Documente Academic
Documente Profesional
Documente Cultură
doi:10.1111/1462-2920.12934
2015 Society for Applied Microbiology and John Wiley & Sons Ltd
L. Allais et al.
Cigarette smoke (CS) is the most prominent environmental risk factor for developing CD; however, it
exerts a protective role in UC (Persson et al., 1990;
Ananthakrishnan, 2013). In addition, smoke exposure
may have an important impact on the composition and
dynamics of the gut microbiome. For instance, the
Bifidobacterium population increased in the caecum of
rats after 4 weeks of CS exposure (Tomoda et al., 2011).
In mouse, side-stream smoking increased Clostridium
sp., but decreased the Firmicutes phylum (Lactococcus
and Ruminococcus sp.), the Enterobacteriaceae family
and the segmented filamentous bacteria in the caecum
(Wang et al., 2012). In human studies, smoking has
been associated with a higher rate of Clostridium difficile
infection, in which current smokers (actively smoking
during the study) have the highest risk compared with
former (quitted smoking before the start of the study)
and never smokers (never smoked in their whole life)
(Rogers et al., 2012). Moreover, CS is a known risk
determinant for both bacterial and viral infections
through alterations in cell- and humoral-mediated
immune responses in the respiratory tract (Arcavi and
Benowitz, 2004). We recently demonstrated that CS triggers the gut immune system through the recruitment of
immune cells to the Peyers patches (PP), the main lymphoid organs in the gut, and through the induction
of autophagy and apoptosis in the follicle-associated
epithelium (FAE) overlying the PP (Verschuere et al.,
2011; 2012).
Many studies have investigated the impact of specific
intestinal bacteria on host gene and protein expression in
the intestine and their role in IBD development (Rolli et al.,
2010). Nevertheless, the role of smoking in the emergence
of dysbiosis, which might modulate the risk for the
development of IBD, still needs further investigation. CS
alters hostmicroorganism interaction dynamics in the
airways, causing respiratory tract infections and contributing to chronic obstructive pulmonary disease (COPD)
(Garmendia et al., 2012). This study addresses the effect
of chronic CS exposure on the gut mucosa and its microbial environment. We examined the diversity of the bacterial community in the ileum and colon of mice exposed to
CS or air for 24 weeks. Additionally, we explored which
species were sensitive to CS exposure and to what extent
the composition of the mucus layer and inflammatory gene
expression is affected.
exposed and 12 air-exposed mice was analysed by denaturing gradient gel electrophoresis (DGGE) as a profiling
technique. Dendrograms applying the abundance-based
Jaccard index (Fig. 1) and Yue and Claytons theta index
(Fig. S1) were used to visualize the clustering of the
samples. Considering the distinct intestinal regions, the
dendrograms showed clear clusters for air-exposed mice
(49 11% and 58 9% within-group similarity, respectively), separated from smoke-exposed mice in caecum
and distal colon, suggesting a bacterial shift (P = 0.001 for
both using multivariate analysis of variance (MANOVA)).
This kind of separated clusters was not observed in the
dendrogram of the ileal samples, with the air-exposed
samples only showing 42 11% within-group similarity.
The activity of specific bacterial species is influenced by
smoke exposure
A shift in the microbial composition may potentially
imply a shift in microbial activity. Using cDNA samples,
we evaluated the activity of the microbiome with Illumina
sequencing as a more high-resolution method. We randomly selected 12 mice (six smoke- and six air-exposed
mice, originating from four distinct cages) of which
ileal, caecal and distal colonic samples were included in
the analysis. Changes in 16S rRNA levels were evaluated by the sparse partial least square discriminant
analysis (sPLS-DA). This clearly showed a distinct ordination for proximal and distal colon between the smokeand air-exposed murine microbiome activity (Fig. 2),
but not for ileum, which parallels the shift in microbial
composition as shown by the DGGE-based clustering
(Fig. 1).
To further investigate the effect of smoke exposure on
bacterial activity in the murine gut, we used Illumina
sequencing to identify the operating taxonomic units
(OTUs) showing changes in activity in the different gut
regions of six smoke- and six air-exposed mice. We
applied the sPLS-DA method to identify the specific OTUs
in each separate intestinal region. All relevant OTUs were
clustered using the unweighted pair group method with
arithmetic mean (UPGMA) algorithm and displayed in a
heatmap (Fig. 3), which demonstrated that the expressed
16S rRNA level and therefore the activity of OTU010,
representing Lachnospiraceae sp., strongly increases in
proximal and distal colon (571.74% and 300.76% change,
respectively) in response to smoke exposure.
Results
The gut bacterial community shifts in response to
cigarette smoke
To determine the response of the host microbiome to CS,
the taxonomical community structure of the microbiome in
ileal, caecal and distal colonic samples of 12 smoke-
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
The gut microbiota play an important role in the immunological response of the gut (Round et al., 2010). Interestingly, we have previously shown that 24 weeks of CS
exposure affects the ileal immunological response by triggering the attraction of immune cells to the PP, the
immune inductive sites of the gut (Verschuere et al.,
2011). Therefore, we investigated the effect of CS exposure on inflammatory gene expression in the immune
effector regions of the gut (n = 6 in each group). We
observed a significant increase of Cxcl2, a decrease of
Ifn- and a nominal decrease of Il-6 in the ileum (Fig. 4C),
whereas Tnf-, Il-10, Nfb and Tgf- remained unaltered
(Fig. S2A). In the proximal colon, Il-6 was increased and
Tgf- was decreased (Fig. 4D), while Il-10, Nfb, Ifn-,
Cxcl2 and Il-1 did not change (Fig. S2B). However, in the
distal colon, inflammatory gene expression remained
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
L. Allais et al.
Fig. 2. Individuals plot, based on the Illumina sequencing data, showing a clearly distinct ordination between the proximal and distal colonic
samples of air- and smoke-exposed mice. No distinct ordination could be detected in the ileum. This confirms the DGGE data. SM, smoking;
NSM, non-smoking; DC, distal colon; IL, ileum; PC, proximal colon.
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
Fig. 3. Heatmap with UPGMA clustering using the sparse patrimonial least squares discriminant analysis (sPLS-DA). The 40 most active
OTUs are displayed (ranked by sPLS-DA Xw score [X within], Liquet et al., 2012). The activity of OTU0010 (=Lachnospiraceae sp. according
to RDP9) is increased in the proximal and distal colon (571.74% and 300.76% change, respectively) of CS-exposed mice.
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
L. Allais et al.
Fig. 4. (A) mRNA expression of mucins in the ileum after air and smoke exposure, relative to the expression of two reference genes
[glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hydroxymethylbilane synthase (HMBS)]. Expression of Muc2 and Muc3
significantly increases after smoke exposure (P = 0.039 and P = 0.0321 respectively). (B) Expression Muc4 significantly increased after smoke
exposure (P = 0.0274). mRNA expression of Muc4 increases in the distal colon after smoke exposure (P = 0.0274) relative to the expression
of two reference genes [glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hydroxymethylbilane synthase (HMBS)]. (C) Expression of
CXCL2 significantly increases and IFN- significantly decreases after smoke exposure (P = 0.0186 and P = 0.0463, respectively), while IL-6
shows a nominal decrease (P = 0.068) and IL-1 is not significantly altered (P = 0.0983). (D) mRNA expression of inflammatory genes in the
proximal colon after air and smoke exposure. Expression of IL-6 significantly increases and TGF- significantly decreases after smoke
exposure (P = 0.0209 and P = 0.0388 respectively). P-values lower than 0.05 were considered significant. Data are represented as
mean SEM. n = 6 in each group. *P < 0.05.
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
L. Allais et al.
RNA from ileum and distal colon (both were taken from 10
smoke- and 10 air-exposed mice) was extracted using the
Qiagen miRNeasy Mini Kit (Qiagen, Hilden, Germany). Subsequently, cDNA was synthesized by reverse transcription
using the iScript cDNA synthesis kit (Bio-Rad Laboratories,
Nazareth, Belgium) following the manufacturers instructions.
Expression of target genes Muc1, Muc2, Muc3, Muc4, Cxcl2,
I1-1, I1-6, Ifn-, Tnf-, Il-10, Nfb, Tgfb1, Ctnb1, Cldb-4,
Ocln and Cdh1, and reference genes glyceraldehyde-3phosphate dehydrogenase (GAPDH) and hydroxymethylbilane synthase (HMBS) (Table 1), was analysed by
qRT-PCR using the SensiMix SYBR No-ROX Kit (Bioline,
London, UK). The qRT-PCR was performed on a
LightCycler480 detection system (Roche Diagnostics) with
the following cycling conditions: 10 min incubation at 95C,
45 cycles of 95C for 10 s and 60C for 1 min. Melting curve
analysis confirmed primer specificity. The PCR efficiency of
each primer pair was calculated using a standard curve from
reference cDNA. The amplification efficiency was determined
using the formula 101/SLOPE 1.
Staining methods
DGGE
The ileal and colonic samples of 12 smoke- and 12 airexposed mice were obtained snap-frozen and stored at
80C. The 16S rRNA genes for all bacteria were amplified by
PCR adding a GC-clamp of 40 bp. The DGGE was performed
using the INGENYPHORU System (Ingeny International BV,
The Netherlands), after which PCR fragments were loaded
onto 8% (w/v) polyacrylamide gels containing 4060% denaturing gradients (Muyzer et al., 1993; Ovreas et al., 1997). To
process and compare the different gels, an in-house developed marker of different PCR fragments was loaded on each
gel (Boon et al., 2002).
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
Accession number
Effic
R2
Hmbs
Gapdh
Muc1*
Muc2
Muc3*
Muc4*
Cxcl2
Il-1
Tnf-
Il-10
Nfb
Tgfb1
Ctnb1
Cldn-4
Ocln
Cdh1
Ifng
NM_001110251
NM_008084
NM_013605
NM_023566
XM_355711
AF520422
NM_009140
NM_000576
NM_013693
NM_010548
NM_023526
NM_011577
NM_001165902.1
NM_009903.2
NM_008756.2
NM_009864.2
NM_008337
AAGGGCTTTTCTGAGGCACC
CATGGCCTTCCGTGTTCCTA
GCAGTCCTCAGTGGCACCTC
CAAGGGCTCGGAACTCCAG
CGTGGTCAACTGCGAGAATGG
CAGCAGCCAGTGGGGACAG
GCGCCCAGACAGAAGTCATAG
CACGATGCACCTGTACGATCA
ATGAGCACTGAAAGCATGATCC
GGTGTCCTTTCAATTGCTCTCAT
GAAGGGCGTGTTTGACAAGGA
CTCCCGTGGCTTCTAGTGC
TCACATTTGAGAAGCGATCCTAC
AGCCTTCCAGGTCCTCAACT
ACAGACTACACAACTGGCGG
TTACTGCCCCCAGAGGATGA
GCCAAGCGGCTGACTGA
AGTTGCCCATCTTTCATCACTG
GCGGCACGTCAGATCCA
CACCGTGGGCTACTGGAGAG
CCAGGGAATCGGTAGACATCG
CGGCTCTATCTCTACGCTCTCC
CTCAGACACAGCCAGGGAACTC
AGCCTTGCCTTTGTTCAGTATC
GTTGCTCCATATCCTGTCCCT
GAGGGCTGATTAGAGAGAGGTC
TCACAACTCTCTTAGGAGCTCTGAACT
GCATCCCGAACAAGAGACAGAAT
GCCTTAGTTTGGACAGGATCTG
TCCAGCTCGGATTCCATGAAC
AGCAGCGAGTAGAAG
TCATCAGCAGCAGCCATGTA
TGCAACGTCGTTACGAGTCA
TCAGTGAAGTAAAGGTACAAGCTACAATCT
99
106
105
97
104
110
89,2
97
92
90
93
87
89
195
101
195
197
0.99
0.9986
0.99
0.92
0.94
0.96
0.99
0.9987
0.9761
0.9974
0.9957
0.9828
0.9971
0.9975
0.9991
0,9957
0,9635
Illumina sequencing
Illumina sequencing was performed on amplicons from cDNA
extracted from snap-frozen gut tissue samples of six smokeand six air-exposed mice. Sequencing was performed on
cDNA, which was synthesized from extracted RNA. Using
random primers for the cDNA synthesis, 16S rRNA was also
translated into cDNA, which made the samples suitable for
16S sequencing. The MicroRneasy Mini Kit (Qiagen) was
used for RNA extraction, for which the manufacturer ensures
high-purity RNA. When measuring samples using a
NanoDrop after RNA extraction, high concentrations (500
1000 ng l1) were obtained and 260/280 nm ratios were all
close to 2, which indicates good RNA quality. Quality and
concentrations were similar for samples of different gut parts.
The sequencing was performed by LGC Genomics (Berlin,
Germany). The raw flowgrams were processed and analysed
in an in-house MOTHUR (Schloss et al., 2009) (http://
www.mothur.org, version 1.26.0) and R (http://www.r
-project.org/ version 2.15.1)/Sweave pipeline. Sequencing
error was reduced using the MOTHUR implementation of the
SeqNoise algorithm (Quince et al., 2011). Alignment with the
SILVA 16S reference (Pruesse et al., 2007) was performed
and sequences were trimmed to overlap in the same alignment space. Chimeric sequences were removed using
Uchime (Edgar et al., 2011). A Bayesian classifier was used
with the ribosomal database project (RDP) training set (Cole
et al., 2009) of RDP release 9 (http://rdp.cme.msu.edu/) to
classify the sequences. Unique sequences were then clustered into 904 OTUs with a 97% sequence identity threshold,
Statistical analysis
Reported gene expression values are expressed as
mean standard error of the mean (SEM) and error bars
depict the SEM. Statistical analysis was performed by SPSS
21 Software (SPSS 21, Chicago, IL, USA) using Students
t-test for normally distributed populations, and Mann
Whitney U-test for populations where normal distribution was
not accomplished. A P-value of less than 0.05 was considered significant.
Clustering of DGGE data was done based on the
abundance-based Jaccard index (with fuzzy logic) or the Yue
and Claytons theta index, and the UPGMA. Similarities and
abundances were extracted from the software, and statistical
analysis was performed using R version 2.15.1. P-values
were calculated using permutation-based MANOVA
(vegan::Adonis).
For -diversity statistics on the Illumina sequencing data,
we applied the sPLS-DA method with two-factor design and
ad hoc optimization from the MixOmics package, considering
ileum, caecum and distal colon originating from the same
mouse as paired samples. The sPLS-DA is a combined multilevel and multivariate method and distinguishes between
within-sample and between-sample variation, after which the
discriminant analysis is executed on the between-sample
variation. We applied this method to identify the abundance of
specific OTUs in each separate intestinal region. An ad hoc
estimation procedure is used to include only the statistically
relevant OTUs. Applying tuning parameter two, the relevant
OTUs were selected in order to model the data into three
sPLS-DA components (Liquet et al., 2012).
Acknowledgements
We thank the FLAMES statistical centre for advice in our
statistical analyses. We are grateful to Dorothea van
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
10
L. Allais et al.
Limbergen, Ran Rumes and Lynn Supply for the support with
the animal experiments and the processing of the samples,
and Eliane Castrique, Christelle Snauwaert, Marie-Rose
Mouton, Katleen de Saedeleer, Anouk Goethals, Ann
Neesen, Indra de Borle, Evelyn Spruyt and Greet Barbier for
the excellent technical support with the animal experiments.
We thank Tim Lacoere, Siska Maertens and Lois Maignien
from LabMET for the support with the DGGE and Illumina
sequencing. This work was supported by the Special
Research Fund of Ghent University (01D41012), the Concerted Research Actions of Ghent University (BOF09/GOA/
005, BOF10/GOA/021 and BOF12/GOA/008) and the
Interuniversity Attraction Poles Program (IUAP, P7/30).
Liesbeth Allais is supported by a doctoral grant from the
Special Research Fund of Ghent University (01D41012).
Frederiek-Maarten Kerckhof is supported by a doctoral grant
from the Concerted Research Actions of Ghent University
(BOF09/GOA/005). Ken R. Bracke is a postdoctoral
researcher of the Fund for Scientific Research Flanders
(FWO Vlaanderen). No author has an ethical or financial
conflict of interest.
References
Ananthakrishnan, A.N. (2013) Environmental risk factors for
inflammatory bowel disease. Gastroenterol Hepatol (N Y)
9: 367374.
Ananthakrishnan, A.N. (2015) Environmental risk factors for
inflammatory bowel diseases: a review. Dig Dis Sci 60:
290298.
Arcavi, L., and Benowitz, N.L. (2004) Cigarette smoking and
infection. Arch Intern Med 164: 22062216.
Arumugam, M., Raes, J., Pelletier, E., Le Paslier, D.,
Yamada, T., Mende, D.R., et al. (2011) Enterotypes of the
human gut microbiome. Nature 473: 174180.
Berry, D., and Reinisch, W. (2013) Intestinal microbiota: a
source of novel biomarkers in inflammatory bowel diseases? Best Pract Res Clin Gastroenterol 27: 4758.
Biedermann, L., Zeitz, J., Mwinyi, J., Sutter-Minder, E.,
Rehman, A., Ott, S.J., et al. (2013) Smoking cessation
induces profound changes in the composition of the intestinal microbiota in humans. PLoS ONE 8: e59260.
Boltin, D., Perets, T.T., Vilkin, A., and Niv, Y. (2013) Mucin
function in inflammatory bowel disease: an update. J Clin
Gastroenterol 47: 106111.
Boon, N., De Windt, W., Verstraete, W., and Top, E.M. (2002)
Evaluation of nested PCR-DGGE (denaturing gradient gel
electrophoresis) with group-specific 16S rRNA primers for
the analysis of bacterial communities from different wastewater treatment plants. FEMS Microbiol Ecol 39: 101112.
Brandtzaeg, P., and Pabst, R. (2004) Lets go mucosal: communication on slippery ground. Trends Immunol 25: 570
577.
Carbonnel, F., Jantchou, P., Monnet, E., and Cosnes, J.
(2009) Environmental risk factors in Crohns disease and
ulcerative colitis: an update. Gastroenterol Clin Biol 33
(Suppl. 3): S145S157.
Cole, J.R., Wang, Q., Cardenas, E., Fish, J., Chai, B., Farris,
R.J., et al. (2009) The Ribosomal Database Project:
improved alignments and new tools for rRNA analysis.
Nucleic Acids Res 37: D141D145.
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
11
flagellin elicits widespread innate immune defense mechanisms, apoptotic signaling, and a sepsis-like systemic
inflammatory response in mice. Crit Care 14: R160.
Round, J.L., and Mazmanian, S.K. (2009) The gut microbiota
shapes intestinal immune responses during health and
disease. Nat Rev Immunol 9: 313323.
Round, J.L., OConnell, R.M., and Mazmanian, S.K. (2010)
Coordination of tolerogenic immune responses by the commensal microbiota. J Autoimmun 34: J220J225.
Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R.,
Hartmann, M., Hollister, E.B., et al. (2009) Introducing
Mothur: open-source, platform-independent, communitysupported software for describing and comparing microbial
communities. Appl Environ Microbiol 75: 75377541.
Shirazi, T., Longman, R.J., Corfield, A.P., and Probert, C.S.
(2000) Mucins and inflammatory bowel disease. Postgrad
Med J 76: 473478.
Stecher, B., Maier, L., and Hardt, W.D. (2013) Blooming in
the gut: how dysbiosis might contribute to pathogen evolution. Nat Rev Microbiol 11: 277284.
Strober, W., Fuss, I., and Mannon, P. (2007) The fundamental
basis of inflammatory bowel disease. J Clin Invest 117:
514521.
Tomoda, K., Kubo, K., Asahara, T., Andoh, A., Nomoto, K.,
Nishii, Y., et al. (2011) Cigarette smoke decreases organic
acids levels and population of bifidobacterium in the
caecum of rats. J Toxicol Sci 36: 261266.
Verschuere, S., Bracke, K.R., Demoor, T., Plantinga, M.,
Verbrugghe, P., Ferdinande, L., et al. (2011) Cigarette
smoking alters epithelial apoptosis and immune composition in murine GALT. Lab Invest 91: 10561067.
Verschuere, S., Allais, L., Bracke, K.R., Lippens, S.,
De Smet, R., Vandenabeele, P., et al. (2012) Cigarette
smoke and the terminal ileum: increased autophagy in
murine follicle-associated epithelium and Peyers patches.
Histochem Cell Biol 137: 293301.
Wang, H., Zhao, J.X., Hu, N., Ren, J., Du, M., and Zhu, M.J.
(2012) Side-stream smoking reduces intestinal inflammation and increases expression of tight junction proteins.
World J Gastroenterol 18: 21802187.
Xavier, R.J., and Podolsky, D.K. (2007) Unravelling the
pathogenesis of inflammatory bowel disease. Nature 448:
427434.
Yu, H., Li, Q., Kolosov, V.P., Perelman, J.M., and Zhou, X.
(2012) Regulation of cigarette smoke-mediated mucin
expression by hypoxia-inducible factor-1alpha via epidermal growth factor receptor-mediated signaling pathways.
J Appl Toxicol 32: 282292.
Supporting information
Additional Supporting Information may be found in the online
version of this article at the publishers web-site:
Fig. S1. Agglomerative nesting clustering dendrograms
using the abundance-based Yue and Claytons based on
the DGGE data with average linkage (UPGMA), normalized
in BIONUMERICS 5.10 software. (A) clustering dendrogram for
ileum, (B) clustering dendrogram for caecum and (C) clustering dendrograms for distal colon. SM, smoking; NSM, nonsmoking; DC, distal colon; IL, ileum; CC, caecum.
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology
12
L. Allais et al.
2015 Society for Applied Microbiology and John Wiley & Sons Ltd, Environmental Microbiology