A Practical Guide To Cellular and Molecular Research Methods in Immunology

1
TABLE OF CONTENTS
1.0 INFLAMMATION
1.1 Purification of mononuclear and polymorphonuclear cells...............4
1.2 Isolation of cells from the peritoneal cavities of mice........................8
1.3 Adherence purification of monocytes................................................9
1.4 Antibody- or C3b-dependent phagocytosis.......................................10
1.5 Activation of macrophages................................................................12
1.6 Monokine Bioassays..........................................................................14
1.6.1 Assay for IL-1 activity...........................................................14
1.6.2 Assay for IL-6 activity...........................................................17
1.6.3 Cytotoxicity assay for TNF.................................................19
1.7. Neutrophil chemotaxis assay............................................................21
1.8. FcRI-dependent activation of mast cells........................................24
2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION
2.1 Hybridoma cell culture with production of monoclonal antibodies....26
2.2 Affinity purification of IgG antibodies.................................................27
2.2.1 Avid-AL affinity chromatography..........................................27
2.2.2 Protein A-Sepharose affinity chromatography.....................29
2.3 Preparation of IgM antibodies...........................................................31
2.4 Analysis & characterization of immunoglobulins...............................33
2.4.1 Polyacrylamide gel electrophoresis of immunoglobulins.....33
2.4.2 Western blotting to detect immunoglobulins........................35
3.0 T CELL AND B CELL RESPONSES
3.1 C'-dependent depletion of CD4+ and CD8+ T Cells.........................37
3.2 MACS purification (or depletion) of CD4+ and CD8+ T Cells...........39
3.3 Assessment of T cell proliferation.....................................................41
3.4 Plaque Forming Cell (PFC) assay for IgM-producing cells...............44
3.5 ELISPOT assays for single cytokine- or Ab-producing cells.............45
3.6 ELISA assay for detection of antigen-specific antibodies.................49
3.7 In vivo assessment of T cell responses............................................51
3.8 Immunohistochemical detection of cytokines in tissues....................53
4.0 MOLECULAR ANALYSIS OF CYTOKINE mRNA EXPRESSION
4.1 Northern blotting.............................................................................55
4.1.1 Purification of cellular RNA..................................................55

4.1.2 Electrophoresis of RNA & transfer to membranes..............58
4.1.3 32P-labelled cDNA probe synthesis.....................................61
4.1.4 Pre-hybridization, hybridization, and washing.....................63
4.1.5 Detection of mRNA bands...................................................65
4.2 In Situ hybridization........................................................................67
4.2.1 Probe synthesis & purification.............................................67
4.2.2 Preparation of slides for hybridization.................................71
4.2.3 Hybridization of 35S-cRNA riboprobes to cellular mRNA....74
4.2.4 Post-hybridization washing & autoradiography...................76
4.2.5 Autoradiograph development & counter-staining................78
4.3 Semi-quantitative RT-PCR to detect cytokine mRNA..................79
4.3.1 First strand cDNA Synthesis using Oligo(dT) priming.........80
4.3.2 PCR amplification of the target cDNA.................................81
4.3.2 Detection of RT-PCR products............................................82
APPENDICES
5.1 APPENDIX A -- GENERAL METHODS...........................................83
5.1.1 Anti-sheep RBC antisera.....................................................83
5.1.2 Cell counting........................................................................83
5.1.3 C3b opsinization of yeast....................................................84
5.1.4 Cytocentrifuge preparations................................................85
5.1.5 Dialysis tubing......................................................................85
5.1.6 Fixation of tissues for ISH or IHC........................................85
5.1.7 Lung cells (single cell suspension)......................................86
5.1.8 Lysis of red blood cells........................................................86
5.1.8.1 Hypotonic lysis with H2O.......................................86
5.1.8.2 Lysis with ammonium chloride...............................86
5.1.9 Opsinization of SRBC with antibody....................................87
5.4.10 Protein assay in microtiter plates.......................................87
5.1.11 Splenocytes (single cell suspensions)..............................87
5.1.12 Splenocytes (spleen cell-conditioned medium)................88
5.1.13 Staining Protocols..............................................................89
5.1.13.1 Giemsa stains......................................................89
5.1.13.1.1 Wrights-Giemsa staining.......................89
5.1.13.1.2 Giemsa staining of tissue sections........89

5.1.13.2 Gills hematoxylin for IHC.....................................90
5.1.13.3 Toluidine blue staining (ISH counter-stain)..........90
5.1.14 Standard curves (e.g., cytokines)......................................90
5.1.15 TESPA-treatment of glass slides.......................................91
5.2 APPENDIX B -- REAGENTS & SOLUTIONS
CELLULAR IMMUNOLOGY REAGENTS....................................92
Acidified isopropanol...........................................................92
Actinomycin D.....................................................................92
Alsevers solution.................................................................92
Ammonium chloride............................................................92
Ammonium sulfate (saturated solutions)............................92
Borate-buffered saline.........................................................92
ELISPOT & ELISA Carbonate Coating buffer....................92
Isotonic Percoll Density Gradient Medium..........................93
PAGE running buffer...........................................................93
PAGE 2x sample prep buffer..............................................93
PAGE gel fix buffer..............................................................93
Phosphate-buffered saline (PBS).......................................93
Giemsa Stain......................................................................93
Giemsa Stock Solution........................................................93
0.4% Trypan Blue................................................................94
MOLECULAR BIOLOGY REAGENTS
Agarose/formaldehyde/MOPS gel (for Northerns).............94
Cesium Chloride (for isolation of total cellular RNA)..........94
DEPC-treated water (& other solutions).............................94
Dithiothreitol........................................................................94
EDTA (0.5M)........................................................................94
Guanidinium Isothiocyanate (GSCN)................................94
ISH 10x salts.......................................................................94
ISH hybridization buffer......................................................95
Northern blotting pre-hyb/hybridization solution.................95
MOPS (1 M)........................................................................95
5X MOPS Buffer.................................................................95
Phenol (salt-saturated).......................................................95
Reagents for purifying DNA from agarose gels..................96

General purpose restriction endonuclease buffers............96
RNA sample prep buffer (Northern analysis).....................96
RNA sample dye/loading buffer..........................................96
RNAse A.............................................................................96
Salmon sperm DNA............................................................96
Sodium acetate (3M)..........................................................96
20X SSC (4 liters)...............................................................97
STE buffer...........................................................................97
5.3 APPENDIX C -- TISSUE CULTURE MEDIA
Click's medium...............................................................................98
DMEM............................................................................................98
DMEM-0% FCS.............................................................................98
DMEM-10% FCS...........................................................................98
DMEM-10% normal horse serum..................................................98
HBSS (Ca++ and Mg++-free)........................................................98
MEM...............................................................................................98
RPMI 1640.....................................................................................98
RPMI-0% FCS...............................................................................98
RPMI-10% FCS.............................................................................98
5.4 APPENDIX D -- MAINTENANCE OF CELL LINES
7TD1 cells (for assay of IL-6).........................................................99
Cl.MC/C57.1 cells (C57 mast cells)...............................................99
L-929 cells (for TNF bioassay).......................................................99
LM-1 cells (for assay of IL-1).........................................................99
Pu5-1.8 cells (macrophage cell line).............................................99
5.6 APPENDIX F -- Human cytokine RT-PCR primers..........................101
5.7 APPENDIX G -- WWW Immunology sites of interest........................102
5.7 APPENDIX G -- Selected templates for 96--well plates....................103
1.0 INFLAMMATION:
In the first week of this course we will begin to acquire some of the basic skills
needed to examine several components of the inflammatory cascade, a series of
responses that are integrally intertwined with the immune system. First we will begin
to acquire some basic skills in tissue culture, and the purification of selected cells
associated with the immunoinflammatory system (i.e., peripheral blood [PBL]
monocytes and neutrophils [PMN or polymorphonuclear cells]). Then we will learn
how to identify them using morphologic criteria, and how to assess a couple of
functions associated with monocytes/macrophages - phagocytosis (a subfunction of
antibody-dependent cellular cytotoxicity) and activation-dependent monokine
production.
1.1 Purification of mononuclear and polymorphonuclear cells from mouse
peripheral blood.
While this protocol is designed specifically for the purification of cells from the
peripheral blood, such density gradient systems can also be used for other cell
systems (e.g., to purify PMN from glycogen-elicited peritoneal cavity preparations).
In general it is better to use polypropylene [p.p.] rather than polystyrene [p.s.] tubes
because polypropylene is less "sticky" for the cells and therefore activates them to a
lesser extent than polystryrene. On the other hand, polypropylene tubes are more
expensive, so this too needs to be taken into account.
Materials
BALB/c mouse
anaesthetic (methoxyfluorane)
clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s. tubes
23-25 ga needles & 1 ml syringes
pipettes/pipettors (micro- and macropipettes)
microscope slides (frosted end; & pencil for labeling)
sterile surgical tools (optional, for open body cardiac puncture)
laminar flow hood, inverted microscope, hemocytometer
Reagents
anticoagulant (heparin 1000U/ml)
DMEM with 1 U/ml heparin or with 3 mg/ml EDTA anticoagulant
DMEM-10% FCS (see Appendix A)
70% ethanol
isotonic Percoll(see Appendix C)
RBC sedimentation buffer (4.5% dextran-T500 in PBS)
cytocentrifuge
METHOD
1.
2.
Obtain blood from surgically anaesthetized (or euthanized) mouse either by

closed- or open-body cardiac puncture. Withdraw blood slowly into a 1 ml
syringe containing 100 l of heparin, being careful not to hemolyse the red
blood cells by using too much back pressure on syringe. Work fairly quickly, or
mix the blood with the anticoagulant in the syringe fairly often, so that the blood
doesn't coagulate.
Mix the blood with the RBC sedimentation buffer (1 volume sed. buffer: 1
volume blood) in the 4 ml tubes and allow the mixture to stand undisturbed on
the bench for 20 - 45' (the time can be highly variable, depending on the
species of animal) . The RBC's will form rouleaux (chains of RBC's) that will
sediment out of suspension rather rapidly, leaving you with a leukocyte/plateletrich plasma layer above the settled RBC's.
Withdraw the plasma layer and transfer to a 15 ml polypropylene tube. Add 10 12 ml of DMEM-anticoagulant to the plasma and sediment the leukocytes out of
1
3.
suspension by centrifugation (1000 rpm for 10') , . Aspirate the platelet-rich

medium, avoiding the cell pellet, and then resuspend the cells by vigorously
flicking the tube. When the cell pellet has become a 'paste' on the lower walls of
the tube, add 5 - 10 ml of tissue culture medium and then gently vortex by
hand to ensure that you have a 'single cell suspension' (i.e., no clumps of cells).
2 3
RBC do not sediment from bovine blood using this dextran sedimentation protocol. Alternately, with
bovine blood, one can either use the density gradients directly with diluted (1:1 with PBS)
anticoagulated blood, followed by RBC lysis of the red cell rich-PMN fraction, or use the buffy coat of
white blood cells from the top of sedimented whole anticoagulated whole blood and fractionate these
cells using density gradient centrifugation as noted.
This fairly low speed centrifugation step reduces the platelet contamination of the mononuclear cell
fraction of the blood. Platelets are a very rich source of a number of cytokines (including TGF) and
other potent biologically active mediators.
Alternately, the platelet-rich leukocyte-plasma can be loaded directly onto the gradients. This saves
some time in the purification procedure, but leaves the mononuclear cell fraction containing high levels
of platelets, which can be gotten rid of by a subsequent low-speed spin (i.e., 1000 rpm for 10 min, in the
clinical centrifuge)
4.
While the cells are spinning in step 3, prepare a 70% isotonic Percoll gradient
cushion by mixing together 1.75 ml isotonic Percoll and 0.75 ml of
DMEM/heparin/EDTA, in a 15 ml p.p. tube . After resuspending the cell pellet
from step 3, gently layer this suspension on top of the 70% isotonic Percoll
'cushion', so that there is no mixing of the two layers. Centrifuge the cell
gradients for 25 min at 2000 rpm (room temperature) in the clinical
centrifuge, and allow the centrifuge rotor to coast to a stop (i.e., no brake).
The completed gradient will appear much as it did before spinning, but now the
PMN and RBC will reside as a pellet at the bottom of the tube and the
mononuclear cells (monocytes and lymphocytes) will reside as a band of cells at
the interface between the tissue culture medium and the isotonic Percoll. To
harvest the mononuclear cells, simply pipette the cells directly from the
interface, trying to avoid aspirating any substantial volume of the Percoll.
Transfer the cells to a new tube and dilute any of the density gradient medium
by topping up the tube with additional medium. To harvest the PMN, carefully
aspirate the remaining Percoll solution, then resuspend the pelleted cells by
flicking the tube and then adding a large volume of medium. If the PMN are
badly contaminated with red blood cells, these can by lysed by hypotonic lysis or
ammonium chloride (see Appendix D).
4
5.
Alternately, one can use other density gradient media, such as Ficoll-Hypaque or Lymphocyte
Separation Medium (see ALTERNATE PROTOCOL), which is useful for the preparation of mononuclear
cells from an array of species. Furthermore, LSM gradients are run for only 15-25 min.
transfer WBCrich plasma to

70% percoll
20'@
2000 rpm
plasma
30' @
RT
mononuclear cells
allow RBC
to
sediment
6.
7.
8.
percoll
percoll
spin percoll
gradient
to separate
monocytes &
PMN/RBC
PMN & RBC
Wash both cell preparations (i.e., PMN and mononuclear cells) as above, and
resuspend the cells in a minimal volume (e.g., 1 ml) of medium. Remove 20 l
of each preparation for cell counting by hemocytometer and determine the cell
numbers and viabilities (see Appendix D). If the mononuclear cell fraction is
heavily contaminated with platelets, rewash at low speed (i.e., 800 rpm for 10').
Prepare cytocentrifuge slides of the cells by applying 5x10 4 cells in 100 l of

medium to each slide assembly and centrifuging them for 5 min at 1500 rpm.
Allow the sedimented cells to dry well before staining them with Giemsa solution
(see Appendix D).
If you have sufficient cells remaining, set them up in culture at a cell density of
3x106 cells/ml and challenge both the monocytes and PMN with endotoxin as in
1.1.
1.1a ALTERNATE PROTOCOL 1 (for rapid mononuclear cell gradients)

Rather than using Percoll or Ficoll-Paque gradients to separate the
mononuclear cells from the other leukocytes, one can use Lymphocyte Separation
Medium (LSM; Organon-Technika), which seems to be useful across a wide array of
species (e.g., human, bovine, equine, murine, ovine). The procedures employed are
essentially identical to those for the Percoll gradients, with the exception that the cells
are centrifuged on the gradients at 1500 rpm (i.e., 400xg) for 15 - 30 min. Thus the
spin is shorter and at a much lower speed (which may be desirable in terms of the
harshness of cellular treatment as well as in term so the times involved). The

drawback to using an abbreviated centrifugation time is that neutrophils will not
sediment to the bottom of the gradients in this time, but instead will remain
suspended in and can be recovered from the LSM rather than as a pellet at the
bottom of the tube.
Materials
all materials required for the Percoll isolation procedure (1.1)
Reagents
all reagents required for the Percoll isolation procedure (1.1)
Lymphocyte Separation Medium (LSM; Organon-Technika Inc)
METHOD
1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure (1.1).
4. Pipette 3 ml of LSM into a 15 ml p.p. conical centrifuge tube, then carefully
overlay this with either the platelet-rich leukocyte-plasma or with platelet
depleted, washed white blood cells.
5. Centrifuge the gradients for 15 - 25 min at 1500 rpm in the clinical centrifuge
(i.e., 400xg).
6. Harvest the mononuclear cells as a band from the top of the density gradient
medium, as in 1.1 - step 5, and wash them as in 1.1 - step 6.
5
1.1b ALTERNATE PROTOCOL 2 (fractionation of leukocyte sub-populations)

The individual leukocyte populations (i.e., monocytes, lymphocytes, basophils,
eosinophils and neutrophils) can be at least partially purified as discrete bands
directly from continuous density gradients. These are relatively easy to generate as
custom gradients which can be tailored for individual needs by simply changing the
low and high density "ends" of the gradient.
TABLE . Examples of useful density ranges for fractionating various cell populations
Fifteen minutes is usually adequate to fully purify the mononuclear cells from the polymorphonuclear
cells and is sufficient to sediment any contaminating red blood cells, but is is not adequate to sediment
the neutrophils in the LSM. A longer spin time (e.g., 25') is required to sediment these cells.
10
Materials
all materials required for the Percoll isolation procedure (1.1)
a continuous density gradient pouring apparatus (commercial or "home-made")
Percoll solutions of the required density
6
Reagents
all reagents required for the Percoll isolation procedure (1.1)
METHOD
1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure (1.1).
4. Pour the continuous density gradients by placing low density Percoll in the first
chamber and high density Percoll in the second chamber. The medium is best
delivered from the gradient pourer into the individual tubes using a peristaltic or
other pump -- as the high density medium empties from the second chamber
into the centrifuge tube, it is replaced and thereby diluted by low density
medium. The second chamber should be equipped with a mixer or stirrer to
ensure rapid and complete mixing of the reagents during this process. By
steadily withdrawing the delivery needle as the centrifuge tube fills, you will
generate a gradient of continuously decreasing density, with the density at the
bottom of the gradient being equal to that of the medium in chamber 2 and that
at the top of the gradient being equal to that of the medium in chamber 1.
The formula for calculating the volumes of materials needed to achieve specific densities with Percoll is:
, where
11
mixer
peristaltic
pump
centrifuge
tube
deliv ery
tubing or
needle
flow
low
density
Percoll
(chamber1)
5.
6.
7.
high
density
Percoll
(chamber 2)
w ithdraw
needle w ith
adv ancing
gradient
When the gradient formation is complete, very carefully load the peripheral
blood leukocytes to be fractionated on top of the gradients. Since the low
density medium may be of a density very similar to that of the medium in which
the cells are resuspended, great care may to be needed to avoid mixing of the
cells and gradient medium.
Run the gradients for 25 min at 2000 rpm in the clinical centrifuge, just as in
1.1, and harvest them in an analogous manner. However, what you will notice
with these gradients is that there are multiple bands, the precise number and
their locations depending on the species and immune status of the blood donor.
For example, quiescent eosinophils of humans and horses will run at a density
equivalent to about _____g/ml, while activated eosinophils are hypodense, and
will run as a discrete band at a density of about _____g/ml. Harvest each band
into a separate tube.
Wash the cells from each band using an appropriate medium for your purposes
(e.g., DMEM-10% or RPMI-10%) and count them using a hemocytometer. The
cells can be morphologically identified on stained cytocentrifuge preparations.
12
1.2 Isolation of cells from the peritoneal cavities of mice.

The serosal (abdominal or peritoneal) cavity of mice is a rich source of
macrophages which are easily purified by simply flushing the cavity and performing a
plastic adherence step (see 1.4). In this section, we will simply examine the method
for lavage of the serosal cavity.
Materials
BALB/c mouse
clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s. tubes
23-25 ga needles & 10 ml syringes
pipettes/pipettors (micropipettes and macropipettes)
sterile surgical tools (optional, for open body cardiac puncture)
laminar flow hood
inverted microscope
hemocytometer
Reagents
Ca++Mg++-free-HBSS (HBSS)
70% ethanol
cytocentrifuge
METHOD
1.
2.
3.
4.
Euthanize mouse with methoxyfluorane and cervical dislocation, and then wet
its abdomen with 70% ethanol. Fully reflect the abdominal skin dorsally and
ventrally, being careful to not tear any holes in the abdominal wall (small holes
discovered during step 2 can be clamped off using hemostats).
Using a 25 ga needle, inject 10 ml of HBSS into the peritoneal cavity, through
the abdominal wall, and then massage the distended gut to wash the serosal
cells into the HBSS.
Slowly withdraw the fluid using a 23 ga needle on a 10 ml syringe and transfer
the wash solution to a 50 ml polypropylene tube.
Repeat the wash with another 10 ml of HBSS and pool the two washings.
13
5.
Wash the cells by centrifugation and resuspend to the desired cell density, in the
desired medium. Determine the cell numbers using a hemocytometer.
14
1.3 Adherence purification of monocytes or macrophages

Monocytes or macrophages can be easily purified by taking advantage of the fact
that they adhere rapidly and tenaciously to plastic (polystyrene, but not polypropylene)
surfaces. So in this procedure, you will simply take the total mononuclear cell fraction
from PBL as well as the total peritoneal lavage population and place the cells into the
wells of multi-well microscope slides, a particularly convenient format for the experiments
we will be doing. Macrophage adherence ostensibly works much better in the absence
of protein (e.g., FCS), so this protocol will be performed using DMEM-0% FCS.
Materials/Reagents
all materials for purification of mononuclear and PMN from mouse PBL ( 1.1) or
peritoneal macrophages (1.2)
plastic petri dishes or multi-well microscope slides
DMEM-0% FCS
DMEM-10% FCS
METHOD
1.
2.
3.
4.
Resuspend the mononuclear or serosal cells at 3x10 6 cells/ml in DMEM-0%

FCS and add 300 l of the cell suspension to each well of the multiwell slide.
Incubate the cells at 37C in the CO2 incubator for 3 h.
Remove the non-adherent cells by repeatedly pipetting the culture medium
directly onto the cell monolayer that has formed on the bottom of each well. If
you are not thorough enough at this stage, large numbers of lymphocytes will
remain with the monocytes/macrophages on the plastic/glass surface. Remove
the resuspended, non-adherent cells by aspirating the medium (save the
aspirates if you want to retain the monocyte-depleted lymphocyte preparation).
Repeat this procedure as needed, monitoring the success of washing by direct
visual observation under the inverted microscope.
To remove the cells from the plastic, you can either remove the medium from the
cells and replace it with 0.02% EDTA in saline, and then transfer the dishes onto
ice for 10-15 min. By smoothly scraping the bottom of the dish with a cell
scraper, 90 - 95% of the adherent cells will be dislodged as viable cells - wash
the cells and resuspend in DMEM-10% FCS. Alternately, the cells can be
removed by treating with EDTA and trypsin (this eliminates the need for
scraping, but increases the wear and tear on the macrophage surface proteins).
15
5.
To activate the cells in situ, just add LPS to a final concentration of 1-10 g/ml.
16
1.4 Antibody- or C3b-dependent phagocytosis by macrophages

In this assay we will explore the potentials for macrophages to specifically
interact with cells that have been targeted by the humoral immune system. That is,
antibody-coated cells can be phagocytosed or otherwise killed by macrophages that
bind the target via the FcR. We will use the classical example of opsinized (i.e.,
antibody- [or C'-] coated) sheep red blood cell phagocytosis by purified PBL
monocytes. This is the basis for antibody-dependent cellular cytotoxicity (ADCC) by
immunoinflammatory cells against multiple types of cellular targets (e.g., tumour
cells, bacterial cells, etc...).
Materials
monolayers of PBL monocytes in 8-well multi-well slides ( 1.3); or use peritoneal
lavage cells from normal or proteose/peptone-injected mice
humidified 37C CO2 incubator
clinical centrifuge & tubes
sterile eppendorf tubes
Reagents
C3b-coated zymosan beads (5.4.12)
0.5% suspension of SRBC in PBS
anti-SRBC-coated SRBC (5.4.13).
normal mouse serum (heat-inactivated at 56C for 30 min)
DMEM-10% FCS
METHOD
1.
2.
Take the monocyte/macrophage monolayers, in multi-well slides out of the 37C

incubator and to pairs of the wells add either 20 l of either: the antibody-coated
SRBC, normal SRBC suspension, C3b-coated zymosan, or 'activated' zymosan
suspension. Incubate the cells/slides for 60 min at 37C.
Remove the slides from the incubator and wash the free SRBC or zymosan from
the cultures by resuspending the sedimented cells with your pipetter and
aspirating the contents. Examine the cells using the phase contrast condenser
of the inverted microscope to determine the extent to which the SRBC/zymosan
particles have been internalized by the macrophages (i.e., are very dull by
phase contrast) or remain in the extracellular compartment (i.e., are very bright
17
by phase contrast). Return the cells to the 37C incubator and periodically
check them again to follow the internalization of the particles.
0 min
Ab- or C'-opsinized
SRBC or yeast
3.
5.
60 min
(adherence to M)
1-4h
(phagocytosis)
At the end of the experiment, take the well casing from the slide itself and fix the
cells by immersion in 100% ethanol for 2 min. Allow the slides to air dry, and
stain the slides with Giemsa stain (Appendix D).
Calculate the mean numbers (+/- SEM) of SRBC or zymosan particles in the
macrophages in each treatment group. To do this, you will count the numbers
of SRBC contained within 25 macrophages in each of ten 40x microscope
fields, for each well on the slide. Perform an ANOVA test to determine the
statistical significance of your results, and plot the data (including means, SEM,
and probability values) on a graph.
18
1.5 Activation of macrophages with bacterial lipopolysaccharide

Monocytes or macrophages can be activated by the addition of many different
kinds of reagents (e.g., immune complexes, interferon-, bacterial products, etc..). In
this protocol, we will use the bacterial cell wall product lipopolysaccharide (LPS) to
activate cultures of Pu5-1.8 (Pu5) cells, a murine macrophage cell line; Pu5 cells
were one of the original lines used in the cloning of murine TNF. While we will be
using this cell line (in order to save the lives of a number of mice), precisely the same
protocol and approximately the same results would be obtained if we were to use
freshly purified monocytes or macrophages. Later in the week we will then determine
the extent to which you have activated the cells by quantifying their secretion of a
number of monokines (i.e., IL-1, IL-6, and TNF).
Materials
laminar flow hood
humidified 37C CO2 incubator
subconfluent monolayer cultures of Pu5-1.8 cells in DMEM-10% FCS
inverted microscope
sterile eppendorf tubes
cell scraper
-20C freezer & freezer bags
Reagents
bacterial endotoxin, 1 mg/ml DMEM-0% FCS (E. coli lipopolysaccharide; LPS)
METHOD
1.
2.
3.
Take a look at the growing Pu5 cells under the inverted microscope to get a
feeling of how they 'should' look under normal conditions.
Using a cell scraper, dislodge the Pu5 cells from the plastic and then transfer
them to a 50 ml centrifuge tube. Remove 20 l of the cell suspension for cell
counting with the hemocytometer.
While counting the Pu5 cells, sediment them by centrifugation (10 min at 1500
rpm in the clinical centrifuge). To resuspend them in fresh DMEM-10% FCS,
completely aspirate the supernatant from the tubes, and then very briskly and
19
repeatedly flick the tube with the cell pellet to disperse the pellet. Dispersal will
be complete when the pellet has become a paste on the walls of the tube. Add
4.
sufficient DMEM-10% FCS to bring the cells to a concentration of 3x10 6

cells/ml, and then dispense the cell suspension into the wells of 24-well plates,
at 1 ml per well. You will need 8 wells of cells (4 wells of unstimulated cells & 4
wells of stimulated cells) for todays experiment, as well as 4 wells which contain
medium but no cells (LPS-medium controls)
Add LPS (to a final concentration of 10 g/ml) to the 4 'stimulated cells' wells
and to the 4 'LPS-medium control' wells, and an equivalent amount of DMEM to
the 4 wells of unstimulated Pu5 cells. Return the cultures to the 37C CO 2
incubator.
5.
6.
7.
Label the eppendorf tubes with your initials, the date, and the sample
information (e.g., Pu5 supn't. + [or -] LPS; 1 [or 6, or 24] h). In addition to the
supernatants from the cell cultures, save several aliquots of the DMEM-10%
FCS that was used for the cultures (as medium controls)
At 1, 6, and 24 h post-challenge, examine the cells to get a feeling for whether
the LPS has affected them in any visible manner. At each time, also harvest the
culture medium from the appropriate wells, centrifuge them for a few minutes at
full speed in the microfuge, and then aliquot each one into four eppendorf tubes
(200 l/tube). Store all aliquots in the -20 freezer (long-term storage requires a
-80 freezer).
At the end of the experiment, place all of the plasticware & cells in the
contaminated-discard pan.
20
1.6 Monokine Bioassays:

1.6.1 Assay for IL-1 activity
In this assay, we will depend on the property of LM-1 cells (a sub-clone of the
ATCC cell line D10.G4) to proliferate in the presence of IL-1. While D10.G4 cells, like
thymocytes, proliferate in response to IL-1 in the presence of sub-mitogenic doses of
PHA or ConA, LM-1 cells do not need the PHA or ConA to respond to IL-1. Before
the assay, the cells are rendered more sensitive to IL-1 by starving them of this
cytokine for 5-7 days. The cell proliferation will be measured by examining the
abilities of the cells in each well of the 96-well plates to take up and reduce the dye
MTT to an insoluble blue-black formazan precipitate within their mitochondria. Thus
the assays measures the mitochondrial activity of the cells, not the numbers of cells.
While this is a very convenient parameter, it carries with it some problems, such as
the influence agents that affect mitochondrial activity can have on the results.
Materials
humidified CO2 incubator
96-well tissue culture plates
micropipetters, tips
multi-channel pipetter
clinical centrifuge, tubes 15 ml
15 ml centrifuge tubes
hemocytometer
ELISA plate reader (with a 595 nm wavelength filter)
Reagents
LM-1 cells which have not been fed fresh IL-1-containing medium for 5-7 days, and
which were washed and held overnight in Click's-10% FCS without conditioned
medium (i.e., IL-1-starved LM-1 cells)
Click's-10% FCS without conditioned medium (Click's-10% FCS-CM -)
recombinant mouse IL-1 (our present stock soln is at a concentration of 7.5 ng/l)
MTT, (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide), 5 mg/ml in PBS
(stable for 2-3 wks at 4C)
acidified isopropanol (see Appendix C)
21
METHOD
1.
Starve the LM-1 cells 4-7 days before assay (feed them fresh conditioned
medium some 4-7 days before the assay, and then do not feed them again).
The night before the assay, wash the cells in fresh Click's-10% FCS-CM - and
leave them in culture overnight.
2.
On the day of the assay, resuspend the LM-1 cells to 4X10 5 cells/ml in Click's10% FCS-CM- and dispense into the 96-well plates at 100 l/well, using a
template pattern similar to the one depicted.
1
10 11 12
A
B
C
D
E
F
standards
(pg/ml)
0.5 5.0
50
plate blank (A1-H1)

500
cytokine standards (4 doses)

test samples (10/plate)
medium control
'plate-effect' blank w ells
G
H
-Do not add any cells to the first column (i.e., wells A1, B1, ..., H1) of each plate,
but do add all other reagents (e.g., Click's without IL-1) -- this will be the
plate blank.
-Do not use the outer wells of the plate for any samples (there is an 'edge-effect'
of the plates), but add DMEM-0% FCS to these wells.
-Always include a medium-only control (i.e., the same medium as that used for
the experimental treatments, but which has not been exposed to the
experimental cells). Use the same volume of experimental medium as that
used in the test samples wells -- if you have multiple doses of test samples,
use equivalent multiple doses of medium controls.
-In this format, one plate will accept 10 experimental samples, each done in
quadruplicate.
3.
Add 80 l of Click's-10% FCS-CM-, and 20 l of appropriately diluted rmIL-1

standard (like all samples and standards, in quadruplicate sets of wells) to a
series of wells to achieve final doses of 0.5, 5.0, 50 and 500 pg/ml (see
Appendix D, Generation of standard curves).
22
4.
In parallel sets of quadruplicate wells, run samples (LPS-stimulated Pu5 cell

culture supernatants) and medium controls (DMEM-10% FCS + 10 g/ml LPS)
at required volumes (usually 5-20 l/well). Bring the final volume of each well to
200 l with Click's-10% FCS-CM-, and return the cells to the 37C humidified
CO2 incubator for 3 - 5 days.
5.
To measure the extent of the IL-1-driven LM-1 cell proliferation in each well, use
the micropipetter to add 20 l of MTT stock solution (5 mg/ml) to each well, and
then return the plates to the humidified 37C CO 2 incubator for 1 - 2 h.
6.
(Optional: centrifuge the plates for 10 min at 1500 rpm to sediment cells.)
Carefully remove 150 l of medium from each well in the plate, and add 100 l
of acidified isopropanol to each well. Agitate the plates on the ELISA plate
shaker for 3 minutes, and then read the plates on the ELISA plate reader, set
at a reading wavelength of 595 nm. Download the data to a 3-1/2" Macintoshformatted floppy disc.
Use the Microplate manager program to crunch your data, and Statview+ to
perform the statistical analyses. Plot your results as a bar graph (+/- SEM)
using the Cricket III program provided.
7.
23
1.6.2 Assay for IL-6 activity

Like the IL-1 assay, the IL-6 assay depends on the fact that 7TD1 cells
proliferate strongly in response to low concentrations of IL-6. Again, we will measure
this response using the MTT dye method.
Materials
hemocytometer
Reagents
7TD1 cells in RPMI-10% FCS supplemented with rhIL-6 (80 pg/ml)
RPMI-10% FCS (see Appendix B)
recombinant human IL-6 (rhIL-6; our stock solution is at 100 ng/ml)
MTT (5 mg/ml in PBS)
acidified isopropanol
METHOD
1.
Wash the 7TD1 cells two times in RPMI-10% FCS, and resuspend to a
concentration of 2.5x104 cells/ml in RPMI-10% FCS.
2.
Add 100 l of cells to each well in plate, using the same or a similar sample
plate format to that indicated in 1.5.1 (IL-1 assay).
Add cytokine standards (2.5, 25, 250 & 2500 pg/ml final concentration) in 20 l
of RPMI-10% FCS, and add your samples and experimental medium controls in
appropriate volumes. In this assay, we will use 1.0, 2.0, and 5.0 l of the LPSstimulated Pu5 cell culture supernatants, so you will need three sets of 'medium
controls', each containing 1.0, 2.0 or 5.0 l of DMEM-10% FCS supplemented
with 10 g/ml of LPS.
Return the plates to the 37C CO2 incubator for 3 days.
3.
4.
24
5.
6.
7.
After 3 days, add 20 ul of MTT solution (5 mg/ml) to each well (including plate
blank wells), and return plates to the incubator for 1-2 hr. When the
mitochondria in each of the cells are plainly visible at 40x magnification,
centrifuge the plates and remove 150 l of medium from each well. Add 100 l
of acidified isopropanol (lysis buffer) to each well, vortex vigorously in the ELISA
plate shaker for 3 min, and then leave the plates on your bench overnight.
The next morning, read the plates at 595 nm wavelength on the ELISA plate
reader and download the data to a 3-1/2" Macintosh-formatted floppy disc.
Use the Microplate manager program to crunch your data, and Statview to
perform the statistical analyses. Plot your results as a bar graph (+/- SEM)
using the Cricket III program provided.
25
1.6.3 Cytotoxicity assay for TNF bioactivity

TNF activity is usually detected using a cytotoxicity assay. L929 cells (or
at least many of its sub-lines) are sensitive to TNF such that this cytokine kills the
cells over 18 h. However, the cytotoxic effects of this cytokine are markedly
diminished by the presence of other proteins (e.g., FCS), so that as much as
possible, the assay should be run the absence of other proteins. Finally, L929 cells
are most sensitive to the effects of TNF when the assay is run in the presence of a
low levels of a transcription inhibitor (e.g., actinomycin D).
Materials
hemocytometer
Reagents
L-929 cells in DMEM-10% normal horse serum (NHS).
DMEM-0% NHS
recombinant murine TNF standards (diluted as in Appendix D)
Actinomycin-D (stock 5 mg/ml in 95% ethanol)
MTT (5 mg/ml PBS)
Acidified isopropanol (lysis buffer)
METHOD
1.
On the day before the assay, harvest L929 cells from a flask by trypsinization
(remove DMEM-10 % NHS medium and add DMEM-0% NHS medium. Add 4
- 5 drops of 1% trypsin/10 ml of medium and allow the typsin to digest the cells
off of the plastic. This process can be expedited by watching the cells and,
when they are beginning to lift well, but many still remain attached, forcefully
slapping the flask down on your thigh. All cells will be dislodged
instantaneously.
26
2.
Wash the dislodged cells in DMEM-10% NHS medium, resuspend them to
3.
4.
The next day, just prior to running the assay, remove all of the serum-containing
medium from the wells by inverting the plate and vigorously flicking it. Add 180
l of DMEM-0% NHS containing 2.5 g/ml of actinomycin D (i.e., a 2000-fold
dilution of the stock Act D).
Add TNF standards (0.04, 0.4, 4.0 and 40 units/well), control medium, and
5.
experimental samples (LPS-stimulated Pu5 cell supernatants & controls) to their

appropriate wells, each in a 20 l total volume, so that the total well volumes
equal 200 l.
Return plate to the 37C CO2 incubator overnight.
6.
7.
8.
4.5x105 cells/ml, and dispense 70 l to each well of a 96-well plate (for plate
format, see 1.5.1; IL-1 assay). Return plate to the 37C CO 2 incubator.
The next day, examine the cells under the inverted microscope to get a feeling
for the relative levels of L929 cell death in each well. Add 20 l of MTT (5 mg/ml
PBS) to each well (including plate blank wells), and again return the plates to the
incubator.
After 45 - 60', re-examine the cells to confirm that adequate levels of MTT
conversion to formazan dye have occurred in the mitochondria (see 1.5.1, IL-1
assay) and then remove 150 l of medium from each well in the plate and
replace it with 100 l of acidified isopropanol.
Vortex the plates on an ELISA plate shaker to solubilize the formazan dye, and
read the plates on the ELISA plate reader at 595 nm wavelength. Calculate the
cytotoxicity in each of the wells using the formula:
percent cytotoxicity =
mean OD590 medium control wells - OD590 experimental well x 100
mean OD590 medium control wells
9.
Calculate the mean (+/- SEM) cytotoxicities for the standards and each
treatment group, express them in terms of units (+/- SEM) of TNF activity (a unit
of TNF activity is that amount of cytokine required to kill 50% of the cells in the
assay) and graph your results. Perform a statistical analysis to confirm that your
results are meaningful.
27
1.7. Neutrophil chemotaxis assay

Neutrophils are attracted in large numbers into inflammatory foci (e.g., loci
of C' cascade activation, bacterial infections), where they are important to the
clearance of bacteria or other insults both by virtue of their abilities to
phagocytose the offenders, as well as through their toxic secretory products.
These cells have receptors for an array of chemoattractants, including bacterial
products (e.g., formyl-methionyl-leucyl-phenylalanine; fMLP), complement split
products (e.g., C3a, C5a), and an array of chemokines (e.g., IL-8 or CINC in
rodents). For this exercise, we will purify neutrophils from the peripheral blood
of mice as in 1.1, then use these cells to study the chemoattractant activities of
fMLP and C3a/C5a (i.e., zymosan-activated serum;5.4.11 ), as represented in
zymosan-activated sera (i.e., C3a, C5a)..
Materials
microchemotaxis chamber (NeuroProbe Inc)
PVP-free (PVPF) polycarbonate cell migration filters (5 m pore size; Millipore or
NeuroProbe)
purified peripheral blood granulocytes
Reagents
DMEM-0% FCS media
Ca/Mg--HBSS
f-met-leu-phe bacterial tripeptide
zymosan-activated serum ( 5.4.11)
interleukin 8 (or CINC)
METHOD
1.
2.
Generate a neutrophil-rich population from the peripheral blood, using dextran

sedimentation (or if your experiments require purified cells, percoll-purified
neutrophils), adjusting the population to a final concentration of 2x10 6 cells/ml of

HBSS.
Prepare the chemoattactants for use in the assay, allowing approximately 30 l
of each chemoattractant dilution. Dilute the zymosan-activated serum (ZAS) to
28
final concentrations of 1:10, 1:100; 1:1000, and 1:10000; the fMLP to final
3.
4.
5.
6.
7.
8.
concentrations of 10-6, 10-7, 10-8, 10-9, and 10-10 M; and the recombinant IL-8
to concentrations ranging from 50 pg/ml to 1000 ng/ml. Putative
chemoattractant-containing biological samples should be diluted to 1:10, 1:20,
1:40, 1:80 and 1:160, as first estimates with unknowns.
To the bottom chamber of each well (samples should be run in duplicate, if not
quadruplicate) add sufficient chemoattractant to completely fill the wells (do not
overfill them, as interwell smearing of chemoattractant may occur when placing
the polycarbonate membrane is step 4 -- a very slight convex surface to the
sample is ideal).
Place the PVPF-free Nucleopore membrane (shiny side up) on top of the wells,
being careful not to smear the chemoattractants between wells. (PVPcontaining membranes will not retain cells that migrate completely through the
pores in the assay, allowing them to drop off the membranes into the bottom
chambers after completely traversing the porous membranes - thus, a complete
assessment of the chemotactic response with these membranes would require
enumerating the cells associated with the membranes, as well as those in the
lower chambers.)
Place the plastic gasket on top of the membrane, and the top half of the
apparatus on top of the gasket and firmly screw the lug-nuts down, such the a
tight seal is created in each well.
Add 50 l of the responder cell population to each well, being careful to not
generate air bubbles which will create an air-lock on top of the membranes (and
thereby exclude cells from the membranes). Put the tip of your pipette just at
the surface of the Nucleopore membrane, without contacting it, and quickly
expel the 50 l of chemoattractant - with a bit of practice, this will become easy
for you.
Place the chambers in a plastic dish containing damp paper towels in the 37C
CO2 incubator, allowing 90 min for the neutrophils to respond to the
chemoattractants. Eosinophils also respond in this time frame (i.e., 90 min)
while monocytes and lymphocytes will call for 2.5-4 hr incubation times to
respond.
Upon completion of the incubation period, disassemble the apparatus and
carefully clamp the ends of the membrane with "bull-dog" or other suitable
clamps, then remove the cells which settled onto the upper surface of the
29
membranes in each well by scraping the upper surface across a scraper (e.g., a
fairly sharp-edged glass microscope slide clamped into a ring-stand clamp).
9. Allow the membrane to air-dry, then stain with a suitable staining solution (e.g.,
Diff-Quick). After air-drying again, the membranes can be dipped in xylene to
"clear" them and mounted in "Permount" or other mounting medium on glass
slides. Mount the membranes with the bottom side of the membranes uppermost, so that the cells which have migrated completely through the membranes
are most apparent. The nuclei of the cells that are still within the membrane
pores will be visible as dark blue or purple shapes within the otherwise clear-tolight purple pores.
10. Count the cells with have migrated completely through the membranes, as well
as those within the pores
30
1.8. FcRI-dependent activation of mast cells

Mast cells are found in increased numbers at the host's interface with its
environment (e.g., skin, airways, intestinal tract) and seem to subserve a number of
obvious functions (e.g., allergen-reactivity), but also perhaps some less obvious
ones. For this class, we will take advantage of the fact that they produce very high
levels of some cytokines and use them as a positive control for some of our
experiments. Cl.MC/C57.1 cells produce higher levels of IL-4 than purified, fully
differentiated Th2 lymphocytes, and higher levels of TNF than LPS-stimulated
macrophages.
Mast cells can be activated by cross-linking (i.e., bridging) adjacent FcRbound IgE molecules on the cell surface, so in these experiments we will sensitize
some Cl.MC/C57.1 cells with a monoclonal IgE anti-DNP antibody, and then
challenge with DNP-conjugated human serum albumin (DNP 30-40HSA). The 2 hour
7
supernatants from these cells will contain abundant TNF, and the cells will contain
very high levels of TNF mRNA.
Materials
T75 flasks
hemocytometer
polypropylene 4 ml culture tubes
Reagents
DMEM-10% FCS media
Cl.MC/C57.1 cells in DMEM-10% FCS.
MAb IgE anti-DNP (ascites fluid; use at 1:3000 for Cl.MC/C57.1 cells).
DNP30-40HSA(stock solution, 1 mg/ml; use at 50 to 100 ng/ml).
Expression of the FcRI is inducible in mast cells, and this is at least in part regulated the
concentrations of exogenous IgE, such that in the presence of high concentrations of IgE, mast cells
express more IgE receptors. Thus, freshly purified tissue mast cells, which will likely have the vast
majority of their existing FcRI occupied by IgE antibodies of irrelevant specificities, can be best
sensitized with IgE of the desired specificity by incubating the cells overnight in high concentrations of
the antibody.
31
METHOD
1.
2.
3.
Obtain some Cl.MC/C57.1 cells and adjust the cell concentration to 3 X 10 6

cells/ml. You will only need 0.5 ml of mast cell supernatant/time point, so set
up 3 ml of cells (i.e., 9x106 cells in 3 ml).

Add MAb IgE anti-DNP to the tube of C57 cells to a final IgE dilution of 1:3000,
and incubate the cells for 30 - 60' at room temperature in order to saturate the
cells' high affinity IgE receptors.
Wash the cells two times with DMEM-10% FCS and resuspend them again at
3x106 cells/ml. Bring the cells to 37C by placing them in a water bath. Add
DNP30-40HSA to the cells to a final concentration of 10 ng/ml and place the
tubes upright and lightly capped in the 37C CO2 incubator for 15 - 20 min to
allow them to gas (i.e., exchange CO2 into the tube). After this, cap the tubes
4.
tightly and lay them on their side in the incubator (or use a slowly moving rotator
at 37C).
At each of the indicated times after allergen challenge (i.e., 0.5, 1, 2, and 4 h),
remove a tube of cells from the CO2 incubator and sediment the cells by
centrifugation (8-10' @ 1500 rpm), and then aliquot the supernatants into
labelled eppendorf tubes (100 l/tube). Freeze the aliquots at -20C (or -80C for
longer term storage). The cells can be either discarded (as in our first
Cl.MC/C57.1 experiment), fixed (e.g., for our in situ hybridization experiments),
or processed for total cellular RNA extraction (e.g., our Northern analysis
experiments).
32
2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION:

In the second week of the course, we will grow up anti-mouse CD4 and antimouse CD8 monoclonal antibody-producing hybridoma cell lines, purify the IgG
antibodies from the anti-CD4 cell culture supernatants by affinity chromatography,
and analyse the purified antibodies and total culture supernatants by polyacrylamide
gel electrophoresis and Western blotting. We will then functionally characterize the
antibodies by using them for negative selection of CD4 and CD8 cells from mouse
splenocyte populations. We will follow the success of depleting each of these
populations using two-colour fluorescence activated cell sorter (FACS) analysis of the
spleen cells.
2.1 Hybridoma cell culture with production of monoclonal antibodies

Materials
T75 tissue culture flasks
clinical centrifuge and 50 ml polypropylene tubes
Reagents
GK1.5 (anti-CD4) and TIB 211 (anti-CD8) hybridoma cells
RPMI-10% FCS
METHOD
1.
Set up two T75 (i.e., 75 cm2) tissue culture flasks, one each for the TIB 211 and
GK1.5 cells. Start each flask as a 40 ml culture, at a cell density of 10 5 cells/ml

of RPMI-5% FCS medium.
2. Allow the cells to continue growing until the medium has gone completely yellow
(acidic) and the cells have essentially all died (about 5 - 7 days; terminal cultures).
3. Collect the supernatant from each flask and centrifuge it for 15 min at 12,000 rpm
in the RC-5B superspeed centrifuge to sediment all particulate matter.
4.
Aliquot the supernatants and either process expeditiously or store at -20C or
-80C (for longer-term storage).
33
2.2 Affinity purification of IgG antibodies

2.2.1 Avid-AL affinity chromatography
AVID-AL is a popular new matrix with a natural affinity for IgG from a wide
array of species, including rat. Thus, we will use it to purify the rat anti-mouse CD4
IgG antibodies from the GK1.5 hybridoma supernatants. Briefly, we will pour minicolumns of the Avid-AL matrix and run the hybridoma supernatants over the
columns, thereby binding the IgG antibodies to the matrix. Following a washing step
to remove the non-specifically bound proteins, we will elute the IgG using a low pH
buffer, neutralize the eluate, dialyse it against PBS and concentrate it if necessary.
Materials
AVID-AL IgG affinity column matrix
10 ml polyprep column, or 5-10 ml syringe and glass wool
dialysis tubing
centrifugal concentrators (e.g., Centricon tubes)
Reagents
AVID-CHROM Ig pure kit for purification of IgG
-column binding buffer (>1M proprietary salt)
-neutral elution buffer (1M Tris [pH 7.4], 20% glycerol)
-regeneration buffer (buffered methanol)
GK1.5 (anti-CD4 hybridoma) cells in RPMI-10% FCS
PBS
METHOD
1.
2.
Collect the supernatant from a 4 day culture of GK1.5 cells (see 2.1) and
centrifuge it for 15 min at 2,500 rpm in clinical centrifuge to sediment all particulate
matter, and then filter the supernatant through a 0.45 m filter. pH the supernatant
to 7.2 - 7.4.
Set up the affinity matrix column by pipetting 1.5 ml of a 50% matrix slurry into a
15 ml centrifuge tube and add 10 ml of regeneration buffer (methanol). Shake
the tube vigorously to disperse the matrix and then sediment the matrix by
34
3.
4.
5.
6.
centrifugation. Resuspend the matrix in 5 ml of binding buffer and pour this into
a polyprep column. Wash the column with 10 ml of binding buffer.
Dilute the hybridoma culture supernatant fluid with 2 volumes of binding buffer (to
bring the final salt concentration to 500 mM), and then run the supernatant
through the affinity column matrix several times to saturate the IgG binding
capacity of the matrix.
Wash the matrix with 15 - 20 ml of binding buffer, or until the phenol red from the
culture supernatant fluid has leached from the matrix (it will turn from a brown to
the lime-green colour).
Elute the IgG from the column by running 4 - 5 ml of the neutral elution buffer (1 M
Tris [pH 7.5], 20% glycerol) through the column, collecting the eluate into one tube.
Regenerate the column with 10 ml of regeneration buffer, and store in either
binding salt (very short term storage; salts will precipitate with long term storage)
or PBS (for longer term storage).
Dialyse the elute IgG overnight against three changes of PBS (1 liter ea.). After
dialysis, determine the protein concentration of the eluted IgG solution using a
Coomassie Brilliant Blue (AKA Bio-Rad or Bradford) protein assay (Appendix D)
and, if necessary, concentrate the eluted protein using a centrifugal concentrator.
35
2.2.2 Protein A-Sepharose affinity chromatography

Protein A from Staphylococcus aureus (Cowan strain) is a molecule with a very
high affinity for IgG antibodies, and has been used for several decades as the
protein of choice to purify these antibodies. We will use recombinant protein A
bound to dextran beads (Sephadex-G50), but in the past people have used the
bacteria themselves (fixed, of course) as affinity matrices for this purpose. In
general, IgG1 antibodies will only bind to protein A at pH 8.0, while IgG2a and
other IgGs will do so a more physiological pH (i.e., pH 7.2) as well as pH 8.0.
The elution pH optima of IgG from the protein A columns is isotype-specific, with
IgG1 elution being best performed at pH 6.5, IgG2a at pH 4.5, and IgG3 at pH
3.0 (the least hostile or acidic elution conditions available should be employed to
prevent acidic hydrolysis of the antibodies)
Materials
protein A-Sepharose (Pharmacia, or Sigma)
10 ml polyprep column, or 5-10 ml syringe and glass wool
spectrophotometer or UV monitor (equipped for reading OD 260)
dialysis tubing
Reagents
0.1 M citric acid (pH 4.5)
supernatant from a terminal culture of GK1.5 (rat IgG2a anti-CD4 hybridoma) cells
PBS (pH 7.2)
PBS/20% ethanol
1M Tris (pH 9.0)
METHOD
1.
2.
3.
4.
Filter the GK1.5 culture supernatant through a 0.45 m filter and pH it to 7.2 - 7.4.
Pipette 1 ml of the protein A-Sepharose 50% matrix slurry into the column and
wash it with several column volumes of PBS.
Run the GK1.5 culture supernatant through the column matrix several times to
saturate the IgG binding capacity of the protein A.
Wash the column with PBS until no more protein elutes from the column, using a
spectrophotometer or UV monitor (OD 260) to confirm the end-point.
36
5.
6.
7.
8.
Elute the IgG from the column by running 10 ml of the 0.1 M citric acid elution
buffer through the column, collecting the eluate into one milliliter fractions (i.e., 1
ml/tube). In order to minimize the time that the antibodies remain in an acidic
environment, we will elute the column directly into 1 M Tris buffer (pH 9.0).
Determine the protein contents of the eluted fractions by either determining the
OD260 of the fractions, or by use of a protein assay (e.g., Coomassie Brilliant Blue
[a.k.a. Bio-Rad, Bradford or CBB] protein assay; Appendix D), and pool the
protein-containing fractions.
Regenerate the column with 10 ml of PBS, and store the matrix in PBS/20%
ethanol.
Dialyse the eluted IgG overnight against three changes of PBS (1 liter ea.). After
dialysis, determine the protein concentration of the eluted IgG solution using a
and, if necessary, concentrate the eluted protein using a centrifugal concentrator.
37
2.3 Preparation of IgM antibodies

IgM antibodies do not adhere well to most of the available immunoglobulin
affinity matrices (e.g., protein A, T gel, Avid-Chrom), so alternate methods must
be employed to prepare IgM antibodies. A number of methods are available,
with the simplest true purification probably being achieved by size exclusion
chromatography (IgM pentamers have a molecular mass of 750 kD, while IgG
and albumin have molecular masses of 150 & 65 kD, respectively). In this
session, we will simply enrich for IgM antibodies by differentially "salting out" the
IgM protein with ammonium sulfate. High concentrations of ammonium sulfate
will cause the proteins in a solution to differentially precipitate out from their
solubilized state - at 30% ammonium sulfate saturation, most of the IgM
antibodies will precipitate out of solution, while at 45% saturation most of the
IgG isotypes and the residual IgM antibodies will precipitate out of solution.
Materials
beaker and stir bar
dialysis tubing
0.45 m filters
pH meter and pH reagents
stir plate
syringe and 20 ga needle
Reagents
culture medium from a terminal culture of TIB211 (IgM anti-CD8) hybridoma cells
saturated ammonium sulfate solution
borate-buffered saline
Method
1.
2.
As with the IgG purification, generate a 4-day TIB211 hybridoma culture

supernatant, sediment the particulate matter by centrifugation, then filter and pH
the supernatants as in 2.2.
Place the supernatant in a beaker on a stir plate and drip saturated ammonium
sulfate into the supernatant, while constantly stirring, to a final ammonium
sulfate concentration of 30% (i.e., 0.5 volumes of ammonium sulfate into 1
38
3.
4.
5.
volume of antibody). Use a syringe and 20-23 ga. needle (as required) to drip
the ammonium sulfate into the antibody culture supernatant, drop-by-drop.
After the 30% ammonium sulfate has precipitated the available proteins in the
hybridoma supernatants, allow the stirring to continue for an additional 30 min,
then sediment the precipitate by centrifugation (15 min at 2500 rpm).
Return the supernatant to the beaker and continue dripping ammonium sulfate
into the supernatant to a final ammonium sulfate concentration of 45%, and then
sediment that as in step 3.
Dissolve the precipitated proteins in borate-buffered saline, dialyse overnight
versus an excess of borate-buffered saline, determine the protein concentration
using a CBB assay and aliquot and freeze.
39
2.4 Analysis & characterization of immunoglobulins

In this section, we will take the anti-CD4 IgG that you have purified, as well as the
TIB211 anti-CD8 IgM antibodies and characterize them according to their size
(molecular mass) and reactivity with anti-IgG and -IgM antibodies. We will use
polyacrylamide gel electrophoresis (PAGE) for the former, and Western blotting for
the latter.
2.4.1 Polyacrylamide gel electrophoresis of immunoglobulins
PAGE is a powerful technique for confirming the presence of proteins in
solutions, although it is lacks the specificity of Western blots in identifying the proteins
(beyond their molecular weights). However, it is an ideal method to confirm the
homogeneity or lack thereof of purified proteins.
Materials
PAGE mini-gel apparatus and power pack
Reagents
Commercial acrylamide/bisacrylamide solution (40% acryl/0.8% bisacryl)
Commercial separating and stacking gel buffers
ammonium persulfate 10% solution (freshly prepared)
isobutyl alcohol (H2O-saturated)
PAGE 2x sample prep buffer (for denaturing & reducing the samples)
PAGE 5x SDS/run buffer (dilute 1:5 with H2O before use)
PAGE gel fix solution (25% isopropanol, 10% acetic acid)
rapid Coomassie blue stain (0.006% Coomassie Brilliant Blue G-250 in 10% glacial acetic acid)
protein samples
biotinylated molecular weight markers (for Western blots)
unstained molecular weight markers (for protein staining gels)
METHOD
1.
2.
Clean the glass plates and gaskets, and assemble the PAGE apparatus. Place
a mark on the glass at the 6 cm mark (from the bottom).
Mix together in a side-arm flask, 3.9 ml of the acrylamide/bisacrylamide solution,
3.75 ml of the separating gel buffer, and 7.2 ml of H 2O. Degas the solution
under vacuum for 10 - 15 min. Add 150 l of ammonium persulfate, and mix
40
once again by swirling gently, and pour the acrylamide separating gel mixture
into the PAGE apparatus up to the 6 cm mark, and then overlay the mixture with
H2O-saturated isobutyl alcohol. Allow the PAGE gel reagents to polymerize,
3.
4.
5.
and then pour off the alcohol overlay and rinse the top of the gel with water.
In another side-arm flask, mix together 0.5 ml of the acrylamide/bisacrylamide
solution, 4.5 ml of the stacking gel buffer, and degas the solution under vacuum
for 10 - 15 min. Add 25 l of ammonium persulfate, and mix once again by
swirling gently, and pipette this solution on top of the polymerized separation
gel. Immediately place the well-forming comb in place, with the teeth
submersed in the stacking gel solution. Allow the stacking gel to polymerize,
and then remove the comb from the top of the stacking gel.
Attach the gels/plates to the electrode frame and seal the seams with agarose.
Place this assembly into the PAGE run reservoir and fill the reservoir and top of
the gel assembly with PAGE run buffer.
Prepare samples for the PAGE run while the stacking gel is polymerizing. To do
so, mix the protein sample 1:1 with sample prep buffer in an eppendorf tube
and place in a boiling water bath for 5 min . Remember to run the appropriate
molecular weight markers , . Pulse microfuge the tubes to sediment samples
and hold on ice until running them on the gels. Carefully pipette each sample
into a well of the gel.
Run the gel at 150 volts until the bromophenol blue dye front reaches the bottom
of the gel. Turn off the power, disassemble the PAGE gel apparatus.
Incubate the gel for 10 - 15 min in isopropanol fix solution, stain it in the rapid
Coomassie brilliant blue for 2 h to overnight at room temp, and then destain in
several changes of 10% glacial acetic acid over 5-8 h.
8
10
11
12
6.
7.
8
9
10
11
12
For non-reducing conditions, the sample prep buffer does not contain 2-mercaptoethanol, while for
reducing condtions, the buffer should contain 10% 2-mercaptoethanol.
Load the proteins such that individual protein bands should contain 1-2 g of protein. For complex
mixtures of proteins, you will need to run greater amounts of protein in order to visualize the multiple
bands in the samples. Thus, for protein A-purified IgG, you could run only 1-2 g, while for ammonium
sulfate precipitated IgM-containing culture supernatants, you would need to run perhaps 20 g of
protein.
Unstained molecular weight markers from Gibco/BRL will contain 1g of each marker protein per l
of solution, so that loading 5 l of marker mix will give you 5 g of each band in the mixture.
For Western blots which are to be probed with an avidin-alkaline phosphatase detection system, load
1.5 l of marker mix/lane (i.e., a 1:20 final dilution of the mix).
The wells of the gels will be able to hold 30 l of sample/sample prep buffer
41
8.
For permanent storage, the gel can be dried down using a commercially
available drying apparatus.
2.4.2 Western blotting to detect immunoglobulins

In Western blotting, proteins that have been fractionated on PAGE gels are
electrophoretically transferred to nitrocellulose or other types of membranes (e.g.,
derivatized nylon), to which they may differentially bind, and then the protein bands
on the membranes are visualized immunochemically, using alkaline phosphatase- or
horse radish peroxidase-labelled antibodies and appropriate chromogens. Western
blotting is a very sensitive method of detecting proteins to which antibodies already
exist.
Materials
Western blotting transfer apparatus (wet)
Whatman #1 filter paper
nitrocellulose transfer membrane (do not handle with bare hands)
Reagents
PAGE gel with separated proteins to be transferred (unfixed)
Western blotting transfer buffer
TTBS (Tris-buffered saline with 0.1% Tween 20)
TTBS-5% Carnation skim milk powder
PBST (PBS with 0.05% Tween 20)
bromo-chloryl-indoyl phosphate/nitroblue tetrazolium (BCIP/NBT) substrate
streptavidin-alkaline phosphatase conjugate (strep-AP; diluted 1:5000 in PBST)
METHOD
1.
2.
Equilibrate the gel after electrophoresis to Western blot transfer buffer by

incubation for 45 min. Also equilibrate a sheet of nitrocellulose (cut to the
same size as the half the gel to be used for Western blotting) to the same buffer.
Transfer the gel to the gel blotting bracket, such that the gel is sandwiched
immediately next to the nitrocellulose (with no air bubbles between the two) and
both are sandwiched between two sheets of filter paper, with two 'brillo' pads
flanking the filter paper. This arrangement of gel, nitrocellulose membrane and
42
pads (depicted below) is clamped between the Western blotting electrodes such
that the gels is on the negative electrode side and the nitrocellulose is on the
positive electrode side (the proteins will be negatively charged due to the SDS in
the PAGE sample prep buffer).
'brillo' pads
negative
electrode
Whatman #1 filter
paper
PAGE gel
nitrocellulose
ASSEMBLED
TRANSFER
ASSEMBY
3.
4.
5.
6.
7.
8.
positive electrode
Set the gel assembly in the gel apparatus, fill it with transfer buffer and then
move the whole apparatus to the cold room. Run the transfer at 100 volts for 23 h (IgM may migrate through the nitrocellulose membrane in 3 h).
Disassemble the transfer assembly and stain the gel as in 2.4.1.
Transfer the nitrocellulose membrane into a large weigh boat containing 15 ml of
TTBS-5% Carnation skim milk powder for 2 h to overnight to block the non-specific
binding of other proteins to the nitrocellulose membrane.
Wash the membrane two times for 5 min each with PBST and place the blot into 15
ml PBST containing biotinylated rabbit anti-rat IgG and IgM (1:1500 final dilution)
for 60 min at room temperature.
Wash the blot three times 5 min in PBST and place the blot in 15 ml of PBST
containing a 1:5000 final dilution of streptavidin-alkaline phosphatase conjugate for
90 min at room temperature.
Wash the blot three times 15 min in H2O, and then transfer into 15 ml of freshlyprepared TMS -BCIP/NBT mixture. (To prepare the BCIP-NBT substrate: to 5 ml
of 0.1 M Tris (pH 9.5), 0.1 M NaCl, 0.05 M MgCl 2, add 22 l BCIP; mix by inverting
then add 16.5 l NBT and again mix). Incubate for 30 - 40 min until the bands
become well-defined, and then wash the blot with H 2O and air dry.
9.
Plot the relative migration distances of each of the molecular weight marker
proteins on a graph, and use the plot and the migration distances of the bands
43
in the IgG and IgM lanes to interpolate the relative molecular weights of the
proteins detected, and thereby confirm their identities.
44
3.0 T CELL AND B CELL RESPONSES:

3.1 C'-dependent depletion of CD4+ and CD8+ T Cells
In this exercise, we will learn how to deplete selected populations of cells from a
heterogeneous mixture of cell types. Specifically, we will use anti-CD4 or anti-CD8
antibodies and C'-dependent cytotoxicity to deplete all of the CD4+ or CD8+ cells,
respectively, in a single cell suspension of mouse splenocytes. We will confirm this
depletion by using commercially available fluorescein-labelled anti-CD4 and
phycoerythrin-labelled anti-CD8 antibodies to stain the residual cell populations and
then we will analyse the composite phenotype of these cells using two-colour FACS
(fluorescence-activated cell sorter) techniques.
Materials
single cell suspension of mouse splenocytes (at 1x10 7 cells/ml; Appendix D)

clinical centrifuge and 4, 15 and 50 ml polypropylene tubes
Reagents
GK1.5 (anti-CD4 hybridoma) cell supernatants (from a 2-4 day culture)
TIB211 (anti-CD8 hybridoma) cell supernatants (from a 2-4 day culture)
purified GK1.5 IgG antibodies
purified HB121 IgG antibodies (control IgG; specificity: mouse IgG1 anti-human IgE)
fluorescein-labelled anti-mouse CD4 IgG antibodies
phycoerythrin-labelled anti-mouse CD8 IgG antibodies
Low-tox rabbit C' (Cedar Lane)
METHOD
1.
Label and set up a series of tubes to receive reagents as follows:

LABEL
CELLS
ANTIBODY (g/ml)
COMPLEMENT (l)
no Ab, no C'
100
0; medium only
HB 121 (control)
100
10
100
GK1.5 supn't
100
10
100
GK1.5 IgG
100
10
100
100
1.0
100
100
0.1
100
45
TIB211 supn't
100
10
100
TIB211 IgM (30% AS)
100
10
100
100
1.0
100
100
0.1
100
100
10
100
100
1.0
100
100
0.1
100
TIB211 IgM (45% AS)
2.
3.
4.
5.
6.
Add 100 l of the splenocyte suspension (i.e., 10 6 cells) and 100 l of

appropriately diluted antibody (10, 1.0 or 0.1 g protein from the HB121, GK1.5, or
TIB211 preparations) to each tube. Incubate the cells with the antibody for 30 min
at room temperature.
Add 100 l of the guinea pig complement to each tube, and incubate the tubes at
37C for 30 min. Wash the cells two times with DMEM-10% FCS (8 min at 1500
rpm in the clinical centrifuge).
Resuspend the cells to 100 l in DMEM-10% FCS, and add 3 l of FITC-labelled
anti-CD4 and 3 l of PE-labelled anti-CD8 IgG to each tube and incubate the cells
on ice for 30 min.
Wash the cells once more with an excess of DMEM-10% FCS and resuspend to
100 l with DMEM-10% FCS. Add 100 l of 1% paraformaldehyde and fix the cells
on ice for 30 min, then wash the cells one time with PBS and resuspend to 100 l
with PBS.
Store the cells in the refrigerator overnight, for FACS analysis the next day.
46
3.2 MACS purification (or depletion) of CD4 + and CD8+ T Cells

In this complementary exercise, we will learn how to use antibody-coated
paramagnetic beads that are specific for the isotypes of the anti-CD4 and anti-CD8
antibodies that you generated in 2.1 to purify all of the CD4 + or CD8+ cells,
respectively, from a single cell suspension of mouse splenocytes. The real advantage
of this system is that the selected populations are not killed or otherwise damaged by
the isolation procedure, so that it may be possible to use them for functional studies
after the purification procedure -- this is what we do in our lab to purify mast cells from
tissues. The potential disadvantage is that in some cases the cell surface marker
employed may well, by itself, activate or otherwise alter the physiology of the cells (e.g.,
anti-CD3 antibodies may activate T cells). We will confirm our depletion by using
commercially available fluorescein-labelled anti-CD4 and phycoerythrin-labelled antiCD8 antibodies to stain the residual cell populations and then we will analyse the
composite phenotype of these cells using two-colour FACS (fluorescence-activated cell
sorter) techniques.
Materials
single cell suspension of mouse splenocytes (at 1x10 7 cells/ml; Appendix D)

clinical centrifuge and 4, 15 and 50 ml polypropylene tubes
Mini-MACS separation column (type MS; capacity 10 7 positive cells/column)
Mini-MACS column magnet (Miltenyi Biotec Gmbh)
Reagents
GK1.5 (anti-CD4 hybridoma) cell supernatants, purified IgG (2.1)
TIB211 (anti-CD8 hybridoma) cell supernatants, ammonium sulfate ppt. IgM (2.1)
PBS (pH 7.2), containing 5% FCS & 2 mM EDTA (PBS/EDTA)
mouse anti-rat IgG-conjugated paramagnetic beads (Miltenyi Biotec)
mouse anti-rat IgM-conjugated paramagnetic beads (Miltenyi Biotec)
fluorescein-labelled anti-mouse CD4 IgG antibodies
phycoerythrin-labelled anti-mouse CD8 IgG antibodies
METHOD
1.
Label and set up a series of tubes to receive reagents as follows:
47
2.
3.
4.
Add 1 ml of the splenocyte suspension (i.e., 10 7 cells) and 250 l of appropriately

diluted antibody (HB121, GK1.5, or TIB211; i.e., 25 g) to each tube. Incubate the
cells with the antibody for 30 min at room temperature.
Wash the cells one time with DMEM-10% FCS (8 min at 1500 rpm in the clinical
centrifuge) and resuspend to 300 l of PBS/EDTA.
While the cells are washing, also wash the Mini-MACS column, flushing it through
with the PBS/EDTA . If air bubbles are present in the column, it may be necessary
to back-flush the columns to get rid of the air bubbles. Mount the column in the
magnetic holder in preparation for the separation in step 7 below.
Add 25 l of the anti-IgG paramagnetic beads to the GK1.5 tube from step 2 (i.e.,
1:40 beads:cells), 25 l of the anti-IgM beads to the TIB211 tube, and 25 l of
13
5.
6.
7.
8.
9.
8.
13
each to the no antibody and HB121 tubes, and incubate for 30 min at 6-12C (icewater bath).
Wash the cells in PBS/EDTA, resuspending them to 300 l PBS/EDTA.
Apply the washed cells to the column (in the magnetic holder), and collect the flow
through, then wash the column two times with an additional 1 ml (each time) of
PBS/EDTA, collecting the flow-through each time. Pool the flow through cells,
which comprise the marker depleted populations, and wash and count them.
Remove the column from the magnet, clamping it to a ring stand, and flush the
bound cells out of the column with 2 ml of PBS/EDTA, using the column plunger to
assist in this operation, and collecting the eluted cells in a sterile tube..
Wash and count under the hemocytometer the retained cell populations. You will
use these counts to compare with those obtained by FACS analysis of the total
spleen populations (no Ab treatments).
Stain the unselected populations from step 6 with the FITC-anti-CD4 and PE-antiCD8 antibodies at in 3.1, and fix with paraformaldehyde for FACS analysis the
next day.
The first 10-20 drop to elute from this wash step will appear quite cloudy (due to elution of matrix
residue). You should continue washing at least until the cloudiness of the eluting buffer diminishes to
background.
48
3.3 Assessment of T cell proliferation (Blast assay)

One of the basic tests in immunology is that of confirming that T cells are
responding to antigens as they should, or determining the precise levels at which
these cells respond to antigens (specific immunoreactivity of the cells) or mitogens
(overall responsiveness of the T cells). Traditionally, immunologists set up the target
T cell population (e.g., PBL mononuclear cells, lymph node or spleen cells) in tissue
culture, challenged the cells with the antigen of interest and then measured the
proliferation of the T cells three days later by ascertaining their uptake of a
radiolabelled DNA precursor (e.g., the nucleotide 3H-thymidine). This is a very
sensitive assay, but it calls for the use of equipment and facilities specialized for use
in handling radioisotopes. More recently, many labs have been using the MTT assay,
performed exactly as outlined above for the LM-1 (IL-1 ASSAY) and 7TD1 (IL-6
ASSAY) cell proliferation assays, to accomplish the same goal.
In this assay, we will examine the overall responsiveness of splenic T cells
from BALB/c mice, by challenging the splenocytes with the T cell mitogen
concanavalin A (Con A). In order to optimize the system however, we will need to
determine the optimal concentrations of spleen cells needed for the assay, as well as
the optimal doses of Con A required to induce proliferation. As with most immune
responses, too much or too little of either can be inhibitory to the responses we wish
to examine.
Materials
hemocytometer
Reagents
BALB/c mouse splenocytes (5x10 7 nucleated cells/ml) in DMEM-10% FCS

DMEM-10% FCS media
49
Concanavalin A (our stock is a 4 mg/ml solution in DMEM)

MTT 5 mg/ml in PBS)
acidified isopropanol
METHOD
1.
In one 96-well plate, set up both cell number-response and Con A doseresponse curves using the plate format indicated below, and the volumes
indicated in the table.
1
10 11 12
A
B
C
cell number-response
(cells x10 6 well)
ConA dose-response
(g ConA/ml)
cell numbers titration
medium control
F
G
H
CELL NUMBERS TITRATION
ConA DOSE-RESPONSE CURVE
[CELL]
(x106/well)
medium
cells
ConA
[ConA]
medium
cells
ConA
(l)
(l)
(l)
(g/well)
(l)
(l)
(l)
0.1
178
20
0.1
130
50
20
0.25
175
20
0.25
130
50
20
0.5
170
10
20
0.5
130
50
20
1.0
160
20
20
1.0
130
50
20
2.5
130
50
20
2.5
130
50
20
5.0
80
100
20
130
50
20
7.5
30
150
20
10
130
50
20
For the cell numbers titration portion of the experiment, use a ConA
concentration of 2.5 g/ml. For the ConA dose-response curve, use a
splenocyte concentration of 2.5x10 6 cells/well. Add sufficient DMEM-10% FCS
50
2.
3.
4.
5.
to each well to bring the well volumes to 180 l, and then add 20 l of
appropriately diluted ConA to each well (i.e., total well volume of 200 l).
Place the plates in the 37C CO2 incubator for three days.
At the end of the three days, examine the cells in each well to get a feeling for
how the cells have responded to the ConA (strong ConA mitogenic responses
will have induced cell clumping). Next, add 20 l of MTT solution (5 mg/ml) to
each well and return the plates to the incubator for 45 - 90 min.
Remove 150 l of medium from each well, taking care not to also aspirate cells
from the bottom of the wells. Add 100 l of acidified isopropanol to each well
and place on the ELISA plate shaker for 3 - 4 min, and then read the plate at
595 nm wavelength on the ELISA plate reader.
Calculate the mean OD595 (+/- SEM) for each treatment group, perform the
statistical analyses and plot your data using bar graphs.
51
513.4 Plaque Forming Cell (PFC) assay for IgM-producing cells

Materials
sheep red blood cells (SRBC; 2x108/ml), washed in PBS

20% (v/v) SRBC in PBS/10%FCS
syringes & 27 or 30 ga needles
mice
PFC assay chambers
methoxyfluorane (anaesthetic)
14
Reagents
PBS
H20 & 10x HBSS for hypotonic lysis of spleen RBC
guinea pig serum diluted 1:2 in PBS/10% FCS
Method
1.
2.
3.
4.
14
Inject 0.2 ml of the SRBC suspension (i.e., 4x10 7 cells) either intravenously or
intraperitoneally into 8-10 week old mice.
Euthanize the mice after 4 days if they were immunized intravenously (or after 5
days if they were vaccinated intraperitoneally), and generate single cell
suspensions from their spleens. Lyse the residual splenic red blood cells by
hypotonic or ammonium chloride lysis (5.4.8) and bring the nucleated cells to a
final concentration of 5x10 6 cells/ml
To a series of labelled eppendorf tubes, add either 0, 30, 60, or 120 l of the
splenocyte suspension, 30 l of the 20% SRBC suspension (i.e., in PBS/10%
FCS), 30 l of diluted guinea pig serum and 240, 210, 180, or 120 l of RPMI10%, as appropriate to bring the final volume of each tube to 300 l, and
thoroughly mix the contents of each tube.
Load 80 l of the mixture into each assay slide chamber (see diagram below) and
seal each with wax.
As an estimate of the numbers of SRBC available from the peripheral blood of a sheep, 1 ml of
heparin-anticoagulated peripheral blood can yield 1x1010 red blood cells after 5-6 washes with PBS
52
low er to appose
against bottom slide
microscope slide (2)
double-sided
tape gaskets (3)
assembled double-chamber apparatus
5.
6.
splenocyte-SRBC mixture
Incubate the chambers for 1 - 1.5 h at 37C.

Remove the chambers from the incubator and count the numbers of plaques of red
blood cell lysis under the microscope.
53
3.5 ELISPOT assays for single cytokine- or Ab-producing cells

A very powerful method to assess the abilities of animals to produce antibodies
(Ab) or cytokines in response to antigenic stimulation is the ELISPOT assay. This
procedure is used to detect the abilities of individual B or T (or other) cells to secrete
their products. We will assess the abilities of splenocytes from BALB/c mice that have
been immunized with ovalbumin-alum to produce ovalbumin-specific antibodies of
varying isotypes or those of these mice or SRBC-vaccinated mice to produce IL-4 or
IFN- in response to antigenic challenge in vitro. Thus, we will in effect by phenotyping
the CD4+ T cell responses (i.e., Th1 or Th2) of the mice to these immunogens.
Materials
splenocyte suspensions from mice vaccinated with:
- ovalbumin/alum (i.p.: on dy 1 and dy 14; harvest cells on dy 21)
- SRBC (i.v.: dy 1, 200 l of 0.1% SRBC; dy 14, 200 l of 1% SRBC)
pipettes/pipettors
clinical centrifuge, 15 ml tubes
96-well ELISPOT plate
Reagents
anti-mouse IL-4 and anti-mouse IFN capture antibodies (1 g/ml coating buffer stock)
bromo-chloryl-indoyl phosphate/nitroblue tetrazolium (BCIP/NBT) substrate
biotinylated anti-mouse IL-4 and anti-mouse IFN antibodies (detection antibodies)
DMEM-10% FCS
ELISPOT blocking solution (DMEM-10% FCS)
ELISPOT coating buffer (carbonate/bicarbonate, pH 9.4)
Lymphocyte separation medium
ovalbumin (5 g/ml coating buffer stock solution)
streptavidin-alkaline phosphatase conjugate (strep-AP; diluted 1:5000 in PBST)
METHOD
1.
Precoat each of the ELISPOT plates with capture antibodies or antigen (this can
be done several days in advance). To do this, to each well of the plate, add the
purified anti-IL-4 or anti-IFN antibodies in ELISPOT coating buffer at a
concentration of 1 g/ml or the ovalbumin at a concentration of 5 g/ml. Cover
and seal the plates with parafilm and incubate overnight at 4C.
54
A
anti-OVA IgG1, IgG2a, IgM, IgE antibody ELISPOT
1
A
1x10e6,
no Ag,
G1,G2a,M
B
C
D
F
1x10e6 c ells
with Ag,
no biotin Ab
con't
1x10e6,
with Ag,
G1,G2a,M,E
no cells,
with Ag,
G1,G2a,M
E
G
1x10e5,
with Ag,
G1,G2a,M
no a-IL-4
10 11 12
con't
no IFNg
no c ells
no secondary
no cells
5x10e5,
with Ag,
G1,G2a,M
anti-IFNg,
no secondary no Ag,
1,5,10x10e5
anti-IL-4,
no Ag,
1,5,10x10e5 no bloc king
(OVA) anti-IL-4, -IFNg ELISPOT
B
OVA mice
1 2
12
anti-SRBC mice
4 5 6 7 8
9 10 11
no secondary no cells
A anti-IL-4,
anti-IL-4
no secondary
B + ovalbumin, anti-IL-4,
1,5,10x10e5
1,5,10x10e5, anti-IFNg,
C
D
E
F
G
H
+SRBC
1,5,10x10e5,
no SRBC
anti-IFNg,
anti-IFNg
+ ovalbumin anti-IL-4,
1,5,10x10e5
1,5,10x10e5,
anti-IFNg,
no SRBC
1,5,10x10e5,
no anti-IL-4
+SRBC
no blocking
no cells
no anti-IFNg
anti-SRBC mice
55
2.
3.
4.
5.
The next morning, remove the capture antibody from the wells by inverting the
plate and sharply flicking it. Rinse out each well with 200 l of blocking solution by
pipetting the solution up and down several times with a multichannel pipetter (do
not touch the bottom of the well with the pipette tips!). Remove the blocking
solution, rinse as above and add 100 l of fresh blocking solution to each well.
Incubate the plates at 37C for a minimum of 1 hour (or until the cells from the next
step are ready).
Generate a single cell suspension from the spleens of an OVA- and SRBC-
sensitized mice, and resuspend the cells to 1x10 7 cells/ml DMEM-10% FCS.
Remove the ELISPOT plate from the incubator and dump out the blocking solution.
Add 100l of spleen cells and 100 l of antigen (ovalbumin @ 2.5 g/ml or SRBC
@ 1.0% suspension) to each well, and incubate the plates at 37 C for 8 hours.
Do not to disturb the plates while they are incubating, so that each cell secretes all
of its cytokine/antibody in only one location.
After 8 h, remove the cells from the plate by first agitating the plates on the ELISA
plate shaker for 3 min, and then inverting them and vigorously flicking the
contents from the wells. Continue washing the wells with 200 l of PBST --
6.
vigorously pipette the contents up and down, but do not touch the bottom of the
wells, and flick the PBST out as above. Remove the excess PBST by banging the
plate upside down on paper towels. Repeat this wash procedure 6 times.
Add 100 l of biotinylated anti-cytokine or anti-isotype antibody (diluted to 1 g/ml
7.
in PBST) to each well, and incubate the plates overnight at 4C.

Wash the plates 5 times with PBST as in step 6, add 100 l of diluted strep-AP to
8.
9.
each well, and incubate the plates for 1.5 h at room temperature.
Wash the plates 10 times by repeatedly dunking the plate in a large beaker of
distilled-deionized H2O, each time removing all of the H2O from each well as
above (i.e., flicking and banging on paper towels). Careful washing is important,
for it will reduce the assay background substantially.
Add 100 l of freshly prepared BCIP/NBT substrate to each well. (To 5 ml of 0.1 M
Tris (pH 9.5), 0.1 M NaCl, 0.05 M MgCl2, add 22 l BCIP, mix by inverting and then
add 16.5 l NBT and again mix; for smaller volumes, use 3.75 ml buffer, 16.5 l
BCIP & 12.37 l NBT).

10. Incubate the plates at room temperature in the dark until spots develop or the plate
background begins to increase (approximately 30-45 minutes).
56
11. To stop the reaction, flick out the substrate and wash the plates 3 times in H 2O by
the dunking method. Allow them to dry overnight (with the lids off), as the
background fades dramatically when the plates dry.
12. Count the spots under low magnification under the dissecting scope, or using an
image analyser
57
3.6 ELISA ASSAYS (Enzyme-linked Immunosorbent Assay)

The ELISA assay is a powerful method for the detection of specific antigens (be
they from pathogens or those specific for antibodies or cytokines). It can detect many
antigens with a sensitivity of 1 pg/ml, although for many others sensitivities of 100-200
pg/ml are difficult to achieve. There is very little difference between the ELISPOT and
ELISA assays - the ELISPOT detects cytokine or antibody production in situ by viable
cells while the ELISA detects proteins which are present in a soluble form in biological
fluids. The former assay is performed in nitrocellulose paper-lined 96-well plates and
utilizes a precipitating indicator dye (so that individual cell traces are detected), while the
latter is performed in high protein-binding plastic 96-well plates and employs soluble
indicator dyes. While the ELISPOT tells you how many cells are secreting the antigen
being detected, the ELISA will quantify the product precisely.
3.6.1 ELISA assay for detection of antigen-specific antibodies

In the antigen-specific antibody ELISA, the wells are coated with the non-antigenspecific immunoglobulin standards or the antigen in question, the latter should capture
the antigen-specific antibodies from the samples. and then blocked. Subsequently, the
wells are blocked with a protein solution that is not recognized by the capture antigen or
standards (e.g., DMEM-10% FCS or 1% bovine serum albumin), and then the biological
samples are applied. The captured antigen-specific antibodies are then detected
precisely as are the cytokines/antibodies in the ELISPOT assay (3.5)
Materials
Immulon-4 ELISA plates
pipettes/pipettors
Reagents
experimental sera or other putative antibody source (e.g., from ova-vaccinated mice)
ovalbumin for capture of antigen-specific antibodies
IgG1, IgG2a, and IgE standards (commercial or appropriate hybridoma supn't )
15
15
ATCC MAb # (mouse IgG1 anti-human IL-8), ATCC MAb # HB121 (mouse IgG2a anti-human IgE) and
ATCC MAb (mouse IgE anti-DNP) ascites fluids work well for the antibody ELISA standards, using ascites
fluid dilutions ranging from 1:50 > 1:1,000,000. Alternately, one can use high antibody value reference
sera generated by vaccinated of mice with the antigen of interest. For example, BALB/c mice produce a
58
biotinylated IgG1, IgG2a, and IgE detection antibodies

ELISA carbonate coating buffer
DMEM-10% FCS
streptavidin-allkaline phosphatase (SA-AP) or SA-horse radish peroxidase (SA-HRP)
3 mM p-nitrophenyl phosphate (in 0.05 M Na2CO3/0.05 mM MgCl2; substrate for SA-
16
AP)
2-2'-azino-di[3-ethyl-benzthiazoline sulfonate (6)] with H 2O2 (ABTS;
1 component substrate for SA-HRP)
1% sodium dodecyl sulfate (SDS; optional stop solution for reactions)
METHOD
1.
2.
3.
4.
Coat the wells of the Immunolon-4 plates with the antigen to be used for antibody
capture (ovalbumin @ 5 g/ml in carbonate coating buffer) or with the diluted
antibody standards, as appropriate. Add 100 l per well, then cover the plate(s)
and incubate overnight at 4C.
Wash the wells 2 times with PBST. To do this, one can either use a squirt bottle of
PBST or a multichannel pipettor to fill each of the wells and allow to stand for 30 60 seconds, then turn the plate upside down and flick the wash fluid into a sink,
then fairly forcefully hit the plate upside down on a stack of paper towels to remove
the excess fluid from each well. Block the plates by adding 200 l of DMEM-10%
FCS to each well and incubate, covered, at room temperature for 2 hours.
Wash the wells 2 times with PBST as in step 2, and to the ovalbumin-coated
sample wells add 100 l of the samples (diluted 1:50 in DMEM-10% FCS) to
each well. Add 200 l of PBST to the antibody standard wells. Cover the plate and
incubate overnight at 4 C.
Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig isotype
very strong IgE and IgG1 response following intraperitoneal vaccination (dy 0) and boosting (dy 14) with 5
g of ovalbumin conjugated to 1 mg of alum. Sera or plasma from these mice can be used as reference
standards.
16
In our hands, the streptavidin-horse radish peroxidase/ ABTS enzyme/substrate combination gives
vastly superior results to those obtained with the SA-AP/p-nitrophenyl phosphate enzyme/substrate
system although, in all honesty, we have not "played" with the latter system sufficiently to suggest that it
could not yield equivalent results under the correct circumstances.
59
antibodies to 0.5 - 2.5 g/ml in PBST (the optimal concentration will need to be
determined empirically), and add 100 l of each per well, as appropriate for each
sample or standard. Cover and incubate at room temperature for 90 min.
5. Wash the wells 8 - 10 times with PBST, and add 100 l of either SA-HRP (1:5000
in PBST) or SA-AP (1:5000 in PBST) to each well. Incubate at room temperature
for 90 min.
6. Wash the plates 8 - 10 times with distilled H2O by the dunking method, making
sure to remove the excess fluid as above. Add 100 l of the ABTS substrate (SAHRP avidin-enzyme conjugate only) or freshly prepared 3 mMp-nitrophenyl
phosphate substrate (SA-AP avidin-enzyme conjugate only) to each well, then
place the plates in a dark location (e.g., a drawer works well) and allow the
reactions to develop for 20 - 45 min at room temperature. The plates can be read
directly at this point, or stop solution may be added to reduce plate to plate
variability when reading multiple plates. For the ABTS substrate, the stop the
reactions by adding 100 l of 1% sodium dodecyl sulfate (SDS) to each well.
Read the plates using the ELISA plate reader, set at a reading wavelength of 405
nm.
17
7.
17
If the optical densities of the standards or samples does not come up to a useable level within this 45
min time frame, the plates can be left longer (e.g., several hours or even overnight with particularly weak
samples). However, during this time, it is possible that the standards could become overdeveloped,
making calibration of the results difficult or impossible.
60
3.6.2 ELISA assay for detection of cytokines

Rather than using antigen as the capturing agent, the cytokine ELISA depends
on using a cytokine-specific antibody which does not recognize the same cytokine
epitope as the biotinylated detection antibody. Thus, monoclonal antibody (MAb) pairs
are required and are available routinely from many commercial sources. Alternately,
you can use a monoclonal in conjunction with a polyclonal anti-cytokine antisera.
However, care must be taken to ensure than the antibodies/antisera employed will only
recognize the cytokine of interest and that they will not inappropriately bind to
immunoglobulin or other assay reagents and thereby give "false-positive" results.
Materials
Immulon-4 ELISA plates
pipettes/pipettors
experimental samples for cytokine assay
Reagents
cytokine capture and biotinylated detection antibody pairs
ELISA carbonate coating buffer
DMEM-10% FCS
SA-horse radish peroxidase (SA-HRP)
2-2'-azino-di[3-ethyl-benzthiazoline sulfonate (6)] with H 2O2 (ABTS;
1 component substrate for SA-HRP)
1% sodium dodecyl sulfate (SDS; optional stop solution for reactions)
METHOD
1. Dilute the capture antibody of each pair to 0.5 - 2.5 g/ml in coating buffer, as
2.
3.
empirically determined, and add 100 l to the appropriate wells of the ELISA plate.
Cover the plate and incubate overnight at 4C.
Wash the wells 2 times with PBST, as above (3.6.1, step 2), and block the plate
by adding 200 l of DMEM-10% FCS to each well and incubate, covered, at room
temperature for 2 hours.
Wash the wells 2 times with PBST, and add 100 l of the standards or samples
(diluted in DMEM-10% FCS) to each well. The precise levels of standards to use
will depend on the detection limits of the antibody pairs employed, but will often
61
cover the range of from 1 pg/ml to 1500 pg/ml. Cover the plate and incubate
overnight at 4 C.
4. Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig isotype
antibodies to an empirically-determined optimal concentration (usually 0.5 - 2.5 g/ml)
in PBST and add 100 l of each per well, as appropriate. Cover and incubate at
room temperature for 90 min.
5. Wash the wells 8 - 10 times with PBST, and add 100 l of the diluted SA-HRP
(1:5000) to each well. Incubate at room temperature for 90 min.
6. Wash the plates 8 - 10 times with distilled H2O, making sure to remove excess
7.
fluid. Add 100 l of ABTS substrate to each well and allow the reactions to develop
for 20 - 45 min at room temperature. The reactions can be stopped by adding 100
l of 1% SDS to each well.
Read the plates using the ELISA plate reader, set at a reading wavelength of 405
nm.
62
3.7 In vivo assessment of T cell responses: Th1 versus Th2 responses

Materials
Ovalbumin- and SRBC-immune mice
Tissue processor (for processing biopsies to paraffin blocks)
1 ml syringes and 30 ga needles
scalpel blades
Reagents
Ovalbumin in Ca++/Mg++-free HBSS (40 g/ml)

SRBC in Ca++/Mg++-free HBSS (5% suspension)
In situ hybridization fixative
70% ethanol
METHOD
1.
2.
3.
4.
5.
6.
Set up the antigens for the intradermal skin tests in the 1 ml tuberculin syringes
equipped with 30 ga needles. The bevel side of the needle and the calibrated side of
the syringe should be aligned if you are going to inject defined volumes based on the
calibration of the syringe.
Lightly anaesthetize each mouse it turn (i.e., two ovalbumin-sensitized mice and two
SRBC-sensitized mice), so that it can be injected intradermally in the ear. If this will
take some time, also set up a 15 ml tube (with cotton batting and methoxyfluorane)
that you can use during the procedure, in order to keep the mouse anaesthetized on
the bench.
Inject 25 l of the 5% SRBC suspension intradermally into the right ear of the mouse
and inject 25 l of the 40 g/ml ovalbumin solution intradermally into the left ear.
Return the mouse to its cage, making sure that you keep it warm (use a heat lamp if
necessary) and safe (from any overly dominant littermates) during recovery.
At four hours post-injection and then again at 24 h, euthanize one mouse from each
group (i.e., one SRBC- and one ovalbumin-sensitized mouse) and take biopsies of the
reaction sites. To do this, use a fresh #12 scalpel blade to remove the ear and cut it in
half longitudinally, through the middle of the reaction (injection) site. Trim away and
discard the tissue from the outside of the ear, away from the injection sites.
Transfer each half of the ear into ice-cold ISH fixative and fix the tissue for 3 h on ice.
63
7.
Replace the ISH fixative with ice-cold 70% ethanol and store the tissue in this solution
at -20C until you are ready for tissue processing.
8. Place the tissues into labelled tissue-tek cassettes and transfer into the tissue
processor at the 70% ethanol step. The processor will automatically process the
tissue through to molten paraffin.
9. Embed the tissues in paraffin such that the ear tissues are standing straight up in the
molds, so that upon sectioning you will obtain cross-sections of the tissue.
10. Cut 6 m paraffin sections of the tissues and dry them onto slides overnight at 42C.
11. Stain the sections with Giemsa stain using the stipulated protocol (6.4.9.1.2), mount
with permount and examine the tissues under the microscope.
64
3.8 Immunohistochemical detection of cytokines in tissues

Immunohistochemistry is a powerful tool for the detection of single cells which
are positive for any marker of interest for which suitable antibodies exist (e.g., F4/80
antibody-positive M, GK1.5-positive CD8 cells, cytokine-secreting cells, etc). It is thus
similar to FACS analysis, but has perhaps traditionally been used most often with fixed
tissues or cells, allowing one to assess the prevalence of marker expression in situ,
within the context of ongoing physiological or pathological processes. The tissues or
cells are perhaps best prepared in fixatives such as Bouins or Carnoys, since
formaldehyde fixation (especially prolonged fixation) can destroy the "antigenicity" of
many epitopes, rendering them much less detectable using standard protocols. In our
laboratory, we often use our in situ hybridization fixative (5.3) for experiments calling
for either in situ hybridization (ISH) or immunohistochemistry (IHC).
Materials
micropipetters
ISH-fixed cell suspensions or paraffin-embedded 5-7 M tissue sections
Reagents
xylene
graded alcohol baths (i.e., 100%, 90%, 70%, 50%) for hydrating tissue sections
PBST - PBS containing 0.05% Tween 20
normal goat serum
primary anti-cytokine antibody (suitable for immunohistochemistry; e.g., rabbit anti-TNF)
biotinylated secondary antibody (e.g., biotinylated goat anti-rabbit IgG antibody; 3.5)
commercial streptavidin-alkaline phosphatase (SA-AP; 3.5)
BCIP/NBT (see 3.5)
METHOD
1.
2.
3.
Run paraffin sections through two xylene baths (10' & 5') to remove the paraffin,
then rehydrate the tissues by passing the slides through the graded ethanol baths
(2x100%, 90%, 70%, 50%, each < 1 min), then equilibrate to PBST buffer for 2-3'.
Circle the tissue sections with wax pencil to reduce the amount of reagents
required to saturate the tissue sections in each of the following steps.
Incubate the rehydrated tissue sections in 10% normal goat serum for 2 h @ RT in
order to block the non-specific binding capacity of the tissue immunoglobulin
receptors (FcR) for the antibodies to be used subsequently.
65
4.
Overlay the tissue sections with 75 l of the primary antibody, using empiricallydetermined optimal concentrations of the antibodies (culture supernatants are
often used @ 1:5- 1:100; commercial preparations of purified antibodies @ 1:501:250; and monoclonal antibody ascites fluids @ 1:250-1:10,000) ON @ 4C.
5. Wash the tissue sections three times for 5' each in PBST.
6. Overlay the tissue sections with 75 l of the biotinylated secondary antibody,
again using empirically-determined optimal concentrations of the antibodies,
generally for 2h @ RT.
8. Overlay the tissue sections again, this time with SA-AP diluted to 1:5000 in PBST,
and incubate for 90 ' @ RT to label the secondary antibodies in the tissue
sections.
10. Overlay the tissue sections with the commercial solution of BCIP/NBT for 20 - 40'
@ RT (continue staining until the antigen of interest becomes apparent or until a
non-specific general tissue background staining begins to appear).
11. Transfer slides to H2O and counter-stain with a water-based counter-stain such as
Gill's haemotoxylin ( ) and cover-slip with aqueous mounting medium.
66
4.0 MOLECULAR ANALYSIS OF CYTOKINE mRNA EXPRESSION :

4.1 Northern blotting
Northern blotting is much like Western blotting, except that instead of examining the
expression of proteins by electrophoretically separating them according to their size and
confirming their identities with specific antibodies, you will be examining the expression of
the mRNA for the protein by electrophoretically separating them according to their size and
confirming their identities with specific cDNA probes. We will examine the methods for the
purification of the mRNA, for electrophoresing and blotting it, and for probing the blots.
4.1.1 Purification of cellular RNA
While the protocol outlined herein is for the purification of RNA from cells, it is
essentially the same as that for tissues, except that with tissues one uses a tissue disrupter
or homogenizer. We will be using CsCl gradients to purify the RNA, but many people
instead use an acidic phenol-chloroform extraction protocol. I use the former method for
purifying large amounts of RNA and the latter for minuscule amounts of RNA -- there are
an increasing number of very good mRNA purification kits available on the market as well.
Finally, while we will not be isolating mRNA from the total cellular RNA (because our target
mRNA species should be highly expressed), for mRNA species that are only weakly
expressed, you will need to purify the mRNA from the total cellular RNA pool.
Materials
samples for RNA extraction (tissues or cultured cells)
RNAse-free pipettes, tips, test tubes
micropipetters
single cell suspensions of activated and control Cl.MC/C57.1 cells
(time course of 0, 3 & 6 h)
Reagents
DEPC-H20
20% lauryl sarcosine
5.5 M GSCN lysis solution
5.7 M CsCl/sodium acetate
67
METHOD
1.
At each time in the activation time course, pellet the appropriate tubes of C57 cells by
centrifugation, then generate a paste on the tube walls by vigorously flicking the tubes.
Add 3 ml of GSCN lysis solution to each tube, and vortex vigorously for 30 sec - 1
min.
For samples homogenized by vortexing only, shear the DNA by forcefully aspirating
and ejecting the lysate through an 18 ga. needle, using a 3 ml syringe, and taking
care to avoid frothing the samples excessively. (When the DNA is shorn sufficiently,
the sample will drip discretely from the tip of the needle rather than coming out as a
viscous linear strand.)
Pipette 1.0 ml of CsCl density gradient medium into each of 6 polyallomer
ultracentrifuge tubes, and then gently overlay the CsCl with the cell lysates. Do not
allow the CsCl and samples to mix, and fill the buckets only to 2 mm from the top
(you will need to leave room for the addition of additional GSCN as required for bucket
balancing (step 4).
Load the tubes into the SW55Ti rotor buckets and balance the loaded buckets & caps
in pairs (i.e., #1 & 4, #2 & 5, #3 & 6), to within 1/100th of a gram. Use GSCN lysis
solution to balance the buckets by adding it to each tube with a syringe fitted with an
18 ga needle, one drop at a time. Tighten the lids down - finger-tight only!
Fit the buckets onto the SW55Ti rotor, very carefully place the rotor on the centrifuge
spindle, being very careful not to damage the overspeed disc on the bottom of the
spindle!, and gently close the weighted door.
Switch on or set the following centrifuge control options: vacuum on, slow acceleration
on, brake off, maximum temperature to 30C, run temperature to 22C, rotor speed
to 42,000 rpm, run time to 20 h, timed operation, and finally, on. Wait for the rotor to
come to speed to confirm that everything is operating smoothly.
The next day, after the rotor has stopped, switch off the vacuum, open the door and
remove the rotor from the spindle, and the buckets from the rotor. Take the tubes from
the buckets, wash them out with hot tap water & dry, and check the "O" rings and
lubricate using vacuum grease, if necessary.
18
2.
3.
4.
5.
6.
7.
18
When extracting RNA from tissues, grind the tissues using a polytron-type homogenizer in GSCN
without sarcosine (to avoid foaming), then add the sarcosine after the tissue homogenization. Precentrifuge the homogenized tissues for 30 min to 2 hours in the ultracentrifuge to get rid of any insoluble
tissue remnants. In place of a polytron to grind up the tissues, one could also use a mortor and pestle
with liguid nitrogen to accomplish the same thing.
68
8.
9.
Completely aspirate the liquid contents of the tube using a Pasteur pipette attached to
a vacuum apparatus. The last few milliliters are best gotten by turning the tube upside
down to allow the fluid to drain to the pipette. Stay away from the gelatin-like pellet of
RNA at the bottom of the tube. The pellet will be anywhere from 1 - 8 mm across.
One at a time, cut the tubes off about 1 cm above the bottom using a heated scalpel
blade, break up the RNA pellet with the tip of the eppendorf tip, and dissolve the pellet
in 50 - 400 l of DEPC-H2O (depending on the size of the pellet) by repeated
vigorous pipetting. If necessary, repeat the H 2O step to make sure you get all of the
RNA, transferring both washes into an RNAse-free 1.5 ml eppendorf tube. Close the
tube and transfer it to a 65C H2O bath for 5 min to completely dissolve the RNA,
then briefly microfuge to sediment the contents.
10. Remove 5 l of the RNA from each tube and transfer to another tube containing 995 l
of H2O. Immediately transfer the stock tubes of RNA to dry ice and then to the -80C
freezer. Determine the optical density (260 nm and 280 nm wavelength; use quartz
cuvettes) of each of the samples. Calculate the OD 260:OD280 ratio and the
concentrations of the stock RNA solutions as follows: The 260:280 ratio should be
between 1.5 and 2.0 (pure nucleotide solutions have an OD 260 of 2.0 -- the lower the
ratio, the more protein contamination but, practically speaking, ratios of 1.5 are not
uncommon and may still yield excellent results with Northern analyses). To calculate
the concentration of the stock RNA, multiply the OD 260 by 10 to get the concentration
in g/l (i.e., an OD260 of 0.108 would mean that the stock RNA concentration was
1.08 g/l; for a 300 l solution, that would mean that you had purified 1.08 x 300 =
324 g of RNA).
11. If your RNA solution is too dilute for subsequent Northern analysis (e.g., 20 g
represent >30 l of RNA), then you will need to concentrate the samples. To do this,
take the calculated volume required for 20 g and transfer it to a new RNAse-free
eppendorf tube. Add 0.1 volumes of 3M sodium acetate (pH 7.0) and 2.5 volumes of
100% RNAse-free ethanol, vortex briefly to mix and put in the -80C freezer overnight.
The next day, microfuge the RNA at 4C for 30 min, carefully aspirate the supernatant
(avoid the minuscule pellet!) and wash the pellet with 500 l of ice-cold 70% ethanol.
Re-microfuge for 15 min at 4C, aspirate the supernatant again and leave the tubes
open on the bench for 30 - 60 min to dry. When the ethanol has dried, resuspend
the pellet in the required volume of H 2O or Northern blot RNA sample prep buffer and
dissolve at 65C, as above. Store at -80C, or on dry ice, until ready to use.
69
4.1.2 Electrophoresis of RNA & transfer to membranes

It is critical that the electrophoresis apparatus used is more-or-less free from RNAse
contamination. Therefore, it should be reserved for RNA work and should not be used for
preparation or analysis of plasmids, a protocol that often depends heavily on the use of
RNAses.
Materials
RNAse-free horizontal gel electrophoresis gel apparatus & power-pack
Zeta-bind transfer membrane (or other)
RNAse-free glass or plastic pipettes
micropipetters & tips
filter paper (e.g., Whatman #1) & absorbent paper (e.g., paper towels)
Reagents
agarose
DEPC-H20
ammonium acetate
formaldehyde
5X MOPS,
10xSSC
1.2% agarose gel
10 mg/ml ethidium bromide
0.03% methylene blue in 0.3M ammonium acetate
RNA sample prep solution (for denaturation of RNA prior to electrophoresis)
RNA sample dye/loading solution (for visualization of progress during run)
METHOD
1. Wash the Northern blotting apparatus with DEPC-H2O, and then pour a 1.2%
agarose/formaldehyde/MOPS gel (appendix , pg 94) to a depth of about 8-10 mm
(since the RNA samples will be negatively charged and will migrate towards the
positive electrode, make sure that you position the gel with the wells closest to the
negative electrode). When the gel is fully solidified (this can be expedited by doing the
last of the cooling step in a refrigerator), remove the comb from the gel and fill up the
chamber with 1x MOPS running buffer, covering the gel to a depth of 2-3 mm with
buffer.
70
2.
3.
4.
To eppendorf tubes containing 20 g samples of RNA in a volume of 10 - 20 l of

H2O, add 15 l of the RNA sample prep buffer and 2 l of RNA load buffer/dye.
Incubate the samples in a 65C water bath for 10 min, then briefly pulse microfuge the
tubes and hold on ice until ready to use.
Load the RNA samples into the wells in the gel, being careful to not puncture the very
fragile bottoms of the wells with the pipette tips. Run two sets of samples, one for
Northern blotting, and a separate set for staining with ethidium bromide (for
confirmation that the RNA samples are intact). When all the samples are loaded, run
the gel until the leading dye front is approximately 50 - 75% down the gel. (The
leading dye front will migrate just in front of the 18s rRNA, while the trailing dye front
will migrate just behind the 28s rRNA in each sample.)
Remove the gel from the gel apparatus and carefully cut it to separate the Northern
blotting portion from that destined for ethidium bromide staining. Transfer both 'halves'
into DEPC-H2O, and incubate the gel in the water bath for 20 min with gentle rocking.
For the half of the gel to be transferred to the nylon membrane, follow steps 5 - 7, for
the portion to be stained with ethidium bromide, follow alternate steps 5a - 6a.
5. Equilibrate the half for transfer to 10xSSC, by incubating in 10x SSC for 20 min with
gentle rocking.
5a. The portion to be stained with ethidium bromide should be incubated for another 20
min in H2O.
6.
Assemble the northern blotting apparatus as follows: Cut a wick of 4 - 5 layers of

Whatman #1 filter paper that can run the full length of the gel apparatus gel platform
and extend down into the fluid reservoirs. Place the gel, upside-down onto this wick,
making sure that there are no air bubbles trapped underneath. Apply a piece of the
Zeta-bind membrane (cut the overlap the gel by a few millimeters) directly to the gel,
and then apply several more pieces of filter paper, cut to the size of the membrane,
directly on top of the transfer membrane, and cover this whole construct with 4-5
inches of paper towel, which will absorb the buffer that wicks through the gel and Zetabind membrane. Next, cut some large pieces of parafilm membrane and place them
around the gel, so that the transfer buffer can only wick into the paper towel by going
through the gel. Finally, place a weight on top of the paper towel (e.g., a 500 ml
reagent bottle that is half full) and secure in place.
71
paper towel
filter paper
nylon membrane
gel for blotting
filter paper wick
10x SSC
gel/blotting apparatus
6a. To the portion of the membrane to be stained with ethidium bromide, transfer the gel
into 0.1 M ammonium acetate solution for another 20 min, and then into 0.1 M
ammonium acetate containing 0.5 g/ml ethidium bromide. Stain the gel for 45 min
and then examine under UV light. If the background is not too high, photograph the
gel as is, but if necessary the background can be decreased by further washing with
water.
7. For the portion of the gel that was blotted, disassemble the transfer apparatus the next
morning and bind the RNA to the membrane by UV cross-linking using the Stratalinker. Place the damp blot on damp filter paper into the irradiation apparatus and set it
to automatically deliver the correct energy to the membrane (auto-crosslink). After
cross-linking, the RNA is completely stable, such that the blots can be stored
indefinitely at room temperature or in the freezer. (Stored in this manner, they can be
successfully probed up to several years later).
8. Assess the integrity of the RNA and the efficiency of transfer by staining the blots in
0.03% methylene blue in 0.3M sodium acetate (pH 5.2) for 45 seconds (or more, if
required), then destaining the blots in DEPC-treated distilled water for 2 minutes. If
the RNA is intact and transferred efficiently, you will readily see the 18s and 28s
ribosomal RNA bands on the blots, as well as a subtle smear of mRNA that runs from
above the 28 s rRNA band to below the 18 s rRNA band. (If the rRNA bands are not
crisp and sharp looking, then some RNA degradation has taken place the extent of
the degradation can be judged readily in this manner.)
72
4.1.3 32P-labelled cDNA probe synthesis

The probes used to detect the mRNA species of interest are generated by in vitro
labeling of individual cDNAs specific for each mRNA, using the random hexamer method.
In this method a solution containing essentially all possible nucleotide hexamers is used to
prime the synthesis of secondary stands of cDNA from the denatured primary strands in a
reaction in which one of the component deoxynucleotides is 32P-dCTP. The labelled cDNA
is then purified from the unbound dCTP by chromatography through Sephadex G-50.
Materials
cDNAs for each mRNA of interest
Plexi-glass 32P-energy-blocking safety shield

glass pipettes
plastic wrap
Geiger counter
Reagents
32P-labelled
dCTP (Mandel-New England Nuclear; 3000-8000 Ci/mmol)

Oligolabelling kit (Pharmacia) containing the random hexamer primers and the Klenow
fragment of DNA polymerase.
METHOD
1. Mix together 500-1000 ng of purified cDNA and H2O, to a final volume of 34 l, then
2.
denature the cDNA by heating to 90C for 10-15 min. Transfer the cDNA to a 37C
incubator for 5 min.
Add 10l of the oligolabelling reaction mixture (i.e., NTPs/random hexamer soup), 5 l
3.
of 32P-dCTP, and 1 l of Klenow fragment.

Incubate the reaction mixture overnight at room temperature (or for >3 h @ 37C).
4.
Purify the 32P-labelled cDNA from the unbound probe by column chromatography
(see accompanying diagram). Run the 50 l reaction mixture over an 8 ml
Sepharose G-50 column, carefully chasing the 50 l reaction into the matrix with 2
sequential 1 ml aliquots of STE buffer, and eluting the labelled cDNA with STE.
Follow the isotope using a Geiger counter, masking from the Geiger counter the
column itself and the collection vessel, but not the elution tubing. Thus the Geiger
counter will detect all of the elution of label from the column (both that incorporated
into the cDNA and that still unincorporated).
73
poly-prep column
Seph G-50
unincorporated
32P
beta energy shield

(with window @ elution
tubing)
beta energy
bound 32P
elution tubing
gieger counter
collection tubes
5.
6.
7.
Once labelled material begins to read on the Geiger counter (i.e., is in the column
elution tubing), begin to collect all of the eluate into one new tube, continuing to do so
until this first peak of labelled material, which comprises the 32P-cDNA in its entirety,
has eluted. Either collect any residual activity into a second, discard, tube or simply
do not elute it from the column, discarding it instead with the column and matrix.
Determine the radioactivity present in the labelled cDNA by adding a 5 or 10 l aliquot
of the cDNA to 4 ml of liquid scintillation cocktail and counting it in a counter.
Calculate the volume of column eluate required to yield 1.5x10 7 cpm of 32P-cDNA,
then aliquot and freeze the labelled material until ready for use.
Clean up your work area, making sure to monitor all pipettes, shields benches, etc, for
19
8.
32P
contamination. Wipe test all surfaces and equipment to confirm your Geiger
counter survey and clean up any remaining contamination using a detergent such as
Count-Off (New England Nuclear). Enter your wipe test results in the lab log books.
19 32
P is a highly unstable isotope, so that the labelled probes cannot be stored for any more than 3 days
to a week without decaying beyond usefulness.
74
4.1.4 Pre-hybridization, hybridization, and washing (Zeta-Bind nylon membranes)

Materials
Plexi-glass 32P-energy-blocking safety shield

U.V. irradiation apparatus (e.g., Stratalinker) or vacuum oven
rotary hybridization oven with hybridization tubes
(or water bath, heat-sealable bags, & heat-sealing unit)
glass pipettes
plastic wrap
Geiger counter
Reagents
0.1x SSC/0.5% SDS
2x SSC/0.1 % SDS
0.2x SSC/0.1% SDS
pre-hyb/hybridization solution
32P-labelled
cDNA probes (TGF, TNF & actin)
METHOD
1.
2.
3.
4.
After transfer of the RNA from the gel to the Zeta-bind membrane, cross-link the RNA
onto the membranes either by U.V. irradiation or by baking the blot in a vacuum oven
(50C for 4 h).
Block the non-specific 32P-cDNA-binding sites on the membranes by incubating the

blot in the hybridization oven for 60 min at 65C in 15 ml of 0.1X SSC/0.5% SDS.
Remove the Northern blot blocking solution from the blot and replace it with 15 ml of
hybridization solution. Pre-hybridize the blots in this solution for 3 h to overnight at
42C.
Next, add 1.5x107 cpm of 32P-labelled cDNA probe (250 - 1000 l volume) to the 15
ml of hybridization solution containing the blot. The probe must be boiled before
addition to the blot to denature the double-stranded DNA (and allow the anti-sense
strand to hybridize to the mRNA on the blots), and should not be allowed to cool
before addition to the blot. Incubate the blots with the probe again overnight at 42C,
making sure that the oven rotator is operating.
75
5.
6.
The next day, remove the very radioactive hybridization solution from the hybridization
bottles (discard in the 32P-liquid waste canister), and rinse the bottles twice for 5 min
each with 2xSSC/0.1% SDS, discarding the spent washing into the 32P-liquid discard
canister.
Add 25 - 50 ml of 0.2xSSC/0.1% SDS to each bottle and incubate for 30 min at 42C.
Repeat this 30 min/42C wash a second time, and discard the spent washings into the
32P-liquid
7.
discard canister.
Remove the blot from the bottle and lay it flat out on a piece of plastic-wrap. Do not
allow it to dry at this point, as drying will permanently fix all of the (i.e., specifically and
any residual non-specifically bound) 32P-labelled cDNA probe to the blot. Using the
Geiger counter, scan the blot to determine whether most, if not all, of the radioactivity
is associated with bands at the expected position (molecular mass) on the blot. If it is
not, then you need to continue washing the blot(s), increasing the stringency of the
washes (i.e., decreasing the SSC concentration &/or increasing the wash
temperature) but, most of the time, 60 min at 42C in 0.2xSSC/0.1% SDS wash is
adequate. If the counts appear to be specifically bound, wrap the blot completely in
plastic wrap and either store it in a freezer until ready to proceed or place in the
autoradiography exposure cassette (again, do not allow the blot to dry!).
76
4.1.5 Detection of mRNA bands by autoradiography

Materials
autoradiography exposure cassettes ('enhancing screens' highly desirable)
Kodak X-OMAT AR x-ray film
automated x-ray film processing unit (or hand processing equipment/solutions)
Reagents
none, unless processing by hand
METHOD
1.
2.
3.
4.
5.
In the laboratory, and for autoradiography cassettes without built-in 'enhancing

screens', place two 'enhancing screens' into the cassette on top of each other (as in a
sandwich), such that their shiny surfaces face one another. Place the probed, plasticwrapped blot in the cassette, outside of the enhancing screen sandwich.
In the dark-room, under safelight illumination, place a sheet of x-ray film inside the
enhancing screen 'sandwich' (i.e., not in contact with the blot), and then close and
lock the cassette. For the much less expensive 'leatherette' cassettes, clamp sheets
of plywood or plexiglass to the outside of the cassettes to hold all layers of the
assembled exposure apparatus tightly together.
Place the exposure cassette in a -80C freezer until you are ready to develop the film.
The length of time will vary depending on the intensity of the specific mRNA signal
(roughly determined with the Geiger counter [see step 7, NORTHERN BLOTTING:
Pre-hybridization, Hybridization, and High-stringency Washing]). If the signal is readily
detectable with the Geiger counter, then a 1 - 3 day exposure is usually adequate, but
if it is not easily detectable, then the exposure time may need to be extended to 1 - 3
weeks. You may need to do a short exposure to get a feel for the intensity of the
signal, and then adjust the time to get an optimal signal intensity.
For development of the film, remove the cassette from the -80C freezer and allow it to
come to room temperature (this avoids condensation on the film later on). Under
safelight illumination, open the cassette, remove the film from between the enhancing
screens and feed it into the x-ray film processor. Do not turn on the lights or exit the
processing room until you are sure that the film has completely entered the processor
(usually there is a signal from the machine).
Provided the mRNA signals on the blot are not over-exposed (i.e., have not
photographically saturated the film), perform a densitometric analysis of the band
77
intensities of each mRNA band, for both the housekeeping control mRNA (e.g., actin)
and the experimental mRNA (e.g., TNF). Determine the relative signal intensities of
each experimental mRNA band by expressing it in terms of the relative amounts of
actin mRNA in each lane (ideally, the actin signals will not vary between lanes -- if they
do, it is because you loaded different amounts of RNA in each lane).
78
4.2 In Situ hybridization (ISH)

In the experimental procedure that we will follow, we will probe activated
Cl.MC/C57.1 cells for the expression of TNF and TGF, using 35S-labelled TNF
sense and anti-sense and TGF anti-sense cRNA probes. Thus we will be probing
cytocentrifuge preps. The cells are fixed in ISH fixative for as short a period as is
consistent with good cytoarchitecture, are hydrolysed in HCl and digested with protease
to make the mRNA more available to the cRNA probes, briefly fixed again to neutralize
any RNAse activity, and blocked with acetic anhydride to reduce non-specific sulfhydryl
bond formation between the 35S-labelled probe and the tissues. The tissues are
probed and washed at a relatively high temperatures to prevent non-specific annealing
of the cRNA probe to other tissue mRNA species, and finally, the mRNA-bound 35ScRNA probes are detected at the cellular level by dipping the slides in a liquid film
emulsion and performing in situ autoradiography. ISH is extremely specific, inasmuch
as you can detect and identify individual cytokine mRNA-positive cells, but its sensitivity
is perhaps one-tenth of that of Northern blotting.
4.2.1 Probe synthesis & purification
Materials
micropipetters & tips
RNAse-free eppendorf tubes
Reagents
in vitro transcription kit or reagents
RNAid RNA purification kit
35S-UTP
(12.5 mCi/ml; 1000 Ci/mmol)

uridine 5'[-thio] triphosphate (or, thio-UTP)
DEPC-H2O
linearized template (i.e., in vitro transcription vector containing cDNA)
METHOD
1.
Synthesize the cRNA probes by transcribing the cDNA in the linearized in vitro
transcription vector (i.e., a vector with SP6, T3 or T7 RNA polymerase recognition
sites upstream of the cDNA sequences of interest). For each experiment you will
need to generate both sense and anti-sense (reciprocal transcriptional orientation)
79
probes. To accomplish this, for each probe to be prepared add the following
ingredients (in order) to a 1.5 ml microcentrifuge tube on the benchtop
2.1 l 5X transcription salts buffer
1.0 l 1M DTT
0.5 l RNAsin
0.5 l NTP cocktail [10 mM @ ATP, CTP, GTP, and 250 M UTP]
1.4 l nuclease-free H2O
briefly mix the ingredients before adding the template (the spermidine in the 5x salts
could precipitate the DNA in the template if not thoroughly dispersed)
2.0 l template (linearized plasmid)

2.0 l 35S-UTP
1.0 l appropriate RNA polymerase

10.5 l total volume
Briefly vortex the tube, pulse microfuge, and place in a 37C H 2O bath for 90'.
2.
3.
Remove the DNA template from the reaction mixture by digestion with RNase-free
DNase I. To do this add,
2 l yeast tRNA
1 l DNAse
1 l RNAsin
briefly vortex the tube and sediment the liquid by a 3" pulse-spin
incubate the reaction tubes for an additional 15 min @ 37C.
Add 86 l DEPC-H2O, vortex, and pulse-spin as above. Remove 1 l of each
reaction mixture and dot it onto a filter paper disc (labelled A), which you then
transfer into an empty scintillation vial (also labelled A, for -counting; below).
4.
5.
6.
7.
Purify the 35S-UTP-labelled cRNA from the reaction mixtures using the RNAid RNA
purification kit. Add 300 l of RNA-binding salt to each tube and vortex.
Add 2 l RNAid-kit 'glass milk' and vortex each tube to disperse the 'glass milk'
evenly. Incubate the tubes for 5 min @ room temperature to allow the RNA to bind
to the scintered glass.
Pulse-spin the tubes for 4 counts (i.e., 4 sec; spinning too long will pack the glass
into too hard a pellet for subsequent dispersal) and remove and discard the highly
radioactive supernatant using a 1 ml pipetman set at 500 l.
Add 400 l of RNAid kit wash solution to each tube and resuspend the pellet by
repeatedly vigorously expelling and not too vigorously aspirating the 400 l wash
80
8.
solution with a P200 micropipetter set at 150 l (too vigorous an aspiration action
will 'bump' the solution up onto the end of the micropipetter, inside the tip, leaving
you with RNAse contamination of your purified preparation). Vortex and pulse-spin
the tubes for 4 counts, and remove and discard the highly radioactive supernatant
using a 1 ml pipetman set at 500 l, as above. Repeat step 7 for a total of three
washes.
Resuspend the pellet in 25 l of DEPC-H 2O (this time notice that the pellet can be
resuspended very easily), and place the tubes in a 55C water bath for 3 min.
During this incubation, set up some new, labelled Eppendorf tubes with 25 l of
9.
deionized formamide (this will be the final storage tube for the purified 35S-cRNA).
Microfuge the tubes for 3 - 5 min (full speed) to pellet the 'glass milk' and carefully
remove the 35S-cRNA (supernatant)) from each tube. It is critical to avoid

aspirating any glassmilk at this point, so remove the supernatant 10 l at a time
using your 1 - 10 l pipetter. Transfer this eluted cRNA into the deionized
formamide-Eppendorf tubes (step 8), so that you should now have a total 35ScRNA (i.e., probe) volume of 50 l.
10. Remove 1 l of this purified probe from each tube, and dot it onto a filter paper disc
(labelled B). Transfer the paper disc into another scintillation vial (labelled B) for counting.
11. Transfer the purified probe to a -70C freezer until you are ready to use it.
12. Add 4 ml of aqueous-miscible scintillation cocktail to scintillation vials A and B, cap
them securely and use a liquid scintillation counter to determine the 35S counts in
each tube.
13. Calculate the reaction yields (i.e., ng cRNA synthesized and purified) for each
probe generated, as follows (this is a typical in vitro transcription result):
You purchased 1 mCi of 35S-UTP (concentration, 1000 Ci/mmol = 1000 mCi/mol)

in a 80 l volume. The 12.5 mCi/ml of the purchased product equates to 12.0
pmol/l of isotope, and you used 4 l or 48 pmol of 35S-UTP/reaction. In addition,

the 1 l of nucleotide cocktail for your in vitro transcription reaction contained 250
pmol of non-radioactive UTP, so that the entire reaction contained 298 pmol of (hot
+ cold) UTP -- 6.2 times the amount of UTP you would detect if you were
measuring radioactivity alone. Since we are interested in calculating the amount of
cRNA synthesized, not just the UTP content, we must also take into account that
the mass of cRNA synthesized contains all four nucleotides (UTP, ATP, CTP &
81
GTP), so that the actual amount of cRNA synthesized will be approximately 6.2 x 4
= 24.8 times the levels of 35S-UTP incorporated (this calculation assumes that
UTP comprises 25% of the total nucleotide content).
Now, using the cpm measured in the 1 l aliquots taken from the transcription reactions
(steps 3 & 10; the total cpm put into the reaction & the total cpm actually
incorporated into the cRNA, respectively), we will determine the amounts of cRNA
synthesized.
The raw data obtained from the 1 l aliquots taken in steps 3 & 10 is:
probe
step 3 (cpm)
step 10 (cpm)
TGFs
569150
576280
TNFs
823920
768370
TNFs
596450
494110
specific
probe
pmol 35S
pmol
total cpm
activity of
total cpm
incorp.
cRNA
ng cRNA
No. slides
per rx.
35S
incorp.
into the
synth.
synth.
(11.5 ng
(pmol/2)
cRNA ea.)
(x107)
(cpm/pmol)
into cRNA
cRNA
(pmol 35S
x106
(x106)
probe
x 24.8)
TGF-s
5.69
1.18
28.8
24.4
605.8
302.9
26.3
TNF-s
8.24
1.72
38.5
22.4
556
278
24.2
TNF-s
5.96
1.24
24.5
19.75
490.4
245.2
21.3
Thus, for these in vitro transcription reactions, we can probe between 21 and 26 slides
for each of the cRNAs.
82
4.2.2 Preparation of slides for hybridization

Materials
37C water bath
60C water bath
90C water bath
slide-staining apparatus (12 'coplin' jars are adequate)
10 ml glass pipettes (baked or commercial disposable)
micropipetters (P200 & P2000) and tips
50 ml graduate centrifuge tubes (adequate for measuring reagents)
pH paper strips (0.5 pH unit sensitivity is fine).
Reagents
10 M NaOH
xylene
ethanol (100%, 90%, 70%, & 50%)
DEPC-treated H2O (500 ml)
0.2 M HCl (16 ml concentrated HCl in 984 ml DEPC-H2O)

TE buffer (10mM Tris/1 mM EDTA in H2O)
PBS
proteinase K (1 - 40 g/ml in TE; prepare immediately before use, from frozen stocks).
0.2% glycine in PBS (3 ml of 10% glycine IN 147 ml PBS)
4% paraformaldehyde in PBS (dissolve at 60C at high pH, then adjust pH to neutral).
0.1 M triethanolamine (prepare just before use)
acetic anhydride
METHOD
1.
Normally, when you are doing ISH with paraffin sections, you need to first de-wax
and rehydrate the sections with sequential treatments with xylene and ethanol.
Since cytocentrifuge preparations are not embedded in paraffin and are stored
already in 70% ethanol, they enter the process at the 70% ethanol stage, and then
are treated as with the paraffin sections protocol. Therefore process your slides as
appropriate by running them through the following baths (in order and for the
specified times):
xylene #1- 10 min
83
2.
3.
4.
5.
6.
7.
8.
9.
xylene #2- 5 min

100%, 90%, 70%, & 30% ethanol - (4 baths total, 30 seconds each).
Hydrolyze the overly extensive protein cross-linking in the formaldehyde-fixed
tissues by incubating them in 0.2 M HCl for 20 min (this increases the access of
your ISH probes to the mRNA).
During the 20 min 0.2 M HCl incubation period (i.e., step 2), prepare a fresh
solution of 4% paraformaldehyde by adding 6 g of paraformaldehyde to the 150
ml of preheated 60C PBS. The paraformaldehyde will not dissolve until the PBS
is made basic (i.e., increase the pH) by adding 6 drops of 10 M NaOH. Swirl
the basic the paraformaldehyde suspension until all of the paraformaldehyde is
dissolved, and then neutralize the pH (to 7 - 8) by adding 600 l of 1 M HCl.
Check the pH of the solution with pH paper (do not dip the paper in the solution,
but instead remove 20 - 40 l aliquots and drop these onto the paper). When the
paraformaldehyde is at the correct pH, move it to an ice bath to cool.
After the 20 min HCl hydrolysis step, transfer the slides into a TE bath for 5 min
Further break down the protein-protein cross-linking (to increase access of the
probe to the mRNA) by digesting the cells/tissues with the highest levels of
proteinase K that they can take without disintegrating due to over digestion. For
cytocentrifuge cells it is often acceptable to use the lower concentration of
proteinase K, while for paraffin sections you should use the highest concentration
that does not damage the integrity of the tissue (often 25 - 40 g/ml). Thus, after
the TE equilibration (step 4), transfer slides into the proteinase K/TE bath for 15
min @ 37C.
Neutralize the progression of the proteinase K tissue digestion by immersing the
slides in 0.2% glycine in PBS for 2 min
Equilibrate the cells/tissues to PBS for 3 min.
Neutralize the newly-exposed RNAses in the tissues by "post-fixing" them in the
freshly-prepared 4% paraformaldehyde in PBS (from step 3) for 5 - 20 min on ice.
While the tissues are in the paraformaldehyde, prepare the triethanolamine
solution for the tissue blocking step below. To prepare the 0.1 M triethanolamine,
add 3.71g triethanolamine powder to 200 ml DEPC-H 2O, and then adjust the pH to
7.5 - 8.0 by adding 200 l of 10M NaOH (additional NaOH may be needed; again,
use pH paper, not a pH meter).
Rinse the paraformaldehyde out of the cells/tissues by immersing in PBS for 5 min.
84
10. Block the non-specific binding sites of the 35S-labelled probes by incubating the
cells/tissues in 0.1M triethanolamine containing 0.5% acetic anhydride for 10 min.
It is critical that the complete triethanolamine/acetic anhydride blocking solution is
prepared fresh immediately (i.e., seconds) before use. Therefore, during the last
few seconds of the step 9 PBS rinse, add 1 ml acetic anhydride to the 150 ml bath
of 0.1M triethanolamine and immediately immerse the slides in this mixture. After
5 min, briefly remove the slides, add another 500 l of acetic anhydride (acetic
anhydride is extremely labile and 'goes off' within minutes), and continue the
blocking step for another 5 min (i.e., total blocking time, 10')
11. Transfer the slides to a 2xSSC bath and hold in this solution until you are ready for
the probe application to the tissues (i.e., hybridization step; below).
85
4.2.3 Hybridization of 35S-cRNA riboprobes to cellular mRNA

Materials
40 - 65C hybridization oven
90C water bath
micropipetter (P200) and tips
pH paper strips (0.5 pH unit sensitivity is fine).
Reagents
DEPC-treated H2O (500 ml)
ISH hybridization buffer
thio-UTP (non-radioactive; for additional blocking of non-specific binding of 35S-UTP)
35S-UTP-labelled
sense and anti-sense cRNA probes (concentrations known)
METHOD
1.
Calculate the amounts of probe, thio-UTP and hybridization buffer that you will
require for your experiment. Base these calculations on:
-using a final probe concentration of 0.25 ng of probe/l of final hybridization
cocktail/kilobase of cRNA probe complexity. For a 1 kilobase cRNA
probe, and applying 45 l of final hybridization cocktail to each slide, then
you will need 45 x 0.25 ng x 1.0 kb = 11.25 ng/slide;
-the 45 l for each slide must include 1.25 l of thio-UTP
-the balance of the 45 l for each slide comprises hybridization buffer
A typical set of calculations for a ISH procedure in which you are going to probe 8 sense
(negative control) slides and 20 anti-sense (experimental) slides with 35S-TNF
cRNA probes that have cRNA concentrations of 5 ng/l is as follows:
cRNA
# slides
Tot. hyb. vol.

(45l ea.)
Vol.
thio-UTP
(1.25 l/slide)
Volume
cRNA probe*
(11.5 ng/slide)
Volume hyb.
buffer
(tot-thio-probe)
TGF:
anti-sense
26
1170
32.5
50
1087.5
TNF:
sense
24
1080
30
50
1000
TNF:
anti-sense
21
945
27
50
868
86
2.
3.
4.
5.
Add each required reagent to labelled Eppendorf tubes, vortex briefly and hold on
ice until ready to use. A few minutes prior to using each probe, place it in a 80 90C water bath for 2 min to denature the cRNA, then transfer it back onto ice to
quench the renaturation process.
One at a time, remove the slides to be probed from the 2xSSC bath, briefly dry the
back and the sides of the slides with a clean Kim-wipe (e.g., Kleenex), and place
on hybridization tray (over 50% formamide-2xSSC-soaked paper towels in a
Tupperware container). Apply 45 l of the final hybridization mixture to each slide,
carefully using the pipette tip to cover most of each tissue section (for
cytocentrifuge preps simply placing the 45 l in the centre of the cell 'patch' is
adequate).
Use some RNAse-free forceps to carefully overlay the tissue/cells with a baked,
siliconized coverslip, taking care to avoid air bubbles.
Repeat this procedure in turn with each of the slides and, when finished, cover and
seal the hybridization chamber (Tupperware container) and place it in the 45C
hybridization oven overnight.
87
4.2.4 Post-hybridization washing & autoradiography

Materials
37C water bath
47C water bath
2 coplin jars
bath for removing cover slips
Geiger counter
plexi-glass shield for working with 35S

isotope disposal bins
Reagents
2x SSC
50% formamide/2xSSC/10 mM 2-mercaptoethanol
4xSSC/TE
RNAse A (10 mg/ml)
ethanol (i.e., 30, 50, 70, & 90%) each containing 0.3 M ammonium acetate
100% ethanol
METHOD
1.
2.
Remove each of the slides from the hybridization chamber and place, back-toback, in the metal slide holder (as much as possible, handle the slides by their
frosted ends, away from the radioactive area). Immerse the slides in a bath of
2xSSC until each of the coverslips has fallen off of the slides.
Transfer slides to a tissue-tek holder and incubate for 30 min at 50C in 50%
formamide-2xSSC-10mM 2-mercaptoethanol. After 30 min repeat this step, for a
total time of 60 min. Discard the 2xSSC solution from step 1, as well as the used
contents of the two reagent baths from step 2 in the liquid 35S waste bucket.
3.
Equilibrate slides for 15 min at 37C in 4X SSC-TE

[4X SSC containing 10mM Tris and 1 mM EDTA]
4.
Digest the single-stranded 35S-cRNA that is non-specifically bound to the tissues

(i.e., not hybridized to mRNA) with RNAse A, by incubating the slides for 30 min at
37C in RNAse (20 g/ml) in 4xSSC-TE. Discard the used RNAse digestion buffer
5.
in the liquid 35S waste bucket.

Wash the residual RNAse from the slides for 30 min at 37C in 4xSSC-TE
88
6.
Perform one final high stringency wash to remove non-specifically bound, digested
35S-UTP
(or larger nucleotides) by incubating the slides for 60 min at 50C in 50%
formamide-2X SSC-10mM 2-mercaptoethanol. Discard the used wash solutions in
the liquid 35S waste bucket.
7. Equilibrate the slides to 2xSSC by incubating them for 3-5 min (at room
temperature) in this solution, and then dehydrate them by sequentially transferring
them through a graded series of ethanol baths (30%, 50%, 70%, and 93%; each
containing 0.3M ammonium acetate), keeping the slides in each for 30 sec.
8. Complete the dehydration process in a 100% ethanol bath (30 sec) and then
transfer the slides to a paper towel on the bench and allow them to air dry for 5 -10
min.
9. With the slides laid out flat on paper towels, scan each with a Geiger counter to get
a feeling for the levels of radioactivity associated with each (this will determine
roughly the exposure times for the autoradiography -- short or long exposure time),
and label each of them with some sort of identification number. These numbers
will need to be visible in the darkroom, under safelight illumination, so they are
best done with a magic marker, on a clear section of the glass that will not be
come in contact with the autoradiography emulsion (i.e., immediately adjacent to
the painted or frosted surface of the slide). Return the slides to tissue-tek
holder(s), clearly separated into "early" and "late" development groups. Since all
subsequent steps are performed in the darkroom under safelight illumination,
remember clearly exactly how you have allocated your slides.
Subsequent steps are performed in the darkroom under safelight illumination:
10. Place an aliquot of emulsion in alight-proof holder (half-filled with water) within a
42-45C water bath. Allow 10-15 min for the emulsion to melt. Also prewarm a the
slide mailer.
11. When the emulsion is melted, fill vertical slide mailer with emulsion.
12. Dip a clean (blank) slide in the emulsion and check for smooth, "bubble-free"
coating. One at a time, gently dip each experimental slide in the emulsion,
withdraw it and wipe the back with a glass slide or razor blade and then standing
vertically against the inner sides of drying boxes. Place the covers on the boxes so
that they are light-proof (which will allow you to open the door of the darkroom and
walk out) and allow slides to dry for 30 min. Return the unused emulsion from the
mailer tube to the centrifuge tube and return it to the refrigerator.
89
13. When the slides are dry, place each into black slide boxes, wrap in 2 layers of foil,
label with tape, and store in a -20C freezer.
90
4.2.5 Autoradiograph development & counter-staining

Materials
staining coplin jars
slide staining rack
cover slips
Reagents
Kodak D19 developer (diluted 1:1 with H2O)
H2O
Kodak rapid fixer

running water bath
60% ethanol bath
0.2% toluidine blue in 60% ethanol bath
acetone bath (2)
xylene bath (2)
entellen or permount mounting medium
METHOD
1.
2.
3.
4.
5.
6.
Remove slides to be developed from the freezer and allow the still foil-wrapped
boxes to come to room temperature.
In the darkroom, under safelight illumination, transfer the slides to a tissue tek slide
holder, and then place them first in the D19 developer for 2.5 min, then in the H 2O
for 15 sec, and finally in the fixer for 5 min. (Within a minute or two of transferring
the slides into the fixer, it is safe to turn on the lights).
Soak the slides in gently running water for 2 hours.
Transfer slides into 60% ethanol for 30 sec, then into the 0.2% toluidine blue in
60% ethanol for 30 sec
Dip the slides in the water bath 3 times and then transfer to the first acetone bath
for 2.5 min, followed by a second acetone bath for another 2.5 min.
Transfer to xylene #2 for 2.5 min, then to xylene #1 for 2.5 min (complete submersion
is required to remove all H2O, which will irreversibly turn the dehydrated emulsion opaque)
7.
Place a drop of permount on the slides and coverslip carefully, avoiding air
bubbles.
91
4.3 Semi-quantitative RT-PCR to detect cytokine mRNA

Polymerase chain reaction (PCR) amplification of cDNA from reverse-transcribed
mRNA is perhaps the most powerful method of detecting transcripts in cells. PCR
primers for most of the human and mouse cytokines are readily available commercially,
either as pre-packaged or as custom-synthesized products. The sequences for custom
synthesis are obtained from the scientific literature. The protocol proposed herein is a
generic one which is based on the GIBCO/BRL product instruction manual for their PCR
kit (Cat. No. 18089-011). Protocols specific for individual cytokines (see 5.5, Appendix
E: Human cytokine RT-PCR primers) are usually published with the sequences in the
literature, and using these will often circumvent your having to develop your own
protocol. The method is made semi-quantitative by virtue of amplifying cDNA for both
the cytokine of interest, as well as that of a house-keeping gene of interest (e.g., actin -many propose that the levels of actin mRNA change little as a result of cellular
stimulation), then comparing the signals of each reaction after the PCR amplification.
The ratios of the cytokine signal to that of actin will change if the mRNA levels for the
cytokine were altered as a result the original cell or tissue stimulus or pathophysiologic
process(es).
Materials
thermocycler
42 & 70C water baths & an ice bath
micropipetter (0.5-10l) and tips
horizontal gel electrophoresis apparatus and powerpac
Reagents
purified total cellular RNA (see 4.1.1)
oligo(dT)
DEPC-treated H2O
10x PCR buffer ()
50 mM MgCl2
10 mM dNTP mix (dATP, dCTP, dGTP & dTTP)
100 mM dithiothreitol (DTT)
M-MLV RT (murine Moloney Leukemia Virus reverse transcriptase; 200 U/ l)
3' & 5' oligonucleotide primers (target mRNA-specific; e.g., actin & cytokine primers)
92
Taq DNA polymerase

agarose
TAE buffer ( mM Tris/ mM sodium acetate/ mM EDTA; pH )
ethidium bromide (10 mg/ml)
DNA sample prep buffer
100 bp DNA oligonucleotide ladder (molecular weight standards)
4.3.1 First strand cDNA Synthesis using Oligo(dT) priming

This procedure is designed to convert 1 to 5g of total RNA into first strand cDNA
1. Prepare RNA/primer mixtures in sterile 0.5 ml tubes as follows:
2.
3.
4.
5.
6.
7.
1 to 5g total RNA
x l
oligo(dT)
1 l
DEPC water
to 12 l (total volume),
then mix and spin briefly.
Incubate each sample at 70C for 10 min to denature the mRNA and then incubate
on ice for at least 1 min.
Prepare the following reaction mixture, adding each component in the indicated
order (for n samples -- but prepare the reaction mix for n+1 reactions to ensure
sufficient levels for all reactions.)
Component
Each reaction (l)
10X PCR buffer
2
50 mM MgCl2
1
10mM dNTP mix
1
0.1M DTT
2
DEPC H2O
1
Add 7 l of reaction mixture to each RNA/primer mixture, mix gently, and collect by
brief centrifugation.
Incubate at 42C for 5 min.
Add 1 l (200 units) M-MLV RT to each tube, mix and incubate at 42C for 50 min.
Terminate the reactions at 70C for 15 min. Chill the tubes on ice. The samples are
now ready for PCR amplification reaction.
93
4.3.2 PCR amplification of the target cDNA

The first cDNA may be amplified directly using PCR. Use only 10% of the first
strand reaction for PCR. Adding larger amounts of the first strand reaction may actually
decrease the amount of product synthesized.
1. Make the 2x stock buffer (recipe for 500l):
100l 10x PCR buffer
30l 50 mM MgCl2
20l 10mM dNTP mix
350l DEPC H2O
2. Prepare the following reaction mixture (for n samples), and mix well.
25 x n l 2x stock buffer
0.5 x n l 3'-primer
0.5 x n l 5'-primer
21.5 x n l H2O
0.5 x n l Taq DNA polymerase
for each reaction, add 2 l RT reaction product to 48 l of above mixture (use 0.5ml tubes) and mix well.
3. Place the samples in the thermocycler, programmed as follows:
1 cycle
94C 3 min (initial denaturation)
30 cycles:
94C 30 sec (cycle internal denaturation)
55C 30 sec (primer-target annealing temp)
72C 1 min (primer extension rx)
hold at 72C for 7 min to complete the last extension, then hold indefinitely
at 4C until ready to analyse.
4. Analyze 5-20 l of the amplified sample by agarose gel electrophoresis.
94
4.3.2 Detection of RT-PCR products

1. Pour a 1.2% agarose-TAE buffer gel, approximately 7 mm thick, with sufficient lanes
to run each of the samples and a 100 bp DNA oligonucleotide ladder. (Be sure to
allow the gel to polymerize sufficiently such that the bottoms of the well do not
break when removing the well-forming comb.)
water
32.3 ml
agarose
0.26 g
40x TAE buffer
0.825 ml
10 mg/ml ethidium bromide
3.3 l
Heat the water/agarose to boiling in a microwave to dissolve the agarose, then cool
this solution to 56C and add the TAE and ethidium bromide .
2. Prepare the actin and companion cytokine PCR reaction products and 100 bp
molecular size standards for gel analysis by heating to 65C for 10 min in DNA
sample prep buffer containing 1l ethidium bromide.
5-20 l of the amplified sample
5-10 l DNA sample prep buffer
1 l ethidium bromide
3. Load the samples and 100 bp ladder into the wells and run at 50-70 mA until the
lead dye front has migrated approximately 2/3 of the way through the gel.
4. Place the gel on an ultraviolet light-box, and examine the banding patterns and
relative amounts of PCR products in each lane using computer-assisted image
analysis of the illuminated gel (or alternately by eye). Be sure that the individual
band signals have not reached the saturation point for the image analyser, or
accurate band comparisons will not be possible.
20
20
At temperatures above 56C the gel apparatus will warp badly, so do not pour the gel into the mold
until it is sufficiently cool
95
APPENDICES:
5.1 APPENDIX A -- GENERAL METHODS
5.1.1 Anti-sheep RBC antisera (preparation of)
1.
2.
3.
4.
5.
Mouse anti-SRBC antiserum can be prepared as follows:

Inject BALB/c mice with 200 l of a10% suspension of SRBC in PBS.
Two weeks later inject them again with 200 l of a 10% SRBC suspension.
Approximately one week later collect blood from the mice, and allow it to clot in a glass
tube, first for 1 h at room temperature and then overnight at 4C.
Inactivate the complement (C') cascade activity of the serum by heating it to 56C for 60'.
Titrate the serum for SRBC agglutination activity.
5.1.2 Cell counting with a hemocytometer

Materials
hemocytometer & coverslip
single cell suspension of cells to be counted
20 l micropipetter and tips
eppendorf tubes 0.5 ml
push button counter
microscope
Reagents
0.4% trypan blue in saline
METHOD
1.
Cap and gently invert or otherwise swirl cells several times to ensure an even cellular
distribution
2.
Withdraw 20 ul of cells to a 0.5 ml eppendorf tube and add an equal volume of 0.4% trypan
blue
3.
Pipette mixture up and down several times to mix the cells
4.
Transfer 10 - 20 l of the cell suspension to the hemocytometer (with coverslip in place).
Capillary activity will draw the cells under the cover slip and thereby fill the viewing chamber
5.
Examine the cells under the microscope, first at low power setting and when you have your
bearings under the scope, switch to higher magnification for actual cell counting.
6.
You will note that the chamber is divided up into 9 larger squares, each of which is in turn
subdivided. Count the total numbers of cells in each of 5 of the larger squares (e.g.,
central , left, right, top and bottom ones), noting the cell count in each. You should count all
cells that lie inside the boundary lines of the squares, and you should also count the cells
that fall on top of the lines delineating two of the four sides (for consistency, pick whichever
ones are easiest for you to remember, e.g., I always include those on the top and left-hand
side lines).
96
HEMOCYTOMETER FIELD
square cell count
1
2
3
4
5
mean
7.
8.
4
3
1
2
4
2.8
Determine the numbers of non-viable cells by counting the numbers of cells with nuclei that
are stained intensely blue (trypan blue is a vital stain for dying, but not healthy cells).
Calculate the mean number of cells (both viable and non-viable) in each of the 5 larger
squares. Each of these squares contains total volume of 0.1 mm 3 (or 10-4 cm3). In
addition, since you used equal volumes of cell suspension and trypan blue for counting, you
have diluted your cells two-fold. Therefore, to calculate the cell concentration (in cells/ml) in
your original cell suspension, take the mean numbers of cells in the large squares and
multiply by 2 (your dilution factor) and by 104 (volume adjustment). For example, if you had
a mean of 24 cells/large square, the concentration of your original cell suspension would be:
9.
24 x 2 x 104 = 48 x 104 cells/ml

To calculate the cellular viability in your preparation, use the following formula:
97
98
99
10.
Clean your hemocytometer immediately after use, using H2O followed by 70% ethanol, and
allow to air dry.
N.B. If your cell preparation includes clumps of cells, you have to decide whether you can get an
accurate estimate of the cell numbers with the clumps present. If you feel that the clumps
are evenly distributed in your original cell suspension, then you might simply vigorously
pipette the cells in the eppendorf tube (i.e., the trypan blue/cell mixture) to disperse the
clumped cells and then recount. However, if the cells are very badly clumped, you will have
to disperse the cells in the stock suspension, either by vigorous pipetting (which is very
inefficient) or by re-centrifuging and dispersing the cell pellet correctly.
5.1.3 C3b opsinization of yeast (zymosan A)

1.
2.
3.
Activate the zymosan A by boiling for 10 min in PBS and then washing with PBS.
Resuspend to a final concentration of 10 mg/ml.
To coat the zymosan beads with C3b, add 200 l of fresh mouse serum to 2 mg 'activated'
zymosan and incubate for 15 min at 37C.
Wash the yeast with PBS and store at 4C until ready to use.
5.1.4 Cytocentrifuge preparations
The cytocentrifuge is simply a centrifuge that deposits cells from a suspension culture
directly onto a microscope slide, usually in an area about 6 -8 mm in diameter. It is an ideal
way to prepare the cells for microscopic examination. Ideally, you want to have somewhere
in the order of 5x104 - 105 cells/slide.

Materials
cytocentrifuge (with chambers, clamps, filters, etc...)
glass microscope slides
METHOD
1.
2.
3.
4.
5.
prepare cell suspension of 5x105 - 106 cells/ml

assemble centrifuge chambers with labeled slides and filters in correct orientation and load
chambers into the centrifuge.
add 50 - 200 l of cells to each chamber (depending on the cell numbers, concentrations,
etc...)
centrifuge the cells for 4 - 5 min at 1500 rpm
when the rotor stops, remove slides from the chambers (being careful not to scrape the cells
off of the slides in this process) and allow the cells to air dry (alternately, you can fix the cells
in acetone or alcohol for 15 sec and then air dry)
100
6.
clean the disassembled chambers and clamp assemblies with H2O and allow to air dry after
use.
the air-dried cells can be stained immediately or, depending on their purpose, stored either at
room temperature or in the freezer.
7.
Dialysis tubing (preparation)
Dialysis tubing can be prepared well in advance and stored in the refrigerator for extended
periods of time. It is sometimes to convenient to prepare a very large batch so that you will have
it on hand whenever you need it. Most dialysis tubing has been treated with glycerol by the
manufacturer in order to prevent excessive drying out (and cracking) during storage -- for most
purposes, this glycerol should be removed from the tubing before use.
Materials
hot plate
beakers
dialysis tubing of required size (and molecular weight cut-off)
Reagents
0.05% EDTA (0.5 g/l; or 3.4 ml of 0.5 M stock/996.6 ml H 2O)
0.05% Na2CO3 (0.5 g/l H2O)
distilled H2O
50%ETOH
METHOD
1.
cut tubing to suitable sizes, allowing for tying or clamping ends or prepare large sections
2.
boil the sections of tubing for 10' in 0.05% EDTA
3.
boil a second time for 10' in 0.05% Na2CO3.
4.
boil a third time for 10' in 0.05% NaCO3.
5.
rinse several times with H2O and, finally, store at 4C in 50% ethanol (keep the beaker
covered with parafilm)
5.1.6 Fixation of tissues for ISH or IHC.
Fix 3-6 mm blocks of tissue for 3 h (or cell suspensions for 30 min) on ice in ISH fix (5.3), then
transfer the tissues/cells to 70% ethanol and store at -20C until ready to process to paraffin blocks by
routine methods.
N.B. The signals from both ISH and IHC procedures seem to be superior if the tissues are processed to
paraffin expeditiously rather than holding them for prolonged periods in 70% ethanol.
5.1.7 Lung cells (single cell suspension)
Single cell suspensions of lung cells are very useful for the determination of immunologic reactivity
of the lung associated immune compartment. The lungs of animals undergoing strong
pulmonary challenges with allergen or other disease agents often contain very high numbers
101
of perivascular and peribronchial lymphoid cells, and in some species these animals also
develop discreet collections of BALT. The immunologic reactivity of the lung tissues can be
profoundly different than that of the spleen or other non-pulmonary lymphoid organs.
Materials
mice, anaesthetic, surgical instruments, hemocytometer
CO2 incubator, 15 ml polypropylene tubes
Reagents
DMEM-10%, MEM
density gradient media (e.g., Lymphocyte Separation Medium, Percoll...; optional)
collagenase (Worthington Scientific); hyaluronidase (Worthington Scientific)
MEM containing 1.5 mg/ml collagenase and 0.75 mg/ml hyaluronidase
METHOD
1.
2.
3.
4.
5.
6.
Obtain lung tissues and dice them finely (to 0.5 mm 3) with a scalpel, in MEM medium.
Transfer the tissues into fresh MEM containing collagenase/hyaluronidase (1 g tissue/10
ml enzyme cocktail) and incubate at 37C for 60 min, ideally on a rocker platform.
Disperse any undigested fragments of tissue by repeated aspirating through a 20 ga.
needle on a10 ml syringe.
Filter the digested tissues through 4 layers of sterile gauze to remove undigested tissue
fragments, and wash the dispersed cells in DMEM-10%.
Either use the cells directly or, if necessary, carry on with the purification, fractionating the
cells by density gradient centrifugation.
Determine the cell yield and viability by direct counting of trypan blue-treated cells using a
hemocytometer.
5.1.8 Lysis of red blood cells
There are a number of options available for lysing contaminating RBC's in a cell preparation,
including commercially available preparations. One of the most simple is hypotonic lysis, which
takes advantage of the fact that red cells undergo lysis in H2O very quickly, while nucleated cells
are damaged much more slowly. Therefore, a very brief pulse with H2O will lyse all of the red
cells and leave the WBC intact. Alternately, you can lyse them by incubation in ammonium
chloride lysis solution for 5 min
5.1.8.1 Hypotonic lysis with H2O
1.
2.
3.
Sediment all of the cells in your preparation by centrifugation, and aspirate all of the
medium from the cell pellet.
Briskly flick the tube to resuspend the cell pellet (to an even paste on the walls of the
tube).
Start a countdown timer set to 25 or 30 seconds and, when it reaches 15 seconds, add 9
volumes of double distilled H2O to the cells and vortex the tube by hand to rapidly disperse
the cells throughout the H2O.
102
4.
5.
When the clock reaches 0 seconds, add 1 volume of 10x HBSS to the H 2O suspension of
cells and rapidly disperse it throughout the cell suspension by swirling or inverting the
(capped) tube. TIMING IS CRITICAL!
Wash the cells two times in DMEM-0% FCS to get rid of the RBC ghosts (plasma
membranes).
5.1.8.2 Lysis with ammonium chloride

1.
Perform steps 1 & 2 as above in the hypotonic lysis protocol
2.
Resuspend the cells in 5 ml of ammonium chloride lysis solution and let stand for 5 min.
3.
Wash the cells two times in DMEM-0% FCS, as above
5.1.9 Opsinization of SRBC with antibody

1.
2.
3.
Generate a 0.5% suspension (vol/vol) of sheep red blood cells 21 (SRBC) in PBS.
To coat the cells with anti-SRBC, add 50 l of heat-inactivated mouse anti-SRBC serum to
300 l of the SRBC suspension, and incubate for 30 min at room temperature. (anti-SRBC
antiserum can be generated by vaccinating a mouse with 0.2 ml of 0.1% SRBC, and
bleeding it 3 wk later).
Wash the cells with medium and store at 4C until ready to use.
5.4.10 Protein assay in microtiter plates

Materials
pipettes, tips, multichannel pipetter
96 well plate
microplate reader
filter paper Whatman #1
Reagents:
Bio-Rad concentrated dye reagent
protein standard (we will use bovine serum albumin; BSA)
METHOD:
1.
dilute dye reagent 1:5 with H2O (ie. 1 part reagent + 4 parts H2O), and filter through
2.
3.
21
Whatman #1 filter paper. (store at 4C; stable for 2 weeks)

dilute BSA standards to a range that should bracket that of the unknowns -- try standards of
5.0, 10, 25, 50, and 100 g/ml.
Pipette 160 l of standard and sample solution into separate wells of the microtitre plate
SRBC are obtained by venipuncture (usually the jugular vein) of sheep directly into EDTAcontaining syringes or alternately into regular syringes followed directly by transfer of the blood into
EDTA-containing tubes. The cells are washed two times with Alsevers solution (see Appendix C)
and resuspended in Alsevers solution, which is a good long-term storage reagent for SRBC.
103
4.
5.
Add 40 l of the diluted dye reagent to each well and mix the samples thoroughly by
repeated pipetting. Incubate the plates at room temperature for at least 5 min, but no more
than 1 h.
Measure the absorbance at a wavelength of 595 nm.
5.1.11 Splenocytes (single cell suspensions)
Materials
BALB/c mouse
clinical centrifuge, 15 ml centrifuge tubes (polypropylene [pp], not polystyrene [ps])
Reagents
DMEM/10% FCS (Appendix B)
70% ethanol
optional:
sterile surgical tools (scissors, forceps)
METHOD:
1.
Euthanize a mouse (e.g., BALB/c) by inducing surgical-level anaesthesia with
methoxyfluorane and dislocating the cervical spinal column. To dislocate the cervical spine
effectively, place the mouse down on the bench in sternal recumbancy (belly down), firmly
place an instrument (e.g., forceps or closed scissors) across the back of the neck and
holding the mouse in position with this instrument, firmly, but not too forcefully, pull the
mouse backwards by the tail. You will hear a popping sound as the neck dislocates.
2.
When the mouse ceases breathing (very shortly after step 1), lay it on its right side, and
soak the left side with 70% ethanol. Holding the skin over the spleen up into a tent, incise it
with a pair of scissors, and then grasp both sides of the incision firmly between the thumb
and forefinger of each hand. Pull the skin open and reflect it full back, both dorsally and
ventrally.
3.
Open the body wall over the spleen with the scissors, pull the spleen up from the other
viscera and clip away the vascular attachments and fat. Place the spleen in a petri dish
containing DMEM-0%FCS and tease the tissues apart using two pairs of fine, curved
forceps. Continue teasing until all of the tissue clumps are dispersed as much as possible.
4.
Using a pipette aid (electrical pipetting device) and a 10 ml pipette, vigorously pipette the
cells 20 - 25 times, to completely break up the clumps. Filter the dispersed spleen cell
preparation through 3 - 4 layers of sterile gauze drawn across the top of a 15 ml centrifuge
tube. Remove 20 l of the filtrate (now a single cell suspension) for hemocytometer
counting.
5.
Wash the cells once by centrifuging and resuspending to the desired final concentration in
the desired medium. For our purposes, this will usually be 3x106 cells/ml of DMEM-10%
FCS. From one normal mouse spleen, you may obtain anywhere from 2 - 12x10 6 nucleated
cells.
104
5.1.12 Splenocytes (spleen cell-conditioned medium)
Materials
single cell suspension of spleen cells
clinical centrifuge, 15 ml centrifuge tubes (polypropylene [pp], not polystyrene [ps])
Reagents:
DMEM/10% FCS (Appendix B)
concanavalin A (4 mg/ml stock solution in PBS, or DMEM or RPMI, etc..)
METHOD
1.
Generate a single cell suspension of spleen cells from a normal mouse with a cell
concentration of 3x106 cells/ml of DMEM-10% FCS. Set up the cells in a T75 flask.
2.
Add ConA to the cultures to a final concentration of 4 g/ml and place the cells in the CO2
3.
4.
incubator for 4 days.

Prior to harvesting the cells, examine the cultures to confirm that the cells have aggregated
as they should following ConA stimulation. Provided the cells appear as they should,
transfer them to 50 ml centrifuge tubes and sediment the cells by centrifugation for 10 min at
1500 rpm.
Aliquot the supernatants and store at either -20C or -80C. This conditioned medium will
keep its activity for many months.
105
5.1.13 Staining Protocols

5.1.13.1 Giemsa stains
5.1.13.1.1 Wrights-Giemsa staining and morphologic identification of PBL
Materials
cytocentrifuge cell preparations, etc..
Wrights-Giemsa stain (10% Wrights-Giemsa solution in buffer)
neutral buffered water
METHOD
1.
Apply 50 - 100 l of stain to the cells on each slide, and allow to sit for 10 min.
2.
flush the scum from the slide with 0.5 ml of buffered water
3.
Add 100 l of neutral buffered water to the cells, incubate for 1 min, then air dry standing up.
4.
Mount coverslips on the slides with Permount or Entellen
5.
Examine the cells under 40x - 100x power using a compound microscope. The cells can be
differentiated based on their staining and morphology, as in figure x.
Results
The appearances of the different types of mouse PBL following Giemsa staining are
demonstrated below. In effect:
POLYMORPHONUCLEAR CELLS (all have highly lobulated nuclei)
--eosinophils have rather large, red-stained cytoplasmic granules that fill all of the
extranuclear compartment of the cells.
-- neutrophils have rather small, pale pink-stained cytoplasmic granules that fill the
extranuclear compartment of the cells.
--in the mouse, basophils are present in such low numbers that some authors state that mice
do not have basophils. They appear much like monocytes, with one or two medium-sized
deep purple-staining granules. You probably will never see a mouse basophils (unless you
begin working with these cells.
MONONUCLEAR CELLS (all have round to slightly indented nuclei)
-- lymphocytes are present in substantial numbers in a number of compartments. Most
circulating lymphocytes are unstimulated ones and appear as very small cells that contain
large nuclei. In fact, often the cytoplasm appears as a small rim of powder blue-coloured
cytoplasm. Activated lymphocytes (plasma cells) tend to be large, with nuclei the same size
as that of the small lymphocytes, but they have abundant cytoplasm. The nuclei are usually
very round, with few if any indentations.
monocytes are much like large lymphocytes, but the nuclei are usually indented.
These are very simplified descriptions of the WBC, but they will probably serve to fulfill most of
your needs as far as differentiating these cells.
5.1.13.1.2 Giemsa staining of tissue sections
106
Materials
tissue sections on slides
Giemsa stain
xylene, 100% ethanol (& 95, 70, & 50%)
isopropanol
METHOD
1.
Deparaffinize and rehydrate the tissue sections (2x 5' in xylene; 2x 30" 100% ethanol; 1x 30"
95% ethanol; 1x 30" 70% ethanol; 1x 30" 50% ethanol.
2.
Transfer the slides into the Giemsa stain bath & hold for 1 - 2 h . After one hour, rinse the
slides with water as in step 3 and briefly look at the sections under the microscope. If they
appear sufficiently stained, proceed with step 4, if not continue staining until the desired
intensity of stain is achieved.
3.
Briefly rinse the slides in tap water.
4.
Dehydrate the slides by transferring through three baths (2.5 min each) of isopropanol, one
bath (2.5 min) isopropanol/xylene [1:1]; and two baths of xylene (5 min each).
5.
Mount coverslips on the slides with Permount or Entellen
5.1.13.2 Gills hematoxylin for IHC
Materials
Gill's hematoxylin solution (1:5 dilution of commercial stain in H2O)
10% methanol, Tris-buffered saline (TBS), H2O
Aqueous mounting medium
METHOD
1.
Transfer the IHC-stained slides from H2O into the Gill's stain for 45 sec
2.
3.
4.
Transfer the slides quickly through 10% methanol (three quick dips to get rid of excess stain).
Transfer the slides into the TBS for 1 min (to blue or differentiate the stain), then into the
H2O bath until ready for cover-slipping.
Cover-slip the slides with aqueous mounting medium.
5.1.13.3 Toluidine blue staining (ISH counter-stain)

Materials
0.2% toluidine blue in 60% ethanol
xylene, 60% ethanol, isopropanol,
50% isopropanol/50% xylene
METHOD
107
1.
Place the water-washed, developed ISH slides into the 60% ethanol bath for 3 min
3.
Transfer the slides to 0.2% toluidine blue in 60% ethanol and hold for 30 seconds, then
quickly rinse the excess stain from the slides by dipping in water.
Transfer the slides through two changes of isopropanol (2.5 min each), one change of 1:1
isopropanol:xylene (2.5 min), and finally two changes of xylene (also 2-3 min each).
Cover-slip the slides with permount.
2.
4.
5.1.14 Standard curves (e.g., cytokines)
For a number of different assays, you will need to perform serial dilutions to generate standard
curves. Depicted is a typical set of dilutions (this one for TNF, for use in the L929 cell
cytotoxicity assay).
1.
Label a series of eppendorf tubes (in this case, 40, 4, 0.4, 0.04, & 0.004 U/well), and add
199 l of standard dilution medium (DMEM-0% FCS/ActD) to the first and 180l to the
others.
2.
To the first tube, add 1 l of stock cytokine (in this case, 1 l of stock TNF = 400 U), such
that 20 l of the resulting solution will contain the amount of cytokine needed for your highest
standard concentration (here, 20 l of the '40' tube will now contain 40 U TNF). Serially
transfer 20 l from each tube to the next tube in the row, such that you are performing serial
10-fold dilutions. Each time you add the 20 l to the next tube, make sure that you
thoroughly mix the tubes before withdrawing the 20 l for the next step. You don't need to
change pipette tips between tubes.
1 l
TNF
stock
final, TNF U/well:

Vol TNF/eppendorf:
Vol. DMEM/ActD:
3.
20l
40
20l
20l
.4
20l
.004
.04
40
4.0
0.4
0.04
1 l
20l
20l
20l
199 l
180l
180l
180l
0.004
20l
180l
To add the standards to the plate, start adding the most dilute one to the replicate wells, and
sequentially move up the concentration gradient. This way you won't have to change pipette
tips for each standard in the series, unless you contaminate a tip in the process.
5.1.15 TESPA-treatment of glass slides for in situ hybridization or histology
108
1.
2.
3.
4.
Loss of tissue sections from glass slides during ISH or routine histology can be a real
problem. Fortunately, it is one that also is easily overcome by pretreating the slides with
TESPA (aminopropyltriethoxysilane or organosilane)
Load slides into the glass racks and bake for 3 h at 300C. Since the glass racks are of cast glass,
they break very easily with rapid heating and cooling, so warm and cool them gradually - that
means put them in a cold oven and then turn on the heat and also allow them to cool completely
before removing them from the oven.
Wash the slides in a 2% solution of organosilane in high-grade acetone for 1 min with gentle
agitation.
Rinse the slides in high-grade acetone for 1 min and air-dry.
Store the slides at room temperature indefinitely.
(N.B. If section or cell loss from the slides is still a problem, even greater adhesiveness can be
achieved by treating the dried slides after step 3 with a 10% formaldehyde solution for 60
min, followed by air drying)
109
5.2 APPENDIX B -- REAGENTS & SOLUTIONS

CELLULAR IMMUNOLOGY REAGENTS
Acidified isopropanol, for use in solubilizing the water-insoluble formazan precipitate formed within
the mitochondria of cells cultured in the presence of MTT. To prepare acidified isopropanol, add
376 l of concentrated HCl to 100 ml of isopropanol. Store at room temperature in an amber or
foil-wrapped bottle.
Actinomycin D is a potent transcription inhibitor that is used routinely in the TNF assay to increase the
sensitivity of the L929 cells to the cytotoxic effects of TNF. We prepare it as a 5 mg/ml solution
(or perhaps more accurately suspension) in 95% ethanol. It should be agitated by vigorous
pipetting before aliquots are removed for use.
Alsevers solution
Recipe for 1 liter
To 900 ml of H2O, add:
20.5 g dextrose (>114 mM)

7.9 g sodium citrate-2H2O (> 27 mM)
dissolve the reagents & adjust pH to 6.1 with 1M citric acid

Add H2O to 1000 ml & filter sterilize
Ammonium chloride
For lysis of red blood cells.
Recipe for 1 litre:
2.42 g Tris
7.56 g NH4Cl
pH to 7.2 with HCl

Ammonium sulfate (saturated solutions)
Recipe for 100 ml:
76 g of ammonium sulfate
bring to a near boil
allow to cool & then sit overnight at room temperature.
(the solubility of ammonium sulfate is 76 g/100 ml at 100C)
Borate-buffered saline
For dialysis with purified IgM antibodies.
Recipe for 1 liter
5.72 g sodium borate
110
8.76 g sodium chloride

pH to 8.5 with 1 M NaOH
ELISPOT & ELISA Carbonate Coating buffer
Recipe for 1000 ml
1.6 g Na2CO3 (>15 mM)
2.9 g NaHCO3 (>35 mM)

0.2 g NaN3 (>3.1 mM)
dissolve the reagents & adjust the pH to 9.5 with NaOH.

Autoclave to sterilize.
111
Isotonic Percoll Density Gradient Medium

To prepare any amount of isotonic Percoll, mix together:
9 volumes of stock Percoll (purchased from Pharmacia as a 100% solution)
1 volume of 10x HBSS (Ca++ and Mg++-free)

This will make the Percoll isotonic with the cells to be fractionated on the gradients.
PAGE running buffer (5x; Tris-glycine)

Recipe for 1 litre
To 800 ml of H2O , add:
15.1 g Tris base

72 g glycine
5.0 g SDS
dissolve contents and add H2O to 1 liter (do not adjust pH)
store at 4C and dilute 5x with H2O before use
PAGE 2x sample prep buffer (denaturing, but not reducing)

Recipe for 25 ml
To 10 ml of H2O , add:
6.25 ml of PAGE 4x stacking gel buffer
5 ml glycerol
1 g SDS
0.25 mg bromophenol blue
add H2O to 25 ml final volume and mix.
aliquot and store at -70C
PAGE gel fix buffer

25% (vol/vol) isopropanol
10% (vol/vol) acetic acid
(can be stored indefinitely at room temperature)
Phosphate-buffered saline (PBS)
Recipe for 1000 ml
0.23 g NaH2PO4 (anhydrous; > 1.9 mM)
1.15 g Na2HPO4 (anhydrous; > 8.1 mM)

9.0 g NaCl (>154 mM)
dissolve the reagents & adjust the pH to 7.2-7.4 with 1 M NaOH or 1 M HCl.
Autoclave to sterilize.
It may be convenient for you to make this up as a 10x PBS solution, that can
simply be diluted 10-fold and used as is.
112
Giemsa Stain (prepare fresh each time)

Recipe for 125 ml
To 100 ml of distilled water, add:
2.5 ml of Giemsa stock solution
3.0 ml of methanol
11.0 ml of 0.1 M citric acid
6.0 ml of 0.2 M disodium phosphate buffer
Briefly stir to mix ingredients before use.
Giemsa Stock Solution (for Giemsa stain)
Recipe for 100 ml
To 25 ml of glycerol, add:
3.8 g Giemsa powder
Heat the glycerol to 60C for 2 h, and work the stain into the glycerol
(either with a mortar and pestle or stirring)
Add 75 ml methanol and continue stirring overnight.
Store at room temperature indefinitely
0.4% Trypan Blue (in PBS) is a vital dye (i.e., is used with live cells) that is not taken up by viable cells, but
is taken up by effete cells. The nuclei of these cells stain an intense blue colour, while fully dead cells or
live ones take up no dye. The dead ones can usually be distinguished morphologically from the live
ones. For use in hemocytometer counting of cells, dilute the cell samples 1:1 with 0.4% trypan blue.
MOLECULAR BIOLOGY REAGENTS

Agarose/formaldehyde/MOPS gel (for electrophoresis of RNA)
Recipe for 220 ml gel (scale down as necessary):
137 ml of DEPC-treated H2O
2.64 g agarose
dissolve the agarose in the water in the microwave or a boiling water bath &
allow the solution to cool to 56C, then add:
39 ml of formaldehyde
44 ml of 5x MOPS buffer
pour the 56C solution into the gel casting apparatus, &
allow to cool completely before removing the well combs.
Cesium Chloride (for isolation of total cellular RNA)
Recipe for 100 ml of CsCl:
95.97 g CsCl
0.83 ml 3M sodium acetate (pH 6.0)
Add H2O to 100 ml, DEPC-treat and autoclave
DEPC-treated water (& other solutions)
113
All water and solutions for use with RNA must be treated with diethylpyrocarbamate (DEPC) before
coming into contact with the RNA. To treat a solution, just add DEPC directly to the solution to 0.1%
final concentration with a pipette and shake the solution vigorously to disperse the DEPC (allow any
built up pressure to escape from the vessel periodically, i.e., every minute), then allow the treated
solution to sit 12 h at room temperature or at 37C, then autoclave to hydrolyze the residual DEPC.
(Tris containing solutions cannot be treated with DEPC, which reacts rapidly with the amines in the Tris)
Dithiothreitol (DTT; 1 M) is used in many solutions to prevent non-specific interactions between sulfhydryl
groups. It is heavily used for the in situ hybridization protocols employing 35S-UTP probes. For the
washing steps of the ISH protocols, 2-mercaptoethanol can be substituted.
EDTA (0.5M); pH 8.0
To prepare 100 ml of 0.5 M EDTA, to 18.61 g of EDTA, add 90 ml of H 2O. To dissolve the EDTA,
pH the solution to>pH 8.0 (by adding 10M NaOH). After dissolution of the EDTA, re-adjust pH to 8.0.
Guanidinium Isothiocyanate (GSCN); 5.5 M

Recipe for 100 ml of 5.5 M GSCN:
64.98 g. guanidine thiocyanate
0.735 g. sodium citrate
0.5 g. sarcosine
add DEPC-H2O to 98.6 ml & adjust the pH to 7.0
add 1.39 ml 2-mercaptoethanol

and filter sterilize
(ref: Okayama, Kawaichi et al., Meth Enzymol 154:3-29)
ISH 10x salts (store @ -20 or -70C)

To prepare 10 ml, sequentially add to a 15 ml polypropylene centrifuge tube
114
ISH hybridization buffer (store @ -20 or -70C)

To prepare 2.5 ml, sequentially add to a 15 ml polypropylene centrifuge tube:
1200 l of deionized formamide
480 l of 50% dextran sulfate (to decrease viscosity,
pre-warm in microwave oven, & use a 5 ml pipette)
(vortex vigorously at this point to thoroughly disperse the dextran sulfate)
240 l of 10X salts
(vortex before pipetting)
24 l 1M DTT
24 l yeast tRNA (10 mg/ml)
480 l DEPC-H20
2448 l ( total volume)
vortex vigorously again to completely mix the reagents &
check/adjust the pH (with paper) to 5.5 - 6.0 (use about 10-12 l of 1M HCl)
ISH fixative (prepare fresh each time)
To prepare 100 ml, add together:
85 ml of 100% ethanol (RNAse-free)
10 ml of 40% stock formaldehyde (use a high grade of chemical)
5 ml of glacial acetic acid
briefly mix, then store on ice until ready for use. Fix 3-6 mm blocks of tissue for 3 h on ice
(or cell suspensions for 30 min), then transfer the tissues/cells to 70% ethanol and store
indefinitely at -20C -- although it seems to be better to process tissues to paraffin blocks (by
routine methods) than to hold them for prolonged periods in 70% ethanol.
Northern blotting pre-hyb/hybridization solution

To prepare 30 ml, mix together:
15 ml of deionized formamide
375 l of salmon sperm DNA (s.s. DNA; boiled)
(add the hot DNA to the formamide and vortex vigorously to completely disperse it, and then
continue adding the rest of the ingredients
3 ml of 1 M HEPES
1.5 ml of 10 M NaCl
300 l of 0.5M EDTA (pH 8.0)
3 ml 50X Denhardt's
3 ml of 10% SDS
1.5 ml of 10% Na pyrophosphate
2.32 ml of DEPC-H2O
MOPS (1 M)
231.28 g MOPS powder
add DEPC-H2O to 1000 ml, and filter sterilize (0.45 m filter)
5X MOPS Buffer
115
MOPS
sodium acetate
EDTA (pH 8.0)
Add DEPC- H2O
0.2 M
50 mM
5 mM
to 1000 ml
(200 ml 1M)
(16.6 ml 3M; pH 7)
(10 ml 0.5 M)
Phenol (salt-saturated)
this recipe produces a very stable phenol solution. It stability largely arises from the extra anti-oxidants added
relative to many other recipes (recipe, Dan Tenen, Harvard Medical School)
100g phenol (heat in a 56C water bath to melt the phenol
45.4 ml 2 M Tris pH 7.5
59.02 ml DEPC-treated H2O
11.35 ml m-cresol
454 l 2-mercaptoethanol
227 mg hydroxyquinolone
Reagents for purifying DNA from agarose gels (store in the dark at 4C)
NaI solution to dissolve agarose gel. To prepare 100 ml, add together:
90.8 g NaI
1.5 g Na2SO3
add DEPC-H2O to 100 ml & mix the solution
filter through Whatman #1 filter paper and then

place 0.5 g Na2SO3 into a piece of dialysis tubing, tie off the ends &
drop it into NaI solution (to keep it sodium sulfate-saturated.
Ethanol wash solution (store at -20C)
50% EtOH
0.1 M NaCl
10 mM Tris (pH 7.5)
General purpose restriction endonuclease buffers

(no, low, medium & high salt)
reagent
Tris/HCl (pH 7.5)
MgCl2
none
100 mM
100 mM
salt level
low
100 mM
100 mM
medium
100 mM
100 mM
.
high
100 mM
100 mM
dithiothreitol
BSA (mg/ml)
NaCl
10 mM
1
0M
10 mM
1
0.5 M
10 mM
1
1.0 M
10 mM
1
1.5 M
RNA sample prep buffer (Northern analysis)

5X MOPS
200 l
116
formamide
formaldehyde
H2O
484 l
61 l
186 l
denature RNA in sample prep solution for 15' @ 65C

RNA sample dye/loading buffer (for visualization of progress during Northerns)
glycerol (final - 50%)
5 ml
0.5M EDTA (pH 8.0) (final - 1 mM)
20l
bromophenol blue (final - 0.4%)
40 mg
xylene cyanol (final - 0.4%)
40 mg
DEPC-H2O
5 ml
add 2 l of loading solution to each sample
RNAse A (heat-inactivated to remove DNAse activity; 10 mg/ml)

Prepare 10 mg/ml RNAse solution in 10 mM Tris (pH 7.4), 15 mM NaCl. Heat-inactive the DNAse by
incubating for 15 min at 70C & then aliquot and store @ -20C.
Salmon sperm DNA
weigh out DNA, wet with a little EtOH, then add sufficient H2O to bring the DNA to a final concentration of 10
mg/ml. Shear the DNA by forceful passage through a18 ga needle & denature it by boiling for 10 min.
Aliquot and store at -20C. (boil again before use)
Sodium acetate (3M)

40.8g sodium acetate
H2O, qs to 100 ml; pH > 6.0
treat with 0.1% DEPC, and autoclave
117
20X SSC (4 liters)

NaCl
701.2 g
Na citrate
352.9 g
add H2O to 3 liters, pH to 7.0, and then H2O qs to 4 liters.
STE buffer
Tris
EDTA
NaCl
H2O
10 mM
1 mM
0.1 M
(0.5 ml of 2M)
(200l of 0.5M)
(1 ml of 10M)
qs to 100 ml
118
5.3 APPENDIX C -- TISSUE CULTURE MEDIA

Click's medium, 10% FCS, 2 mM L-glutamine, 1% antibiotic/antimycotic solution (Gibco; stock: 100
U/ml penicillin G, 100 g/ml streptomycin sulfate, and 0.25 g/ml amphotericin B), 5x10 -5 M 2mercaptoethanol, and 10% Con A-stimulated mouse spleen cell-conditioned media)
DMEM (Dulbecco's modified eagles medium; AKA Dulbecco's minimal essential medium).
This is a general purpose medium, which can be purchased either pre-made or as a powder,
from GIBCO. We generally have ours made up from powder by the Glassware & Media
Preparation (GMP) laboratory in the department. In general, they prepare it with a bicarbonate
buffer and L-glutamine, so that it is ready to be used as is. However, since L-glutamine degrades
at 4C, then after a few weeks of storage, you need to supplement the DMEM stocks with Lglutamine.
DMEM-0% FCS. For use in situations wherein you don't want any serum in your medium. Use the
stock GMP DMEM: to 980 ml of DMEM, add 10 ml of 100x antibiotic/antimycotic solution from
GIBCO (stock: 100 U/ml penicillin G, 100 g/ml streptomycin sulfate, and 0.25 g/ml
amphotericin B), 10 ml of 5x10-3M 2-mercaptoethanol (and, if the medium is old, 10 ml of 100x Lglutamine).
DMEM-10% FCS. To 900 ml of DMEM-0% FCS, add 100 ml of heat-inactivated fetal calf serum.
Heat-inactivate by incubating the pre-warmed serum in a 56C waterbath for 30-45 min. For
DMEM-5% FCS, etc, reduce the amounts of FCS proportionately, and increase the amounts of
DMEM-0% FCS.
DMEM-10% normal horse serum. With the exception that the serum source is different (i.e., normal
horse vs fetal calf), this medium is the same as indicated for DMEM-10% FCS. DMEM-10%
normal horse serum is used for the L929 cells in the TNF assay.
HBSS (Ca++ and Mg++-free) This can either be purchased from GIBCO or prepared from scratch. A
recipe for this reagent can be found in Current Protocols in Immunology. It is very convenient to
purchase this as a 10x concentrated solution, for use in hypotonic lysis of red blood cells or in
diluting Percoll
MEM (minimal essential medium) This is an alternate general purpose medium, which can be
purchased either pre-made or as a powder, from GIBCO. As with our DMEM, we have ours
made by GMP, with bicarbonate buffer and L-glutamine.
RPMI 1640 (Roswell Park Memorial Institute medium #1640). This is an alternate general purpose
medium, which can be purchased either pre-made or as a powder, from GIBCO. As with our
DMEM, we have ours made by GMP, with bicarbonate buffer and L-glutamine.
RPMI-0% FCS. For use in situations wherein you don't want any serum in your medium. Use the
stock GMP RPMI: to 980 ml of RPMI, add 10 ml of 100x antibiotic/antimycotic solution from
GIBCO (stock: 100 U/ml penicillin G, 100 g/ml streptomycin sulfate, and 0.25 g/ml
amphotericin B), 10 ml of 5x10-3M 2-mercaptoethanol (and, if the medium is old, 10 ml of 100x Lglutamine).
RPMI-10% FCS. To 900 ml of RPMI-0% FCS, add 100 ml of heat-inactivated fetal calf serum. Heatinactivate by incubating the pre-warmed serum in a 56C waterbath for 30-45 min. For RPMI-5%
FCS, etc, reduce the amounts of FCS proportionately, and increase the amounts of RPMI-0%
FCS.
119
5.4 APPENDIX D -- MAINTENANCE OF CELL LINES

7TD1 cells (for assay of IL-6). 7TD1 cells are an IL-6 dependent murine hybridoma cell line that can
be purchased from the American Type Culture Collection (ATCC #CRL ). They are maintained in
RPMI 1640, 10% FCS, L-glutamine, antibiotics, 5x10-5M 2-Me and require a source of IL-6.
7TD1 cells are normally adherent, and are passaged with versene and trypsin. They must be
maintained in a subconfluent state (i.e., 1x105 cells/ml), or they will lose their IL-6
responsiveness. In our hands, these cells are responsive to bovine, equine, murine and human
IL-6. We maintain our cells in recombinant human IL-6.
Cl.MC/C57.1 cells (C57 mast cells). Cl.MC/C57.1 cells are an Fc RI-positive, transformed murine
mast cell line, that was ostensibly originally derived from the liver of a C57/Bl6 mouse. Recent
molecular phenotyping evidence indicates that these cells arose instead from BALB/c mice.
They are maintained in DMEM-10% FCS, and are a very potent source of many cytokines.
These were the cells originally used to examine the production of many cytokines in mast cells.
L-929 cells (for TNF bioassay). The line of L-929 cells that we are using are exquisitely sensitive to
the effects of TNF (ATCC # ). TNF will kill these cells with the kinetics observed with natural
cytotoxic cells (i.e., 18 h), as opposed to natural killer cells (which require much less time to kill
their targets). L929 cells are maintained in DMEM, 10% normal horse serum, L-glutamine,
penicillin, streptomycin, fungisone (PSF), and 5x10-5 M 2-mercaptoethanol. The cells are
necessarily maintained at sub-confluent levels (over-growth dramatically diminishes their
sensitivity to TNF). They comprise an adherent cell line, that is best split by minimal trypsin
digestion in medium lacking FCS, followed quickly thereafter by washing with regular growth
medium to prevent over-digestion of the cells.
LM-1 cells (for assay of IL-1). LM-1 cells comprise a sub-clone of the IL-1-responsive ATCC cell line
D10.G4.1. They were sub-cloned by the immunologists at VIDO (U of S), and were selected in part
because, unlike thymocytes, they do not require sub-mitogenic doses of mitogens (e.g., ConA or
PHA) in order to respond to IL-1. They are maintained in Clicks-10% FCS, supplemented with 10%
Con A-stimulated mouse spleen cell-conditioned medium.
Pu5-1.8 cells (macrophage cell line) subconfluent monolayer cultures of Pu5-1.8 cells (ATCC #) in
DMEM-10% FCS. Pu5 cells were one of the lines originally used to clone murine TNF,
primarily because of the fact that they produce enormous amounts of the cytokine relative to
most macrophages or macrophage cell lines. Unlike more cell lines, Pu5 cells always look
horribly unhealthy in culture.
120
5.5 APPENDIX E -- Binding affinities of Immunoglobulin G binding matrices
IgG Binding Matrix

SPECIES
AVID AL TM
Protein A
Protein G
HUMAN
++
++
++
RABBIT
++
++
++
MOUSE
++
++
++
GUINEA PIG
++
++
++
BOVINE
++
++
++
PIG
++
++
++
RAT
++
GOAT
++
++
HORSE
++
++
SHEEP
++
++
CHICKEN
++
121
5.6 APPENDIX F -- HUMAN CYTOKINE RT-PCR PRIMERS
CYTOKINE
5' PRIMERS
3' PRIMERS
PCR
PRODUCT
(BP)
IL-122
5'-ATGGCCAAAGTTCCAGACATGTTTC
5'-GGTTTTCCAGTATCTGAAAGTTCAGT
868
IL-1
5'-AGCTGATGGCCCTAAACAGATGA
5'-GATCTACACTCTCCAGCTGTAGA
533
IL-2
5'-ATGTACAGGATGCAACTCCTGTCTT
5'-GTTAGTGTTGAGATGATGCTTTGAC
420
IL-3
5'-AATCCAAACATGAGCTGCCTGCC
5'-GGCCCAGAGAGAGAGCTGGAG
496
IL-4
5'-TCACATTGTCACTGCAAATCGACA
5'-TCAGCTCGAACACTTTGAATATTTCT
493
IL-5
5'-ATGCACTTTCTTTGCCAAAGGCAA
5'-GGTTTACTCTCCGTCTTTCTTCT
365
IL-6
5'-TATCTCCCCTCCAGAAGCCCAG
5'-TCTGAGGAGAGCGCGGTCGT
685
IL-7
5'-TCTTTTAGGTATATCTTTGGACTTC
5'-TTTTCAGTGTTCTTTAGTGCCCATC
462
IL-8
5'-GCTTCTAGGACAAGAGCCAGGAAG
5'-CTTGGATACCACAGAGAATGAATTTTT
389
IL-10
5'-TCCTAGAGTCTATAGAGTCGCC
5'-AAGGCATGCACAGCTCAGCACT
625
IL-11
5'-ACATGGCTGTGTTTGCCGCCT
5'-TAAGATCTGGCTTTGGAAGGA
606
IL-13
5'-AAGCCACCCAGCCTATGCATCCG
5'-GATGCTTTCGAAGTTTCAGTTGAACC
471
5'-GAATTCCGGGCTGCAGTCAC
5'-AACAGGCAGGCCTGGGCAGTA
578
eotaxin 5'CCCAACCACCTGCTGCTTTAACCTG
5'TGGCTTTGGAGTTGGAGATTTTTGG
207
G-CSF 5'-CTGTGGCACAGTGCACTCTGG
5'-GGAGGGCTTGGCTCAGGGCT
573
GM-CSF 5'-ATGTGGCTGCAGAGCCTGCTGC
5'-TCCAGCCTCATCGGCCGGT
456
LIFa
5'-CCTCGGTTCACAGCACACACTTCAAGA
659
5'-GGCCACACACTCACCAGCCG
340
IRAP
23
5'-TCTGAAGTGCAGCCCATAATGAAGGT
M-CSF 5'-AAAGTGAAAGTTTGCCTGGGTCCT
MCP-3 5'-ACCTGCAGATTTATCAATAAGAAAATCCC 5'-CCCGGTCCTGAAATACTTCGTGGACCAGTGGTT 178

MIP-1 5'-CAGACAGTGGTCAGTCCTTTC
5'-CCCTCAGGCACTCAGCTCTA
379
MIP-2 5'-GCTTCCCGACGCGTCTGCTGA
5'-GTAAGGGCAGGGACCACCCTG
417
RANTES 5'-GCTGTCATCCTCATTGCTAC
5'-CTCTACTCGATCCTACCTCT
260
SCF
5'-TTACACTTCAAACTCTCTCTCTTT
822
22
23
5'-CTGCTCCTATTTATTCCTCTCGTC
IL-1 , IL-3, -4, -5, -6, -7, -8, -10, -11, & -13, and
IRAP, G-CSF, GM-CSF, LIF, M-CSF, MIP1, MIP2, SCF & TNF can be found in Oka et al. (1995).
Cytokine mRNA expression patterns in human esophageal cancer cell lines. J Interf. & Cytokine Res
15: 1005-09.
The RT-PCR protocol for amplifying eotaxin mRNA is available in Bartels et al. (1996). Human dermal
fibroblasts express eotaxin: molecular cloning, mRNA expression, and identification of eotaxin sequence
variants. Biochem Biophys Res Commun 25: 1045-51
122
TNF
5'-CTTCTGCCTGCTGCACTTTGGA
5'-TCCCAAAGTAGACCTGCCCAGA
598
123
5.7 APPENDIX G -- WORLD WIDE WEB Immunology sites of interest

The following comprises a list of potentially useful web sites for immunologists.
Immunology (medical Specialties)...................

http://galaxy.einet.net/galaxy/Medicine/MedicicalSpecialties/Immunology.htmi
The World Wide Web Virtual Library: Immunology (Biosciences)..http://golgi.harvard.edu/biopages/immuno.htmi
Medical Research Council of Canada ........................................ ..http://www.mrc.gc.ca/title.html
Society homepages
American Association of Allergy, Asthma and Immunology...........http://execpc.com/~edi/aaaai.htmi
American Association of Immunologists.........................................http://glamdring.ucsd.edu/others/aal/
Australasian Society for Immunology.............................................http://www.wehi.edu.au/societies/ASI/ASI.htmi
British Society for Immunology.......................................................http://www.blackci.co.uk/society/bsi/
CanadianSociety for Immunology..................................................http://www.csi.ucalgary.ca/csiweb.nsf
Federation of Immunological Societies of Asia-Oceania.......................
http://www.microbiology.adelaide.edu.au/fimsa.htm
International Society of Experimental Hematology.........................http://www.kcj.com/hema/
National Academy of Science (US).................................................http://www.nas.edu
Online services and databases
American Type Culture Collection (ATCC)...........................................http://www.atcc.org/
Bionet Electronic Newsgroup Network for Biology (BIOSCI)................http://www.bio.net
Centre for Protein Engineering: Home Page (MRC-CPE)....................http://www.mrc-cpe.cam.ac.uk/
European Collection of Animal Cell Culture (ECACC)..........................http://www.ist.unige.it/cldb/descart5.htmi
GeneBank (Searches address)....................................................
http://www.ncbi.nlm.nih.gov/Web/Search/index.html
Immunogenetics database (IMGT Database).......................................http://www.ebi.ac.uk/contrib/imgt/topimgt.htmi
Jackson Laboratories (source of mice)..http://www.jax.org/jaxmice
Journal of Immunology.........................................................................http://ji.journals.at-home.com/JI
Kabat Database of Sequences of Immunological Interest...................http://immuno.bme.nwu.edu
Linscott's Directory of Immunological and Biological Reagents.......................................................
.........................http://ourworld.compuserve.com/homepages/LINSCOTTSDIRECTORY
/
National Center for Biotechnology Information (NCBI).........................http://www.ncbi.nim.nih.gov
National Institutes of Health (NIH)........................................................http://www.nih.gov
National Library of Medicine (USNLM).................................................http://www.nim.nih.gov/
NCBI WWW Enerez
Browser...............................................................http://www3.ncbi.nim.nih.gov/Entrez/index.htmi
124
Vbase: a Directory of Human Immunoglobulin V Genes.........................................

..........................http://www.mrc-cpe.cam.ac.uk/imt-doc/vbase-home-page.htmi
Services provided by individuals homepages
Cytokines and receptors....................http://www.Imb.uni-muenchen.de/groups/ibelgaufts/cytokines.htmi
Cytokines and receptors..........................................................http://www.ocms.ox.ac.uk/~smb/cyt_web/
Immunoglobulin structure and function.................................. http://www.path.cam.ac.uk/~mrc7/mikeimages.htmi
Immunoglobulin structure and sequences.............................. http://www.biochem.ucl.ac.uk/~martin/antibodies.htmi
MHC structure and fanction, CD antigens.............................. http:/histo.cryst.bbk.ac.uk/
Tissue typing............................................................................http://www.umds.ac.uk/elsewhere/tissue/whatl.htmi
125
Veterinary Immunology and Immunopathology 71:
(1999)
pp 115-123
Differential complement activation by bovine IgG2 allotypes
FD Bastida-Corcuera, LB Corbeil
pp 143-149
Binding of bovine IgG2a and IgG2b allotypes to protein A, protein G,
and Haemophilus somnus IgBPs
FD Bastida-Corcuera, LB Corbeil
126
5.7 APPENDIX G -- SELECTED TEMPLATES FOR 96--WELL PLATES

1
10 11 12
10 11 12
10 11 12
A
B
C
D
E
F
G
H
A
B
C
D
E
F
G
H
A
B
C
D
E
F
G
H
127
10 11 12
10 11 12
10 11 12
A
B
C
D
E
F
G
H
A
B
C
D
E
F
G
H
A
B
C
D
E
F
G
H
128
10 11 12
10 11 12
A
B
C
D
E
F
G
H
A
B
C
D
E
F
G
H
1
A
B
C
D
E
F
G
H
10 11 12
INDEX
10xSSC 63
32P-labelled
cDNA probe synthesis 66

5X MOPS 63
7TD1 cells 21
actinomycin-D 23
activation of macrophages 16
ammonium persulfate 38
anaesthetic 8, 12, 100
antibody-dependent phagocytosis 14
antibody-coated cells 14
ADCC 14
anticoagulant 8
AVID-AL IgG affinity columns 32
blast assay 46
bromophenol blue dye 39
C'-dependent cytotoxicity 42
capture antibodies 50
cell counting 96
cellular RNA 60
cellular viability 97
Concanavalin A 46
CsCl/sodium acetate 60
cytocentrifuge preparations 97
cytotoxicity assay for TNF 23
density gradient systems 8
detection antibodies 50
detection of mRNA bands 70
ELISPOT 50
ELISPOT plates 50
fluorescein-labelled anti-CD4 42
Giemsa stain 57
Gill's hematoxylin 102
GK1.5 (anti-CD4) 31
GSCN lysis solution 60
H2O-saturated isobutyl alcohol. 38
hemocytometer 96
heparin 8
IgE anti-DNP antibody 29
IL-1 activity 18
IL-6 activity 21
immunohistochemistry 58
in situ hybridization 72
intradermal skin test 56
isopropanol fix 39
isotonic Percoll 9
L-929 cells 23
lauryl sarcosine 60
leukocyte/platelet-rich plasma 9
lipopolysaccharide 16
LM-1 cells 18
low-tox rabbit C' 42
LPS 16
Lymphocyte separation medium 50
mast cells 29
monoclonal antibodies 31
monocyte/macrophage monolayers 14
monokine bioassays 18
morphologic identification of PBL 101
MTT 18
neutrophil chemotaxis assay 25
neutrophils 8
nitrocellulose 40
Northern blot blocking solution 68
Northern blotting 60
Northern blotting apparatus 63
PAGE 2x sample prep buffer 91
PAGE running buffer 91
paraffin section 57
paraformaldehyde 43
PBST 50
percoll 9
peripheral blood 8
phycoerythrin-labelled anti-CD8
antibodies 42
platelet 9
PMN 8
polyacrylamide gel electrophoresis 38
polymorphonuclear cells 8
pre-hybridization (Northerns) 68
radioactive hybridization solution 68
rapid Coomassie blue stain 38
rapid Coomassie brilliant blue 39
RBC sedimentation buffer 9
recombinant human IL-6 21
RNA sample dye/loading solution 63
RNA sample prep solution 63
rouleaux 9
separating gel (PAGE) 38
stacking gel (PAGE) 39
streptavidin-AP conjugate 40, 50
Synthesize the cRNA probes 72
T cell responses 56
Th1 versus Th2 responses 56
TIB 211 (anti-CD8) 31

tissue processor 57
TNF activity 24
TNF standards 23
two-colour FACS 42
unit of TNF activity 24
web sites for immunologists 105
Wrights-Giemsa staining 101
x-ray film 70
Zeta-bind transfer membrane 63
A PRACTICAL GUIDE TO
CELLULAR AND MOLECULAR

RESEARCH METHODS IN IMMUNOLOGY
John R. Gordon, Ph.D.
Department of Veterinary Microbiology,
University of Saskatchewan,
Saskatoon, CANADA
SECOND EDITION
1998, John R. Gordon
tel: 306-966-7214; FAX: 306-966-7244
email: gordon@sask.usask.ca
--------------------------------------------------------------------------Front cover:
top left - In situ hybridization autoradiography of mouse skin tissues undergoing a passive cutaneous
anaphylaxis response following intravenous allergen challenge. The tissue was harvested at 8 h post35
challenge and was probed with a S-1 (I) collagen cRNA probe, which hybridizes specifically with
fibroblasts activated by mast cell TNF and TGF (Gordon & Galli, J Exp Med 180: 2027, 1994).
top right - Northern blot autoradiograph of mRNA from Cl.MC/C57.1 mast cells challenged via the
32
FcRI for varying periods of time. The blot was probed with a P-TNF cDNA and washed at high
stringency (Gordon & Galli, J Exp Med 174: 103, 1991).
bottom left - Antigen-driven IFN and IL-4 production in splenocyte cultures from BALB/c mice
vaccinated (dy 0) and boosted (dy 14) with a range of doses of ovalbumin (0.05 - 10 g) in the context
of alum (taken from Schneider & Gordon, manuscript in preparation)
bottom right - Chemotaxis assay of the eosinophil chemotactic activities of extracts from the skin of an
eosinophilic epitheliotropic T cell lymphoma patient. The tissues contained high levels of MCP-3, and
moderate levels of RANTES & GM-CSF (Hull, Saxena & Gordon, manuscript in preparation)

A Practical Guide To Cellular and Molecular Research Methods in Immunology

Încărcat de

Informații document

Titlu original

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

A Practical Guide To Cellular and Molecular Research Methods in Immunology

Încărcat de

Drepturi de autor:

Formate disponibile

1

4.1.1 Purification of cellular RNA..................................................55

5.1.13.1.2 Giemsa staining of tissue sections........89

Reagents for purifying DNA from agarose gels..................96

Obtain blood from surgically anaesthetized (or euthanized) mouse either by

suspension by centrifugation (1000 rpm for 10') , . Aspirate the platelet-rich

transfer WBCrich plasma to

PMN & RBC

Prepare cytocentrifuge slides of the cells by applying 5x10 4 cells in 100 l of

1.1a ALTERNATE PROTOCOL 1 (for rapid mononuclear cell gradients)

harshness of cellular treatment as well as in term so the times involved). The

1.1b ALTERNATE PROTOCOL 2 (fractionation of leukocyte sub-populations)

1.2 Isolation of cells from the peritoneal cavities of mice.

1.3 Adherence purification of monocytes or macrophages

Resuspend the mononuclear or serosal cells at 3x10 6 cells/ml in DMEM-0%

1.4 Antibody- or C3b-dependent phagocytosis by macrophages

Take the monocyte/macrophage monolayers, in multi-well slides out of the 37C

1.5 Activation of macrophages with bacterial lipopolysaccharide

sufficient DMEM-10% FCS to bring the cells to a concentration of 3x10 6

1.6 Monokine Bioassays:

plate blank (A1-H1)

cytokine standards (4 doses)

Add 80 l of Click's-10% FCS-CM-, and 20 l of appropriately diluted rmIL-1

In parallel sets of quadruplicate wells, run samples (LPS-stimulated Pu5 cell

1.6.2 Assay for IL-6 activity

1.6.3 Cytotoxicity assay for TNF bioactivity

Wash the dislodged cells in DMEM-10% NHS medium, resuspend them to

experimental samples (LPS-stimulated Pu5 cell supernatants & controls) to their

1.7. Neutrophil chemotaxis assay

Generate a neutrophil-rich population from the peripheral blood, using dextran

neutrophils), adjusting the population to a final concentration of 2x10 6 cells/ml of

1.8. FcRI-dependent activation of mast cells

Obtain some Cl.MC/C57.1 cells and adjust the cell concentration to 3 X 10 6

up 3 ml of cells (i.e., 9x106 cells in 3 ml).

2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION:

2.1 Hybridoma cell culture with production of monoclonal antibodies

GK1.5 cells. Start each flask as a 40 ml culture, at a cell density of 10 5 cells/ml

2.2 Affinity purification of IgG antibodies

2.2.2 Protein A-Sepharose affinity chromatography

2.3 Preparation of IgM antibodies

As with the IgG purification, generate a 4-day TIB211 hybridoma culture

2.4 Analysis & characterization of immunoglobulins

2.4.2 Western blotting to detect immunoglobulins

Equilibrate the gel after electrophoresis to Western blot transfer buffer by

3.0 T CELL AND B CELL RESPONSES:

single cell suspension of mouse splenocytes (at 1x10 7 cells/ml; Appendix D)

Label and set up a series of tubes to receive reagents as follows:

TIB211 IgM (30% AS)

TIB211 IgM (45% AS)

Add 100 l of the splenocyte suspension (i.e., 10 6 cells) and 100 l of

3.2 MACS purification (or depletion) of CD4 + and CD8+ T Cells

single cell suspension of mouse splenocytes (at 1x10 7 cells/ml; Appendix D)

Label and set up a series of tubes to receive reagents as follows:

Add 1 ml of the splenocyte suspension (i.e., 10 7 cells) and 250 l of appropriately

3.3 Assessment of T cell proliferation (Blast assay)

BALB/c mouse splenocytes (5x10 7 nucleated cells/ml) in DMEM-10% FCS

Concanavalin A (our stock is a 4 mg/ml solution in DMEM)

cell numbers titration

ConA DOSE-RESPONSE CURVE

513.4 Plaque Forming Cell (PFC) assay for IgM-producing cells

sheep red blood cells (SRBC; 2x108/ml), washed in PBS

microscope slide (2)

assembled double-chamber apparatus