Documente Academic
Documente Profesional
Documente Cultură
(Chapter 8)
Lecture Materials
for
Amy Warenda Czura, Ph.D.
Suffolk County Community College
Eastern Campus
Primary Source for figures and content:
Tortora, G.J. Microbiology An Introduction 8th, 9th, 10th ed. San Francisco: Pearson
Benjamin Cummings, 2004, 2007, 2010.
DNA Replication
-must replicate DNA to pass genetic info to
progeny cells
-process converts one parental molecule into
two identical daughter molecules
-process is
semi-conservative:
each strand of parental
molecule is template for
new strand, and new
molecules contain half
parental and half new
DNA complementary
base paired
P on 5carbon
of nucleotide
gets bound to
OH on 3
carbon of next
nucleotide
DNA Replication
1. Enzymes, gyrase and helicase, unwind the parental double helix at a site called the origin of replication.
2. Proteins stabilize the unwound parental DNA creating the replication fork.
3. Beginning with an RNA primer complementarily base paired to the single stranded parental DNA, the
leading strand is synthesized continuously by the enzyme DNA polymerase in the direction of the
replication fork. New tri-phosphate nucleotides from the cytoplasm/nucleoplasm are
complementarily base paired with the parental strand and chemically bonded to the 3end of the
RNA primer and subsequently to each other at the 3ends (via removal of two phosphates) to create a
new DNA strand.
4. The lagging strand is synthesized discontinuously:
At the replication fork an RNA primer complementarily pairs with the single stranded parental DNA.
Nucleotides are complementarily base paired to the single stranded DNA molecule and bonded to the
3 end of the RNA primer and growing chain by DNA polymerase, working away from the
replication fork for ~1000bases. The resulting segment is called an Okazaki fragment.
5. As the replication fork moves forward, the leading strand continues to have nucleotides added to the 3
end. The lagging strand begins another Okazaki fragment. DNA polymerase digests the RNA
primers on completed Okazaki fragments on the lagging strand and replaces them with DNA
nucleotides.
6. As each Okazaki fragment ends at the beginning of the previous one, the enzyme DNA ligase bonds the
neighboring fragments into a single continuous molecule.
7. Replication continues down the full length of the chromosome until both parental strands are completely
separated and each is base paired to a newly synthesized strand.
Transcription
making RNA from DNA
3 types of RNA:
1. Ribosomal RNA (rRNA) - integral part of
ribosomes, which carry out protein
synthesis
2. Transfer RNA (tRNA) - bring amino acids
to ribosome for use in protein synthesis
3. Messenger RNA (mRNA) - carries coded
info for synthesis of specific proteins from
DNA gene to ribosome for use
RNA is synthesized as complementary copy
of a DNA gene except that T is replaced by U
The complement is produced from the
template or sense strand of the DNA gene
Coding/Antisense strand of the DNA:
ATGGTATTCTCCTATCGTTAA
Template/Sense of the DNA gene:
TACCATAAGAGGATAGCAATT
RNA:
AUGGUAUUCUCCUAUCGUUAA
Start codon
Terminator
Stop codon
The Promoter and Terminator are directions for RNA polymerase to indicate the location of the gene to be
transcribed
The start and stop codons are directions for the ribosome to indicate where the amino acid information for
translation begins and ends
The ORF is the coding region of the gene: it begins at the start codon and contains in order all the codons
for all the amino acids in the resulting protein. (3 bases of DNA = 1 codon, each codon indicates one of
the 20 amino acids) The ORF ends at the stop codon.
Transcription Events
(on handout)
Translation
-protein synthesis at the ribosome
DNA: 4 different bases in a particular order
make up the gene sequence
RNA: 4 bases complementary to the DNA
gene make up the RNA sequence
Nucleotide bases are like letters in the
alphabet: used in groups of three to make
words; each word indicates a particular
amino acid
3 nucleotides = 1 codon
Each codon = one amino acid of the 20
possible
Translation involves reading the codons on
the mRNA to build the polypeptide using
the correct amino acids in the order
specified by the gene
The Genetic Code
-all organisms use the same codons to specify
the particular amino acids
on
han
dou
t
Terminator
Terminator
Transcription
Translation
E
C
Genetic Mutations
Mutation = change in base sequence of DNA
Types of mutations:
1. Base substitution / point mutation
single base at one point in DNA
replaced by another base
A. Silent point mutation: does not change
the amino acid
B. Missense point mutation: causes
insertion of the wrong amino acid
2. Frameshift mutation
one or a few nucleotides are deleted or
inserted - this can alter the translational
reading frame
e.g. AUG GCU ACC GUC...
Met - Ala - Thr - Val
insert A at 4th position:
AUG AGC UAC CGU C
Met - Ser - Tyr - Arg-
template
10
GCTATTATCG
GATAATAGC
ATGCTA?GCTATTATCG
TACGAT?CGATAATAGC
11
12
2. Conjugation
-genes transferred between two live cells via
sex pilus (Gram -) or surface adhesion
molecules (Gram +)
-transfer mediated by a plasmid: small circle
of DNA separate from genome that is self
replicating but contains no essential genes
-plasmid has genes for its own transfer
-Gram negative plasmids have genes for pilus
-Gram positive plasmids have genes for
surface adhesion molecules
Conjugation requires cell to cell contact
between two cells of opposite mating type,
usually the same species, must be same
genus
3. Transduction
-DNA from a donor is carried by a virus to a
recipient cell
Bacteriophage / Phage = virus that infects
bacterial cells
-each phage is species specific (donor and
recipient are the same species)
Transduction mechanism:
1. Phage attaches to donor cell and injects
phage DNA
13
14