of environmental factors on production and dispersal of
Tolyposporium penicillariae sporidia. Indian Journal of Aerobioliology 1:85-91.
Kuramae E, Robert V, Echavarri-Erasun C, Boekhout T. 2007. Cophenetic correlation analysis as a strategy to
select phylogenetically informative proteins: an example from the fungal kingdom. BMC Evolutionary
Biology 7:134.
Kuramae EE, Robert V, Snel B, WeiSz M, Boekhout T. 2006. Phylogenomics reveal a robust fungal tree of life.
FEMS Yeast Res 6:1213 - 1220.
Langdon RFN, Fullerton RA. 1975. Sorus ontogeny and sporogenesis in some smut fungi. Australian Journal of
Botany 23:913-930.
Lendzemo VW, Kuyper TW, Kropff MJ, van Ast A. 2005. Field inoculation with arbuscular mycorrhizal fungi
reduces Striga hermonthica performance on cereal crops and has the potential to contribute to integrated
Striga management. Field Crops Research 91:51-61.
Lendzemo VW, Kuyper TW. 2001. Effects of arbuscular mycorrhizal fungi on damage by Striga hermonthica on
two contrasting cultivars of sorghum, Sorghum bicolor. Agriculture,Ecosystems & Environment 87:29-35.
Leon-Ramirez CG, Cabrera-Ponce JL, Martinez-Espinoza AD, Herrera-Estrella L, Mendez L, Reynaga-Pena CG,
Ruiz-Herrera J. 2004. Infection of alternative host plant species by Ustilago maydis. New Phytologist
164:337-346.
Linning R, Lin D, Lee N, Abdennadher M, Gaudet D, Thomas P, Mills D, Kronstad JW, Bakkeren G. 2004. Markerbased cloning of the region containing the UhAvr1 avirulence gene from the basidiomycete barley pathogen
Ustilago hordei. Genetics 166:99-111.
Lu XW, Brewbaker JL. 1999. Molecular mapping of QTLs conferring resistance to Sphacelotheca reiliana (Khn)
Clinton. Maize Genetics Cooperation Newsletter 73:36.
Lubberstedt T, Klein D, Melchinger AE. 1998. Comparative QTL mapping of resistance to Ustilago maydis across
four populations of European flint-maize. Theoretical and Applied Genetics 97:1321-1330.
Lubberstedt T, Xia XC, Tan G, Liu X, Melchinger AE. 1999. QTL mapping of resistance to Sporisorium reiliana in
maize. Theoretical and Applied Genetics 99:593-598.
Mangnus EM, Dommerholt FJ, De Jong RLP, Zwanenburg B. 1992a. Improved synthesis of strigol analogue GR24
and evaluation of the biological activity of its diastereomers. Journal of agricultural and food chemistry
40:1230-1235.
Mangnus EM, Stommen PLA, Zwanenburg B. 1992b. A standardized bioassay for evaluation of potential
germination stimulants for seeds of parasitic weeds. Journal of plant growth regulation 11:91-98.

95

BIBLIOGRAPHIE GENERALE

Manthey K, Krajinski F, Hohnjec N, Firnhaber C, Phler A, Perlick AM, Kster H. 2004. Transcriptome Profiling in
Root Nodules and Arbuscular Mycorrhiza Identifies a Collection of Novel Genes Induced During Medicago
truncatula Root Endosymbioses. Molecular Plant - Microbe Interactions 10:2004-2007.
Marschner H. 1995. MineralNutrition ofHigherPlants. SecondEdition. London: Academic.
Martinez C, A.Jauneau, C. Roux, C. Savy, R. Dargent. 2000. Early infection of maize roots by Sporisorium reilianum
f. sp. zeae. Protoplasma 213:83-92.
Martinez C, Bue M, Jauneau A, Bcard G, Dargent R, Roux C. 2001. Effects of a fraction from maize root
exudates on haploid strains of Sporisorium reilianum f. sp. zeae. Plant and Soil 236:145-153.
Martinez C, Jauneau A, Roux C, Savy C, Dargent R. 2000. Early infection of maize root by Sporisorium reilianum
f.sp. zeae. Protoplasma 213:83-92.
Martinez C, Roux C, Dargent R. 1999. Biotrophic Development of Sporisorium reilianum f. sp. zeae in Vegetative
Shoot Apex of Maize. Phytopathology 89:247-253.
Martinez C, Roux C, Jauneau A, Dargent R. 2002. The biological cycle of Sporisorium reilianum f.sp. zeae: an
overview using microscopy. Mycologia 94:505-514.
Matsuoka Y, Vigouroux Y, Goodman MM, Sanchez G, J, Buckler E, Doebley J. 2002. A single domestication for
maize shown by multilocus microsatellite genotyping. PNAS 99:6080-6084.
Matusova R, Mourik T, Bouwmeester HJ. 2004. Changes in the sensitivity of parasitic weed seeds to germination
stimulants. Seed Sci. Res. 14:335344.
Matusova R, Rani K, Verstappen F, Franssen M, Beale M, Bouwmeester H. 2005. The strigolactone germination
stimulants of the plant-parasitic Striga and Orobanche spp. are derived from the carotenoid pathway. Plant
Physiology 139:920-934.
Matyac CA, Kommedahl T. 1985a. Factors affecting the development of head smut caused by Sphacelotheca
reiliana on corn. Phytopathology 75:577-581.
Matyac CA, Kommedahl T. 1985b. Occurrence of chlorotic spots on corn seedlings infected with Sphacelotheca
reiliana and their use in evaluation of head smut resistance. Plant Dis. 69:251-254.
Mndez-Morn L, Reynaga-Pea C, Springer PS, Ruiz-Herrera J. 2005. Ustilago maydis infection of the nonnatural
host Arabidopsis thaliana. Phytopathology 95:480-488.
Meyers BC, Tingey SV, Morgante M. 2001. Abundance, Distribution, and Transcriptional Activity of Repetitive
Elements in the Maize Genome. Genome Res. 11:1660-1676.
Mills LJ, Kotz JM. 1981. Scanning electron microscopy of the germination, growth and infection of Ustilago
maydis on maize. Phytopathologie Zurnal 102:21-27.
Mori K, Matsui J, Bando M, Kido M, Takeuchi Y. 1997. Synthesis and Biological Evaluation of the Four Racemic
Stereoisomers of the Structure Proposed for Sorgolactone, the Germination Stimulant from Sorghum
bicolor. Tetrahedron Letters 38:2507-2510.
Mori K, Matsui J, Yokota T, Sakai H, Bando M, Takeuchi Y. 1999. Structure and Synthesis of Orobanchol, the
Germination Stimulant for Orobanche minor. Tetrahedron Letters 40:943-946.
Morris P, Bone E, Tyler B. 1998. Chemotropic and contact responses of Pbytopbtbora sojaehyphaeto
soybeanisoflavonoids and artificialsubstrates. Plant Pbysiol. 117:1171-1178.
Muller P, Weinzierl G, Brachmann A, Feldbrugge M, Kahmann R. 2003. Mating and pathogenic development of
the Smut fungus Ustilago maydis are regulated by one mitogen-activated protein kinase cascade. Eukaryot
Cell 2:1187-1199.
Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. 1986. Specific enzymatic amplification of DNA in vitro: the
polymerase chain reaction. In: Cold Spring Harb Symp Quant Biol. p 263-273.
Munkacsi AB, Stoxen S, May G. 2007. Domestication of maize, sorghum, and sugarcane did not drive the
divergence of their smut pathogens. Evolution 61:388-403.
Musselman LJ. 1987. Parasitic weeds in agriculture. Boca Raton: CRC Press.
Musselman LJ. 1980. The biology of Striga, Orobanche and other root-parastic weeds. In: Grogan RG, Zentmyer
GA, Cowling AB, editors. Annual Review of Phytopathology. Palo Alto: Annual Reviews Inc.
Nelson EB. 1991. Exudate molecules initiating fungal response to seed and roots. In: The rhizosphere and plant
growth. Keister, D. L.; Cregan, P.
Nyamsuren O, Colditz F, Rosendahl S, Tamasloukht M, Bekel T, Meyer F, Kuester H, Franken P, Krajinski F. 2003.
Transcriptional profiling of Medicago truncatula roots after infection with Aphanomyces euteiches
(oomycota) identifies novel genes upregulated during this pathogenic interaction. Physiological and
Molecular Plant Pathology 63:17-26.
Parisseaux B, Bernardo R. 2004. In silico mapping of quantitative trait loci in maize. Theor Appl Genet. online
version.

96

BIBLIOGRAPHIE GENERALE

Parniske M. 2000. Intracellular accommodation of microbes by plants: a common developmental program for
symbiosis and disease? Current Opinion in Plant Biology 3:320-328.
Paszkowski U. 2006. Mutualism and parasitism: the yin and yang of plant symbioses. Current Opinion in Plant
Biology 9:364-370.
Peters NK, Frost JW, Long SR. 1986. A plant flavone, luteolin, induces expression of Rhizobium meliloti nodulation
genes. Science 233:977-980.
Peters NK, Long SR. 1988. Alfalfa Root Exudates and Compounds which Promote or Inhibit Induction of Rhizobium
meliloti Nodulation Genes. Plant Physiol. 88:396-400.
Piepenbring M, Hagedorn G, Oberwinkler F. 1998. Spore liberation and dispersal in smut fungi. Botanica Acta
111:444-460.
Piepenbring M. 2003. Smut fungi (Ustilaginomycetes p.p. and Microbotryales, Basidiomycota). New York: New
York Botanical Garden.
Poinar Jr GO, Buckley R. 2007. Evidence of mycoparasitism and hypermycoparasitism in Early Cretaceous amber.
Mycological Research 111:503-506.
Ptaffi M. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acid Research
29:2002-2007.
Puhalla JE. 1968. Compatibility reactions on solid medium ans interstrain inhibition in Ustilago maydis. Genetics
60:461-474.
Rafalski A, Morgante M. 2004. Corn and humans: recombination and linkage disequilibrium in two genomes of
similar size. Trends in Genetics 20:103-111.
Reizelman A, Wigchert SCM, del-Bianco C, Zwanenburg B. 2003. Synthesis and bioactivity of labelled germination
stimulants for the isolation and identification of the strigolactone receptor. Organic & Biomolecular
Chemistry 1:950-959.
Remy W, Taylor TN, Hass H, Kerp H. 1994. Four Hundred-Million-Year-Old Vesicular Arbuscular Mycorrhizae.
Proceedings of the National Academy of Sciences 91:11841-11843.
Roux C, Almaraz T, Durrieu G. 1998. Phylogenie de champignons responsables des charbons des vegetaux a partir
de l'analyse des sequences ITS. Comptes Rendus de l'Academie des Sciences - Series III - Sciences de la Vie
321:603-609.
Saiki R, Gelfand D, Stoffel S, Scharf S, Higuchi R, Horn G, Mullis K, Erlich H. 1988. Primer-directed enzymatic
amplification of DNA with a thermostable DNA polymerase. Science 239:487-491.
Schirawski J, Heinze B, Wagenknecht M, Kahmann R. 2005. Mating Type Loci of Sporisorium reilianum: Novel
Pattern with Three a and Multiple b Specificities. Eukaryotic Cell 4:1317-1327.
Sesma A, Osbourn AE. 2004. The rice leaf blast pathogen undergoes developmental processes typical of rootinfecting fungi. Nature 431:582-586.
Siame BA, Weerasuriya Y, Wood K, Ejeta G, Butler LG. 1993. Isolation of Strigol, a Germination Stimulant for
Striga asiatica, from Host Plants,. Agricultural and food chemistry 1486::1486-1491.
Siame BA, Yohan W, Wood K, Ejeta G, Butler LG. 1993. Isolation of strigol, a germination stimulant for Striga
asiatica, from host plants. Journal of agricultural and food chemistry 41:1486-1491.
Snetselaar KM, Carfioli MA, Cordisco KM. 2001. Pollination can protect maize ovaries from infection by Ustilago
maydis, the corn smut fungus. Canadian Journal of Botany 12:1390-1399.
Snetselaar KM, Mims CW. 1992. Sporidial fusion and infection of maize seedlings by the smut fungus Ustilago
maydis. Mycologia 84:193-203.
Snetselaar KM, Mims CW. 1994. Light and electron microscopy of Ustilago maydis hyphae in maize. Mycological
Research 98:347-355.
Snetselaar KM, Mims CW. 1993. Infection of maize stigmas by Ustilago maydis : light and electron microscopy.
Phytopathology 83:843-850.
Snetselaar KM. 1993. Microscopic Observation of Ustilago maydis Mating Interactions. Experimental Mycology
17:345-355.
Spellig T, Bolker M, Lottspeich F, Frank RW, Kahmann R. 1994. Pheromones Trigger Filamentous Growth in
Ustilago Maydis. EMBO Journal 13:1620-1627.
Spellig T, Bottin A, Kahmann R. 1996. Green fluorescent protein (GFP) as a new vital marker in the
phytopathogenic fungus Ustilago maydis. Molecular & General Genetics 252:503-509.
Steinkellner S, Lendzemo V, Langer I, Schweiger P, Khaosaad T, Toussaint JP, Vierheilig H. 2007. Flavonoids and
Strigolactones in Root Exudates as Signals in Symbiotic and Pathogenic Plant-Fungus Interactions. Molecules
12:1290-1306.
Stoll M, Begerow D, Oberwinkler F. 2005. Molecular phylogeny of Ustilago, Sporisorium, and related taxa based
on combined analyses of rDNA sequences: Cambridge Journals Online.

97

BIBLIOGRAPHIE GENERALE

Stoll M, Piepenbring M, Begerow D, Oberwinkler F. 2003. Molecular Phylogeny of Ustilago and Sporisorium
species (Basidiomycota, Ustilaginales) based on Internal Transcribed Spacer (ITS) sequences. Canadian
Journal of Botany 12:1390-1399. 81:976-984.
Takemoto D, Tanaka A, Scott B. 2007. NADPH oxidases in fungi: Diverse roles of reactive oxygen species in fungal
cellular differentiation. Fungal Genetics and Biology 44:1065-1076.
Tamasloukht MB, Sejalon-Delmas N, Kluever A, Jauneau A, Roux C, Becard G, Franken P. 2003. Root Factors
Induce Mitochondrial-Related Gene Expression and Fungal Respiration during the Developmental Switch
from Asymbiosis to Presymbiosis in the Arbuscular Mycorrhizal Fungus Gigaspora rosea. Plant Physiology
131:1468-1478.
Thuring JWJF, Nefkens GHL, Zwanenburg B. 1997. Synthesis and biological evaluation of the strigol analogue
carba-GR24. Journal of agricultural and food chemistry 45:1409-1414.
Tivoli B, Baranger A, Sivasithamparam K, Barbetti MJ. 2006. Annual Medicago: From a Model Crop Challenged by
a Spectrum of Necrotrophic Pathogens to a Model Plant to Explore the Nature of Disease Resistance. Annals
of Botany 98:1117-1128.
Uren N. 2000. Types, amounts and possible functions of compounds released into the rhizosphere by soil grown
plants. In The Rhizosphere: Biochemistry and Organic Substances at the Soil Interface, ed. R Pinton, Z
Varanini, P Nannipieri. New York: Marcel Dekker:pp.
Vnky K. 1998. A survey of the spore-ball-forming smut fungi. Mycological Research 102 Part 5:513-526.
Vnky K. 1994. European Smut Fungi. Stuttgart: Gustav Fisher Verlag.
Vierheilig H, Lerat S, Piche Y. 2003. Systemic inhibition of arbuscular mycorrhiza development by root exudates of
cuncumber plants colonized by Glomus mossae. Mycorrhiza 13:167-170.
Walker TS, Bais HP, Grotewold E, Vivanco JM. 2003a. Root Exudation and Rhizosphere Biology. Plant Physiol.
132:44-51.
Weerasuriya Y, Siame BA, Hess D, Ejeta G, Butler LG. 1993. Influence of conditions and genotype on the amount
of Striga germination stimulants exuded by roots of several host crops. Journal of agricultural and food
chemistry 41:1492-1496.
Wen K, Seguin P, St-Arnaud M, Jabaji-Hare S. 2005. Real-time Quantitative RT-PCR of Defence-Associate Gene
Transcripts of Rhizoctonia solani - Infected Bean Seedling in Response to Inoculation with a Nonpathogenic
Binucleate Rhizoctonia Isolate. Phytopathology 95:345-353.
Wenzler H, Meins F. 1987. Persistent changes in the proliferative capacity of maize leaf tissues induced by
Ustilago infection. Physiological and Molecular Plant Pathology 30:309-319.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for
phylogenetics: Academic press.
Wigchert SCM, Kuiper E, Boelhouwer GJ, Nefkens GHL, Verkleij JAC, Zwanenburg B. 1999. Dose-response of
seeds of the parasitic weeds Striga and Orobanche toward the synthetic germination stimulants GR 24 and
Nijmegen 1. Journal of agricultural and food chemistry 47:1705-1710.
Wigchert SCM, Zwanenburg B. 1999. A critical account on the inception of Striga seed germination. Journal of
agricultural and food chemistry 47:1320-1325.
Wilson JP, Bondari K. 1990. Quantitative genetic analysis of pathogenicity and virulence of Moesziomyces
penicillariae. Phytopathology 80:1173-1177.
Wilson JP. 1995. Mechanisms associated with the tr allele contributing to reduced smut susceptibility of pearl
millet. Phytopathology 85:966-969.
Yoder JI. 2001. Host-plant recognition by parasitic Scrophulariaceae. Current Opinion in Plant Biology 4:359-365.
Yoneyama K, Takeuchi Y, Ogasawara M, Konnai M, Sugimoto Y, Sassa T. 1998. Cotylenins and fusicoccins
stimulate seed germination of Striga hermonthica (Del.) Benth and Orobanche minor Smith. Journal of
agricultural and food chemistry 46:1583-1586.

98

AUTEUR : Seyed Kazem SABBAGH

TITRE : Adaptation la pntration racinaire de deux Ustilaginaceae parasites du mas :
Ustilago maydis et Sporisorium reilianum Analyse microscopique et transcriptomique
DIRECTEUR DE THESE : Pr Christophe ROUX
LIEU ET DATE DE SOUTENANCE : Salle de lIFR 40, le 17 janvier 2008

RESUME en franais
Laptitude linfection racinaire dUstilago maydis, lagent du charbon commun du mas, a
t analyse en vue dutiliser ce modle fongique biotrophe pour ltude de linfection racinaire.
Les capacits dinfection ont t analyses en tablissant un comparatif avec Sporisorium reilianum
f.sp. zeae, une espce phylogntiquement proche, responsable du charbon des inflorescences du
mas. Dans un premier chapitre, il est compar la capacit de trois espces dUstilaginaceae
produire des souches solopathognes, souches infectieuses en absence de croisement avec une
souche compatible. Une corrlation apparat entre la frquence de production de telles cellules et le
mode de dissmination : frquent chez lespce dissmine de faon arienne et rare chez lespce
tellurique. La capacit intermdiaire dUstilago maydis laisse supposer que la dissmination et
linfection ariennes ne sont pas les seuls intervenir dans ltiologie de la maladie. Un deuxime
chapitre dcrit les processus de pntration racinaire du mas par Ustilago maydis. Le troisime
chapitre prsente des arguments sur la perception par S. reilianum du GR24, analogue structural des
strigolactones. Ces composs induisent la respiration cellulaire dU. maydis et de S. reilianum. Une
analyse du transcriptome par construction dune banque SSH de S. reilianum en rponse au GR24 a
rvl une induction rapide de gnes de la respiration et du dveloppement cellulaire. Ces
molcules, dj identifies pour leur rle signaltique dans linteraction plante parasite-plante hte
et dans linteraction endomycorhizienne, pourraient ainsi avoir une incidence plus large dans
lorganisation de la flore rhizosphrique.
MOTS-CLES
Ustilago maydis Sporisorium reilianum infection racinaire biotrophiesolopathognie strigolactones respiration cellulaire
DISCIPLINE ADMINISTRATIVE : Biosciences vgtales
Spcialit : Phytopathologie Cellulaire et Molculaire
Laboratoire Surface Cellulaire et Signalisation chez les Vgtaux , UMR 5546
CNRS/Universit Paul Sabatier, Ple de Biotechnologie Vgtales, 24 chemin de Borde-Rouge,
B.P.42617 Auzeville