Documente Academic
Documente Profesional
Documente Cultură
15.
18.
RNA polymerase
aminoacyl tRNA synthetase
Type I restriction endonuclease
Type II restriction endonuclease
reverse transcriptase
the amino terminus of the amino acid is directly attached to the 5' end of
the tRNA.
the carboxyl terminus of the amino acid is directly attached to the 5' end of
the tRNA.
the amino terminus of the amino acid is directly attached to the 3' end of
the tRNA.
the carboxyl terminus of the amino acid is directly attached to the 3' end of
the tRNA.
the side chain group of the amino acid is directly attached to the anticodon
loop of the tRNA.
Ribosomes read mRNA from the 5' to the 3' end and synthesize the
nascent protein chain from the carboxyl to the amino terminus.
Ribosomes read mRNA from the 3' to the 5' end and synthesize the
nascent protein chain from the amino to the carboxyl terminus.
Ribosomes read mRNA from the 5' to the 3' end and synthesize the
nascent protein chain from the amino to the carboxyl terminus.
Ribosomes read mRNA from the 3' to the 5' end and synthesize the
nascent protein chain from the carboxyl to the amino terminus.
Ribosomes read DNA from the 5' to the 3' end and synthesize the nascent
RNA chain from the 3' to the 5' end.
Page 1
22.
24.
CAAT box.
Hogness box.
Shine-Dalgarno box.
Meselson-Stahl box.
Pribnow box.
A promoter
(a)
(b)
(c)
(d)
(e)
26.
Energy for the process of elongation during translation comes from the hydrolysis
of
(a)
ATP.
(b)
CTP.
(c)
GTP.
(d)
TTP.
(e)
UTP.
30.
The enzyme responsible for forming the final phosphodiester bond between two
DNA fragments during DNA replication is
(a)
(b)
(c)
(d)
(e)
33.
DNA ligase
DNA polymerase I
DNA polymerase III
DNA-directed RNA polymerase
reverse transcriptase
Which of the following statements best describes the relationship between the
nucleotide sequences of the template strand and the nontemplate strand in the
DNA of a gene?
(a)
(b)
(c)
(d)
(e)
Page 2
38.
Which of the following best describes the function of the stop codons UAA,
UAG, and UGA?
(a)
(b)
(c)
(d)
(e)
39
Okasaki fragments
(a)
(b)
(c)
(d)
(e)
40.
1.
Which of the following processes occurs to eukaryotic mRNA during posttranscriptional processing?
(a)
(b)
(c)
(d)
(e)
48.
Page 3
2.
The enzyme responsible for the most of the nascent chain synthesis during DNA
replication in E. coli is
(a)
(b)
(c)
(d)
(e)
the addition of new nucleotides to the 5' end of a nascent RNA strand
during transcription.
the addition of new nucleotides to the 3' end of a nascent RNA strand
during transcription.
the addition of the 5' leader sequence to eukaryotic mRNA during posttranscriptional processing.
the addition of the 3' poly-A tail to eukaryotic mRNA during posttranscriptional processing.
none of the above.
DNA polymerase I
DNA polymerase II
DNA polymerase III
DNA-directed RNA polymerase
DNA ligase
The longer strand required a template, but the shorter strands did not.
The longer strand had been synthesized from 5'3', and the shorter
fragments had been synthesized from 3'5'.
The longer strand had been synthesized from 3'5', and the shorter
fragments had been synthesized from 5'3'.
The longer strand represented discontinuous strand synthesis, and the
shorter fragments represented continuous strand synthesis.
The longer strand represented continuous strand synthesis, and the shorter
fragments represented discontinuous strand synthesis.
Page 4
Okasazi fragments
(a)
(b)
(c)
(d)
(e)
41.
Page 5
***********************************************************************
Eukaryotic cells can be grown in a medium containing bromodeoxyuridine
(BrdU), which substitutes for thymidine during DNA replication. A fluorescent
dye that binds to double-stranded DNA makes it possible to recognize
chromosomes or chromatids with BrdU incorporated in their DNA. You can tell
the difference between unlabeled chromatids, chromatids with one strand of the
DNA double helix labeled, and chromatids with both strands of the DNA double
helix labeled. The chromatid fluoresces brightly when only one strand contains
BrdU, but weakly when both strands contain BrdU. The following diagrams
represent the possible fluorescence patterns in metaphase chromosomes. Double
hatch marks represent bright fluorescence, single marks represent weak
fluorescence, and a clear white chromatid represents no fluorescence.
Key:
I.
II.
III.
IV.
V.
VI.
A group of cultured eukaryotic cells, all at the G1 stage and containing unlabeled
chromosomes, were placed in a medium containing BrdU and allowed to grow.
Samples were removed during the first, second, and third mitotic divisions.
Mitosis in each of these samples was arrested at metaphase using colchicine.
Chromosomes were isolated from cells in the samples and examined for
fluorescence. Remember that chromosomes isolated at metaphase are in the
replicated state (a pair of chromatids connected at the centromere). In addition,
each chromatid in a replicated chromosome has one double helix. The two
helices are the products of DNA replication.
See next page for an explanation.
8
10
1/3 will look like I and 2/3 will look like III.
1/4 will look like II, 1/4 like III, 1/4 like V, and 1/4 like VI.
1/2 will look like III and 1/2 will look like IV.
3/4 will look like II and 1/4 will look like V.
3/4 will look like III and 1/4 will look like VI.
1/3 will look like I and 2/3 will look like III.
1/4 will look like II, 1/4 like III, 1/4 like V, and 1/4 like VI.
1/2 will look like III and 1/2 will look like IV.
3/4 will look like II and 1/4 will look like V.
3/4 will look like III and 1/4 will look like VI.
Based on what you learned about DNA replication in class, what do you predict
about the appearance of the metaphase chromosomes after the third mitotic
division? (The Roman numerals refer to the diagram above.)
(a)
(b)
(c)
(d)
(e)
1/3 will look like I and 2/3 will look like III.
1/4 will look like II, 1/4 like III, 1/4 like V, and 1/4 like VI.
1/2 will look like III and 1/2 will look like IV.
3/4 will look like II and 1/4 will look like V.
3/4 will look like III and 1/4 will look like VI.
Page 7
The BrdU problem is similar to the Meselson-Stahl experiment. At the start of the
experiment, each chromosome (DNA double helix) is unreplicated, and its strands
are unlabeled.. The G1 cells are transferred to BrdU before the first round of
replication begins, and the cells remain in BrdU for the remainder of the experiment.
This means that every new strand formed will be labeled in BrdU. When the
chromosomes are analyzed after the 1st, 2nd, & 3rd round of replication, each pair of
sister chromatids represents the two daughter helices formed during replication in the
S phase.
Let a blue line
represent a labeled
strand.
If replication is CONSERVATIVE, the DNA during the experiment will follow this
pattern:
||
Unlabeled, unreplicated helix at the start of the experiment
st
1 round of replication.
The two old strands stay together, and the two new strands join together if replication
is conservative
||||
All
|||| ||||
rd
and
3 round of replication.
and
Page 8
||
Unlabeled, unreplicated helix at the start of the experiment
st
1 round of replication.
In semiconservative replication,
each new helix consists of one old strand and one new strand.
||||
nd
All
2 round of replication.
|||| ||||
rd
All
3 round of replication.
and
Page 9
Pribnow box
CAAT box
-35 consensus sequence
Shine-Dalgarno sequence
Hogness box
d 11
a 12
e 13
b 14
Rho factors
(a)
(b)
(c)
(d)
(e)
16
Sigma factors
(a)
(b)
(c)
(d)
(e)
Page 10
17
************************************************************************
The nucleotide sequence listed below represents the transcriptional template strand of a
gene.
Template DNA strand
18
19
Which of the following is the mRNA transcribed from the template DNA (assume
that there is no intron splicing or other processing).
(a)
(b)
(c)
(d)
(e)
20
Which of the following is the peptide that is produced when the mRNA is
translated? (The standard 3-letter abbreviations for amino acids are used.)
(a)
(Amino end) Tyr Arg Ser (Carboxyl end)
(b)
(Amino end) Asp Ser Thr Ser Asp Asp (Carboxyl end)
(c)
(Carboxyl end) Asp Ser Thr Ser Asp Asp (Amino end)
(d)
(Carboxyl end) Met Ser Ser Thr Thr (Amino end)
(e)
(Amino end) Met Ser Ser Thr Thr (Carboxyl end)
***********************************************************************
Page 11
21
22`
23
It attaches the amino end of an amino acid to the 5' end of a tRNA
molecule.
It attaches the carboxyl end of an amino acid to the 5' end of a tRNA
molecule.
It attaches the carboxyl end of an amino acid to the 3' end of a tRNA
molecule.
It attaches the amino end of an amino acid to the 3' end of a tRNA
molecule.
It attaches the anticodon of a tRNA to the codon on the mRNA.
ATP
CTP
GTP
UTP
lactose
Page 12
24
To which site on the ribosome does the next aminoacyl tRNA bind during the
elongation phase of translation?
(a)
(b)
(c)
(d)
(e)
1.
What are the special features found at the 5' end and the 3' end of mature
eukaryotic mRNA? (4 pt)
At the 5 end, there is a methylated guanosine cap attached via a 5 -> 5
triphophate linkage. It is added during posttranscriptional processing by a
capping enzyme.
At the 3 end is a poly-A tail consisting of about 100 200 consecutive
adenosine nucleotides. It is added during post-transcriptional processing by a
terminal transferase enzyme.
2.
The nucleotide sequence listed below represents the nontemplate strand of a gene.
Please give: (a) the nucleotide sequence of the template strand, (b) the nucleotide
sequence of the mRNA formed (assuming no introns are present), and (c) the
amino acid sequence of the peptide chain encoded by this sequence. Be sure to
include which ends are 5', 3', amino, or carboxyl. (16 pt)
nontemplate DNA strand
5' CGATGTCTTCAACTACGTAG 3'
template DNA strand:
3GCTACAGAAGTTGATGCATC 5
mRNA:
5CGAUGUCUUCAACUACGUAG 3
Peptide chain:
(amino end) met - ser - ser - thr - thr (carboxyl end)
(starting at an initiation codon)
3.
(a)
DNA ligase Forms the final phosphodoester bond between two fragments of a
nascent chain during DNA replication.
(b)
Primase: Creates short RNA primers that are needed by DNA polymerase,
because DNA polymerase cannot initiate the de novo synthesis of a new chain.
(c)
DNA polymerase I: This enzyme has 5 -> 3 polymerase activity capable of
elongating a nascent strand. It also has 3 exonuclease activity that serves to remove
mismatched bases (proofreading function). It also has 5 exonuclease activity that is
responsible for primer excision. Its major role in vivo is primer excision and
proofreading.
Page 13
(d)
DNA polymerase III: This enzyme has 5-> 3 poylmerase activity and also 3
exonuclease (proofreading) activity, but no 5 exonuclease activity. It is responsible for
most of the nascent chain elongation during replication in E. coli.
(e)
6.
5.
Page 14
A group of cultured eukaryotic cells, all at the G1 stage, were placed in a medium
containing BrdU and allowed to grow. Samples were removed during the first,
second, and third mitotic divisions. Mitosis in each of these samples was arrested
at metaphase using colchicine. Chromosomes were isolated from cells in the
samples and examined for fluorescence.
What will be the appearance of the metaphase chromosomes isolated in the first,
second, and third mitotic divisions after transferring the cells to the BrdU
medium? Answer this question by sketching the chromosomes, as shown in the
diagram. Use double hatch marks to indicate bright fluorescence, and single hatch
marks for weak fluorescence. (6 pt)
Here are two hints.
Hint 1: Chromosomes isolated at metaphase are in the replicated state (a pair of
chromatids connected at the centromere)
Hint 2: Each chromatid in a replicated chromosome has one double helix. The
two helices are the products of DNA replication.
See pgs. 8 & 9 for an explanation. This question asks you to predict what the
appearance should be, so you should state the results for SEMICONSERVATIVE
replication.
Page 15