INTRODUCTION

Poultry production in Botswana have grown in recent years .Moreki (2008) explains that in
Botswana small scale poultry farmers constitute the majority of chicken rears in the country. A
significant number of Small Medium and Micro Sized Enterprises (SMMEs) producers raise
their poultry outdoors and sell the meat directly to the customers without any inspection
including the microbial safety of the meat. Moreki (2011). This has created a need to assess the
microbial safety of the meat in order to insure that the public is protected against any out comes
that may arise due to the consumption of the poultry meat.
It is important to note that microbial safety of meat has now become an increasing public health
concern due to an increase in foodborne illnesses caused by eating contaminated meat .It is
estimated that each year in the united states there are approximately 76 million foodborne
illnesses recorded. Salmonella, E.coli and Campylobacter are the most common cause of
foodborne illnesses. These pathogens cause foodborne illness of gastroenteritis symptoms e.g.
diarrhea, vomiting, fever headaches etc. At times death may occur. Attanasso and Ring (1999)
also explains that meat contaminated with Salmonella or E.coli can lead to diseases such as
Salmonellosis and Hemorrhagic colitis which can cause kidney failure. Meat contamination
with these pathogens can occur at various steps along the food production chain which include
production, processing, distribution, retail marketing and handling or preparation. Many animals
(rats, mice) and insects (cockroaches) can infect the meat with such organisms if not controlled
properly, Charles et.al (2015).Within chicken meat processing plant a number of steps should be
taken to ensure that contamination is prevented for instance very active rodent control, water
chlorination and temperature controls.
Despite the growing poultry industry, there are challenges faced by the farmers that may
contribute to poor quality meat and these challenges include poor quality feeds, lack of cold
storage facilities and lack of utility such as water and electricity. This study involves the use of
molecular biology based methods i.e. Polymerase chain reaction as it has shown the sensitivity
and specificity for detecting target organisms in meat and time required to obtain results is short
as 12hours compared to the conventional microbiology methods(Fratamico 2005).

OBJECTIVES
Assess safety aspects of SMME,s poultry operations.
To relate processing hygiene with product safety.

To enhance public health.

METHODOLOGY
Chicken samples were collected from different poultry Farms in Kanye and transported in cooler
box with ice packs inside it. The samples were collected as final poultry meat in selling packs.
Four samples were collected from Four different farms then samples were analyzed using
molecular biology methods i.e. polymerase chain reaction. The meat was analyzed for E.coli and
Salmonella.
Specific Primers Sequence used for PCR Amplification
Table 1: Showing specific Primers used for E.coli and Salmonella
SEQUENCE

ORIENTATION

NAME

GACCTCGGTTTAGTTCACAGA Forward

Eco 1

CACACGCTGACGCTGACCA

Reverse

Eco 2

TATCGCCACGTTCGGGCAA

Forward

Sal 3

TCGCACCGTCAAAGGAACC

Reverse

Sal 4

PCR PRODUCT
SIZE
585 bp

275 bp

1.0 PRE ENRICHMENT

25 grams of chicken meat was enriched in tryptone soy broth supplemented with yeast
extract (TSB-YE).The samples were then incubated overnight at 37C.From overnight mix
2ml of the broth was pipetted into micro centrifuge tubes and spinned at 10 000rpm and
DNA extraction was carried out as per the Fast ID extraction kit manual

2.0 PREPARATION POLYMERASE CHAIN REACTION

2.1 Genomic DNA Extraction

Extraction of DNA was done using the Fast ID Genomic DNA extraction kit.

2.2 PCR mix Preparation

PCR mix was prepared by pipetting Dream Taq PCR Master mix( contains: Magnesium chloride,
PCR buffer, DNA Taq polymerase and deoxynucleoside triphosphates ( dNTP's), Specific
primers, DNA sample and nuclease free water into the 0.2ml PCR tubes to make the final volume
in the tube to be 50 l containing :

Dream Taq PCR Master Mix:25l

DNA sample (concentration of 20ng/l):..10l
Nuclease free water:..5l
Mixture of primers (concentration of 10M)...10l
PRIMER MIX PREPARATION
E.coli forward primer5l
E.coli reverse primer.5l
Salmonella forward primer..5l
Salmonella reverse primer..5l
Total..20l

N.B From the 20l of the primer mix 10l was pippeted in a new micro centrifuge tube and
mixed with 90l of RNase free water to make a final concentration of 10M. From the 10M
solution 10l was added to pcr mixture.
3.0 DNA AMPLIFICATION
DNA amplification was done using the PCR machine(thermo cycler) which was set to run for 35
cycles each consisting of 30s at 95C ( Denaturation), 1min 30s at 59 C(Annealing),1min at 72
C and final extension step at 10 min at 72 C.

4.0 AGAROSE GEL ELECTROPHORESIS

4.1 Gel preparation
2% Agarose gel was prepared by dissolving 2g of the agar into 100ml of 1XTAE
buffer. The gel was poured on a gel tray and left to solidify. The solidified gel was
placed on the gel box containing 1TAE buffer.
4.2 Loading of Sample
Sample was loaded while the gel was suspended in the buffer. 5l of the sample + 1l
of DNA loading dye were loaded in each well accordingly .The loading dye gives the
DNA some weight so that it does not escape from the well after loading. DNA Marker
of 1000bp was also added for reference purposes. The marker also known as ladder
was loaded on the first well labelled L in Figure 1.

4.3 Electrophoresis
After loading the sample the electrodes were attached to the power supply for
electrophoresis. By attaching the electrodes electric field was created in which the
DNA will migrate from negative charge towards positive charge.
N.B. The DNA is negatively charged, always run the gel from negatively charged
electrode to positively
After gel electrophoresis gel was stained using the Ethidium bromide which binds to
the DNA acting as an intercalating agent

GEL IMAGING / GEL VEIWING

Gel was visualized using the Bio imaging System which use the UV light which is absorbed by
the Ethidium bromide dye.

MINI SURVEY
Some of the information was acquired through observations during inspections. This included the
administration of mini survey questionnaires which were used to determine if farmers know
anything about the microbial safety of poultry meat.
RESULTS
5

Figure 1. DNA amplification (ITS Products) of 275 bp salmonella and 585 bp E.coli using the
multiplex method

DISCUSSION

According to the results in Figure 1 in all the chicken samples (1, 2, 3, and 4) E.coli was detected
while Salmonella was detected in chicken sample 2 only. It can be observed from figure 1 that
there are bands (in lane 1-8) in line with the controls samples for E.coli(c 1) at 585 bp on the
ladder while in lane 3and 4 there are bands in line with the control sample for salmonella(c2) at
275bp on the ladder. This may be due to processing of poultry meat under unhygienic conditions
or poor hygienic practices during handling and processing i.e. evisceration.
From the survey it was noted that there was poor handling and processing of meat for instance
washing of the knife after using it to open the chicken was not done. This could lead to cross
contamination. In one of the Farms water used for scalding was not changed per batch. It was
also noted that the farm workers did not wear proper protective clothing. There was also a
concern that the chicken feeds are eaten by mice and rodents which are vectors of diseases and
can transmit Salmonella to poultry. (Charles et al.2015).The survey results also correlates with
Moreki (2011) who stated that generally the poultry meat in Botswana is processed under
unhygienic conditions that leads to meat contamination with such organisms like E.coli and
salmonella.
It is important to note that the survey findings correlates with the results in Figure 1 because poor
handling practices can lead to meat contamination with microbes. One major factor that may
have contributed to detection of these pathogens is that most farm personnel are unaware of the
microbial safety of meat.

CONCLUSION
7

In conclusion the results shows that chicken meat analyzed contain pathogenic microorganisms
which can lead to foodborne illness. This is due to factors such as lack of slaughter facilities,
poor hygienic practices as well as lack of knowledge on the microbial safety of meat. In future it
would be important to use both conventional microbiology and molecular based methods as each
method has some limitation. Sampling more farms would also be important in order to have a
true reflection on the meat safety in Kanye.

RECOMMENDATIONS
Government should sensitize the public about the importance of proper cooking of meat
either through television or radio.
There should be periodic inspection to insure that the farmers adhere to the food laws.
Relevant stakeholders should develop safety manuals so that farmers can use them in
their farms.
Government should build central abattoirs for small scale poultry farmers where they
would slaughter their chicken in order to eliminate problem of lack of slaughter facilities

REFERENCES
Charles H., William P. Sweeney J. Jeffrey R, and Barry J. (2015) Pest Control. Retrieved
fromhttp://www.pestcontrolcanada.com/Rodents/mice.htm.Revised2015-06-16,.Accessed
17-06-2015
Moreki J. C., (2008) Current Status of Livestock production in Botswana. AgriNews
38(12) : 7, 14-16
Moreki J. C., (2011) Poultry Meat production in Botswana. 23(7).
Fratamico, P.M., (2005). Real-time PCR. Food Protection