1999 Nature America Inc. http://biotech.nature.

com

RESEARCH

Rapid protein-folding assay using green

fluorescent protein
Geoffrey S. Waldo1*, Blake M. Standish3, Joel Berendzen2, and Thomas C. Terwilliger1
1Structural

Biology Group, MS-M888 and 2Biophysics Group, MS-P244, Los Alamos National Laboratory, Los Alamos, NM 87545. 3University of New Mexico,
Albuquerque, NM 87131. *Corresponding author (e-mail: waldo@telomere.lanl.gov).

1999 Nature America Inc. http://biotech.nature.com

Received 26 February 1999; accepted 5 May 1999

Formation of the chromophore of green fluorescent protein (GFP) depends on the correct folding of the
protein. We constructed a folding reporter vector, in which a test protein is expressed as an N-terminal
fusion with GFP. Using a test panel of 20 proteins, we demonstrated that the fluorescence of Escherichia
coli cells expressing such GFP fusions is related to the productive folding of the upstream protein
domains expressed alone. We used this fluorescent indicator of protein folding to evolve proteins that are
normally prone to aggregation during expression in E. coli into closely related proteins that fold robustly
and are fully soluble and functional. This approach to improving protein folding does not require functional assays for the protein of interest and provides a simple route to improving protein folding and expression by directed evolution.
Keywords: protein folding, solubility, reporter, aggregation directed evolution, green fluorescent protein, inclusion body

Proteins often misfold and aggregate1 when overproduced in

microorganisms2. Despite extensive work relating experimental in
vitro protein refolding with theory3, and attempts to relate protein
solubility with amino acid sequence4, no reliable method exists for
predicting when proteins will misfold in vivo. Current experimental
approaches to improve soluble expression in Escherichia coli include
fusion of the protein with a more soluble partner; coexpression of
folding catalysts and chaperones; expression at reduced temperature;
and modified growth media (reviewed in ref. 2). These approaches
do not always work, since they fail to modify the intrinsic sequencedependent folding characteristics of the protein5. Improving protein
function by directed evolution6 can enhance protein folding and stability79, but this approach is untenable for the vast number of proteins without a simple functional assay.
Our goal was to develop a reporter of protein folding that would
be thermally and chemically robust, protein-based, and genetically
encodable, and that would require no exogenous cofactors. Green
fluorescent protein (GFP) satisfies many of these criteria10. We constructed such a model folding reporter, in which the protein of interest is expressed as an N-terminal fusion with GFP. We first expressed
a variety of test proteins and assayed their solubilities by SDSPAGE.
Next, we measured the whole-cell fluorescence of E. coli cells
expressing the test proteins as GFP fusions. The results indicate that
productive folding of the downstream GFP protein domain and consequent formation of the GFP chromophore11 is directly related to
the folding robustness (avoidance of inclusion body formation and
aggregation) of the upstream protein. Finally, we demonstrated the
utility of this folding reporter in a molecular evolution scheme to isolate soluble variants of proteins that normally misfold and aggregate
when overexpressed in E. coli. This practical folding reporter gives a
signal directly proportional to the amount of correctly folded protein,
and requires no functional assay for the protein of interest or a priori
knowledge of the test protein structure or biological function.
Results
Protein solubility and whole-cell fluorescence. To test the folding
reporter, we expressed 20 different proteins from the hypertherNATURE BIOTECHNOLOGY VOL 17 JULY 1999

http://biotech.nature.com

mophilic archaeon Pyrobaculum aerophilum12, in E. coli at 37C as Nterminal GFP fusions. Because protein insolubility can result from
other factors besides misfolding on the ribosome, we focused on
cytoplasmic proteins, excluding candidates with homologies to
known membrane-bound, membrane-associated, or periplasmic
proteins. Striking gene-dependent (up to 50-fold) differences in
whole-cell GFP fluorescence (Fig. 1) could not be explained by the
total expression levels, which varied at most by 20% over the entire
set of proteins (data not shown). Instead, the fluorescence was
directly related to the fraction of the overexpressed protein found in
the supernatant of lysed cells expressing the corresponding nonfusion protein under identical conditions (Fig. 1).
The correlation between nonfusion solubility and GFP fusion
fluorescence is not perfect. For example, the solubility of protein 8
(purine-nucleoside phosphorylase) is underestimated, whereas that
of protein 9 (soluble hydrogenase) is overestimated (Fig. 1).
Nonetheless, failure of the GFP chromophore to form in the fusion
context is surprisingly well correlated with the likelihood that the
protein of interest will be aggregated when expressed without the
GFP tag. Our results are consistent with the hypothesis that the GFP
folding trajectory is sensitive to the misfolding of the fused upstream
proteins. Based on the limited data set of 20 proteins presented in
Figure 1, and assuming that GFP fluorescence is an indicator of the
correct tertiary folding of the GFP moiety11, the threshold of full solubility (implying correct folding and avoidance of aggregation) for
the test protein expressed alone occurs when the downstream GFP
domain has an approximately 90% probability of misfolding in the
fusion context.
In vitro transcription/translation. Using six additional proteins
of bacterial and vertebrate origin, we repeated the GFP fusion experiment with an in vitro protein synthesis system in which the bulk
concentration of newly synthesized polypeptides is reduced by a factor of at least 1,000 relative to their concentration in E. coli13,14. The
production of the fluorescent GFP fusion protein was initiated by
addition of the DNA template and appeared to be complete within
about 30 min at 37C. When normalized by a control expressing GFP
alone, the GFP fusion fluorescence in the in vitro system and in E.
691

 1999 Nature America Inc. http://biotech.nature.com

Fraction soluble

RESEARCH

1999 Nature America Inc. http://biotech.nature.com

Ln (Fluoroescence)
Figure 1. Solubility of proteins expressed in E. coli is highly correlated
with fluorescence of E. coli expressing corresponding GFP fusions.
Randomly selected proteins from Pyrobaculum aerophilum in order
of increasing GFP fusion fluorescence: (1) tartrate dehydratase bsubunit; (2) nucleoside-diphosphate kinase; (3) tyrosine tRNA
synthetase; (4) polysulfide reductase subunit; (5) methyltransferase;
(6) GTP cyclohydrolase I; (7) aspartate-semialdehyde dehydrogenase; (8) purine-nucleoside phosphorylase; (9) soluble
hydrogenase; (10) cysteine tRNA synthetase; (11) 3-hexulose 6phosphate synthase; (12) nirD protein; (13) C-type cytochrome
biogenesis factor; (14) phosphate cyclase; (15) hydrogenase
expression/formation protein (hypE); (16) chorismate mutase; (17)
DNA-directed RNA polymerase; (18) ribosomal protein S9p; (19)
translation initiation factor; (20) sulfite reductase (dissimilatory
subunit). GFP, soluble variant of GFP expressed alone. Dashed line
indicates threshold above which test proteins are fully soluble.

coli closely agreed (Table 1). This lack of dependence on the bulk
concentration of translated polypeptides implies that the GFP fluorescence reports folding of the fusion partner occurring cotranslationally15, or soon after translation.
Evolution of protein folding. The GFP folding reporter distinguishes proteins that fold robustly and are highly soluble when
expressed in E. coli from those that tend to misfold and aggregate.
Such a reporter system could be used in a directed evolution
process16,17 to evolve proteins that normally misfold into related ones
that fold properly. As a test of directed evolution of protein folding
we chose the mutant C33T of gene V protein18 and bullfrog H-subunit ferritin19,20. Beginning with DNA encoding the insoluble wildtype proteins, we used DNA shuffling6 to generate and recombine
mutations, and the GFP folding reporter to identify variants with
improved folding. Each protein was subjected to four rounds of forward evolution to generate soluble variants, followed by three
rounds of backcrossing6 against parental DNA to remove nonessential mutations. With each cycle of evolution, both the nonfusion solubility and GFP fusion fluorescence increased (Fig. 2).
Robustly folding ferritin variants. The rapid Fe-mineralization
phenotype of H-subunit ferritin requires at least seven key amino
acids21. Thus, the ferritin system can be used to test whether directed
evolution of protein folding can be accomplished without a loss of
function. Thirty of the ferritin clones that were most fluorescent
when expressed with the GFP reporter system were sequenced. These
comprised just three variants we designated HM-1 (N47D + Q55L +
E58R + T93P + G146E), HM-2 (N47D + E58K + E59A + T93P +
G146E), and HM-3 (K53R + Q55R + T93P + G146E). HM-3 also
contained two silent mutations at Asp120 (GAG to GAC) and at
Gln138 (CAG to CAA). These changed the codon usage without
changing the amino acid being coded. The variants HM-1 and HM692

2 each contained a substitution of Glu58, an acidic amino acid

residue involved in iron binding and ferroxidation21, by a basic
amino acid unlikely to bind iron. Aside from this substitution, none
of the seven residues directly involved in the function of ferritin were
mutated. All three evolved ferritin variants were highly fluorescent as
GFP fusions (Fig. 3A) and fully soluble when expressed as nonfusions in E. coli at 37C (Fig. 3B). These proteins were assayed for
enzymatic activity by measuring their ability to oxidize Fe(II). As
expected, HM-1 and HM-2 were nonfunctional. The third variant,
HM-3, retained most of the wild-type Fe-oxidation activity (Fig.
3C), showing that directed evolution of solubility using GFP as an
intramolecular folding reporter can generate mutants of a protein of
interest with improved folding while maintaining function.
Temperature-dependent misfolding. The four single-mutant
clones derived from HM-3 (K53R, Q55R, T93P, and G146E) were
expressed at two different temperatures in order to monitor their
folding robustness in some detail. At 27C, the wild-type ferritin
protein was only partially soluble when expressed in E. coli. In contrast, each variant protein was fully soluble (Fig. 4). At 37C, a more
stringent expression temperature and the optimum for E. coli
growth14, the wild-type ferritin aggregated and was not soluble. Two
of the variants with single point mutations (K53R and T93P)
remained relatively insoluble when expressed at this temperature,
but the other two (Q55R and G146E) were almost completely soluble (Fig. 4). These results indicate that each of the amino acid mutations that were obtained in the evolved HM-3 mutant enhanced the
solubility of the ferritin and did not simply change interactions specific to the GFP fusion context. Two additional single point mutants
incorporating the silent mutations at Asp120 (GAG to GAC) and at
Gln138 (CAG to CAA) were generated. These did not appear to
change the solubility or expression level of the nonfusion ferritin
protein, but did increase the level of GFP fusion fluorescence by
about 15% relative to the wild-type ferritinGFP fusion. We are currently investigating whether the evolved ferritin sequences, which
apparently fold better in vivo, also exhibit improved folding characteristics during in vitro refolding.
Discussion
Early events during protein expression and folding leading to thermodynamically or kinetically trapped intermediates are a major
pathway to aggregation (i.e., inclusion body formation) during protein overexpression in heterologous hosts1. These defects can often
supersede other pathways to insolubility, many of which can occur
at later times after translation and release of the polypeptide from
Table 1. GFP fusion fluorescence from
in vivo and in vitro expression
Type of Protein

E. coli cellsa

Insoluble proteins
Bullfrog H-subunit ferritin
Gene V (C33T)
XylR

0.034 0.004
0.030 0.005
0.023 0.003

0.031 0.003
0.041 0.005
0.031 0.003

Soluble proteins
Bullfrog L-subunit ferritin
Gene V (wild type)
Maltose-binding protein

0.58 0.02
0.40 0.03
0.43 0.02

0.53 0.03
0.43 0.02
0.50 0.03

Coupled transcription
and translationb

aE. coli cells: whole-cell fluorescence measured by fluorimetry (see

Experimental Protocol) expressing indicated proteins as fusions with GFP at
37C, normalized by intensity of E. coli expressing GFP alone.
bCoupled transcription and translation: Fluorescence of coupled E. coli S-30
transcription/translation reactions using circular plasmid templates, normalized by fluorescence of reaction using GFP template. Experiments were performed in triplicate. Note that the normalized fluorescence data are dimensionless.

NATURE BIOTECHNOLOGY VOL 17 JULY 1999

http://biotech.nature.com

 1999 Nature America Inc. http://biotech.nature.com

RESEARCH

A
A

1999 Nature America Inc. http://biotech.nature.com

B
C

Figure 3. GFP fusion fluorescence, nonfusion solubility, and activity of

ferritin variants. Columns marked: Wt H, wild-type H-subunit ferritin;
Wt L, wild-type L-subunit ferritin; HM-1, HM-2, HM-3, fully evolved
ferritin optima. (A) Photograph of E. coli colonies expressing GFP
fusions of ferritin variants. (B) Coomassie brilliant bluestained 12.5%
acrylamide SDSPAGE of soluble (S) and pellet (P) fractions of ferritin
variants expressed without GFP tags at 37C. Upper indicated band is
bovine serum albumin (BSA); positions of H and L wild-type ferritins
are indicated. (C) Fe activity blot assay32 of nonfusion proteins.
Sufficient wild-type H-subunit ferritin for activity assay was obtained
by expression at 27C. Otherwise, expression temperature was 37C.
Figure 2. Improved solubility of nonfusion (black bars) and GFP fusion
fluorescence (crosshatched bars) for (A) gene V (C33T) and (B)
bullfrog H-subunit ferritin during rounds of directed evolution. Rounds
14: 40 clones expressing GFP fusions were pooled and the
normalized fluorescence determined at 37C (see Experimental
Protocol). Vector DNA prepared from these pools was digested and
the insert subcloned en masse into an expression vector without the
GFP tag. Solubility of pooled nonfusion proteins expressed at 37C
(see Experimental Protocol). Evolved gene V (C33T) and H-subunit
ferritin: pools assayed as above after backcrossing three times.

the ribosome (i.e., incorrect disulfide bond formation). As the GFP

variant used here folds well when expressed alone (see Experimental
Protocol), our results imply the existence of one or more as-yetuncharacterized intermediates in the folding trajectory of the GFP,
which have the remarkable property of robustly reporting the misfolded states of upstream fused proteins.
The time interval spanning the start of translation, folding, and
chromophore formation of the GFP moiety in the fusion context is
of interest because it roughly defines the open time for trapping
upstream misfolded intermediates displayed by the fusion partner.
Misfolding intermediates, improper disulfide bonds, or other structures leading to aggregation of the upstream domain that are generated after the GFP chromophore is committed to form would escape
detection by this scheme. Estimates of the time for spontaneous
chromophore formation of newly synthesized GFP range from 30
min (this work), to 90 min (ref. 22), to as long as 4 h (ref. 23). The
variations apparently reflect contributions from translation rate,
folding mutations, and redox-mediated chromophore cyclization24.
In contrast, the half-life of the recovery of fluorescence by aciddenatured GFP with a preformed chromophore has been reported
to be approximately 24 s (ref. 25).
NATURE BIOTECHNOLOGY VOL 17 JULY 1999

http://biotech.nature.com

These observations and the results described in this work underscore the sensitivity of the GFP folding trajectory to the expression
environment. It will be interesting to see whether new GFP variants
that abolish the sensitivity of the GFP chromophore formation to
the presence of misfolded fused protein domains can be generated.
Using the accessibility of small fused domains to indicate protein
folding can yield paradoxical results26, because such domains may
be accessible or partially functional even when the fusion partner is
aggregated or misfolded. In contrast, GFP fluorescence is a robust,
direct, sensitive indicator of the productive folding of fused protein
domains. We successfully improved the folding and solubility of the
multimeric protein ferritin. Here the 24 subunit monomers associate to form the large stable protein assembly. The method worked,
even though the subunit C termini of many of the members of the
ferritin family tend to become buried during folding26. This suggests that the fluorescence of the GFP translational fusion could
provide a convenient metric for driving the evolution of other protein scaffoldings as well.
In this work, for the first time, functional and soluble variants of
a normally insoluble protein have been obtained without recourse to
functional screens for the protein of interest. Where protein function
is being modified by random mutation and functional screens are
time-consuming or difficult, our method can be used to preadapt
proteins for improved folding robustness and to screen mutants for
folding potential. GFP fluorescence can be assessed on the basis of a
single cell, so large numbers of clones (>106) can be rapidly screened
for solubility by fluorescence-activated cell sorting 27. Our demonstration that the GFP folding reporter system works both in vivo and
in vitro opens up the possibility of high-throughput genome-wide in
vitro screening of protein folding from PCR-amplified genes, facili693

 1999 Nature America Inc. http://biotech.nature.com

1999 Nature America Inc. http://biotech.nature.com

RESEARCH

Figure 4. Fraction of indicated ferritin variant that is overexpressed in

soluble form in E. coli at 37C (crosshatched bars) or 27C (black
bars). Variants are (left to right): wild-type H-subunit ferritin (Wt H);
four single point mutants derived from fully evolved optimum HM-3;
and fully evolved soluble ferritin optimum (HM-3).

tating a class-directed approach to structural proteomics28. In addition to improving protein expression, this approach should have
wide applicability to the design of novel protein structures, theoretical and empirical studies of protein folding, screening large numbers
of proteins and protein fragments for solubility, finding and modifying efficient folding partners, and even engineering hosts for
improved protein expression. The use of GFP as a sensitive fluorescent indicator of protein folding should enable the evolution of
closely related of sets of polypeptides that differ in their ability to
fold, thereby shedding new light on the folding code.
Experimental protocol
Cloning. Genes coding test proteins were amplified by conventional PCR
from plasmids available in-house (gene V and xylR), plasmids purchased
from commercial sources (maltose-binding protein, malE; Invitrogen, San
Diego, CA), or genomic DNA (P. aerophilum). Bullfrog H-subunit and Lsubunit ferritin genes were cloned from Rana catesbeiana tadpole red cells by
reverse-transcription PCR using a commercially available kit (Perkin-Elmer,
Foster City, CA) according to the manufacturers instructions. Gene V
C33(TGT)T33(ACT) was engineered using conventional PCR techniques.
Incorporating two codon changes guarded against trivial mutation to the soluble wild-type sequence (i.e., by the reversion T33C) in subsequent directedevolution experiments. Clones were isolated and sequences verified by dyeterminator sequencing. Specific ferritin mutants were engineered by overlap
PCR.
GFP folding reporter. The BglII/XhoI fragment of pET21(a+) (Novagen,
Madison, WI) was inserted into the corresponding site of pET28(a+), and the
BamHI/EcoRI site was replaced with the DNA fragment GGATCCGCTGGCTCCGCTGCTGGTTCTGGCGAATTC coding for amino acid linker
GSAGSAAGSGEF. We avoided large bulky hydrophobic residues in designing
the linker. A longer (GGGS)4 linker was also tried, and did not appear to
change the performance of the folding reporter. We chose to use the shorter
GSAGSAAGSGEF linker because it reduced the amount of homologous
repeats in the coding sequence, which could have resulted in deletions by
homologous recombination during the shuffling protocol. A soluble GFP
variant was engineered based on a variant that folds well in E. coli22 using sitedirected mutation to eliminate the internal NdeI and BamHI sites and incorporate the red-shift S65T mutation27 and the folding mutation F64L (ref. 29),
and inserted into the EcoRI/XhoI site of the vector. The NdeI/BamHI cloning
site was replaced by the frameshift stuffer with three translational stops
CATATGTGTTAACTGAGTAGGATCC, and the resulting vector digested
with NdeI and BamHI to receive inserts.
Fluorescence measurements and protein solubility. Cultures were
grown at 37C in Luria-Bertani (LB) media containing 30ml/ml kanamycin
and induced with 1 mM isopropylthiogalactoside (IPTG) at indicated temperature. Cells were diluted to OD600nm = 0.15 in 10 mM Tris, pH 7.5, 0.15
694

M NaCl (buffer A), and fluorescence was measured using a Perkin-Elmer

LS 50 B spectrofluorimeter (excitation, 490 nm; emission, 510 nm; each
with 5 nm bandwidth). Fluorescence was normalized by dividing by fluorescence of E. coli cells expressing GFP alone. Protein solubility was determined by SDSPAGE throughout30. Briefly, a 3 ml culture of cells was pelleted in a 1.5 ml Eppendorf tube and washed twice with 1 ml of buffer A.
The pellet was resuspended in 150 ml of buffer A and subjected to two
sequences of 10 pulses of sonication, using a Branson Ultrasonics
(Danbury, CT) model 450 sonicator equipped with a 1/2-inch horn and
1/8-inch tapered tip, with a minimum power setting and 80% duty cycle.
The sample was pelleted by centrifugation between the two pulse
sequences. The sonicant was centrifuged at 14,000 g for 15 min and the
supernatant fraction removed by pipetting and reserved. The remaining
pellet was washed twice with 1 ml buffer A and finally resuspended in 150
ml buffer A. A 5 ml aliquot of the sample (pellet or supernatant) was mixed
with 5 ml of SDS buffer containing dithiothreitol and heated for 15 min at
100C in an MJR PTC-200 thermocycler (heated lid). The denatured proteins were resolved by SDSPAGE using a 12.5% acrylamide homogeneous
gel (PHAST gel instrument; Amersham Pharmacia Biotech, Piscataway,
NJ), stained by Coomassie brilliant blue dye, and fixed. The gels were
scanned using a Hewlett-Packard 5P ScanJet flatbed scanner, and densitometry analyzed using NIH Image31. The total expressed protein was estimated by summing the integrated density of the soluble and insoluble
fractions DT = DS + DI. The soluble fraction was defined as SF = DS / DT,
and the insoluble fraction was defined as IF= DI / DT. The SDS sample
buffer was spiked with 2 mg/ml of bovine serum albumin (BSA) to provide
an internal density standard compensating for differences in loading volume. Before processing, all integrated sample densities were thus normalized by the BSA-integrated sample density.
Coupled transcription and translation. Plasmids were isolated from 3
ml overnight cultures using a commercially available spin-column purification kit (Qiagen, Valencia, CA). DNA concentrations were determined
spectrophotometrically at 260 nm, plasmids were diluted to 0.1 mg/ml, and
10 ml added to a 150 ml coupled transcription/translation mix (E. coli T7
S30 extract system for circular DNA, Promega (Madison, WI)) according to
the manufacturers instructions. Although the development of green fluorescence appeared complete within 30 min, the reaction was allowed to proceed for 2 h at 37C. Fluorescence was measured by spectrofluorimetry as
above. A small background resulting from the endogenous fluorescence of
the translation mix was subtracted during data analysis, and the fluorescence of each test sample was normalized by dividing by the fluorescence of
a sample translating GFP alone.
Forward evolution. Bullfrog H-subunit ferritin or gene V (C33T) PCR
amplicons were DNase-I digested and in vitro recombined as in ref. 17, with
the following modifications: Co(II) was used in place of Mn(II) as the
DNAse-I metal cofactor, Pfu(exo-) DNA polymerase (Stratagene, La Jolla,
CA) was used during forward mutation, and Pfu(exo+) DNA polymerase
was used for backcrossing for high-fidelity amplification. Reassembled
genes were cloned into the GFP fusion vector, and transformed into DH10B
by electroporation, yielding approximately 5 106 unique clones. Plasmids
isolated from the plates were transformed into BL21(DE3) (Novagen). Cells
were plated directly onto nitrocellulose membranes at a density of about
2,000 transformants/plate, grown at 37C for 912 h until approximately 1
mm diameter, then the membranes were transferred to LB+kanamycin
plates containing 1 mM IPTG, and induced for 3 h at 37C. The 40 brightest
clones were picked, maintained as individual permanents, and as pools.
DNA from these optima was used in subsequent rounds of directed evolution. A total of 10,000 clones were screened for each cycle of forward evolution. For backcrossing, amplicons derived by PCR from a plasmid isolation
of the pooled optima were combined in a 1:2 ratio with PCR amplicons of
wild-type DNA. DNase-I digest and subsequent protocols were as described
above for the forward evolution.
Fe(II) oxidation assay. Supernatant fractions of 3 ml cultures were diluted
to approximately 1 mg/ml in ferritin. The concentration of ferritin was
determined by SDS gel densitometry scan, relative to a ferritin sample of
known concentration. For ferroxidase assays, 3 ml aliquots of protein were
dotted onto a moist nitrocellulose membrane on a stack of two Whatman
3M filter paper disks soaked in 50 mM 2-[N-Morpholino]ethanesulfonic
acid, pH 6.0, 0.15 M NaCl (buffer B). The membrane with the bound ferritin
was transferred to a stack of two filters soaked in buffer B containing 0.1 mM
Fe(II), for 5 min at 30C. The reaction was quenched by washing the membrane twice in buffer B containing 5 mM EDTA to remove adventitiously
NATURE BIOTECHNOLOGY VOL 17 JULY 1999

http://biotech.nature.com

 1999 Nature America Inc. http://biotech.nature.com

RESEARCH
bound Fe(II). The Fe(III) zones were developed32. Briefly, the membrane
was treated with a solution of 1% HCl + 1% potassium ferrocyanide
(Turnbull Blue reaction) at ambient temperature (~24C) for 10 min. After
copious washing with distilled water, the Prussian blue spots were intensified by treating with 10 mM H2O2 + 10 mM diamminobenzidine in 10 mM
Tris, pH 8.0 (buffer C), for 5 min in the dark. The membrane was copiously
washed with distilled water, transferred to a Petri plate, and scanned on a
Hewlett-Packard 5P flatbed scanner while still moist.

Acknowledgments

1999 Nature America Inc. http://biotech.nature.com

We wish to thank Sorel Fitz-Gibbon and Jeffrey Miller (UCLA) for P.

aerophilum DNA, sequence data, and BLAST searches. We also thank Thomas
Peat, James Jett, Scott Peterson, Chia-Hwa Chang, and Raymond Nanni for
helpful discussions and review of the manuscript, and the NIH and LDRD program LANL for generous support.
1. King, J., Haasepettingell, C., Robinson, A.S., Speed, M. & Mitraki, A.
Thermolabile folding intermediates: inclusion-body precursors and chaperonin
substrates. FASEB J. 10, 5766 (1996).
2. Makrides, S.C. Strategies for achieving high-level expression of genes in
Escherichia-coli. Microbiol. Rev. 60, 512538 (1996).
3. Plaxco, K.W., Simons, K.T. & Baker, D. Contact order, transition-state placement
and the refolding rates of single-domain proteins. J. Mol. Biol. 277, 985994
(1998).
4. Wilkinson D.L. & Harrison R.G. Predicting the solubility of recombinant proteins
in Escherichia-coli. Bio/Technology 9, 443448 (1991).
5. Anfinsen, C.B. Principles that govern the folding of protein chains. Science 181,
223230 (1973).
6. Stemmer, W.P.C. Rapid evolution of a protein in-vitro by DNA shuffling. Nature
370, 389391 (1994).
7. Macbeath, G., Kast, P. & Hilvert, D. Redesigning enzyme topology by directed
evolution. Science 279, 19581961 (1998).
8. Martineau, P., Jones, P. & Winter, G. Expression of an antibody fragment at highlevels in the bacterial cytoplasm. J. Mol. Biol. 280, 117127 (1998).
9. Proba, K., Worn, A., Honegger, A. & Pluckthun, A. Antibody scFv fragments
without disulfide bonds made by molecular evolution. J. Mol. Biol. 275, 245253
(1998).
10. Ward, W.W. in Bioluminescence and chemiluminescence (eds DeLuca, M.A. &
McElroy, W.D.) 235242 (Academic, New York; 1981).
11. Cody, C.W., Prasher, D.C., Westler, W.M., Prendergast, F.G. & Ward, W.W.
Chemical-structure of the hexapeptide chromophore of the Aequorea green-fluorescent protein. Biochemistry 32, 12121218 (1993).
12. Fitz-Gibbon, S. et al. A fosmid-based genomic map and identification of 474
genes of the hyperthermophilic archaeon Pyrobaculum aerophilum.
Extremophiles 1, 3651 (1997).

NATURE BIOTECHNOLOGY VOL 17 JULY 1999

http://biotech.nature.com

13. Zubay, G. In vitro synthesis of protein in microbial systems. Annu. Rev. Genet. 7,
267287 (1973).
14. Neidhardt, F.C. in Escherichia coli and Salmonella typhimurium: Cellular and
Molecular Biology (ed. Neidhardt, F.C.) 36 (American Society of Microbiology,
Washington, DC; 1987).
15. Fedorov, A.N. & Baldwin, T.O. Cotranslational protein-folding. J. Biol. Chem.
272, 3271532718 (1997).
16. Arnold, F.H. Directed evolution: creating biocatalysts for the future. Chem. Eng.
Sci. 51, 50915102 (1996).
17. Zhao, H.M. & Arnold, F.H. Optimization of DNA shuffling for high-fidelity recombination. Nucleic Acids Res. 25, 13071308 (1997).
18. Terwilliger, T.C., Zabin, H.B., Horvath, M.P., Sandberg, W.S. & Schlunk, P.M. Invivo characterization of mutants of the bacteriophage-F1 gene-V protein isolated by saturation mutagenesis. J. Mol. Biol. 236, 556571 (1994).
19. Dickey, L.F. et al. Differences in the regulation of messenger-RNA for housekeeping and specialized-cell ferritin: a comparison of 3 distinct ferritin complementary DNAS, the corresponding subunits, and identification of the 1st
processed pseudogene in Amphibia. J. Biol. Chem. 262, 79017907 (1987).
20. Waldo, G.S. & Theil, E.C. in Ferritin and Iron Biomineralization. Comprehensive
Supramolecular Chemistry 5. (vol. ed. Susslick, K.) 6591 (Pergamon Press,
Elsevier Science Ltd, Oxford, UK,1996).
21. Harrison, P.M. & Arosio P. The ferritins: molecular-properties, iron storage function and cellular-regulation. Biochim. Biophys. Acta-Bioenerg. 1275, 161203
(1996).
22. Crameri, A., Whitehorn, E.A., Tate, E. & Stemmer, W.P.C. Improved green fluorescent protein by molecular evolution using DNA shuffling. Nat. Biotechnol. 14,
315319 (1996).
23. Heim, R., Prasher, D.C. & Tsien, R.Y. Wavelength mutations and posttranslational autooxidation of green fluorescent protein. Proc. Natl. Acad. Sci. USA 91,
1250112504 (1994).
24. Reid, B.G. & Flynn, G.C. Chromophore formation in green fluorescent protein.
Biochemistry 36, 67866791 (1997).
25. Makino, Y., Amada, K., Taguchi, H. & Yoshida, M. Chaperonin-mediated folding
of green fluorescent protein. J. Biol. Chem. 272, 1246812474 (1997).
26. Jappelli, R., Luzzago, A., Tataseo, P., Pernice, I. & Cesareni G. Loop mutations
can cause a substantial conformational change in the carboxy terminus of the
ferritin protein. J. Mol. Biol. 227, 532543 (1992).
27. Cormack, B.P., Valdivia, R.H. & Falkow, S. FACS-optimized mutants of the green
fluorescent protein (GFP). Gene 173, 3338 (1996).
28. Terwilliger, T.C. et al. Class-directed structure determination: foundation for a
protein structure initiative. Protein Sci. 9, 18511856 (1998).
29. Heim R., Cubitt A.B. & Tsien R.Y. Improved green fluorescence. Nature 373,
663664 (1995).
30. Zhang, Y. et al. Expression of eukaryotic proteins in soluble form in Escherichia
coli. Protein Expr. Purif. 12, 159165 (1998).
31. http://rsb.info.nih.gov/nih-image/. NIH-Image is a public domain image processing program developed at the U.S. by the National Institutes of Health.
32. Moos, T. & Mollgard, K. A sensitive post-DAB enhancement technique for
demonstration of iron in the central-nervous-system. Histochem. J. 99, 471475
(1993).

695

Copyright of Nature Biotechnology is the property of Nature Publishing Group and its content may not be
copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written
permission. However, users may print, download, or email articles for individual use.