Questions for Section 1

1. Describe a the structure of three different units of supersecondary structure, one

containing all helices, one all strands and one with both types of secondary structure. In
one sentence, explain why most supersecondary structure units are not associated with a
particular protein function.
2. Describe the structure and function of three proteins that bind DNA using different
structural motifs. For each protein, describe the interactions between the protein and
the DNA, and explain whether or not they are sequence specific.
3. Describe, in detail, the structures of two protein domain families that contain just beta
secondary structure that have different architectures. Give a full set of CATH numbers
for each. What is the equivalent SCOP classification?

Questions for Section 2

1. a) What is meant by competence, when referring to bacterial cells? [2 marks]
b) How is this condition related to transformation? [2 marks]
c)Name two common approaches to conferring artificial competence to laboratory cells of
E.coli, and note the key steps up to and including transformation. [3 marks per approach, 6
marks]
2. What is a plasmid? [2 marks]. In order to do a recombinant expression experiment in
E.coli, the promoter and ribosome binding sequence are key factors: describe details of
these elements, such as nucleotide spacing and interactions [4 marks].
What other DNA sequence elements are required on an expression plasmid? Outline the roles of
each named element [4 marks].
3. The following is a small portion of the sequence of a vector, in the vicinity of the cloning
site. The vector start codon and choice of stop codons are shown in bold type. Some
unique restriction sites in this region are listed below the sequence.
TAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTT
AAGAAGGAGGTATTGGCCATGGAACTGGTCTCACCCGCAGTTCGAGAAAGCTAGCGCTGT
GCACCATCACCATCACCATTGAAGCTTATAAGTTAAGTATGATGAACAAAGCCCGAAAGG
AAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATA
Unique restriction sites in the ORF cloning region: AfeI, ApaLI, HindIII, MscI, NcoI, NheI, PsiI.
a) Using the open reading frame for the uracil-DNA glycosylase in the following GenBank
summary page http://www.ncbi.nlm.nih.gov/nuccore/NC_008541.1?
report=genbank&from=838653&to=839357&strand=true answer the following:
i) Design primers for PCR of the gene, to subsequently permit restriction-ligation cloning at the
NcoI site for the 5'-end of the gene, and at the HindIII site for the 3'-end of the gene.

ii) Design an alternative 5'-end primer for PCR of the gene, to create a LIC-compatible end,
assuming a MscI cut to the vector.
iii) Design an alternative 3'-end primer for PCR of the gene, to create a LIC-compatible end,
assuming a PsiI cut to the vector.
b) After cutting the vector at the LIC restriction sites, describe in sufficient detail, the steps
required to complete the LIC process.

Questions for Section 4

1. A protein crystal has cell dimensions of a = 48.4, b = 48.4 , c = 138.4, = 90.0, =
90.0, = 120.0. What possible crystal systems could it belong to?
2. In protein crystallography the ratio of the data collected to the number of parameters to
be refined is often low. Why is this problematic and name 3 ways in which this can be
overcome?
3. What is anomalous scattering in protein crystallography? [ 3 marks] How is it used in
phase determination? [4 marks] Which elements typically display anomalous scattering
in protein crystals and under what conditions are they found in the crystals? [3 marks].

Questions for Section 5

1. Discuss the merits of expression hosts other than E.coli for producing proteins for
structural biology.

Question for Section 6

1. The Fourier Transform is a mathematical function that is used extensively in structure
determination in both electron microscopy and protein crystallography. a) Describe
qualitatively (without the use of equations), or illustrate, what the Fourier Transform of
the electron density in a protein crystal looks like [2 marks].
b) Why is a periodic pattern not seen in the Fourier Transform of a raw EM particle [2 marks]?
The following diagrams represent c) the Contrast Transfer Function in EM and
d) the scattering factor f for an atom in protein crystallography. For each graph describe what
these functions show (2 marks) and their effect on the data obtained [2 marks].

e) Describe or illustrate how the Contrast Transfer Function would look for a electron
microscope with perfect optics [1 mark].
f) Describe or illustrate how temperature (B)-factors affect the graph shown in d) [1 mark].
2. a) Describe sample preparation for negative stain EM and cryo EM. [5 marks] b) What
are the differences between the data that are obtained by each approach? [5 marks]

Questions for Section 7

1. (a) Describe the principles of operation of an electrospray ionisation (ESI) mass
spectrometer [8 marks].
b) Describe the information that can be obtained about protein-protein complexes using ESI
mass spectrometry. [2 Marks].
2. (a) Outline the principles of secondary structure determination using Circular
Dichroism spectroscopy?
(b) Use the web and literature to find out about the advantages of synchrotron radiation
CD in determining secondary structure. Briefly describe these advantages and how they
arise. Give references for your source(s) of information.
3. Describe the mechanisms by which proteins are separated in 2D-gel electrophoresis
using the O'Farrell technique. Describe ONE limitation of this technique in separating
complex mixtures of proteins?

Questions for Section 8

1. It is thought that a small peptide has the sequence Ile-Asn-Gly-Phe. Write the chemical
formula of the tetrapeptide when dissolved in D2O solution at neutral pH, distinguishing
between protons (H) and deutrons (D) and indicate which atoms will give distinct signals
in a 1H NMR experiment under these conditions.
2. The typical fingerprint solution NMR spectrum of 3 proteins are shown in Figure 1
(A,B,C). These correlation spectra are known as HSQCs and can represent the
fingerprint of the topology of the protein. Each dot or cross-peak in the
HSQC spectrum corresponds to a backbone amide nitrogen and hydrogen pair. In these
spectra, each (non-proline) residue in the protein gives rise to one cross-peak which
comes at the intersection between the amide protein frequency (X-axis, labelled
hydrogen) and the nitrogen frequency (Y-axis, labelled nitrogen). The
frequency axes are by convention both use the parts per million or ppm scale.

A) Green Fluorescence Protein (GFP, 238 residues, 27 KDa, 10 prolines),

B) immunoglobulin (Ig) domain (106 residues, 11 KDa) 9 prolines)
C) alpha-synuclein (140 residues, 14.5 KDa, 4 prolines)
2.1 What does HSQC stand for? (1 mark)
2.2 What quantities (in mg) would be needed in a 0.5 ml NMR tube to achieve the
concentrations stated in the inset of the spectra in Figure 1? (1.5 marks)
2.3 Answer the following 3 questions about the spectra in Figure 1
a) How many cross-peaks would be expected in each spectrum? 1.5 marks
b) What is the spectral dispersion i.e. the x- (hydrogen dimension) and y-axis (nitrogen
dimension) ranges that are covered by peaks 1.5 marks

c) The relative thickness (linewidths) of the dots in A) and B)? Does this relate to the
molecular mass of the protein? 1.5 marks
2.4 Along the x-axis (the 1H dimension), the resonances in spectrum C) are crowded in the centre
of the spectrum. Of what feature of this proteins conformation (alpha-synuclein; see Dedmon
MM, et al, J Am Chem Soc. 2005;127:476477 if necessary;
http://www.ncbi.nlm.nih.gov/pubmed/15643843) is this likely to be an indication? 1 mark
2.5 In light of your answer to ii) what would the dispersion of the spectra shown in A) and B)
indicate about these proteins? 1 mark
2.6 How, then, is this spectrum of alpha-synuclein likely to change on addition of lipids (useful
ref: Perrin et al, J. Biol. Chem., 2000 275, 34393-8;
http://www.ncbi.nlm.nih.gov/pubmed/10952980). Assume that we would not see the peaks of
these added molecules? 1 mark
3. NMR spectroscopy can be used to describe the structure and dynamic aspects of a
protein during folding. If the Ig domain (same protein whose NMR spectrum was shown
in Figure 1B) is subjected to increasing amounts of urea denaturant, the NMR
fingerprint spectra at 3 points during this urea titration are shown in Figure 2.

3.1 What changes are observed in the three spectra as the concentration of urea increases: as
regards (a) the spectral range along the hydrogen (x-axis) dimension?
(b) the number of cross-peaks? (2 marks each)
3.2 What does the spectrum of Ig in 8M urea conditions reveal about its likely topology under
these conditions? (2 marks)
3.3 What is the likely explanation for what is occurring to the Ig domain at 4.5M urea (2 marks)
3.4 Using a simple schematic representing the Ig domain as a string, depict what is happening to
the proteins structure in increasing concentrations of urea. (2 marks)
4. NMR can also be used to provide detailed information on protein-protein interactions at
a residue specific level. Calmodulin (CaM), is a 16.7kDa EF-hand regulatory calciumbinding protein composed of two domains (see Figure 3A) and mediates a range of
cellular processes.

CaM undergoes a conformational change upon binding to calcium ions, which enables it to bind
to specific proteins for a specific regulatory response. The resonances observed in the
fingerprint of CaM have been assigned (Figure 3B) to their specific residue in the CaM
sequence, which allows us to know which cross-peak in this 148 residue protein corresponds to
an amino acid within the protein.
In this experiment, a 25 amino acid peptide substrate was bound to calmodulin in different
ratios of calmodulin:peptide: 1:0, 1:0.5, 1:0.8, 1:1.2 and HSQC spectra were recorded for each
sample, as shown in Fig 3C (black= 1:0, red = 1:0.5, green 1:0.8 and cyan 1:1.2).
We can measure the changes in the positions of the cross-peaks during the titration and plot
this, know as the chemical shift change for each of the amino acids within the calmodulin
sequence as shown in panel D.

4.1. Using these data and the figures, describe what structural changes occur in CaM when the
peptide binds. (5 marks total)

Questions for Section 9

1. For the PDB structure 2YMV find the original publication describing the structure
determination and give the reference. Describe the methods used for the protein
purification (NOT THE EXPRESSION) and the principles of the methods
2. Below are listed a number of factors that affect the efficiency of protein separation
during a column chromatography run. Discuss these factors and include any equations
that relate to each one.
a) Retention time and resolution [2.5 Marks]
b) Band broadening [2.5 Marks]
c) Theoretical Plates [2.5 Marks]
d) Capacity Factor and Peak Symmetry [2.5 Marks]
3. What are the three distinct stages in the process of crystal formation? Illustrate using a
generalised phase diagram and a schematic for the energetics of crystal formation

Questions for Section 10

1. What are the following stereochemical parameters and how are they used in protein
structure determination [2 marks each]
a) Bond length
b) Phi and psi angles (Hint: Ramachandran plot)
c) Side chain conformer/torsion angles
d) Hydrogen-bond
e) Distance restraint (NMR)
There are several answers we will accept to the following questions, which depend on how you do
the search in which database and what you and the database take resolution to mean.
2. a) Using web based search facilities (in practice the RCSB or PDBe web sites), determine
and write down the PDB codes of the protein structures that currently have the highest
and lowest quoted values for their resolution.
b) Download the full text of the main journal reference for the highest resolution structure and
tell us what the full reference is. Say in no more than a few sentences what can be seen at this
resolution. (We do not expect you to fully understand the paper, but to be able to give some idea
of what it is talking about in broad terms).
c) Tell us the primary reference for the lowest resolution structure. Describe the technique used
to determine the structure in a few sentences. What information can be gained from a structure
of such low precision?

Questions for Section 11

1. Describe four protein modules that specifically bind to the phosphorylated state of
serine residues.
2. What is a "hot spot" in protein-protein interactions?
3. Describe four methods that can be used for measuring protein/protein interactions in
protein complexes. How quantitative is each method? For which of obligate core, nonobligate core or transient complexes does each give useful results?