JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 1998, p. 3020–3027 Vol. 36, No.

10
0095-1137/98/$04.0010
Copyright © 1998, American Society for Microbiology. All Rights Reserved.

Genotyping of 27 Human Papillomavirus Types by Using L1

Consensus PCR Products by a Single-Hybridization,
Reverse Line Blot Detection Method
P. E. GRAVITT,1† C. L. PEYTON,2 R. J. APPLE,1* AND C. M. WHEELER2
Department of Human Genetics, Roche Molecular Systems, Inc., Alameda, California 945011 and
Department of Molecular Genetics and Microbiology, University of New Mexico
School of Medicine, Albuquerque, New Mexico 871312
Received 5 March 1998/Returned for modification 6 May 1998/Accepted 12 June 1998

Amplification of human papillomavirus (HPV) DNA by L1 consensus primer systems (e.g., MY09/11 or
GP51/61) can detect as few as 10 to 100 molecules of HPV targets from a genital sample. However, genotype
determination by dot blot hybridization is laborious and requires at least 27 separate hybridizations for
substantive HPV-type discrimination. A reverse blot method was developed which employs a biotin-labeled
PCR product hybridized to an array of immobilized oligonucleotide probes. By the reverse blot strip analysis,
genotype discrimination of multiple HPV types can be accomplished in a single hybridization and wash cycle.
Twenty-seven HPV probe mixes, two control probe concentrations, and a single reference line were immobilized
to 75- by 6-mm nylon strips. Each individual probe line contained a mixture of two bovine serum albumin-
conjugated oligonucleotide probes specific to a unique HPV genotype. The genotype spectrum discriminated on
this strip includes the high-risk, or cancer-associated, HPV genotypes 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 55,
56, 58, 59, 68 (ME180), MM4 (W13B), MM7 (P291), and MM9 (P238A) and the low-risk, or non-cancer-
associated, genotypes 6, 11, 40, 42, 53, 54, 57, 66, and MM8 (P155). In addition, two concentrations of b-globin
probes allowed for assessment of individual specimen adequacy following amplification. We have evaluated the
performance of the strip method relative to that of a previously reported dot blot format (H. M. Bauer et al.,
p. 132–152, in C. S. Herrington and J. O. D. McGee (ed.), Diagnostic Molecular Pathology: a Practical Approach,
(1992), by testing 328 cervical swab samples collected in Digene specimen transport medium (Digene Diag-
nostics, Silver Spring, Md.). We show excellent agreement between the two detection formats, with 92%
concordance for HPV positivity (kappa 5 0.78, P < 0.001). Nearly all of the discrepant HPV-positive samples
resulted from weak signals and can be attributed to sampling error from specimens with low concentrations
(<1 copy/ml) of HPV DNA. The primary advantage of the strip-based detection system is the ability to rapidly
genotype HPVs present in genital samples with high sensitivity and specificity, minimizing the likelihood of
misclassification.

Epidemiologic evidence identifying human papillomavirus
(HPV) as the sexually transmitted, primary cause of cervical
cancer is strong (12). It is clear from several large case-control
and cohort studies that HPV infection is the main risk factor
for the development of cervical intraepithelial neoplasia and
that risk is significantly increased by persistent infection with
high-risk, or cancer-associated, HPV genotypes (2, 3, 14, 15,
23). PCR technology, particularly with consensus, or general,
primer systems such as MY09/11 (1) and GP51/61 (13), has
been instrumental to these studies by elaborating the natural
history of HPV infections. The recognition of HPV infection as
a factor that is necessary, but not sufficient, for the develop-
ment of cervical cancer has resulted in the initiation of several
longitudinal studies and randomized clinical trials designed to
examine the predictive value of HPV DNA testing (5, 6, 12, 17,
18, 24). Preliminary findings from these studies support the
potential utility of HPV testing for the effective triage of Pap
smears of atypical squamous cells of undetermined significance
and atypical glandular cells of undetermined significance and
* Corresponding author. Mailing address: Roche Molecular Sys-
tems, Inc., 1145 Atlantic Ave., Alameda, CA 94501. Phone: (510)
814-2938. Fax: (510) 522-1285. E-mail: raymond.apple@roche.com.
† Present address: Department of Epidemiology, School of Hygiene
and Public Health, Johns Hopkins University, Baltimore, MD 21205.
suggest a potential role in primary screening of populations in
which Pap smears have not been sufficiently effective. A rapid
PCR-based test for HPV DNA is also important to accurately
investigate the natural history of HPV infections. Further-
more, because of the high sensitivity and type specificity af-
forded only by amplified DNA detection methods, specific
PCR-based HPV DNA typing may have a unique utility in the
clinical management of cervical lesions.
We report a method that uses a sensitive and broad-spec-
trum amplification system (1), followed by a single hybridiza-
tion with a reverse line blot detection method for complete
HPV genotype discrimination (see Fig. 1). This method, like
other PCR-based assays, avoids false negatives below the limit
of detection of nonamplified methods and can readily detect a
broad spectrum of HPV genotypes. Furthermore, HPV type-
specific disease associations can be precisely defined, since
genotypes are individually discriminated.
MATERIALS AND METHODS
Sample acquisition and preparation. Cervical specimens were collected in 1.0
ml of specimen transport medium (Digene Diagnostics, Silver Spring, Md.) as
part of an ongoing natural history study of HPV infection conducted at the
University of New Mexico Health Sciences Center. The samples were processed
by adding 30 ml of digestion solution to achieve a final concentration of 200 mg
of proteinase K per ml and 0.1% Laureth-12. Digestion was conducted at 56°C
for 1 h. A 300-ml aliquot of the digested material was added to 1.0 ml of absolute
ethanol containing ammonium acetate and precipitated overnight at 220°C. The

3020
VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS
FIG. 1. HPV genotyping of PCR product by reverse line blot method. Schematic of the reverse line blot genotyping assay from L1 consensus primer-generated PCR
products. The drawing represents the detection of a hypothetical mixed infection of HPV 16, 31, and 11.
precipitated DNA was centrifuged for 30 min at 13,000 3 g. The supernatant was
immediately removed and discarded with a plugged Pasteur pipette. The crude
DNA pellet was dried overnight at room temperature. The pellet was then
resuspended in 150 ml of TE (10 mM Tris, 1 mM EDTA) and incubated for 15
min at 95°C to inactivate the proteinase K. The crude DNA extracts were then
stored at 220°C until amplification.
PCR and dot blot-based HPV-testing methods. Prior to amplification, the
crude digests were allowed to reach room temperature and centrifuged briefly.
Six microliters of each specimen was amplified with the MY09-MY11-HMB01
L1 consensus primer system (1) and AmpliTaq polymerase (Perkin-Elmer, Fos-
ter City, Calif.). To determine specimen adequacy, the GH20/PC04 human
b-globin target was coamplified with the HPV consensus primers. The PCRs
were amplified in a Perkin-Elmer GeneAmp PCR System 9600 for 40 cycles. The
following ultrasensitive, or long, amplification profile was used: 95°C denatur-
ation for 1 min, 55°C annealing for 1 min, and 72°C extension for 1 min for 40
cycles; followed by a 5-min terminal extension at 72°C. A subset of 56 specimens
were amplified with an alternate amplification profile (rapid amplification) as
follows: 95°C denaturation for 20 s, 55°C annealing for 20 s, and 72°C terminal
extension for 30 s for 40 cycles; followed by a 5-min extension at 72°C.
HPV typing analyses were carried out by dot blot hybridization and biotinyl-
ated HPV type-specific oligonucleotide probes as previously described (1, 10). To
each nylon membrane, 6 ml of each PCR product was denatured and applied to
replicate membranes with dot blot apparatuses (Bio-Rad, Hercules, Calif.). Pre-
viously characterized PCR products were applied to 22 wells on each membrane
as HPV type-specific controls (3.5 ml of PCR product per well). The membranes
were hybridized at 53°C overnight with biotinylated HPV type-specific oligonu-
cleotide probes (6/11, 16, 18, 31, 33, 35, 39, 45, 51 to 59, 66, 68, MM7, MM9, and
MM4). Probes for HPV types 26 and MM8 and 40 and 42 were pooled as pairs
during hybridization. A b-globin probe was used to assess specimen adequacy.
Following hybridization, membranes were washed at 56 to 57°C to remove
nonspecifically bound probe. The wash buffer was 56 to 57°C so that the wash
stringency would be increased, given the salt and detergent concentrations and
the selected oligonucleotide probes. This ensures efficient removal of the non-
specifically bound probe and optimal specific hybridization. The bound probes
were detected with streptavidin-horseradish peroxidase (Vector, Burlingame,
Calif.) and enhanced chemiluminescent substrate (ECL; Amersham, Arlington
Heights, Ill.). Blots were exposed to Kodak X-OMAT AR 5 film initially for 10
min, followed by a second 2-h or overnight exposure. HPV positivity by dot blot
was determined by establishment of a negative cutoff, and signals above the
cutoff were scored based on four graded levels of intensity with visual standard
references. In addition, these autoradiograms were read by two blinded inde-
pendent observers. The discrepant results were resolved independently by a third
observer.
PCR and line blot-based detection methods. HPV DNA was amplified by the
L1 consensus primer system previously described for dot blot detection, except
3021
each primer was labeled with a 59 biotin molecule (denoted in the primer name
by the inclusion of a capital B as follows: MYB09, MYB11, HMBB01, B GH20,
B PC04). In brief, each amplification contained 10 mM Tris-HCl (pH 8.5), 50
mM KCl, 6 mM MgCl2, 200 mM (each) dCTP, dGTP, and dATP, 600 mM dUTP,
7 to 10 U of AmpliTaq Gold, 50 pmol of MYB09, 50 pmol of MYB11, 5 pmol of
HMBB01, 5 pmol of B PC04, 5 pmol of B GH20, and 5 to 10 ml of sample (the
MgCl2, dUTP, and AmpliTaq Gold were modifications from dot blot protocol).
Modifications to the published L1 consensus amplification were made to obtain
optimal sensitivity and to standardize the format to other RMS PCR assays. For
eventual inclusion of uracil-N-glycosylase to prevent product carryover, dTTP
was replaced with dUTP. It was empirically determined that the dUTP concen-
tration must be increased threefold relative to the other dNTPs for efficient
strand incorporation by a DNA polymerase. The MgCl2 was subsequently reop-
timized to 6 mM to compensate for the increase in dNTP concentration. Reac-
tions were amplified in a Perkin-Elmer TC9600 thermal cycler with the following
ultrasensitive thermal profile: 9-min AmpliTaq Gold activation at 95°C, 40 cycles
of 1-min denaturation at 95°C, 1-min annealing at 55°C, 1-min extension at 72°C;
a 5-min final extension at 72°C; and a hold step at 15°C. A subset of 56 specimens
were amplified with an alternate amplification profile (rapid amplification) as
follows: a 9-min AmpliTaq Gold activation at 95°C followed by 40 cycles of
denaturation for 20 s at 95°C, annealing for 20 s at 55°C, and terminal extension
for 30 s at 72°C; followed by a 5-minute extension at 72°C and a hold step at 15°C.
After removal from the thermal cycler, samples were stored at 4°C.
The general principle of immobilized probe hybridization has been described
elsewhere (4, 21), and a schematic of the procedure is presented in Fig. 1.
Generally, the probes were diluted into a coating buffer (50 mM 3-[cyclohex-
ylamino]-1-propanesulfonic acid [CAPS] and 0.1 g of orange dye II per liter) and
applied to a plastic-backed nylon membrane strip with a pump mechanism which
delivers controlled amounts of probe to the membrane. The HPV genotyping
strip contains 29 probe lines plus one reference ink line, detecting 27 individual
HPV genotypes and two concentrations of the b-globin control probe. Two
bovine serum albumin (BSA)-conjugated probes per HPV type, corresponding to
each of two hypervariable regions within the MY09/MY11 amplicon, are depos-
ited in a single line for each of the following HPV types: 16, 18, 26, 31, 33, 35, 39,
42, 45, 51 to 59, 66, 68, MM4, MM7, MM8, and MM9. HPV types 6, 11, 40, and
the b-globin controls have a single probe deposited per line. Subsequent to this
study, HPV 51A has been removed from the HPV 51 pool, due to apparent
cross-reactivity with nonspecific amplicon. The configuration of the genotyping
strip is diagrammed in Fig. 2, and the probe sequences are listed in Table 1. The
high- and low-risk HPV types are visually separated by b-globin control lines
such that all types between the reference and b-globin control lines are associ-
ated with high cancer risk and all types beyond the control lines are associated
with low or no cancer risk. Disease association was defined according to the
International Biological Study on Cervical Cancer (3). In the International Bi-
ological Study on Cervical Cancer, HPV types were considered high risk if
3022 GRAVITT ET AL. J. CLIN. MICROBIOL.

FIG. 2. Probe layout of the HPV genotyping strip. (a) HPV genotyping strips (n 5 28) hybridized with the HPV L1 consensus PCR product generated from the
HPV targets indicated to the right. Fifty microliters of PCR product generated from amplification of 106 HPV plasmid targets (with the exception of HPV 51 and 68,
which were amplified with 103 plasmid targets) in a background of human cellular DNA (12.5 ng/PCR) was hybridized to the HPV genotyping strips and detected by
the previously described reverse line blot method. (b) Line blot genotyping hybridization results for 10 clinical specimens in the previously described study. Fifty
microliters of denatured PCR product was hybridized to each strip. The genotyping results for the specimens are as follows: no. 333, HPV negative; no. 334, HPV
negative; no. 352, HPV 16, 26, and MM8; no. 353, HPV 16; no. 354, HPV 16, 51, and 66; no. 355, HPV negative; no. 357, HPV 39; no. 359, HPV MM7; no. 361, HPV
16 and 52; and no. 373, HPV 18, 56, and 58.

detected as a single HPV infection within an invasive cancer. One exception is an
HPV 6 which was found alone in a single invasive tumor; we still considered HPV
6 to be an HPV with low oncogenic potential, and it remains in the low-risk
category within our present study.
All liquid detection reagents used for the line blot assay were from Amplicor
strip detection reagent kits (Dynal, Oslo, Norway). PCR products were dena-
tured with 0.13 N NaOH (1:2 dilution of 0.4 N NaOH in PCR product). HPV
genotyping strips were placed into individual wells of the typing trays (Perkin-
Elmer) and covered with 3 ml of hybridization buffer (43 SSPE [13 SSPE is 0.18
M NaCl, 10 mM NaH2PO4, and 1 mM EDTA, pH 7.7], 0.1% sodium dodecyl
sulfate) prewarmed to 53°C. Seventy microliters of denatured, biotinylated prod-
uct was added to each well and incubated in a shallow, shaking (60 rpm) water
bath at 53°C for 30 min. Following hybridization, trays were removed from the
water bath, and hybridization solution was removed with a vacuum aspirator.
Strips were briefly rinsed in the trays with ambient wash buffer (13 SSPE, 0.1%
sodium dodecyl sulfate). After removal of the rinse by aspiration, 3 ml of
prewarmed (53°C) wash buffer was added to each well and the trays were
incubated in a shaking water bath at 53°C for 15 min. After the stringent wash,
buffer was removed, 3 ml of streptavidin-horseradish peroxidase conjugate was
added to each well, and the tray was placed on a rotating platform at room
temperature for 30 min, with shaking at 70 rpm. Unbound conjugate was re-
moved by a quick rinse with ambient wash buffer followed by two 10-min washes
in ambient wash buffer. After the final wash, buffer was removed by vacuum
aspiration, and strips were rinsed in 0.1 M sodium citrate. Color development
was activated by incubation in a 4:1 mixture of substrates A (hydrogen peroxide
in sodium citrate buffer) and B (3,39,5,59-tetramethylbenzidine in dimethylform-
amide) for 5 min on a rotating platform (70 rpm). Strips were rinsed in deionized
water and stored in citrate buffer until interpretation. Developed strips were
interpreted or photographed within 2 h of color development for accurate anal-
ysis of the results. Strips can be stored in citrate buffer in a sealed plastic bag in
the dark. Any prolonged exposure to light results in fading of the signal and
darkening of the membrane. Alternatively, the strips can be dried immediately
following the final citrate buffer wash and taped directly into a research note-
book. Strip interpretation was performed with a labeled acetate overlay, with
lines indicating the position of each probe relative to the reference mark.
RESULTS
Analytic sensitivity of the HPV-type spectrum detected for
both dot blot and line blot assays was determined by serial
dilution of HPV plasmid or M13 phage clones amplified in a
background of 12.5 ng of human cellular DNA from the K562
cell line (ATCC CCL243). HPV types 58, 59, 61, 62, 64, and 67
were provided by T. Matsukura; HPVs 33, 39, 42, 54, 55, 66, 68,
and 70 were from G. Orth; HPVs 6, 11, 16, 18, 53, and 57 were
from E. M. de Villiers; HPV 52 was from W. Lancaster; HPV
26 was from R. Ostrow; HPV 45 was from K. Shah; and HPV
51 was from S. Silverstein. Clinical HPV types, including MM4
(W13B), MM7 (P291), MM8 (P155), and MM9 (P238A) had
been previously cloned as PCR fragments of approximately
VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS 3023

TABLE 1. BSA-conjugated HPV line blot probe sequences

HPV type BSA probe Biotinylated probe Sequencea

6 HPV611A MYB12 CATCCGTAACTACATCTTCCA (1)

11 HPV611B MYB13 TCTGTGTCTAAATCTGCTACA (1)

16 HPV16A MYB95 GATATGGCAGCACATAATGAC (1)

HPV16B MYB133 GTAACATCCCAGGCAATTG (1)

18 HPV18C CTTAAATTTGGTAGCATCATATTGb
HPV18D TCAGCCGGTGCAGCATCC

26 HPV26A MYB186 GCTGACAGGTAGTAGCAGAGTT (10)

HPV26B MYB187 GCCATAACATCTGTTGTAAGTG (10)

31 HPV31C GATCTTCCTTGGGCTTTTGG
HPV31D TGTCTGTTTGTGCTGCAATT

33 HPV33C CTGTCACTAGTTACTTGTGTGCAT
HPV33E TTTGGAGGTACTGTTTTTTGA

35 HPV35A MYB115 CTGCTGTGTCTTCTAGTGACAG (1)

HPV35B MYB117 ATCATCTTTAGGTTTTGGTGC (1)

39 HPV39A MYB89 TAGAGTCTTCCATACCTTCTAC (1)

HPV39B MYB90 CTGTAGCTCCTCCACCATCT (1)

40 HPV40A MYB176 CCCAAGGTACGGGAGGATCC (10)

42 HPV42C GCGTTGTTACCTTAGCCTGA
HPV42D ATCACCAGATGTTGCAGTG

45 HPV45A MYB69 ATACTACACCTCCAGAAAAGC (1)

HPV45B MYB129 GCACAGGATTTTGTGTAGAG (10)

51 HPV51Ab MYB87 TATTAGCACTGCCACTGCTG (1)

HPV51D CATCCTCCAAACTAGCAGAC

52 HPV52A MYB81 CACTTCTACTGCTATAACTTGT (1)

HPV52B MYB82 ACACACCACCTAAAGGAAAGG (1)

53 HPV53A MYB102 TTCTACCTTACTGGAAGACTGG (10)

HPV53B MYB182 GCAACCACACAGTCTATGTC (10)

54 HPV54C TTATTAAAGCTATCCTGCGTGG
HPV54D TCCTCCAAACTACTTGTAGCTG

55 HPV55A MYB151 GTGCTGCTACAACTCAGTCT (10)

HPV55D CGCATGTATTGTTTATATTCTGTA

56 HPV56A MYB197 GCACAGCTATAACATGTCAACG (10)

HPV56C CGTGCATCATATTTACTTAACTG

57 HPV57A MYB154 AATGTCTCTTTGTGTGCCAC (10)

HPV57B MYB156 GGATCAGTAGGGGTCTTAGG (10)

58 HPV58A MYB94 AGCACCCCCTAAAGAAAAGGA (10)

HPV58B MYB179 GACATTATGCACTGAAGTAACTAAG (10)

59 HPV59A MYB123 GCCAGTTAAACAGGACCC (10)

HPV59B MYB162 CCTAATGWATACACACCTACCAG (10)

66 HPV66A MYB83 ATTAATGCAGCTAAAAGCACATT (10)

HPV66B MYB178 CATGTCAGAGGGAACAGCC (10)

68 HPV68A MYB191 CATACCGCTATCTGCAATCAG (10)

HPV68B MYB194 CTACTACTGAATCAGCTGTACC (10)

MM4 HPVMM4A MYB164 CTCAATCTGTTGCACAAACA (10)

HPVMM4B MYB165 TAACCTTGCCCCCCTCAG (10)
Continued on following page
3024 GRAVITT ET AL.
TABLE 1—Continued
HPV type BSA probe
MM7 HPVMM7A
HPVMM7C
MM8 HPVMM8A
HPVMM8B
MM9 HPVMM9A
HPVMM9B
b-Globin B PCO3
a
Bold-faced sequences have not been previously published.
b
HPV 51A was subsequently removed from the assay; see Materials and Methods.
450 bp (16). Additional sensitivities were determined in pre-
characterized cervical specimens. Sensitivities were virtually
identical by both dot and line blot assays, ranging from 10 to
100 genomes per PCR for HPV types 6, 11, 16, 18, 31, 33, 39,
45, 51, 52, 58, 59, 66, and 68 and from ;500 to 1,000 genomes
per PCR for HPV types 26, 35, 40, 42, and 53 to 57. Variation
in sensitivity among the genotypes reflects the number and
position of mismatched bases in the primer-binding region at
nondegenerate sites.
The specificity of HPV genotype discrimination was tested
by hybridization of 500 ng (determined by gel quantitation) of
amplified product to the HPV genotyping strips. Specificity of
typing was excellent, with negligible background or cross-reac-
tivity.
To test the utility of the line blot HPV detection method in
clinical samples, we analyzed 359 specimens collected in Di-
gene specimen transport medium. Type-specific oligonucleo-
tide probe results obtained by the standard MY09-MY11-
HMB01 dot blot hybridization method were compared to
those obtained using the MYB09-MYB11-BHMB01 reverse
line blot method. Two separate aliquots of each digested STM
sample were taken and processed independently at the two
participating laboratory sites, where all aliquots were amplified
by using the ultrasensitive amplification profile (see Materials
and Methods). Thirty-two HPV-positive and 24 HPV-negative
samples determined by the ultrasensitive cycle system were
randomly chosen for analysis by the short cycle profile, in
which the time at each temperature step in the thermal profile
was shortened. Samples were amplified separately for dot and
line blot detection because of the requirement of unlabeled
versus labeled primers in the dot and line blot detection meth-
ods, respectively. Investigators performing the two assays were
blinded to results until all interpretations were final.
Of the 359 samples evaluated, 30 were excluded because of
false signal generation from the ECL substrate (1), presumably
caused by pseudoperoxidases in the sample, thus precluding
interpretation of the dot blot results. The results from the
remaining 329 samples are presented.
The HPV prevalence in this population was 24.0 and 25.5%
by the dot blot and line blot detection methods, respectively.
Table 2 represents the overall HPV concordance between the
two detection formats. Agreement for HPV-positive results
was good, with a kappa statistic of 0.78. Type-specific agree-
ment between the two methods was good, with total concor-
dance ranging from 97 to 100%. Within the HPV-positive
samples, multiple HPV types were detected in 10.7 and 8.5%
of specimens by the dot blot and line blot detection methods,
respectively. A comparison of the results from 56 samples that
J. CLIN. MICROBIOL.
Biotinylated probe Sequencea
MYB166 GGCTAATGAATACACAGCCTC (10)
TCCTTCCACCAGCCTTGAT
MYB85 CCAACACCGAATCAGAATATAAA (10)
MYB163 GTTGTGCCCCCTCCCTCCA (10)
MYB104 GTAGGTACACAGGCTAGTAGCTC (10)
MYB106 AGTTGCCAACGTCCTCAAC (10)
PC03 ACACAACTGTGTTCACTAGC (1)
were amplified and detected with a long and short cycle profile
is presented in Table 3. Only 49 of the 56 samples were in-
cluded in the final analysis due to false ECL signals on the dot
blot. As expected, the agreement between the two amplifica-
tion profiles reflected the increase in detection of low levels of
HPV with the longer, ultrasensitive profile. Only the line blot
results for rapid versus ultrasensitive amplification profiles are
shown; however, the dot blot results were virtually identical
(87.8% agreement, kappa 5 0.75 for both line and dot blot).
Further analysis of HPV data for both line and dot HPV assay
was conducted based on recorded intensities. Signal intensity
scores were as follows: 1, strong; 2, medium; 3, weak; 4, very
weak; and 0, negative. Stratified analyses by signal intensity
revealed that a short versus a long profile resulted in discor-
dance within HPV-positive specimens designated 3, 4, and 0
(i.e., weak or negative) for both the line and dot blot assays.
Assays of samples with discrepant results were repeated by
line blot. Results by line blot were consistent after repeat
analysis, with the exception of weak-positive signals, which
were inconsistently amplified. To ascertain the possibility of
irreproducibility due to sampling error from low concentra-
tions of viral DNA, we added HPV 16 plasmid DNA to a PCR
premix for a final concentration of 1.27 3 1024 fg/ml, the
equivalent of a single target per 100-ml reaction mixture. This
mixture was aliquotted to 80 PCR tubes and amplified under
sensitive amplification profiles. Analysis of the products by
strip analysis indicated that only 42 of 80, or 52.5%, were
positive for HPV DNA. Human DNA was included at a con-
centration of 2.5 ng per PCR and was amplified in all 80
reactions.
DISCUSSION
We compared our reformatted line blot system to the estab-
lished dot blot assay to evaluate its performance. In general,
the results from this comparison are highly concordant, both
for overall HPV DNA detection and for genotype-specific dis-
crimination. Most of the signals from the few discrepant sam-
ples were weak, suggesting low concentration of viral DNA,
with disagreement likely attributable to sampling error and
variable amplification of low levels of HPV DNA. This expla-
nation is substantiated by the following observations. First, the
design of the study required each laboratory to prepare, am-
plify, and detect each sample separately. This procedure cre-
ates at least three separate circumstances wherein subaliquots
of each sample were transferred to a subsequent step in the
protocol. The likelihood of each transfer containing equivalent
concentrations of HPV DNA is low. Second, the discrepant
VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS 3025

TABLE 2. Correlation between results for dot and line blot assays (n 5 329)
Dot blot Line blot Dot or line Dot and strip % overall % agreement
HPV type Kappa
positive n (%) positive n (%) positive n (%) positive n (%) agreement among positives

Any 79 (24.0) 84 (25.5) 95 (28.9) 68 (20.7) 91.8 71.6 0.780

6 or 11 5 (1.5) 6 (1.8) 6 (1.8) 5 (1.5) 99.7 83.3 0.908
16 16 (4.9) 22 (6.7) 22 (6.7) 16 (4.9) 98.2 72.7 0.883
18 5 (1.5) 6 (1.8) 7 (2.1) 4 (1.2) 99.1 57.1 0.723
26 or MM8 4 (1.2) 5 (1.5) 5 (1.5) 4 (1.2) 99.7 80.0 0.887
31 10 (3.0) 9 (2.7) 12 (3.6) 7 (2.1) 98.5 58.3 0.729
33 2 (0.6) 2 (0.6) 2 (0.6) 2 (0.6) 100 100 1.000
35 1 (0.3) 1 (0.3) 1 (0.3) 1 (0.3) 100 100 1.000
39 5 (1.5) 9 (2.7) 10 (3.0) 4 (1.2) 98.2 40.0 0.563
40 or 42 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
45 3 (0.9) 3 (0.9) 4 (1.2) 2 (0.6) 99.4 50.0 0.664
51 6 (1.8) 13 (4.0) 13 (4.0) 6 (1.8) 97.9 46.2 0.622
52 14 (4.3) 5 (1.5) 15 (4.6) 4 (1.2) 96.7 26.7 0.408
53 10 (3.0) 12 (3.6) 13 (4.0) 9 (2.7) 98.8 69.2 0.812
54 3 (0.9) 7 (2.1) 7 (2.1) 3 (0.9) 98.9 42.9 0.595
55 2 (0.6) 0 (0.0) 2 (0.6) 0 (0.0) 99.4 0.0
56 8 (2.4) 6 (1.8) 9 (2.7) 5 (1.5) 98.8 55.6 0.708
57 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
58 4 (1.2) 4 (1.2) 5 (1.5) 3 (0.9) 99.4 60.0 0.747
59 7 (2.1) 4 (1.2) 7 (2.1) 4 (1.2) 99.1 57.1 0.723
66 5 (1.5) 6 (1.8) 7 (2.1) 4 (1.2) 99.1 57.1 0.723
68 3 (0.9) 3 (0.9) 3 (0.9) 3 (0.9) 100 100 1.000
MM4 1 (0.3) 1 (0.3) 1 (0.3) 1 (0.3) 100 100 1.000
MM7 4 (1.2) 6 (1.8) 6 (1.8) 4 (1.2) 99.4 66.7 0.797
MM9 1 (0.3) 2 (0.6) 3 (0.9) 0 (0.0) 99.1 0.0 20.004

results were evenly distributed between the two methods, in-
dicating that neither method had a propensity toward false-
negative or false-positive results. Third, we demonstrated in a
controlled experiment that a homogeneous mixture of low-
copy DNA yielded a positive result in only 52.5% (42 of 80) of
the reactions tested. Based on these results, we attribute most
discrepancies to random sampling error, except those for HPV
types 51, 52, 54, and MM9. In these cases, the more-discordant
detection rates were attributed to differences in type-specific
amplification efficiencies among degenerate primer lots (data
not shown).
We also evaluated the effect of amplification conditions on

TABLE 3. Correlation between ultrasensitive and rapid PCR resultsa

Ultrasensitive Rapid positive Ultrasensitive or Ultrasensitive and % overall % agreement
HPV type Kappa
positive n (%) n (%) rapid positive n (%) rapid positive n (%) agreement among positives

Any 24 (49.0) 22 (44.9) 26 (53.1) 20 (40.8) 87.8 76.9 0.755

6 or 11 1 (2.0) 1 (2.0) 1 (2.0) 1 (2.0) 100 100 1.000
16 12 (24.5) 10 (20.4) 12 (24.5) 10 (20.4) 95.9 83.3 0.883
18 2 (4.1) 2 (4.1) 3 (6.1) 1 (2.0) 95.9 33.3 0.479
26 or MM8 1 (2.0) 3 (6.1) 3 (6.1) 1 (2.0) 95.9 33.3 0.484
31 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
33 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
35 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
39 1 (2.0) 1 (2.0) 1 (2.0) 1 (2.0) 100 100 1.000
40 or 42 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
45 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
51 5 (10.2) 2 (4.1) 5 (10.2) 2 (4.1) 93.9 40.0 0.545
52 3 (6.1) 0 (0.0) 3 (6.1) 0 (0.0) 93.9 0.0
53 3 (6.1) 1 (2.0) 3 (6.1) 1 (2.0) 95.9 33.3 0.484
54 2 (4.1) 2 (4.1) 3 (6.1) 1 (2.0) 95.9 33.3 0.479
55 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
56 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
57 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
58 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
59 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
66 3 (6.1) 2 (4.1) 3 (6.1) 2 (4.1) 98.0 66.7 0.790
68 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
MM4 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 100
MM7 2 (4.1) 2 (4.1) 2 (4.1) 2 (4.1) 100 100 1.000
MM9 1 (2.0) 0 (0.0) 1 (2.0) 0 (0.0) 98.0 0.0
a
n 5 49 for line blot results.
3026 GRAVITT ET AL.
the low-end sensitivity of the assay by decreasing the time
spent at each thermal cycling step in the amplification profile.
The results confirm that the discrepancies predominate among
the low-copy, or weak, positives, while all other results are
consistent, independent of the profile used. These results re-
flect the inherent variability in sensitivity that results from
seemingly minor changes in protocol. Thus, it is recommended
that changes to standardized protocols be accompanied by
revalidated assays and appropriately redefined performance
criteria.
It has been clearly demonstrated that accurate measurement
of even minute levels of HPV DNA is critical for a compre-
hensible evaluation of the natural history of HPV infection (7).
Use of a nonamplified method can dramatically skew the
strength and even the existence of important epidemiologic
associations. Thus, amplification methods, including consen-
sus, or general, primer PCR have been adopted for the major-
ity of epidemiological studies (11, 20, 22). While the use of
PCR methods can increase the molecular sensitivity of HPV
DNA detection, the issue of misclassification remains (8, 9,
19). It is important not only to increase the sensitivity relative
to detectable levels of virus but also to increase sensitivity by
increasing the spectrum of HPV genotypes detected, a goal
met by consensus primer PCR assays. However, previously
described consensus PCR methods that utilized dot blot for-
mats are too laborious to allow for the rapid evaluation of
genotype-specific infections in large population studies. As a
result, some investigators have combined genotyping probes
into mixtures of presumably related HPV types in an attempt
to reduce the number of hybridizations required. For example,
HPV 18 and 45 are often combined, the HR HPV 50s are
combined, the HR HPV 30s are combined, etc. Assumptions
have to be made regarding the validity of these groupings.
Groupings have historically been made according to anecdotal
observations of disease relatedness and more recently accord-
ing to phylogenetic relatedness. While these assumptions are
reasonable for grouping related viruses, the information ob-
tained from such groupings is inherently biased. Given that
slight misclassification of HPV-type status may have dramatic
effects on the interpretation of far-more-subtle associations,
some of which are also prone to measurement error, it is
clearly important to develop accurate discriminatory HPV-
typing systems.
The PCR-based line blot HPV detection method described
here allows sensitive amplification of a broad spectrum of HPV
genotypes and accurate discrimination between 27 of those
types. Subsequent to this report, our collaborative efforts have
extended the HPV type-specific discrimination of this novel
line blot to an additional 12 HPV types (data not shown). Thus,
disease associations can be more accurately defined, since dis-
crete and comprehensive genotyping information is available,
without confounding due to potential misclassification. Also,
since the central role of HPVs in the etiology of cervical cancer
has been defined, natural history studies of HPV infection will
now address more difficult issues, such as persistence, trans-
missibility, and immunologic responses. All these parameters
are adequately studied only in an HPV type-specific or perhaps
even in an HPV variant-specific manner.
In addition to natural history studies of HPV infection, the
success of HPV DNA testing in patient management and can-
cer screening strategies is dependent upon the methodology
used. The key to improving the current standard of Pap screen-
ing may be to significantly increase the specificity of cytology-
based screening, without a concomitant decrease in sensitivity.
It is believed that an HPV DNA testing method with both
high-positive and negative predictive value will serve to in-
J. CLIN. MICROBIOL.
crease both the sensitivity and specificity of cervical cancer
screening. Furthermore, the amplification and detection pro-
tocols used with the line blot detection method are compatible
with automation, facilitating the use of this method in large-
scale studies or screening. The ability to visually categorize
high- versus low-risk HPV infection rapidly by the line blot
supports the use of a detailed and informative research assay
for routine clinical screening and patient management pur-
poses.
ACKNOWLEDGMENTS
This work was funded in part by a grant to C.M.W. from the Na-
tional Institutes of Health (AI32917).
We thank William C. Hunt for performing the statistical analysis,
Susan Eaton for excellent technical support, and the Roche Molecular
Systems DNA synthesis group for oligonucleotide support.
REFERENCES
1. Bauer, H. M., C. E. Greer, and M. M. Manos. 1992. Determination of genital
human papillomavirus infection using consensus PCR, p. 132–152. In C. S.
Herrington and J. O. D. McGee (ed.), Diagnostic molecular pathology: a
practical approach. Oxford University Press, Oxford, United Kingdom.
2. Bosch, F. X., N. Munoz, S. de Sanjose, C. Navarro, P. Moreo, N. Ascunce,
L. C. Gonzalez, L. Tafur, M. Gili, I. Larranaga, et al. 1993. Human papil-
lomavirus and cervical intraepithelial neoplasia grade III/carcinoma in situ:
a case-control study in Spain and Colombia. Cancer Epidemiol. Biomarkers
Prev. 2:415–422.
3. Bosch, F. X., M. M. Manos, N. Munoz, M. Sherman, A. M. Jansen, J. Peto,
M. H. Schiffman, V. Moreno, R. Kurman, K. V. Shah, and the IBSCC Study
Group. 1995. Prevalence of human papillomavirus in cervical cancer: a
worldwide perspective. J. Natl. Cancer Inst. 87:796–802.
4. Bugawan, T. L., R. Apple, and H. Erlich. 1994. A method for typing poly-
morphism at the HLA-A locus using PCR amplification and immobilized
oligonucleotide probes. Tissue Antigens 44:137–147.
5. Cox, J. T., A. T. Lorincz, M. H. Schiffman, M. E. Sherman, A. Cullen, and
R. J. Kurman. 1995. Human papillomavirus testing by hybrid capture ap-
pears to be useful in triaging women with a cytologic diagnosis of atypical
squamous cells of undetermined significance. Am. J. Obstet. Gynecol. 172:
946.
6. Cuzick, J., A. Szarewski, G. Terry, L. Ho, A. Hanby, P. Maddox, M. Ander-
son, G. Kocjan, S. T. Steele, and J. Guillebaud. 1995. Human papillomavirus
testing in primary cervical screening. Lancet 345:1533.
7. Franco, E. L. 1991. The sexually transmitted disease model for cervical
cancer: incoherent epidemiologic findings and the role of misclassification of
human papillomavirus infection. Epidemiology 2:98–106.
8. Franco, E. L. 1992. Measurement errors in epidemiological studies of human
papillomavirus and cervical cancer, p. 181–197. In N. Munoz, F. X. Bosch,
K. J. Shah, and A. Meheus (ed.), The epidemiology of human papillomavirus
and cervical cancer. Oxford University Press, Oxford, United Kingdom.
9. Franco, E. L. 1997. Statistical issues in studies of human papillomavirus
infection and cervical cancer, p. 39–50. In E. Franco and J. Monsonego (ed.),
New developments in cervical cancer screening and prevention. Blackwell
Science Ltd., Oxford, United Kingdom.
10. Hildesheim, A., M. H. Schiffman, P. E. Gravitt, A. G. Glass, C. E. Greer, T.
Zhang, D. R. Scott, B. B. Rush, P. Lawler, M. Sherman, R. J. Kuman, and
M. M. Manos. 1994. Persistence of type-specific human papillomavirus in-
fection among cytologically normal women. J. Infect. Dis. 169:235–240.
11. Ho, G. Y. F., R. D. Burk, S. Klein, A. S. Kadish, C. J. Chang, P. Palan, J.
Bassu, R. Tachezy, R. Lewis, and S. Romney. 1995. Persistent genital human
papillomavirus infection as a risk factor for persistent cervical dysplasia.
J. Natl. Cancer Inst. 87:1365–1371.
12. International Agency for Research on Cancer. 1995. Monographs on the
evaluation of the carcinogenic risk of chemicals to humans, vol. 64. Human
papillomaviruses. International Agency for Research on Cancer, Lyon,
France.
13. Jacobs, M. V., P. J. F. Snijders, A. J. C. van den Bruie, T. J. M. Helmerhorst,
C. J. L. M. Meijer, and J. M. M. Walboomers. 1997. A general primer
GP51/61-mediated PCR-enzyme immunoassay method for rapid detection
of 14 high-risk and 6 low-risk human papillomavirus genotypes in cervical
scrapings. J. Clin. Microbiol. 35:791–795.
14. Koutsky, L. A., K. K. Holmes, C. W. Critchlow, C. E. Stevens, J. Paavonen,
A. M. Beckmann, T. A. DeRouen, D. A. Galloway, D. Vernon, and N. B.
Kiviat. 1992. A cohort study of the risk of cervical intraepithelial neoplasia
grade 2 or 3 in relation to papillomavirus infection. N. Engl. J. Med. 327:
272–278.
15. Liaw, K.-L., A. W. Hsing, C. J. Chen, M. H. Schiffman, T. Y. Zhang, C. Y.
Hsieh, C. E. Greer, S. L. You, T. W. Huang, T. C. Wu, et al. 1995. Human
papillomavirus and cervical neoplasia: a case-control study in Taiwan. Int. J.
Cancer 62:565–571.
VOL. 36, 1998 ONE-STEP GENOTYPING OF HPV FROM CONSENSUS PCR PRODUCTS
16. Manos, M. M., J. Waldman, T. Y. Zhang, C. E. Greer, G. Eichinger, M. H.
Schiffman, and C. M. Wheeler. 1994. Epidemiology and partial nucleotide
sequence of four novel genital human papillomaviruses. J. Infect. Dis. 170:
1096–1099.
17. Meijer, C. J. L. M., L. Rozendaal, J. C. van der Linden, et al. 1997. Human
papillomavirus testing for primary cervical screening, p. 338–347. In E.
Franco and J. Monsonego (ed.), New developments in cervical cancer
screening and prevention. Blackwell Science Ltd., Oxford, United Kingdom.
18. Mould, T. A., and A. Singer. 1997. Human papillomavirus testing for diag-
nostic triage of minor-grade cytological abnormalities: the European per-
spective, p. 354–359. In E. Franco and J. Monsonego (ed.), New develop-
ments in cervical cancer screening and prevention. Blackwell Science Ltd.,
Oxford, United Kingdom.
19. Qu, W., G. Jiang, Y. Cruz, C. J. Chang, G. Y. F. Ho, R. S. Klein, and R. D.
Burk. 1997. PCR detection of human papillomavirus: comparison between
MY09/MY11 and GP51/GP61 primer systems. J. Clin. Microbiol. 35:1304–
1310.
20. Remmink, A. J., J. M. M. Walboomers, T. J. M. Helmerhorst, F. J. Voor-
horst, L. Rozendaal, E. K. J. Risse, C. J. L. M. Meijer, and P. Kenemans.
3027
1995. The presence of persistent high-risk HPV genotypes in dysplastic
cervical lesions is associated with progressive disease: natural history up to 36
months. Int. J. Cancer 61:306–311.
21. Saiki, R. K., P. S. Walsh, C. H. Levenson, and H. A. Erlich. 1989. Genetic
analysis of amplified DNA with immobilized sequence-specific oligonucleo-
tide probes. Proc. Natl. Acad. Sci. USA 86:6230–6234.
22. Schiffman, M. H. 1995. New epidemiology of human papillomavirus infec-
tion and cervical neoplasia. J. Natl. Cancer Inst. 87:1345–1347.
23. Schiffman, M., H. Bauer, R. Hoover, A. G. Glass, D. M. Cadell, B. B. Rush,
D. R. Scott, M. E. Sherman, R. J. Kurman, S. Wacholder, C. K. Stanton, and
M. M. Manos. 1993. Epidemiologic evidence showing that HPV infection
causes most cervical intraepithelial neoplasia. J. Natl. Cancer Inst. 85:958–
964.
24. Sherman, M. E., M. H. Schiffman, A. T. Lorincz, M. M. Manos, D. R. Scott,
R. J. Kurman, N. B. Kiviat, M. Stoler, A. G. Glass, and B. B. Rush. 1994.
Toward objective quality assurance in cervical cytopathology: correlation of
cytopathologic diagnoses with detection of high-risk human papillomavirus
types. Am. J. Clin. Pathol. 2:182–187.