Regulation of Staphylococcus aureus Type

5 and Type 8 Capsular Polysaccharides by

CO2
Silvia Herbert, Steven W. Newell, Chia Lee, Karsten-Peter
Wieland, Bruno Dassy, Jean-Michel Fournier, Christiane
Wolz and Gerd Dring
J. Bacteriol. 2001, 183(15):4609. DOI:
10.1128/JB.183.15.4609-4613.2001.

These include:
REFERENCES

CONTENT ALERTS

This article cites 29 articles, 19 of which can be accessed free

at: http://jb.asm.org/content/183/15/4609#ref-list-1
Receive: RSS Feeds, eTOCs, free email alerts (when new
articles cite this article), more

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml

To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

Downloaded from http://jb.asm.org/ on May 4, 2014 by guest

Updated information and services can be found at:

http://jb.asm.org/content/183/15/4609

JOURNAL OF BACTERIOLOGY, Aug. 2001, p. 46094613

0021-9193/01/$04.000 DOI: 10.1128/JB.183.15.46094613.2001
Copyright 2001, American Society for Microbiology. All Rights Reserved.

Vol. 183, No. 15

Regulation of Staphylococcus aureus Type 5 and Type 8

Capsular Polysaccharides by CO2
SILVIA HERBERT,1 STEVEN W. NEWELL,2 CHIA LEE,2 KARSTEN-PETER WIELAND,3
BRUNO DASSY,4 JEAN-MICHEL FOURNIER,4 CHRISTIANE WOLZ,1
RING1*
AND GERD DO
Department of General and Environmental Hygiene, Hygiene-Institute,1 and Institute of Microbial Genetics,3
University of Tu
bingen, Tu
bingen, Germany; Department of Microbiology, Molecular Genetics
and Immunology, University of Kansas Medical Center, Kansas City, Kansas2;
and Unite du Cholera et des Vibrions, Institut Pasteur, Paris, France4
Received 12 November 2000/Accepted 18 April 2001

Staphylococcus aureus is a pathogen which causes a number

of serious human diseases, such as endocarditis, osteomyelitis,
skin abcesses, and chronic endobronchial infections in patients
with cystic fibrosis (CF) (15, 20). Several extracellular and cell
surface-bound components act as virulence factors in S. aureus,
including capsular polysaccharides (CPs) (23, 30). Although S.
aureus strains can produce 11 serologically distinct CPs (16,
29), the majority of clinical isolates of this pathogen have been
described as CP5 or CP8 positive (1, 3, 4, 14). Previously,
however, we showed that S. aureus strains producing CP5 (12)
or CP8 (22) in vitro lack these polysaccharides when directly
examined by immunofluorescence microscopy of thin airway
sections from CF patients. CP5 was reexpressed when the
isolates were grown under normal air conditions, whereas the
addition of 1% CO2 rendered the strains CP5 negative. Since
the mean value of the inspiratory and expiratory CO2 in the
bronchioli is about 4% (11), CP5 expression in vivo may be
inhibited due to the elevated pCO2 compared to the pCO2 in
normal air (0.03%). In contrast to the negative effect of CO2
on CP5 expression, it was previously shown that - and -hemolysin expression, as well as expression of S. aureus toxic

shock syndrome toxin 1 (17), is increased in the presence of

elevated CO2 concentrations (6, 7, 24).
CO2 also regulates the expression of surface components in
other bacteria. For example, the expression of the fibrillar
surface M protein of Streptococcus pyogenes (5) and the capsule
of Bacillus anthracis (18, 21) is increased in the presence of
elevated CO2 concentrations. Additionally, capsule synthesis
in Cryptococcus neoformans is positively regulated by CO2 (10).
In contrast, the production of slime by Staphylococcus epidermidis is decreased when the bacteria are incubated with 5%
CO2 (8, 25). These observations show that CO2 is an important
environmental signal for many bacteria and appears to be
involved in regulating virulence factors in more than one manner.
The molecular basis for the regulation of S. aureus CP5 by
CO2 is still unresolved. We wanted to clarify our observations
at a transcriptional level and to extend our previous observations to CP8-expressing S. aureus strains. The CP5-producing
strains S. aureus Reynolds and Newman, the CP8-positive
strain Becker, and several clinical S. aureus isolates from CF
patients were used.
MATERIALS AND METHODS

* Corresponding author. Mailing address: Department of General

and Environmental Hygiene, Hygiene-Institute, University of Tu
bingen, Wilhelmstrase 31, D-72074 Tu
bingen, Germany. Phone:
49-7071-2982069. Fax: 49-7071-2983011. E-mail: gerd.doering@uni
-tuebingen.de.
Present address: Naval Medical Center, San Diego, CA 92134.

Sequencing of cap promoter. The cap5 and -8 promoter regions from 11 S.

aureus strains were amplified by PCR (Advantage kit; Clontech) using two
primers, GAATTCGGTCAATCAGTCGGAATT (EcoRI site is underlined)
and AAGCTTCAAGTTTTTTTGTAATA (HindIII site is underlined). The amplified fragments correspond to 512 to 71 of the published cap8 sequence of

4609

Downloaded from http://jb.asm.org/ on May 4, 2014 by guest

Staphylococcus aureus expression of capsular polysaccharide type 5 (CP5) has been shown to be downregulated by CO2. Here we show that CO2 reduces CP5 expression at the transcriptional level and that CO2
regulates CP8 expression depending on the genetic background of the strains. Growth in the presence of air
supplemented with 5% CO2 caused a significant decrease in CP8 expression in four S. aureus strains, a
marginal effect in four strains, and higher CP8 expression in strain Becker. Absolute CP8 expression in the
nine S. aureus strains differed largely from strain to strain. Four groups of strains were established due to
sequence variations in the promoter region of cap5 and cap8. To test whether these sequence variations are
responsible for the different responses to CO2, promoter regions from selected strains were fused to the
reporter gene xylE in pLC4, and the plasmids were electrotransformed into strains Becker and Newman. XylE
activity was negatively regulated by CO2 in all derivatives of strain Newman and was always positively
regulated by CO2 in all derivatives of strain Becker. Differences in promoter sequences did not influence the
pattern of CP8 expression. Therefore, the genetic background of the strains rather than differences in the
promoter sequence determines the CO2 response. trans-acting regulatory molecules may be differentially
expressed in strain Becker versus strain Newman. The strain dependency of the CP8 expression established in
vitro was also seen in lung tissue sections of patients with cystic fibrosis infected with CP8-positive S. aureus
strains.

4610

HERBERT ET AL.

J. BACTERIOL.

TABLE 1. Quantitation of CP on the surface of S. aureus strains

Strain

Becker
CF4
CF6
CF7
CF8
CF9
CF10
CF11
CF12
Newman
CF1

CP production (ng of CP/109

CFU)a in:
Air

Air plus CO2

Ratio of
CP production
(air/air plus CO2)

1,550 580
113 64
15.3 12.5
1,867 611
1,225 556
373 424
953 832
5,150 3,553
2,125 2,069
1,080 170
2,200 283

2,250 866
55
10
1,333 569
628 126
93 40
323 267
7.8 8.7
50 52
180 85
240 0

0.7
22.6
15.3
1.4
1.95
4.0
2.95
660
42.5
6
9.17

Pb value

0.228
0.015
0.063
0.330
0.081
0.237
0.199
0.028
0.022

strain Becker, with 1 being the transcriptional start (27, 28). The PCR-amplified DNA fragments were cloned into the pGEM-T vector (Promega) and sequenced. To avoid possible errors generated by PCR, two independent PCR
amplifications from each strain were performed. No mismatch was found between the two independent PCR amplifications from each strain. Sequences
from all 11 strains are 583 bp in length, except that from strain Becker, which had
a 1-bp deletion. The sequences were then compared by the Clustal method (13)
of the MegAlign program (Dnastar Inc.).
cap promoter fusion. The lipase-negative S. aureus strain Reynolds was supplemented with the promoter test plasmid pPS11cap5 containing a 424-bp fragment of the cap5 promoter fused to the lipase gene of Staphylococcus hyicus. A
cap5 promoter fragment (424 bp) was generated by PCR using DNA from S.
aureus strain Reynolds. The cap8 primer pairs (upper primer, TTTGGATCCA
ACTAATCCTAAAGAAGCACTAA; lower primer, CTCCATTTATAACCTT
TCATGAACCTAGGTTT) were selected to span nucleotides 32 to 456 of the
published sequence (27), with artificial BamHI cleavage sites (underlined) at the
5 ends. The cap8 primer pairs were selected for the cap5 promoter PCR due to
the availability of only the cap8 sequence data at that time and the expected high
homology between the cap5 and cap8 sequences (27). Additionally, the cap start
codon (in bold) was changed in the lower primer. The PCR fragment was
digested with BamHI and ligated into the BamHI site of pPS11 (31) containing
a promoterless lipase gene (lip) of S. hyicus and a chloramphenicol resistance
gene. The ligation mixture was used for protoplast transformation into Staphylococcus carnosus (9). Single, chloramphenicol-resistant colonies were grown on
lipase test plates (Tributyrin agar base supplemented with 1% Tween 20; Merck,
Darmstadt, Germany). Insertion of the cap5 promoter region in pPS11cap5 was
confirmed by sequencing (LI-COR, model 40002; WG-Biotech, Ebersberg, Germany). The plasmid pPS11cap5 was electrotransformed into S. aureus strain
Reynolds as previously described (2). Thus, strain Reynolds contains, besides the
natural chromosomal cap5 promoter, additional multicopy promoters on the
extrachromosomal plasmid. For the measurement of the CP5 promoter activity,
strain Reynolds containing pPS11cap5 was grown to an optical density at 600 nm
(OD600) of 7.4 in air and in air supplemented with 5% CO2, and lipase activity
in the culture supernatant fluid was determined as previously described (31).
The promoter regions from strains CF1, CF4, CF6, CF12, and Becker were
fused to the promoterless reporter gene xylE in pLC4 (26), which resulted in
plasmids pCL8388, -8389, -8390, -8396, and -8420, respectively. The cap promoter fragments were obtained by PCR (for primers, see above). The resultant
plasmids were electrotransformed into strains Becker (a type 8 capsule strain)
and Newman (a type 5 capsule strain) and were incubated in Luria-Bertani broth
for 18 h at 37C with air or air supplemented with 5% CO2. The XylE activities
were assayed to measure the promoter activities (32).
ELISA for detection of CP8. Bacterial cells were diluted from an overnight
culture to an OD600 of 0.05 in 30 ml of tryptic soy broth (Oxoid, Hampshire,
United Kingdom). The bacteria were incubated with shaking at 37C under air or
air with 5% CO2 (Aerotron incubator; Infors, Einsbach, Germany) for 16 h. CP8
expression of clinical isolates of S. aureus was assessed by a two-step inhibition

FIG. 1. Downregulation of the cap5 promoter under air plus 5%

CO2 growth conditions. The lipase-negative S. aureus strain Reynolds
was supplemented with the promoter test plasmid pPS11cap5 containing a 424-bp fragment of the cap5 promoter fused to the lipase gene of
S. hyicus. For details, see Materials and Methods.

enzyme-linked immunosorbent assay (ELISA) (3). Microtiter wells were coated

with 5% gelatin in phosphate-buffered saline (PBS) at 37C for 1 h. After
washing with PBS-Tween 20, the wells were incubated with 100-l volumes of
washed S. aureus cells and 100 l of an anti-CP8 monoclonal immunoglobulin G3
(IgG3) antibody diluted in PBS-Tween supplemented with 0.5% gelatin at a
concentration giving an OD492 of 0.2 to 0.5, which was determined by preliminary
titration. For CP8 antibody production, BALB/c mice were immunized with 5
107 cells of S. aureus strain Becker as previously described (3). After incubation
at 37C for 1 h and then overnight at 4C, 100-l samples from each well were
transferred to another plate which had previously been coated with purified CP8
and blocked with gelatin. This plate was incubated at 37C for 1 h, and after
washing with PBS-Tween, an anti-mouse peroxidase-conjugated IgG (Diagnostics Pasteur) was added to the wells and the plate was incubated at 37C for 45
min. After washing, enzyme substrate (o-phenylenediamine dihydrochloride;
Dako, Copenhagen, Denmark) was added, and after 10 min at room temperature, the reaction was stopped and the OD492 was read. For each ELISA run,
negative controls were used (wells not receiving test samples but receiving PBSTween supplemented with 0.5% gelatin) and titration of purified CP8 was performed to determine the assay sensitivity. The amount of CP8 in the samples was
determined from standard titration curves of purified CP8 and expressed in
nanograms per milliliter. The lower limit of the assay is 1 ng of CP8/ml.
Detection of CP8 and teichoic acid by immunofluorescence. CP8 production
was assessed by indirect immunofluorescence using monoclonal antibodies
(IgG3; Institut Pasteur, Paris, France) and fluorescein isothiocyanate (FITC)conjugated IgG rabbit antibodies against mouse IgG (Dako). Cryostat thin sections (5 to 10 m) were prepared (Kryostat 2800 Frigocut E; Reichert-Jung,
Heidelberg, Germany) from shock-frozen lung tissue material from two CF
patients. The thin sections were fixed on slides with acetone for 10 min, incubated for 20 min with normal rabbit serum (Dako) diluted 1:5, and incubated
with anti-CP8 antibody (final dilution, 33 g/ml) for 1 h at room temperature.
After washing, slides were incubated with FITC-conjugated antibodies and diluted 1:40 for 30 min at room temperature. After washing, slides were mounted
with Permafluor (Dako) for 24 h and visualized using a fluorescence microscope
(Axioplan; Zeiss, Oberkochen, Germany). Teichoic acid expression on S. aureus
strains was determined using a rabbit antiserum. Slides were preincubated with
swine antiserum and diluted 1:5, and a FITC-conjugated swine antibody against
rabbit IgG, diluted 1:40, was used (Dako). The rabbit serum against teichoic acid
(SL-39) was prepared by immunizing the animals with a killed S. aureus strain
completely lacking CP5 and CP8. The serum did not contain antibodies against
CP5 or CP8 as demonstrated by ELISA.

Downloaded from http://jb.asm.org/ on May 4, 2014 by guest

a
Strains were grown in tryptic soy broth under normal air conditions or in air
supplemented with 5% CO2 with shaking, and aliquots were taken after 15 h.
Aliquots of 109 cells were assayed for cell-bound CP antigen by ELISA (3).
Values represent the means standard deviations of two independent growth
cultures.
b
A two-tailed unpaired t test was used to calculate P values.

S. AUREUS CAPSULAR POLYSACCHARIDES

VOL. 183, 2001

4611

TABLE 2. Promoter activities as measured by the XylE assay

Groupa

1
2
3
2
4
1
2
3
2
4

(CF1)
(CF4)
(CF6)
(CF12)
(Becker)
(CF1)
(CF4)
(CF6)
(CF12)
(Becker)
a
b

XylE activity (mU/mg of protein)b in:

Air

Air plus CO2

Ratio of XylE activity

(air/air plus CO2)

3.83 0.68
3.66 1.46
2.44 0.44
5.34 0.72
7.70 1.13
5.52 0.29
6.13 0.96
6.66 1.10
6.41 0.99
1.17 0.24

5.91 1.45
6.51 1.10
3.12 0.43
6.81 0.84
10.21 0.88
3.57 0.37
3.72 0.66
3.28 0.27
3.63 0.30
0.67 0.08

0.65
0.56
0.78
0.78
0.75
1.55
1.55
2.03
1.77
1.76

Strain

Becker(pSN8388)
Becker(pSN8389)
Becker(pSN8390)
Becker(pSN8396)
Becker(pSN8420)
Newman(pSN8388)
Newman(pSN8389)
Newman(pSN8390)
Newman(pSN8396)
Newman(pSN8420)

For group definitions, see the text. The strain origin of the cap fragment is indicated in parentheses.
XylE activities of the fusion plasmids are expressed as means standard deviations of at least three independent tests.

Regulation of CP5 by CO2. Previously, we have shown that

the CP5 expression of strain Reynolds is inhibited by the
growth of S. aureus strains in air supplemented with 5% CO2.
This was further confirmed using two other CP5 strains (CF1
and Newman) which both showed a significant decrease of
capsular material on the surface after growth with 5% CO2
(Table 1). To analyze whether this is mediated by downregulation of the promoter activity, we cloned the cap5 promoter in

front of the lipase gene and compared the lipase activity in

strain Reynolds(pPS11cap5). After growth in the presence of
air supplemented with 5% CO2, the lipase activity was 60%
lower compared to that for growth under normal air conditions
(P 0.001; Mann-Whitney test) (Fig. 1). Thus, CO2 affects
cap5 gene expression at the transcriptional level. The ratio
obtained from the promoter fusion is lower than those previously obtained by ELISA, possibly due to the presence of the
cap5 promoter in multiple copies in the promoter test assay.

FIG. 2. DNA sequence alignment of the cap5 and -8 promoter regions from various S. aureus strains. A region of 583 bp from each strain was
compared, but only sequences corresponding to positions 56 to 455 (indicated by arrowheads) with respect to the transcriptional start site of
the cap8 sequence of strain Becker are shown. Mismatched sequences are boxed. We found no mismatches between strains in the sequences that
were not shown. Note that CF1 and strain Reynolds are type 5 strains.

Downloaded from http://jb.asm.org/ on May 4, 2014 by guest

RESULTS AND DISCUSSION

4612

HERBERT ET AL.

J. BACTERIOL.

Regulation of CP8 by CO2. Next, we wanted to know

whether CP8 is influenced in the same manner by CO2. In
contrast to CP5, quantitative detection of the CP8 antigen by
ELISA on type 8 bacterial cells gave conflicting results with
respect to CO2 regulation when several strains were tested
(Table 1). In only four of nine CP8-positive S. aureus strains
examined (CF4, CF6, CF11, and CF12), a significant decrease
in CP8 expression was found when CP8-positive S. aureus
strains were grown in the presence of air supplemented with
5% CO2 compared to cells grown under normal air conditions.
In other strains, the effect of CO2 was less pronounced, and in
one case, the type 8 prototypic strain Becker, CP8 expression
was higher under supplemented CO2 growth conditions. The
results also show that absolute CP8 expression in S. aureus
strains as well as the regulatory CO2 effect may vary considerably from one strain to another. For example, strain CF7 produces about 1 order of magnitude more CP8 than strain CF4
does. The reason for these effects may be related to sequence
variations in the promoter region of cap or in other genes
which mediate cap transcription.
cap promoter sequence. To analyze whether differences in
the promoter region account for differences in the CO2 effect,
the upstream sequences of eight CP8 strains and two CP5
strains (CF1 and Reynolds) were sequenced. As shown in Fig.
2, most of the mismatches were found between nucleotides
231 and 89. Based on the sequence comparison, the strains

can be grouped into the following four groups: group 1, Reynolds, CF1 (type 5 strain), and CF11, with identical sequences;
group 2, CF4, CF8, CF9, CF10, and CF12, with identical sequences except CF12 has one mismatch; group 3, CF6 and
CF7, with three mismatches; and group 4, Becker (Fig. 2).
Interestingly, the promoter sequence of one CP8 strain (CF11)
was identical to the sequence derived from the CP5 strains
Reynolds and CF1 but different from that of the other CP8
strains.
Activity of different cap promoters in strains Newman and
Becker. To test whether differences in the cap upstream sequences are responsible for the different responses to CO2, we
fused each of the promoter regions from strains CF1, CF4,
CF6, CF12, and Becker to the promoterless reporter gene xylE,
which resulted in plasmids pCL8388, -8389, -8390, -8396, and
-8420, respectively. These strains were selected as representatives of the four groups defined by sequencing. Strain Becker
(a type 8 capsule strain) and strain Newman (a type 5 capsule
strain) containing the cap promoter fusion plasmids were incubated with air or air supplemented with 5% CO2, and the
XylE activities were measured (Table 2). Interestingly, XylE
activity was negatively regulated by CO2 in all derivatives of
strain Newman containing the various promoter sequences in
front of xylE. In contrast, with strain Becker as the genetic
background, XylE activity was always positively correlated with
CO2 pressure. The difference in the promoter sequences used

Downloaded from http://jb.asm.org/ on May 4, 2014 by guest

FIG. 3. Expression of S. aureus CP8 in lung tissue sections of two CF patients. Lung tissue sections filled with inflammatory plaques from CF
patients 7 (A and C) and 12 (B and D) infected with S. aureus strains CF7 and CF12, respectively, were stained with a monoclonal antibody against
CP8 (A and B) and a polyclonal rabbit antibody against teichoic acid (C and D) followed by FITC-conjugated anti-mouse (A and B) and anti-rabbit
(C and D) antibodies. Note the absence of CP8 in panel B and the presence of CP8 in panel D. Magnification, 1,000; bars 10 m.

S. AUREUS CAPSULAR POLYSACCHARIDES

VOL. 183, 2001

ACKNOWLEDGMENTS
We thank S. Crampton for language corrections.
The study was supported in part by a grant to S.H. from the Deutsche Forschungsgemeinschaft (Graduiertenkolleg Mikrobiologie, University of Tu
bingen) and by grant AI37027 to C.L. by NIH.
REFERENCES
1. Albus, A., J.-M. Fournier, C. Wolz, A. Boutonnier, M. Ranke, N. Hiby, H.
Hochkeppel, and G. Do
ring. 1988. Staphylococcus aureus capsular types and
antibody response to lung infection in patients with cystic fibrosis. J. Clin.
Microbiol. 26:25052509.
2. Augustin, J., and F. Go
tz. 1990. Transformation of Staphylococcus epidermidis and other staphylococcal species with plasmid DNA by electroporation.
FEMS Microbiol. Lett. 66:203208.
3. Boutonnier, A., F. Nato, A. Bouvet, L. Lebrun, A. Audurier, J. C. Mazie, and
J.-M. Fournier. 1989. Direct testing of blood cultures for detection of the
serotype 5 and 8 capsular polysaccharides of Staphylococcus aureus. J. Clin.
Microbiol. 27:989993.
4. Branger, C., J.-M. Fournier, J. Loulergue, A. Bouvet, P. Goullet, A. Boutonnier, C. De Gialluly, G. Couetdic, M. Chomarat, M. C. Jaffar-Banjee, and P.
Mariani. 1994. Epidemiology of Staphylococcus aureus in patients with cystic
fibrosis. Epidemiol. Infect. 112:489500.
5. Caperon, M. G., R. T. Geist, J. Perez-Casal, and J. R. Scott. 1992. Environmental regulation of virulence in group A streptococci: transcription of the
gene encoding M protein is stimulated by carbon dioxide. J. Bacteriol.
174:56935701.
6. Carlson, E. C. 1986. A CO2-enhanced hemolytic activity of Staphylococcus
aureus associated with toxic shock syndrome: inhibition by agar. J. Infect.
Dis. 154:1861818628.
7. Chow, A. W., M. J. Gribble, and K. H. Bartlett. 1983. Characterization of the
hemolytic activity of Staphylococcus aureus strains associated with toxic shock
syndrome. J. Clin. Microbiol. 17:524528.
8. Denyer, S. P., M. C. Davies, J. A. Evans, R. G. Finch, D. G. E. Smith, M. H.
Wilcox, and P. Williams. 1990. Influence of carbon dioxide on the surface
characteristics and adherence potential of coagulase-negative staphylococci.
J. Clin. Microbiol. 28:18131817.

9. Go
tz, F., and B. Schumacher. 1987. Improvements of protoplast transformation in Staphylococcus carnosus. FEMS Microbiol. Lett. 40:285288.
10. Granger, D. L., J. R. Perfect, and D. T. Durack. 1985. Virulence of Cryptococcus neoformans. Regulation of capsule synthesis by carbon dioxide.
J. Clin. Investig. 76:508516.
11. Guyton, A. C. 1991. Textbook of medical physiology, eighth ed, p. 433443.
W. B. Saunders, Philadelphia, Pa.
12. Herbert, S., D. Worlitzsch, B. Dassy, A. Boutonnier, J.-M. Fournier, G.
Bellon, A. Dalhoff, and G. Doring. 1997. Regulation of Staphylococcus aureus
capsular polysaccharide type 5: CO2 inhibition in vitro and in vivo. J. Infect.
Dis. 176:431438.
13. Higgins, D. G., and P. M. Sharp. 1988. CLUSTAL: a package for performing
multiple sequence alignments on a microcomputer. Gene 73:237244.
14. Hochkeppel, H. K., D. G. Braun, W. Vischer, A. Imm, S. Sutter, U. Staubli,
R. Guggenheim, E. L. Kaplan, A. Boutonnier, and J.-M. Fournier. 1987.
Serotyping and electron microscopy studies of Staphylococcus aureus clinical
isolates with monoclonal antibodies to capsular polysaccharide types 5 and 8.
J. Clin. Microbiol. 25:526530.
15. Hiby, N. 1994. Microbiology of cystic fibrosis, p. 7598. In M. E. Hodson
and D. M. Geddes (ed.), Cystic fibrosis. Chapman and Hall, London, United
Kingdom.
16. Karakawa, W. W., and W. F. Vann. 1982. Capsular polysaccharides of S.
aureus. Semin. Infect. Dis. 4:285293.
17. Kass, E. H., M. I. Kendrick, Y.-C. Tsai, and J. Parsonnet. 1987. Interaction
of magnesium ion, oxygen tension, and temperature in the production of
toxic-shock-syndrome toxin-1 by Staphylococcus aureus. J. Infect. Dis. 155:
812814.
18. Koehler, T. M., Z. Dai, and M. Kaufman-Yarbray. 1984. Regulation of the
Bacillus anthracis protective antigen gene: CO2 and a trans-acting element
activate transcription from one of two promoters. J. Bacteriol. 176:586595.
19. Lee, J. C., S. Takeda, P. J. Livolsi, and L. C. Paoletti. 1993. Effects of in vitro
and in vivo growth conditions on expression of type 8 capsular polysaccharide by Staphylococcus aureus. Infect. Immun. 61:18531858.
20. Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:
520532.
21. Makino, S., C. Sasakawa, I. Uchida, N. Terakado, and M. Yoshikawa. 1988.
Cloning and CO2-dependent expression of the genetic region for encapsulation from Bacillus anthracis. Mol. Microbiol. 2:371376.
22. McKenney, D., K. L. Tibbetts, Y. Wang, V. Murthy, M. Ulrich, G. Do
ring,
J. C. Lee, D. A. Goldmann, and G. B. Pier. 1999. Broadly-protective vaccine
for Staphylococcus aureus based on an in vivo expressed antigen. Science
284:15231527.
23. Nilsson, I. M., J. C. Lee, T. Bremell, C. Ryden, and A. Tarkowski. 1997. The
role of staphylococcal polysaccharide microcapsule expression in septicemia
and septic arthritis. Infect. Immun. 65:42164221.
24. Ohlson, K., K.-P. Koller, and J. Hacker. 1997. Analysis of expression of the
alpha-toxin gene (hla) of Staphylococcus aureus by using a chromosomally
encoded hla::lacZ gene fusion. Infect. Immun. 65:36063614.
25. Perez-Giraldo, C., A. Rodrguez-Benito, F. J. Mora
n, C. Hurtado, M. T.
Blanco, and A. C. Go
mez-Garca. 1995. Influence of the incubation atmosphere on the production of slime by Staphylococcus epidermidis. Eur. J. Clin.
Microbiol. Infect. Dis. 14:359362.
26. Ray, C., R. E. Hay, H. J. Carter, and C. P. Moran, Jr. 1985. Mutations that
affect utilization of a promoter in stationary-phase Bacillus subtilis. J. Bacteriol. 163:610612.
27. Sau, S., J. Sun, and C. Y. Lee. 1997. Molecular characterization and transcriptional analysis of type 8 capsule genes in Staphylococcus aureus. J.
Bacteriol. 179:16141621.
28. Sau, S., N. Bhasin, E. R. Wann, J. C. Lee, T. J. Foster, and C. Y. Lee. 1997.
The Staphylococcus aureus allelic genetic loci for serotype 5 and 8 capsule
expression contain the type-specific genes flanked by common genes. Microbiology 143:23952405.
29. Sompolinsky, D., Z. Samra, W. Karakawa, W. F. Vann, R. Schneerson, and
Z. Malik. 1985. Encapsulation and capsular types in isolates of Staphylococcus aureus from different sources and relationship to phage types. J. Clin.
Microbiol. 22:828834.
30. Thakker, M., J. S. Park, V. Carey, and J. C. Lee. 1998. Staphylococcus aureus
serotype 5 capsular polysaccharide is antiphagocytic and enhances bacterial
virulence in a murine bacteremia model. Infect. Immun. 66:51835189.
31. Wieland, K. P., B. Wieland, and F. Gotz. 1995. A promoter-screening plasmid and xylose-inducible, glucose-repressible expression vectors for Staphylococcus carnosus. Gene 158:9196.
32. Zukowski, M. M., D. F. Gaffney, D. Speck, M. Kauffmann, A. Findeli, A.
Wisecup, and J. P. Lecocq. 1983. Chromogenic identification of genetic
regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene. Proc. Natl. Acad. Sci. USA 80:11011105.

Downloaded from http://jb.asm.org/ on May 4, 2014 by guest

in the different constructs did not influence the pattern of CO2

regulation. For instance, the promoter fusions derived from
strain Becker resulted in enhanced XylE activity in strain
Becker(pSN8420) but in decreased activity in strain Newman(pSN8420) after growth of the strains with 5% CO2.
Therefore, the genetic background of the strains rather than
differences in the promoter sequence determines the CO2 response. trans-acting regulatory molecules such as transcriptional activators or sigma factors may be differentially expressed in strain Becker versus strain Newman.
CP8 expression in lung tissue sections of CF patients. Previously, we postulated that elevated CO2 during lung infections
in patients with CF may account for the downregulation of CP5
during infection (12). Since CP8 expression is only marginally
affected (CF7, CF8, CF9, and CF10) or even enhanced (strain
Becker) by CO2, it may be assumed that CP8-producing S.
aureus strains are CP8 positive during infection. Indeed, CP8positive S. aureus has been detected in experimental endocarditis (19) and in our own investigations (1). Here we demonstrate that the strain dependency of CP8 expression established
by in vitro tests is also seen in lung tissue sections of CF
patients infected with CP8-positive S. aureus strains. As shown
in Fig. 3, strain CF7, which was only marginally affected by
CO2 in regards to CP8, also expressed CP8 in vitro in the
airway lumen of the patient. In contrast, strain CF12, which
had significantly reduced CP8 expression by CO2 in vitro (Table 1) did not express CP8 in vivo. In summary, the regulation
of CP8 seems to be more complex than that of CP5 in S.
aureus.

4613